Multiz Alignments of 60 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 120 in window, 37105431 - 37105484, 54 bps 
B D             Mouse  ggaa--aaagttac-ttagtaaaaag--gcttgtgatctgaaacccag-tttt-attagaa-
B D               Rat  ggaa--aaagttac-tcagtagaaag--gtttgtgatctggaacccag-tttt-attagat-
B D          Squirrel  aggagcaaagttacaacatcaaaaag--gttcatgatctgtggactca-cttt-attagaa-
B D            Rabbit  ggg---aaagtcacagtagcaaaaag--atttattatctatggactcactttt-cttagaa-
B D             Human  aggggaaaagttacagtagcaaaaat--gttcatgatctagggacccactttc-attagaa-
B D             Chimp  aggggaaaagttacagtagcaaaaat--gttcatgatctagggacgcactttc-attagaa-
B D           Gorilla  aggggaaaagttacagtagcaaaaat--gttcatgatctagggacccactttc-attagaa-
B D         Orangutan  aagggaaaagttatagtagcaaaagg--gttcatgatctagggacccactttc-attagaa-
B D            Gibbon  aggggaaaagttacagtagcaaaaag--gttcatgatctagggacccactttc-attagaa-
B D            Rhesus  aggggaaaagttacagtagcaaaaag--tttcatgatctgtggacccactttc-attagaa-
B D            Baboon  aggggaaaagttacagtagcaaaaag--gttcatgatctgtggacccactttc-attagaa-
B D           Tarsier  tgaggaaaaattacagtagcaaaaat--gttcatgatctatggacccacttat-attagaa-
B D          Bushbaby  aagcaaaaagttacaatagtgaaaag--atttgtgacctgtgcacccactttt-attagaa-
B D               Pig  agggatagagttaaaatagcaagaaa--gctcatgatctgtggac----tttt-attagaa-
B D            Alpaca  agaaaaagagtta-aatagcaagaaa--gctcatgatctgtggacccactttt-gttagaa-
B D           Dolphin  agggaaagagttacaatagcaagaaa--gctcatgatctgtggacccacttct-attagaa-
B D               Cow  agggaaagagttacagaagcaagaac--gct-ataatatgtgaacctattttt-attagaa-
B D               Cat  a--gagagagttacaatagcaaaaac--tttcatagtctgtggacccgctttt-attagaa-
B D               Dog  ----agagagtt---aaagcaaaaag--tttcgtggtctatggacccacttttaattagaa-
B D             Panda  a--gagagagtt---atagcaaaaca--ttgcatggtctatagatccactttt-attagaa-
B D             Horse  agggaaagaggtacagtagcaaaaaa--gttcttcatctgtggacccactttt-attaaaa-
  D  Little brown bat  aggaaaggagtttcaatagcaaaaac--gttcatgatata----------------taaaa-
B D           Megabat  tgggaaagagttacaaagcaaaaaac--gtacatgatctgtggacccactttt-attaaaa-
B D          Elephant  aggg-aaaaattacagtagtaaaaaaagattcatgatctgtggacccattttt-aatagaaa
B D           Manatee  aggg-aaaaattacaataataaaaaa--gtttatgatctgtggacccattttt-gatagaaa
B D         Armadillo  agga-aaaaattacagtaacaaa-----gctcatgatctgtggaccca-tttt-attagaaa
B D             Sloth  aat--aaatattacagtagcaaaaag--gttcatgatctgtgaacccactttt-attagaaa
B D        Guinea pig  ==============================================================
B D    Naked mole-rat  ==============================================================
B D   Squirrel monkey  ==============================================================
B D          Marmoset  ==============================================================
B D             Shrew  ==============================================================
B D          Hedgehog  ==============================================================
B D       Mouse lemur  ==============================================================
B D           Wallaby  ==============================================================
B D      Kangaroo rat  ==============================================================
B D        Rock hyrax  ==============================================================
B D           Opossum  ==============================================================
B D            Lizard  ==============================================================
B D        Budgerigar  ==============================================================
B D   Tasmanian devil  ==============================================================
B D          Platypus  ==============================================================
B D         Zebrafish  ==============================================================
B D       Zebra finch  ==============================================================
B D           Chicken  ==============================================================
B D     X. tropicalis  ==============================================================
B D        Coelacanth  ==============================================================
B D    Painted turtle  ==============================================================
B D            Turkey  ==============================================================

