Multiz Alignments of 35 Vertebrates

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 23 in window, 37105176 - 37105952, 777 bps 
B D                 Mouse  a------aagagtattgtggctcacagtttaggagcaaataca--ctgtccatcttggtgtcacaatatg
B D                   Rat  ggggtgcaggagtagtatggct------ttaagagaaaataca--ctg--caccttggtggcacagtatg
            GCF_003668045  a------ggttttattttagctcatagtttaagaggggatacagtcagtccatcctggtggcacaacatg
B D                   Dog  ======================================================================
B D                Rhesus  ======================================================================
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D                 Horse  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D              Marmoset  ======================================================================
B D               Opossum  ======================================================================
B D                   Pig  ======================================================================
                  Beaver  ======================================================================
B D                 Shrew  ======================================================================
B D                   Cow  ======================================================================
B D              Elephant  ======================================================================
B D               Dolphin  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D               Tarsier  ======================================================================
B D                Rabbit  ======================================================================
B D              Bushbaby  ======================================================================
B D                Tenrec  ======================================================================
B D              Squirrel  ======================================================================
B D            Tree shrew  ======================================================================
B D             Zebrafish  ======================================================================
B D  Malayan flying lemur  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  aggcagctgctcacagtgtatacacaatcagaacaagaaaa-tgacaggaagtatagccaggctctaaca
                      Rat  aggcagctgttcacaatgtatacacaggcagaactagaaaagtgacaggaaatgtagccagaccctaacc
            GCF_003668045  aggcaactaat--cagtgtatccataatcagaaccagagaagtgacagaaaatgggaccaagctataaca
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  cctcagaacctgccccc---gacctacacttggtcgaggaaagcctcacctcctaaagattccacaatcc
                      Rat  cctcaaaaccttcctctagtgacctccagttcctccagtaaagcctcac-tcctaaagagtccaccattc
            GCF_003668045  tctcaaagcctgcccccaggaacccacact--------------------tcctacaggttc-----gtt
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  ccacactcttcaacactgccgtcagctgggaaccaagtgttcagcgcagcccatgagagacatagtgtat
                      Rat  ccacaatcttcatcacagccgtcagctgg-acccaggtgttggatgcagcccatggaagacatagcttat
            GCF_003668045  ccaaaaccttcaacagtgccaccatctgggtacca------------agcccatggaggacatagtttat
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  gttcaaaccgcaacacccacttcaccccccacaggcttaaagccaccccataatgagaaatgcatttatt
                      Rat  gttcaaatcataatacctacttccttccccacaggggtaaagccaccccataagaaaaaacgtatttatt
            GCF_003668045  gttcaaaccacaatgtctactccatccgcaacaggctcatagccatcccataatgaaaaatacatttgtt
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  cactgtcaaatgttttcatagttccagcgctatttaaaattccaaagtctcttttgggacttaagtccgt
                      Rat  cacttgcaaacattttcatagtcccaaccctatttaaaattccaaagtctcttttgagacttagggcagt
            GCF_003668045  caccttcaaaagtgttcataactccaaccctagttaataatccaaagtctcttttgagattcaaggcact
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  ttc-ttaactgtaaactgcttgctatacaat-caaaggacaagttaatatttccaatatacactggcaca
                      Rat  ttc-ttaactgagaaccagt----atacaat-caaagaacaagttaatatttccaaaatacagtggcaca
            GCF_003668045  ctctttaactctgagccact----gtacaataaaaaaaacaagttaatacttccaatatataatggcaca
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  gaataaaccttccccattacatatggaggaatggggacatggcaagggaagattgagccaaagcagtact
                      Rat  gagtaaaccttccacatggcatatggaagaatgtggatgtggcaaggaaagattgggccaaagtagtact
            GCF_003668045  gagaaaaccttccctgttacaaatggaagaataggggcatagcaaggaaagattgggctaaagcagtact
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  gaaaccaaacagaactgaaaccaaggctccaaaggtgttg----agtggctccagttttccagctctgcc
                      Rat  gaaacccaacagggcagaaaccaaggctccaaaggtgttggttgagtggctgcactcttccaactctgtc
            GCF_003668045  gaagcacaacagggcagaaacctagcttccaaagatcttc----agtggctccattcttccagctctgcc
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  tcctgaaatacacacaccctcttcttttgggccagttctccatgcctgcagcttttctcaggagacatcc
                      Rat  tcctgaaatacacacagccact-ctctccggcgagttctccatgcctgcagcttttctcaggagacatgc
            GCF_003668045  tcctgcaatacatataacctct-ctcttgggtcagttcttcatgtctgtagcttttctcaggagacattc
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  cactctcctggcattcc--tcattctaggcttccttcgctacttactgcttcactttcacagttttatgc
                      Rat  cactatcctggcatcca--tcattgtagacttcctttgcttcttactgcttcactttcacagctccatgc
            GCF_003668045  cgtgatcctggcatctctgtcatccaggctttcctctcctatgtac-acttcactttcacagattcatgc
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  agtaagctcttggcctttctttgcag---a
                      Rat  aataagcacttggcgcttctttgcagcaga
            GCF_003668045  attaaactcttggcgattctttgaag---a
                      Dog  ==============================
                   Rhesus  ==============================
               Guinea pig  ==============================
                    Sheep  ==============================
                    Horse  ==============================
       Hawaiian monk seal  ==============================
                  Gorilla  ==============================
                   Bonobo  ==============================
                    Chimp  ==============================
                    Human  ==============================
                 Marmoset  ==============================
                  Opossum  ==============================
                      Pig  ==============================
                   Beaver  ==============================
                    Shrew  ==============================
                      Cow  ==============================
                 Elephant  ==============================
                  Dolphin  ==============================
                 Hedgehog  ==============================
                     Pika  ==============================
                  Tarsier  ==============================
                   Rabbit  ==============================
                 Bushbaby  ==============================
                   Tenrec  ==============================
                 Squirrel  ==============================
               Tree shrew  ==============================
                Zebrafish  ==============================
     Malayan flying lemur  ==============================
            X. tropicalis  ==============================
                  Chicken  ==============================
                  Lamprey  ==============================

Inserts between block 1 and 2 in window
           GCF_003668045 4464bp

Alignment block 2 of 23 in window, 37105953 - 37106286, 334 bps 
B D                 Mouse  gactttgagccagcatatttttcaaatgcaggtacaaatgcagtaaaaatcttctttatccttctccccc
B D                   Rat  gactt-gagcca-catatttttcaga----ggtacaaatgcagtaata-tcttctgt-------------
B D                   Dog  ======================================================================
B D                Rhesus  ======================================================================
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D                 Horse  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D              Marmoset  ======================================================================
B D               Opossum  ======================================================================
B D                   Pig  ======================================================================
                  Beaver  ======================================================================
B D                 Shrew  ======================================================================
B D                   Cow  ======================================================================
B D              Elephant  ======================================================================
B D               Dolphin  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D               Tarsier  ======================================================================
           GCF_003668045  ======================================================================
B D                Rabbit  ======================================================================
B D              Bushbaby  ======================================================================
B D                Tenrec  ======================================================================
B D              Squirrel  ======================================================================
B D            Tree shrew  ======================================================================
B D             Zebrafish  ======================================================================
B D  Malayan flying lemur  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  ctctctccctctctccccctctccctctctctctccccctctccctccctctcccccctctctccctctc
                      Rat  -------cttctttccccctctctctctttctcccaccc-------ccctgcaatccccatccctcacta
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
            GCF_003668045  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  ccttttgcaacctccccagccctacctctattctctcgagtaattggctatagccacttttatttaacca
                      Rat  actgaagcaaca--------cctacctctattctcaccagtaattggctgtagccacttttatttaacca
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
            GCF_003668045  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  atagctttaaattggtgagtcaggtttacacaacaaaggccactgtatgtgaacactcactcatctggga
                      Rat  atagctttaaattggagagtaaggctcacacaacaaaggccactgtacatgagaaggcactggtctgagg
                      Dog  ======================================================================
                   Rhesus  ======================================================================
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                    Horse  ======================================================================
       Hawaiian monk seal  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                 Marmoset  ======================================================================
                  Opossum  ======================================================================
                      Pig  ======================================================================
                   Beaver  ======================================================================
                    Shrew  ======================================================================
                      Cow  ======================================================================
                 Elephant  ======================================================================
                  Dolphin  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                  Tarsier  ======================================================================
            GCF_003668045  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Tenrec  ======================================================================
                 Squirrel  ======================================================================
               Tree shrew  ======================================================================
                Zebrafish  ======================================================================
     Malayan flying lemur  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================
                  Lamprey  ======================================================================

                    Mouse  gcaaccagatcatgggattcagaatttaacatttgcatacataacaccaga-----cca
                      Rat  gcaaccagatcatggggttcagaatttagcatttgcatac-taacaccagagcagacca
                      Dog  ===========================================================
                   Rhesus  ===========================================================
               Guinea pig  ===========================================================
                    Sheep  ===========================================================
                    Horse  ===========================================================
       Hawaiian monk seal  ===========================================================
                  Gorilla  ===========================================================
                   Bonobo  ===========================================================
                    Chimp  ===========================================================
                    Human  ===========================================================
                 Marmoset  ===========================================================
                  Opossum  ===========================================================
                      Pig  ===========================================================
                   Beaver  ===========================================================
                    Shrew  ===========================================================
                      Cow  ===========================================================
                 Elephant  ===========================================================
                  Dolphin  ===========================================================
                 Hedgehog  ===========================================================
                     Pika  ===========================================================
                  Tarsier  ===========================================================
            GCF_003668045  ===========================================================
                   Rabbit  ===========================================================
                 Bushbaby  ===========================================================
                   Tenrec  ===========================================================
                 Squirrel  ===========================================================
               Tree shrew  ===========================================================
                Zebrafish  ===========================================================
     Malayan flying lemur  ===========================================================
            X. tropicalis  ===========================================================
                  Chicken  ===========================================================
                  Lamprey  ===========================================================

