Skip to main content

UCSC Genome Browser 101

This tutorial is a basic introduction of the most common UCSC Genome Browser usage. This includes the navigation menu, configuration of the tracks display, and where to find additional resources.

Sections

Explore each of the three section below to learn the material in a different form.

Browser Interface Annotated Screenshot

This 'cheat sheet' highlights and describes the main features and functionalities of the tracks display.

Guided Walkthrough

A guided walkthrough that explains menu bar navigation, as well as using and configuring the tracks display.

Interactive Tutorial

An interactive tutorial that covers the basic Browser introduction on this page.

Annotated Screenshot

Guided Walkthrough

The navigation bar at the top of the page will allow you to access our tools, downloads, and help pages.

Several of these drop-downs are useful for most users:

  • Genomes - switch between the many genomes available.
  • Genome Browser - configure the display, search for tracks, load a Recommended Track Set, and reset the Genome Browser back to the default settings.
  • Tools - access to features such as BLAT, isPCR, and LiftOver. The Table Browser can also export track data in various file formats.
  • Downloads - download sequence and annotation data in bulk, along with our command-line utilities.
  • My Data - create stable short links (Sessions) and visualize your own data via custom tracks or track hubs.
  • View - save the current image as a PDF, get the DNA sequence for the window, or open the region in an external tool.
  • Help - access contact information, FAQs, and Browser Documentation.

The search bar allows you to navigate to a region on the genome using genome coordinates, gene symbols, rsIDs, HGVS terms, or DNA sequence. You can even search documentation and FAQ pages using this search bar. A few example queries are:

  • chr1:127140001-127140001
  • SOD1
  • rs2569190
  • NM_198056.3:c.1654G>T
  • CCTTCCTATAGTCCGGAATACGCC AATGGCGCGGCCGGCCTGGACC ACTCCCATTACGGGGGTGTCCC GGGCAGCGGGGCCGGAGGCTTA ATGCAAAGGC

Please note, BLAT is used if your search term is a DNA sequence. For the best results, make sure your sequence is long enough to meet BLAT specifications. The examples link next to the search bar contains even more search queries.


Highlights and Zooming

Dragging the Genome Browser image performs different tasks depending on where and how you click the image.

Click-and-Drag the ruler at the top of the image will bring up a menu to zoom into or highlight the region. Click-and-Drag anywhere else on the Genome Browser image to scroll to the left or right.

Alternatively, you can:

  • Hold Alt+drag or Option+drag to highlight
  • Hold Ctrl+drag or Cmd+drag to zoom

Configuring Data Track Display

Clicking on the rectangle box next to a track is an easy way to go to that track's settings page quickly.

Right-clicking on the track will also bring up a menu to change the display mode, configure a track, or view a PNG image of the current window.


Track Display Modes

Annotation tracks can be entirely hidden or shown in four different ways that take an increasing amount of vertical space: dense, squish, pack, and full.

Pack display is the recommended visibility for most data types as it provides the best balance of information and space.

After changing a track's display mode, the change will not be applied until you refresh the page. You can either refresh the page manually using your web browser or click on any of the track groups.


Searching for Data Tracks

Having trouble finding a dataset for your genome assembly? The Track Search feature allows searching for terms in track names, descriptions, groups, and ENCODE metadata.

More information about can be found on the following help page. The Track Search feature can also be accessed by hovering over the "Genome Browser" drop-down menu.


Configuring the Genome Browser Display

Use the button to customize graphic font, size, gridlines, and more. This can be helpful when exporting an image for publication.

You can also find a link to configure the browser image by hovering over the "Genome Browser" drop-down menu.


Viewing the Reverse Strand

By default, the UCSC Genome Browser displays the forward strand (5' to 3') but can be configured to display the negative strand (3' to 5').

To reverse the genome orientation, click the button, and the Genome Browser image will flip to show either the negative or positive strand.


Recommended Track Sets are ready-made groups of tracks designed for specific purposes. Each set turns on a specific set of tracks and pre-configures those to aid in answering a particular question, such as interpreting clinical variants. Choosing a set switches on the relevant tracks without moving you away from your current location.

Open the list from the Genome Browser menu in the top blue bar.


The Share a link button in the top-right corner turns your current view into a short, permanent link that captures the assembly, position, and all of your track settings. The link never expires, so it works well in emails, figure legends, and published papers.

Log in first if you would like to give your links a name or update them later. To save and reload a full setup of your own, use the Sessions tool under the My Data menu.


Getting Help Using the Genome Browser

The training page has other guides and training videos. You can also search the mailing list archive for previously answered questions.

If you still have questions after searching the FAQ page or Genome Browser User Guide pages, you can email the suitable mailing list for your inquiry from the Contact Us page.

Follow our citation guidelines when using the Genome Browser tool suite or data from the UCSC Genome Browser database in a research work that will be published in a journal or on the Internet.

In addition to the relevant paper, please reference the Genome Browser website in your manuscript: http://genome.ucsc.edu.