Inserts between block 1 and 2 in window
B D              Pig 217bp
B D           Alpaca 2bp
B D          Dolphin 6bp
B D              Cow 6bp
B D              Cat 3bp
B D              Dog 3bp
B D            Panda 3bp
B D            Horse 3bp
  D Little brown bat 3bp
B D          Megabat 3bp

Alignment block 2 of 120 in window, 37105485 - 37105489, 5 bps 
B D             Mouse  tag----ac---------
B D               Rat  tag----ac-aat----g
B D          Squirrel  tta----ta-aat---gg
B D            Rabbit  aca----ac-ttg---tg
B D             Human  acc----ca-aat-----
B D             Chimp  acc----ca-aat-----
B D           Gorilla  acc----ca-aat-----
B D         Orangutan  acc----ca-aat-----
B D            Gibbon  acc----ca-aat-----
B D            Rhesus  acc----ca-aat-----
B D            Baboon  acc----ca-aat-----
B D           Tarsier  acc----ct-aag-----
B D          Bushbaby  acccagaca-aat-----
B D            Alpaca  ----------aga---aa
B D           Dolphin  ----------aaa---aa
B D               Cow  ----------aaa---aa
B D               Cat  --------a-aaa-----
B D               Dog  --------a-aaa-----
B D             Panda  --------a-aaa-----
B D             Horse  --------t-agaagtag
  D  Little brown bat  --------t-agaaaaaa
B D           Megabat  --------t-ggaaacaa
B D          Elephant  -------ca-gaa-----
B D           Manatee  -------ca-aaa-----
B D         Armadillo  -------cataaa-----
B D             Sloth  -------cataga-----
B D               Pig  ==================
B D        Guinea pig  ==================
B D    Naked mole-rat  ==================
B D   Squirrel monkey  ==================
B D          Marmoset  ==================
B D             Shrew  ==================
B D          Hedgehog  ==================
B D       Mouse lemur  ==================
B D           Wallaby  ==================
B D      Kangaroo rat  ==================
B D        Rock hyrax  ==================
B D           Opossum  ==================
B D            Lizard  ==================
B D        Budgerigar  ==================
B D   Tasmanian devil  ==================
B D          Platypus  ==================
B D         Zebrafish  ==================
B D       Zebra finch  ==================
B D           Chicken  ==================
B D     X. tropicalis  ==================
B D        Coelacanth  ==================
B D    Painted turtle  ==================
B D            Turkey  ==================

Alignment block 3 of 120 in window, 37105490 - 37105522, 33 bps 
B D             Mouse  tatacatgtgcatgcacac----aca----------tacacatatat
B D               Rat  catacatgtgcgtgcacac----aca----------catacatatat
B D          Squirrel  cataaacatctgtgtgcac----ata----------tacaagtgcaa
B D            Rabbit  tatacatctacagggacat----ata-------------------gt
B D             Human  tacacatctacatgcacata---ata----------tacacatacag
B D             Chimp  tacacgtctacatgcacata---ata----------tacacatacag
B D           Gorilla  tacacatctacatgcacata---ata----------tacacatacag
B D         Orangutan  tacacatctacatgcacata---ata----------tacac------
B D            Gibbon  tacacatctacatgcacata---ata----------tacacatacac
B D            Rhesus  tacacatctacatgcacata---ata----------tacacacacac
B D            Baboon  tacacgtctacatgcacata---ata----------tacacacacac
B D           Tarsier  taaacatctacatatctat----gca----------catatatatag
B D          Bushbaby  tacacatccacatgtacatgc--att----------cacgtgtatgt
B D            Alpaca  tatatatccacatgcacat----ata----tacacatatacatatat
B D           Dolphin  tacatatctatatgtgcat----aca----------tacatatatat
B D               Cow  tatatatatttacgtgtgt----acacatatgcacgtatatatatat
B D               Cat  -atatatctacatgcacgt----atg----------caaatat----
B D               Dog  ---atatctgcaaggacat----ata----------c----------
B D             Panda  --tatatctgtgtgcacat----aca----------tgtatatggaa
B D             Horse  tatatatctatgtatgcgt----aca----------tacacac----
  D  Little brown bat  -atatatctacatgtgcat----aca----------tgcccatatac
B D           Megabat  tatttacctacatgtacat----aca----------tgcgta-----
B D          Elephant  aatatatatacatgcacac----ata----------cacatgtattt
B D           Manatee  aatatatatacatgcacac----aca----------tgtacacatat
B D         Armadillo  aatacacatatcagtgaacacagaca----------tatatatatta
B D             Sloth  aatatacaaatgtgtgcac----aca----------catatatatga
B D           Opossum  tgtccatgtgcatgcatat----aca----------tatacacacgt
B D               Pig  ===============================================
B D        Guinea pig  ===============================================
B D    Naked mole-rat  ===============================================
B D   Squirrel monkey  ===============================================
B D          Marmoset  ===============================================
B D             Shrew  ===============================================
B D          Hedgehog  ===============================================
B D       Mouse lemur  ===============================================
B D           Wallaby  ===============================================
B D      Kangaroo rat  ===============================================
B D        Rock hyrax  ===============================================
B D            Lizard  ===============================================
B D        Budgerigar  ===============================================
B D   Tasmanian devil  ===============================================
B D          Platypus  ===============================================
B D         Zebrafish  ===============================================
B D       Zebra finch  ===============================================
B D           Chicken  ===============================================
B D     X. tropicalis  ===============================================
B D        Coelacanth  ===============================================
B D    Painted turtle  ===============================================
B D            Turkey  ===============================================