Alignment block 3 of 23 in window, 37106287 - 37106293, 7 bps 
B D                 Mouse  gccccca
B D                   Rat  gccccca
B D                  Pika  gctctca
B D      Chinese pangolin  gctctca
B D                   Dog  gctctca
B D    Hawaiian monk seal  gctctca
B D                Rhesus  =======
B D            Guinea pig  =======
B D                 Sheep  =======
B D                 Horse  =======
B D               Gorilla  =======
B D                Bonobo  =======
B D                 Chimp  =======
B D                 Human  =======
B D              Marmoset  =======
B D               Opossum  =======
B D                   Pig  =======
                  Beaver  =======
B D                 Shrew  =======
B D                   Cow  =======
B D              Elephant  =======
B D               Dolphin  =======
B D              Hedgehog  =======
B D               Tarsier  =======
           GCF_003668045  =======
B D                Rabbit  =======
B D              Bushbaby  =======
B D                Tenrec  =======
B D              Squirrel  =======
B D            Tree shrew  =======
B D             Zebrafish  =======
B D  Malayan flying lemur  =======
B D         X. tropicalis  =======
B D               Chicken  =======
B D               Lamprey  =======

Alignment block 4 of 23 in window, 37106294 - 37106295, 2 bps 
B D                 Mouse  ag
B D                   Rat  ac
            GCF_003668045  ag
B D                  Pika  ag
B D                 Human  ag
B D      Chinese pangolin  ag
B D                   Dog  gg
B D    Hawaiian monk seal  ag
B D                Rhesus  ==
B D            Guinea pig  ==
B D                 Sheep  ==
B D                 Horse  ==
B D               Gorilla  ==
B D                Bonobo  ==
B D                 Chimp  ==
B D              Marmoset  ==
B D               Opossum  ==
B D                   Pig  ==
                  Beaver  ==
B D                 Shrew  ==
B D                   Cow  ==
B D              Elephant  ==
B D               Dolphin  ==
B D              Hedgehog  ==
B D               Tarsier  ==
B D                Rabbit  ==
B D              Bushbaby  ==
B D                Tenrec  ==
B D              Squirrel  ==
B D            Tree shrew  ==
B D             Zebrafish  ==
B D  Malayan flying lemur  ==
B D         X. tropicalis  ==
B D               Chicken  ==
B D               Lamprey  ==

Inserts between block 4 and 5 in window
B D                 Pika 3bp
B D     Chinese pangolin 3bp
B D                  Dog 3bp
B D   Hawaiian monk seal 3bp

Alignment block 5 of 23 in window, 37106296 - 37106299, 4 bps 
B D                 Mouse  actt
B D                   Rat  actt
            GCF_003668045  agtt
                   Beaver  actt
B D                Rabbit  actt
B D                  Pika  attt
B D                 Human  attt
B D                 Chimp  attt
B D                Bonobo  attt
B D               Gorilla  attt
B D  Malayan flying lemur  attt
B D                 Horse  attt
B D      Chinese pangolin  tctt
B D                   Dog  actt
B D    Hawaiian monk seal  actt
B D              Elephant  actt
B D                Rhesus  ====
B D            Guinea pig  ====
B D                 Sheep  ====
B D              Marmoset  ====
B D               Opossum  ====
B D                   Pig  ====
B D                 Shrew  ====
B D                   Cow  ====
B D               Dolphin  ====
B D              Hedgehog  ====
B D               Tarsier  ====
B D              Bushbaby  ====
B D                Tenrec  ====
B D              Squirrel  ====
B D            Tree shrew  ====
B D             Zebrafish  ====
B D         X. tropicalis  ====
B D               Chicken  ====
B D               Lamprey  ====

Alignment block 6 of 23 in window, 37106300 - 37106304, 5 bps 
B D                 Mouse  atcag
B D                   Rat  accag
            GCF_003668045  atcat
                   Beaver  acaat
B D                Rabbit  aacag
B D                  Pika  aacag
B D                 Human  ataat
B D                 Chimp  ataat
B D                Bonobo  ataat
B D               Gorilla  ataat
B D                Rhesus  ataat
B D  Malayan flying lemur  ataat
B D                 Horse  ataat
B D      Chinese pangolin  ataat
B D                   Dog  ataat
B D    Hawaiian monk seal  acaat
B D              Elephant  acatt
B D            Guinea pig  =====
B D                 Sheep  =====
B D              Marmoset  =====
B D               Opossum  =====
B D                   Pig  =====
B D                 Shrew  =====
B D                   Cow  =====
B D               Dolphin  =====
B D              Hedgehog  =====
B D               Tarsier  =====
B D              Bushbaby  =====
B D                Tenrec  =====
B D              Squirrel  =====
B D            Tree shrew  =====
B D             Zebrafish  =====
B D         X. tropicalis  =====
B D               Chicken  =====
B D               Lamprey  =====

Alignment block 7 of 23 in window, 37106305 - 37106306, 2 bps 
B D                 Mouse  ca
B D                   Rat  ca
            GCF_003668045  ca
                   Beaver  ca
B D                Rabbit  t-
B D                  Pika  c-
B D                 Human  ca
B D                 Chimp  ca
B D                Bonobo  ca
B D               Gorilla  ca
B D                Rhesus  ca
B D              Bushbaby  ca
B D            Tree shrew  ca
B D  Malayan flying lemur  ca
B D               Dolphin  ca
B D                   Cow  ca
B D                 Sheep  ca
B D              Elephant  ca
B D                   Dog  --
B D            Guinea pig  ==
B D                 Horse  --
B D    Hawaiian monk seal  --
B D              Marmoset  ==
B D               Opossum  ==
B D                   Pig  ==
B D      Chinese pangolin  --
B D                 Shrew  ==
B D              Hedgehog  ==
B D               Tarsier  ==
B D                Tenrec  ==
B D              Squirrel  ==
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D               Chicken  ==
B D               Lamprey  ==

Alignment block 8 of 23 in window, 37106307 - 37106315, 9 bps 
B D                 Mouse  cac-at-aaat
B D                   Rat  cac-at-aata
            GCF_003668045  cca-at-aaat
                   Beaver  gac-at-a--t
B D                Rabbit  cat-at-atct
B D                  Pika  tgc-at-cttt
B D                 Human  tac-at-atat
B D                 Chimp  tac-at-atat
B D                Bonobo  tac-at-atat
B D               Gorilla  tac-at-atat
B D                Rhesus  tag-at-atat
B D               Tarsier  cac-at-atat
B D              Bushbaby  tac-at-acat
B D            Tree shrew  cac-at-attc
B D  Malayan flying lemur  tgt-gt-atat
B D               Dolphin  cac-at-t---
B D                   Cow  cac-at-t---
B D                 Sheep  cac-at-t---
B D                 Horse  cac-acat---
B D      Chinese pangolin  cacaattt---
B D                   Dog  cac-at-t---
B D    Hawaiian monk seal  cac-at-t---
B D              Elephant  tat-at-atct
B D            Guinea pig  ===========
B D              Marmoset  ===========
B D               Opossum  ===========
B D                   Pig  ===========
B D                 Shrew  ===========
B D              Hedgehog  ===========
B D                Tenrec  ===========
B D              Squirrel  ===========
B D             Zebrafish  ===========
B D         X. tropicalis  ===========
B D               Chicken  ===========
B D               Lamprey  ===========

Inserts between block 8 and 9 in window
B D               Rabbit 2bp
B D                 Pika 2bp

Alignment block 9 of 23 in window, 37106316 - 37106318, 3 bps 
B D                 Mouse  tat
B D                   Rat  tac
            GCF_003668045  tat
                   Beaver  aat
B D            Guinea pig  tat
B D                Rabbit  tat
B D                  Pika  ta-
B D                 Human  tat
B D                 Chimp  tat
B D                Bonobo  tat
B D               Gorilla  tat
B D                Rhesus  tat
B D               Tarsier  ttt
B D              Bushbaby  tat
B D            Tree shrew  tgc
B D  Malayan flying lemur  tat
B D              Elephant  tat
B D                   Dog  ---
B D                 Sheep  ---
B D                 Horse  ---
B D    Hawaiian monk seal  ---
B D              Marmoset  ===
B D               Opossum  ===
B D                   Pig  ===
B D      Chinese pangolin  ---
B D                 Shrew  ===
B D                   Cow  ---
B D               Dolphin  ---
B D              Hedgehog  ===
B D                Tenrec  ===
B D              Squirrel  ===
B D             Zebrafish  ===
B D         X. tropicalis  ===
B D               Chicken  ===
B D               Lamprey  ===

