Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 509 in window, 25160915 - 25160927, 13 bps 
B D                     Human  t----ggatgtgaaat-t----
B D                     Chimp  t----ggatgtgaaat-t----
B D                   Gorilla  t----ggatgtgaaat-t----
B D                 Orangutan  t----ggatgtaaaat-t----
B D                    Gibbon  t----ggatgtgaaat-t----
B D                    Rhesus  t----ggatgtgaaat-t----
B D       Crab-eating macaque  t----ggatgtgaaat-t----
B D                    Baboon  c----ggatgtgaaat-t----
B D              Green monkey  c----ggatgtgaaat-t----
B D                  Marmoset  c----ggatgtgaaat-t----
B D           Squirrel monkey  c----ggatgtgaaat-t----
B D                  Bushbaby  c----tgatgcgaaac-t----
           Chinese tree shrew  c----agatgtgaaat-g----
B D                  Squirrel  c----ggctgtgaatt-t----
       Lesser Egyptian jerboa  c----ggcggtgaaat-c----
                 Prairie vole  c----atctgtgaaat-c----
B D           Chinese hamster  c----gtctgtgaaat-c----
               Golden hamster  c----gtttgtgaaat-c----
B D                     Mouse  c----gactgtgaaat-c----
B D                       Rat  c----ggctgtgaagt-c----
B D            Naked mole-rat  c----ggctgcgagat-t----
                   Chinchilla  c----ggctgcgaaat-t----
             Brush-tailed rat  c----ggctacgaaat-t----
B D                    Rabbit  c-----ggtgtgaaat-g----
B D                      Pika  cgggtgggtgtgaagt-g----
B D                       Pig  c----ggatgtgaaac-t----
B D                    Alpaca  a----ggaagtgaaac-t----
               Bactrian camel  a----ggaagtgaaac-t----
B D                   Dolphin  c----ggatgcgaaac-t----
                 Killer whale  c----ggatgcgaaac-t----
             Tibetan antelope  ---------gtgaaac-t----
B D                       Cow  ---------gtgaaac-t----
B D                     Sheep  ---------gtgaaac-t----
                Domestic goat  ---------gtgaaac-t----
B D                     Horse  c----agatgtgaaac-t----
B D          White rhinoceros  c----agatgtgaaac-t----
B D                       Cat  c----agatgcgaaac-t----
B D                       Dog  c----gggtgtgaaactt----
B D                   Ferret   c----agatgtgagac-t----
B D                     Panda  c----agatgtgaaac-t----
               Pacific walrus  c----agacatgaaac-t----
                 Weddell seal  c----agacatgaaac-t----
             Black flying-fox  c----agacgtgaaac-t----
B D                   Megabat  c----agacgtgaaac-t----
                Big brown bat  c----agatgtgcaac-t----
         David's myotis (bat)  c----ggatgtgcaac-t----
  D          Little brown bat  c----agatgtgcaac-t----
B D                  Hedgehog  c----ggatgtgaaac-tggaa
              Star-nosed mole  c----agctgcgaatg-aaaca
B D                  Elephant  c----aggtgtgaaat-t----
          Cape elephant shrew  c----ggatgtgacat-t----
B D                   Manatee  c----agatatgaaat-t----
             Cape golden mole  c----tgatgagacag-t----
                     Aardvark  c----agatgtgacat-t----
B D                 Armadillo  c----agatgtgacat-t----
B D                   Opossum  c---gaaatgtgaaat-c----
B D           Tasmanian devil  -----aaatgtgaagt-c----
B D                   Wallaby  t---caaagatgaaat-c----
  D           Green seaturtle  a----ag------aac-a----
  D            Painted turtle  a----ag------aac-a----
  D  Chinese softshell turtle  a----ag------aac-a----
  D    Spiny softshell turtle  a----ag------aac-a----
B D                     Shrew  ======================
                 Zebra mbuna  ======================
         Pundamilia nyererei  ======================
       Burton's mouthbreeder  ======================
         Princess of Burundi  ======================
B D              Nile tilapia  ======================
  D          Peregrine falcon  ======================
  D              Saker falcon  ======================
    Mexican tetra (cavefish)  ======================
                 Spotted gar  ======================
B D                Coelacanth  ======================
B D                 Zebrafish  ======================
B D                Budgerigar  ======================
  D               Rock pigeon  ======================
          Southern platyfish  ======================
B D                    Medaka  ======================
  D              Mallard duck  ======================
B D                 Tetraodon  ======================
      Yellowbelly pufferfish  ======================
B D                      Fugu  ======================
B D                   Chicken  ======================
B D                    Turkey  ======================
B D             X. tropicalis  ======================
B D              Atlantic cod  ======================
B D        American alligator  ======================
B D                    Lizard  ======================
B D               Stickleback  ======================
B D                Guinea pig  ======================
B D                  Platypus  ======================
B D                    Tenrec  ======================

Alignment block 2 of 509 in window, 25160928 - 25160936, 9 bps 
B D                     Human  tgaaa--gg-tt
B D                     Chimp  tgaaa--gg-tt
B D                   Gorilla  tgaaa--gg-tt
B D                 Orangutan  tgaaa--gg-tt
B D                    Gibbon  tcaaa--gg-tt
B D                    Rhesus  tgaaa--gg-tt
B D       Crab-eating macaque  tgaaa--gg-tt
B D                    Baboon  tgaaa--gg-tt
B D              Green monkey  tgaaa--gg-tt
B D                  Marmoset  tgaaa--gg-tt
B D           Squirrel monkey  tgaaa--gg-tt
B D                  Bushbaby  tgaaa--ggttt
           Chinese tree shrew  tgaaa--ga-tt
B D                  Squirrel  taaaa--gg-ct
       Lesser Egyptian jerboa  tgaaa--gg--t
                 Prairie vole  tgaaa--gg-tt
B D           Chinese hamster  tgaaa--gg-tt
               Golden hamster  tgaaa--gg-tt
B D                     Mouse  tgaaa--gg-tt
B D                       Rat  tgaaa--gg-tt
B D            Naked mole-rat  tgaca--gg-ct
                   Chinchilla  tgaca--gg-ct
             Brush-tailed rat  tgaca--gg-ct
B D                    Rabbit  ggaaaacgg-gt
B D                      Pika  accaa--gg-tt
B D                       Pig  tgaaa--gg-tt
B D                    Alpaca  ttaaa--gg-tt
               Bactrian camel  tgaaa--gg-tt
B D                   Dolphin  tgaaa--gg-tt
                 Killer whale  tgaaa--gg-tt
             Tibetan antelope  tgaga--gg-tt
B D                       Cow  tgaaa--gg-tt
B D                     Sheep  tgaaa--gg-tt
                Domestic goat  tgcaa--gg-tt
B D                     Horse  tgaaa--gg-tt
B D          White rhinoceros  ggaaa--gg-tt
B D                       Cat  tgaaa--gg-tt
B D                       Dog  tgcaa--gg-tt
B D                   Ferret   ggaaa--gg-tt
B D                     Panda  tgaaa--gg-tt
               Pacific walrus  tgaaa--gg-tt
                 Weddell seal  tgaaa--gg-tt
             Black flying-fox  tgaaa--gg-tt
B D                   Megabat  tgaaa--gg-tt
                Big brown bat  tgaaa--gg-ct
         David's myotis (bat)  tgcaa--gg-ct
  D          Little brown bat  tgcaa--gg-ct
B D                  Hedgehog  ggaaa--gg-tt
              Star-nosed mole  aaaaa--gc-tt
B D                  Elephant  taaaa--gg-tt
          Cape elephant shrew  tgaaa--gg-tt
B D                   Manatee  tgaaa--gg-tt
             Cape golden mole  tgaaa--gg-tt
                     Aardvark  tgaca--ag-tt
B D                 Armadillo  tgaaa--gg-tt
B D                   Opossum  aaata--ag-ct
B D           Tasmanian devil  aaatg--aa-tt
B D                   Wallaby  aaatg--aa--c
  D           Green seaturtle  tgaaa-------
  D            Painted turtle  tgaaa-------
  D  Chinese softshell turtle  tgaaa-------
  D    Spiny softshell turtle  tgaaa-------
B D                      Fugu  tgaga--gt-ct
B D                     Shrew  ============
                 Zebra mbuna  ============
         Pundamilia nyererei  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D              Nile tilapia  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
    Mexican tetra (cavefish)  ============
                 Spotted gar  ============
B D                Coelacanth  ============
B D                 Zebrafish  ============
B D                Budgerigar  ============
  D               Rock pigeon  ============
          Southern platyfish  ============
B D                    Medaka  ============
  D              Mallard duck  ============
B D                 Tetraodon  ============
      Yellowbelly pufferfish  ============
B D                   Chicken  ============
B D                    Turkey  ============
B D             X. tropicalis  ============
B D              Atlantic cod  ============
B D        American alligator  ============
B D                    Lizard  ============
B D               Stickleback  ============
B D                Guinea pig  ============
B D                  Platypus  ============
B D                    Tenrec  ============

Alignment block 3 of 509 in window, 25160937 - 25160948, 12 bps 
B D                     Human  ttatttcctaac
B D                     Chimp  ttatttcctaac
B D                   Gorilla  ttatttcctaac
B D                 Orangutan  ttatttcctaac
B D                    Gibbon  ttatttcctaac
B D                    Rhesus  ttatttcctgac
B D       Crab-eating macaque  ttatttcctgac
B D                    Baboon  ttatttcccgac
B D              Green monkey  ttatttcctgac
B D                  Marmoset  ttatttcctaac
B D           Squirrel monkey  ttatttcctaac
B D                  Bushbaby  ttatttcctatc
           Chinese tree shrew  ttatttcctaac
B D                  Squirrel  ttatttcctaac
       Lesser Egyptian jerboa  ttatttcctaac
                 Prairie vole  ttatttcctaac
B D           Chinese hamster  ttatttcctaac
               Golden hamster  ttatttcctaac
B D                     Mouse  ttatttcctaac
B D                       Rat  ttatttcctaac
B D            Naked mole-rat  ttatttcctaac
                   Chinchilla  ttatttcctaac
             Brush-tailed rat  ttatttcctaac
B D                    Rabbit  ttatttcctaag
B D                      Pika  ttatttcctaac
B D                       Pig  ttatttcctaac
B D                    Alpaca  ttatttcctagc
               Bactrian camel  ttatttcctagc
B D                   Dolphin  ttatttcctaac
                 Killer whale  ttattgcctaac
             Tibetan antelope  ttatttcttaac
B D                       Cow  ttatttcttaac
B D                     Sheep  ttatttcttaac
                Domestic goat  ttatttcttaac
B D                     Horse  ttatttactaac
B D          White rhinoceros  ttatttcttaac
B D                       Cat  ttatttcctaac
B D                       Dog  ttatttcctgac
B D                   Ferret   ttatttcctaac
B D                     Panda  ttatttcctaac
               Pacific walrus  ttatttcctaac
                 Weddell seal  ttatttcccaac
             Black flying-fox  ttatttcctaac
B D                   Megabat  ttatttcctaac
                Big brown bat  ttatttcctaat
         David's myotis (bat)  ttatttcctaac
  D          Little brown bat  ttatttcctaac
B D                  Hedgehog  ttatttcttagc
              Star-nosed mole  ttatttcctaac
B D                  Elephant  ttatttcctaac
          Cape elephant shrew  ttatttcctatc
B D                   Manatee  ttatttcttaac
             Cape golden mole  ttatttcctaac
                     Aardvark  ttatttcctaac
B D                 Armadillo  ttatttcctaac
B D                   Opossum  ttattttctaaa
B D           Tasmanian devil  ttatttcctaaa
B D                   Wallaby  ttatttcctaaa
B D        American alligator  tcattccctaac
  D           Green seaturtle  tcatttcctaat
  D            Painted turtle  tcatttcctaac
  D  Chinese softshell turtle  ccgtttcctagc
  D    Spiny softshell turtle  ccatttcctagc
B D                      Fugu  tcaggccctc--
B D                     Shrew  ============
                 Zebra mbuna  ============
         Pundamilia nyererei  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D              Nile tilapia  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
    Mexican tetra (cavefish)  ============
                 Spotted gar  ============
B D                Coelacanth  ============
B D                 Zebrafish  ============
B D                Budgerigar  ============
  D               Rock pigeon  ============
          Southern platyfish  ============
B D                    Medaka  ============
  D              Mallard duck  ============
B D                 Tetraodon  ============
      Yellowbelly pufferfish  ============
B D                   Chicken  ============
B D                    Turkey  ============
B D             X. tropicalis  ============
B D              Atlantic cod  ============
B D                    Lizard  ============
B D               Stickleback  ============
B D                Guinea pig  ============
B D                  Platypus  ============
B D                    Tenrec  ============

Inserts between block 3 and 4 in window
B D                  Opossum 2bp
B D          Tasmanian devil 5bp
B D                  Wallaby 4bp

Alignment block 4 of 509 in window, 25160949 - 25160966, 18 bps 
B D                     Human  tac---aggcag--cttt-aag-------ag
B D                     Chimp  tac---aggcag--cttt-aag-------ag
B D                   Gorilla  tac---aggcag--cttt-aag-------ag
B D                 Orangutan  tac---aggcag--cttt-aag-------ag
B D                    Gibbon  tac---aggcag--cttt-aag-------ag
B D                    Rhesus  tac---agacag--cttt-aag-------ag
B D       Crab-eating macaque  tac---agacag--cttt-aag-------ag
B D                    Baboon  tac---agacag--cttt-aag-------ag
B D              Green monkey  tac---agacag--attt-aag-------ag
B D                  Marmoset  tat---agacag--cttt-aag-------ag
B D           Squirrel monkey  tat---agacag--cttt-aag-------ag
B D                  Bushbaby  tac---agacag--cttt-aag-------ag
           Chinese tree shrew  tac---agacta--c-tg-acg-------at
B D                  Squirrel  tac---agacag--cttt-aag--------g
       Lesser Egyptian jerboa  t-----aggcgg--tttt-aag-------ag
                 Prairie vole  tac---aggcta--acta-tgg-------ag
B D           Chinese hamster  tac---aggcag--ctct-agg-------ag
               Golden hamster  tac---aggcag--ctct-agg-------ag
B D                     Mouse  -ac---aggtaa--ctct-aag-------ag
B D                       Rat  tac---aggtaa--ctct-aag-------ag
B D            Naked mole-rat  tac---gggcag--cttc-ggc-------ag
                   Chinchilla  tac---aggcag--cttc-agt-------ga
             Brush-tailed rat  tac---agacag--cttc-agt-------ga
B D                    Rabbit  gac---agg----------------------
B D                      Pika  tac---agc----------------------
B D                       Pig  tac---agg--------t-aag-------ag
B D                    Alpaca  tac---agacag--cttt-aag-------ag
               Bactrian camel  tac---agacag--cttt-aag-------ag
B D                   Dolphin  tac---agacag--cttt-aaa-------ag
                 Killer whale  tac---agacag--ctct-aaa-------ag
             Tibetan antelope  tac---agacag--cttt-aag-------ag
B D                       Cow  tac---agacag--cttt-aag-------ag
B D                     Sheep  tac---agacag--cttt-aag-------ag
                Domestic goat  tac---agacag--cttt-aag-------ag
B D                     Horse  tac---acacag--ctta-aac-------ag
B D          White rhinoceros  tac---acacgg--cggg-aag-------ag
B D                       Cat  tac---aggcag--cttt-aag-------ag
B D                       Dog  tac---aggcag--cttt-agg-------ag
B D                   Ferret   tac---agacag--cttg-aag-------ag
B D                     Panda  tac---agacag--cttt-aag-------ag
               Pacific walrus  tac---agacag--cttt-agg-------ag
                 Weddell seal  tac---agacgg--cttt-aag-------ag
             Black flying-fox  tac---agacagaacttt-aac-------cg
B D                   Megabat  tac---agacagaacttt-aac-------cg
                Big brown bat  tac---aggcag--cttt-cac-------ag
  D          Little brown bat  tac---aggcag--cttt-aac-------ag
B D                  Hedgehog  tac---a------------------------
              Star-nosed mole  tac---ag------ctta-aag-------ag
B D                  Elephant  tac---agacag--cttt-aaa-------gg
          Cape elephant shrew  tac---aggcag--cctc-ggg---------
B D                   Manatee  tac---agacag--cttt-aag-------gg
             Cape golden mole  taccagggacag--aatt-aag-------gt
                     Aardvark  tac---aggcag--cttt-aaggtttaaggt
B D                 Armadillo  tac---aag-ag--cttt-aag-------gg
B D                   Opossum  --t---ggacag--cttt-agc--------a
B D           Tasmanian devil  aac---agacag--cttt-aat--------g
B D                   Wallaby  gtc---agactg--cttt-agt--------g
B D        American alligator  cgc---agactg--cttgtaga-------a-
  D           Green seaturtle  agc---aaactg--ctta-ata-------at
  D            Painted turtle  agc---aaactg--cttt-ata-------at
  D  Chinese softshell turtle  cgc---aaaccg--ctta-aga-------at
  D    Spiny softshell turtle  tgc---aaaccg--ctta-aga-------at
B D                      Fugu  tac---aaacag--cagg-aag-------tg
B D                     Shrew  ===============================
                 Zebra mbuna  ===============================
         Pundamilia nyererei  ===============================
       Burton's mouthbreeder  ===============================
         Princess of Burundi  ===============================
B D              Nile tilapia  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
    Mexican tetra (cavefish)  ===============================
                 Spotted gar  ===============================
B D                Coelacanth  ===============================
B D                 Zebrafish  ===============================
B D                Budgerigar  ===============================
  D               Rock pigeon  ===============================
          Southern platyfish  ===============================
B D                    Medaka  ===============================
  D              Mallard duck  ===============================
B D                 Tetraodon  ===============================
      Yellowbelly pufferfish  ===============================
B D                   Chicken  ===============================
B D                    Turkey  ===============================
B D             X. tropicalis  ===============================
B D              Atlantic cod  ===============================
B D                    Lizard  ===============================
B D               Stickleback  ===============================
B D                Guinea pig  ===============================
B D                  Platypus  ===============================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Tenrec  ===============================

