Multiz Alignments of 35 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 76 in window, 37102582 - 37102622, 41 bps 
B D                 Mouse  atgga-------tctatgtaaat-ctttatcgatg-----------gaagaggcctttgc
B D                   Rat  atgga-------tccatgtaaat-ctttactgagg-----------gaagaggcctttgc
            GCF_003668045  atgga-------tctgtgtacat-cttta---atg-----------ggaggagcctt---
                   Beaver  atgga-------cctatgtaaat-ctttactgatgggaaga-----ggaggagacat-gt
B D              Squirrel  gtgta--------ctgcttgcct-cattattaaag-----a-----gaagaggactc-gt
B D                Rabbit  atgtaaatgcatcctatttaaat-cttaattaatg-----g-----gaagagtactt-at
B D                  Pika  attga-------cctttgtaact-cttaatt-----------------agaatattc-at
B D                 Human  ataga-------cctatataaat-ccttattaatg-----g-----gaagatgactc-at
B D                 Chimp  ataga-------cctatataaat-ccttattaatg-----g-----gaagatgactc-at
B D                Bonobo  ataga-------cctatataaat-ccttattaatg-----g-----gaagatgactc-at
B D               Gorilla  ataga-------cctatataaat-ccttattaata-----g-----gaagatgactc-at
B D                Rhesus  gcaga-------cctatgtaaat-ccttattaatg-----ggaa--gaagatgactc-at
B D              Marmoset  ataga-------cctatataaat-cctta-----------------gaagattactc-at
B D               Tarsier  ---ga-------cctatgtaaat-tcgtattaatg-----ggaa--gaggaaaactc-tt
B D              Bushbaby  --------------tatgtaaac-tcttactacta-----agaa--gagagggactc-at
B D            Tree shrew  atggg-------cctatgtaaat-ccttat-----------------aaga---------
B D  Malayan flying lemur  ataga-------cctatgtaaat-ccttattaatg-----g-----gaaggggattc-at
B D                   Pig  aggga-------tctatgtaaatacattgttaaca-----ggaagaggaagagactt-at
B D               Dolphin  acgga-------cccatgtaaatcccttgttaatg-----ggaagaggaagggactt-at
B D                   Cow  atgga-------cccatgtaaatcccttgttaatg-----ggaag----agggactt-at
B D                 Sheep  atgga-------cccatgtaaatcccttgttaatg-----ggaag----agggactt-at
B D                 Horse  ataga-------ctca----------ttattaaca-----ggaagagaaaggaactt-at
B D      Chinese pangolin  acaga-------cctacatatgtcccttattagtg-----gcaagagaaaggaactt-ac
B D                   Dog  atgaa-------cccatgtcgct-tgttattaaca-----ggaagtgaaagggactt---
B D    Hawaiian monk seal  atgaa-------cccatgtaaatcccttattaaca-----ggaagagaatgggactt-at
B D                 Shrew  ------------------------ctctcttcatg-----ggaagggaaaggaatgt-at
B D              Elephant  ataga-------cccatctaaatccct--ttagca-----ggaagaggaaggaactg-at
B D                Tenrec  acagg-------cccatgtaaaccccttattatca-----ggaagaggaaggaattc-at
B D             Zebrafish  actga-------gtgctgtgaat-------------------------------------
B D            Guinea pig  ============================================================
B D               Opossum  ============================================================
B D              Hedgehog  ============================================================
B D         X. tropicalis  ============================================================
B D               Chicken  ============================================================
B D               Lamprey  ============================================================

Alignment block 2 of 76 in window, 37102623 - 37102628, 6 bps 
B D                 Mouse  ttc---atg
B D                   Rat  tgc---gtg
                   Beaver  ttc---ata
B D              Squirrel  gtt---acc
B D                Rabbit  ctt---att
B D                  Pika  cttagcagt
B D                 Human  ttt---att
B D                 Chimp  ttt---att
B D                Bonobo  ttt---att
B D               Gorilla  ttt---att
B D                Rhesus  ttt---att
B D              Marmoset  ttt---att
B D               Tarsier  ttc---act
B D              Bushbaby  ttc---att
B D            Tree shrew  --------t
B D  Malayan flying lemur  ttc---att
B D                   Pig  ttc---agt
B D               Dolphin  ttc---aat
B D                   Cow  ttc---aat
B D                 Sheep  atc---aat
B D                 Horse  ttc---ata
B D      Chinese pangolin  ttc---ttt
B D                   Dog  ------aag
B D    Hawaiian monk seal  ctc---att
B D                 Shrew  ttc---att
B D              Elephant  gtt---att
B D                Tenrec  ttc---agt
B D               Chicken  ctt---a--
B D            Guinea pig  =========
B D               Opossum  =========
B D              Hedgehog  =========
           GCF_003668045  ---------
B D             Zebrafish  ---------
B D         X. tropicalis  =========
B D               Lamprey  =========

Inserts between block 2 and 3 in window
B D              Chicken 9bp

Alignment block 3 of 76 in window, 37102629 - 37102630, 2 bps 
B D                 Mouse  ga
B D                   Rat  ga
                   Beaver  aa
B D              Squirrel  aa
B D                Rabbit  aa
B D                  Pika  aa
B D                 Human  aa
B D                 Chimp  aa
B D                Bonobo  aa
B D               Gorilla  aa
B D                Rhesus  aa
B D              Marmoset  aa
B D               Tarsier  aa
B D              Bushbaby  ga
B D            Tree shrew  aa
B D  Malayan flying lemur  ac
B D                   Pig  aa
B D               Dolphin  aa
B D                   Cow  aa
B D                 Sheep  aa
B D                 Horse  aa
B D      Chinese pangolin  aa
B D                   Dog  aa
B D    Hawaiian monk seal  aa
B D                 Shrew  gc
B D              Elephant  aa
B D                Tenrec  ac
B D               Opossum  ta
B D               Chicken  aa
B D            Guinea pig  ==
B D              Hedgehog  ==
           GCF_003668045  --
B D             Zebrafish  --
B D         X. tropicalis  ==
B D               Lamprey  ==

Alignment block 4 of 76 in window, 37102631 - 37102650, 20 bps 
B D                 Mouse  atttttta-c--tgt-------aaca--------------------t-cct
B D                   Rat  atttttca-c--tgt-------aaaa--------------------cgcct
            GCF_003668045  gtttcata-c--tgt-------aaaa--------------------gaact
                   Beaver  atatt-ta-c--cat-------aaaa--------------------gaaca
B D              Squirrel  gactttca-c--tgt-------aaca--------------------gaact
B D                Rabbit  atgtttta-c--tat-------aaaa--------------------gaact
B D                  Pika  atgcttca-t--gat-------aaaa--------------------gaact
B D                 Human  atctttta-c--ca-------------------------------------
B D                 Chimp  atctttta-c--ca-------------------------------------
B D                Bonobo  atctttta-c--ca-------------------------------------
B D               Gorilla  atctttta-c--ca-------------------------------------
B D                Rhesus  atctctta-c--ca-------------------------------------
B D              Marmoset  atcttttacc--ca-------------------------------------
B D               Tarsier  atattata-c--tgt-------aaaa--------------------taac-
B D              Bushbaby  at-tttta-t--tat-------agaa--------------------gaac-
B D            Tree shrew  atcct-------tat-------gata--------------------aatc-
B D  Malayan flying lemur  atctttta-c--tat-------aaaa--------------------gaac-
B D                   Pig  ctcttcta-c--tat-------aaaaaaaacaacaaacaaacaaacaaact
B D               Dolphin  -tctttta-c--tgt-------aaaa--------------------gaact
B D                   Cow  -tctttta-a--tat-------agaa--------------------gaact
B D                 Sheep  -tctttta-a--tat-------agaa--------------------gaact
B D                 Horse  acctttt-------t-------aaaa--------------------gaact
B D      Chinese pangolin  atcttttc-c--tgt-------aaaa--------------------caact
B D                   Dog  atatttta-c--tat----------a--------------------gaact
B D    Hawaiian monk seal  atctttta-a--tat----------a--------------------gaact
B D                 Shrew  cattttta-c--tgt--------aaa--------------------gaact
B D              Elephant  atctttta-c--tat-------acaa--------------------gaact
B D                Tenrec  atctttta-c--tat-------aaag--------------------gaact
B D               Opossum  attttcaa-c--tgtttccctaaaca--------------------gaatt
B D               Chicken  tgctattt-c--ca-------------------------------------
B D         X. tropicalis  ttctttta-cattgt------------------------------------
B D             Zebrafish  -tcactga-c--cct------------------------------------
B D            Guinea pig  ===================================================
B D              Hedgehog  ===================================================
B D               Lamprey  ===================================================

Alignment block 5 of 76 in window, 37102651 - 37102657, 7 bps 
B D                 Mouse  t-tatcgt
B D                   Rat  t-tatcat
            GCF_003668045  t-tatcat
                   Beaver  t-tatcat
B D              Squirrel  t-caccat
B D            Guinea pig  t-tatcat
B D                Rabbit  t-tatcat
B D                  Pika  t-aatcat
B D                 Human  --tattat
B D                 Chimp  --tattat
B D                Bonobo  --tattat
B D               Gorilla  --tattat
B D                Rhesus  --tattat
B D              Marmoset  --tattat
B D               Tarsier  --tattat
B D              Bushbaby  tttatcat
B D            Tree shrew  cttatcat
B D  Malayan flying lemur  tttacctt
B D                   Pig  -ttgccat
B D               Dolphin  -ttgccat
B D                   Cow  -ctgccat
B D                 Sheep  -ctgccat
B D                 Horse  -ttgccat
B D      Chinese pangolin  -ttgccat
B D                   Dog  -ttgccat
B D    Hawaiian monk seal  -ttgccat
B D                 Shrew  -t---cat
B D              Elephant  -ttaccat
B D                Tenrec  -ttg-cat
B D               Opossum  -ttctcat
B D               Chicken  --tctgac
B D         X. tropicalis  --ttttgt
B D             Zebrafish  ------gt
B D              Hedgehog  ========
B D               Lamprey  ========

Alignment block 6 of 76 in window, 37102658 - 37102659, 2 bps 
B D                 Mouse  -tt
B D                   Rat  -tt
            GCF_003668045  -ta
                   Beaver  -tg
B D              Squirrel  -tg
B D            Guinea pig  -tg
B D                Rabbit  -tg
B D                  Pika  -tg
B D                 Human  -tg
B D                 Chimp  -tg
B D                Bonobo  -tg
B D               Gorilla  -tg
B D                Rhesus  -tg
B D              Marmoset  -tg
B D               Tarsier  -tg
B D              Bushbaby  -tg
B D            Tree shrew  -tg
B D  Malayan flying lemur  -tg
B D                   Pig  -tg
B D               Dolphin  -tg
B D                   Cow  -tg
B D                 Sheep  -tg
B D                 Horse  -tg
B D      Chinese pangolin  -tg
B D                   Dog  -tg
B D    Hawaiian monk seal  -tg
B D                 Shrew  -tt
B D              Elephant  -tg
B D                Tenrec  -tg
B D               Opossum  -tt
B D               Chicken  -tg
B D         X. tropicalis  -tt
B D             Zebrafish  -tg
B D               Lamprey  tt-
B D              Hedgehog  ===

Inserts between block 6 and 7 in window
B D                Shrew 2bp
B D              Opossum 1bp
B D        X. tropicalis 4bp

Alignment block 7 of 76 in window, 37102660 - 37102801, 142 bps 
B D                 Mouse  cagatgccagcttgaaacccaaggtggagtgcagtgtggtgaccgagttcactgaccacatctgtgtgac
B D                   Rat  cagatgccaacgtgaaacccaaggtggagtgcagtgtggtgacagagttcacggaccacatctgtgtgac
            GCF_003668045  cagatgccaacttgaaacccaaggtggaatgcagtgtggtgacagaatttactgaccacatttgtgtgac
                   Beaver  cagatgccagcttgaagccaaaggtagaatgtagtgtggtgacagagttcaccgatcatatttgtgtgac
B D              Squirrel  cagatgccagcctaaagccaaaggtggaatgcagcgtggtgacagaattcacggaccacatctgtgtgac
B D            Guinea pig  cagacgccaacttgaagccaaaggtagaatgtagtgtggtaacagaattcactgatcacatttgtgtgac
B D                Rabbit  cagatgccaacctaaagccaaaggtggaatgcagtgtggtgacagagttcactgaccatatttgtgtgac
B D                  Pika  cagatgtcaacctgaagccaaaggtggaatgcagtgtggtaacagagttcactgaccacatttgtgtgac
B D                 Human  cagatgccagcctgaagccaaaagtagaatgtagtgtggtgacagagttcactgaccacatttgtgtgac
B D                 Chimp  cagatgccagcctgaagccaaaagtagaatgtagtgtggtgacagagttcactgaccacatttgtgtgac
B D                Bonobo  cagatgccagcctgaagccaaaagtagaatgtagtgtggtgacagagttcactgaccacatttgtgtgac
B D               Gorilla  cagatgccagcctgaagccaaaagtagaatgtagtgtggtgacagagttcactgaccacatttgtgtgac
B D                Rhesus  cagatgccaacctgaagccaaaagtagaatgtagtgtggtgacagagttcactgaccacatttgtgtgac
B D              Marmoset  cagatgccaacctcaagccaaaagtagaatgtagtgtggtgacagagttcactgaccacatttgtgtgac
B D               Tarsier  cagatgccaacttgaagccaaaagtagaatgtagtgtggtgacagagttcactgaccacatttgtgtgac
B D              Bushbaby  cagatgccaacatgaagccaaaagtcgaatgtagtgtggtgacagagttcactgaccatatttgtgtgac
B D            Tree shrew  cagatgccaacctgaaaccaaaggtagaatgtagtgtggtaacagagttcactgaccatatttgtgtgac
B D  Malayan flying lemur  cagatgccaacctgaagccaaaggtagaatgtagtgtggtgactgagttcactgaccacatctgtgtgac
B D                   Pig  cagatgccagcctgaagccaaaggtagaatgcagtgtggtgacagagttcactgaccacatctgtgtgac
B D               Dolphin  cagacgccagcctgaagccaaaggtagaatgcagtgtggtgacagagttcactgaccacatttgtgtgac
B D                   Cow  cagatgccagcctgaagccaaaggtagaatgcagtgtggtgacagagttcactgaccacatctgtgtgac
B D                 Sheep  cagatgccagcctgaagccaaaggtggaatgcagtgtggtgacagagttcactgaccacatctgtgtgac
B D                 Horse  cagatgcaaacctgaagccaaaggtagaatgtagtgtggtgacagagttcaccgaccacatttgtgtgac
B D      Chinese pangolin  cagatgccaacctgaagccaaaggtagaatgtagtgtggtgacagagttcactgaccacatttgtgtgac
B D                   Dog  cagatgccagcctgaagccgaaggtagaatgtagtgtggtgacagagttcactgaccacatttgtgtgac
B D    Hawaiian monk seal  cagatgccagcctgaagccgaaggtagaatgtagtgtggtgacagagttcactgaccacatttgtgtgac
B D              Hedgehog  cagatgcagacctgaagcctaaggtggagtgcagcgtggtgaccgagttcactgaccacatttgtgtgac
B D                 Shrew  cagatgctaacttgaagcccaaggtggaatgcagcgtggttacagagttcactgaccacatctgcgtgac
B D              Elephant  cagacaccaacctgaagccaaaggtagaatgtagtgtggtgacagagtttacggaccacatttgtgtgac
B D                Tenrec  cagatgcccacctgaagccaaaggtagaatgcagtgtggtaacggagttcactgaccacatttgtgtgac
B D               Opossum  cagacaccaacatcaagccgaaggtagaatgtagtgtggtaactgaattcacagaccacatttgtgtgac
B D               Chicken  tagatacaagcgttaaaccaaaggtggaatgcagtgtggtaactgaatttacagaccacatctgtgtaac
B D         X. tropicalis  tagatgacagc---aaacctaaggtggaatgtagtgtggtaacggagtttactgaccatatctgtgtgac
B D             Zebrafish  cagatgccaacagcaaacccaaagtggagtgcagtgtggtgaccgagttcaccgatcacatctgcgtcac
B D               Lamprey  cagatgcatcacggaaaccgaaggtggagtgcagcgttgtgacggagttccgcgaccacatctgcgtgac

