Skip to main content

Querying the Genome Browser

From the Genomes page, you can jump to the default position of an assembly by clicking the "Go" button or you can specify a particular genome position in a variety of formats. These same formats are valid in the search bar above the main Genome Browser track display.

In addition to the positional queries described below, any search term can be used to find matches in track data, track names and/or descriptions, help docs, and public hub track names and/or descriptions. See our search page for more details on the search functionality.

Valid position queries can include:

To specify a genome position:

  1. Select the desired clade, genome and assembly
  2. Enter the desired query in the "Position/Search Term" box (see sample queries below)
  3. Click the "Go" button

A query may have multiple results. If this is the case, a results page will appear listing each result along with the track it is associated with. Once selected, the result will be displayed in the Browser with a highlighted label, making it easier to identify. If you have further questions, you can search the Genome Browser FAQ page and find links to further resources. Also, developers of track hubs can create searchable track hubs using the searchTrix setting.

To jump directly to a specific exon, type the gene symbol or transcript ID followed by the exon number in one of two formats:

Exon numbering is 1-based and follows transcript order (exon 1 is the 5′ exon). Genes are looked up in order: MANE, GENCODE/UCSC (knownGene), all RefSeq, then historical RefSeq. To jump to a codon instead, just enter it after the gene, e.g. BRAF 600, use the HGVS notation (see below), or right-click any transcript in the browser and select “Zoom to codon”.

Sample queries

Below is a list of examples that might be used to query the Genome Browser. Note that not every query listed here will produce a result in every assembly. The list serves only to illustrate the different types of queries that can be performed.