Alignment block 4 of 120 in window, 37105523 - 37105526, 4 bps 
B D             Mouse  --ggat
B D               Rat  --ggat
B D          Squirrel  --ggat
B D            Rabbit  --ggac
B D             Human  --gaag
B D             Chimp  --gaag
B D           Gorilla  --gaag
B D         Orangutan  --gaag
B D            Gibbon  --aaag
B D            Rhesus  --gaag
B D            Baboon  --aaag
B D           Tarsier  --agag
B D          Bushbaby  --agag
B D            Alpaca  --ggag
B D           Dolphin  --ggag
B D               Cow  --gaag
B D               Cat  --ggga
B D               Dog  --agaa
B D             Panda  --agaa
B D             Horse  --atgc
  D  Little brown bat  atggag
B D           Megabat  --agag
B D          Elephant  --gggg
B D         Armadillo  --gggg
B D             Sloth  --ggag
B D               Pig  ======
B D           Manatee  ------
B D        Guinea pig  ======
B D    Naked mole-rat  ======
B D   Squirrel monkey  ======
B D          Marmoset  ======
B D             Shrew  ======
B D          Hedgehog  ======
B D       Mouse lemur  ======
B D           Wallaby  ======
B D      Kangaroo rat  ======
B D        Rock hyrax  ======
B D           Opossum  ======
B D            Lizard  ======
B D        Budgerigar  ======
B D   Tasmanian devil  ======
B D          Platypus  ======
B D         Zebrafish  ======
B D       Zebra finch  ======
B D           Chicken  ======
B D     X. tropicalis  ======
B D        Coelacanth  ======
B D    Painted turtle  ======
B D            Turkey  ======

Inserts between block 4 and 5 in window
B D           Rabbit 298bp

Alignment block 5 of 120 in window, 37105527 - 37105534, 8 bps 
B D             Mouse  ----------ggttatga
B D               Rat  ----------ggttataa
B D          Squirrel  ----------tgtaaagt
B D             Human  ----------gcttgtga
B D             Chimp  ----------ggttgtga
B D           Gorilla  ----------ggttgtga
B D         Orangutan  ----------ggttgtga
B D            Gibbon  ----------ggttgtga
B D            Rhesus  ----------ggttgtga
B D            Baboon  ----------ggttgtga
B D           Tarsier  ----------gattgtga
B D          Bushbaby  ----------ggtcatga
B D            Alpaca  ----------ggtagtga
B D           Dolphin  ----------ggtggtga
B D               Cow  ----------ggtgatgg
B D               Cat  ----------gttcatga
B D               Dog  ----------ggtcatga
B D             Panda  ----------ggtcatga
B D             Horse  ----------atatatga
  D  Little brown bat  ----------gatcagga
B D           Megabat  ----------gatcgtga
B D          Elephant  agacaggttaggt-----
B D         Armadillo  t-----gttggga-----
B D             Sloth  t------tggggt-----
B D               Pig  ==================
B D           Manatee  ------------------
B D            Rabbit  ==================
B D        Guinea pig  ==================
B D    Naked mole-rat  ==================
B D   Squirrel monkey  ==================
B D          Marmoset  ==================
B D             Shrew  ==================
B D          Hedgehog  ==================
B D       Mouse lemur  ==================
B D           Wallaby  ==================
B D      Kangaroo rat  ==================
B D        Rock hyrax  ==================
B D           Opossum  ==================
B D            Lizard  ==================
B D        Budgerigar  ==================
B D   Tasmanian devil  ==================
B D          Platypus  ==================
B D         Zebrafish  ==================
B D       Zebra finch  ==================
B D           Chicken  ==================
B D     X. tropicalis  ==================
B D        Coelacanth  ==================
B D    Painted turtle  ==================
B D            Turkey  ==================