                    Mouse  tatggatgccgagctcatcatgtttctccatgatctggtgtcagcatatctcaaagaaaaagaaaagggt
                      Rat  gatggatgctgagctcatcatgtttctccatgatctagtgtcagcatatctgaaagaaaaggaaaagggt
            GCF_003668045  tatggatgctgagctcatcatgtttctccatgatctagtgtcagcatatctgaaggaaaaagaaaagggt
                   Beaver  catggatgctgaactcatcatgtttcttcatgatttagtgtcagcttatctgaaagaaaaagaaaaaggt
                 Squirrel  catggatgctgagctcatcatgtttctccatgatttagtgtcagcttatctcaaagaaaaagaaaaaggt
               Guinea pig  catggatgctgagctcatcatgtttcttcatgatttagtgtcagcttaccttaaagaaaaagaaaaaggt
                   Rabbit  catggatgctgagctcattatgtttctgcatgatctagtgtcagcttatcttaaagaaaaagaaaaaggt
                     Pika  catggatgctgagctcatcatgtttctacatgatctagtgtcagcttatctgaaagaaaaagaaaaaggt
                    Human  tatggatgctgagctcatcatgtttcttcatgatttagtatcagcttatcttaaagaaaaagaaaaaggt
                    Chimp  tatggatgctgagcttatcatgtttcttcatgatttagtgtcagcttatcttaaagaaaaagaaaaaggt
                   Bonobo  tatggatgctgagcttatcatgtttcttcatgatttagtgtcagcttatcttaaagaaaaagaaaaaggt
                  Gorilla  tatggatgctgagctcatcatgtttcttcatgatttagtgtcagcttatcttaaagaaaaagaaaaaggt
                   Rhesus  tatggatgctgagctcatcatgtttcttcatgatttagtgtcagcttatcttaaagaaaaagaaaaaggt
                 Marmoset  tatggatgctgagctcatcatgtttcttcatgatttagtgtcagcttatcttaaagaaaaagaaaaaggt
                  Tarsier  tatggatgctgagctcatcatgtttcttcatgatttagtgtcagcttatcttaaagaaaaagaaaaaggt
                 Bushbaby  tatggatgctgagctcatcatgtttcttcatgatttagtctcagcgtatcttaaagaaaaagaaaaaggt
               Tree shrew  tatggatgctgagctcattatgtttcttcatgatttagtgtcagcttatcttaaagaaaaagaaaaaggt
     Malayan flying lemur  tatggatgctgagctcatcatgtttctccatgatttagtgtcagcttatcttaaagaaaaagaaaaaggt
                      Pig  aatggatgctgagctcatcatgtttcttcatgatttagtgtcagcttatcttaaagaaaaagaaaaaggt
                  Dolphin  gatggacgctgagctcatcatgtttcttcatgatttagtgtcagcttatcttaaagaaaaagaaaaaggt
                      Cow  gatggatgctgagcttatcatgtttcttcatgacttagtatcagcttatcttaaagaaaaagaaaaaggt
                    Sheep  gatggatgctgagctcatcatgtttcttcatgatttagtatcagcttatcttaaagaaaaagaaaaaggt
                    Horse  tatggatgctgagctcatcatgtttcttcatgatttagtgtcggcttatcttaaagaaaaagaaaaaggt
         Chinese pangolin  tatggatgctgagcttatcatgtttcttcatgatttagtgtcggcttatcttaaagaaaaagaaaaaggt
                      Dog  tatggatgctgagctcatcatgttccttcatgatttagtgtctgcttatcttaaggaaaaagaaaaaggt
       Hawaiian monk seal  tatggatgctgagctcatcatgtttcttcatgatttagtgtcggcttatctcaaagaaaaagaaaaaggt
                 Hedgehog  catggacgctgagctcatcatgtttctccatgacctggtgtctgcgtacctgaaagagaaggaaaaaggt
                    Shrew  catggatgctgagctcatcatgttcctccatgatctagtgtctgcttatctgaaagaaaaagaaaaaggt
                 Elephant  tatggatgcagagctcatcatgtttcttcatgatttagtgtcagcttatctaaaagaaaaagaaaaaggt
                   Tenrec  tatggatgctgagctcattatgtttttgcacgatttagtgtcggcttacctaaaagaaaaagaaaaaggt
                  Opossum  gatggacgccgaactgatcatgttccttcatgacttagtgtccgcctatcttaaagaaaaagaaaaaggt
                  Chicken  tatggatgctgaattgattatgtttctgcatgacttggtgtcggcttatctaaaagaaaaagaaaaaggt
            X. tropicalis  gatggatgcagaactgatcatattcctacatgatatggtgtctgcttacctaaaggagaaagaaaaaggt
                Zebrafish  catggatgcagagctcattatgttcctgcatgacctggtgtcggcgtacctgaaggaaaaagagaaaggt
                  Lamprey  gatggacgccgagctcatcatgttcctgcatgacctcgtctccgcttacctcaaggagaaggagaaaggt

                    Mouse  gg
                      Rat  gg
            GCF_003668045  gt
                   Beaver  ag
                 Squirrel  gg
               Guinea pig  ga
                   Rabbit  gt
                     Pika  at
                    Human  gg
                    Chimp  gg
                   Bonobo  gg
                  Gorilla  gg
                   Rhesus  gg
                 Marmoset  gg
                  Tarsier  ga
                 Bushbaby  gg
               Tree shrew  ga
     Malayan flying lemur  gg
                      Pig  gg
                  Dolphin  gg
                      Cow  gg
                    Sheep  gg
                    Horse  gc
         Chinese pangolin  gg
                      Dog  gg
       Hawaiian monk seal  gg
                 Hedgehog  gg
                    Shrew  ag
                 Elephant  ga
                   Tenrec  ga
                  Opossum  ag
                  Chicken  aa
            X. tropicalis  ac
                Zebrafish  ga
                  Lamprey  ag

Inserts between block 7 and 8 in window
B D              Lamprey 5079bp

Alignment block 8 of 76 in window, 37102802 - 37102803, 2 bps 
B D                 Mouse  gt
B D                   Rat  gc
            GCF_003668045  gt
                   Beaver  gt
B D              Squirrel  gc
B D            Guinea pig  gt
B D                Rabbit  gc
B D                  Pika  gt
B D                 Human  gt
B D                 Chimp  gt
B D                Bonobo  gt
B D               Gorilla  gt
B D                Rhesus  gt
B D              Marmoset  gt
B D               Tarsier  gt
B D              Bushbaby  gt
B D            Tree shrew  gt
B D  Malayan flying lemur  gt
B D                   Pig  gt
B D               Dolphin  gt
B D                   Cow  gt
B D                 Sheep  gt
B D                 Horse  gt
B D      Chinese pangolin  gt
B D                   Dog  gt
B D    Hawaiian monk seal  gt
B D              Hedgehog  gt
B D                 Shrew  gt
B D              Elephant  gt
B D                Tenrec  gt
B D               Opossum  gc
B D               Chicken  gc
B D         X. tropicalis  a-
B D             Zebrafish  ga
B D               Lamprey  ==

Inserts between block 8 and 9 in window
B D                Shrew 2737bp
B D              Chicken 888bp
B D        X. tropicalis 1bp

Alignment block 9 of 76 in window, 37102804 - 37102805, 2 bps 
B D                 Mouse  tg
B D                   Rat  tg
            GCF_003668045  tt
                   Beaver  tg
B D              Squirrel  tg
B D            Guinea pig  tc
B D                Rabbit  ag
B D                  Pika  gg
B D                 Human  gg
B D                 Chimp  gg
B D                Bonobo  gg
B D               Gorilla  gg
B D                Rhesus  gg
B D              Marmoset  gg
B D               Tarsier  ag
B D              Bushbaby  ag
B D            Tree shrew  ag
B D  Malayan flying lemur  ag
B D                   Pig  aa
B D               Dolphin  aa
B D                   Cow  aa
B D                 Sheep  aa
B D                 Horse  ag
B D      Chinese pangolin  ag
B D                   Dog  ag
B D    Hawaiian monk seal  ag
B D              Hedgehog  ga
B D              Elephant  ag
B D                Tenrec  ag
B D               Opossum  ag
B D         X. tropicalis  -g
B D             Zebrafish  tg
B D                 Shrew  ==
B D               Chicken  ==
B D               Lamprey  ==

Inserts between block 9 and 10 in window
B D            Zebrafish 5319bp

Alignment block 10 of 76 in window, 37102806 - 37102806, 1 bps 
B D                 Mouse  c
B D                   Rat  c
            GCF_003668045  t
                   Beaver  t
B D              Squirrel  c
B D            Guinea pig  c
B D                Rabbit  t
B D                  Pika  t
B D                 Human  a
B D                 Chimp  a
B D                Bonobo  a
B D               Gorilla  a
B D                Rhesus  a
B D              Marmoset  a
B D               Tarsier  a
B D              Bushbaby  a
B D            Tree shrew  c
B D  Malayan flying lemur  c
B D                   Pig  a
B D               Dolphin  c
B D                   Cow  c
B D                 Sheep  t
B D                 Horse  c
B D      Chinese pangolin  c
B D                   Dog  c
B D    Hawaiian monk seal  c
B D              Hedgehog  c
B D              Elephant  c
B D                Tenrec  c
B D               Opossum  c
B D         X. tropicalis  c
B D                 Shrew  =
B D             Zebrafish  =
B D               Chicken  =
B D               Lamprey  =

Inserts between block 10 and 11 in window
B D              Opossum 7995bp

Alignment block 11 of 76 in window, 37102807 - 37102808, 2 bps 
B D                 Mouse  at
B D                   Rat  at
            GCF_003668045  at
                   Beaver  gt
B D              Squirrel  at
B D            Guinea pig  at
B D                Rabbit  at
B D                  Pika  gt
B D                 Human  at
B D                 Chimp  at
B D                Bonobo  at
B D               Gorilla  at
B D                Rhesus  at
B D              Marmoset  at
B D               Tarsier  at
B D              Bushbaby  a-
B D            Tree shrew  at
B D  Malayan flying lemur  at
B D                   Pig  at
B D               Dolphin  at
B D                   Cow  ac
B D                 Sheep  ac
B D                 Horse  at
B D      Chinese pangolin  at
B D                   Dog  at
B D    Hawaiian monk seal  at
B D              Hedgehog  at
B D              Elephant  at
B D                Tenrec  a-
B D         X. tropicalis  ct
B D               Opossum  ==
B D                 Shrew  ==
B D             Zebrafish  ==
B D               Chicken  ==
B D               Lamprey  ==

Inserts between block 11 and 12 in window
B D                  Pig 7bp
B D              Dolphin 7bp
B D                  Cow 7bp
B D                Sheep 7bp
B D                Horse 20bp
B D     Chinese pangolin 7bp
B D                  Dog 7bp
B D   Hawaiian monk seal 7bp
B D             Hedgehog 1878bp

Alignment block 12 of 76 in window, 37102809 - 37102832, 24 bps 
B D                 Mouse  g---------gtt------tttctttcttctt-----------t---------c-----aa-tta-----
B D                   Rat  a---------gtt------ttcctttcttctg-----------t---------c-----at-ata-----
            GCF_003668045  a---------ttt------ttattttcttctt-----------t---------t---caag-tta-----
                   Beaver  g---------ttg------ttatttttttctt-----------t---------c----aag-cca-----
B D              Squirrel  g---------ttc------ttttttttttttt-----------t---------ctttcaag-ctg-----
B D            Guinea pig  a---------ttt------tttatttttt--------------t---------c----aag-ctg-----
B D                Rabbit  a----------------------ttttttctt-----------t---------c----aag-ctg-----
B D                  Pika  a----------------------tttttccat-----------t---------c----aagtttg-----
B D                 Human  a---------ctc-----------tttttctt-----------t---------t----agg-ctg-----
B D                 Chimp  a---------ctc-----------tttttctt-----------t---------t----agg-ctg-----
B D                Bonobo  a---------ttc-----------tttttctt-----------t---------t----agg-ctg-----
B D               Gorilla  a---------ctc-----------tttttctt-----------t---------t----agg-ctg-----
B D                Rhesus  a---------ctc-------------tttctt-----------t---------c----agg-ctg-----
B D              Marmoset  a---------ttc------------ttttcta-----------t---------c----aag-ctg-----
B D               Tarsier  a---------ttt------tcttttttttctt-----------t---------c----cag-ctg-----
B D              Bushbaby  ------------------------tttttctt-----------t---------c----aag-ctg-----
B D            Tree shrew  t---------ttt-----------tccctttc--------------------------------------
B D  Malayan flying lemur  a---------tta-----------tttttattattattattatt---------c----agg-ctg-----
B D                   Pig  t---------ttt-------------ttcatt-----------a--------------aag-ctt-----
B D               Dolphin  tttggttttgttt-------------ttccct-----------t---------c----aag-ctt-----
B D                   Cow  t---------ttt-------------ttcact-----------a---------c----cat-tta-----
B D                 Sheep  t---------ttt-------------ttcact-----------a---------c----cat-tta-----
B D                 Horse  t---------tttggtgtttttttttttcctt-----------a---------a----aag-ctt-----
B D      Chinese pangolin  t---------tttgctttgttttgtttttctt-----------t---------c----aag-ctt-----
B D                   Dog  t---------ttt----------------ctt-----------t---------c----cca-ttt-----
B D    Hawaiian monk seal  t---------ttt---------ttttttcctt-----------t---------c----caa-ttt-----
B D              Elephant  ------attctcc------ccccttcctcccc-----------tccaccccacc----aag-cta-----
B D                Tenrec  ----------tca------ctctgtcttgccc-----------t---------a----aag-ctg-----
B D         X. tropicalis  ----------------------gggttttctg-----------t---------g----tgg-tccccatt
B D               Opossum  ======================================================================
B D                 Shrew  ======================================================================
B D              Hedgehog  ======================================================================
B D             Zebrafish  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  -
                      Rat  -
            GCF_003668045  -
                   Beaver  -
                 Squirrel  -
               Guinea pig  -
                   Rabbit  -
                     Pika  -
                    Human  -
                    Chimp  -
                   Bonobo  -
                  Gorilla  -
                   Rhesus  -
                 Marmoset  -
                  Tarsier  -
                 Bushbaby  -
               Tree shrew  -
     Malayan flying lemur  -
                      Pig  -
                  Dolphin  -
                      Cow  -
                    Sheep  -
                    Horse  -
         Chinese pangolin  -
                      Dog  -
       Hawaiian monk seal  -
                 Elephant  -
                   Tenrec  -
            X. tropicalis  a
                  Opossum  =
                    Shrew  =
                 Hedgehog  =
                Zebrafish  =
                  Chicken  =
                  Lamprey  =