Inserts between block 4 and 5 in window
B D       American alligator 41bp

Alignment block 5 of 509 in window, 25160967 - 25160974, 8 bps 
B D                     Human  -gctgatta
B D                     Chimp  -gctgatta
B D                   Gorilla  -gctgatta
B D                 Orangutan  -gctgatta
B D                    Gibbon  -gctgatta
B D                    Rhesus  -gctgaata
B D       Crab-eating macaque  -gctgaata
B D                    Baboon  -gctgaata
B D              Green monkey  -gctgaata
B D                  Marmoset  -gctgaata
B D           Squirrel monkey  -gctgaata
B D                  Bushbaby  -gctgaatg
           Chinese tree shrew  -gctgggta
B D                  Squirrel  -gttgaatg
       Lesser Egyptian jerboa  -gctggagg
                 Prairie vole  -gcttgagg
B D           Chinese hamster  -gcttgagg
               Golden hamster  -gcttgagg
B D                     Mouse  -gctagagg
B D                       Rat  -gctggagg
B D            Naked mole-rat  -cc-ggagg
                   Chinchilla  -ccagaagg
             Brush-tailed rat  -ccagaagg
B D                       Pig  -gcgggata
B D                    Alpaca  -acagaata
               Bactrian camel  -acagaatc
B D                   Dolphin  -gtggaatg
                 Killer whale  -gtggaatg
             Tibetan antelope  -tcgggata
B D                       Cow  -tcgggata
B D                     Sheep  -tcgggata
                Domestic goat  -tcgggata
B D                     Horse  -gccgagta
B D          White rhinoceros  -gccgagca
B D                       Cat  -gctgacta
B D                       Dog  -gctgacta
B D                   Ferret   -gctgacta
B D                     Panda  -gctgacta
               Pacific walrus  -gctgacta
                 Weddell seal  -gctgccta
             Black flying-fox  -actgaaca
B D                   Megabat  -actgaaca
                Big brown bat  -gccgag--
  D          Little brown bat  -gccggt--
              Star-nosed mole  -gccgaaca
B D                  Elephant  -gctgaaca
B D                   Manatee  -gctgaatg
             Cape golden mole  -gctgagta
                     Aardvark  -gctgaaaa
B D                 Armadillo  -cctgcggc
B D                   Opossum  -gctgaagg
B D           Tasmanian devil  -actgaagg
B D                   Wallaby  -actgaagg
  D           Green seaturtle  -----aata
  D            Painted turtle  -----aata
  D  Chinese softshell turtle  -----aata
  D    Spiny softshell turtle  -----aata
B D                      Fugu  tcccagtt-
B D                  Hedgehog  ---------
B D                     Shrew  =========
                 Zebra mbuna  =========
         Pundamilia nyererei  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D              Nile tilapia  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
    Mexican tetra (cavefish)  =========
                 Spotted gar  =========
B D                Coelacanth  =========
B D                 Zebrafish  =========
B D                Budgerigar  =========
  D               Rock pigeon  =========
          Southern platyfish  =========
B D                    Medaka  =========
  D              Mallard duck  =========
B D                 Tetraodon  =========
      Yellowbelly pufferfish  =========
B D                   Chicken  =========
B D                    Turkey  =========
B D             X. tropicalis  =========
B D              Atlantic cod  =========
B D        American alligator  =========
B D                    Lizard  =========
B D               Stickleback  =========
B D                Guinea pig  =========
         Cape elephant shrew  ---------
B D                  Platypus  =========
        David's myotis (bat)  NNNNNNNNN
B D                    Rabbit  ---------
B D                      Pika  ---------
B D                    Tenrec  =========

Inserts between block 5 and 6 in window
  D          Green seaturtle 4bp
  D           Painted turtle 67bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp

Alignment block 6 of 509 in window, 25160975 - 25161002, 28 bps 
B D                     Human  tc--tg----------------c-cac-------g----------------------------a--c---
B D                     Chimp  tc--tg----------------c-cac-------g----------------------------a--c---
B D                   Gorilla  tc--tg----------------c-cac-------g----------------------------a--c---
B D                 Orangutan  tc--tg----------------c-cac-------g----------------------------a--cc--
B D                    Gibbon  tc--tg----------------c-cac-------g----------------------------g--cc--
B D                    Rhesus  tc--tg----------------c-cgc-------g----------------------------a--cc--
B D       Crab-eating macaque  tc--tg----------------c-cgc-------g----------------------------a--cc--
B D                    Baboon  tc--tg----------------c-cgc-------g----------------------------a--cc--
B D              Green monkey  tc--tg----------------c-cgc-------g----------------------------a--cc--
B D                  Marmoset  tc--tg----------------c-ctc-------g----------------------------a--cc--
B D           Squirrel monkey  tc--tg----------------c-ctc-------g----------------------------a--cc--
B D                  Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  tc--tg----------------c-cgcttccaagg----------------------------a--cctg
B D                  Squirrel  tc--tgtcgctaccaccagcccc-agc-------g----------------------------a--ga--
       Lesser Egyptian jerboa  tc----------------------ggc-------c----------------------------g--cc--
                 Prairie vole  tc--gg----------------c-ggc-------g----------------------------a--gt--
B D           Chinese hamster  tc--tg----------------t-ggc-------g----------------------------a--gt--
               Golden hamster  tc--------------------t-ggc-------g----------------------------a--gt--
B D                     Mouse  tc-------------------------------------------------------------a--tc--
B D                       Rat  tc-------------------------------------------------------------aggtg--
B D            Naked mole-rat  ----------------------c-gc-----------------------------------------g--
                   Chinchilla  ----------------------c-gat-------g----------------------------g--ag--
             Brush-tailed rat  ----------------------c-gcg-------g----------------------------g--ag--
B D                    Rabbit  ----------------------c-ggc-------g----------------------------c------
B D                      Pika  ----------------------a-ggc-------g----------------------------t------
B D                       Pig  tc--tggcgccc----------a-cac-------a----------------------------g--cctg
B D                    Alpaca  cc--tgccacca----------t-cac-------c----------------------------g--cctg
               Bactrian camel  cc--tgccacca----------t-cac-------c----------------------------g--cctg
B D                   Dolphin  cc--tggcgcca----------t-cac-------c----------------------------g--cctg
                 Killer whale  cc--tggcgcca----------t-cac-------c----------------------------g--cctg
             Tibetan antelope  cc--tggcgcca----------t-cac-------t----------------------------g--cctg
B D                       Cow  cc--tggcgcca----------t-cac-------t----------------------------g--cctg
B D                     Sheep  cc--tggcgcca----------t-cac-------t----------------------------g--cctg
                Domestic goat  cc--tggcgcca----------t-cac-------t----------------------------g--cctg
B D                     Horse  tc--tgccgctg----------t-cac-------c----------------------------g--cccg
B D          White rhinoceros  tc--cgctgcta----------t-cac-------g----------------------------g--cccg
B D                       Cat  tctggg--gcta----------taccc-------g----------------------------g--cctg
B D                       Dog  cc--gg--gctgcccc------c-cac-------c----------------------------g--cctg
B D                   Ferret   tg--gg--gcca----------t-cac-------g----------------------------g--cctg
B D                     Panda  tc--gg--gcta----------t-cgc-------c----------------------------g--cctg
               Pacific walrus  tc--gg--ggta----------t-cac-------c----------------------------g--cctg
                 Weddell seal  tc--gg--ccta----------t-cac-------c----------------------------g--cctg
             Black flying-fox  tc--cgctgctc----------c-cac-------c----------------------------g--cctg
B D                   Megabat  tc--cgctgctc----------c-cac-------c----------------------------g--cctg
                Big brown bat  -----g--gctc----------c-ca-------------------------------------c--ccgg
  D          Little brown bat  -----gccgcgc----------c-cac-------cgccggagcccggagcccggagcccggagc--ccgg
B D                  Hedgehog  --------caca----------g-ctc-------t-----------------------------------
              Star-nosed mole  tc--tgcccgga----------g-ccc-------t-------------------------------tctg
B D                  Elephant  cc--tgccgcta----------t-cac-------c----------------------------t--cctg
          Cape elephant shrew  ------------------------cgc-------c----------------------------t--cccc
B D                   Manatee  cc--tgctgcta----------t-cac-------c----------------------------t--ccgg
             Cape golden mole  tc--tgctgc-a----------t-cac-------c----------------------------t--cc--
                     Aardvark  tc--cgctgcta----------t-cac-------c----------------------------t--cctg
B D                 Armadillo  tc--t-----------------------------c----------------------------c--ccct
B D                   Opossum  ca--tg--gttgc---------t-gag-------g----------------------------a--tttg
B D           Tasmanian devil  ca--tg--gctgt---------t-gag-------g----------------------------g--ttta
B D                   Wallaby  ca--tg--gcta----------t-gag-------g----------------------------g--tttg
  D           Green seaturtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
B D                      Fugu  ----------------------------------------------------------------------
B D                     Shrew  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                   Chicken  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
B D              Atlantic cod  ======================================================================
B D        American alligator  ======================================================================
B D                    Lizard  ======================================================================
B D               Stickleback  ======================================================================
B D                Guinea pig  ======================================================================
B D                  Platypus  ======================================================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Tenrec  ======================================================================

                        Human  -----------c--cccc-aggctgggaggc-
                        Chimp  -----------c--cccc-aggctgggaggc-
                      Gorilla  -----------c--cccc-aggctgggaggc-
                    Orangutan  -------accac--cccc-aggctgggaagc-
                       Gibbon  -------accac--cccc-aggctgggaggc-
                       Rhesus  -------accgc--cccc-aggctggga----
          Crab-eating macaque  -------accgc--cccc-aggctggga----
                       Baboon  -------accgc--cccc-aggctgggc----
                 Green monkey  -------accgc--cccc-aggctggga----
                     Marmoset  -------atctg--cccc-aggctgggaggc-
              Squirrel monkey  -------atctgc-cccc-cggctgggaggc-
                     Bushbaby  -----------c--ccgc--------------
           Chinese tree shrew  agtgagtagcac--actc-aggctgggaggc-
                     Squirrel  -------agctg--g-cc-aggcagagg----
       Lesser Egyptian jerboa  -------cccca--gccc-aggcgggga----
                 Prairie vole  -------agctc--gccc-atgcaggga----
              Chinese hamster  -------ggctc--gccc-atgcaggga----
               Golden hamster  -------ggctc--gccc-atgcaggga----
                        Mouse  -------agctc--gccc-atgcaggga----
                          Rat  -------ctctc--gccc-atgcaggga----
               Naked mole-rat  -------ggctt--g--------gg-------
                   Chinchilla  -------ggctg--g--------cgggc----
             Brush-tailed rat  -------ggctg--g--------ggggc----
                       Rabbit  -----------------------gggga----
                         Pika  -----------------------gaaga----
                          Pig  agcg-------t--accc-gggctg-gaggc-
                       Alpaca  ggcaactc-cac--accc-aggctgcgatgt-
               Bactrian camel  ggcaactc-cac--acct-aggctgcgacgt-
                      Dolphin  ggcgaggc-ctc--actc-aggccgcgaggc-
                 Killer whale  ggcgaggc-ctc--accc-aggccgcgaggc-
             Tibetan antelope  ggcaagtc-ctc--accc-gggctgcgaggc-
                          Cow  ggcgaatc-ctc--accc-aggctgcgaggc-
                        Sheep  ggcaagtc-ctc--accc-gggctgcgaggc-
                Domestic goat  ggcaagtc-ctc--accc-gggctgcgaggc-
                        Horse  --------------------ggctgcgaggc-
             White rhinoceros  agcgaacagcac--accc-aggctgcgaggc-
                          Cat  agcgagtagcac--accc-aggctgggaggc-
                          Dog  ggcgaggagcac--atccggggctggggggg-
                      Ferret   agcgaggagcac--accc-aggccgggaggc-
                        Panda  agcgaggagcac--accc-aggctgggaggc-
               Pacific walrus  agcgaggggcac--accc-aggcagggaggc-
                 Weddell seal  agcgaggagccc--accc-aggctgggaggc-
             Black flying-fox  agcgagcagcac--accc-aggctgtgaggt-
                      Megabat  agcgagcagcac--accc-agcctgggaggt-
                Big brown bat  agcgagtggccc--agcc-aggctgggaggc-
             Little brown bat  agcccggagccc--ggac-aggctggaggcc-
                     Hedgehog  -------------------agg----gggct-
              Star-nosed mole  ggtgagcaaatc--acca-agg----gcgat-
                     Elephant  agcgagtaccag--agcc-aggctgggaggc-
          Cape elephant shrew  agcgaggagcgc--agcc-aggcctgggggt-
                      Manatee  agagagtaccac--agcg-aggctgggaggc-
             Cape golden mole  ---------cac--ctcc-aggctgggcggc-
                     Aardvark  agcgagtaccac--accc-agactgggaggc-
                    Armadillo  agagagtcccac--gccc-cgg-tgggaggc-
                      Opossum  actatgtagca---ccca-agcctgggaaat-
              Tasmanian devil  actatctaacacatccca-agcctgggaaat-
                      Wallaby  actatgtagcac--ccca-ag-ctgagagat-
              Green seaturtle  -----ttagtaa--caac-ataataagtgat-
     Chinese softshell turtle  -----ttagtaa--cgac-agaataagtgac-
       Spiny softshell turtle  -----ttagtaa--caac-agaataagtgac-
                         Fugu  -------ggacc--acct-ggtccagaaagac
                        Shrew  ================================
                  Zebra mbuna  ================================
          Pundamilia nyererei  ================================
        Burton's mouthbreeder  ================================
          Princess of Burundi  ================================
                 Nile tilapia  ================================
             Peregrine falcon  ================================
                 Saker falcon  ================================
     Mexican tetra (cavefish)  ================================
                  Spotted gar  ================================
                   Coelacanth  ================================
                    Zebrafish  ================================
                   Budgerigar  ================================
                  Rock pigeon  ================================
           Southern platyfish  ================================
                       Medaka  ================================
                 Mallard duck  ================================
                    Tetraodon  ================================
       Yellowbelly pufferfish  ================================
                      Chicken  ================================
                       Turkey  ================================
                X. tropicalis  ================================
               Painted turtle  ================================
                 Atlantic cod  ================================
           American alligator  ================================
                       Lizard  ================================
                  Stickleback  ================================
                   Guinea pig  ================================
                     Platypus  ================================
         David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Tenrec  ================================

Inserts between block 6 and 7 in window
  D          Green seaturtle 6bp
  D Chinese softshell turtle 6bp
  D   Spiny softshell turtle 6bp

Alignment block 7 of 509 in window, 25161003 - 25161013, 11 bps 
B D                     Human  ggcag---------cagggc-----
B D                     Chimp  ggcag---------cagggc-----
B D                   Gorilla  ggcag---------cagggc-----
B D                 Orangutan  agcag---------cagggc-----
B D                    Gibbon  ggcag---------cagggc-----
B D                    Rhesus  ggcag---------cagggc-----
B D       Crab-eating macaque  ggcag---------cagggc-----
B D                    Baboon  ggcag---------cagggt-----
B D              Green monkey  ggcag---------cagggc-----
B D                  Marmoset  ggcag---------cagggc-----
B D           Squirrel monkey  ggcgg---------cagggc-----
B D                  Bushbaby  ggcag---------cagggc-----
           Chinese tree shrew  ggcag---------gggggc-----
B D                  Squirrel  ggcag---------gcgagc-----
       Lesser Egyptian jerboa  ggcag---------gagagc-----
                 Prairie vole  g------------------------
B D           Chinese hamster  g------------------------
               Golden hamster  g------------------------
B D                     Mouse  g------------------------
B D                       Rat  g------------------------
                   Chinchilla  a------------------------
             Brush-tailed rat  a------------------------
B D                    Rabbit  g------------------------
B D                      Pika  g------------------------
B D                       Pig  ggcag---------gagggc-----
B D                    Alpaca  ggcag---------gaagga-----
               Bactrian camel  ggcag---------gaagga-----
B D                   Dolphin  ggcag---------gagggc-----
                 Killer whale  ggcag---------gagggc-----
             Tibetan antelope  gacag---------gaggac-----
B D                       Cow  ggtag---------gagggc-----
B D                     Sheep  gacag---------gaggac-----
                Domestic goat  gacag---------gaggac-----
B D                     Horse  ggcag---------gagggc-----
B D          White rhinoceros  ggcag---------ga-ggc-----
B D                       Cat  ggcag---------gagggc-----
B D                       Dog  ggcgg---------gagggc-----
B D                   Ferret   ggtgg---------gagggc-----
B D                     Panda  ggcag---------gagggc-----
               Pacific walrus  ggcag---------gagggc-----
                 Weddell seal  ggccg---------gagggc-----
             Black flying-fox  ggcag---------gtgggc-----
B D                   Megabat  ggcag---------gtgggc-----
                Big brown bat  g---g---------gcaggc-----
  D          Little brown bat  ---------------ccggc-----
B D                  Hedgehog  gg-gg---------gaggac-----
              Star-nosed mole  ggcgt---------ggggac-----
B D                  Elephant  ggcag---------gaggac-----
          Cape elephant shrew  ggc-g---------gggtgc-----
B D                   Manatee  ggc-a---------ggcggc-----
             Cape golden mole  gga-g---------gggcgc-----
                     Aardvark  ggcag---------gggagc-----
B D                 Armadillo  agctg---------gagggc-----
B D                   Opossum  aggagatgggaatgcaggga-----
B D           Tasmanian devil  ggaag------atacagggg-----
B D                   Wallaby  gggaggtaggaatgcaaggg-----
  D              Saker falcon  gccag---------caggac-----
  D          Peregrine falcon  gccag---------caggac-----
  D           Green seaturtle  ---aa---------ctgtat-----
  D  Chinese softshell turtle  ---ga---------ctgtat-----
  D    Spiny softshell turtle  ---ga---------ctgtat-----
B D                      Fugu  --------------cagatcacagc
B D                     Shrew  =========================
                 Zebra mbuna  =========================
         Pundamilia nyererei  =========================
       Burton's mouthbreeder  =========================
         Princess of Burundi  =========================
B D              Nile tilapia  =========================
    Mexican tetra (cavefish)  =========================
                 Spotted gar  =========================
B D                Coelacanth  =========================
B D                 Zebrafish  =========================
B D                Budgerigar  =========================
  D               Rock pigeon  =========================
          Southern platyfish  =========================
B D                    Medaka  =========================
  D              Mallard duck  =========================
B D                 Tetraodon  =========================
      Yellowbelly pufferfish  =========================
B D                   Chicken  =========================
B D                    Turkey  =========================
B D             X. tropicalis  =========================
  D            Painted turtle  =========================
B D              Atlantic cod  =========================
B D        American alligator  =========================
B D                    Lizard  =========================
B D               Stickleback  =========================
B D                Guinea pig  =========================
B D            Naked mole-rat  -------------------------
B D                  Platypus  =========================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Tenrec  =========================