Alignment block 10 of 23 in window, 37106319 - 37106319, 1 bps 
B D                 Mouse  t
B D                   Rat  t
            GCF_003668045  t
                   Beaver  t
B D            Guinea pig  t
B D                Rabbit  t
B D                  Pika  t
B D                 Human  t
B D                 Chimp  t
B D                Bonobo  t
B D               Gorilla  t
B D                Rhesus  t
B D               Tarsier  t
B D              Bushbaby  g
B D            Tree shrew  c
B D  Malayan flying lemur  t
B D                   Pig  t
B D               Dolphin  t
B D                   Cow  t
B D                 Sheep  t
B D                 Horse  t
B D      Chinese pangolin  t
B D                   Dog  t
B D    Hawaiian monk seal  t
B D              Elephant  t
B D              Marmoset  =
B D               Opossum  =
B D                 Shrew  =
B D              Hedgehog  =
B D                Tenrec  =
B D              Squirrel  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Inserts between block 10 and 11 in window
B D                Human 2bp
B D                Chimp 2bp
B D               Bonobo 2bp
B D              Gorilla 2bp
B D               Rhesus 2bp
B D              Tarsier 4bp
B D             Bushbaby 2bp
B D           Tree shrew 2bp
B D Malayan flying lemur 2bp
B D                  Pig 1bp
B D              Dolphin 1bp
B D                  Cow 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp

Alignment block 11 of 23 in window, 37106320 - 37106326, 7 bps 
B D                 Mouse  --tttag--ga
B D                   Rat  --tttag--ga
            GCF_003668045  --ttcag-aaa
                   Beaver  --ttcag-aat
B D              Squirrel  --tttac--ag
B D            Guinea pig  --ttgaatatg
B D                Rabbit  --ttttg-aat
B D                  Pika  --tttgg-aat
B D                 Human  --ttgaa----
B D                 Chimp  --ttgaa----
B D                Bonobo  --ttgaa----
B D               Gorilla  --ttgaa----
B D                Rhesus  --ttgaa----
B D               Tarsier  --ttg------
B D              Bushbaby  --ttcaa----
B D            Tree shrew  --tttaa----
B D  Malayan flying lemur  --ttgaa----
B D                   Pig  --ttgag----
B D               Dolphin  --ttgag----
B D                   Cow  --ttgag----
B D                 Sheep  --ttgag----
B D                 Horse  --ctgaa----
B D      Chinese pangolin  --tttaa----
B D                   Dog  --tcgaa----
B D    Hawaiian monk seal  --ttaaa----
B D              Elephant  ttttaaa----
B D              Marmoset  ===========
B D               Opossum  ===========
B D                 Shrew  ===========
B D              Hedgehog  ===========
B D                Tenrec  ===========
B D             Zebrafish  ===========
B D         X. tropicalis  ===========
B D               Chicken  ===========
B D               Lamprey  ===========

Inserts between block 11 and 12 in window
B D                Human 4bp
B D                Chimp 4bp
B D               Bonobo 4bp
B D              Gorilla 4bp
B D               Rhesus 4bp
B D             Bushbaby 4bp
B D           Tree shrew 4bp
B D Malayan flying lemur 4bp
B D                  Pig 1bp
B D              Dolphin 1bp
B D                  Cow 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp
B D             Elephant 10bp

Alignment block 12 of 23 in window, 37106327 - 37106353, 27 bps 
B D                 Mouse  attattac-----aatgaatacaaggc-tttca
B D                   Rat  gctattac-----aatgaataaaaggc-cttta
            GCF_003668045  acaattac-----agtgaatctaaggc-tttta
                   Beaver  gctattac--tctattgaatccaggaa-ttata
B D              Squirrel  atcttaac-----agtaagtacaggaa-ttatg
B D            Guinea pig  attattat-----actagatccaggaa-ttaaa
B D                Rabbit  actgttat--tatagtgaatccaggaa-ttaca
B D                  Pika  gctattactatatagataatccaggaa-ttaca
B D                 Human  attattat-----ggtgaatccaggaa-ttatg
B D                 Chimp  attattat-----ggtgaatccaggaa-ttatg
B D                Bonobo  attattat-----ggtgaatccaggaa-ttatg
B D               Gorilla  attattat-----ggtgaatccaggaa-ttatg
B D                Rhesus  attattat-----ggtgaatccaggaa-ttatg
B D              Marmoset  attattat-----ggtgaatccaggaa-ttatg
B D               Tarsier  -ttgttgt-----agcaaatccaggaa-ttata
B D              Bushbaby  attattat-----agtgaatccaggaa-ttata
B D            Tree shrew  tttatca--------tgaattcaggaa-atgta
B D  Malayan flying lemur  attattat-----agtgaatccaggaatttatg
B D                   Pig  gctcctac-----agtgaatctaggaa-ctgca
B D               Dolphin  gctattac-----agtgaatccaggaa-ttgta
B D                   Cow  gctgttat-----agtgaatctaggaa-ttata
B D                 Sheep  gctgttat-----agtgaatctaggaa-ttata
B D                 Horse  gctatggt-----agtgaatccaggaa-ttgta
B D      Chinese pangolin  gctattag-----agtgaatccaggaa-tttta
B D                   Dog  gct-----------gtaaacccaggaa-ttgca
B D    Hawaiian monk seal  gctgttat-----agtaaaccctggaa-ttgta
B D              Elephant  agtattat-----agtgaattcagtaa-ttata
B D               Opossum  =================================
B D                 Shrew  =================================
B D              Hedgehog  =================================
B D                Tenrec  =================================
B D             Zebrafish  =================================
B D         X. tropicalis  =================================
B D               Chicken  =================================
B D               Lamprey  =================================

Alignment block 13 of 23 in window, 37106354 - 37106361, 8 bps 
B D                 Mouse  gactcaag
B D                   Rat  gactcaag
            GCF_003668045  gactcatg
                   Beaver  ggctcaat
B D              Squirrel  ggctcaat
B D            Guinea pig  ggtttagt
B D                Rabbit  gttctaat
B D                  Pika  ggcttaat
B D                 Human  ggctcatt
B D                 Chimp  ggctcatt
B D                Bonobo  ggctcatt
B D               Gorilla  ggctcatt
B D                Rhesus  ggctcaat
B D              Marmoset  gactcaaa
B D               Tarsier  ggctcaat
B D              Bushbaby  tgcttaat
B D            Tree shrew  aggtcaaa
B D  Malayan flying lemur  ggttcaat
B D                   Pig  gg---gtt
B D               Dolphin  ggttagat
B D                   Cow  ggttagat
B D                 Sheep  ggttagat
B D                 Horse  ggttagat
B D      Chinese pangolin  ggttatat
B D                   Dog  gcttagat
B D    Hawaiian monk seal  gcttat--
B D                 Shrew  gactagat
B D              Elephant  gatc----
B D               Opossum  ========
B D              Hedgehog  ========
B D                Tenrec  ========
B D             Zebrafish  ========
B D         X. tropicalis  ========
B D               Chicken  ========
B D               Lamprey  ========

Alignment block 14 of 23 in window, 37106362 - 37106422, 61 bps 
B D                 Mouse  tattc-aaatatatctgcta-aagtattt----------ta----tcc---aga--gtatattaagggag
B D                   Rat  tattc-atacacatctccta-aagtgctt----------ta----tcc---aga--gtatattaagcgag
            GCF_003668045  tattc-aaataca-ctgctg-aagtggtt----------ta----ccc---aga--ctctattaagggag
                   Beaver  tattc-aaatgcacctactg-aaatattt----------tg----cct---tga--gtgtattataaagg
B D              Squirrel  tattc-aaatgc----------------------------------cc---tga--gtatattagggagg
B D            Guinea pig  aatgg-gaagacccctgctg-aaatattc----------tg----tct---taa--gtatattacggaag
B D                Rabbit  tattc-aaatgcatctactgaaagtatttcagatatacctatacctac---tga--gtattttatagaga
B D                  Pika  tattc-aaattcacctcctaaaaatagttccag------tatacctac---tga--gtattttttggagt
B D                 Human  tatac-aaatgtacctactgaaaatattt----------tg----tct---tga--gtatattatagagg
B D                 Chimp  tatac-aaatgtacctactgaaaatattt----------tg----tct---tga--gtatattatagagg
B D                Bonobo  tatac-aaatgtacctactgaaaatattt----------tg----tct---tga--gtatattatagagg
B D               Gorilla  tatac-aaatgtacttactgaaaatattt----------tg----tct---tga--gtatattatagagg
B D                Rhesus  tatac-aaatgtacctactgaaaatattt----------tg----tct---tga--gtatattacagagg
B D              Marmoset  tatac-aaatgtacctactgaaaatatt-------------------t---tga--gtatattatagagg
B D               Tarsier  cattc-aaatgtacctactaaaagtattt----------tg----tcc---tga--atatattatgaaga
B D              Bushbaby  tattc-aaatgtatctactgaaaatattt----------ta----att---tta--atatattatggcgg
B D            Tree shrew  aattc-aaatgcatctactgaaaatatt-------------------t---tgaatatatatagtaaagg
B D  Malayan flying lemur  tattc-aaatacacctactgaaaatatt-------------------t---tga--gtatattatggagg
B D                   Pig  aatc--agttgcacatactgaaaagattt----------tg----tct---tgt--gcatattatggagg
B D               Dolphin  aatc--atttgcatctactgaaaatactt----------tg----tct---tga--acctaccttcagga
B D                   Cow  aatc--agttgtatctactgaaaatattt----------t-----tct---tga--gcataccgtggagg
B D                 Sheep  aatc--agttgtatctactgaaaatattt----------t-----tct---tga--gcatactgtggagg
B D                 Horse  tattc-cagtgcacctattgacaatattt----------tg----tct---tga--gcatattatggagg
B D      Chinese pangolin  tatt--caatataactactgaaaatattt----------tg----tct---tga--gcatgttatggagg
B D                   Dog  cattc-agtcacacctactgagagaagtc----------tg----cct---cgg--acatctgaaagagg
B D    Hawaiian monk seal  -------------tctattgagaatagtc----------tg----tct---tga--gcatattatggagg
B D              Hedgehog  tattc-aagtgcacctgctgacaatactt----------tg----tct---tga--gcc-----------
B D                 Shrew  cattcaaaatgcacatactgaaaatatct----------tg----tat---tga--accaattatggagg
B D              Elephant  -attc-aaatgtagcttctgaaaatattt----------tt----tgtctgtga--ccatattttagagg
B D               Opossum  ======================================================================
B D                Tenrec  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  tgcagt-aatgtt
                      Rat  tgcagt-aatgtc
            GCF_003668045  tgcagt-aatatt
                   Beaver  ttcagt-gattct
                 Squirrel  gtcagt-gatgtt
               Guinea pig  cttaat-gatgtt
                   Rabbit  ttcagt-gatgtt
                     Pika  tccgat-gatgtt
                    Human  cttagt-gatgtt
                    Chimp  cttagt-gatgtt
                   Bonobo  cttagt-gatgtt
                  Gorilla  cttagt-gatgtt
                   Rhesus  cttagt-gatgtt
                 Marmoset  cttagt-ggtgtt
                  Tarsier  cttaat-gaagtt
                 Bushbaby  cttagt-gatgtt
               Tree shrew  cttagcatattct
     Malayan flying lemur  cttagt-tatgtt
                      Pig  cttagt-gatgtt
                  Dolphin  ctgtgc-tagggc
                      Cow  cttagt-gatgtt
                    Sheep  cttagt-gatgtt
                    Horse  cttagt-gatgtt
         Chinese pangolin  tttagt-gatgtt
                      Dog  ctta-t-gatatt
       Hawaiian monk seal  cttagt-gatgtt
                 Hedgehog  -----------tg
                    Shrew  cttagt-aatgtt
                 Elephant  cttaat-gatgtt
                  Opossum  =============
                   Tenrec  =============
                Zebrafish  =============
            X. tropicalis  =============
                  Chicken  =============
                  Lamprey  =============