Inserts between block 12 and 13 in window
B D        X. tropicalis 448bp

Alignment block 13 of 76 in window, 37102833 - 37102838, 6 bps 
B D                 Mouse  catgaa
B D                   Rat  ca----
            GCF_003668045  caggaa
                   Beaver  cagaac
B D              Squirrel  cagcaa
B D            Guinea pig  cagaaa
B D                Rabbit  aaggaa
B D                  Pika  caggaa
B D                 Human  caagaa
B D                 Chimp  caagaa
B D                Bonobo  caagaa
B D               Gorilla  caagaa
B D                Rhesus  caggaa
B D              Marmoset  cagtaa
B D               Tarsier  ctggaa
B D              Bushbaby  aaggaa
B D            Tree shrew  -----a
B D  Malayan flying lemur  taggga
B D                   Pig  caggaa
B D               Dolphin  caggaa
B D                   Cow  tatgaa
B D                 Sheep  tatgaa
B D                 Horse  caggaa
B D      Chinese pangolin  cagtaa
B D                   Dog  caggaa
B D    Hawaiian monk seal  caggaa
B D              Elephant  caggaa
B D                Tenrec  caagaa
B D               Opossum  ======
B D                 Shrew  ======
B D              Hedgehog  ======
B D             Zebrafish  ======
B D         X. tropicalis  ======
B D               Chicken  ======
B D               Lamprey  ======

Inserts between block 13 and 14 in window
B D                  Cow 3555bp
B D                Sheep 3184bp

Alignment block 14 of 76 in window, 37102839 - 37102870, 32 bps 
B D                 Mouse  aggcaa----gtgccagtgg--------------------attaacatggagaatg
B D                   Rat  ------------------gg--------------------attggcatgg-ggata
            GCF_003668045  agacag----gtgtcaatgg--------------------attagcatggagaatg
                   Beaver  aggtag----cagtcaatgtcatagacagctgtcaatgccatttatgtga-----a
B D              Squirrel  aggcag----ctattgatgc-------------------cacttaaatgg-----a
B D            Guinea pig  aagcaa----caataatagc-------------------caattacatgg-----a
B D                Rabbit  ataca-----------atgt-------------------catgtatatga-----g
B D                  Pika  at--------------gtgt-------------------catt--tatgg-----a
B D                 Human  tggcag----ctgtcaatgc-------------------catttacatga-----a
B D                 Chimp  tggcag----ctgtcaatgc-------------------catttacatga-----a
B D                Bonobo  tggcag----ctgtcaatgc-------------------catttacatga-----a
B D               Gorilla  tggcag----ctgtcaatgc-------------------catttacatga-----a
B D                Rhesus  tggcag----ctgtcagtgc-------------------catttacatga-----a
B D              Marmoset  tggcag----ctaccaatgc-------------------catttacattg-----a
B D               Tarsier  aggcaa----ctatcaatgc-------------------cttatatatgt-----a
B D              Bushbaby  aggcag----ctatcaatgt-------------------catttatatgg-----a
B D            Tree shrew  aggcat----ctgttaatac------------acttagacacttatatgg-----a
B D  Malayan flying lemur  aggcag----ctgtgaatgc-------------------catttatattg-----a
B D                   Pig  aggcag----ctctcactac-------------------catctataagg------
B D               Dolphin  aggcag----ctctcactac-------------------aatttatatgg-----a
B D                 Horse  aggtag--------------------------------------------------
B D      Chinese pangolin  aggcagccagctgtcaatcc-------------------cacttttatgg-----a
B D                   Dog  aggccg----ttgtcagtac-------------------catttatatgg-----a
B D    Hawaiian monk seal  aggcag----ttgtcagtgc-------------------cattcatatgg-----a
B D              Elephant  aggcag----ctgtctatgc-------------------catttagatga-----a
B D                Tenrec  aggtag--------ctatgt-------------------gatttagatga-----g
B D                 Sheep  ========================================================
B D               Opossum  ========================================================
B D                 Shrew  ========================================================
B D                   Cow  ========================================================
B D              Hedgehog  ========================================================
B D             Zebrafish  ========================================================
B D         X. tropicalis  ========================================================
B D               Chicken  ========================================================
B D               Lamprey  ========================================================

Alignment block 15 of 76 in window, 37102871 - 37102937, 67 bps 
B D                 Mouse  ttttta-tggtctggggataggatg--------aatg--c-----ctt---tttcctctgtggactgcaa
B D                   Rat  tcttca-tggcctagggacaggatg--------catg--c-----ctt---tt---cctctgggctgc-a
            GCF_003668045  tttttg-agttct-gtgatagaatgaatgga-acatg--t-----ctt---tttc-catgtgggctgcaa
                   Beaver  tttttg-tggtctagttattgagta----aa-atatg--t-----ctc---ctttctcagtgagttac--
B D              Squirrel  ttttta-tggtctagtgctaaaagg-gtgga-ctata--t-----ctc---cttcct----------caa
B D            Guinea pig  tttttg-tggtctaatgataaaatg--agta-gaatg--t-----ctt---ctttagc----aactgcaa
B D                Rabbit  ttttta-tagtctagtaataaaatgaatata-aaatg--t-----ctc---cttcctccgtgagttgcta
B D                  Pika  ttttta-tagtctaatgataaaatgaatgta-aaata--------ctc---tttcctccctgagttgcta
B D                 Human  ttgtta-tggtctaatgagaaaatgagtgga-atata--t-----ctc---cc------gtgagttgaag
B D                 Chimp  ttgtta-tggtctaatgagaaaatgagtgga-atata--t-----ctc---cc------gtgagttgaag
B D                Bonobo  ttgtta-tggtctaatgagaaaatgagtgga-atata--t-----ctc---cc------gtgagttgaag
B D               Gorilla  ttgtta-tggtctaatgagaaaatgagtgga-atata--t-----ctc---ct------gtgagttgaag
B D                Rhesus  ttgtta-tggtctaatgagaaaatgagtgga-atata--t-----ctccttct------gtgagttgaag
B D              Marmoset  ttttta-cggtctattgagaaaacaagtgga-atata--tatctcctc---ct------atgaactgaag
B D               Tarsier  ttttta-tggtcttgtgagaaaatgag-gga-ctttg--t----cctt---ct------atgagttggaa
B D              Bushbaby  ttttta-tggtctagtgagaaaatg----------tc--t----cctc---ct------gggaattgcaa
B D            Tree shrew  ttttta-tggtctaatgataaatgaatggaatatgta--t-----cct---tt------atgagttgcaa
B D  Malayan flying lemur  ttttta-tggtctagtaataaaataagtggatgcttcctt-----cct---ct------atgagttgcag
B D                   Pig  gtttta-tggtctattgataaaatgg--------------------------------tataacttacaa
B D               Dolphin  ttttta-tggtctagtgataaaatgggtaga-atgtg--t-----ctc---cttcctctatgagttacaa
B D                 Sheep  ttttta-tagtccagtgataaaatgagtgga-atgtg--t-----ctc---cttcctctatgagttacaa
B D                 Horse  ------------------tagaatgag------tctc--c-----ttc---ct----ccattagctgcaa
B D      Chinese pangolin  tttttattggtctcatgacaaaatgagtgga-atgtg--t-----ctc---ct----ctatgaattacaa
B D                   Dog  ttttta-tggtctaatggtaaaatgcgt-----tctg--t-----ctc---cttc--ctttaaattataa
B D    Hawaiian monk seal  ttttta-tggtctaatgataaaatgagtgga-atgta--t-----ctc---cttc--ctttgagttgtaa
B D              Elephant  ttttta-tggtctagggataaaatggatgga-atgtg--t-----ctc---cttcctctatgagttgtaa
B D                Tenrec  ttttta-tggtctagggagaaagtgggtggg-atgtg--c-----cta---atttatctatcagttgtaa
B D               Opossum  ======================================================================
B D                 Shrew  ======================================================================
B D                   Cow  ======================================================================
B D              Hedgehog  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  atgtcatga------ag--tagca
                      Rat  gtgtcatgc------ag--aagca
            GCF_003668045  atgtcaaaa------aaataataa
                   Beaver  -------------------aaaca
                 Squirrel  atatcagta------aa--cagca
               Guinea pig  gtgtcagta------aa--taaca
                   Rabbit  gtatcagta------aa--cagca
                     Pika  gcatgtgta------aa--tagca
                    Human  atatcagta------aa--tagcg
                    Chimp  atatcagta------aa--tagcg
                   Bonobo  atatcagta------aa--tagcg
                  Gorilla  atatcagta------aa--tagtg
                   Rhesus  atatcagta------aa--tagcg
                 Marmoset  atagcagta------aa--tagcg
                  Tarsier  ataacagta------aa--caaca
                 Bushbaby  atatcagta------aa--tgaca
               Tree shrew  atatcagtaaatattaa--tagca
     Malayan flying lemur  atgtcacta------aa--taacg
                      Pig  atatcaata------aa--t----
                  Dolphin  atatcaata------aa--t----
                    Sheep  atagaaata------aa-------
                    Horse  atatcaata------ca--t-aca
         Chinese pangolin  atatcaata------aa--tgaaa
                      Dog  atatcaatc------aa--tgaaa
       Hawaiian monk seal  atatcaatc------aa--tgaaa
                 Elephant  a----acta------ga--tagca
                   Tenrec  a----actc------tg--tagca
                  Opossum  ========================
                    Shrew  ========================
                      Cow  ========================
                 Hedgehog  ========================
                Zebrafish  ========================
            X. tropicalis  ========================
                  Chicken  ========================
                  Lamprey  ========================

Inserts between block 15 and 16 in window
B D                  Pig 8bp
B D              Dolphin 7bp
B D                Sheep 7bp
B D               Tenrec 2194bp

Alignment block 16 of 76 in window, 37102938 - 37102939, 2 bps 
B D                 Mouse  ct-
B D                   Rat  ct-
            GCF_003668045  tt-
                   Beaver  tt-
B D              Squirrel  tt-
B D            Guinea pig  at-
B D                Rabbit  tt-
B D                  Pika  tt-
B D                 Human  tt-
B D                 Chimp  tt-
B D                Bonobo  tt-
B D               Gorilla  tt-
B D                Rhesus  tt-
B D              Marmoset  tt-
B D               Tarsier  ct-
B D              Bushbaby  tt-
B D            Tree shrew  tt-
B D  Malayan flying lemur  tt-
B D                 Horse  ta-
B D      Chinese pangolin  ta-
B D                   Dog  ta-
B D    Hawaiian monk seal  ta-
B D              Elephant  -ta
B D                 Sheep  ===
B D               Opossum  ===
B D                   Pig  ===
B D                 Shrew  ===
B D                   Cow  ===
B D               Dolphin  ===
B D              Hedgehog  ===
B D                Tenrec  ===
B D             Zebrafish  ===
B D         X. tropicalis  ===
B D               Chicken  ===
B D               Lamprey  ===

Inserts between block 16 and 17 in window
B D             Squirrel 676bp
B D                Horse 17bp
B D     Chinese pangolin 15bp
B D                  Dog 17bp
B D   Hawaiian monk seal 17bp

Alignment block 17 of 76 in window, 37102940 - 37102956, 17 bps 
B D                 Mouse  -----tctaaaa--ctacatg----aca
B D                   Rat  -----tc-agga--cagtctg----aca
            GCF_003668045  -----actaatg--ctgtgtg----aca
                   Beaver  -----actaaca--ccatatt----ata
B D            Guinea pig  -----actgtga--c-gtatg----aca
B D                Rabbit  -----agcaagg--ctatgtg----aaa
B D                  Pika  -----aaacata--ctgtgtg----aca
B D                 Human  -----agtaaga--cta--tc----aca
B D                 Chimp  -----agtaaga--cta--tc----aca
B D                Bonobo  -----agtaaga--cta--tc----aca
B D               Gorilla  ---------aga--cta--tc----aca
B D                Rhesus  -----agtaaca--cta--tc----aca
B D              Marmoset  -----agtaaga--cta--tc----aca
B D               Tarsier  -----aataggc--cca--tatgtgaca
B D              Bushbaby  -----ggtaagatttta--tg----aca
B D            Tree shrew  -----agtaaga--caaggtg----aca
B D  Malayan flying lemur  -----agtaaga--ctctgtg----aca
B D                   Pig  -----agtaaga--ctatgtg----ata
B D               Dolphin  -----agtaaga--ctatgtg----ata
B D                 Sheep  -----agtaaga--ctgtttg----ata
B D                 Horse  -----agtaaga--cgatgtg----ata
B D      Chinese pangolin  -----agtaaga--ctgtacg----aca
B D                   Dog  -----agtaaaa--ctatgtg----aca
B D    Hawaiian monk seal  -----actaaaa--ctgtgtg----aca
B D              Elephant  tttttagtaaga--ctatgta----aca
B D               Opossum  ============================
B D                 Shrew  ============================
B D                   Cow  ============================
B D              Hedgehog  ============================
B D                Tenrec  ============================
B D              Squirrel  ============================
B D             Zebrafish  ============================
B D         X. tropicalis  ============================
B D               Chicken  ============================
B D               Lamprey  ============================

Inserts between block 17 and 18 in window
B D           Guinea pig 1140bp

Alignment block 18 of 76 in window, 37102957 - 37102961, 5 bps 
B D                 Mouse  gg-ttt
B D                   Rat  ga-ctc
            GCF_003668045  gatttc
                   Beaver  tagttt
B D                Rabbit  gacctt
B D                  Pika  gacgac
B D                 Human  gactt-
B D                 Chimp  gactt-
B D                Bonobo  gactt-
B D               Gorilla  gactt-
B D                Rhesus  gactt-
B D              Marmoset  gactt-
B D               Tarsier  ggctt-
B D              Bushbaby  gactt-
B D            Tree shrew  gacat-
B D  Malayan flying lemur  gtctt-
B D                   Pig  gattc-
B D               Dolphin  gactt-
B D                 Sheep  ggctt-
B D                 Horse  gactt-
B D      Chinese pangolin  gactt-
B D                   Dog  gacat-
B D    Hawaiian monk seal  gactt-
B D              Elephant  gactt-
B D            Guinea pig  ======
B D               Opossum  ======
B D                 Shrew  ======
B D                   Cow  ======
B D              Hedgehog  ======
B D                Tenrec  ======
B D              Squirrel  ======
B D             Zebrafish  ======
B D         X. tropicalis  ======
B D               Chicken  ======
B D               Lamprey  ======