Inserts between block 5 and 6 in window
B D            Human 3bp
B D            Chimp 3bp
B D          Gorilla 36bp
B D        Orangutan 3bp
B D           Gibbon 3bp

Alignment block 6 of 120 in window, 37105535 - 37105535, 1 bps 
B D             Mouse  a
B D               Rat  a
B D          Squirrel  a
B D             Human  a
B D             Chimp  a
B D         Orangutan  a
B D            Gibbon  a
B D            Rhesus  a
B D            Baboon  a
B D           Tarsier  a
B D          Bushbaby  a
B D            Alpaca  g
B D           Dolphin  g
B D               Cow  a
B D               Cat  g
B D               Dog  g
B D             Panda  g
B D             Horse  a
  D  Little brown bat  g
B D           Megabat  g
B D          Elephant  g
B D         Armadillo  g
B D             Sloth  g
B D               Pig  =
B D           Manatee  -
B D            Rabbit  =
B D        Guinea pig  =
B D           Gorilla  =
B D    Naked mole-rat  =
B D   Squirrel monkey  =
B D          Marmoset  =
B D             Shrew  =
B D          Hedgehog  =
B D       Mouse lemur  =
B D           Wallaby  =
B D      Kangaroo rat  =
B D        Rock hyrax  =
B D           Opossum  =
B D            Lizard  =
B D        Budgerigar  =
B D   Tasmanian devil  =
B D          Platypus  =
B D         Zebrafish  =
B D       Zebra finch  =
B D           Chicken  =
B D     X. tropicalis  =
B D        Coelacanth  =
B D    Painted turtle  =
B D            Turkey  =

Inserts between block 6 and 7 in window
B D           Rhesus 90bp
B D           Baboon 90bp
B D          Tarsier 2bp
B D         Bushbaby 2bp
B D           Alpaca 2bp
B D          Dolphin 2bp
B D              Cow 2bp
B D              Cat 2bp
B D              Dog 2bp
B D            Panda 2bp
B D            Horse 2bp
  D Little brown bat 3bp
B D          Megabat 3bp

Alignment block 7 of 120 in window, 37105536 - 37105538, 3 bps 
B D             Mouse  gga--
B D               Rat  gaa--
B D          Squirrel  gat--
B D             Human  gg---
B D             Chimp  gg---
B D         Orangutan  gg---
B D            Gibbon  g----
B D           Tarsier  gg---
B D          Bushbaby  gg---
B D            Alpaca  a----
B D           Dolphin  g----
B D               Cow  a----
B D               Cat  g----
B D               Dog  g----
B D             Panda  g----
B D             Horse  g----
  D  Little brown bat  g----
B D           Megabat  g----
B D          Elephant  --agt
B D         Armadillo  --agt
B D             Sloth  --ggt
B D               Pig  =====
B D           Manatee  -----
B D            Rabbit  =====
B D        Guinea pig  =====
B D            Rhesus  =====
B D           Gorilla  =====
B D    Naked mole-rat  =====
B D   Squirrel monkey  =====
B D          Marmoset  =====
B D             Shrew  =====
B D          Hedgehog  =====
B D       Mouse lemur  =====
B D           Wallaby  =====
B D      Kangaroo rat  =====
B D        Rock hyrax  =====
B D           Opossum  =====
B D            Lizard  =====
B D        Budgerigar  =====
B D   Tasmanian devil  =====
B D          Platypus  =====
B D         Zebrafish  =====
B D       Zebra finch  =====
B D            Baboon  =====
B D           Chicken  =====
B D     X. tropicalis  =====
B D        Coelacanth  =====
B D    Painted turtle  =====
B D            Turkey  =====

Inserts between block 7 and 8 in window
B D           Gibbon 114bp
B D          Tarsier 16bp
B D         Bushbaby 16bp
B D           Alpaca 1bp
B D          Dolphin 1bp
B D              Cow 57bp