Alignment block 15 of 23 in window, 37106423 - 37106434, 12 bps 
B D                 Mouse  catg------------------------------------------------------------------
B D                   Rat  catg------------------------------------------------------------------
            GCF_003668045  catggacc---------tacc---------------------------tccaggactatgc--agata--
                   Beaver  tttggata---------tgcccttggggcattaaatggcatttatactcctagcattatag--tggta-g
B D              Squirrel  cttggacc---------tgcc---------------------------atcaggactatgt--taggg--
B D            Guinea pig  cttatgcc---------tacc---------------------------ttcaaaactgcta--gag----
B D                Rabbit  cttagacc---------tacc---------------------------ttcaggactgtg----------
B D                  Pika  cttagagc---------tacc---------------------------atcaggatagtg----------
B D                 Human  cttt-tcc---------tacc---------------------------attagaaccatgctttaggg--
B D                 Chimp  cttt-tcc---------tacc---------------------------attagaaccatgctttaggg--
B D                Bonobo  cttt-tcc---------tacc---------------------------attagaaccatgctttaggg--
B D               Gorilla  cttt-tcc---------tacc---------------------------attagaaccatgctttaggg--
B D                Rhesus  cttt-tcc---------tacc---------------------------attagaaccgtgctctaggg--
B D              Marmoset  cttt-tcc---------tgcc---------------------------attagaactgtgctctaggg--
B D               Tarsier  cttg-acc---------aacc---------------------------tttaggactgtgc--taggg--
B D              Bushbaby  cttg-acc---------tatc---------------------------tttagggctatgc--tacag--
B D            Tree shrew  g-gg-gcc---------tacc---------------------------ttcagaaat-tgc--taggg--
B D  Malayan flying lemur  gttg-acc---------tacc---------------------------ttcaggactgtgc--ttggg--
B D                   Pig  -ctgaacc---------cacc---------------------------ttcaggactgtgc--taggg--
B D               Dolphin  actgtac---------------------------------------------------------------
B D                   Cow  cctgaacc---------tgcc---------------------------ttcaggact-------------
B D                 Sheep  cctgaacc---------tacc---------------------------ttcaggatt-------------
B D                 Horse  tttgaacc---------tact---------------------------ttcaggactgtgc--aaggg--
B D      Chinese pangolin  cttaaacct--------tacc---------------------------ttcagaactgtgc--taggg--
B D                   Dog  cctgaacc---------tac--------------------------------------------------
B D    Hawaiian monk seal  cttgaacc---------tacc---------------------------ttcagaactgagt--tatgg--
B D              Hedgehog  cctgc-----------------------------------------------------ttc--catg---
B D                 Shrew  cttgaacttgaacacaccctc---------------------------ttcaggattgttc--tatgg--
B D              Elephant  cttgaacc---------tat----------------------------tccaggattttg---tagtgca
B D               Lamprey  --------------------------------------------------------------------ca
B D               Opossum  ======================================================================
B D                Tenrec  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  --a---atcatac
                      Rat  --c---attatgt
            GCF_003668045  --c---ataatat
                   Beaver  ggc---attatat
                 Squirrel  --c---attttat
               Guinea pig  --c---attaaac
                   Rabbit  -------------
                     Pika  -------------
                    Human  --c---attacac
                    Chimp  --c---attacac
                   Bonobo  --c---attacac
                  Gorilla  --c---attacac
                   Rhesus  --cattattatac
                 Marmoset  --c---attatat
                  Tarsier  --c---attatgc
                 Bushbaby  --c---attattc
               Tree shrew  --c---attatac
     Malayan flying lemur  --c---attatac
                      Pig  --c---gctgaac
                  Dolphin  -------------
                      Cow  -------------
                    Sheep  -------------
                    Horse  --c---actgtac
         Chinese pangolin  --c---actgtac
                      Dog  -------------
       Hawaiian monk seal  --c---actgtat
                 Hedgehog  -----------ac
                    Shrew  --c---actatgc
                 Elephant  ttc---attatac
                  Lamprey  tcc---atcacac
                  Opossum  =============
                   Tenrec  =============
                Zebrafish  =============
            X. tropicalis  =============
                  Chicken  =============

Inserts between block 15 and 16 in window
B D               Rabbit 27bp
B D                 Pika 31bp

Alignment block 16 of 23 in window, 37106435 - 37106446, 12 bps 
B D                 Mouse  accttg---atagt----------g
B D                   Rat  accttc---ataac----------g
            GCF_003668045  accttg---acaat----------g
                   Beaver  tcctta---acagt----------t
B D              Squirrel  ccctta---acaaa----------t
B D            Guinea pig  tcctta---aaaat----------t
B D                 Human  tcctta---ataat----------a
B D                 Chimp  tcctta---ataat----------a
B D                Bonobo  tcctta---ataat----------a
B D               Gorilla  tcctta---ataac-----------
B D                Rhesus  tcctta---ataat----------a
B D              Marmoset  tcctta---ataatagctaataata
B D               Tarsier  ccctta---ttaat----------a
B D              Bushbaby  tcctta---ataat-----------
B D            Tree shrew  tccttaattattat---------ta
B D  Malayan flying lemur  tcctta---ataat---------ta
B D                   Pig  tcctta---ataat----------a
B D               Dolphin  tcctta---ataat----------a
B D                   Cow  tcatta---ataat----------a
B D                 Sheep  tcgtta---ataat----------a
B D                 Horse  tcctta---ataac----------t
B D      Chinese pangolin  tactta---ataat----------t
B D                   Dog  tgctta---ttact----------t
B D    Hawaiian monk seal  tcctta---atacc----------t
B D              Hedgehog  cctcta---a---c----------t
B D                 Shrew  ccctta---a---t----------t
B D              Elephant  tcctta---ataat----------t
B D               Opossum  acttta---gtcaa----------a
B D               Lamprey  gtctga---at--------------
B D                  Pika  =========================
B D                Rabbit  =========================
B D                Tenrec  =========================
B D             Zebrafish  =========================
B D         X. tropicalis  =========================
B D               Chicken  =========================

Alignment block 17 of 23 in window, 37106447 - 37106454, 8 bps 
B D                 Mouse  accct---gat
B D                   Rat  agc------at
            GCF_003668045  acc------at
                   Beaver  atc------at
B D              Squirrel  atc------at
B D            Guinea pig  ---------at
B D                Rabbit  act------ac
B D                 Human  ---------ac
B D                 Chimp  ---------ac
B D                Bonobo  ---------ac
B D                Rhesus  ---------ac
B D              Marmoset  ---------ac
B D               Tarsier  ---------ac
B D            Tree shrew  ---------tt
B D  Malayan flying lemur  ---------tc
B D                   Pig  ata------at
B D               Dolphin  atg------ac
B D                   Cow  atg------at
B D                 Sheep  ata------at
B D                 Horse  att------at
B D      Chinese pangolin  att------at
B D                   Dog  att------at
B D    Hawaiian monk seal  att------at
B D              Hedgehog  gtg------at
B D                 Shrew  att------at
B D              Elephant  atc------ac
B D               Opossum  ---------ac
B D               Lamprey  ----tcccgac
B D               Gorilla  -----------
B D                  Pika  ===========
B D              Bushbaby  -----------
B D                Tenrec  ===========
B D             Zebrafish  ===========
B D         X. tropicalis  ===========
B D               Chicken  ===========