Inserts between block 7 and 8 in window
B D                      Pig 5bp
  D          Green seaturtle 3bp
  D Chinese softshell turtle 3bp
  D   Spiny softshell turtle 3bp

Alignment block 8 of 509 in window, 25161014 - 25161022, 9 bps 
B D                     Human  aggg----------------------ga-gag-------
B D                     Chimp  aggg----------------------ga-gag-------
B D                   Gorilla  aggg----------------------ga-gag-------
B D                 Orangutan  aggg----------------------ga-gag-------
B D                    Gibbon  aggg----------------------ga-gag-------
B D                    Rhesus  aggg----------------------ga-gag-------
B D       Crab-eating macaque  aggg----------------------ga-gag-------
B D                    Baboon  aggg----------------------ga-gag-------
B D              Green monkey  aggg----------------------ga-gag-------
B D                  Marmoset  tggg----------------------ga-ggg-------
B D           Squirrel monkey  tggg----------------------ga-ggg-------
B D                  Bushbaby  gggt----------------------gt-ggg-------
           Chinese tree shrew  aaat----------------------ga-gag-------
B D                  Squirrel  cag------------------------------------
       Lesser Egyptian jerboa  aggc----------------------ga-ggg-------
B D                       Pig  agga----------------------ga-ggg-------
B D                    Alpaca  agga----------------------aa-gga-------
               Bactrian camel  agga----------------------aa-gga-------
B D                   Dolphin  agga----------------------gg-tgg-------
                 Killer whale  agga----------------------gg-tgg-------
             Tibetan antelope  agaa----------------------ga-gag-------
B D                       Cow  agaa----------------------ga-gag-------
B D                     Sheep  agaa----------------------ga-gag-------
                Domestic goat  agaa----------------------ga-gag-------
B D                     Horse  aggc----------------------ga-gga-------
B D          White rhinoceros  aggc----------------------ga-gga-------
B D                       Cat  aggg----------------------ga-gga-------
B D                       Dog  agga----------------------gg-gca-------
B D                   Ferret   aggc----------------------ga-gga-------
B D                     Panda  aggc----------------------ga-gga-------
               Pacific walrus  aggc----------------------gaggga-------
                 Weddell seal  gggc----------------------ga-gga-------
             Black flying-fox  aggc----------------------aa-gga-------
B D                   Megabat  aggc----------------------aa-gga-------
                Big brown bat  ccgc----------------------ga-gag-------
  D          Little brown bat  ccgc----------------------ga-gag-------
B D                  Hedgehog  gagg-----------------------------------
              Star-nosed mole  aagcagtggggcttcggggcgctccc-------------
B D                  Elephant  tggg----------------------gc-agc-------
          Cape elephant shrew  aggg----------------------gc-cgc-------
B D                   Manatee  aggg----------------------gc-agc-------
             Cape golden mole  aggg----------------------gc-agt-------
                     Aardvark  tggt----------------------gc-agc-------
B D                 Armadillo  cggg----------------------ga-gga-------
B D                   Opossum  gaag----------------------ga-gag-------
B D           Tasmanian devil  atag----------------------ga-aag-------
B D                   Wallaby  gaag----------------------ga-gag-------
B D                      Fugu  ------------------------------ggtgaccat
              Golden hamster  ---------------------------------------
B D                       Rat  ---------------------------------------
B D                     Shrew  =======================================
B D                     Mouse  ---------------------------------------
                 Zebra mbuna  =======================================
         Pundamilia nyererei  =======================================
       Burton's mouthbreeder  =======================================
         Princess of Burundi  =======================================
B D              Nile tilapia  =======================================
  D          Peregrine falcon  ---------------------------------------
  D              Saker falcon  ---------------------------------------
    Mexican tetra (cavefish)  =======================================
                 Spotted gar  =======================================
B D                Coelacanth  =======================================
B D                 Zebrafish  =======================================
B D                Budgerigar  =======================================
  D               Rock pigeon  =======================================
          Southern platyfish  =======================================
B D                    Medaka  =======================================
  D              Mallard duck  =======================================
B D                 Tetraodon  =======================================
  D  Chinese softshell turtle  =======================================
      Yellowbelly pufferfish  =======================================
B D                   Chicken  =======================================
B D                    Turkey  =======================================
B D             X. tropicalis  =======================================
  D            Painted turtle  =======================================
B D              Atlantic cod  =======================================
B D        American alligator  =======================================
B D                    Lizard  =======================================
B D               Stickleback  =======================================
B D                Guinea pig  =======================================
            Brush-tailed rat  ---------------------------------------
B D            Naked mole-rat  ---------------------------------------
                  Chinchilla  ---------------------------------------
                Prairie vole  ---------------------------------------
B D           Chinese hamster  ---------------------------------------
B D                  Platypus  =======================================
  D    Spiny softshell turtle  =======================================
  D           Green seaturtle  =======================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rabbit  ---------------------------------------
B D                      Pika  ---------------------------------------
B D                    Tenrec  =======================================

Inserts between block 8 and 9 in window
B D                      Dog 5bp
B D                     Fugu 1bp

Alignment block 9 of 509 in window, 25161023 - 25161026, 4 bps 
B D                     Human  ca-----ag
B D                     Chimp  ca-----ag
B D                   Gorilla  ca-----ag
B D                 Orangutan  ca-----ag
B D                    Gibbon  ca-----ag
B D                    Rhesus  ca-----ag
B D       Crab-eating macaque  ca-----ag
B D                    Baboon  ca-----ag
B D              Green monkey  ca-----ag
B D                  Marmoset  ca-----ag
B D           Squirrel monkey  ca-----ag
B D                  Bushbaby  ca-----gg
           Chinese tree shrew  --------g
B D                  Squirrel  --------g
       Lesser Egyptian jerboa  ca------g
                 Prairie vole  --------g
B D           Chinese hamster  --------g
               Golden hamster  --------g
B D                     Mouse  --------g
B D                       Rat  --------g
                   Chinchilla  --------g
             Brush-tailed rat  --------g
B D                      Pika  --------g
B D                       Pig  gg-------
B D                    Alpaca  gc------g
               Bactrian camel  ga------g
B D                   Dolphin  gg-------
                 Killer whale  gg-------
             Tibetan antelope  gc-------
B D                       Cow  gc-------
B D                     Sheep  gc-------
                Domestic goat  gc-------
B D                     Horse  gc----ggg
B D          White rhinoceros  gc----ggg
B D                       Cat  ga-----ag
B D                       Dog  ga----ggg
B D                   Ferret   ga-------
B D                     Panda  ga----ggg
               Pacific walrus  ga----ggg
                 Weddell seal  ga----ggg
             Black flying-fox  --------g
B D                   Megabat  ga-----gg
                Big brown bat  --------g
  D          Little brown bat  --------g
B D                  Elephant  ga--aaagg
          Cape elephant shrew  -----aagg
B D                   Manatee  gaggagagg
             Cape golden mole  -----gagg
                     Aardvark  gaggagagg
B D                 Armadillo  ggggagagg
B D                   Opossum  ggagaagaa
B D           Tasmanian devil  gg-gcagaa
B D                   Wallaby  ggagcagaa
  D              Saker falcon  --actaaag
  D          Peregrine falcon  --actaaag
B D        American alligator  --agtgaag
  D           Green seaturtle  --agtgaaa
  D  Chinese softshell turtle  --agtgaaa
  D    Spiny softshell turtle  --agtgaaa
B D                      Fugu  -----aacg
           Southern platyfish  -----catg
             Star-nosed mole  ---------
B D                  Hedgehog  ---------
B D                     Shrew  =========
                 Zebra mbuna  =========
         Pundamilia nyererei  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D              Nile tilapia  =========
    Mexican tetra (cavefish)  =========
                 Spotted gar  =========
B D                Coelacanth  =========
B D                 Zebrafish  =========
B D                Budgerigar  =========
  D               Rock pigeon  =========
B D                    Medaka  =========
  D              Mallard duck  =========
B D                 Tetraodon  =========
      Yellowbelly pufferfish  =========
B D                   Chicken  =========
B D                    Turkey  =========
B D             X. tropicalis  =========
  D            Painted turtle  =========
B D              Atlantic cod  =========
B D                    Lizard  =========
B D               Stickleback  =========
B D                Guinea pig  =========
B D            Naked mole-rat  ---------
B D                  Platypus  =========
        David's myotis (bat)  NNNNNNNNN
B D                    Rabbit  ---------
B D                    Tenrec  =========

Inserts between block 9 and 10 in window
  D             Saker falcon 9bp
  D         Peregrine falcon 9bp
B D       American alligator 14bp
  D          Green seaturtle 12bp
  D Chinese softshell turtle 12bp
  D   Spiny softshell turtle 12bp

Alignment block 10 of 509 in window, 25161027 - 25161039, 13 bps 
B D                     Human  ggg--ctttggggtc------------------
B D                     Chimp  ggg--ctttggggtc------------------
B D                   Gorilla  ggg--ctttggggtc------------------
B D                 Orangutan  ggg--ctttggggtc------------------
B D                    Gibbon  gag--ctttgggatc------------------
B D                    Rhesus  ggg--ctttggggtc------------------
B D       Crab-eating macaque  ggg--ctttggggtc------------------
B D                    Baboon  ggg--ctttggggtc------------------
B D              Green monkey  ggg--ctttggggtc------------------
B D                  Marmoset  ggg--ctttggggtc------------------
B D           Squirrel monkey  ggg--ctttggggtc------------------
B D                  Bushbaby  gtg--ctttagggac------------------
           Chinese tree shrew  ggt--cttcagggac------------------
B D                  Squirrel  ggg--ctttaggatg------------------
       Lesser Egyptian jerboa  ggg--ctctcgggcg------------------
                 Prairie vole  ggg---ctcggggtg------------------
B D           Chinese hamster  gag---cttggagtg------------------
               Golden hamster  gag---cttggagtg------------------
B D                     Mouse  ggg--ccttggaatg------------------
B D                       Rat  ggg--ccttggagtg------------------
                   Chinchilla  ggg---ctgcgggcg------------------
             Brush-tailed rat  gag---ctgcgggga------------------
B D                    Rabbit  ------------gcg------------------
B D                      Pika  ccg---ccccgcgcg------------------
B D                       Pig  -----ctttggggtc------------------
B D                    Alpaca  gag--ctttagggtt------------------
               Bactrian camel  gag--ctttagggtt------------------
B D                   Dolphin  -----ctttggggtc------------------
                 Killer whale  -----ctttggggtc------------------
             Tibetan antelope  -----cttcggggtc------------------
B D                       Cow  -----cttcagggtc------------------
B D                     Sheep  -----cttcggggtc------------------
                Domestic goat  -----cttcggggtc------------------
B D                     Horse  ga----cttcgggcc------------------
B D          White rhinoceros  g-----cgtagggcc------------------
B D                       Cat  ggg--ccttagggtc------------------
B D                       Dog  ggg--ccttc-cgtg------------------
B D                   Ferret   -----------ggtc------------------
B D                     Panda  ggg--ccttagggtc------------------
               Pacific walrus  ggg--ccttagggtc------------------
                 Weddell seal  ggg--ccttagggtc------------------
             Black flying-fox  gag--ctttagggtc------------------
B D                   Megabat  gag--ctttagggtc------------------
                Big brown bat  ggg--ttcgggggtc------------------
  D          Little brown bat  ggg--ctcaggggcc------------------
B D                  Elephant  tgg--ctttggggcc------------------
          Cape elephant shrew  tga------------------------------
B D                   Manatee  ggg--ctttggggcc------------------
             Cape golden mole  agg----------cc------------------
                     Aardvark  gggggctctgcggcc------------------
B D                 Armadillo  agg-gctctggggag------------------
B D                   Opossum  ggg--ccttggcggc------------------
B D           Tasmanian devil  ggg--aactggggcc------------------
B D                   Wallaby  atg--actcagggat------------------
  D              Saker falcon  ggg--tagcgg----------------------
  D          Peregrine falcon  ggg--tagcgg----------------------
B D        American alligator  gga--tcgtgaagct------------------
  D           Green seaturtle  gga--tcttgaagct------------------
  D            Painted turtle  gga--tcttgaagct------------------
  D  Chinese softshell turtle  ggc--tcttgaagct------------------
  D    Spiny softshell turtle  gga--tcttgaagct------------------
B D                      Fugu  ----------gaaccgtcatcatccctgaaccc
           Southern platyfish  ----------gagcca----------tggatat
             Star-nosed mole  ---------------------------------
B D                  Hedgehog  ---------------------------------
B D                     Shrew  =================================
                 Zebra mbuna  =================================
         Pundamilia nyererei  =================================
       Burton's mouthbreeder  =================================
         Princess of Burundi  =================================
B D              Nile tilapia  =================================
    Mexican tetra (cavefish)  =================================
                 Spotted gar  =================================
B D                Coelacanth  =================================
B D                 Zebrafish  =================================
B D                Budgerigar  =================================
  D               Rock pigeon  =================================
B D                    Medaka  =================================
  D              Mallard duck  =================================
B D                 Tetraodon  =================================
      Yellowbelly pufferfish  =================================
B D                   Chicken  =================================
B D                    Turkey  =================================
B D             X. tropicalis  =================================
B D              Atlantic cod  =================================
B D                    Lizard  =================================
B D               Stickleback  =================================
B D                Guinea pig  =================================
B D            Naked mole-rat  ---------------------------------
B D                  Platypus  =================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Tenrec  =================================

Inserts between block 10 and 11 in window
            Brush-tailed rat 1bp

Alignment block 11 of 509 in window, 25161040 - 25161041, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
           Chinese tree shrew  gc
B D                  Squirrel  ga
       Lesser Egyptian jerboa  ca
                   Chinchilla  ga
             Brush-tailed rat  gg
B D                       Pig  gg
B D                    Alpaca  ga
               Bactrian camel  ga
B D                   Dolphin  ga
                 Killer whale  ga
             Tibetan antelope  aa
B D                       Cow  aa
B D                     Sheep  aa
                Domestic goat  aa
B D                     Horse  ga
B D          White rhinoceros  ga
B D                       Cat  ga
B D                       Dog  ga
B D                   Ferret   ga
B D                     Panda  ga
               Pacific walrus  ga
                 Weddell seal  ga
             Black flying-fox  ga
B D                   Megabat  ga
                Big brown bat  gc
  D          Little brown bat  gc
B D                  Elephant  gg
B D                   Manatee  gg
             Cape golden mole  gg
                     Aardvark  gg
B D                 Armadillo  ga
B D                   Opossum  tg
B D           Tasmanian devil  ta
B D                   Wallaby  gg
B D        American alligator  a-
  D           Green seaturtle  aa
  D            Painted turtle  aa
  D  Chinese softshell turtle  aa
  D    Spiny softshell turtle  aa
B D             X. tropicalis  ga
B D                      Fugu  gc
           Southern platyfish  ga
             Star-nosed mole  --
              Golden hamster  --
B D                  Hedgehog  --
B D                       Rat  --
B D                     Shrew  ==
B D                     Mouse  --
                 Zebra mbuna  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D          Peregrine falcon  --
  D              Saker falcon  --
    Mexican tetra (cavefish)  ==
                 Spotted gar  ==
B D                Coelacanth  ==
B D                 Zebrafish  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
B D                    Medaka  ==
  D              Mallard duck  ==
B D                 Tetraodon  ==
      Yellowbelly pufferfish  ==
B D                   Chicken  ==
B D                    Turkey  ==
B D              Atlantic cod  ==
B D                    Lizard  ==
B D               Stickleback  ==
B D                Guinea pig  ==
B D            Naked mole-rat  --
                Prairie vole  --
         Cape elephant shrew  --
B D           Chinese hamster  --
B D                  Platypus  ==
        David's myotis (bat)  NN
B D                    Rabbit  --
B D                      Pika  --
B D                    Tenrec  ==