Alignment block 8 of 120 in window, 37105539 - 37105539, 1 bps 
B D             Mouse  g
B D          Squirrel  g
B D            Alpaca  g
B D           Dolphin  g
B D               Cat  g
B D               Dog  g
B D             Panda  g
  D  Little brown bat  g
B D           Megabat  g
B D          Elephant  a
B D         Armadillo  a
B D             Sloth  a
B D               Pig  =
B D           Manatee  -
B D            Rabbit  =
B D        Guinea pig  =
B D               Cow  =
B D            Rhesus  =
B D             Horse  -
B D          Bushbaby  =
B D            Gibbon  =
B D         Orangutan  -
B D           Gorilla  =
B D             Chimp  -
B D             Human  -
B D    Naked mole-rat  =
B D   Squirrel monkey  =
B D          Marmoset  =
B D               Rat  -
B D             Shrew  =
B D          Hedgehog  =
B D           Tarsier  =
B D       Mouse lemur  =
B D           Wallaby  =
B D      Kangaroo rat  =
B D        Rock hyrax  =
B D           Opossum  =
B D            Lizard  =
B D        Budgerigar  =
B D   Tasmanian devil  =
B D          Platypus  =
B D         Zebrafish  =
B D       Zebra finch  =
B D            Baboon  =
B D           Chicken  =
B D     X. tropicalis  =
B D        Coelacanth  =
B D    Painted turtle  =
B D            Turkey  =

Alignment block 9 of 120 in window, 37105540 - 37105542, 3 bps 
B D             Mouse  tg----------t
B D               Rat  tg----------t
B D          Squirrel  tatacatgttatt
B D             Human  ------------t
B D             Chimp  ------------t
B D         Orangutan  ------------t
B D          Bushbaby  ----------ttt
B D            Alpaca  ----------tgt
B D           Dolphin  ----------tgt
B D               Cat  ----------ggt
B D               Dog  ----------tgt
B D             Panda  ----------tgt
  D  Little brown bat  ----------tgt
B D           Megabat  ----------tgt
B D          Elephant  ----------tat
B D         Armadillo  ----------tgt
B D             Sloth  ----------tgt
B D               Pig  =============
B D           Manatee  -------------
B D            Rabbit  =============
B D        Guinea pig  =============
B D               Cow  =============
B D            Rhesus  =============
B D             Horse  -------------
B D            Gibbon  =============
B D           Gorilla  =============
B D    Naked mole-rat  =============
B D   Squirrel monkey  =============
B D          Marmoset  =============
B D             Shrew  =============
B D          Hedgehog  =============
B D           Tarsier  =============
B D       Mouse lemur  =============
B D           Wallaby  =============
B D      Kangaroo rat  =============
B D        Rock hyrax  =============
B D           Opossum  =============
B D            Lizard  =============
B D        Budgerigar  =============
B D   Tasmanian devil  =============
B D          Platypus  =============
B D         Zebrafish  =============
B D       Zebra finch  =============
B D            Baboon  =============
B D           Chicken  =============
B D     X. tropicalis  =============
B D        Coelacanth  =============
B D    Painted turtle  =============
B D            Turkey  =============

Inserts between block 9 and 10 in window
B D            Human 4bp
B D            Chimp 4bp
B D        Orangutan 83bp
B D           Alpaca 1bp
B D          Dolphin 1bp
B D              Cat 71bp
B D         Elephant 11bp
B D        Armadillo 79bp
B D            Sloth 13bp

Alignment block 10 of 120 in window, 37105543 - 37105544, 2 bps 
B D             Mouse  tt
B D               Rat  tt
B D          Squirrel  tt
B D             Human  tg
B D             Chimp  tg
B D           Tarsier  tt
B D          Bushbaby  tt
B D            Alpaca  c-
B D           Dolphin  t-
B D               Pig  ==
B D           Manatee  --
B D            Rabbit  ==
B D          Elephant  ==
B D        Guinea pig  ==
B D               Cow  ==
B D            Rhesus  ==
B D             Horse  --
B D             Panda  --
B D               Dog  --
B D            Gibbon  ==
B D         Orangutan  ==
B D           Gorilla  ==
B D    Naked mole-rat  ==
B D   Squirrel monkey  ==
B D          Marmoset  ==
  D  Little brown bat  --
B D           Megabat  --
B D             Shrew  ==
B D         Armadillo  ==
B D             Sloth  ==
B D          Hedgehog  ==
B D       Mouse lemur  ==
B D           Wallaby  ==
B D               Cat  ==
B D      Kangaroo rat  ==
B D        Rock hyrax  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D   Tasmanian devil  ==
B D          Platypus  ==
B D         Zebrafish  ==
B D       Zebra finch  ==
B D            Baboon  ==
B D           Chicken  ==
B D     X. tropicalis  ==
B D        Coelacanth  ==
B D    Painted turtle  ==
B D            Turkey  ==

