You created a Track Collection that has expired and been removed. Track Collections expire 48 hours after their last use. Save your session to preserve collections long-term and to allow sharing.

Set-Cookie: hguid.genome-euro=430549234_Qc3B4QrOripFiawcrWEpGh1JYffq; path=/; domain=.ucsc.edu; expires=Thu, 31-Dec-2037 23:59:59 GMT Content-Type:text/html Predicted mRNA from Genome
>NM_001179454
ATGTCATTTTTACAAAATTTTCATTTAAGTCCAGGACAGACTATACGTTC
TACAAGAGGTTTCAAATGGAATACTGGAAATACCGATTTCAATTATACCC
CTTCACATCAAAAACCGTTTATACAGCCCGTATCAGGAACTACAGTAACA
ACTCATCAAGATATTAAGGAAATTGTAGAGACTACTCTAGGTTCTGAAGG
TGTTTTAAATCAGGCTGTCAAATTACCAAAGGGTGAAAATGAAAATGAAT
GGTTAGCTGTTCATGTAGTGGATTTTTACAATCAAATTAATATGTTGTAC
GGTACAATTACTGAATTTTGTTCACCTGAATCATGTCCAAGAATGATTGC
TACCAATGAATATGAATATTTATGGTCCTTTGAAAAAGGTAGATCTCCGG
TTTCTGTTAGTGCTCCAAAATATGTTGAATGTTTGATGAGGTGGTGTCAG
GATCAATTTGATGATGAATTAATATTCCCAAGTAGGAGGGATGGTGTTTT
CCCTGATAGATTTATTGACAAAGTTATTATTCCAATGTTAAGAAGGTTGT
TTAGAGTATATGCTCATATATATTGTCATCATTTCAATGAGGTTCTTGAA
TTGAATTTACAAACTGTGTTAAATACTAGTTTTAGACATTTTTGTCTATT
TGCACAAGAATTTAATTTATTACGTCCCTCAGATTTTGGACCTTTATTAG
AATTGGTTACAGAATTAAGAGATAGGTGA