Inserts between block 18 and 19 in window
B D                Human 1bp
B D                Chimp 1bp
B D               Bonobo 1bp
B D              Gorilla 1bp
B D               Rhesus 1bp
B D             Marmoset 1bp
B D              Tarsier 1bp
B D             Bushbaby 1bp
B D Malayan flying lemur 6924bp
B D                  Pig 1bp
B D              Dolphin 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp
B D             Elephant 1bp

Alignment block 19 of 76 in window, 37102962 - 37102978, 17 bps 
B D                 Mouse  ctgagtttctgctggat
B D                   Rat  ctgcgtttctgctgcat
            GCF_003668045  ctgagtatcagctagat
                   Beaver  ctgagtatctgctagat
B D                Rabbit  ttgaatatctgctaaat
B D                  Pika  ctgaatatctgttggat
B D                 Human  ctgagtacttgctatat
B D                 Chimp  ctgagtacttgctatat
B D                Bonobo  ctgagtacttgctatat
B D               Gorilla  ctgagtacttgctatat
B D                Rhesus  ctgagtacttgctatat
B D              Marmoset  ctgagtacttgctatat
B D               Tarsier  ctgagtctttcctggat
B D              Bushbaby  ctaagtagttgctagat
B D            Tree shrew  -tgagtatctgctaggt
B D                   Pig  cggagtatctgctaggt
B D               Dolphin  ctgagtatctgccaggt
B D                 Sheep  ctaagtatctgctaggt
B D                 Horse  -tgaatatctgctaggt
B D      Chinese pangolin  ctgaatgactgccaggt
B D                   Dog  ctgagtgtctgctatgt
B D    Hawaiian monk seal  ctgagtatctgctatgt
B D              Elephant  ctgagtatctgctaggc
B D            Guinea pig  =================
B D               Opossum  =================
B D                 Shrew  =================
B D                   Cow  =================
B D              Hedgehog  =================
B D                Tenrec  =================
B D              Squirrel  =================
B D             Zebrafish  =================
B D  Malayan flying lemur  =================
B D         X. tropicalis  =================
B D               Chicken  =================
B D               Lamprey  =================

Inserts between block 19 and 20 in window
B D             Bushbaby 573bp

Alignment block 20 of 76 in window, 37102979 - 37102981, 3 bps 
B D                 Mouse  gca
B D                   Rat  aca
            GCF_003668045  aca
                   Beaver  aga
B D                Rabbit  acc
B D                  Pika  ata
B D                 Human  ata
B D                 Chimp  ata
B D                Bonobo  ata
B D               Gorilla  ata
B D                Rhesus  ata
B D              Marmoset  ata
B D               Tarsier  ata
B D            Tree shrew  aca
B D                   Pig  aca
B D               Dolphin  aca
B D                 Sheep  aca
B D                 Horse  aca
B D      Chinese pangolin  aca
B D                   Dog  cca
B D    Hawaiian monk seal  cca
B D              Elephant  aca
B D            Guinea pig  ===
B D               Opossum  ===
B D                 Shrew  ===
B D                   Cow  ===
B D              Hedgehog  ===
B D              Bushbaby  ===
B D                Tenrec  ===
B D              Squirrel  ===
B D             Zebrafish  ===
B D  Malayan flying lemur  ===
B D         X. tropicalis  ===
B D               Chicken  ===
B D               Lamprey  ===

Inserts between block 20 and 21 in window
B D                  Rat 1047bp
B D                Human 823bp
B D                Chimp 824bp
B D               Bonobo 823bp
B D              Gorilla 819bp
B D             Marmoset 811bp
B D           Tree shrew 1528bp
B D                  Pig 540bp
B D                Sheep 1442bp
B D     Chinese pangolin 6111bp
B D             Elephant 756bp

Alignment block 21 of 76 in window, 37102982 - 37102982, 1 bps 
B D                 Mouse  t
            GCF_003668045  t
                   Beaver  t
B D                Rabbit  t
B D                  Pika  t
B D                Rhesus  c
B D               Tarsier  c
B D               Dolphin  t
B D                 Horse  t
B D                   Dog  t
B D    Hawaiian monk seal  t
B D            Guinea pig  =
B D                 Sheep  =
B D               Gorilla  =
B D                Bonobo  =
B D                 Chimp  =
B D                 Human  =
B D              Marmoset  =
B D               Opossum  =
B D                   Pig  =
B D      Chinese pangolin  =
B D                   Rat  =
B D                 Shrew  =
B D                   Cow  =
B D              Elephant  =
B D              Hedgehog  =
B D              Bushbaby  =
B D                Tenrec  =
B D              Squirrel  =
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Inserts between block 21 and 22 in window
                  Beaver 557bp
B D                 Pika 2161bp
B D              Dolphin 623bp
B D                Horse 604bp
B D                  Dog 745bp
B D   Hawaiian monk seal 755bp

Alignment block 22 of 76 in window, 37102983 - 37102983, 1 bps 
B D                 Mouse  -c
            GCF_003668045  -t
B D                Rabbit  -c
B D                Rhesus  a-
B D               Tarsier  a-
B D                   Dog  ==
B D            Guinea pig  ==
B D                 Sheep  ==
B D                 Horse  ==
B D    Hawaiian monk seal  ==
B D               Gorilla  ==
B D                Bonobo  ==
B D                 Chimp  ==
B D                 Human  ==
B D              Marmoset  ==
B D               Opossum  ==
B D                   Pig  ==
B D      Chinese pangolin  ==
B D                   Rat  ==
                  Beaver  ==
B D                 Shrew  ==
B D                   Cow  ==
B D              Elephant  ==
B D               Dolphin  ==
B D              Hedgehog  ==
B D                  Pika  ==
B D              Bushbaby  ==
B D                Tenrec  ==
B D              Squirrel  ==
B D            Tree shrew  ==
B D             Zebrafish  ==
B D  Malayan flying lemur  ==
B D         X. tropicalis  ==
B D               Chicken  ==
B D               Lamprey  ==

Inserts between block 22 and 23 in window
B D               Rabbit 1126bp

Alignment block 23 of 76 in window, 37102984 - 37102984, 1 bps 
B D                 Mouse  g
            GCF_003668045  g
B D                Rhesus  g
B D               Tarsier  g
B D                   Dog  =
B D            Guinea pig  =
B D                 Sheep  =
B D                 Horse  =
B D    Hawaiian monk seal  =
B D               Gorilla  =
B D                Bonobo  =
B D                 Chimp  =
B D                 Human  =
B D              Marmoset  =
B D               Opossum  =
B D                   Pig  =
B D      Chinese pangolin  =
B D                   Rat  =
                  Beaver  =
B D                 Shrew  =
B D                   Cow  =
B D              Elephant  =
B D               Dolphin  =
B D              Hedgehog  =
B D                  Pika  =
B D                Rabbit  =
B D              Bushbaby  =
B D                Tenrec  =
B D              Squirrel  =
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Inserts between block 23 and 24 in window
           GCF_003668045 7339bp

Alignment block 24 of 76 in window, 37102985 - 37102985, 1 bps 
B D                 Mouse  t
B D                Rhesus  c
B D               Tarsier  t
B D                   Dog  =
B D            Guinea pig  =
B D                 Sheep  =
B D                 Horse  =
B D    Hawaiian monk seal  =
B D               Gorilla  =
B D                Bonobo  =
B D                 Chimp  =
B D                 Human  =
B D              Marmoset  =
B D               Opossum  =
B D                   Pig  =
B D      Chinese pangolin  =
B D                   Rat  =
                  Beaver  =
B D                 Shrew  =
B D                   Cow  =
B D              Elephant  =
B D               Dolphin  =
B D              Hedgehog  =
B D                  Pika  =
           GCF_003668045  =
B D                Rabbit  =
B D              Bushbaby  =
B D                Tenrec  =
B D              Squirrel  =
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Inserts between block 24 and 25 in window
B D              Tarsier 1755bp

Alignment block 25 of 76 in window, 37102986 - 37102994, 9 bps 
B D                 Mouse  g---gtggtatt
B D                Rhesus  gccaatggtgtt
B D                   Dog  ============
B D            Guinea pig  ============
B D                 Sheep  ============
B D                 Horse  ============
B D    Hawaiian monk seal  ============
B D               Gorilla  ============
B D                Bonobo  ============
B D                 Chimp  ============
B D                 Human  ============
B D              Marmoset  ============
B D               Opossum  ============
B D                   Pig  ============
B D      Chinese pangolin  ============
B D                   Rat  ============
                  Beaver  ============
B D                 Shrew  ============
B D                   Cow  ============
B D              Elephant  ============
B D               Dolphin  ============
B D              Hedgehog  ============
B D                  Pika  ============
B D               Tarsier  ============
           GCF_003668045  ============
B D                Rabbit  ============
B D              Bushbaby  ============
B D                Tenrec  ============
B D              Squirrel  ============
B D            Tree shrew  ============
B D             Zebrafish  ============
B D  Malayan flying lemur  ============
B D         X. tropicalis  ============
B D               Chicken  ============
B D               Lamprey  ============

Inserts between block 25 and 26 in window
B D               Rhesus 809bp

Alignment block 26 of 76 in window, 37102995 - 37103102, 108 bps 
B D                 Mouse  gaggcaggctttccttatgaccttgagctcactctgcattttaggcaggccttgaacttttgatcctcct
B D                   Dog  ======================================================================
B D                Rhesus  ======================================================================
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D                 Horse  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D              Marmoset  ======================================================================
B D               Opossum  ======================================================================
B D                   Pig  ======================================================================
B D      Chinese pangolin  ======================================================================
B D                   Rat  ======================================================================
                  Beaver  ======================================================================
B D                 Shrew  ======================================================================
B D                   Cow  ======================================================================
B D              Elephant  ======================================================================
B D               Dolphin  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D               Tarsier  ======================================================================
           GCF_003668045  ======================================================================
B D                Rabbit  ======================================================================
B D              Bushbaby  ======================================================================
B D                Tenrec  ======================================================================
B D              Squirrel  ======================================================================
B D            Tree shrew  ======================================================================
B D             Zebrafish  ======================================================================
B D  Malayan flying lemur  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  gcctcaccttcccatataggtctaggatagcagagcta
                      Dog  ======================================
                   Rhesus  ======================================
               Guinea pig  ======================================
                    Sheep  ======================================
                    Horse  ======================================
       Hawaiian monk seal  ======================================
                  Gorilla  ======================================
                   Bonobo  ======================================
                    Chimp  ======================================
                    Human  ======================================
                 Marmoset  ======================================
                  Opossum  ======================================
                      Pig  ======================================
         Chinese pangolin  ======================================
                      Rat  ======================================
                   Beaver  ======================================
                    Shrew  ======================================
                      Cow  ======================================
                 Elephant  ======================================
                  Dolphin  ======================================
                 Hedgehog  ======================================
                     Pika  ======================================
                  Tarsier  ======================================
            GCF_003668045  ======================================
                   Rabbit  ======================================
                 Bushbaby  ======================================
                   Tenrec  ======================================
                 Squirrel  ======================================
               Tree shrew  ======================================
                Zebrafish  ======================================
     Malayan flying lemur  ======================================
            X. tropicalis  ======================================
                  Chicken  ======================================
                  Lamprey  ======================================

Alignment block 27 of 76 in window, 37103103 - 37103121, 19 bps 
B D                 Mouse  ctttgccaggcccaactct
            GCF_003668045  ctctacctggctcagtttt
B D                   Dog  ===================
B D                Rhesus  ===================
B D            Guinea pig  ===================
B D                 Sheep  ===================
B D                 Horse  ===================
B D    Hawaiian monk seal  ===================
B D               Gorilla  ===================
B D                Bonobo  ===================
B D                 Chimp  ===================
B D                 Human  ===================
B D              Marmoset  ===================
B D               Opossum  ===================
B D                   Pig  ===================
B D      Chinese pangolin  ===================
B D                   Rat  ===================
                  Beaver  ===================
B D                 Shrew  ===================
B D                   Cow  ===================
B D              Elephant  ===================
B D               Dolphin  ===================
B D              Hedgehog  ===================
B D                  Pika  ===================
B D               Tarsier  ===================
B D                Rabbit  ===================
B D              Bushbaby  ===================
B D                Tenrec  ===================
B D              Squirrel  ===================
B D            Tree shrew  ===================
B D             Zebrafish  ===================
B D  Malayan flying lemur  ===================
B D         X. tropicalis  ===================
B D               Chicken  ===================
B D               Lamprey  ===================

Alignment block 28 of 76 in window, 37103122 - 37103123, 2 bps 
B D                 Mouse  ac
            GCF_003668045  ac
B D                 Human  at
B D                 Chimp  at
B D                Bonobo  at
B D               Gorilla  at
B D              Marmoset  ac
B D                   Dog  ==
B D                Rhesus  ==
B D            Guinea pig  ==
B D                 Sheep  ==
B D                 Horse  ==
B D    Hawaiian monk seal  ==
B D               Opossum  ==
B D                   Pig  ==
B D      Chinese pangolin  ==
B D                   Rat  ==
                  Beaver  ==
B D                 Shrew  ==
B D                   Cow  ==
B D              Elephant  ==
B D               Dolphin  ==
B D              Hedgehog  ==
B D                  Pika  ==
B D               Tarsier  ==
B D                Rabbit  ==
B D              Bushbaby  ==
B D                Tenrec  ==
B D              Squirrel  ==
B D            Tree shrew  ==
B D             Zebrafish  ==
B D  Malayan flying lemur  ==
B D         X. tropicalis  ==
B D               Chicken  ==
B D               Lamprey  ==