Inserts between block 11 and 12 in window
B D            X. tropicalis 1bp

Alignment block 12 of 509 in window, 25161042 - 25161044, 3 bps 
B D                     Human  c-c--t
B D                     Chimp  c-c--t
B D                   Gorilla  c-c--t
B D                 Orangutan  c-c--t
B D                    Gibbon  c-c--t
B D                    Rhesus  c-c--t
B D       Crab-eating macaque  c-c--t
B D                    Baboon  c-c--t
B D              Green monkey  c-c--t
B D                  Marmoset  c-c--t
B D           Squirrel monkey  c-c--t
B D                  Bushbaby  c-t--t
           Chinese tree shrew  c-t--t
B D                  Squirrel  c-t--t
       Lesser Egyptian jerboa  c-t--t
                   Chinchilla  c-t--g
             Brush-tailed rat  c-t--t
B D                       Pig  c-t--t
B D                    Alpaca  c-t--t
               Bactrian camel  c-t--t
B D                   Dolphin  c-t--t
                 Killer whale  c-t--t
             Tibetan antelope  c-t--t
B D                       Cow  c-t--t
B D                     Sheep  c-c--t
                Domestic goat  c-t--t
B D                     Horse  c-t---
B D          White rhinoceros  c-t--c
B D                       Cat  c-t--t
B D                       Dog  c-t--t
B D                   Ferret   c-t--t
B D                     Panda  c-t--t
               Pacific walrus  c-tccc
                 Weddell seal  c-t--t
             Black flying-fox  c-t---
B D                   Megabat  c-t---
                Big brown bat  c-t---
  D          Little brown bat  c-t---
B D                  Elephant  c-t--t
B D                   Manatee  c-t--t
             Cape golden mole  c-t--t
                     Aardvark  c-t--t
B D                 Armadillo  cgt--c
B D                   Opossum  c-c--t
B D           Tasmanian devil  c-t--t
B D                   Wallaby  c-t--t
  D              Mallard duck  --c--t
B D        American alligator  c-c--t
  D           Green seaturtle  c-t--t
  D            Painted turtle  c-t--t
  D  Chinese softshell turtle  t-c--t
  D    Spiny softshell turtle  t-c--t
B D             X. tropicalis  c-t---
B D                      Fugu  c-t--t
           Southern platyfish  a-a--t
             Star-nosed mole  ------
              Golden hamster  ------
B D                  Hedgehog  ------
B D                       Rat  ------
B D                     Shrew  ======
B D                     Mouse  ------
                 Zebra mbuna  ======
         Pundamilia nyererei  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D          Peregrine falcon  ------
  D              Saker falcon  ------
    Mexican tetra (cavefish)  ======
                 Spotted gar  ======
B D                Coelacanth  ======
B D                 Zebrafish  ======
B D                Budgerigar  ======
  D               Rock pigeon  ======
B D                    Medaka  ======
B D                 Tetraodon  ======
      Yellowbelly pufferfish  ======
B D                   Chicken  ======
B D                    Turkey  ======
B D              Atlantic cod  ======
B D                    Lizard  ======
B D               Stickleback  ======
B D                Guinea pig  ======
B D            Naked mole-rat  ------
                Prairie vole  ------
         Cape elephant shrew  ------
B D           Chinese hamster  ------
B D                  Platypus  ======
        David's myotis (bat)  NNNNNN
B D                    Rabbit  ------
B D                      Pika  ------
B D                    Tenrec  ======

Inserts between block 12 and 13 in window
  D             Mallard duck 3bp

Alignment block 13 of 509 in window, 25161045 - 25161047, 3 bps 
B D                     Human  cct
B D                     Chimp  cct
B D                   Gorilla  cct
B D                 Orangutan  cct
B D                    Gibbon  cct
B D                    Rhesus  ccc
B D       Crab-eating macaque  ccc
B D                    Baboon  ccc
B D              Green monkey  ccc
B D                  Marmoset  ccc
B D           Squirrel monkey  ccc
B D                  Bushbaby  ccc
           Chinese tree shrew  ccc
B D                  Squirrel  ccc
       Lesser Egyptian jerboa  ccc
                   Chinchilla  cct
             Brush-tailed rat  ccc
B D                       Pig  -cc
B D                    Alpaca  ccc
               Bactrian camel  ccc
B D                   Dolphin  ccc
                 Killer whale  ccc
             Tibetan antelope  tcc
B D                       Cow  tcc
B D                     Sheep  tcc
                Domestic goat  tcc
B D                     Horse  tcc
B D          White rhinoceros  ccc
B D                       Cat  cct
B D                       Dog  ccc
B D                   Ferret   cct
B D                     Panda  cct
               Pacific walrus  ccc
                 Weddell seal  ccc
             Black flying-fox  tcc
B D                   Megabat  tcc
                Big brown bat  tcg
  D          Little brown bat  tcc
B D                  Elephant  cc-
B D                   Manatee  cc-
             Cape golden mole  cc-
                     Aardvark  tc-
B D                 Armadillo  cc-
B D                   Opossum  tcc
B D           Tasmanian devil  ctc
B D                   Wallaby  cct
  D              Saker falcon  -cg
  D          Peregrine falcon  -cg
  D              Mallard duck  -cg
B D                    Turkey  -cg
B D        American alligator  cct
B D             X. tropicalis  -ct
B D                      Fugu  cct
           Southern platyfish  ccc
             Star-nosed mole  ---
              Golden hamster  ---
B D                  Hedgehog  ---
B D                       Rat  ---
B D                     Shrew  ===
B D                     Mouse  ---
                 Zebra mbuna  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
    Mexican tetra (cavefish)  ===
                 Spotted gar  ===
B D                Coelacanth  ===
B D                 Zebrafish  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
B D                    Medaka  ===
B D                 Tetraodon  ===
  D  Chinese softshell turtle  ---
      Yellowbelly pufferfish  ===
B D                   Chicken  ===
  D            Painted turtle  ---
B D              Atlantic cod  ===
B D                    Lizard  ===
B D               Stickleback  ===
B D                Guinea pig  ===
B D            Naked mole-rat  ---
                Prairie vole  ---
         Cape elephant shrew  ---
B D           Chinese hamster  ---
B D                  Platypus  ===
  D    Spiny softshell turtle  ---
  D           Green seaturtle  ---
        David's myotis (bat)  NNN
B D                    Rabbit  ---
B D                      Pika  ---
B D                    Tenrec  ===

Inserts between block 13 and 14 in window
                  Chinchilla 9bp
            Brush-tailed rat 9bp
B D                  Ferret  1bp
B D                  Opossum 3bp
B D          Tasmanian devil 3bp
B D                  Wallaby 3bp
  D             Mallard duck 1bp
B D                   Turkey 1bp
B D            X. tropicalis 1bp

Alignment block 14 of 509 in window, 25161048 - 25161053, 6 bps 
B D                     Human  -ggggga
B D                     Chimp  -ggggga
B D                   Gorilla  -ggggga
B D                 Orangutan  --gggga
B D                    Gibbon  -ggggga
B D                    Rhesus  -tgggga
B D       Crab-eating macaque  -tgggga
B D                    Baboon  -tgagga
B D              Green monkey  -tgggga
B D                  Marmoset  -cgggga
B D           Squirrel monkey  -cgggga
B D                  Bushbaby  --ggaga
           Chinese tree shrew  -cggggg
B D                  Squirrel  -ggagga
                   Chinchilla  -gcgggc
             Brush-tailed rat  -ccggcc
B D                       Pig  --ggggt
B D                    Alpaca  --aggaa
               Bactrian camel  --aggaa
B D                   Dolphin  --aggga
                 Killer whale  --aggga
             Tibetan antelope  --gcgga
B D                       Cow  --gcgga
B D                     Sheep  --gcgga
                Domestic goat  --gcgga
B D                     Horse  --gggga
B D          White rhinoceros  --gggga
B D                       Cat  --gggaa
B D                       Dog  --gggaa
B D                   Ferret   -ggggga
B D                     Panda  --cggaa
               Pacific walrus  --gggga
                 Weddell seal  --gggga
             Black flying-fox  --gagga
B D                   Megabat  --gggga
                Big brown bat  --ggtgg
  D          Little brown bat  --ggg--
B D                     Shrew  ---gggg
              Star-nosed mole  ---ggga
B D                  Elephant  -caggga
          Cape elephant shrew  --ggggc
B D                   Manatee  -cgaaga
             Cape golden mole  -cggaga
                     Aardvark  -caggca
B D                 Armadillo  -caggga
  D               Rock pigeon  --ggggg
  D              Saker falcon  --ggggc
  D          Peregrine falcon  --ggggc
  D                    Parrot  --ggggt
  D             Scarlet macaw  --ggggt
  D              Mallard duck  ---gggc
B D                    Turkey  ---gggg
B D        American alligator  -cgggga
B D             X. tropicalis  -ggtgga
B D                      Fugu  ccgggg-
           Southern platyfish  tcggag-
              Golden hamster  -------
B D                  Hedgehog  -------
B D                       Rat  -------
B D                     Mouse  -------
                 Zebra mbuna  =======
         Pundamilia nyererei  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
    Mexican tetra (cavefish)  =======
                 Spotted gar  =======
B D                Coelacanth  =======
B D                 Zebrafish  =======
B D                Budgerigar  =======
B D                    Medaka  =======
B D                 Tetraodon  =======
  D  Chinese softshell turtle  -------
      Yellowbelly pufferfish  =======
B D                   Chicken  =======
  D            Painted turtle  -------
B D              Atlantic cod  =======
B D                    Lizard  =======
B D               Stickleback  =======
B D                Guinea pig  =======
B D            Naked mole-rat  -------
                Prairie vole  -------
B D           Chinese hamster  -------
B D                   Wallaby  =======
B D           Tasmanian devil  =======
B D                  Platypus  =======
  D    Spiny softshell turtle  -------
  D           Green seaturtle  -------
        David's myotis (bat)  NNNNNNN
B D                    Rabbit  -------
B D                   Opossum  =======
B D                      Pika  -------
      Lesser Egyptian jerboa  -------
B D                    Tenrec  =======

Inserts between block 14 and 15 in window
               Big brown bat 8bp
  D              Rock pigeon 6bp
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
  D             Mallard duck 4bp
B D                   Turkey 4bp
B D       American alligator 10bp

Alignment block 15 of 509 in window, 25161054 - 25161064, 11 bps 
B D                     Human  gg-gtagcc----ctg----
B D                     Chimp  gg-gtagcc----ccg----
B D                   Gorilla  gg-gtagcc----ccg----
B D                 Orangutan  gc-gtagcc----ccg----
B D                    Gibbon  gg-gtagcc----ccg----
B D                    Rhesus  gg-gtagcc----cca----
B D       Crab-eating macaque  gg-gtagcc----cca----
B D                    Baboon  gg-gtagcc----cca----
B D              Green monkey  gg-gtag-c----cca----
B D                  Marmoset  ag-gaagct----ccg----
B D           Squirrel monkey  ag-gaagcc----ccg----
B D                  Bushbaby  ga-gaagcc----cta----
           Chinese tree shrew  ggagaagac----ccc----
B D                  Squirrel  ga-gaagcc----cct----
       Lesser Egyptian jerboa  ca-gaag-c----cg-----
                 Prairie vole  -a-gaagac----cc-----
B D           Chinese hamster  -c-gaagac----cc-----
               Golden hamster  -a-gaagac----cc-----
B D                     Mouse  -a-gaagac----cc-----
B D                       Rat  -a-gaagac----cc-----
                   Chinchilla  gg-gcaggcccgggc-----
             Brush-tailed rat  gg-cgggat----gc-----
B D                    Rabbit  -------------gc-----
B D                      Pika  -------------gc-----
B D                       Pig  ga-gaggcg----cct----
B D                    Alpaca  ga-gaagcc----cct----
               Bactrian camel  ga-gaagcc----cct----
B D                   Dolphin  ga-gaag-c----cct----
                 Killer whale  ga-gaag-c----cct----
             Tibetan antelope  ga-gaggcc----cct----
B D                       Cow  ga-gaggcc----cct----
B D                     Sheep  ga-gaggcc----cct----
                Domestic goat  ga-gaggcc----cct----
B D                     Horse  ga-gcag-c----ccg----
B D          White rhinoceros  ga-gaagcc----cct----
B D                       Cat  ga-gaagcc----tct----
B D                       Dog  ga-gaagcc----tcc----
B D                   Ferret   ga-gaagcc----tct----
B D                     Panda  ga-gaagcc----tct----
               Pacific walrus  ca-gaagcc----tgg----
                 Weddell seal  ga-gaagcc----tgg----
             Black flying-fox  gg-gaagcc----cct----
B D                   Megabat  gg-gaagcc----cct----
                Big brown bat  gg-gaggcc----ccg----
  D          Little brown bat  ga-gaggcc----c------
B D                     Shrew  ga-ggggtg----ctg----
              Star-nosed mole  gg-gcgacc----ctg----
B D                  Elephant  at-gcagcc----cca----
          Cape elephant shrew  gc-gcggcc----gct----
B D                   Manatee  aa-gaagcc----cca----
             Cape golden mole  ga-gaagcc----ccc----
                     Aardvark  gt-gcagcc----cca----
B D                 Armadillo  ga-caagcc----cct----
B D                   Opossum  ta-gagatc----cta----
B D           Tasmanian devil  ta--aaaac----cta----
B D                   Wallaby  ta-gaaagc----cta----
  D               Rock pigeon  -g-gacgcc----tct----
  D              Saker falcon  -g-gaggcc----cct----
  D          Peregrine falcon  -g-gaggcc----cct----
B D                Budgerigar  -g-gatgcc----cct----
  D                    Parrot  -g-gtcgcc----cct----
  D             Scarlet macaw  -g-gatgcc----cct----
  D              Mallard duck  -g-gtggct----gc-----
B D                    Turkey  -g-tgggct----gg-----
B D        American alligator  gg-tcagcc----ccg----
  D           Green seaturtle  ---gggtct----cct----
  D            Painted turtle  ---gggtct----cct----
  D  Chinese softshell turtle  ---gggtct----ccg----
  D    Spiny softshell turtle  ---gggtct----ccg----
B D                    Lizard  -g-ggcacc----cc-----
B D             X. tropicalis  ----acgt------------
B D                      Fugu  -----gctt----tcccacg
           Southern platyfish  -----cgtc----tcat---
B D                  Hedgehog  --------------------
                 Zebra mbuna  ====================
         Pundamilia nyererei  ====================
       Burton's mouthbreeder  ====================
         Princess of Burundi  ====================
B D              Nile tilapia  ====================
    Mexican tetra (cavefish)  ====================
                 Spotted gar  ====================
B D                Coelacanth  ====================
B D                 Zebrafish  ====================
B D                    Medaka  ====================
B D                 Tetraodon  ====================
      Yellowbelly pufferfish  ====================
B D                   Chicken  ====================
B D              Atlantic cod  ====================
B D               Stickleback  ====================
B D                Guinea pig  ====================
B D            Naked mole-rat  --------------------
B D                  Platypus  ====================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNN
B D                    Tenrec  ====================

Inserts between block 15 and 16 in window
              Bactrian camel 1bp
B D                    Shrew 11bp
  D              Rock pigeon 3bp
  D             Saker falcon 3bp
  D         Peregrine falcon 3bp
B D               Budgerigar 3bp
  D                   Parrot 3bp
  D            Scarlet macaw 3bp
  D             Mallard duck 3bp
B D       American alligator 1bp
  D          Green seaturtle 4bp
  D           Painted turtle 4bp
  D Chinese softshell turtle 4bp
  D   Spiny softshell turtle 4bp
B D                   Lizard 2bp
B D            X. tropicalis 2bp

Alignment block 16 of 509 in window, 25161065 - 25161067, 3 bps 
B D                     Human  -ggg
B D                     Chimp  -ggg
B D                   Gorilla  -ggg
B D                 Orangutan  -ggg
B D                    Gibbon  -ggg
B D                    Rhesus  -ggg
B D       Crab-eating macaque  -ggg
B D                    Baboon  -ggg
B D              Green monkey  -ggt
B D                  Marmoset  -ggg
B D           Squirrel monkey  -ggg
B D                  Bushbaby  -gtg
           Chinese tree shrew  -ggg
B D                  Squirrel  -gcg
B D                       Pig  -g--
B D                    Alpaca  -g--
               Bactrian camel  -g--
B D                   Dolphin  -g--
                 Killer whale  -g--
             Tibetan antelope  -g--
B D                       Cow  -g--
B D                     Sheep  -g--
                Domestic goat  -g--
B D                     Horse  -gg-
B D          White rhinoceros  -cg-
B D                       Cat  -gg-
B D                       Dog  -gg-
B D                   Ferret   -gg-
B D                     Panda  -gg-
               Pacific walrus  -gg-
                 Weddell seal  -gg-
             Black flying-fox  -tg-
B D                   Megabat  -tg-
                Big brown bat  -gg-
  D          Little brown bat  -gg-
B D                     Shrew  -gg-
              Star-nosed mole  -gg-
B D                 Armadillo  -ggg
B D                   Opossum  -ggt
B D           Tasmanian devil  -aga
B D                   Wallaby  -ggg
  D               Rock pigeon  -gc-
  D              Saker falcon  -gc-
  D          Peregrine falcon  -gc-
B D                Budgerigar  -gc-
  D                    Parrot  -gc-
  D             Scarlet macaw  -gc-
  D              Mallard duck  -gc-
B D                   Chicken  -gc-
B D                    Turkey  -gc-
B D        American alligator  -gc-
  D           Green seaturtle  -ga-
  D            Painted turtle  -ga-
  D  Chinese softshell turtle  -ga-
  D    Spiny softshell turtle  -ga-
B D                    Lizard  -ac-
B D             X. tropicalis  -g--
B D                      Fugu  tgg-
           Southern platyfish  tgg-
              Golden hamster  ----
B D                  Hedgehog  ----
B D                       Rat  ----
B D                     Mouse  ----
                 Zebra mbuna  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
    Mexican tetra (cavefish)  ====
                 Spotted gar  ====
B D                Coelacanth  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
B D                 Tetraodon  ====
      Yellowbelly pufferfish  ====
B D              Atlantic cod  ====
B D               Stickleback  ====
B D                Guinea pig  ====
            Brush-tailed rat  ----
B D            Naked mole-rat  ----
                  Chinchilla  ----
                Prairie vole  ----
         Cape elephant shrew  ----
B D           Chinese hamster  ----
B D                  Platypus  ====
        David's myotis (bat)  NNNN
B D                    Rabbit  ----
B D                      Pika  ----
      Lesser Egyptian jerboa  ----
B D                    Tenrec  ====
                    Aardvark  ----
B D                  Elephant  ----
B D                   Manatee  ----
            Cape golden mole  ----