Inserts between block 17 and 18 in window
B D             Elephant 3bp
B D              Opossum 6bp

Alignment block 18 of 23 in window, 37106455 - 37106466, 12 bps 
B D                 Mouse  ttctaattacca
B D                   Rat  ttctgattactg
            GCF_003668045  ttctaattacta
                   Beaver  ttgtaattatta
B D              Squirrel  ttataatta---
B D            Guinea pig  ttataatt-tta
B D                Rabbit  ttataattatta
B D                  Pika  ttataattgcta
B D                 Human  -tgtaattttta
B D                 Chimp  -tgtaattttta
B D                Bonobo  -tgtaattttta
B D               Gorilla  ---taattttta
B D                Rhesus  -tgtaattttta
B D              Marmoset  -tgtaattttta
B D               Tarsier  ---taattatta
B D              Bushbaby  -tataattatca
B D            Tree shrew  -tgtaatta---
B D  Malayan flying lemur  -tataattatta
B D                   Pig  ttataatt---a
B D               Dolphin  ttataatt---a
B D                   Cow  ttataatt---a
B D                 Sheep  ttataatt---a
B D                 Horse  ttataatt---a
B D      Chinese pangolin  gtataatt---a
B D                   Dog  ctgta------a
B D    Hawaiian monk seal  ttata------a
B D              Hedgehog  ttgtaatt---a
B D                 Shrew  ttataatt---g
B D              Elephant  ttacaa---tta
B D                Tenrec  ttataaatgtca
B D               Opossum  ------tttttc
B D               Lamprey  ctcca-------
B D             Zebrafish  ============
B D         X. tropicalis  ============
B D               Chicken  ============

Alignment block 19 of 23 in window, 37106467 - 37106643, 177 bps 
B D                 Mouse  tttc--agattaatttcttggactggaagaaagattgaccctgtaggtgttgattatattcttcaaaaat
B D                   Rat  tttt--agattaatttcttggactggaagaaagattgatccagtaggtgttgattacattcttcaaaaat
            GCF_003668045  tttt--agattaatttcttggactggaagaaagattgatccagtaggtgttgattatattcttcaaaaat
                   Beaver  tttt--agattaatttcttggactggaagaaagattgatcctgtaggtgttgattatattcttcaaaaac
B D              Squirrel  tttt--agattaatttcttggactggaagaaagattgatccagtaggtgttgattacattcttcaaaaat
B D            Guinea pig  tttt--agattaatttcttggactggaagaaagattgatccagtaggagttgattatattcttcaaaaat
B D                Rabbit  tttt--agattaatttcttggactggaagaaagatcgatccagtaggcgttgattatattcttcaaaaac
B D                  Pika  tttc--agacttatttcttggactggaagaaaaattgatccagtaggcgttgattacattcttcaaaaat
B D                 Human  tttt--agattaatttcttggactggaagaaagattgatccagtaggtgttgattatattcttcaaaaat
B D                 Chimp  tttt--agattaatttcttggactggaagaaagattgatccagtaggtgttgattatattcttcaaaaat
B D                Bonobo  tttt--agattaatttcttggactggaagaaagattgatccagtaggtgttgattatattcttcaaaaat
B D               Gorilla  tttt--agattgatttcttggactggaagaaagattgatccagtaggtgttgattatattcttcaaaaat
B D                Rhesus  tttt--aggttaatttcttggactggaagaaagattgatccagtaggtgttgattatattcttcaaaaat
B D              Marmoset  tttt--agattaatttcttggactggaagaaagattgatccagtaggtgttgattatattcttcagaaat
B D               Tarsier  tttt--agattaatttcttggactggaagaaagattgacccagtaggcgttgattatattcttcaaaaat
B D              Bushbaby  tttt--agattaatttcttggactggaagaaagattgatccagtaggtgttgattatattcttcaaaaac
B D            Tree shrew  --tt--agattaatttcctggactggaaggaagattgatccagtaggtgttgattatatccttcaaaaat
B D  Malayan flying lemur  tttt--agattaatttcttggactggaagaaagattgatccagtaggcgttgattatattcttcaaaaat
B D                   Pig  tttt--agattaatttcttggactggaagaaagattgatccagtaggtgttgattatattcttcaaaaat
B D               Dolphin  tttt--agattaatttcttggactggaagaaaaattgatccagtaggcgttgattatattcttcaaaaat
B D                   Cow  tttt--agattaatttcttggactggaagaaaaattgatccagtaggcgttgattatattcttcaaaaat
B D                 Sheep  tttt--agattaatttcttggactggaagaaaaattgatccagtaggtgttgattatattcttcaaaaat
B D                 Horse  tttt--agattaatttcttggactggaagaaagattgatccagtaggtgttgattatattcttcaaaaat
B D      Chinese pangolin  ttat--agattaatttcttggactggaagaaagattgatccagtaggcattgattatactcttcaaaaat
B D                   Dog  tttt--agattaatttcttggactggaagaaagattgatccagtaggtgttgattatattcttcaaaaac
B D    Hawaiian monk seal  tttt--agattaatatcttggactggaagaaagattgatccagtgggtgttgattacattcttcaaaaac
B D              Hedgehog  cttt--agattaatttcttggactggaaggaagattgacccagtgggtgttgactatattcttcaaaagc
B D                 Shrew  cttt--agattaatttcctggactggaagaaagatcgatccagtaggtgttgattatattcttcaaaaac
B D              Elephant  tttt--agattaatttcttggactggaagaaagattgatcccgtaggcgttgattatattcttcaaaaat
B D                Tenrec  tttt--agattaatctcttggactggaagaaaaattgatcctgtaggagttgattatattcttcaaaaat
B D               Opossum  tttttaaggttaatttcctggactggaagaaaaattgacccagtaggtgttgattacattcttcaaaaat
B D               Chicken  ttta--agattaatatcctggactgggaggaaaatcgaccctgttggtgttgactacatcctccaaaagc
B D         X. tropicalis  tttt--aggcttatttcatggacaggaaggaaaattgacccagttggtgttgattacatccttcagaagt
B D             Zebrafish  tttc--aggttgatctcttggacgggtcgtaagatcgatccagtaggagtggactacattctgcagaagc
B D               Lamprey  -ccc--aggctcatctcgtggacgggccagaagatcgaccccgttggcgtggactacatcctgcagaagc

                    Mouse  tgggctttcaccatgccaggactactattcccaaatggcttcagagaggagtgatggacccactggacaa
                      Rat  tgggctttcaccatgccaggactactattcccaaatggcttcagagaggagtgatggacccactggataa
            GCF_003668045  tgggctttcaccatgccaggactactattcccaaatggcttcagagaggagtgatggatcccctggacaa
                   Beaver  tgggcttccatcatgccaggactactattcctaagtggcttcagagaggagtcatggacccactggacaa
                 Squirrel  tgggctttcatcatgccaggacaaccattcctaaatggcttcagagaggagtcatggacccactggacaa
               Guinea pig  tgggttttcaccatgccaggactactattccaaaatggctacagagaggagtcatggacccactagacaa
                   Rabbit  tgggctttcatcatgccaggactactattcctaaatggcttcagagaggagtcatggacccactggacaa
                     Pika  tgggctttcatcatgccagaacaactattcctaaatggcttcagagaggggtcatggacccactggacaa
                    Human  tgggctttcatcatgctaggactactattcctaaatggcttcaaagaggagtcatggatccactggacaa
                    Chimp  tgggctttcatcatgctaggactactattcctaaatggcttcaaagaggagtcatggatccactggacaa
                   Bonobo  tgggctttcatcatgctaggactactattcctaaatggcttcaaagaggagtcatggatccactggacaa
                  Gorilla  tgggctttcatcatgctaggactactattcctaaatggcttcaaagaggagtcatggatccactggacaa
                   Rhesus  tgggctttcatcatgctaggactactattcctaaatggcttcaaagaggagtcatggatccactggacaa
                 Marmoset  tgggctttcatcatgctagaactactattcctaaatggcttcaaagaggagtcatggatccactggacaa
                  Tarsier  tgggctttcatcatgccaggactactattcctaaatggcttcagagaggagtcatggacccactagacaa
                 Bushbaby  tgggctttcatcatgccaggactactattcctaaatggcttcagagaggagtcatggacccactggacaa
               Tree shrew  tgggctttcatcatgccaggactactattcctaaatggcttcagagaggagtcatggacccactggataa
     Malayan flying lemur  tgggctttcatcatgccaggactactattcctaaatggcttcagagaggagtcatggatccactggacaa
                      Pig  tgggctttcatcatgccaggactactattcctaaatggcttcaaagaggagtcatggacccactggacaa
                  Dolphin  tgggctttcatcatgccaggactactattcctaagtggcttcaaagaggagttatggacccactggacaa
                      Cow  tgggctttcatcatgccaggactactattcctaaatggcttcaaagaggagtcatggatccactggacaa
                    Sheep  tgggctttcatcatgccaggactactattcctaaatggcttcaaagaggagtcatggatccactggacaa
                    Horse  tgggctttcatcatgccaggactactattcctaaatggcttcaaagaggagtcatggacccactggacaa
         Chinese pangolin  tgggcttccctcatgctgggaccactacccctaaatggctttagaggggagtcatggacccactggacaa
                      Dog  tgggcttccatcatgccaggactactattcctaaatggcttcaaagaggagtcatggatccacttgacaa
       Hawaiian monk seal  tgggcttccatcatgccaggactactattcctaaatggcttcaaagaggagtcatggacccacttgacaa
                 Hedgehog  tgggcttccatcatgccaggactaccatccccaagtggctccagaggggggttatggacccactggacaa
                    Shrew  tgggctttcatcatgccaggactactattcctaagtggcttcaaagaggagtcatggacccattggacaa
                 Elephant  tgggctttcatcatgccaggactactattcctaaatggcttcagagaggagtcatggacccactggacaa
                   Tenrec  tgggcttccatcacgcgaggactactattcctaaatggcttcagagaggagtcatggaccccctggacaa
                  Opossum  tgggttttcaccatgccagaaccactattcccaaatggcttcaaagaggagtcatggacccactggataa
                  Chicken  tgggcttccaccacgccaggactaccatccccaagtggctgcagcgcggggtgatggatcctttggacaa
            X. tropicalis  taggctttcaccacgccagaactactattccaaaatggttacagcgtggagtaatggatcctctggataa
                Zebrafish  tgggtttccatcacgccagaaccacaatccccaagtggctgcaacgaggagtgatggaccctctggataa
                  Lamprey  tgggcttccaccacgcgcgcaccaccatccccaagtggctgcagcgcggcgtcatggacccgctcgacaa