Alignment block 29 of 76 in window, 37103124 - 37103124, 1 bps 
B D                 Mouse  a
            GCF_003668045  g
                   Beaver  a
B D                 Human  a
B D                 Chimp  a
B D                Bonobo  a
B D               Gorilla  a
B D                Rhesus  a
B D              Marmoset  a
B D              Bushbaby  a
B D                   Pig  a
B D                 Horse  a
B D                   Dog  a
B D            Guinea pig  =
B D                 Sheep  =
B D    Hawaiian monk seal  =
B D               Opossum  =
B D      Chinese pangolin  =
B D                   Rat  =
B D                 Shrew  =
B D                   Cow  =
B D              Elephant  =
B D               Dolphin  =
B D              Hedgehog  =
B D                  Pika  =
B D               Tarsier  =
B D                Rabbit  =
B D                Tenrec  =
B D              Squirrel  =
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Alignment block 30 of 76 in window, 37103125 - 37103141, 17 bps 
B D                 Mouse  tgtgattct--cagtaaat
            GCF_003668045  tgtgattct--tactaaat
                   Beaver  tgtgattct--ta--aaac
B D                 Human  tgtgcttcc--taataa--
B D                 Chimp  tgtgcttcc--taataa--
B D                Bonobo  tgtgcttcc--taataa--
B D               Gorilla  tgtgcttcc--taataa--
B D                Rhesus  tgtgcttcc--tgataa--
B D              Marmoset  gatgtttct--taataa--
B D              Bushbaby  tgttattct--taaaaa--
B D                   Pig  tgtgcttttaaaaaaaa--
B D                 Horse  tgtgatttt--aaagaa--
B D                   Dog  tgtgatttt--ttttta--
B D    Hawaiian monk seal  tgtga-ttt--ttttta--
B D            Guinea pig  ===================
B D                 Sheep  ===================
B D               Opossum  ===================
B D      Chinese pangolin  ===================
B D                   Rat  ===================
B D                 Shrew  ===================
B D                   Cow  ===================
B D              Elephant  ===================
B D               Dolphin  ===================
B D              Hedgehog  ===================
B D                  Pika  ===================
B D               Tarsier  ===================
B D                Rabbit  ===================
B D                Tenrec  ===================
B D              Squirrel  ===================
B D            Tree shrew  ===================
B D             Zebrafish  ===================
B D  Malayan flying lemur  ===================
B D         X. tropicalis  ===================
B D               Chicken  ===================
B D               Lamprey  ===================

Alignment block 31 of 76 in window, 37103142 - 37103142, 1 bps 
B D                 Mouse  a
            GCF_003668045  g
                   Beaver  a
B D                 Human  a
B D                 Chimp  a
B D                Bonobo  a
B D               Gorilla  a
B D                Rhesus  a
B D              Marmoset  a
B D               Tarsier  a
B D              Bushbaby  a
B D                   Pig  a
B D                 Horse  t
B D                   Dog  a
B D    Hawaiian monk seal  a
B D            Guinea pig  =
B D                 Sheep  =
B D               Opossum  =
B D      Chinese pangolin  =
B D                   Rat  =
B D                 Shrew  =
B D                   Cow  =
B D              Elephant  =
B D               Dolphin  =
B D              Hedgehog  =
B D                  Pika  =
B D                Rabbit  =
B D                Tenrec  =
B D              Squirrel  =
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Alignment block 32 of 76 in window, 37103143 - 37103152, 10 bps 
B D                 Mouse  taacttggaa
            GCF_003668045  tagcttggaa
                   Beaver  tagcttggaa
B D              Squirrel  tatcttggaa
B D                 Human  taacttggaa
B D                 Chimp  taacttggaa
B D                Bonobo  taacttggaa
B D               Gorilla  taacttggaa
B D                Rhesus  tagcttggaa
B D              Marmoset  tagcttggta
B D               Tarsier  tagcttggaa
B D              Bushbaby  cagtttggaa
B D                   Pig  atgcttggaa
B D                 Horse  ttacttggaa
B D                   Dog  ttgcttggaa
B D    Hawaiian monk seal  ttgcttggaa
B D            Guinea pig  ==========
B D                 Sheep  ==========
B D               Opossum  ==========
B D      Chinese pangolin  ==========
B D                   Rat  ==========
B D                 Shrew  ==========
B D                   Cow  ==========
B D              Elephant  ==========
B D               Dolphin  ==========
B D              Hedgehog  ==========
B D                  Pika  ==========
B D                Rabbit  ==========
B D                Tenrec  ==========
B D            Tree shrew  ==========
B D             Zebrafish  ==========
B D  Malayan flying lemur  ==========
B D         X. tropicalis  ==========
B D               Chicken  ==========
B D               Lamprey  ==========

Inserts between block 32 and 33 in window
B D             Squirrel 1bp
B D                Human 1bp
B D                Chimp 1bp
B D               Bonobo 1bp
B D              Gorilla 1bp
B D               Rhesus 1bp
B D             Marmoset 1bp
B D              Tarsier 1bp
B D             Bushbaby 1bp
B D                  Pig 1bp
B D                Horse 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp

Alignment block 33 of 76 in window, 37103153 - 37103209, 57 bps 
B D                 Mouse  aaacata--acttgttcaggccattctttagtt------------ttattttgggtttttgttttgtatt
            GCF_003668045  aaa-ata--acttgttcagggcatactataaaa------------ctatttt---------------att
                   Beaver  aaatat---atatgtttaggtcacagtataata------------ctgtttc------------------
B D              Squirrel  aaatgta--atttgttcagatcacactataa---------------tgtttc---------------att
B D                 Human  aaatgta--atttgttcaagtcacactataata------------ttgtttc---------------att
B D                 Chimp  aaatgta--atttgttcaagtcacactataata------------ctgtttc---------------att
B D                Bonobo  aaatgta--atttgttcaagtcacactataata------------ctgtttc---------------att
B D               Gorilla  aaatgta--atttgttcaagtcacactataata------------ctgtttc---------------att
B D                Rhesus  aaatgta--atttgttcaagtcacactataata------------ctgtttc---------------att
B D              Marmoset  aaatgta--atttgttcaggtcacactataata------------ctgtttc---------------att
B D               Tarsier  aagtgca--atttgttcaggtcccactataaca------------ttgtctc---------------aat
B D              Bushbaby  aagtg----attttttca-----cacaaaaata------------ttgtttc----------------tt
B D                   Pig  agaggta--atttgttcaggtcacactataatcatgct-----------ttt---------------ttt
B D               Dolphin  -----aa--atataatcaagtcacactataattacactataataactgcttc---------------att
B D                 Horse  agatacgtaatttgttcaggtcacactagaata------------ttgcttc---------------act
B D                   Dog  acatgct--atttgtttaggtcaccctataatt---------------cttc---------------att
B D    Hawaiian monk seal  acatgct--atttgtttaggtcgccctataata---------------cttc---------------att
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D               Opossum  ======================================================================
B D      Chinese pangolin  ======================================================================
B D                   Rat  ======================================================================
B D                 Shrew  ======================================================================
B D                   Cow  ======================================================================
B D              Elephant  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D                Rabbit  ======================================================================
B D                Tenrec  ======================================================================
B D            Tree shrew  ======================================================================
B D             Zebrafish  ======================================================================
B D  Malayan flying lemur  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  t
            GCF_003668045  t
                   Beaver  -
                 Squirrel  t
                    Human  t
                    Chimp  t
                   Bonobo  t
                  Gorilla  t
                   Rhesus  t
                 Marmoset  t
                  Tarsier  t
                 Bushbaby  t
                      Pig  t
                  Dolphin  t
                    Horse  t
                      Dog  t
       Hawaiian monk seal  t
               Guinea pig  =
                    Sheep  =
                  Opossum  =
         Chinese pangolin  =
                      Rat  =
                    Shrew  =
                      Cow  =
                 Elephant  =
                 Hedgehog  =
                     Pika  =
                   Rabbit  =
                   Tenrec  =
               Tree shrew  =
                Zebrafish  =
     Malayan flying lemur  =
            X. tropicalis  =
                  Chicken  =
                  Lamprey  =

Alignment block 34 of 76 in window, 37103210 - 37103267, 58 bps 
B D                 Mouse  t-ttaatgaagaaaaa--atgttaaatttaccttgc-agat-----------------------------
            GCF_003668045  t-atcatgaataaaa----tgctaaatttaccttgc-agatatatcaaca--------------------
                   Beaver  -----------aaaa----caggaaatttgtcttgc-agatacttcaaaa--------------------
B D              Squirrel  t-ttcatgaagaaatt--atgcaaaatttgtcctat-agatatttcagga--------------------
B D                 Human  tcttcatgaggaaaaa--atataaaatttgtcttga-----cttttaaaa--------------------
B D                 Chimp  tcttcatgaggaaaaa--atataaaatttgtcttga-----cttttaaaa--------------------
B D                Bonobo  tcttcatgaggaaaaa--atataaaatttgtcttga-----cttttaaaa--------------------
B D               Gorilla  tcttcatgaggaaaaa--atataaaatttgtcttga-----cttttaaaa--------------------
B D                Rhesus  tcttcatgaggaaaaa--atatagaatttgtcctga-agatattttaaaa--------------------
B D              Marmoset  tcttcatgtgg-aaaa--atataaaatttgt----------actttaaaa--------------------
B D               Tarsier  ttttcatgaagaaaaa--gtataaaatttgtcctgc-agatatttcagaa--------------------
B D              Bushbaby  ttttcataaagaaaaac-atataacatttgtcttgt-agttatttcaaaac-------------------
B D                   Pig  ttttcatgaagaaaaa------------caatttgt-aaatatttcaaaatgcccttatgaggaatgctt
B D               Dolphin  tttccaagaagaaagaa-atataaaatttatcttgt-agatatttcaaaatagcttcatgatgaatgttt
B D                 Horse  ttttcatgaagaaagaa-atgtaaaatttgccttac-agatatttcaaagtagcctcatgataaatgttt
B D                   Dog  tcctaatgaacaaag---ctataaaatttttctagc-aggtatttcaaaatagcctcatgataaatgttt
B D    Hawaiian monk seal  tcctagtgagcaaaa---atacaaaatttgtctagc-aggtatttcaagatggcctcatgatgaatgttt
B D              Elephant  -tttaatgaagaaaaaatacataaaatttgtcttgggaggtatttcaaaatagcctc-------------
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D               Opossum  ======================================================================
B D      Chinese pangolin  ======================================================================
B D                   Rat  ======================================================================
B D                 Shrew  ======================================================================
B D                   Cow  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D                Rabbit  ======================================================================
B D                Tenrec  ======================================================================
B D            Tree shrew  ======================================================================
B D             Zebrafish  ======================================================================
B D  Malayan flying lemur  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  ----------------------tcctcaaaacaaccatttggg-
            GCF_003668045  --ctaaaaga------------ttatcaaaaagactatgttga-
                   Beaver  --gtaaaaga------------ttatcaag--gatcatattaa-
                 Squirrel  --ataaaaa-----------------------gaacacattg--
                    Human  --ataaaga-------------ttatcaaac-gaccatgttga-
                    Chimp  --ataaaga-------------ttatcaaac-gaccatgttga-
                   Bonobo  --ataaaga-------------ttatcaaac-gaccatgttga-
                  Gorilla  --ataaaga-------------ttatcaaac-gaccatgttga-
                   Rhesus  --ataaaaa-------------ttatcaaac-gaccatgttga-
                 Marmoset  --ataaaaga-----------tttatcaaaa-gactatgttga-
                  Tarsier  --at-aaga-------------taatcaaaa-gaccatgttga-
                 Bushbaby  --at------------------ttac-------------ttgg-
                      Pig  aagtgaagaaaa-------agattaccaaaa-gataaagtgga-
                  Dolphin  gagtgaagaaaacaaagacagattatcaaaa-gaccatgtgga-
                    Horse  gagtgaagaaaa---------------caaa-gattatcaaaa-
                      Dog  gagtgaagaa------------------aca-gattatcaaaa-
       Hawaiian monk seal  aagtgaagtt------------------tta-ga-tatcaaaa-
                 Elephant  --ttgaaaatgt----------ttcttgagt-gaagaaattaga
               Guinea pig  ============================================
                    Sheep  ============================================
                  Opossum  ============================================
         Chinese pangolin  ============================================
                      Rat  ============================================
                    Shrew  ============================================
                      Cow  ============================================
                 Hedgehog  ============================================
                     Pika  ============================================
                   Rabbit  ============================================
                   Tenrec  ============================================
               Tree shrew  ============================================
                Zebrafish  ============================================
     Malayan flying lemur  ============================================
            X. tropicalis  ============================================
                  Chicken  ============================================
                  Lamprey  ============================================

Inserts between block 34 and 35 in window
B D             Bushbaby 947bp

Alignment block 35 of 76 in window, 37103268 - 37103331, 64 bps 
B D                 Mouse  aagagtac-----------------aaagttaacaagttaacatagattggactggtcttccattaatta
            GCF_003668045  aatagtac-----------------aaagctaaca---taaca--gattggactactcttccatta----
                   Beaver  tagaatgt-----------------gaagttagta---cagcatagattgaagttctctttcactg----
B D              Squirrel  -------------------------aaagttagca---tagcataaattgaattgctctttcatta----
B D                 Human  aagagtac-----------------aaaggtagca---tagcatacattgaaatgctcttttatta----
B D                 Chimp  aagagtac-----------------aaaggtagca---tagcatacattgaaatgctcttttatta----
B D                Bonobo  aagagtac-----------------aaaggtagca---tagcatacattgaaatgctcttttatta----
B D               Gorilla  aagagtac-----------------aaaggtagca---tagcatacattgaaatgctcttttatta----
B D                Rhesus  aagagtac-----------------aaaggtagca---tagcatacattgaaatgctgttgtatta----
B D              Marmoset  aagagtgc-----------------acaggtagca---tagcatagactgaaatgctcttttatta----
B D               Tarsier  aaga-------------------------atagca---t-gcatagactgaactgctctt-tatta----
B D                   Pig  aagagtac-----------------agaagtagcc---ta-cataaattgaattgctcttctatta----
B D               Dolphin  aagagtgt-----------------aaatatagca---ta-cataagttgagttgctcttccatta----
B D                 Horse  gacaatgttgaaaga-------gtgcaaagtagca---tagcatagactg---------------g----
B D                   Dog  atcaatgc-----------------aaacgtagca---tagcatagactgaattgctgttccatta----
B D    Hawaiian monk seal  aacaatgc-----------------aaaagtagcg---tagcatagattgaattgctgctccatta----
B D              Elephant  aagattatcaaaagaccatgttaagagaggtggca---gagca--gactgaattgctcttctgtta----
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D               Opossum  ======================================================================
B D      Chinese pangolin  ======================================================================
B D                   Rat  ======================================================================
B D                 Shrew  ======================================================================
B D                   Cow  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D                Rabbit  ======================================================================
B D              Bushbaby  ======================================================================
B D                Tenrec  ======================================================================
B D            Tree shrew  ======================================================================
B D             Zebrafish  ======================================================================
B D  Malayan flying lemur  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  ctcttcatcag
            GCF_003668045  ctgttgatcaa
                   Beaver  cttttcagaag
                 Squirrel  ttattcagtca
                    Human  atattcaattg
                    Chimp  atattcaattg
                   Bonobo  atattcaattg
                  Gorilla  atattcaattg
                   Rhesus  atattcaatcg
                 Marmoset  ataattaattg
                  Tarsier  ctatccagtca
                      Pig  ctattcaatgt
                  Dolphin  ctatttaatct
                    Horse  caatcta----
                      Dog  gaattca-tct
       Hawaiian monk seal  ctattcagtct
                 Elephant  ctattcagtct
               Guinea pig  ===========
                    Sheep  ===========
                  Opossum  ===========
         Chinese pangolin  ===========
                      Rat  ===========
                    Shrew  ===========
                      Cow  ===========
                 Hedgehog  ===========
                     Pika  ===========
                   Rabbit  ===========
                 Bushbaby  ===========
                   Tenrec  ===========
               Tree shrew  ===========
                Zebrafish  ===========
     Malayan flying lemur  ===========
            X. tropicalis  ===========
                  Chicken  ===========
                  Lamprey  ===========