Inserts between block 16 and 17 in window
B D                  Opossum 11bp
B D          Tasmanian devil 11bp
B D                  Wallaby 11bp
  D              Rock pigeon 1bp
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
  D             Mallard duck 8bp
B D                  Chicken 2bp
B D                   Turkey 8bp
B D       American alligator 1bp
  D          Green seaturtle 38bp
  D           Painted turtle 38bp
  D Chinese softshell turtle 29bp
  D   Spiny softshell turtle 38bp
          Southern platyfish 5bp

Alignment block 17 of 509 in window, 25161068 - 25161068, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  c
           Chinese tree shrew  t
B D                  Squirrel  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
  D          Little brown bat  c
B D                 Armadillo  g
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
B D                      Fugu  c
B D              Nile tilapia  c
           Southern platyfish  c
             Star-nosed mole  -
              Golden hamster  -
B D                  Hedgehog  -
B D                       Rat  -
B D                     Shrew  -
B D                     Mouse  -
                 Zebra mbuna  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  =
                 Spotted gar  =
B D                Coelacanth  =
B D                 Zebrafish  =
  D                    Parrot  =
B D                Budgerigar  =
  D               Rock pigeon  =
B D                    Medaka  =
  D              Mallard duck  =
B D                 Tetraodon  =
  D  Chinese softshell turtle  =
      Yellowbelly pufferfish  =
B D                   Chicken  =
B D                    Turkey  =
B D             X. tropicalis  -
  D            Painted turtle  =
B D              Atlantic cod  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                    Lizard  -
B D               Stickleback  =
B D                Guinea pig  =
            Brush-tailed rat  -
B D            Naked mole-rat  -
                  Chinchilla  -
                Prairie vole  -
         Cape elephant shrew  -
B D           Chinese hamster  -
               Domestic goat  -
B D                     Sheep  -
B D                  Platypus  =
  D    Spiny softshell turtle  =
  D           Green seaturtle  =
B D                       Cow  -
            Tibetan antelope  -
        David's myotis (bat)  N
B D                       Pig  -
B D                    Rabbit  -
B D                      Pika  -
              Bactrian camel  -
B D                    Alpaca  -
      Lesser Egyptian jerboa  -
B D                    Tenrec  =
                    Aardvark  -
B D                  Elephant  -
B D                     Horse  -
B D          White rhinoceros  -
B D                   Manatee  -
                Killer whale  -
B D                   Dolphin  -
            Cape golden mole  -

Inserts between block 17 and 18 in window
B D             Nile tilapia 21bp

Alignment block 18 of 509 in window, 25161069 - 25161070, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  ct
B D           Squirrel monkey  ct
B D                  Bushbaby  cc
           Chinese tree shrew  cc
B D                  Squirrel  cc
B D                       Pig  cc
B D                    Alpaca  cc
               Bactrian camel  cc
B D                   Dolphin  cc
                 Killer whale  cc
             Tibetan antelope  cc
B D                       Cow  cc
B D                     Sheep  cc
                Domestic goat  cc
B D                     Horse  cc
B D          White rhinoceros  cc
B D                       Cat  cc
B D                       Dog  cc
B D                   Ferret   cc
B D                     Panda  cc
               Pacific walrus  cc
                 Weddell seal  cc
             Black flying-fox  cc
B D                   Megabat  cc
                Big brown bat  cc
  D          Little brown bat  cc
B D                  Hedgehog  cc
B D                     Shrew  cc
              Star-nosed mole  cc
B D                 Armadillo  cc
B D                   Opossum  ct
B D           Tasmanian devil  cg
B D                   Wallaby  ct
  D               Rock pigeon  ct
  D              Saker falcon  ct
  D          Peregrine falcon  ct
  D       Collared flycatcher  ct
B D                Budgerigar  ct
  D                    Parrot  ct
  D             Scarlet macaw  ct
  D              Mallard duck  c-
B D                   Chicken  g-
B D                    Turkey  c-
B D        American alligator  ct
  D           Green seaturtle  ct
  D            Painted turtle  ct
  D  Chinese softshell turtle  ct
  D    Spiny softshell turtle  ct
B D                    Lizard  cc
B D                      Fugu  cc
B D              Nile tilapia  cc
          Princess of Burundi  cc
        Burton's mouthbreeder  cc
                  Zebra mbuna  cc
          Pundamilia nyererei  cc
           Southern platyfish  cc
              Golden hamster  --
B D                       Rat  --
B D                     Mouse  --
    Mexican tetra (cavefish)  ==
                 Spotted gar  ==
B D                Coelacanth  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
B D                 Tetraodon  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  --
B D              Atlantic cod  ==
B D               Stickleback  ==
B D                Guinea pig  ==
            Brush-tailed rat  --
B D            Naked mole-rat  --
                  Chinchilla  --
                Prairie vole  --
         Cape elephant shrew  --
B D           Chinese hamster  --
B D                  Platypus  ==
        David's myotis (bat)  NN
B D                    Rabbit  --
B D                      Pika  --
      Lesser Egyptian jerboa  --
B D                    Tenrec  ==
                    Aardvark  --
B D                  Elephant  --
B D                   Manatee  --
            Cape golden mole  --

Inserts between block 18 and 19 in window
  D             Mallard duck 1bp
B D                  Chicken 1bp
B D                   Turkey 1bp

Alignment block 19 of 509 in window, 25161071 - 25161077, 7 bps 
B D                     Human  c----------------gct------gtg--------------
B D                     Chimp  g----------------gct------gtg--------------
B D                   Gorilla  c----------------tct------gtg--------------
B D                 Orangutan  c----------------gct------gtg--------------
B D                    Gibbon  c----------------gct------gtg--------------
B D                    Rhesus  t----------------gat------gtg--------------
B D       Crab-eating macaque  t----------------gat------gtg--------------
B D                    Baboon  c----------------gct------gtg--------------
B D              Green monkey  c----------------gct------gtg--------------
B D                  Marmoset  c----------------gct------gcg--------------
B D           Squirrel monkey  c----------------gct------gcg--------------
B D                  Bushbaby  c----------------tct------tag--------------
           Chinese tree shrew  t----------------gcg------gcg--------------
B D                  Squirrel  c----------------gct------gca--------------
       Lesser Egyptian jerboa  ------------------cg------gcg--------------
                 Prairie vole  ------------------ct------gca--------------
B D           Chinese hamster  ------------------ct------gcg--------------
               Golden hamster  ------------------ct------gcg--------------
B D                     Mouse  ------------------ct------gca--------------
B D                       Rat  ------------------ct------gca--------------
B D            Naked mole-rat  ---------------------------cg--------------
                   Chinchilla  ------------------cc------gcg--------------
             Brush-tailed rat  ------------------cc------tcg--------------
B D                       Pig  c----------------cct------gaa--------------
B D                    Alpaca  c----------------gcg------gcg--------------
               Bactrian camel  c----------------gcg------gcg--------------
B D                   Dolphin  c----------------act------gcg--------------
                 Killer whale  c----------------act------gcg--------------
             Tibetan antelope  g----------------gct------gcg--------------
B D                       Cow  c----------------gct------gcg--------------
B D                     Sheep  c----------------gct------gcg--------------
                Domestic goat  c----------------gct------gcg--------------
B D                     Horse  c----------------gcc------gcg--------------
B D          White rhinoceros  c----------------gct------gcg--------------
B D                       Cat  c----------------gct------gca--------------
B D                       Dog  c----------------gct------gcg--------------
B D                   Ferret   c----------------gcg------gcg--------------
B D                     Panda  c----------------gct------g-g--------------
               Pacific walrus  c----------------gcg------gcg--------------
                 Weddell seal  c----------------gcg------gcg--------------
             Black flying-fox  c----------------tcg------gtg--------------
B D                   Megabat  c----------------tcg------gtg--------------
                Big brown bat  c----------------gcg------gcg--------------
  D          Little brown bat  c----------------gcg------gcg--------------
B D                  Hedgehog  c----------------ggg-----------------------
B D                     Shrew  c----------------ggtgggggggcg--------------
              Star-nosed mole  c----------------gct------gca--------------
B D                  Elephant  ------------------ct------gcg--------------
          Cape elephant shrew  ------------------tc------g----------------
B D                   Manatee  ------------------ct------gcg--------------
             Cape golden mole  ------------------ct------gcg--------------
                     Aardvark  ------------------ct------gta--------------
B D                 Armadillo  c----------------gcc------gcg--------------
B D                   Opossum  a----------------gct------ctt--------------
B D           Tasmanian devil  a----------------ggt------ttt--------------
B D                   Wallaby  a----------------gct------ttt--------------
  D               Rock pigeon  ccccc--------------------------------------
  D              Saker falcon  c------------------------------------------
  D          Peregrine falcon  c------------------------------------------
  D       Collared flycatcher  c------------------------------------------
B D                Budgerigar  c------------------------------------------
  D                    Parrot  c------------------------------------------
  D             Scarlet macaw  c------------------------------------------
B D        American alligator  c----cccagc--------------------------------
  D           Green seaturtle  c------------------------------------------
  D            Painted turtle  c------------------------------------------
  D  Chinese softshell turtle  c------------------------------------------
  D    Spiny softshell turtle  c------------------------------------------
B D                    Lizard  c----------ttcccg--------------------------
B D             X. tropicalis  -----------------------ctcgta--------------
B D              Nile tilapia  ---------------------------cattat---------t
          Princess of Burundi  ---------------------------cattat---------t
        Burton's mouthbreeder  ---------------------------cattat---------t
                  Zebra mbuna  ---------------------------cattat---------t
          Pundamilia nyererei  ---------------------------cattat---------t
           Southern platyfish  ---------------------------cggcgtgtcggagcgt
    Mexican tetra (cavefish)  ===========================================
                 Spotted gar  ===========================================
B D                Coelacanth  ===========================================
B D                 Zebrafish  ===========================================
B D                    Medaka  ===========================================
  D              Mallard duck  ===========================================
B D                 Tetraodon  ===========================================
      Yellowbelly pufferfish  ===========================================
B D                      Fugu  ===========================================
B D                   Chicken  ===========================================
B D                    Turkey  ===========================================
B D              Atlantic cod  ===========================================
B D               Stickleback  ===========================================
B D                Guinea pig  ===========================================
B D                  Platypus  ===========================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rabbit  -------------------------------------------
B D                      Pika  -------------------------------------------
B D                    Tenrec  ===========================================

Inserts between block 19 and 20 in window
B D                Armadillo 1bp
  D             Saker falcon 2bp
  D         Peregrine falcon 2bp
B D               Budgerigar 2bp
  D                   Parrot 2bp
  D            Scarlet macaw 2bp
B D       American alligator 2bp
B D            X. tropicalis 3bp

Alignment block 20 of 509 in window, 25161078 - 25161078, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  t
           Chinese tree shrew  c
B D                  Squirrel  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
  D          Little brown bat  c
B D                  Elephant  c
B D                   Manatee  c
             Cape golden mole  t
                     Aardvark  c
B D                 Armadillo  c
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
  D               Rock pigeon  c
  D              Saker falcon  c
  D          Peregrine falcon  c
  D       Collared flycatcher  c
B D               Zebra finch  c
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
  D              Mallard duck  c
B D                   Chicken  c
B D                    Turkey  c
B D        American alligator  c
B D                    Lizard  c
B D             X. tropicalis  a
B D                 Zebrafish  c
             Star-nosed mole  -
B D                  Hedgehog  -
B D                     Shrew  -
                 Zebra mbuna  -
         Pundamilia nyererei  -
       Burton's mouthbreeder  -
         Princess of Burundi  -
B D              Nile tilapia  -
    Mexican tetra (cavefish)  =
                 Spotted gar  =
B D                Coelacanth  =
          Southern platyfish  -
B D                    Medaka  =
B D                 Tetraodon  =
  D  Chinese softshell turtle  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
  D            Painted turtle  -
B D              Atlantic cod  =
B D               Stickleback  =
B D                Guinea pig  =
            Brush-tailed rat  -
B D            Naked mole-rat  -
                  Chinchilla  -
         Cape elephant shrew  -
B D                  Platypus  =
  D    Spiny softshell turtle  -
  D           Green seaturtle  -
        David's myotis (bat)  N
B D                    Rabbit  -
B D                      Pika  -
      Lesser Egyptian jerboa  -
B D                    Tenrec  =
B D                       Cat  -

Alignment block 21 of 509 in window, 25161079 - 25161083, 5 bps 
B D                     Human  cc---tca
B D                     Chimp  cc---tca
B D                   Gorilla  cc---tca
B D                 Orangutan  cc---tca
B D                    Gibbon  cc---tca
B D                    Rhesus  cc---tca
B D       Crab-eating macaque  cc---tca
B D                    Baboon  cc---tca
B D              Green monkey  cc---tca
B D                  Marmoset  ct---tca
B D           Squirrel monkey  ct---tca
B D                  Bushbaby  cc---tca
           Chinese tree shrew  c----tca
B D                  Squirrel  cc---tca
       Lesser Egyptian jerboa  -c---tca
                 Prairie vole  cc---tca
B D           Chinese hamster  cc---tca
               Golden hamster  cc---tca
B D                     Mouse  cc---tca
B D                       Rat  cc---tca
B D            Naked mole-rat  cc---tca
                   Chinchilla  cc---tca
             Brush-tailed rat  cc---tca
B D                    Rabbit  gc---tca
B D                      Pika  gc---tca
B D                       Pig  cc---tca
B D                    Alpaca  cc---tca
               Bactrian camel  cc---tca
B D                   Dolphin  cc---tca
                 Killer whale  cc---tca
             Tibetan antelope  cc---tca
B D                       Cow  cc---tca
B D                     Sheep  cc---tca
                Domestic goat  cc---tca
B D                     Horse  cc---tca
B D          White rhinoceros  cc---tca
B D                       Cat  cg---tca
B D                       Dog  cc---tca
B D                   Ferret   cc---tca
B D                     Panda  cc---tca
               Pacific walrus  cc---tca
                 Weddell seal  cc---tca
             Black flying-fox  cc---tca
B D                   Megabat  cc---tca
                Big brown bat  cc---tca
  D          Little brown bat  cc---tca
B D                  Hedgehog  -c---tca
B D                     Shrew  cc---tca
              Star-nosed mole  cc---cta
B D                  Elephant  cc---tca
          Cape elephant shrew  -c---tca
B D                   Manatee  cc---tca
             Cape golden mole  cc---tca
                     Aardvark  cc---tca
B D                 Armadillo  cc---tca
B D                   Opossum  cc---tca
B D           Tasmanian devil  cc---tca
B D                   Wallaby  cc---tca
  D               Rock pigeon  ca---tca
  D              Saker falcon  ca---tca
  D          Peregrine falcon  ca---tca
  D       Collared flycatcher  ca---tca
B D               Zebra finch  cg---tca
B D                Budgerigar  ca---tca
  D                    Parrot  ca---tca
  D             Scarlet macaw  ca---tca
  D              Mallard duck  cggccccg
B D                   Chicken  tg--ctca
B D                    Turkey  cg--ctca
B D        American alligator  ct---tta
  D           Green seaturtle  --acctta
  D            Painted turtle  --acctta
  D  Chinese softshell turtle  --ccctta
  D    Spiny softshell turtle  --ccctta
B D                    Lizard  aa---tta
B D             X. tropicalis  cc---cta
B D              Nile tilapia  -c---tct
          Princess of Burundi  -c---tct
        Burton's mouthbreeder  -c---tct
                  Zebra mbuna  -c---tct
          Pundamilia nyererei  -c---tct
           Southern platyfish  -c---tca
B D              Atlantic cod  -c---cca
B D                 Zebrafish  ac---tca
     Mexican tetra (cavefish)  cc---tca
                  Spotted gar  cc---tta
B D                Coelacanth  ========
B D                    Medaka  ========
B D                 Tetraodon  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D               Stickleback  ========
B D                Guinea pig  ========
B D                  Platypus  ========
        David's myotis (bat)  NNNNNNNN
B D                    Tenrec  ========

Inserts between block 21 and 22 in window
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
          Southern platyfish 337bp
B D             Atlantic cod 2bp