QueryGenome Browser Response
chr7 Displays all of chromosome 7
chr3:1-1000000 Displays the first million bases of chromosome 3, counting from the p-arm telomere
3:1-1000000 Displays the first million bases of chromosome 3, Ensembl format chromosome names
chr3 0 1000000 Displays the first million bases of chromosome 3; BED format
NC_000007.14:1-1000000 Displays the first million bases of chromosome 3, RefSeq format
CM000665.2:1-1000000 Displays the first million bases of chromosome 3, GenBank/INSDC format
chr3:1000000+2000 Displays a region of chromosome 3 that spans 2000 bases, starting with position 1000000
chrUn_GL000213v1 Displays all of the unplaced contig GL000213v1
chr3_GL000221v1_random Displays the unlocalized contig GL000221v1
chr1_KN196472v1_fix Displays all of patch fix KN196472v1
20p13 Displays the region for band p13 on chromosome 20
GTATGTAGCCACGGAGCACCATTACCTGTCACCATTACCTGAATGGCTA Displays the first best match to this DNA sequence, e.g. chr21:33034835-33034883 for hg19
AA205474 Displays the region containing the EST with GenBank accession AA205474 in the BRCA1 cancer gene on chromosome 17
AC008101 Displays the region containing the clone with GenBank accession AC008101
AF083811 Displays the region containing the mRNA with GenBank accession number AF083811
NM_017414 Displays the region containing RefSeq identifier NM_017414
NP_059110 Displays the region containing protein accession number NP_059110
PRNP Displays the region containing HUGO Gene Nomenclature Committee identifier PRNP
Q99697 Displays the region containing the alignment of the UniProt/SwissProt protein sequence with accession Q99697 (PITX2)
RH18061;RH80175
15q11;15q13
NM_012090.5;NM_012421.4
Displays the region between genome landmarks, such as the STS markers RH18061 and RH80175, or chromosome
bands 15q11 to 15q13, or SNPs NM_000310.4 and NM_012090.5. This syntax may also be used for other range queries,
such as between uniquely determined ESTs, mRNAs, refSeqs, SNPS, etc.
NR_026861.1:1-1000 Works with any other type of accession from this page: Displays the first 1000bp of NR_026861.1
TP53 exon 5
NM_000546 exon 5
Jumps to exon 5 of TP53 using the verbose notation. A transcript ID (NM_, NR_, XM_, XR_, ENST) may be used in place of the gene symbol.
TP53:e.5
NM_000546.6:e.5
BRCA2:e.10+2
BRCA2:e.10-3
Compact exon notation from the VICC Gene Fusion Specification. Jumps to exon 5 of TP53, or to 2 bp past the end / 3 bp before the start of BRCA2 exon 10 (useful for splice site inspection). The +N/-N offset is optional.
NM_000310.4(PPT1):c.271_287del17insTT
NM_007262.5(PARK7):c.-24+75_-24+92dup
NM_006172.4(NPPA):c.456_*1delAA
MYH11:c.503-14_503-12del
NM_198576.4(AGRN):c.1057C>T
NM_198056.3:c.1654G>T
NP_002993.1:p.Asp92Glu
NP_002993.1:p.D92E
BRCA1 Ala744Cys
BRCA1 A744C
LRG_100t1:c.4G>A
LRG_100t1:n.1
LRG_456p1:p.Ser190Leu
LRG_321:g.16409_16461del
ENST00000002596.6:c.-108-6848A>G
ENSP00000005178.5:p.Val20Gly
chrX:g.31500000_31600000del
NR_111987:n.-1
NM_015102.5:n.3038-2
NM_001372044:c.1528_1530del
Displays the region that matches the HGVS expression, usually in the format <transcript or protein>:<position> <amino acid or nucleotide change>
If a gene symbol is used, HGVS search will try all RefSeq transcripts to find the nucleotide or amino acid at the position indicated in the expression. If there are multiple matches, a disambiguation page will be shown. If the RefSeq sequence differs from the genome sequence, then currently the search will use the genome, not the transcript, for codon counting and amino acid / nucleotide comparison. Please contact us if this is inconvenient.
NM_198056.2:c.1A>C An example of an HGVS search on a previous NM version that is now outdated. Support for previous NM accessions is only available on hg38.
1-55051215-G-GA Displays the region that matches the gnomAD variant ID, 1-55051215-G-GA
essv8694097 Displays the region covering the copy number variant with the accession essv8694097 in the Database of Genomic Variants (DGV)
nssv3446126 Displays the region covering the copy number variant with the accession nssv3446126 in the cases of developmental delay
CTD-3071L10 Displays the region covering the CTD-3071L10 NCBI clone end mapping in the NCBI Clone DB database
nssv16167444 Displays the region covering the common copy number genomic variant with the accession nssv16167444 in the nstd186 (NCBI Curated Common Structural Variants) dataset
rs1333049 Displays results for annotations matching this rsID, including dbSNP database
COSM6161404 Displays the region covering COSM6161404 in the Catalogue Of Somatic Mutations In Cancer (COSMIC) database
nssv3395351 Displays the region covering ClinVar Copy Number Variant with the accession nssv3395351 in the ClinVar database
BRCT_assoc Displays the region covering the manually-curated Pfam-A domain BRCT_assoc found in GENCODE Genes
U133A:219211_at Displays the region containing the consensus and exemplar sequences used for the selection of probes on the Affymetrix HG-U133A chips
chr1 0 1000 When entered without ":" and "-", uses 0-based, half-open coordinates (like custom tracks and internal table coordinates), so displays chr1:1-1000
pseudogene mRNA Lists transcribed pseudogenes, but not cDNAs
p53 Lists mRNAs related to the p53 tumor suppressor
T-cell receptor Lists mRNAs for T-cell receptor genes in GenBank
breast cancer Lists mRNAs associated with breast cancer
homeobox caudal Lists mRNAs for caudal homeobox genes
zinc finger Lists zinc finger mRNAs
kruppel zinc finger Lists only kruppel-like zinc fingers
huntington Lists candidate genes associated with Huntington's disease
zahler Lists mRNAs deposited by a scientist named Zahler
Evans,J.E. Lists mRNAs deposited by co-author J.E. Evans

Use this last format for author queries. Although GenBank requires the search format Evans JE, internally it uses the format Evans,J.E..