Alignment block 36 of 76 in window, 37103332 - 37103382, 51 bps 
B D                 Mouse  aaatataccaa-aaatt--ggacaagagtaaaa--tctatagtgatggtgggaaaa-
            GCF_003668045  aaatgtgccaa-aaatc--aagtgagagtaaaa--tctatagtgatggtgggaaga-
                   Beaver  agtgatgccaa-aaacttagggagagagtaaaaactcaatagtgatagtgggaaga-
B D              Squirrel  agatgtgccaa-aattc-agtgagacagtaaaa--tcaataa-ggtgcttggaagc-
B D                 Human  agatgtgccca-aaattcagtgagagagtaaaa--tcaataatgatggctgggaga-
B D                 Chimp  agatgtgccca-aaattcagtgagagagtaaaa--ccaataatgatggctgggaga-
B D                Bonobo  agatgtgccca-aaattcagtgagagagtaaaa--ccaataatgatggctgggaga-
B D               Gorilla  agatgtgccca-aaattcagtgagagagtaaaa--tcaataatgatggctgggaga-
B D                Rhesus  agatgtgccca-aaattcagtgagagagtaaaa--tcaataatgatggctggtaga-
B D              Marmoset  agatgtgccca-aaattcagtgagacagtaaaa--tc---aatgatgtctgggaga-
B D               Tarsier  agatgtgccaataaattcagtgagagagtaaaa--tcattaataatggctaggaga-
B D                   Pig  agaagtggcaa-aaattcagt--gaaagtgaaa--tc---agtgatggctgggaga-
B D               Dolphin  agatgtgccaa-aaattcagt--gagagtgaaa--gcaataatgatggctgggaga-
B D                 Horse  gaatgtgctaa-aaattcagt--gagagtaaag--tcaataatgatggctggaaga-
B D      Chinese pangolin  agatgtaccaa-aaattcagt--aagagtaaaa--ccaatactgatggctgagaga-
B D                   Dog  agatgtgccaa-aaatcc--t--gagagtaaaa--gcagtaatgatggctgg-agg-
B D    Hawaiian monk seal  agatgtgccaa-aagtccagt--gagagtaaaa--tcagtaatgatgactggaaga-
B D              Elephant  ggatgtgctga-aaatttagtggtaaagtaaaa--tcaataatgatggctgggagaa
B D            Guinea pig  =========================================================
B D                 Sheep  =========================================================
B D               Opossum  =========================================================
B D                   Rat  =========================================================
B D                 Shrew  =========================================================
B D                   Cow  =========================================================
B D              Hedgehog  =========================================================
B D                  Pika  =========================================================
B D                Rabbit  =========================================================
B D              Bushbaby  =========================================================
B D                Tenrec  =========================================================
B D            Tree shrew  =========================================================
B D             Zebrafish  =========================================================
B D  Malayan flying lemur  =========================================================
B D         X. tropicalis  =========================================================
B D               Chicken  =========================================================
B D               Lamprey  =========================================================

Inserts between block 36 and 37 in window
B D                  Pig 4bp
B D              Dolphin 86bp

Alignment block 37 of 76 in window, 37103383 - 37103383, 1 bps 
B D                 Mouse  g
            GCF_003668045  g
B D              Squirrel  a
B D                 Human  a
B D                 Chimp  a
B D                Bonobo  a
B D               Gorilla  a
B D                Rhesus  a
B D              Marmoset  a
B D               Tarsier  a
B D                   Pig  a
B D                 Horse  a
B D      Chinese pangolin  a
B D                   Dog  a
B D    Hawaiian monk seal  a
B D              Elephant  a
B D            Guinea pig  =
B D                 Sheep  =
B D               Opossum  =
B D                   Rat  =
                  Beaver  -
B D                 Shrew  =
B D                   Cow  =
B D               Dolphin  =
B D              Hedgehog  =
B D                  Pika  =
B D                Rabbit  =
B D              Bushbaby  =
B D                Tenrec  =
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Inserts between block 37 and 38 in window
B D                Human 1bp
B D                Chimp 1bp
B D               Bonobo 1bp
B D              Gorilla 1bp
B D               Rhesus 137bp
B D             Marmoset 5bp
B D              Tarsier 1bp
B D                Horse 78bp
B D     Chinese pangolin 1bp
B D                  Dog 5bp
B D   Hawaiian monk seal 5bp
B D             Elephant 58bp

Alignment block 38 of 76 in window, 37103384 - 37103384, 1 bps 
B D                 Mouse  t
            GCF_003668045  t
B D              Squirrel  g
B D                 Human  t
B D                 Chimp  t
B D                Bonobo  t
B D               Gorilla  t
B D              Marmoset  t
B D               Tarsier  t
B D                   Pig  t
B D      Chinese pangolin  t
B D                   Dog  t
B D    Hawaiian monk seal  t
B D                Rhesus  =
B D            Guinea pig  =
B D                 Sheep  =
B D                 Horse  =
B D               Opossum  =
B D                   Rat  =
                  Beaver  -
B D                 Shrew  =
B D                   Cow  =
B D              Elephant  =
B D               Dolphin  =
B D              Hedgehog  =
B D                  Pika  =
B D                Rabbit  =
B D              Bushbaby  =
B D                Tenrec  =
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Inserts between block 38 and 39 in window
B D                Human 143bp
B D                Chimp 143bp
B D               Bonobo 143bp
B D              Gorilla 143bp
B D              Tarsier 2bp

Alignment block 39 of 76 in window, 37103385 - 37103385, 1 bps 
B D                 Mouse  -a
            GCF_003668045  -a
B D              Squirrel  -t
B D              Marmoset  -a
B D               Tarsier  -a
B D                   Pig  g-
B D      Chinese pangolin  c-
B D                   Dog  g-
B D    Hawaiian monk seal  g-
B D                Rhesus  ==
B D            Guinea pig  ==
B D                 Sheep  ==
B D                 Horse  ==
B D               Gorilla  ==
B D                Bonobo  ==
B D                 Chimp  ==
B D                 Human  ==
B D               Opossum  ==
B D                   Rat  ==
                  Beaver  --
B D                 Shrew  ==
B D                   Cow  ==
B D              Elephant  ==
B D               Dolphin  ==
B D              Hedgehog  ==
B D                  Pika  ==
B D                Rabbit  ==
B D              Bushbaby  ==
B D                Tenrec  ==
B D            Tree shrew  ==
B D             Zebrafish  ==
B D  Malayan flying lemur  ==
B D         X. tropicalis  ==
B D               Chicken  ==
B D               Lamprey  ==

Inserts between block 39 and 40 in window
B D                  Pig 2bp
B D     Chinese pangolin 88bp
B D                  Dog 2bp
B D   Hawaiian monk seal 2bp

Alignment block 40 of 76 in window, 37103386 - 37103390, 5 bps 
B D                 Mouse  a--gatc
            GCF_003668045  a--tatc
B D              Squirrel  c--tgtc
B D              Marmoset  t--gacc
B D               Tarsier  tcagacc
B D                   Pig  --acatt
B D                   Dog  --atact
B D    Hawaiian monk seal  --acatt
B D                Rhesus  =======
B D            Guinea pig  =======
B D                 Sheep  =======
B D                 Horse  =======
B D               Gorilla  =======
B D                Bonobo  =======
B D                 Chimp  =======
B D                 Human  =======
B D               Opossum  =======
B D      Chinese pangolin  =======
B D                   Rat  =======
                  Beaver  -------
B D                 Shrew  =======
B D                   Cow  =======
B D              Elephant  =======
B D               Dolphin  =======
B D              Hedgehog  =======
B D                  Pika  =======
B D                Rabbit  =======
B D              Bushbaby  =======
B D                Tenrec  =======
B D            Tree shrew  =======
B D             Zebrafish  =======
B D  Malayan flying lemur  =======
B D         X. tropicalis  =======
B D               Chicken  =======
B D               Lamprey  =======

Inserts between block 40 and 41 in window
B D             Marmoset 59bp
B D              Tarsier 7bp
B D                  Dog 5bp
B D   Hawaiian monk seal 5bp

Alignment block 41 of 76 in window, 37103391 - 37103405, 15 bps 
B D                 Mouse  aagctgccacacatc
            GCF_003668045  aagcctcaattcaag
B D              Squirrel  agacctc--------
B D               Tarsier  aaacttgaagtaaaa
B D                   Pig  caagtaaaatgat--
B D                   Dog  aaacttaaatgac--
B D    Hawaiian monk seal  aaacttaaatgac--
B D                Rhesus  ===============
B D            Guinea pig  ===============
B D                 Sheep  ===============
B D                 Horse  ===============
B D               Gorilla  ===============
B D                Bonobo  ===============
B D                 Chimp  ===============
B D                 Human  ===============
B D              Marmoset  ===============
B D               Opossum  ===============
B D      Chinese pangolin  ===============
B D                   Rat  ===============
                  Beaver  ---------------
B D                 Shrew  ===============
B D                   Cow  ===============
B D              Elephant  ===============
B D               Dolphin  ===============
B D              Hedgehog  ===============
B D                  Pika  ===============
B D                Rabbit  ===============
B D              Bushbaby  ===============
B D                Tenrec  ===============
B D            Tree shrew  ===============
B D             Zebrafish  ===============
B D  Malayan flying lemur  ===============
B D         X. tropicalis  ===============
B D               Chicken  ===============
B D               Lamprey  ===============

Inserts between block 41 and 42 in window
B D             Squirrel 54bp
B D              Tarsier 4bp

Alignment block 42 of 76 in window, 37103406 - 37103428, 23 bps 
B D                 Mouse  tcacgccttgccctggacagcac
            GCF_003668045  ctcctacatatctcaaaaagcac
                   Beaver  --------tatatcaggcagtgt
B D               Tarsier  tgaagccatataatgg---gcat
B D                   Pig  tgaaagcatataataggaaagat
B D                   Dog  tgaaactatataataggaaatat
B D    Hawaiian monk seal  taaaaccatataataggaaatat
B D                Rhesus  =======================
B D            Guinea pig  =======================
B D                 Sheep  =======================
B D                 Horse  =======================
B D               Gorilla  =======================
B D                Bonobo  =======================
B D                 Chimp  =======================
B D                 Human  =======================
B D              Marmoset  =======================
B D               Opossum  =======================
B D      Chinese pangolin  =======================
B D                   Rat  =======================
B D                 Shrew  =======================
B D                   Cow  =======================
B D              Elephant  =======================
B D               Dolphin  =======================
B D              Hedgehog  =======================
B D                  Pika  =======================
B D                Rabbit  =======================
B D              Bushbaby  =======================
B D                Tenrec  =======================
B D              Squirrel  =======================
B D            Tree shrew  =======================
B D             Zebrafish  =======================
B D  Malayan flying lemur  =======================
B D         X. tropicalis  =======================
B D               Chicken  =======================
B D               Lamprey  =======================

Alignment block 43 of 76 in window, 37103429 - 37103437, 9 bps 
B D                 Mouse  tgtctgtcg
            GCF_003668045  tgtgtgtcg
                   Beaver  tatatatta
B D               Tarsier  tatatataa
B D                   Pig  tatgtataa
B D                   Dog  tatatacaa
B D    Hawaiian monk seal  tatatataa
B D              Elephant  tttttgtag
B D                Rhesus  =========
B D            Guinea pig  =========
B D                 Sheep  =========
B D                 Horse  =========
B D               Gorilla  =========
B D                Bonobo  =========
B D                 Chimp  =========
B D                 Human  =========
B D              Marmoset  =========
B D               Opossum  =========
B D      Chinese pangolin  =========
B D                   Rat  =========
B D                 Shrew  =========
B D                   Cow  =========
B D               Dolphin  =========
B D              Hedgehog  =========
B D                  Pika  =========
B D                Rabbit  =========
B D              Bushbaby  =========
B D                Tenrec  =========
B D              Squirrel  =========
B D            Tree shrew  =========
B D             Zebrafish  =========
B D  Malayan flying lemur  =========
B D         X. tropicalis  =========
B D               Chicken  =========
B D               Lamprey  =========

Inserts between block 43 and 44 in window
B D              Tarsier 10bp
B D                  Pig 9bp
B D                  Dog 4bp
B D   Hawaiian monk seal 4bp

Alignment block 44 of 76 in window, 37103438 - 37103453, 16 bps 
B D                 Mouse  agccc-------------acctttcctgt
            GCF_003668045  cacctacccaaagcatgaacccttcatgt
                   Beaver  tgtgt-----aagtatagatc--tcata-
B D              Squirrel  --------gcaaatccagtcttcacatg-
B D              Marmoset  -----------gataaaatcttcacata-
B D               Tarsier  -----------gatccagtcttcatata-
B D                   Pig  ------------atctagt----------
B D                   Dog  ------------atcctgtcttcact---
B D    Hawaiian monk seal  ------------atccagtcttgact---
B D              Elephant  ------------gtccagtctttaca---
B D                Rhesus  =============================
B D            Guinea pig  =============================
B D                 Sheep  =============================
B D                 Horse  =============================
B D               Gorilla  =============================
B D                Bonobo  =============================
B D                 Chimp  =============================
B D                 Human  =============================
B D               Opossum  =============================
B D      Chinese pangolin  =============================
B D                   Rat  =============================
B D                 Shrew  =============================
B D                   Cow  =============================
B D               Dolphin  =============================
B D              Hedgehog  =============================
B D                  Pika  =============================
B D                Rabbit  =============================
B D              Bushbaby  =============================
B D                Tenrec  =============================
B D            Tree shrew  =============================
B D             Zebrafish  =============================
B D  Malayan flying lemur  =============================
B D         X. tropicalis  =============================
B D               Chicken  =============================
B D               Lamprey  =============================

Alignment block 45 of 76 in window, 37103454 - 37103456, 3 bps 
B D                 Mouse  cct
            GCF_003668045  cct
                   Beaver  --t
B D              Squirrel  --c
B D              Marmoset  --c
B D               Tarsier  --c
B D                   Pig  ctt
B D                 Horse  --t
B D                   Dog  --t
B D    Hawaiian monk seal  --t
B D              Elephant  cat
B D                Rhesus  ===
B D            Guinea pig  ===
B D                 Sheep  ===
B D               Gorilla  ===
B D                Bonobo  ===
B D                 Chimp  ===
B D                 Human  ===
B D               Opossum  ===
B D      Chinese pangolin  ===
B D                   Rat  ===
B D                 Shrew  ===
B D                   Cow  ===
B D               Dolphin  ===
B D              Hedgehog  ===
B D                  Pika  ===
B D                Rabbit  ===
B D              Bushbaby  ===
B D                Tenrec  ===
B D            Tree shrew  ===
B D             Zebrafish  ===
B D  Malayan flying lemur  ===
B D         X. tropicalis  ===
B D               Chicken  ===
B D               Lamprey  ===