Alignment block 22 of 509 in window, 25161084 - 25161089, 6 bps 
B D                     Human  ctcgcc
B D                     Chimp  ctcgcc
B D                   Gorilla  ctcgcc
B D                 Orangutan  ctcgcc
B D                    Gibbon  ctcgcc
B D                    Rhesus  ctggcc
B D       Crab-eating macaque  ctggcc
B D                    Baboon  ctggcc
B D              Green monkey  ctggcc
B D                  Marmoset  ctggcc
B D           Squirrel monkey  ctggcc
B D                  Bushbaby  ctggcc
           Chinese tree shrew  ctggcc
B D                  Squirrel  ctggcc
       Lesser Egyptian jerboa  ctggcc
                 Prairie vole  ctggcc
B D           Chinese hamster  ctggcc
               Golden hamster  ctggcc
B D                     Mouse  ctggcc
B D                       Rat  ctggcc
B D            Naked mole-rat  ctggcc
                   Chinchilla  ctggcc
             Brush-tailed rat  ctggcc
B D                    Rabbit  cgggcc
B D                      Pika  cgggcc
B D                       Pig  ctggcc
B D                    Alpaca  ctggcc
               Bactrian camel  ctggcc
B D                   Dolphin  ctggcc
                 Killer whale  ctggcc
             Tibetan antelope  ctggcc
B D                       Cow  ctggcc
B D                     Sheep  ctggcc
                Domestic goat  ctggcc
B D                     Horse  ctggcc
B D          White rhinoceros  ctggcc
B D                       Cat  ctggcc
B D                       Dog  ctggcc
B D                   Ferret   ctggcc
B D                     Panda  ctggcc
               Pacific walrus  ctggcc
                 Weddell seal  ctggcc
             Black flying-fox  ctggcc
B D                   Megabat  ctggcc
                Big brown bat  ctggcc
  D          Little brown bat  ctggcc
B D                  Hedgehog  ctggcc
B D                     Shrew  ctggcc
              Star-nosed mole  ctggcc
B D                  Elephant  gtggcc
          Cape elephant shrew  ctggcc
B D                   Manatee  ctggcc
             Cape golden mole  ctggcc
                     Aardvark  ctggcc
B D                 Armadillo  ctggcc
B D                   Opossum  ctgccc
B D           Tasmanian devil  ctggcc
B D                   Wallaby  ttctcc
  D               Rock pigeon  ctgccc
  D              Saker falcon  ctgccc
  D          Peregrine falcon  ctgccc
  D       Collared flycatcher  ctgccc
B D               Zebra finch  ctgccc
B D                Budgerigar  ctgccc
  D                    Parrot  ctgccc
  D             Scarlet macaw  ctgccc
  D              Mallard duck  ctgggt
B D                   Chicken  ctgacc
B D                    Turkey  ctgagc
B D        American alligator  ttggcc
  D           Green seaturtle  ctggcc
  D            Painted turtle  ctggcc
  D  Chinese softshell turtle  ctggcc
  D    Spiny softshell turtle  ctggcc
B D                    Lizard  ttggcc
B D             X. tropicalis  ctgacc
B D                      Fugu  ctcacc
       Yellowbelly pufferfish  ctcacc
B D              Nile tilapia  cacatc
          Princess of Burundi  cacatc
        Burton's mouthbreeder  cacatc
                  Zebra mbuna  cacatc
          Pundamilia nyererei  cacatc
           Southern platyfish  cacatc
B D              Atlantic cod  ctcccc
B D                 Zebrafish  ctcatc
     Mexican tetra (cavefish)  gtggtc
                  Spotted gar  ctggcc
B D                Coelacanth  ======
B D                    Medaka  ======
B D                 Tetraodon  ======
B D               Stickleback  ======
B D                Guinea pig  ======
B D                  Platypus  ======
        David's myotis (bat)  NNNNNN
B D                    Tenrec  ======

Alignment block 23 of 509 in window, 25161090 - 25161091, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  ct
B D                    Gibbon  ct
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
B D           Squirrel monkey  ct
B D                  Bushbaby  ct
           Chinese tree shrew  ct
B D                  Squirrel  ct
       Lesser Egyptian jerboa  ct
                 Prairie vole  ct
B D           Chinese hamster  ct
               Golden hamster  ct
B D                     Mouse  ct
B D                       Rat  ct
B D            Naked mole-rat  ct
                   Chinchilla  ct
             Brush-tailed rat  ct
B D                    Rabbit  ct
B D                      Pika  ct
B D                       Pig  ct
B D                    Alpaca  ct
               Bactrian camel  ct
B D                   Dolphin  ct
                 Killer whale  ct
             Tibetan antelope  ct
B D                       Cow  ct
B D                     Sheep  ct
                Domestic goat  ct
B D                     Horse  ct
B D          White rhinoceros  ct
B D                       Cat  ct
B D                       Dog  ct
B D                   Ferret   ct
B D                     Panda  ct
               Pacific walrus  ct
                 Weddell seal  ct
             Black flying-fox  ct
B D                   Megabat  ct
                Big brown bat  at
  D          Little brown bat  ct
B D                  Hedgehog  ct
B D                     Shrew  ct
              Star-nosed mole  ct
B D                  Elephant  ct
          Cape elephant shrew  ct
B D                   Manatee  ct
             Cape golden mole  ct
                     Aardvark  ct
B D                 Armadillo  ct
B D                   Opossum  ct
B D           Tasmanian devil  ct
B D                   Wallaby  gt
  D               Rock pigeon  ct
  D              Saker falcon  ct
  D          Peregrine falcon  ct
  D       Collared flycatcher  at
B D               Zebra finch  at
B D                Budgerigar  ct
  D                    Parrot  ct
  D             Scarlet macaw  ct
  D              Mallard duck  tt
B D                   Chicken  ct
B D                    Turkey  ct
B D        American alligator  ct
  D           Green seaturtle  tt
  D            Painted turtle  tt
  D  Chinese softshell turtle  ct
  D    Spiny softshell turtle  ct
B D                    Lizard  tt
B D             X. tropicalis  ct
B D                Coelacanth  ct
B D                      Fugu  ct
       Yellowbelly pufferfish  ct
B D              Nile tilapia  tt
          Princess of Burundi  tt
        Burton's mouthbreeder  tt
                  Zebra mbuna  tt
          Pundamilia nyererei  tt
           Southern platyfish  ct
B D              Atlantic cod  t-
B D                 Zebrafish  ct
     Mexican tetra (cavefish)  ct
                  Spotted gar  tt
B D                    Medaka  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
B D                Guinea pig  ==
B D                  Platypus  ==
        David's myotis (bat)  NN
B D                    Tenrec  ==

Inserts between block 23 and 24 in window
B D             Nile tilapia 4bp

Alignment block 24 of 509 in window, 25161092 - 25161098, 7 bps 
B D                     Human  tcttgta
B D                     Chimp  tcttgta
B D                   Gorilla  tcttgta
B D                 Orangutan  tcttgta
B D                    Gibbon  tcttgta
B D                    Rhesus  tcttgta
B D       Crab-eating macaque  tcttgta
B D                    Baboon  tcttgta
B D              Green monkey  tcttgta
B D                  Marmoset  tcttgta
B D           Squirrel monkey  tcttgta
B D                  Bushbaby  tcttgtg
           Chinese tree shrew  ttttgtg
B D                  Squirrel  tcttgtg
       Lesser Egyptian jerboa  tcttgtg
                 Prairie vole  tcttgtg
B D           Chinese hamster  tcttgtg
               Golden hamster  tcttgtg
B D                     Mouse  tcttgtg
B D                       Rat  tcttgtg
B D            Naked mole-rat  tctggtg
                   Chinchilla  tcttgtg
             Brush-tailed rat  tcttgtg
B D                    Rabbit  tcttgtg
B D                      Pika  tcctgtg
B D                       Pig  tcttgtg
B D                    Alpaca  tcttgtg
               Bactrian camel  tcttgtg
B D                   Dolphin  tcttgtg
                 Killer whale  tcttgtg
             Tibetan antelope  tcttgtg
B D                       Cow  tcttgtg
B D                     Sheep  tcttgtg
                Domestic goat  tcttgtg
B D                     Horse  tcttgtg
B D          White rhinoceros  tcttgtg
B D                       Cat  tcttgtg
B D                       Dog  tcttgtg
B D                   Ferret   tcttgtg
B D                     Panda  tcttgtg
               Pacific walrus  tcttgtg
                 Weddell seal  tcttgtg
             Black flying-fox  tcttgtg
B D                   Megabat  tcttgtg
                Big brown bat  tctggtt
  D          Little brown bat  tccggtg
B D                  Hedgehog  tcttgta
B D                     Shrew  tcttgtg
              Star-nosed mole  tcttgtg
B D                  Elephant  tcttgta
          Cape elephant shrew  tcttgtg
B D                   Manatee  tcttgtg
             Cape golden mole  tcttgtg
                     Aardvark  tcttgtg
B D                 Armadillo  tcttgtg
B D                   Opossum  tcttgtg
B D           Tasmanian devil  tgtcagg
B D                   Wallaby  tctcgtg
  D               Rock pigeon  tcttgta
  D              Saker falcon  tcttgta
  D          Peregrine falcon  tcttgta
  D       Collared flycatcher  ccttgga
B D               Zebra finch  ccttggc
B D                Budgerigar  tcttgta
  D                    Parrot  tcttgta
  D             Scarlet macaw  tcttgta
  D              Mallard duck  tggggtg
B D                   Chicken  tcttgta
B D                    Turkey  tcttgta
B D        American alligator  tcttgta
  D           Green seaturtle  tcttgta
  D            Painted turtle  tcttgta
  D  Chinese softshell turtle  tcttgta
  D    Spiny softshell turtle  tcttgta
B D                    Lizard  tcttgta
B D             X. tropicalis  ttttgtg
B D                Coelacanth  tttcatg
B D                      Fugu  -----t-
       Yellowbelly pufferfish  -----t-
B D              Nile tilapia  -----ta
          Princess of Burundi  -----ta
        Burton's mouthbreeder  -----ta
                  Zebra mbuna  -----ta
          Pundamilia nyererei  -----ta
           Southern platyfish  -----tc
B D               Stickleback  tcctctg
B D              Atlantic cod  ---tcta
B D                 Zebrafish  tcctcgg
     Mexican tetra (cavefish)  tcttctg
                  Spotted gar  ttttctg
B D                    Medaka  =======
B D                 Tetraodon  =======
B D                Guinea pig  =======
B D                  Platypus  =======
        David's myotis (bat)  NNNNNNN
B D                    Tenrec  =======

Inserts between block 24 and 25 in window
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
          Southern platyfish 5bp
B D              Stickleback 1bp
B D             Atlantic cod 6bp
                 Spotted gar 3bp

Alignment block 25 of 509 in window, 25161099 - 25161100, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  cg
           Chinese tree shrew  gg
B D                  Squirrel  cg
       Lesser Egyptian jerboa  gg
                 Prairie vole  ag
B D           Chinese hamster  ag
               Golden hamster  cg
B D                     Mouse  cg
B D                       Rat  cg
B D            Naked mole-rat  gg
                   Chinchilla  gg
             Brush-tailed rat  gg
B D                    Rabbit  cg
B D                      Pika  cg
B D                       Pig  gg
B D                    Alpaca  gg
               Bactrian camel  gg
B D                   Dolphin  gg
                 Killer whale  gg
             Tibetan antelope  gg
B D                       Cow  gg
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   gg
B D                     Panda  tg
               Pacific walrus  gg
                 Weddell seal  gg
             Black flying-fox  gg
B D                   Megabat  gg
                Big brown bat  gg
  D          Little brown bat  gg
B D                  Hedgehog  ag
B D                     Shrew  cg
              Star-nosed mole  gg
B D                  Elephant  gg
          Cape elephant shrew  cg
B D                   Manatee  gg
             Cape golden mole  gg
                     Aardvark  gg
B D                 Armadillo  gg
B D                   Opossum  gc
B D           Tasmanian devil  gg
B D                   Wallaby  gg
  D               Rock pigeon  gg
  D              Saker falcon  gg
  D          Peregrine falcon  gg
  D       Collared flycatcher  aa
B D               Zebra finch  aa
B D                Budgerigar  gg
  D                    Parrot  gg
  D             Scarlet macaw  gg
  D              Mallard duck  gg
B D                   Chicken  gg
B D                    Turkey  gg
B D        American alligator  gg
  D           Green seaturtle  gg
  D            Painted turtle  gg
  D  Chinese softshell turtle  gg
  D    Spiny softshell turtle  gg
B D                    Lizard  cg
B D             X. tropicalis  gg
B D                Coelacanth  ac
B D                 Tetraodon  -g
B D                      Fugu  -g
       Yellowbelly pufferfish  -g
           Southern platyfish  -a
B D               Stickleback  -a
B D              Atlantic cod  -g
B D                 Zebrafish  -t
     Mexican tetra (cavefish)  -g
                  Spotted gar  -g
                 Zebra mbuna  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D                    Medaka  ==
B D                Guinea pig  ==
B D                  Platypus  ==
        David's myotis (bat)  NN
B D                    Tenrec  ==

Inserts between block 25 and 26 in window
B D                Tetraodon 1bp
B D                     Fugu 1bp
      Yellowbelly pufferfish 1bp
          Southern platyfish 1bp
B D                Zebrafish 2bp
    Mexican tetra (cavefish) 4bp
                 Spotted gar 1bp

Alignment block 26 of 509 in window, 25161101 - 25161101, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
  D          Little brown bat  c
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
                     Aardvark  c
B D                 Armadillo  c
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
  D               Rock pigeon  c
  D              Saker falcon  t
  D          Peregrine falcon  t
  D       Collared flycatcher  a
B D               Zebra finch  a
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
  D              Mallard duck  a
B D                   Chicken  c
B D                    Turkey  c
B D        American alligator  c
  D           Green seaturtle  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
  D    Spiny softshell turtle  c
B D                    Lizard  g
B D             X. tropicalis  t
B D                Coelacanth  c
B D                 Tetraodon  c
B D                      Fugu  c
       Yellowbelly pufferfish  c
B D                    Medaka  c
B D               Stickleback  c
     Mexican tetra (cavefish)  c
                  Spotted gar  c
                 Zebra mbuna  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D                 Zebrafish  =
          Southern platyfish  =
B D              Atlantic cod  -
B D                Guinea pig  =
B D                  Platypus  =
        David's myotis (bat)  N
B D                    Tenrec  =

Alignment block 27 of 509 in window, 25161102 - 25161128, 27 bps 
B D                     Human  gttcttgatgatggcgtttttgaacag
B D                     Chimp  gttcttgatgatggcgtttttgaacag
B D                   Gorilla  gttcttgatgatggcgtttttgaacag
B D                 Orangutan  gttcttgatgatggcgtttttgaacag
B D                    Gibbon  gttcttgatgatggcgtttttgaacag
B D                    Rhesus  gttcttgatgatggcgtttttgaacag
B D       Crab-eating macaque  gttcttgatgatggcgtttttgaacag
B D                    Baboon  gttcttgatgatggcgtttttgaacag
B D              Green monkey  gttcttgatgatggcgtttttgaacag
B D                  Marmoset  gttcttgataatggcgtttttgaacag
B D           Squirrel monkey  gttcttgataatggcgtttttgaacag
B D                  Bushbaby  gctcttgacaatggcgtttttgaagag
           Chinese tree shrew  gttcttgatgatggcatttctgaacag
B D                  Squirrel  gttcttgatgatggcgttcttgaacag
       Lesser Egyptian jerboa  attcttgatgatggcgttcttgaacag
                 Prairie vole  gttcttgacgatggcgttcttaaagag
B D           Chinese hamster  gttcttgacgatggcgttcttaaagag
               Golden hamster  gttcttgacgatggcattcttaaagag
B D                     Mouse  gttcttgatgatggcgttcttgaagag
B D                       Rat  gttcttgatgatggcgttcttgaagag
B D            Naked mole-rat  gttcttgatgatggcgttcttgaacag
B D                Guinea pig  gttcttgacgatgacgttc-tgaacag
                   Chinchilla  gttcttgatgatggcgttcttgaacag
             Brush-tailed rat  gttcttgatgatggcgttcttgaacag
B D                    Rabbit  gttcttgacgatggcgttgcggaacag
B D                      Pika  gcccttgacgatggcgttcctgaagag
B D                       Pig  gttcttgacgatggcgtttttgaacag
B D                    Alpaca  gttcttcatgatggcatttttgaacag
               Bactrian camel  gttcttgatgatggcgtttttgaacag
B D                   Dolphin  gttcttgatgatggtgtttttgaacag
                 Killer whale  gttcttgatgatggtgtttttgaacag
             Tibetan antelope  gttcttgatgatggcgtttctgaacag
B D                       Cow  gttcttgatgatggcgtttttgaacag
B D                     Sheep  gttcttgatgatggcgtttttgaacag
                Domestic goat  gttcttgatgatggcgtttttgaacag
B D                     Horse  gttcttgatgatggc-gttttgaacag
B D          White rhinoceros  gttcttgatggcg---tttttgaacag
B D                       Cat  gttcttgatgatggcgtttttgaacag
B D                       Dog  gttcttgatgatggcgtttttgaacag
B D                   Ferret   gttcttgatgatggcgtttttgaacag
B D                     Panda  gttcttgatgatggcgtttttgaacag
               Pacific walrus  gttcttgatgatggcgtttttgaacag
                 Weddell seal  gttcttgatgatggcgtttttgaagag
             Black flying-fox  gttcttgatgatggcgtttttgaacag
B D                   Megabat  gttcttgatgatggcgtttttgaacag
                Big brown bat  gttcttgatgatggcgtttttgaacag
  D          Little brown bat  gttcttgatgatggcgtttttgaacag
B D                  Hedgehog  gctcttgatgatggcgtttctgaacag
B D                     Shrew  gttcttgatgatggcgttcctgaacag
              Star-nosed mole  gttcttgatgatggcatttttgaacag
B D                  Elephant  gttcttgatgatggcgtttttgaacag
          Cape elephant shrew  gttcttgatgatggcgtttttgaacag
B D                   Manatee  gttcttgatgatggcgtttttgaacag
             Cape golden mole  gttcttgatgatggcgtttctgaacag
                     Aardvark  gttcttgatgatggcgtttttgaaaag
B D                 Armadillo  ggtcttgatgatggcgtttctgaacag
B D                   Opossum  attcttgatgatggcatttttgaagag
B D           Tasmanian devil  attcttgattatggcatttctgaacag
B D                   Wallaby  atacttg---atggcatttttgaacag
  D               Rock pigeon  gcttttgacgatggcgtttttgaagag
  D              Saker falcon  gcttttgatgatggcatttttgaagag
  D          Peregrine falcon  gcttttgatgatggcatttttgaagag
  D       Collared flycatcher  gcttttcccgatggcgttcttgaagag
B D               Zebra finch  actcttcccgatggcgttcttgaagag
B D                Budgerigar  gctcttgatgatggcgtttttgaagag
  D                    Parrot  gctcttgatgatggtgtttttgaagag
  D             Scarlet macaw  gctcttgatgatggtgtttttgaagag
  D              Mallard duck  g-----gacgaggg----------caa
B D                   Chicken  gcttttgacgatggcgtttttgaacag
B D                    Turkey  gcttttgacgatggcgtttttgaacag
B D        American alligator  gcttttgacgatggcgttcttaaaaag
  D           Green seaturtle  atttttgattatggcattcttaaaaag
  D            Painted turtle  atttttgattatggcattcttaaaaag
  D  Chinese softshell turtle  atttttgattatggcattcttaaagag
  D    Spiny softshell turtle  atttttgattatggcattcttaaaaag
B D                    Lizard  cgtcttgacaatggcgttcttgaaaag
B D             X. tropicalis  gtttttgatgatggcatttttgaaaag
B D                Coelacanth  atccttgatcatgacattcttaaagag
B D                 Tetraodon  tttcttgtctattatggtcctgaagag
B D                      Fugu  gttcttgtctataatgttcctgaagat
       Yellowbelly pufferfish  gttcttgtctataatgttcctgaagat
B D              Nile tilapia  ------------aatgttcctgaagaa
          Princess of Burundi  ------------aatgttcctgaagaa
        Burton's mouthbreeder  ------------aatgttcctgaagaa
                  Zebra mbuna  ------------aatgttcctgaagaa
          Pundamilia nyererei  ------------aatgttcctgaagaa
B D                    Medaka  gtccttgttgatgatgttcttgaagag
           Southern platyfish  --------------tgttcttgaataa
B D               Stickleback  gtccttgaggaaaatgttcctgagcag
B D              Atlantic cod  ----cgtttgaaggtgctcccgaagaa
B D                 Zebrafish  gtctttatgcattacgtttttgaagag
     Mexican tetra (cavefish)  gtctttgttgatgacgtttttgaagag
                  Spotted gar  gtccttaatgatgacgttcttaaagag
B D                  Platypus  ===========================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Tenrec  ===========================