                    Mouse  ggtgctgtccgttctcatcaaaaaactcggaactgccct
                      Rat  ggtgctatccgttctcatcaaaaaactcgggactgccct
            GCF_003668045  ggtgctgtccgttctcataaaaaaacttggcactgcact
                   Beaver  ggttctgtctgttcttatcaaaaagcttggtactgcact
                 Squirrel  ggttctgtctgttcttatcaaaaagcttggcactgcact
               Guinea pig  agttctgtcagttcttatcaaaaagctgggtaccgcact
                   Rabbit  agtcttgtcagttctcatcaaaaagcttggtactgcact
                     Pika  ggttttatcagttctcatcaaaaagcttggtactgcact
                    Human  ggttctgtcagttcttatcaaaaagctcggtactgcact
                    Chimp  ggttctgtcagttcttatcaaaaagctcggtactgcact
                   Bonobo  ggttctgtcagttcttatcaaaaagctcggtactgcact
                  Gorilla  ggttctgtcagttcttatcaaaaagctcggtactgcact
                   Rhesus  ggttctgtcagttcttatcaaaaagctcggtactgcact
                 Marmoset  ggttctgtcagttcttatcaaaaagctcggtactgcact
                  Tarsier  ggttctgtcagttcttatcaaaaagcttggtactgcact
                 Bushbaby  ggttctgtcagttcttatcaaaaagcttggtactgcact
               Tree shrew  ggttctgtcagttcttatcaaaaagcttgggactgcact
     Malayan flying lemur  ggttctgtcagttcttatcaaaaagcttggtactgcact
                      Pig  ggttctgtcagttcttatcaaaaaacttggtactgcact
                  Dolphin  ggttctgtcagttcttattaaaaaacttggtactgcact
                      Cow  ggttctgtcagttcttattaaaaaactcggtactgcact
                    Sheep  ggttctgtcagttcttattaaaaaactcggtactgcact
                    Horse  ggtcctgtcagttcttatcaaaaagctcgggactgcact
         Chinese pangolin  agttctgtcagttcttatcaaaaaactcggtactgcact
                      Dog  ggttctatcagttcttataaaaaaactgggtactgcact
       Hawaiian monk seal  ggttctgtcagtacttataaaaaaactcggtactgcact
                 Hedgehog  ggttctatcagttcttatcaagaagctcggcactgcact
                    Shrew  agttttgtctgttcttatcaaaaagcttggtaccgcact
                 Elephant  ggttctgtcagttcttatcaaaaagcttggcactgcact
                   Tenrec  agttctgtcggttcttatcaagaagcttggtactgcact
                  Opossum  ggtgctctcagtcctcatcaaaaagcttggcacctcact
                  Chicken  ggttctgtccgttctgatcaagaaacttggtactgcact
            X. tropicalis  ggtcctttcagtcctcataaagaaacttggctctgccct
                Zebrafish  agtcctgtctgttctcattaagaaactgggcacggctct
                  Lamprey  ggtgctctccgtgctcatcgagcgcctcgtgctggcgtt

Alignment block 20 of 23 in window, 37106644 - 37106686, 43 bps 
B D                 Mouse  gcaggatgagaaggagaagaaagg---aaaggacaaagaagaacac
B D                   Rat  gcaggatgagaaggagaagaaagg---aaaagacaaagaagaacac
            GCF_003668045  gcaggatgaaaaggaaaagaaagg---aaaagacaaagaagaacac
                   Beaver  acaggacgaaaaggaaaggaaagg---aaaagacaaagaagaacac
B D              Squirrel  acaggacgaaaaggaaaagaaagg---aaaagacaaagaagaacac
B D            Guinea pig  acaggacgaaaaggagaagaaagg---caaagacaaagaagagcac
B D                Rabbit  acaggatgaaaaggaaaagaaagg---aaaagacaaagaagaacac
B D                  Pika  acaggatgagaaggaaaagaaagg---aaaagacaaagaagaacac
B D                 Human  acaggatgaaaaggaaaagaaagg---caaagacaaagaagaacac
B D                 Chimp  acaggatgaaaaggaaaagaaagg---caaagacaaagaagaacac
B D                Bonobo  acaggatgaaaaggaaaagaaagg---caaagacaaagaagaacac
B D               Gorilla  acaggatgaaaaggaaaagaaagg---caaagacaaagaagaacac
B D                Rhesus  acaggatgaaaaggaaaagaaagg---caaagacaaagaagaacac
B D              Marmoset  acaggatgaaaaggaaaagaaagg---aaaagacaaagaagaacac
B D               Tarsier  acaggacgaaaaggaaaagaaagg---aaaagacaaagaagaacac
B D              Bushbaby  acaggatgaaaaggagaagaaagg---aaaagacaaagaagaacac
B D            Tree shrew  acaagatgaaaaggaaaagaaagg---aaaggacaaagaagaacac
B D  Malayan flying lemur  acaggatgaaaaggagaagaaagg---aaaagacaaagaagaacac
B D                   Pig  acaggatgaaaaggaaaagaaagg---aaaagacaaagaagaacac
B D               Dolphin  acaggatgaaaaggaaaagaaagg---aaaagataaagaagaacac
B D                   Cow  acaggatgaaaaggaaaagaaagg---aaaagacaaagaagaacac
B D                 Sheep  acaggatgaaaaggaaaagaaagg---aaaagacaaagaagaacac
B D                 Horse  acaggacgaaaaggaaaagaaagg---gaaagacaaagaagaacac
B D                   Dog  acaggatgaaaaggaaaagaaagg---aaaagacaaagaagaacac
B D    Hawaiian monk seal  acaggatgaaaaggaaaagaaagg---aaaagacaaagaagaacac
B D              Hedgehog  acaggacgaaaaggagaagaaagg---aaaagacagggaagaacac
B D                 Shrew  acaggatgaaaaggaaaagagagg---aaaagacaaagaagaacac
B D              Elephant  acaggacgaaaaggaaaagaaagg---aaaagacaaagaagaacac
B D                Tenrec  acaggatgaaaaggaaaagaaagg---caaagacaaagaagagcac
B D               Opossum  ccaagatgaaaaggaaaggaaagg---aaaggacaaggaagaacac
B D               Chicken  acaggacgaaaaggaaaagaaagg---aaaagacaaagaggaatac
B D         X. tropicalis  tcaagatgaaaaagaaaagaaggg---gaaggacaaagaagagcac
B D             Zebrafish  gcaggacgagagggagaagaaagggcaaagagacaaagacgagcat
B D               Lamprey  gcagcacgagcgcgagcgcaaggc---ctcgtccaaggacgagcac

Alignment block 21 of 23 in window, 37106687 - 37106688, 2 bps 
B D                 Mouse  t------------------a
B D                   Rat  t------------------a
            GCF_003668045  t------------------a
                   Beaver  t------------------a
B D              Squirrel  t------------------a
B D            Guinea pig  t------------------a
B D                Rabbit  t------------------a
B D                  Pika  t------------------a
B D                 Human  t------------------a
B D                 Chimp  t------------------a
B D                Bonobo  t------------------a
B D               Gorilla  t------------------a
B D                Rhesus  t-------------------
B D              Marmoset  t-------------------
B D               Tarsier  t------------------a
B D              Bushbaby  t-------------------
B D            Tree shrew  t-------------------
B D  Malayan flying lemur  t------------------a
B D                   Pig  t-----------------aa
B D               Dolphin  t------------------a
B D                   Cow  t------------------a
B D                 Sheep  t------------------a
B D                 Horse  t------------------a
B D                   Dog  t------------------a
B D    Hawaiian monk seal  t------------------a
B D              Hedgehog  t-------------------
B D                 Shrew  taaaaaaaaaaaaaaaaaaa
B D              Elephant  t-------------------
B D                Tenrec  t-------------------
B D               Opossum  t-------------------
B D               Chicken  t------------------g
B D         X. tropicalis  t------------------g
B D             Zebrafish  t------------------a