Inserts between block 45 and 46 in window
B D                  Pig 7bp

Alignment block 46 of 76 in window, 37103457 - 37103457, 1 bps 
B D                 Mouse  a
            GCF_003668045  a
                   Beaver  a
B D              Squirrel  a
B D              Marmoset  a
B D               Tarsier  a
B D                   Pig  a
B D               Dolphin  a
B D                 Horse  a
B D                   Dog  a
B D    Hawaiian monk seal  a
B D              Elephant  a
B D                Rhesus  =
B D            Guinea pig  =
B D                 Sheep  =
B D               Gorilla  =
B D                Bonobo  =
B D                 Chimp  =
B D                 Human  =
B D               Opossum  =
B D      Chinese pangolin  =
B D                   Rat  =
B D                 Shrew  =
B D                   Cow  =
B D              Hedgehog  =
B D                  Pika  =
B D                Rabbit  =
B D              Bushbaby  =
B D                Tenrec  =
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Inserts between block 46 and 47 in window
B D                Horse 2bp
B D                  Dog 2bp
B D   Hawaiian monk seal 2bp

Alignment block 47 of 76 in window, 37103458 - 37103504, 47 bps 
B D                 Mouse  gcactgaagt----gcagcagtcactagttacctt---gatgctcatgctgtgt
            GCF_003668045  gcactgaagt----gtagtagccactagttaccct-------------------
                   Beaver  gcaccaacataaccatagttactgctaattttttt---gtttcttcttttgcct
B D              Squirrel  ccaccaatgt----gcaccagtaactggtaatcctttcgtttttccctctgatt
B D              Marmoset  gccccaacag----ataccagtcactggtaatccttttgtttttgtgc------
B D               Tarsier  gcaataacat----acaccagtcactggtaatccttttgtttttttct------
B D                   Pig  gcaacaacat----atattagttactgttaatcctcttgtctttctctctgcct
B D               Dolphin  gcaacaaaat----atacca-tcactgttaatcctcttgtttttctctctgcct
B D                 Horse  gcaccaacat----gtatcagtcactagtaatcctcttgtttttctctctgcct
B D      Chinese pangolin  gtactaacat----atattagtcactggtaatcctcttgtttttatctctgcct
B D                   Dog  gcaccaacat----acaccagtccctagtaatccccttgtttt--tctctgttt
B D    Hawaiian monk seal  gcaccaacat----ataccagtccctggtaatcctcttgtttttctctctgcct
B D              Elephant  gcagcaacat----ataccagttcctggtaatccttttgtttttccctctgcct
B D                Rhesus  ======================================================
B D            Guinea pig  ======================================================
B D                 Sheep  ======================================================
B D               Gorilla  ======================================================
B D                Bonobo  ======================================================
B D                 Chimp  ======================================================
B D                 Human  ======================================================
B D               Opossum  ======================================================
B D                   Rat  ======================================================
B D                 Shrew  ======================================================
B D                   Cow  ======================================================
B D              Hedgehog  ======================================================
B D                  Pika  ======================================================
B D                Rabbit  ======================================================
B D              Bushbaby  ======================================================
B D                Tenrec  ======================================================
B D            Tree shrew  ======================================================
B D             Zebrafish  ======================================================
B D  Malayan flying lemur  ======================================================
B D         X. tropicalis  ======================================================
B D               Chicken  ======================================================
B D               Lamprey  ======================================================

Inserts between block 47 and 48 in window
B D             Marmoset 1bp
B D              Tarsier 5bp

Alignment block 48 of 76 in window, 37103505 - 37103573, 69 bps 
B D                 Mouse  tca---gtatctatac---aaaatta---ta-caaagcaagctttgtacaaacc----aacgttcca-ag
            GCF_003668045  ----------------------------------------gctctgtgcaaacc----aacatt-ta-gg
                   Beaver  taat--aaatttaaactt-aatgtag---aa-gaaaacagattctatataaaac----agaattctatag
B D              Squirrel  tg----gtatttaaattt-tagatag---cg-taaaacagat----tataaaacttgtgaagtt-ca-ga
B D                 Human  ---ttaatatttaaactt-aatgtag---aa-aaaaacagattcaagacaaacc-tgtgaagtt-ca-ga
B D                 Chimp  ---ttaatatttaaactt-aatgtag---aa-aaaaacagattcaagacaaacc-tgtgaagtt-ca-ga
B D                Bonobo  ---ttaatatttaaactt-aatgtag---aa-aaaaacagattcaagacaaacc-tgtgaagtt-ca-ga
B D               Gorilla  ---ttaatatttaaactt-aatgtag---aa-aaaaacagattcaagacaaacc-tgtgaagtt-ca-ga
B D                Rhesus  ---ttaatatttaaactt-aatgtag---aa-aaaaatagattcaagataaacc-tgtgaagtt-ca-ga
B D              Marmoset  ---ttaatatttaaactt-aatgtgg---ag-aaaaacagatttaacataaacc-tgtaaagtt-ca-ga
B D               Tarsier  ---ttaatatttaaactt-aatgtag---aagaaaaacagattctagataaacc-tgtgacatt-ca-ca
B D                   Pig  ----tagtatttaaactt-a--------------------attctagataaacc-tatgaagtt-ca-ga
B D               Dolphin  ----taatatttaaactt-aatgtgg---ag-aaacacagattctagataaagc-tgtgaagtg-ca-ga
B D                 Horse  ----taatatttaaactt-aatgtgg---ag-aaaaacagattctagataaacc-tgtgaagtt-ca-ga
B D      Chinese pangolin  ----tcacatttaaacttaaatgtgg---ag-gaaaac--attctagataaact-ggt-aattg-ta-ga
B D                   Dog  ----taatagttaaactt-cacgtggaaaaa-aaaaacagactctaagaaaacc-tgcgaagtt-ca-ga
B D    Hawaiian monk seal  ----taatatttaaac---aatgtgg--aaa-aataacagactctaagtaaacc-tgtgaagtt-ca-ga
B D              Elephant  ----taatatctaaactt-aatgtgg---ac-aaaaacagattctaagtaaacc---------t-gt-aa
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D               Opossum  ======================================================================
B D                   Rat  ======================================================================
B D                 Shrew  ======================================================================
B D                   Cow  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D                Rabbit  ======================================================================
B D              Bushbaby  ======================================================================
B D                Tenrec  ======================================================================
B D            Tree shrew  ======================================================================
B D             Zebrafish  ======================================================================
B D  Malayan flying lemur  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  cttcattttcagtc
            GCF_003668045  cttcatttccagtc
                   Beaver  attcttttctagtc
                 Squirrel  atgaatttctagtc
                    Human  attattttctagtc
                    Chimp  attattttctagtc
                   Bonobo  attattttctagtc
                  Gorilla  attattttctagtc
                   Rhesus  attattttctagtc
                 Marmoset  attattttctagtc
                  Tarsier  gttactttctaatc
                      Pig  attcttttcttatc
                  Dolphin  attcttttctagtc
                    Horse  attcttttctagtc
         Chinese pangolin  attcttttctagtc
                      Dog  attcttttctagtc
       Hawaiian monk seal  attcttttctaggt
                 Elephant  attcttctctagtc
               Guinea pig  ==============
                    Sheep  ==============
                  Opossum  ==============
                      Rat  ==============
                    Shrew  ==============
                      Cow  ==============
                 Hedgehog  ==============
                     Pika  ==============
                   Rabbit  ==============
                 Bushbaby  ==============
                   Tenrec  ==============
               Tree shrew  ==============
                Zebrafish  ==============
     Malayan flying lemur  ==============
            X. tropicalis  ==============
                  Chicken  ==============
                  Lamprey  ==============

Inserts between block 48 and 49 in window
B D   Hawaiian monk seal 9bp

Alignment block 49 of 76 in window, 37103574 - 37103602, 29 bps 
B D                 Mouse  tgcccatatgtgagagc-----ccatatttatgt-
            GCF_003668045  tgcccatgtctg-------------cacttattt-
                   Beaver  ttcctagatttgaaacc--ctgccagatttattt-
B D              Squirrel  tacctagatttaaaagc--ctgccaaacttatgt-
B D                 Human  tacctatatttgaaaac--ctgacaaatttgttt-
B D                 Chimp  tacctatatttgaaaac--ctgacaaatttgttt-
B D                Bonobo  tacctatatttgaaaac--ctgacaaatttgttt-
B D               Gorilla  tacctatatttgaaaac--ctgacaaatttgttt-
B D                Rhesus  tacctatatttgaaaac--ctgacaaatttgttt-
B D              Marmoset  tacctgtatttgaaaac--ctggcaaatttgttt-
B D               Tarsier  tacctagatgtgaaagt--ctgctgga----ttt-
B D                   Pig  tacctagacatgaatgc--ctgccagatttcttt-
B D               Dolphin  tacctaggtatgaatgc--ctgccagatttcttt-
B D                 Sheep  tacctaaatatgaatgc--ctgccagatttcttt-
B D                 Horse  taccgagatatgaaatc--ctgccagatttcttt-
B D      Chinese pangolin  tacctagttatgaaagc--ctgctggatttcttt-
B D                   Dog  tatgtctatataaaaac--ctgccagatttcttt-
B D    Hawaiian monk seal  tatgtctatataaaagc--ctgccagatttcttt-
B D              Elephant  ttcctcgatttgaaaaaggctgccaaattttctca
B D            Guinea pig  ===================================
B D               Opossum  ===================================
B D                   Rat  ===================================
B D                 Shrew  ===================================
B D                   Cow  ===================================
B D              Hedgehog  ===================================
B D                  Pika  ===================================
B D                Rabbit  ===================================
B D              Bushbaby  ===================================
B D                Tenrec  ===================================
B D            Tree shrew  ===================================
B D             Zebrafish  ===================================
B D  Malayan flying lemur  ===================================
B D         X. tropicalis  ===================================
B D               Chicken  ===================================
B D               Lamprey  ===================================

Alignment block 50 of 76 in window, 37103603 - 37103641, 39 bps 
B D                 Mouse  ctctcaaatatattatgaaacc-cttgacattttgtgaaa
            GCF_003668045  ctcttagatgttatataaaaca-tttaacatttcataaaa
                   Beaver  ccct--gatattatgtgaaacc-tatgacattttgt-aac
B D              Squirrel  ctctcaggtgctatgtgaaaccttttggcatttgatgaaa
B D                 Human  ctcttgggtatgatgtgaaaca-tttgtcattttatgaaa
B D                 Chimp  ctcttgggtatgatgtgaaaca-tttgtcattttatgaaa
B D                Bonobo  ctcttgggtatgatgtgaaaca-tttgtcattttatgaaa
B D               Gorilla  ctcttggttatgatgtgaaaca-tttgtcattttatgaaa
B D                Rhesus  ctcttgggtatgatgtgaaaca-tttgtcattttatgaaa
B D              Marmoset  ctctcaggtatgttgtgaaaca-tttgtcattttttgaag
B D               Tarsier  ctcttcaatattatatgagaac-tttgtcattttatgaaa
B D                   Pig  ctctcaggtattatgtgaaacc-tttatcattttatggaa
B D               Dolphin  ccctcaggtattatgtggaacc-tttgtcactttatgaaa
B D                 Sheep  tcctcagaaattatgtagaacc-tttgtcattttatgaaa
B D                 Horse  ctctcaggtattatgtgaagcc-tttgtcattttatgaaa
B D      Chinese pangolin  ccctcaggtattatatgaaacc-tctgtaattttatgatg
B D                   Dog  ctcgcagttatt-tgtgaaatc-tttgtaattttatgaaa
B D    Hawaiian monk seal  cttgcagttattatgtgaagtc-tttgtcattttatgaaa
B D              Elephant  acttcagatattatgtgaaacc-tttgctattttatgaaa
B D                Tenrec  cttccagatattctatgaaacc-tttgcaatcttgtgaaa
B D            Guinea pig  ========================================
B D               Opossum  ========================================
B D                   Rat  ========================================
B D                 Shrew  ========================================
B D                   Cow  ========================================
B D              Hedgehog  ========================================
B D                  Pika  ========================================
B D                Rabbit  ========================================
B D              Bushbaby  ========================================
B D            Tree shrew  ========================================
B D             Zebrafish  ========================================
B D  Malayan flying lemur  ========================================
B D         X. tropicalis  ========================================
B D               Chicken  ========================================
B D               Lamprey  ========================================

Inserts between block 50 and 51 in window
B D                  Pig 405bp

Alignment block 51 of 76 in window, 37103642 - 37103645, 4 bps 
B D                 Mouse  tatt
            GCF_003668045  tatt
                   Beaver  tatt
B D              Squirrel  tatt
B D                 Human  tagt
B D                 Chimp  tagt
B D                Bonobo  tagt
B D               Gorilla  tagt
B D                Rhesus  tagt
B D              Marmoset  tact
B D               Tarsier  tatt
B D               Dolphin  tatt
B D                 Sheep  tact
B D                 Horse  tatt
B D      Chinese pangolin  tatt
B D                   Dog  tatt
B D    Hawaiian monk seal  tact
B D              Elephant  tatt
B D                Tenrec  tatt
B D            Guinea pig  ====
B D               Opossum  ====
B D                   Pig  ====
B D                   Rat  ====
B D                 Shrew  ====
B D                   Cow  ====
B D              Hedgehog  ====
B D                  Pika  ====
B D                Rabbit  ====
B D              Bushbaby  ====
B D            Tree shrew  ====
B D             Zebrafish  ====
B D  Malayan flying lemur  ====
B D         X. tropicalis  ====
B D               Chicken  ====
B D               Lamprey  ====

Inserts between block 51 and 52 in window
B D                Chimp 68bp

Alignment block 52 of 76 in window, 37103646 - 37103646, 1 bps 
B D                 Mouse  g
            GCF_003668045  g
                   Beaver  g
B D              Squirrel  g
B D                 Human  g
B D                Bonobo  g
B D               Gorilla  g
B D                Rhesus  g
B D              Marmoset  g
B D               Tarsier  g
B D               Dolphin  g
B D                 Sheep  g
B D                 Horse  g
B D      Chinese pangolin  g
B D                   Dog  g
B D    Hawaiian monk seal  g
B D              Elephant  g
B D                Tenrec  g
B D            Guinea pig  =
B D                 Chimp  =
B D               Opossum  =
B D                   Pig  =
B D                   Rat  =
B D                 Shrew  =
B D                   Cow  =
B D              Hedgehog  =
B D                  Pika  =
B D                Rabbit  =
B D              Bushbaby  =
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Inserts between block 52 and 53 in window
B D   Hawaiian monk seal 506bp
B D               Tenrec 1499bp