Alignment block 28 of 509 in window, 25161129 - 25161156, 28 bps 
B D                     Human  cgtcaccaggggcgtctggctcttctcg------
B D                     Chimp  cgtcaccaggggcgtctggctcttctcg------
B D                   Gorilla  cgtcaccaggggcgtctggctcttctcg------
B D                 Orangutan  cgtcaccaggggcgtctggcttttctcg------
B D                    Gibbon  cgtcaccaggggcgtctgactcttctcg------
B D                    Rhesus  tgtcaccaggggagtctggctcttctcg------
B D       Crab-eating macaque  tgtcaccaggggagtctggctcttctcg------
B D                    Baboon  tgtcaccaggggagtctggctcttctcg------
B D              Green monkey  tgtcaccaggggagtctggctcttctcg------
B D                  Marmoset  cgtcaccaggggcgtctggctcttctcg------
B D           Squirrel monkey  cgtcaccaggggcgtctggctcttctcg------
B D                  Bushbaby  cgtcaccaggggcgtctggctcttctcc------
           Chinese tree shrew  cgtcaccaggggcgtctggctcttctcg------
B D                  Squirrel  cgtcaccaggggcgtctggctcttctca------
       Lesser Egyptian jerboa  cgtcaccagcggcgtctggctcttctcc------
                 Prairie vole  tgtcactaggggcgtctggctcttctcg------
B D           Chinese hamster  tgtcaccaggggcgtctggctcttctcg------
               Golden hamster  tgtcaccaggggcgtctggctcttctcg------
B D                     Mouse  cgtcaccaggggcgtctggctcttctcg------
B D                       Rat  cgtcaccaggggcgtctggctcttctcg------
B D            Naked mole-rat  cgtcaccagcggcgtctggcccttctcc------
B D                Guinea pig  cgtcaccagcggcgtctggctcttctcc------
                   Chinchilla  cgtcaccagcggcgtctggctcttctcc------
             Brush-tailed rat  cgtcaccagcggcgtctggctcttctcc------
B D                    Rabbit  cgtcaccagcggcgtctggcccttctcc------
B D                      Pika  cgtcaccagcggcgtctgacccttgtcg------
B D                       Pig  cgtgaccaggggcgtctggctcttctcg------
B D                    Alpaca  ggtcaccaggggcgtctggctcttctcc------
               Bactrian camel  ggtcaccaggggcgtctggctcttctcc------
B D                   Dolphin  cgtgaccaggggcgtctggctcttctcg------
                 Killer whale  cgtgaccaggggcgtctggctcttctcg------
             Tibetan antelope  cgtgacaaggggcgtttggctcttctcc------
B D                       Cow  cgtgacaaggggcgtttggctcttctcg------
B D                     Sheep  cgtgacaaggggcgtttggct-------------
                Domestic goat  cgtgacaaggggcgtttggctcttctcc------
B D                     Horse  cgtcacca-gggcgtctggctcttctc-------
B D          White rhinoceros  cgtcaccaggggcgtctggctcttctcg------
B D                       Cat  cgtcaccagaggcgtctggctcttctcc------
B D                       Dog  cgtcaccaggggcgtctggctcctctcc------
B D                   Ferret   cgtcaccaagggggtctggctcttctcg------
B D                     Panda  cgtcaccaggggcgtctggctcttctcg------
               Pacific walrus  cgtcaccaggggggtctggctcttctcg------
                 Weddell seal  cgtcaccaggggggtctggctcttctcg------
             Black flying-fox  cgtcaccaggggcgtctggctcttctcg------
B D                   Megabat  cgtcaccaggggcgtctggctcttctcg------
                Big brown bat  cgtcaccaggggcgtctggctcttctcc------
  D          Little brown bat  cgtcaccaggggcgtctggctcttctcc------
B D                  Hedgehog  cgtcaccagcggcgtctggctcttctcg------
B D                     Shrew  cgtcaccaggggcgtctggctcttctcg------
              Star-nosed mole  cgtcacgagtggcgtctggctcttctcc------
B D                  Elephant  cgtcaccaggggcgtctggcttttctcg------
          Cape elephant shrew  cgtcaccagcggcgtctggcctttgtcg------
B D                   Manatee  cgtcacgagaggggtctggcttttctca------
             Cape golden mole  cgtcaccaggggcgtctggcttttctcc------
                     Aardvark  cgtcaccaggggcgtctggcttttctca------
B D                 Armadillo  ggtcaccagaggcgtctggcccttctcg------
B D                   Opossum  tgtcatgagaggggtatggctcttctca------
B D           Tasmanian devil  tgtcatgagaggagtatgactcttctca------
B D                   Wallaby  tgtcatgagaggggtatgactcttctca------
B D                  Platypus  cgtgacgagcggcatgggccccctctcc------
  D               Rock pigeon  agtcactagcggggtctggccgtgctcc------
  D              Saker falcon  agtcactagaggggtctggctgtgctcc------
  D          Peregrine falcon  agtcactagaggggtctggctgtgctcc------
  D       Collared flycatcher  cgtcaccagcggcgtccggatcctctcc------
B D               Zebra finch  cgtcaccaacggcgtccggatcctctcg------
B D                Budgerigar  agtcactagaggggtctggctgtgctcc------
  D                    Parrot  agtcactagaggggtctggctgtgctcc------
  D             Scarlet macaw  agtcactagaggggtctggctgtgctcc------
  D              Mallard duck  atccttcacctggggtggg---------------
B D                   Chicken  agtcatcagcggggtctggctgtgctcc------
B D                    Turkey  agtcatcagcggggtctggctgtgctcc------
B D        American alligator  agtcactagaggcgtctggctgtgctct------
  D           Green seaturtle  agtcattaaaggggtctggctgttctcc------
  D            Painted turtle  agtcattaaaggggtctggctgttctcc------
  D  Chinese softshell turtle  agtcattagaggggtctggctgctctct------
  D    Spiny softshell turtle  agtcattagaggggtctggctgctctcc------
B D                    Lizard  agtcactaagggcatgcggctgcgctcg------
B D             X. tropicalis  agtcattagaggtgtctggctccgctca------
B D                Coelacanth  agtcattaagggcttctggctcctctcg------
B D                 Tetraodon  cttggccagctgtctcaga------------cgg
B D                      Fugu  cttgcccatctgtgtcaga------------cgg
       Yellowbelly pufferfish  c--nnnnnnntgtgtcaga------------cgg
B D              Nile tilapia  cttggccagctgcccctgaggtttctcctcccac
          Princess of Burundi  cttggccagctgcccctgaggtttctcctcccac
        Burton's mouthbreeder  cttggccagctgcccctgaggtttctcctcccac
                  Zebra mbuna  cttggccagctgcccctgaggtttctcctcccac
          Pundamilia nyererei  cttggccagctgcccctgaggtttctcctcccac
B D                    Medaka  cgtcaccagtggtttctggcgatcctcctcccag
           Southern platyfish  cttggacagcttttcccgaggtttctcctcccac
B D               Stickleback  cttgtccagctgacctttaggtttcttcctcggc
B D              Atlantic cod  cctggacaggggcttc------ttcacctcccac
B D                 Zebrafish  tgtgagcagtggtttctgagcacgctcgtcccag
     Mexican tetra (cavefish)  cgtcagcagaggtttctggctccgttcatcccag
                  Spotted gar  cgtcaggagtggcttctggctgcgctcgtcccag
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Tenrec  ==================================

Inserts between block 28 and 29 in window
B D               Coelacanth 6bp

Alignment block 29 of 509 in window, 25161157 - 25161167, 11 bps 
B D                     Human  gaggtcatgaa
B D                     Chimp  gaggtcatgaa
B D                   Gorilla  gaggtcatgaa
B D                 Orangutan  gaggtcatgaa
B D                    Gibbon  gaggtcatgaa
B D                    Rhesus  gaggtcatgaa
B D       Crab-eating macaque  gaggtcatgaa
B D                    Baboon  gaggtcatgaa
B D              Green monkey  gaggtcatgaa
B D                  Marmoset  gaggtcatgaa
B D           Squirrel monkey  gaggtcatgaa
B D                  Bushbaby  gaggtcatgaa
           Chinese tree shrew  gacgtcatgaa
B D                  Squirrel  gaggtcatgaa
       Lesser Egyptian jerboa  gagctcatgaa
                 Prairie vole  gaggtcatgaa
B D           Chinese hamster  gaggtcatgaa
               Golden hamster  gaggtcatgaa
B D                     Mouse  gaggtcatgaa
B D                       Rat  gaggtcatgaa
B D            Naked mole-rat  gagctcatgaa
B D                Guinea pig  gagctcatgaa
                   Chinchilla  gagctcatgaa
             Brush-tailed rat  gagctcatgaa
B D                    Rabbit  gacgacatgaa
B D                      Pika  gacgtcatgaa
B D                       Pig  gaggtcatgaa
B D                    Alpaca  gaggtcatgaa
               Bactrian camel  gaggtcatgaa
B D                   Dolphin  gaggtcatgaa
                 Killer whale  gaggtcatgaa
             Tibetan antelope  gagctcttgac
B D                       Cow  gaggtcatgaa
                Domestic goat  gaggtcatgaa
B D                     Horse  gagctcatgaa
B D          White rhinoceros  gagctcatgaa
B D                       Cat  gaggtcatgaa
B D                       Dog  gagctcatgaa
B D                   Ferret   gaggtcatgaa
B D                     Panda  gaggtcatgaa
               Pacific walrus  gaggtcatgaa
                 Weddell seal  gaggtcatgaa
             Black flying-fox  gaggtcatgaa
B D                   Megabat  gaggtcatgaa
                Big brown bat  gagctcatgaa
  D          Little brown bat  gaggtcatgaa
B D                  Hedgehog  gagctcatgaa
B D                     Shrew  gacgacatgaa
              Star-nosed mole  gaggtcatgaa
B D                  Elephant  gaggtcatgaa
          Cape elephant shrew  gagcccatgaa
B D                   Manatee  gaggtcatgaa
             Cape golden mole  gaggtcatgaa
                     Aardvark  gaagtcatgaa
B D                 Armadillo  gtggacatgaa
B D                   Opossum  gagatcatgaa
B D           Tasmanian devil  gaaaccataaa
B D                   Wallaby  gaaaccatgaa
B D                  Platypus  gacgtcatgaa
  D               Rock pigeon  gaggtcatgaa
  D              Saker falcon  gaggtcatgaa
  D          Peregrine falcon  gaggtcatgaa
  D       Collared flycatcher  gggctcatgaa
B D               Zebra finch  gaactcatgaa
           Tibetan ground jay  gagctcatgaa
B D                Budgerigar  gaggtcatgaa
  D                    Parrot  gaggtcatgaa
  D             Scarlet macaw  gaggtcatgaa
  D              Mallard duck  aggaggacgag
B D                   Chicken  aagctcatgaa
B D                    Turkey  aggctcatgaa
B D        American alligator  gaggtcatgaa
  D           Green seaturtle  gatgtcatgaa
  D            Painted turtle  gatgtcatgaa
  D  Chinese softshell turtle  gacgtcatgaa
  D    Spiny softshell turtle  gacgtcatgaa
B D                    Lizard  gaggtcatgaa
B D             X. tropicalis  ggagtcataaa
B D                Coelacanth  gacctcatgaa
B D                 Tetraodon  gtcttcactga
B D                      Fugu  gtcttcattga
       Yellowbelly pufferfish  gtcttcattaa
B D              Nile tilapia  ggcttcataaa
          Princess of Burundi  ggcttcataaa
        Burton's mouthbreeder  ggcttcataaa
                  Zebra mbuna  ggcttcataaa
          Pundamilia nyererei  ggcttcataaa
B D                    Medaka  ctcttcatgaa
           Southern platyfish  agcttcacaaa
B D               Stickleback  tgtctcatggt
B D              Atlantic cod  ggagtcagctg
B D                 Zebrafish  gacttcatgaa
     Mexican tetra (cavefish)  gacttcatgaa
                  Spotted gar  gacttcatgaa
B D                     Sheep  -----------
        David's myotis (bat)  NNNNNNNNNNN
B D                    Tenrec  ===========

Inserts between block 29 and 30 in window
B D                 Bushbaby 3bp

Alignment block 30 of 509 in window, 25161168 - 25161170, 3 bps 
B D                     Human  acc
B D                     Chimp  acc
B D                   Gorilla  acc
B D                 Orangutan  acc
B D                    Gibbon  acc
B D                    Rhesus  gcc
B D       Crab-eating macaque  gcc
B D                    Baboon  gcc
B D              Green monkey  gcc
B D                  Marmoset  gcc
B D           Squirrel monkey  gcc
           Chinese tree shrew  gcc
B D                  Squirrel  gcc
       Lesser Egyptian jerboa  gcc
                 Prairie vole  gcc
B D           Chinese hamster  gcc
               Golden hamster  gcc
B D                     Mouse  gcc
B D                       Rat  gcc
B D            Naked mole-rat  gcc
B D                Guinea pig  gcc
                   Chinchilla  gcc
             Brush-tailed rat  gcc
B D                    Rabbit  gcc
B D                      Pika  gcc
B D                       Pig  gcc
B D                    Alpaca  tcc
               Bactrian camel  gcc
B D                   Dolphin  acc
                 Killer whale  acc
             Tibetan antelope  ccc
B D                       Cow  ccc
                Domestic goat  ccc
B D                     Horse  gcc
B D          White rhinoceros  gcc
B D                       Cat  gcc
B D                       Dog  gcc
B D                   Ferret   gcc
B D                     Panda  gcc
               Pacific walrus  gcc
                 Weddell seal  gcc
             Black flying-fox  gcc
B D                   Megabat  gcc
                Big brown bat  gcc
  D          Little brown bat  gcc
B D                  Hedgehog  gcc
B D                     Shrew  gcc
              Star-nosed mole  gcc
B D                  Elephant  gcc
          Cape elephant shrew  gcc
B D                   Manatee  gcc
             Cape golden mole  gcc
                     Aardvark  gcc
B D                 Armadillo  gcc
B D                   Opossum  gcc
B D           Tasmanian devil  gcc
B D                   Wallaby  gcc
B D                  Platypus  gcc
  D               Rock pigeon  gcc
  D              Saker falcon  gcc
  D          Peregrine falcon  gcc
  D       Collared flycatcher  acc
B D               Zebra finch  tcc
           Tibetan ground jay  tcc
B D                Budgerigar  gcc
  D                    Parrot  gcc
  D             Scarlet macaw  gcc
  D              Mallard duck  gac
B D                   Chicken  gcc
B D                    Turkey  gcc
B D        American alligator  gcc
  D           Green seaturtle  gcc
  D            Painted turtle  gcc
  D  Chinese softshell turtle  gcc
  D    Spiny softshell turtle  gcc
B D                    Lizard  ccc
B D             X. tropicalis  tcc
B D                Coelacanth  gcc
B D                 Tetraodon  ctt
B D                      Fugu  ctt
       Yellowbelly pufferfish  ctt
B D              Nile tilapia  gcc
          Princess of Burundi  gcc
        Burton's mouthbreeder  gcc
                  Zebra mbuna  gcc
          Pundamilia nyererei  gcc
B D                    Medaka  gcc
           Southern platyfish  ccc
B D               Stickleback  gct
B D              Atlantic cod  tcc
B D                 Zebrafish  gcc
     Mexican tetra (cavefish)  gcc
                  Spotted gar  gcc
B D                     Sheep  ---
        David's myotis (bat)  NNN
B D                    Tenrec  ===
B D                  Bushbaby  ===