Inserts between block 10 and 11 in window
B D           Alpaca 15bp
B D          Dolphin 69bp

Alignment block 11 of 120 in window, 37105545 - 37105557, 13 bps 
B D             Mouse  tctaaatta----aagt
B D               Rat  tctcaatta----aagt
B D          Squirrel  tttaagtta----aata
B D             Human  tatatgtta----cact
B D             Chimp  tatatgtta----cact
B D           Tarsier  tttaaattg----aagt
B D          Bushbaby  attgagtta----aaat
B D            Alpaca  ------att----gagt
B D               Dog  ----atgtactcttagt
B D             Panda  ----gtata----tagt
B D             Horse  -------------tggt
  D  Little brown bat  ------ata----tatt
B D           Megabat  ------gta----gatt
B D          Elephant  attgagtta----aaat
B D             Sloth  attgagata----aaat
B D               Pig  =================
B D           Manatee  -----------------
B D            Rabbit  =================
B D        Guinea pig  =================
B D               Cow  =================
B D            Rhesus  =================
B D            Gibbon  =================
B D         Orangutan  =================
B D           Gorilla  =================
B D    Naked mole-rat  =================
B D   Squirrel monkey  =================
B D          Marmoset  =================
B D           Dolphin  =================
B D             Shrew  =================
B D         Armadillo  =================
B D          Hedgehog  =================
B D       Mouse lemur  =================
B D           Wallaby  =================
B D               Cat  =================
B D      Kangaroo rat  =================
B D        Rock hyrax  =================
B D           Opossum  =================
B D            Lizard  =================
B D        Budgerigar  =================
B D   Tasmanian devil  =================
B D          Platypus  =================
B D         Zebrafish  =================
B D       Zebra finch  =================
B D            Baboon  =================
B D           Chicken  =================
B D     X. tropicalis  =================
B D        Coelacanth  =================
B D    Painted turtle  =================
B D            Turkey  =================

Inserts between block 11 and 12 in window
B D          Tarsier 94bp

Alignment block 12 of 120 in window, 37105558 - 37105564, 7 bps 
B D             Mouse  ttgcttg
B D               Rat  ttgcttg
B D          Squirrel  ttttttt
B D             Human  tttattg
B D             Chimp  tttattg
B D          Bushbaby  ttacctg
B D            Alpaca  taaaatt
B D               Dog  taaaatt
B D             Panda  tcatttt
B D             Horse  gaggt--
  D  Little brown bat  ttacttt
B D           Megabat  ttacttt
B D          Elephant  ttatata
B D             Sloth  ttacata
B D               Pig  =======
B D           Manatee  -------
B D            Rabbit  =======
B D        Guinea pig  =======
B D               Cow  =======
B D            Rhesus  =======
B D            Gibbon  =======
B D         Orangutan  =======
B D           Gorilla  =======
B D    Naked mole-rat  =======
B D   Squirrel monkey  =======
B D          Marmoset  =======
B D           Dolphin  =======
B D             Shrew  =======
B D         Armadillo  =======
B D          Hedgehog  =======
B D           Tarsier  =======
B D       Mouse lemur  =======
B D           Wallaby  =======
B D               Cat  =======
B D      Kangaroo rat  =======
B D        Rock hyrax  =======
B D           Opossum  =======
B D            Lizard  =======
B D        Budgerigar  =======
B D   Tasmanian devil  =======
B D          Platypus  =======
B D         Zebrafish  =======
B D       Zebra finch  =======
B D            Baboon  =======
B D           Chicken  =======
B D     X. tropicalis  =======
B D        Coelacanth  =======
B D    Painted turtle  =======
B D            Turkey  =======

Inserts between block 12 and 13 in window
B D            Human 3bp
B D            Chimp 57bp
B D           Alpaca 104bp
B D              Dog 3bp
B D            Panda 1bp
B D            Horse 6bp
  D Little brown bat 2bp
B D          Megabat 3bp