Alignment block 22 of 23 in window, 37106689 - 37106690, 2 bps 
B D                 Mouse  ga
B D                   Rat  ga
            GCF_003668045  ga
                   Beaver  aa
B D              Squirrel  gg
B D            Guinea pig  aa
B D                Rabbit  aa
B D                  Pika  aa
B D                 Human  aa
B D                 Chimp  aa
B D                Bonobo  aa
B D               Gorilla  aa
B D                Rhesus  aa
B D              Marmoset  aa
B D               Tarsier  aa
B D              Bushbaby  aa
B D            Tree shrew  aa
B D  Malayan flying lemur  aa
B D                   Pig  aa
B D               Dolphin  aa
B D                   Cow  aa
B D                 Sheep  aa
B D                 Horse  aa
B D                   Dog  aa
B D    Hawaiian monk seal  aa
B D                 Shrew  aa
B D              Elephant  aa
B D                Tenrec  aa
B D               Chicken  aa
B D         X. tropicalis  aa
B D               Opossum  --
B D              Hedgehog  --

Alignment block 23 of 23 in window, 37106691 - 37106774, 84 bps 
B D                 Mouse  atagcaattccatctgtga--aacacttga-ctct----gttaatttctattacactgcaa--tt-----
B D                   Rat  atagtaactccatctgtga--agtacctga-ctctgtccgttaagttctg--gcactgcaa---t-----
            GCF_003668045  atagtagcttaatctgtga--aaaacctga-ttatatccgttaagttttattacactggatt-tt-----
                   Beaver  gtattaacttgatctgtgagcaaattctgt-ttgtgtccattaagcttcagtacatgagtg--at-----
B D              Squirrel  agagtaacttgatccatgaa-aagatttga-gtgtgtccattaagttttgctacactggag--tg-----
B D            Guinea pig  a-agtaac--aatctgtgaataaattgtga-ttgtgtctgttaagttttattacactggggt-gt-----
B D                Rabbit  a-cataacttgatctgtgaacaaattatga-ctgtatccattcagttttattacactgaag--tg-----
B D                  Pika  a-agtaaa--aaactgtgaacaa---atga-ttgtgtccgttaagttttattacaaggatg--tg-----
B D                 Human  aaagtaatttgatctgtgaacaaattatga-ttgtgtct-----gttttattacactggagt-gt-----
B D                 Chimp  aaagtaatttgatctgtgaacaaattatga-ttgtgtct-----gttttattacactggagt--t-----
B D                Bonobo  aaagtaatttgatctgtgaacaaattatga-ttgtgtct-----gttttattacactggagt-gt-----
B D               Gorilla  aaagtaatttgatctgtgaacaaattatga-ttgtgtct-----gttttattacac--gagt-gt-----
B D                Rhesus  aaagtaatttgatctttgaacaa---atga-ttgtgtctgttaagttttattacactggagt-gt-----
B D              Marmoset  aaagtaatttgatctgtgaacaaattatga-ttgtgtccgttaagttttattatactggagt-gt-----
B D               Tarsier  aatgttatttgatctgtgaacaaattatga-ttgtgtccgttaagttttattacactggagt-gttattc
B D              Bushbaby  aaagttactcaatctgtgaactaattatga-ttgtgtccattaagttttattacactgaaggagt-----
B D            Tree shrew  aatgtaacctgatctgtgaacaaattatgatttttgtccgttaaattttattacactggaga-ttt----
B D  Malayan flying lemur  aaagtaacttgatctgtgaacaaattatga-ttgtatctgttaagttttactaccctggagt-gtt----
B D                   Pig  aaagtaacttcatctgtgaacaaattttga-ttctgtccgttaagctttattacactggagt-gt-----
B D               Dolphin  aatgcaacttgatctgtgaacaaattttga-ttctgtctgttaagctttattacactggagt-gt-----
B D                   Cow  aaagtaacttaatctgtgaacaaactttga-ttctgtccgttaagctttattacactggagt-gt-----
B D                 Sheep  aaagtaacttaatctgtgaacaaactttga-ttctgtccgttaagctttattacactggagt-gt-----
B D                 Horse  aaagtagcttgatttgtgaacaaattatga-ttgtgtccgttatgttttattacactggagt-gt-----
B D                   Dog  a---tcacttgatctgtgaacaaattatga-ttgtgtccgttaagttttattacactggagt-gt-----
B D    Hawaiian monk seal  aaagtaacttgatctgtgaacaaattatga-ttgtgtccattaagttttattacactggagt-gt-----
B D              Hedgehog  aacgctcttg--tctgtg-gcaggtgatga-ctatgccccttaagtttcattatactggagg-gt-----
B D                 Shrew  aaaacaagtt--tctgtgaacaaattatga-tcttgttgc-tacattttattacactggagt-gt-----
B D              Elephant  aaaataacttgagctgtgaacaatttatga-ttgtgtcc-----g-tttattacactggagt-tt-----
B D                Tenrec  aaatga----gatctgtgaacaaattatga-caatgtccgttaag-tttattacactggagt-tt-----
B D               Opossum  aacgcagatctatccagaaacaaagtagaatttatgcccattaag-tttacgaccctgaag--gg-----
B D               Chicken  gcgataatgtgac---------aaccacca-ttccgt---ttgatttttatca-----aagt-gt-----

                    Mouse  t--------t-----------------------t---tt-cagc--------a-aaa-tttaa--atggt
                      Rat  t--------t-----------------------t---tt-cagc--------ataac-tttaa--atggt
            GCF_003668045  t--------t-----------------------t---tt-cagc--------ataacttttaa--gtatt
                   Beaver  a--------t-----------------------t---tt-aagt--------tt----attaa--atatg
                 Squirrel  t--------t-----------------------t---tt-taat--------------ttaaa--ttata
               Guinea pig  t--------t-----------------------t---tt-aaat--------atgat-tttaa--atatg
                   Rabbit  t--------t-----------------------t---ttatagt--------ataat-tttaa--ctata
                     Pika  t--------t-----------------------t---tt-tagt--------ataat-tt--------ta
                    Human  t--------t-----------------------t---tt-tagtat-----aataat-ttgaa--atata
                    Chimp  t--------t-----------------------t---tt-tagtat-----aataat-tttaa--atata
                   Bonobo  t--------t-----------------------t---tt-tagtat-----aataat-tttaa--atata
                  Gorilla  t--------t-----------------------t---tt-tagtat-----aataat-tttaa--atata
                   Rhesus  t--------t-----------------------t---tt-tagtat-----aataat-tttaa--atata
                 Marmoset  t--------t-----------------------t---tt-tagt--------atgat-tttaa--atata
                  Tarsier  t--------t-----------------------t---tt-tagt--------atact-tttaa--atata
                 Bushbaby  t--------t-----------------------t---tt-taat--------ataat-cttaa--atata
               Tree shrew  t--------t-----------------------t---tt-tagtat-----aataat-tttaa--atata
     Malayan flying lemur  t--------t-----------------------t---tt-tagc--------ataat-tttaa--atata
                      Pig  t-ggg----gt--------------------------tt-ttgtatagtaaaattat-tttaa--atata
                  Dolphin  t-gggttttttgtgtt-----------------t---tt-ttgtatagtaaaattat-tttaa--atata
                      Cow  t-ggg----gtgggtg-----------------g---gt-ttgtataataaaattat-tttaa--atata
                    Sheep  tgggg----gtgggtg-----------------g---gt-ttgtataataaaattat-tttaaatatata
                    Horse  t--------tt----------------------t---tt-ttgcatagtaaaattat-tttaa--atata
                      Dog  t--------ttt---------------------t---tt-ttgtatagtaaaattat-tttca--gtata
       Hawaiian monk seal  t--------ttttttttc---------------t---tt-ttgtatagtaaaattat-tttca--gtata
                 Hedgehog  t--------tttttgttttgttttgttttgttat---tt-ttgtacagtaaaat------------tatt
                    Shrew  t--------t-----------------------t---tt-ttgtatagtaaaat----tttaa--ataca
                 Elephant  t--------t-----------------------t---tt-taatat-----aattat-tttaa--atata
                   Tenrec  t--------t-----------------------ttaatg-taacaa-----aattat-tttaa--atata
                  Opossum  t--------g-----------------------t---tc-ttgtataataaaattat-tttct--gtata
                  Chicken  t--------t-----------------------t---at-taca----------agg-tttat--atatg

                    Mouse  actt-t
                      Rat  actt-c
            GCF_003668045  actt-t
                   Beaver  gttt-t
                 Squirrel  actt-t
               Guinea pig  aatt-t
                   Rabbit  actt-t
                     Pika  actt-t
                    Human  actt-t
                    Chimp  actt-t
                   Bonobo  actt-t
                  Gorilla  actt-t
                   Rhesus  actt-t
                 Marmoset  actt-t
                  Tarsier  actt-t
                 Bushbaby  actt-t
               Tree shrew  actt-t
     Malayan flying lemur  ac---t
                      Pig  actt--
                  Dolphin  actt--
                      Cow  actt--
                    Sheep  actt--
                    Horse  acttaa
                      Dog  actt--
       Hawaiian monk seal  actt--
                 Hedgehog  tttt--
                    Shrew  actt--
                 Elephant  actt-t
                   Tenrec  actt-t
                  Opossum  attt-a
                  Chicken  gttt-a

View table schema

Go to Conservation track controls

Data last updated at UCSC: 2020-12-20


This track shows multiple alignments of 35 vertebrate species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package.

The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track. The conservation measurements were created using the phastCons package from Adam Siepel at Cold Spring Harbor Laboratory.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data.

See also: lastz parameters and other details for the chaining minimum score and gap parameters used in these alignments.

PhastCons (which has been used in previous Conservation tracks) is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Missing sequence in the assemblies is highlighted in the track display by regions of yellow when zoomed out and Ns displayed at base level (see Gap Annotation, below).