Alignment block 31 of 509 in window, 25161171 - 25161187, 17 bps 
B D                     Human  gccgtagcgcttgtcct
B D                     Chimp  gccgtagcgcttgtcct
B D                   Gorilla  gccgtagcgcttgtcct
B D                 Orangutan  gccgtagcgcttgtcct
B D                    Gibbon  gccgtagcgcttgtcct
B D                    Rhesus  gccgtagcgcttgtcct
B D       Crab-eating macaque  gccgtagcgcttgtcct
B D                    Baboon  gccgtagcgcttgtcct
B D              Green monkey  gccgtagcgcttgtcct
B D                  Marmoset  gccgtagcgcttgtcct
B D           Squirrel monkey  gccgtagcgcttgtcct
B D                  Bushbaby  gccgtagcgcttgtcct
           Chinese tree shrew  tccgtagcgcttgtcct
B D                  Squirrel  gccgtagcgcttgtcct
       Lesser Egyptian jerboa  gccgtagcgcttgtcct
                 Prairie vole  gccatagcgcttgtcct
B D           Chinese hamster  gccatagcgcttgtcct
               Golden hamster  gccgtagcgcttgtcct
B D                     Mouse  accgtaacgcttgtcct
B D                       Rat  gccgtagcgcttgtcct
B D            Naked mole-rat  gccgtagcgcttgtcct
B D                Guinea pig  gccgtagcgcttgccct
                   Chinchilla  gccgtagcgcttgtcct
             Brush-tailed rat  gccatagcgcttgtcct
B D                    Rabbit  gccgtagcgcttgtcct
B D                      Pika  gccgtagcgcttgtcct
B D                       Pig  gccgtagcgcttgtcct
B D                    Alpaca  gccgtagcgcttgtcct
               Bactrian camel  cccgtagcgtttgtcct
B D                   Dolphin  gccgtagcgcttgtcct
                 Killer whale  gccgtagcgcttgtcct
             Tibetan antelope  gccgtagcgcttgtcct
B D                       Cow  gccgtagcgcttgtcct
B D                     Sheep  ----tagcgcttgtcct
                Domestic goat  gccgtagcgcttgtcct
B D                     Horse  gccgtagcgcttgtcct
B D          White rhinoceros  gccgtagcgcttgtcct
B D                       Cat  gccgtagcgcttgtcct
B D                       Dog  gccgtagcgcttgtcct
B D                   Ferret   gccgtagcgcttgtcct
B D                     Panda  gccgtagcgcttgtcct
               Pacific walrus  gccgtagcgcttgtcct
                 Weddell seal  gccgtagcgcttgtcct
             Black flying-fox  gccgtagcgcttgtcct
B D                   Megabat  gccgtagcgcttgtcct
                Big brown bat  gccgtagcgcttgttct
  D          Little brown bat  gccgtagcgcttgtcct
B D                  Hedgehog  gccgtagcgcttgtcct
B D                     Shrew  gccgtaccgcttgtcct
              Star-nosed mole  gccgtagcgcttgtcct
B D                  Elephant  gccgtagcgcttgtcct
          Cape elephant shrew  gccgtaacgcttgtcct
B D                   Manatee  gccgtagcgcttgtcct
             Cape golden mole  gccatagcgtttgtcct
                     Aardvark  gccgtagcgcttgtcct
B D                 Armadillo  gccgtagcgcttgtcct
B D                   Opossum  accataccgcttatcct
B D           Tasmanian devil  accatatcgcttattcc
B D                   Wallaby  accatacctcttattcc
B D                  Platypus  tccgtagcgcttgtcct
  D               Rock pigeon  cccgtagcgcttgtcct
  D              Saker falcon  cccatagcgcttgtcct
  D          Peregrine falcon  cccatagcgcttgtcct
  D       Collared flycatcher  cccgtaacgtttctcct
B D               Zebra finch  gccgtaacgcttctcct
           Tibetan ground jay  cccgtagcgcttttcct
B D                Budgerigar  cccgtagcgcttgtcct
  D                    Parrot  cccgtagcgcttgtcct
  D             Scarlet macaw  cccgtagcgcttgtcct
  D              Mallard duck  gccgtagcgcttgtcct
B D                   Chicken  gccgtagcgcttgtcct
B D                    Turkey  tccgtagcgcttgtcct
B D        American alligator  gccgtaccgcttgtcca
  D           Green seaturtle  cccgtatcgcttgtctt
  D            Painted turtle  cccgtatcgcttgtctt
  D  Chinese softshell turtle  cccgtatcgcttgtctt
  D    Spiny softshell turtle  cccgtatcgcttgtctt
B D                    Lizard  gccgtaacgcttccgct
B D             X. tropicalis  cccatatctcttatctt
B D                Coelacanth  cccgtaacgcttgttct
B D                 Tetraodon  gtcgttacgtttggaga
B D                      Fugu  cttgctgcgttcggaga
       Yellowbelly pufferfish  gttgctgcgtttggaga
B D              Nile tilapia  gccgttacgtttggatg
          Princess of Burundi  gccgttacgtttggatg
        Burton's mouthbreeder  gccgttacgtttggatg
                  Zebra mbuna  gccgttacgtttggatg
          Pundamilia nyererei  gccgttacgtttggatg
B D                    Medaka  gccatagcgtttactgg
           Southern platyfish  attgttttgtttggatg
B D               Stickleback  gccgttgcgcttggagg
B D              Atlantic cod  gtcgccgcgcttgg---
B D                 Zebrafish  tccatagcgcttgctag
     Mexican tetra (cavefish)  tccgtagcgcttgcttg
                  Spotted gar  cccgtaccgcttgtcct
        David's myotis (bat)  NNNNNNNNNNNNNNNNN
B D                    Tenrec  =================

Inserts between block 31 and 32 in window
B D                    Horse 258bp
B D                  Wallaby 24bp

Alignment block 32 of 509 in window, 25161188 - 25161233, 46 bps 
B D                     Human  tgggc---gggctgccccagcggaagtgctccatcctgtaggggcc---ctc
B D                     Chimp  tgggc---gggctgccccagcggaagtgctccatcctgtaggggcc---ctc
B D                   Gorilla  tgggc---gggctgccccagcggaagtgctccatcctgtaggggcc---ctc
B D                 Orangutan  tgggc---gggctgccccagcggaagtgctccatcctgtaggggcc---ctc
B D                    Gibbon  tgggc---gggctgccccagcggaagtgctccatcctgtaggggcc---ctc
B D                    Rhesus  tgggc---gggctgccccagcggaagtgctccatcctgtaggggcc---ctc
B D       Crab-eating macaque  tgggc---gggctgccccagcggaagtgctccatcctgtaggggcc---ctc
B D                    Baboon  tgggc---gggctgccccagcggaagtgctccatcctgtaggggcc---ctc
B D              Green monkey  tgggc---gggctgccccagcggaagtgctccatcctgtaggggac---ccc
B D                  Marmoset  tgggc---gggctgccccagcggaagtgctccatcctgtacggtcc---ttc
B D           Squirrel monkey  tgggc---gggctgccccagcggaagtgctccatcctgtaggggcc---gtc
B D                  Bushbaby  tgggc---gggctgccccagcggaagtgctccatcctgtagggccc---ctc
           Chinese tree shrew  tgggc---gggctgccccagcggaagtgctccatccgatagggccc---ctc
B D                  Squirrel  tgggc---gggctgccccagcggaagtgctccatgcgataaggccc---gtc
       Lesser Egyptian jerboa  tgggc---gggccgccccagcggaagcgctcctcccggtagggccc---gcc
                 Prairie vole  tgggc---gtgctgccccagcggaagcgctccatccggtagggccc---atc
B D           Chinese hamster  tgggc---gggctgccccagcggaagcgctccatccgatagggccc---gtc
               Golden hamster  tgggc---gggctgccccagcggaagcgctccacccgatagggccc---gtc
B D                     Mouse  tgggc---gggttgctccagcggaagtgctccacccggtagggccc---gtc
B D                       Rat  tgggc---gggttgccccagcggaagtgctccacccgatagggccc---gtc
B D            Naked mole-rat  tgcgc---gggctgccccagcgaaagtgctccatgcgatagggccc---gtc
B D                Guinea pig  tgcgc---ggggtgccccagcggaagtgctccatgcgataggaccc---gtc
                   Chinchilla  tgcgc---ggcgtgccccagcggaagtgctccatgcgatagggccc---gtc
             Brush-tailed rat  tgcgc---ggggtgccccagcggaagtgctccatgcggtagggccc---gtc
B D                    Rabbit  tgggc---cggctgccccagcggaagtgctccatcctgtaggggcc---ctc
B D                      Pika  tgggc---gggctgccccagcgaaagtgctccatgcggtagggccc---gtc
B D                       Pig  tgggc---gggctgccccagcggaagtgctccatcttatagggccc---ttc
B D                    Alpaca  tgggc---gggctgccccagcggaagtgctgcatcttataggggcc---ccc
               Bactrian camel  tgggc---gggctgccccagcggaagtgctgcatcttataggggcc---ccc
B D                   Dolphin  tgggc---gggctgccccagcggaagtgctccatcttatacggccc---ctc
                 Killer whale  tgggc---gggctgccccagcggaagtgctccatcttatacggccc---ctc
             Tibetan antelope  tgggc---gggctgccccagcggaagtgttccatcttgtagggccc---cga
B D                       Cow  tgggc---gggctgccccagcggaagtgttccatcttatagggccc---cga
B D                     Sheep  tgggc---gggctgccccagcggaagtgttccatcttatagggccc---cga
                Domestic goat  tgggc---gggctgccccagcggaagtgttccatcttatagggccc---cga
B D          White rhinoceros  tgggc---gggctgccccagcggaaatgctccatcttatagggccc---ctc
B D                       Cat  tgggc---gggctgccccagcggaaatgctccatcttatagggccc---ttc
B D                       Dog  tgggc---gggctgccccagcggaagtgctccatcttgtagggccc---gtc
B D                   Ferret   tgggc---gggctgccccagcggaagtgctccatcttgtagggccc---gac
B D                     Panda  tgggc---gggctgccccagcggaagtgctccatcttatagggccc---gtc
               Pacific walrus  tgggc---gggctgccccagcggaagtgctccatcttatagggccc---acc
                 Weddell seal  tgggc---gggctgccccagcggaagtgctccatcttatagggccc---gcc
             Black flying-fox  tgggc---gggctgccccagcggaagtgctccatcctatagggccc---ctc
B D                   Megabat  tgggc---gggctgccccagcggaagtgctccatcctatagggccc---ctc
                Big brown bat  tgggc---cggctgccccagcggaagtgctccatcttgtagggccc---ctc
  D          Little brown bat  tgggc---gggctgccccagcggaagtgctccatccggtagggccc---ctc
B D                  Hedgehog  tgcgc---gggctgccccagcggaagtgctccatcttgtagggtcc---gcc
B D                     Shrew  tgggc---gggctgccccagcggaagtgctccatcttgtagggcgt---ccc
              Star-nosed mole  tgggc---gggctgccccagcggaaatgcttcatctggtaggcccc---gtc
B D                  Elephant  tggcg---gggctgccccagcggaagtgctccatcttgtagggccc---ctc
          Cape elephant shrew  tgggc---gggctgccccagcggaagtgctccatgcggtacgggcc---gtc
B D                   Manatee  tgggc---gggctgccccaacggaagtgctccatcttatagggccc---ctc
             Cape golden mole  taggc---gggctgccccagcggaaatgctccattttataaggccc---gtc
                     Aardvark  tgggc---gggctgccccagcggaagtgctccatcttatagggccc---ctt
B D                 Armadillo  tgggc---gggctgtccgagctaaagcgctcccgcttagagggcca---ctc
B D                   Opossum  tggga---ggggtaccccaccggaaatgctccatcttatag-cccc------
B D           Tasmanian devil  tggga---gaggtaccccaccagaaatgctccatattatag-cccc------
B D                   Wallaby  tagga---ggggtaccccaccggaaatgctccatcctatagacccc------
B D                  Platypus  tagcc---ggtctgccccaccgaaagtgtcgcatccggtagacctc---ccc
  D               Rock pigeon  tcaag---ggtgcgtgccaacggaaatggcgcatgcggtaggaccc---gcc
  D              Saker falcon  tcaag---ggcacatgccagggaagatggcacatgcggtaggagcc---acc
  D          Peregrine falcon  tcaag---ggcacatgccagggaagatggcacatgcggtaggagcc---acc
  D       Collared flycatcher  tct------gggaattccacgggaatt----------------tcg---gga
B D               Zebra finch  tcc------gggaattccacgggaatt----------------ccg---gga
           Tibetan ground jay  tcc------gggaatcccacgggaatt----------------ccc---aac
B D                Budgerigar  tcatg---ggggtgtgccagcggaagtggtgcatgcggtacgagcc---gcc
  D                    Parrot  tcgtg---ggggtgtgccagcggaagtggtgcatgcggtatgagcc---gcc
  D             Scarlet macaw  tcgtg---ggggtgtgccagcggaagtggtgcatgcggtacgagcc---gcc
  D              Mallard duck  tcagc---ggcgcgtgccagcggaaatggcgcatgcggtaggagcc---gct
B D                   Chicken  tcagc---ggcgcgtgccagcggaagtgccgcatgcggtacgagcc---tcc
B D                    Turkey  tcagc---ggcgcgtgccagcggaagtgccgcatgcggtacgagcc---gcc
B D        American alligator  gggcc---ggcgcgttccagcggaagtggcgcatcttgtaggcccc---gcc
  D           Green seaturtle  tgggc---ggggtgttccatcggaaatggtgcatcttgtaggactc---tcc
  D            Painted turtle  tgggc---ggggtgttccatcggaaatggtgcatcttgtaggactt---tcc
  D  Chinese softshell turtle  tgggc---ggggcgttccatcggaaatggtgcatcttgtaggaatt---tcc
  D    Spiny softshell turtle  tggga---ggggagttccatcggaaatggtgcatcttgtaggaatt---tcc
B D                    Lizard  tcggggctggggcaccccaccggaagtggttcatcttgta---------gcc
B D             X. tropicalis  tgggt---gggctgccccatcggaagtgatgcatcctgtagtttcc---att
B D                Coelacanth  tgggt---gggctgctccagcggaagtggtgcatcttgtagttgcc------
B D                 Tetraodon  cgttg---gggctcccccatctgaagtggttcatctggtaggtccc------
B D                      Fugu  cgttg---gggctcccccacctgaagtggctcatctggtaggtccc------
       Yellowbelly pufferfish  cgttg---gggctcccccacctgaagtggctcatctggtaggtccc------
B D              Nile tilapia  caggt---gggctgccccatctgaagtgactcatcttataggtcct------
          Princess of Burundi  caggt---gggctgccccatctgaagtgactcatcttataggtcct------
        Burton's mouthbreeder  caggt---gggctgccccatctgaagtgactcatcttataggtcct------
                  Zebra mbuna  caggt---gggctgccccatctgaagtgactcatcttataggtcct------
          Pundamilia nyererei  caggt---gggctgccccatctgaagtgactcatcttataggtcct------
B D                    Medaka  cggga---gggccgctccagcggaaatgcttcatcttgtaggagcc------
           Southern platyfish  caagc---gggctgccccatctgaagtgactcatcctgtaggtctc------
B D               Stickleback  ggggc---gggctcccccatcggaagtggctcatccgataggcgcc------
B D              Atlantic cod  ---gc---gggctcccccagcggaagtgactcatccggtacgtcccggg---
B D                 Zebrafish  ccggc---gggacgctccagcggaaatgggtcattttgtagggggg------
     Mexican tetra (cavefish)  cgggc---ggctcgctccagcggaagtggttcatcttgtaggaacc------
                  Spotted gar  tgggc---gggccgctccagcggaagtggtgcattttgtaggagcc------
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Tenrec  ====================================================
B D                     Horse  ====================================================

Inserts between block 32 and 33 in window
B D                   Alpaca 436bp
B D                  Opossum 4bp
B D          Tasmanian devil 4bp
B D                  Wallaby 4bp
B D                 Platypus 15bp

Alignment block 33 of 509 in window, 25161234 - 25161271, 38 bps 
B D                     Human  gtccttctt------ctcggcc------------------------------------------------
B D                     Chimp  gtccttctt------ctcggcc------------------------------------------------
B D                   Gorilla  gtccttctt------ctcggcc------------------------------------------------
B D                 Orangutan  gtccttctt------ctcggcc------------------------------------------------
B D                    Gibbon  gtccttctt------ctcggcc------------------------------------------------
B D                    Rhesus  atccttctt------ctcggcc------------------------------------------------
B D       Crab-eating macaque  atccttctt------ctcggcc------------------------------------------------
B D                    Baboon  atccttctt------ctcggcc------------------------------------------------
B D              Green monkey  atccttctt------ctcggcc------------------------------------------------
B D                  Marmoset  gtctttctt------ctcagcc------------------------------------------------
B D           Squirrel monkey  gtctttctt------ctcggcc------------------------------------------------
B D                  Bushbaby  gtccttctt------cccgacc------------------------------------------------
           Chinese tree shrew  gtccttctt------ctctgcc------------------------------------------------
B D                  Squirrel  gtccttctt------ctcggccg------------------------------------ccgccgcctgg
       Lesser Egyptian jerboa  gtcctcggc------ggcgtcg------------------------------------------------
                 Prairie vole  ttccttctc------ggcg---------------------------------------------------
B D           Chinese hamster  ctccttctc------ggcgtcc------------------------------------------------
               Golden hamster  ttccttctc------ggcgtcc------------------------------------------------
B D                     Mouse  gtccttctc------cgcgtcg------------------------------------------------
B D