Alignment block 13 of 120 in window, 37105565 - 37105567, 3 bps 
B D             Mouse  cag
B D               Rat  cag
B D          Squirrel  tgg
B D             Human  caa
B D          Bushbaby  ca-
B D          Elephant  cag
B D               Pig  ===
B D           Manatee  ---
B D            Rabbit  ===
B D        Guinea pig  ===
B D               Cow  ===
B D            Rhesus  ===
B D             Horse  ===
B D             Panda  ===
B D               Dog  ===
B D            Gibbon  ===
B D         Orangutan  ===
B D           Gorilla  ===
B D             Chimp  ===
B D    Naked mole-rat  ===
B D   Squirrel monkey  ===
B D          Marmoset  ===
B D            Alpaca  ===
  D  Little brown bat  ===
B D           Dolphin  ===
B D           Megabat  ===
B D             Shrew  ===
B D         Armadillo  ===
B D             Sloth  ---
B D          Hedgehog  ===
B D           Tarsier  ===
B D       Mouse lemur  ===
B D           Wallaby  ===
B D               Cat  ===
B D      Kangaroo rat  ===
B D        Rock hyrax  ===
B D           Opossum  ===
B D            Lizard  ===
B D        Budgerigar  ===
B D   Tasmanian devil  ===
B D          Platypus  ===
B D         Zebrafish  ===
B D       Zebra finch  ===
B D            Baboon  ===
B D           Chicken  ===
B D     X. tropicalis  ===
B D        Coelacanth  ===
B D    Painted turtle  ===
B D            Turkey  ===

Inserts between block 13 and 14 in window
B D              Rat 1bp
B D         Elephant 38bp

Alignment block 14 of 120 in window, 37105568 - 37105582, 15 bps 
B D             Mouse  gagctggtgagatgg
B D          Squirrel  cag------------
B D               Dog  -atgtagtaaaatgg
B D           Manatee  -atttggggagacag
B D             Sloth  ----ttgtgaaatgt
B D               Pig  ===============
B D            Rabbit  ===============
B D          Elephant  ===============
B D        Guinea pig  ===============
B D               Cow  ===============
B D            Rhesus  ===============
B D             Horse  ===============
B D             Panda  ===============
B D          Bushbaby  ---------------
B D            Gibbon  ===============
B D         Orangutan  ===============
B D           Gorilla  ===============
B D             Chimp  ===============
B D             Human  ---------------
B D    Naked mole-rat  ===============
B D   Squirrel monkey  ===============
B D          Marmoset  ===============
B D               Rat  ===============
B D            Alpaca  ===============
  D  Little brown bat  ===============
B D           Dolphin  ===============
B D           Megabat  ===============
B D             Shrew  ===============
B D         Armadillo  ===============
B D          Hedgehog  ===============
B D           Tarsier  ===============
B D       Mouse lemur  ===============
B D           Wallaby  ===============
B D               Cat  ===============
B D      Kangaroo rat  ===============
B D        Rock hyrax  ===============
B D           Opossum  ===============
B D            Lizard  ===============
B D        Budgerigar  ===============
B D   Tasmanian devil  ===============
B D          Platypus  ===============
B D         Zebrafish  ===============
B D       Zebra finch  ===============
B D            Baboon  ===============
B D           Chicken  ===============
B D     X. tropicalis  ===============
B D        Coelacanth  ===============
B D    Painted turtle  ===============
B D            Turkey  ===============

Inserts between block 14 and 15 in window
B D              Dog 125bp
B D          Manatee 1bp
B D            Sloth 95bp