MouseMus musculus Jun. 2020 (GRCm39/mm39)Jun. 2020 (GRCm39/mm39)reference species
BeaverCastor canadensis Feb. 2017 (C.can genome v1.0/casCan1)Feb. 2017 (C.can genome v1.0/casCan1)reciprocal best
BonoboPan paniscus May 2020 (Mhudiblu_PPA_v0/panPan3)May 2020 (Mhudiblu_PPA_v0/panPan3)syntenic net
BushbabyOtolemur garnettii Mar. 2011 (Broad/otoGar3)Mar. 2011 (Broad/otoGar3)reciprocal best
ChickenGallus gallus Mar. 2018 (GRCg6a/galGal6)Mar. 2018 (GRCg6a/galGal6)maf net
ChimpPan troglodytes Jan. 2018 (Clint_PTRv2/panTro6)Jan. 2018 (Clint_PTRv2/panTro6)syntenic net
Chinese hamsterCricetulus griseus Jun. 2020 (GCF_0003668045.3 CriGri-PICRH-1.0)Jun. 2020 (GCF_0003668045.3 CriGri-PICRH-1.0)syntenic net
Chinese pangolinManis pentadactyla Aug 2014 (M_pentadactyla-1.1.1/manPen1)Aug 2014 (M_pentadactyla-1.1.1/manPen1)reciprocal best
CowBos taurus Apr. 2018 (ARS-UCD1.2/bosTau9)Apr. 2018 (ARS-UCD1.2/bosTau9)reciprocal best
DogCanis lupus familiaris Mar. 2020 (UU_Cfam_GSD_1.0/canFam4)Mar. 2020 (UU_Cfam_GSD_1.0/canFam4)syntenic net
DolphinTursiops truncatus Oct. 2011 (Baylor Ttru_1.4/turTru2)Oct. 2011 (Baylor Ttru_1.4/turTru2)reciprocal best
ElephantLoxodonta africana Jul. 2009 (Broad/loxAfr3)Jul. 2009 (Broad/loxAfr3)reciprocal best
GorillaGorilla gorilla gorilla Aug. 2019 (Kamilah_GGO_v0/gorGor6)Aug. 2019 (Kamilah_GGO_v0/gorGor6)syntenic net
Guinea pigCavia porcellus Feb. 2008 (Broad/cavPor3)Feb. 2008 (Broad/cavPor3)syntenic net
Hawaiian monk sealNeomonachus schauinslandi Jun. 2017 (ASM220157v1/neoSch1)Jun. 2017 (ASM220157v1/neoSch1)syntenic net
HedgehogErinaceus europaeus May 2012 (EriEur2.0/eriEur2)May 2012 (EriEur2.0/eriEur2)reciprocal best
HorseEquus caballus Jan. 2018 (EquCab3.0/equCab3)Jan. 2018 (EquCab3.0/equCab3)syntenic net
HumanHomo sapiens Dec. 2013 (GRCh38/hg38)Dec. 2013 (GRCh38/hg38)syntenic net
LampreyPetromyzon marinus Dec. 2017 (Pmar_germline 1.0/petMar3)Dec. 2017 (Pmar_germline 1.0/petMar3)maf net
Malayan flying lemurGaleopterus variegatus Jun. 2014 (G_variegatus-3.0.2/galVar1)Jun. 2014 (G_variegatus-3.0.2/galVar1)maf net
MarmosetCallithrix jacchus May 2020 (Callithrix_jacchus_cj1700_1.1/calJac4)May 2020 (Callithrix_jacchus_cj1700_1.1/calJac4)syntenic net
OpossumMonodelphis domestica Oct. 2006 (Broad/monDom5)Oct. 2006 (Broad/monDom5)maf net
PigSus scrofa Aug. 2011 (SGSC Sscrofa10.2/susScr3)Aug. 2011 (SGSC Sscrofa10.2/susScr3)reciprocal best
PikaOchotona princeps May 2012 (OchPri3.0/ochPri3)May 2012 (OchPri3.0/ochPri3)reciprocal best
RabbitOryctolagus cuniculus Apr. 2009 (Broad/oryCun2)Apr. 2009 (Broad/oryCun2)reciprocal best
RatRattus norvegicus Jul. 2014 (RGSC 6.0/rn6)Jul. 2014 (RGSC 6.0/rn6)syntenic net
RhesusMacaca mulatta Feb. 2019 (Mmul_10/rheMac10)Feb. 2019 (Mmul_10/rheMac10)syntenic net
SheepOvis aries Nov. 2015 (Oar_v4.0/oviAri4)Nov. 2015 (Oar_v4.0/oviAri4)syntenic net
ShrewSorex araneus Aug. 2008 (Broad/sorAra2)Aug. 2008 (Broad/sorAra2)reciprocal best
SquirrelSpermophilus tridecemlineatus Nov. 2011 (Broad/speTri2)Nov. 2011 (Broad/speTri2)reciprocal best
TarsierTarsius syrichta Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)reciprocal best
TenrecEchinops telfairi Nov. 2012 (Broad/echTel2)Nov. 2012 (Broad/echTel2)reciprocal best
Tree shrewTupaia belangeri Dec. 2006 (Broad/tupBel1)Dec. 2006 (Broad/tupBel1)reciprocal best
X. tropicalisXenopus tropicalis Jul. 2016 (Xenopus_tropicalis_v9.1/xenTro9)Jul. 2016 (Xenopus_tropicalis_v9.1/xenTro9)maf net
ZebrafishDanio rerio May 2017 (GRCz11/danRer11)May 2017 (GRCz11/danRer11)maf net

Table 1. Genome assemblies included in the 35-way Conservation track.
* Data download only, browser not available.

Display Conventions and Configuration

The track configuration options allow the user to display either the vertebrate or placental mammal conservation scores, or both simultaneously. In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the size of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the mouse genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the mouse genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the mouse genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the mouse sequence at those alignment positions relative to the longest non-mouse sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation, depending on the species chosen (Table 2).

Gene TrackSpecies
Known Geneshuman
Ensembl Genestree shrew, opossum
NCBI RefSeqbeaver, bonobo, bushbaby, chicken, Chinese hamster, chimp, cow, elephant, gorilla, guinea pig, hawaiian monk seal, hedgehog, horse, malayan flying lemur, marmoset, mouse, pig, pika, rabbit, rat, rhesus, sheep, shrew, squirrel, tarsier, tenrec, X. tropicalis, zebrafish
Xeno RefGeneChinese pangolin, dog, dolphin, lamprey
Table 2. Gene tracks used for codon translation.


Pairwise alignments with the mouse genome were generated for each species using lastz from repeat-masked genomic sequence. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net. For more information about the chaining and netting process and parameters for each species, see the description pages for the Chain and Net tracks.

An additional filtering step was introduced in the generation of the 35-way conservation track to reduce the number of paralogs and pseudogenes from the high-quality assemblies and the suspect alignments from the low-quality assemblies: the pairwise alignments of high-quality mammalian sequences (placental and marsupial) were filtered based on synteny; those for 2X mammalian genomes were filtered to retain only alignments of best quality in both the target and query ("reciprocal best").

The resulting best-in-genome pairwise alignments were progressively aligned using multiz/autoMZ, following the tree topology diagrammed above, to produce multiple alignments. The multiple alignments were post-processed to add annotations indicating alignment gaps, genomic breaks, and base quality of the component sequences. The annotated multiple alignments, in MAF format, are available for bulk download. An alignment summary table containing an entry for each alignment block in each species was generated to improve track display performance at large scales. Framing tables were constructed to enable visualization of codons in the multiple alignment display.

Conservation scoring was performed using the PhastCons package (A. Siepel), which computes conservation based on a two-state phylogenetic hidden Markov model (HMM). PhastCons measurements rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The vertebrate tree model for this track was generated using the phyloFit program from the phastCons package (REV model, EM algorithm, medium precision) using multiple alignments of 4-fold degenerate sites extracted from the 28-way human(hg18) alignment (msa_view). The 4d sites were derived from the Oct 2005 Gencode Reference Gene set, which was filtered to select single-coverage long transcripts. The phastCons parameters used for the conservation measurement were: expected-length=45, target-coverage=.3 and rho=.31

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 2005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Unlike many conservation-scoring programs, note that phastCons does not rely on a sliding window of fixed size; therefore, short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. 2005.

PhastCons currently treats alignment gaps as missing data, which sometimes has the effect of producing undesirably high conservation scores in gappy regions of the alignment. We are looking at several possible ways of improving the handling of alignment gaps.

Data Access

You can access this data in the Table Browser for position or identifier based queries in multiple formats. Downloads for data in this track are available in the following locations:


This track was created using the following programs:

  • Alignment tools: lastz (formerly blastz) and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
  • Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
  • Conservation scoring: PhastCons, phyloFit, tree_doctor, msa_view by Adam Siepel while at UCSC, now at Cold Spring Harbor Laboratory
  • MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
  • Tree image generator: phyloPng by Galt Barber, UCSC
  • Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

The phylogenetic tree is based on Murphy et al. (2001) and general consensus in the vertebrate phylogeny community as of March 2007.


Phylo-HMMs and phastCons:

Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 2005. pp. 325-351.

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 2005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1206396


Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11484-9. PMID: 14500911; PMC: PMC208784


Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383317

Lastz (formerly Blastz):

Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 2002:115-26. PMID: 11928468

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 2007.

Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res. 2003 Jan;13(1):103-7. PMID: 12529312; PMC: PMC430961

Phylogenetic Tree:

Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 2001 Dec 14;294(5550):2348-51. PMID: 11743200