Alignment block 53 of 76 in window, 37103647 - 37103647, 1 bps 
B D                 Mouse  c
            GCF_003668045  t
                   Beaver  c
B D                 Human  t
B D                Bonobo  t
B D               Gorilla  t
B D                Rhesus  t
B D              Marmoset  t
B D               Tarsier  t
B D              Elephant  t
B D                   Dog  -
B D            Guinea pig  =
B D                 Sheep  -
B D                 Horse  -
B D    Hawaiian monk seal  =
B D                 Chimp  =
B D               Opossum  =
B D                   Pig  =
B D      Chinese pangolin  -
B D                   Rat  =
B D                 Shrew  =
B D                   Cow  =
B D               Dolphin  -
B D              Hedgehog  =
B D                  Pika  =
B D                Rabbit  =
B D              Bushbaby  =
B D                Tenrec  =
B D              Squirrel  -
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Inserts between block 53 and 54 in window
B D                Human 66bp
B D               Bonobo 66bp
B D              Gorilla 66bp
B D               Rhesus 66bp

Alignment block 54 of 76 in window, 37103648 - 37103648, 1 bps 
B D                 Mouse  -a
            GCF_003668045  -a
                   Beaver  -c
B D              Elephant  g-
B D                   Dog  --
B D                Rhesus  ==
B D            Guinea pig  ==
B D                 Sheep  --
B D                 Horse  --
B D    Hawaiian monk seal  ==
B D               Gorilla  ==
B D                Bonobo  ==
B D                 Chimp  ==
B D                 Human  ==
B D              Marmoset  --
B D               Opossum  ==
B D                   Pig  ==
B D      Chinese pangolin  --
B D                   Rat  ==
B D                 Shrew  ==
B D                   Cow  ==
B D               Dolphin  --
B D              Hedgehog  ==
B D                  Pika  ==
B D               Tarsier  --
B D                Rabbit  ==
B D              Bushbaby  ==
B D                Tenrec  ==
B D              Squirrel  --
B D            Tree shrew  ==
B D             Zebrafish  ==
B D  Malayan flying lemur  ==
B D         X. tropicalis  ==
B D               Chicken  ==
B D               Lamprey  ==

Inserts between block 54 and 55 in window
B D             Elephant 240bp

Alignment block 55 of 76 in window, 37103649 - 37103649, 1 bps 
B D                 Mouse  -----------a
            GCF_003668045  ttggtcttgcca
                   Beaver  -----------a
B D                   Dog  ------------
B D                Rhesus  ============
B D            Guinea pig  ============
B D                 Sheep  ------------
B D                 Horse  ------------
B D    Hawaiian monk seal  ============
B D               Gorilla  ============
B D                Bonobo  ============
B D                 Chimp  ============
B D                 Human  ============
B D              Marmoset  ------------
B D               Opossum  ============
B D                   Pig  ============
B D      Chinese pangolin  ------------
B D                   Rat  ============
B D                 Shrew  ============
B D                   Cow  ============
B D              Elephant  ============
B D               Dolphin  ------------
B D              Hedgehog  ============
B D                  Pika  ============
B D               Tarsier  ------------
B D                Rabbit  ============
B D              Bushbaby  ============
B D                Tenrec  ============
B D              Squirrel  ------------
B D            Tree shrew  ============
B D             Zebrafish  ============
B D  Malayan flying lemur  ============
B D         X. tropicalis  ============
B D               Chicken  ============
B D               Lamprey  ============

Inserts between block 55 and 56 in window
                  Beaver 48bp

Alignment block 56 of 76 in window, 37103650 - 37103664, 15 bps 
B D                 Mouse  ggtgtggttggcata---
            GCF_003668045  ggtggtggtggttca---
B D              Squirrel  --tgttgtt---------
B D              Marmoset  ---gttggt---------
B D               Tarsier  ---gttggt---------
B D               Dolphin  --tgttggc------ctg
B D                 Sheep  --tgtttgt------ctt
B D                 Horse  --tgttggt------ctt
B D      Chinese pangolin  --tgttggt------ctt
B D                   Dog  --tgttggt------ctt
B D                Rhesus  ==================
B D            Guinea pig  ==================
B D    Hawaiian monk seal  ==================
B D               Gorilla  ==================
B D                Bonobo  ==================
B D                 Chimp  ==================
B D                 Human  ==================
B D               Opossum  ==================
B D                   Pig  ==================
B D                   Rat  ==================
                  Beaver  ==================
B D                 Shrew  ==================
B D                   Cow  ==================
B D              Elephant  ==================
B D              Hedgehog  ==================
B D                  Pika  ==================
B D                Rabbit  ==================
B D              Bushbaby  ==================
B D                Tenrec  ==================
B D            Tree shrew  ==================
B D             Zebrafish  ==================
B D  Malayan flying lemur  ==================
B D         X. tropicalis  ==================
B D               Chicken  ==================
B D               Lamprey  ==================

Inserts between block 56 and 57 in window
B D              Dolphin 86bp
B D                Sheep 5bp

Alignment block 57 of 76 in window, 37103665 - 37103668, 4 bps 
B D                 Mouse  agct
            GCF_003668045  cgcc
B D              Squirrel  --ct
B D              Marmoset  --ct
B D               Tarsier  --ct
B D                 Sheep  aact
B D                 Horse  ggtc
B D      Chinese pangolin  ggtt
B D                   Dog  gatc
B D                Rhesus  ====
B D            Guinea pig  ====
B D    Hawaiian monk seal  ====
B D               Gorilla  ====
B D                Bonobo  ====
B D                 Chimp  ====
B D                 Human  ====
B D               Opossum  ====
B D                   Pig  ====
B D                   Rat  ====
                  Beaver  ====
B D                 Shrew  ====
B D                   Cow  ====
B D              Elephant  ====
B D               Dolphin  ====
B D              Hedgehog  ====
B D                  Pika  ====
B D                Rabbit  ====
B D              Bushbaby  ====
B D                Tenrec  ====
B D            Tree shrew  ====
B D             Zebrafish  ====
B D  Malayan flying lemur  ====
B D         X. tropicalis  ====
B D               Chicken  ====
B D               Lamprey  ====

Inserts between block 57 and 58 in window
B D                Sheep 25bp
B D                  Dog 344bp

Alignment block 58 of 76 in window, 37103669 - 37103717, 49 bps 
B D                 Mouse  tataatct---------cagtgatt------------caagaggat---tgcaagttcaaggccaaccca
            GCF_003668045  tttaatcc---------cagcacttgggaggcagaagcaggcggatctctgtgagttcaagaccagtctg
B D              Squirrel  tagactgc---------ca---------------------------------------------------
B D              Marmoset  tggtctgccacaagctaca------------------caagc----------------------------
B D               Tarsier  cagtctgc---------ca------------------tgagc----------------------------
B D                 Horse  -----tgc--------------------------------------------------------------
B D      Chinese pangolin  -----tgc--------------------------------------------------------------
B D                   Dog  ======================================================================
B D                Rhesus  ======================================================================
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D               Opossum  ======================================================================
B D                   Pig  ======================================================================
B D                   Rat  ======================================================================
                  Beaver  ======================================================================
B D                 Shrew  ======================================================================
B D                   Cow  ======================================================================
B D              Elephant  ======================================================================
B D               Dolphin  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D                Rabbit  ======================================================================
B D              Bushbaby  ======================================================================
B D                Tenrec  ======================================================================
B D            Tree shrew  ======================================================================
B D             Zebrafish  ======================================================================
B D  Malayan flying lemur  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  gcc
            GCF_003668045  gtc
                 Squirrel  ---
                 Marmoset  ---
                  Tarsier  ---
                    Horse  ---
         Chinese pangolin  ---
                      Dog  ===
                   Rhesus  ===
               Guinea pig  ===
                    Sheep  ===
       Hawaiian monk seal  ===
                  Gorilla  ===
                   Bonobo  ===
                    Chimp  ===
                    Human  ===
                  Opossum  ===
                      Pig  ===
                      Rat  ===
                   Beaver  ===
                    Shrew  ===
                      Cow  ===
                 Elephant  ===
                  Dolphin  ===
                 Hedgehog  ===
                     Pika  ===
                   Rabbit  ===
                 Bushbaby  ===
                   Tenrec  ===
               Tree shrew  ===
                Zebrafish  ===
     Malayan flying lemur  ===
            X. tropicalis  ===
                  Chicken  ===
                  Lamprey  ===

Inserts between block 58 and 59 in window
           GCF_003668045 79bp

Alignment block 59 of 76 in window, 37103718 - 37103808, 91 bps 
B D                 Mouse  aatttagtgaacttttttcttagggaa-----aaacttaaagagattagggttatatatcttagttagtg
B D              Squirrel  -------tcaactatatttctaaaaca-----aaa------------------atctcttttaatt----
B D              Marmoset  --------tatgtgtatttctaaaaaaacaacaga----aaga------------ctgttttaaat----
B D               Tarsier  --------tatatgtatttcttaaaaa-----aaa----aag-----------------tttgaata---
B D                 Horse  -catgaactgtgtatatttctaaaaaa-----aaa---aaagaaaccct----acctatttttat-----
B D      Chinese pangolin  -cattagttgtatgtatttcttaaaaa-----aag---aaagaaagtct---------ctttaat-----
B D                   Dog  ======================================================================
B D                Rhesus  ======================================================================
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D               Opossum  ======================================================================
B D                   Pig  ======================================================================
B D                   Rat  ======================================================================
                  Beaver  ======================================================================
B D                 Shrew  ======================================================================
B D                   Cow  ======================================================================
B D              Elephant  ======================================================================
B D               Dolphin  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
           GCF_003668045  ======================================================================
B D                Rabbit  ======================================================================
B D              Bushbaby  ======================================================================
B D                Tenrec  ======================================================================
B D            Tree shrew  ======================================================================
B D             Zebrafish  ======================================================================
B D  Malayan flying lemur  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================
B D               Lamprey  ======================================================================

                    Mouse  tacttgtgtagcatctggtaggccta
                 Squirrel  --------------------------
                 Marmoset  --------------------------
                  Tarsier  --------------------------
                    Horse  --------------------------
         Chinese pangolin  --------------------------
                      Dog  ==========================
                   Rhesus  ==========================
               Guinea pig  ==========================
                    Sheep  ==========================
       Hawaiian monk seal  ==========================
                  Gorilla  ==========================
                   Bonobo  ==========================
                    Chimp  ==========================
                    Human  ==========================
                  Opossum  ==========================
                      Pig  ==========================
                      Rat  ==========================
                   Beaver  ==========================
                    Shrew  ==========================
                      Cow  ==========================
                 Elephant  ==========================
                  Dolphin  ==========================
                 Hedgehog  ==========================
                     Pika  ==========================
            GCF_003668045  ==========================
                   Rabbit  ==========================
                 Bushbaby  ==========================
                   Tenrec  ==========================
               Tree shrew  ==========================
                Zebrafish  ==========================
     Malayan flying lemur  ==========================
            X. tropicalis  ==========================
                  Chicken  ==========================
                  Lamprey  ==========================

Alignment block 60 of 76 in window, 37103809 - 37103825, 17 bps 
B D                 Mouse  gactcaatccccaggaa
B D               Dolphin  gacttgattatcagact
B D                   Dog  =================
B D                Rhesus  =================
B D            Guinea pig  =================
B D                 Sheep  =================
B D                 Horse  -----------------
B D    Hawaiian monk seal  =================
B D               Gorilla  =================
B D                Bonobo  =================
B D                 Chimp  =================
B D                 Human  =================
B D              Marmoset  -----------------
B D               Opossum  =================
B D                   Pig  =================
B D      Chinese pangolin  -----------------
B D                   Rat  =================
                  Beaver  =================
B D                 Shrew  =================
B D                   Cow  =================
B D              Elephant  =================
B D              Hedgehog  =================
B D                  Pika  =================
B D               Tarsier  -----------------
           GCF_003668045  =================
B D                Rabbit  =================
B D              Bushbaby  =================
B D                Tenrec  =================
B D              Squirrel  -----------------
B D            Tree shrew  =================
B D             Zebrafish  =================
B D  Malayan flying lemur  =================
B D         X. tropicalis  =================
B D               Chicken  =================
B D               Lamprey  =================

Alignment block 61 of 76 in window, 37103826 - 37103826, 1 bps 
B D                 Mouse  t
B D                 Sheep  t
B D                   Dog  =
B D                Rhesus  =
B D            Guinea pig  =
B D                 Horse  -
B D    Hawaiian monk seal  =
B D               Gorilla  =
B D                Bonobo  =
B D                 Chimp  =
B D                 Human  =
B D              Marmoset  -
B D               Opossum  =
B D                   Pig  =
B D      Chinese pangolin  -
B D                   Rat  =
                  Beaver  =
B D                 Shrew  =
B D                   Cow  =
B D              Elephant  =
B D               Dolphin  -
B D              Hedgehog  =
B D                  Pika  =
B D               Tarsier  -
           GCF_003668045  =
B D                Rabbit  =
B D              Bushbaby  =
B D                Tenrec  =
B D              Squirrel  -
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =
B D         X. tropicalis  =
B D               Chicken  =
B D               Lamprey  =

Alignment block 62 of 76 in window, 37103827 - 37103828, 2 bps 
B D                 Mouse  gc
B D                 Sheep  at
B D              Elephant  at
B D                   Dog  ==
B D                Rhesus  ==
B D            Guinea pig  ==
B D                 Horse  --
B D    Hawaiian monk seal  ==
B D               Gorilla  ==
B D                Bonobo  ==
B D                 Chimp  ==
B D                 Human  ==
B D              Marmoset  --
B D               Opossum  ==
B D                   Pig  ==
B D      Chinese pangolin  --
B D                   Rat  ==
                  Beaver  ==
B D                 Shrew  ==
B D                   Cow  ==
B D               Dolphin  --
B D              Hedgehog  ==
B D                  Pika  ==
B D               Tarsier  --
           GCF_003668045  ==
B D                Rabbit  ==
B D              Bushbaby  ==
B D                Tenrec  ==
B D              Squirrel  --
B D            Tree shrew  ==
B D             Zebrafish  ==
B D  Malayan flying lemur  ==
B D         X. tropicalis  ==
B D               Chicken  ==
B D               Lamprey  ==

Alignment block 63 of 76 in window, 37103829 - 37103829, 1 bps 
B D                 Mouse  a
B D                 Human  a
B D                 Chimp  a
B D                Bonobo  a
B D               Gorilla  a
B D                Rhesus  a
B D              Marmoset  a
B D                 Sheep  a
B D                 Horse  a
B D      Chinese pangolin  g
B D              Elephant  a
B D                   Dog  =
B D            Guinea pig  =
B D    Hawaiian monk seal  =
B D               Opossum  =
B D                   Pig  =
B D                   Rat  =
                  Beaver  =
B D                 Shrew  =
B D                   Cow  =
B D               Dolphin  -
B D              Hedgehog  =
B D                  Pika  =
B D               Tarsier  -
           GCF_003668045  =
B D                Rabbit  =
B D              Bushbaby  =
B D                Tenrec  =
B D              Squirrel  -
B D            Tree shrew  =
B D             Zebrafish  =
B D  Malayan flying lemur  =