Alignment block 15 of 120 in window, 37105583 - 37105604, 22 bps 
B D             Mouse  ctcagcgagtaagcactgactg-
B D          Squirrel  -------agaatgcactgtaaa-
B D          Bushbaby  -------------cattataca-
B D             Panda  -----------tttagtgagtt-
  D  Little brown bat  -------------tagcaagtc-
B D           Megabat  -------------tagtgagtt-
B D           Manatee  --gtaggtgagtatattttactt
B D               Pig  =======================
B D            Rabbit  =======================
B D          Elephant  =======================
B D        Guinea pig  =======================
B D               Cow  =======================
B D            Rhesus  =======================
B D             Horse  =======================
B D               Dog  =======================
B D            Gibbon  =======================
B D         Orangutan  =======================
B D           Gorilla  =======================
B D             Chimp  =======================
B D             Human  -----------------------
B D    Naked mole-rat  =======================
B D   Squirrel monkey  =======================
B D          Marmoset  =======================
B D               Rat  =======================
B D            Alpaca  =======================
B D           Dolphin  =======================
B D             Shrew  =======================
B D         Armadillo  =======================
B D             Sloth  =======================
B D          Hedgehog  =======================
B D           Tarsier  =======================
B D       Mouse lemur  =======================
B D           Wallaby  =======================
B D               Cat  =======================
B D      Kangaroo rat  =======================
B D        Rock hyrax  =======================
B D           Opossum  =======================
B D            Lizard  =======================
B D        Budgerigar  =======================
B D   Tasmanian devil  =======================
B D          Platypus  =======================
B D         Zebrafish  =======================
B D       Zebra finch  =======================
B D            Baboon  =======================
B D           Chicken  =======================
B D     X. tropicalis  =======================
B D        Coelacanth  =======================
B D    Painted turtle  =======================
B D            Turkey  =======================

Inserts between block 15 and 16 in window
B D            Panda 117bp
  D Little brown bat 2bp
B D          Megabat 2bp

Alignment block 16 of 120 in window, 37105605 - 37105621, 17 bps 
B D             Mouse  atctcctgaaggttcaa
B D          Squirrel  atttcatgagagttgat
B D          Bushbaby  gtttcatgaa-------
B D             Horse  attt-------------
  D  Little brown bat  agtt-------------
B D           Megabat  gatt-------------
B D           Manatee  -ttttattgagttaaa-
B D               Pig  =================
B D            Rabbit  =================
B D          Elephant  =================
B D        Guinea pig  =================
B D               Cow  =================
B D            Rhesus  =================
B D             Panda  =================
B D               Dog  =================
B D            Gibbon  =================
B D         Orangutan  =================
B D           Gorilla  =================
B D             Chimp  =================
B D             Human  -----------------
B D    Naked mole-rat  =================
B D   Squirrel monkey  =================
B D          Marmoset  =================
B D               Rat  =================
B D            Alpaca  =================
B D           Dolphin  =================
B D             Shrew  =================
B D         Armadillo  =================
B D             Sloth  =================
B D          Hedgehog  =================
B D           Tarsier  =================
B D       Mouse lemur  =================
B D           Wallaby  =================
B D               Cat  =================
B D      Kangaroo rat  =================
B D        Rock hyrax  =================
B D           Opossum  =================
B D            Lizard  =================
B D        Budgerigar  =================
B D   Tasmanian devil  =================
B D          Platypus  =================
B D         Zebrafish  =================
B D       Zebra finch  =================
B D            Baboon  =================
B D           Chicken  =================
B D     X. tropicalis  =================
B D        Coelacanth  =================
B D    Painted turtle  =================
B D            Turkey  =================

Inserts between block 16 and 17 in window
B D         Squirrel 65bp

Alignment block 17 of 120 in window, 37105622 - 37105641, 20 bps 
B D             Mouse  atcccagcagccacatggtg
B D           Manatee  attt----------------
B D               Pig  ====================
B D            Rabbit  ====================
B D          Elephant  ====================
B D        Guinea pig  ====================
B D               Cow  ====================
B D            Rhesus  ====================
B D          Squirrel  ====================
B D             Horse  --------------------
B D             Panda  ====================
B D          Bushbaby  --------------------
B D               Dog  ====================
B D            Gibbon  ====================
B D         Orangutan  ====================
B D           Gorilla  ====================
B D             Chimp  ====================
B D             Human  --------------------
B D    Naked mole-rat  ====================
B D   Squirrel monkey  ====================
B D          Marmoset  ====================
B D               Rat  ====================
B D            Alpaca  ====================
  D  Little brown bat  --------------------
B D           Dolphin  ====================
B D           Megabat  --------------------
B D             Shrew  ====================
B D         Armadillo  ====================
B D             Sloth  ====================
B D          Hedgehog  ====================
B D           Tarsier  ====================
B D       Mouse lemur  ====================
B D           Wallaby  ====================
B D               Cat  ====================
B D      Kangaroo rat  ====================
B D        Rock hyrax  ====================
B D           Opossum  ====================
B D            Lizard  ====================
B D        Budgerigar  ====================
B D   Tasmanian devil  ====================
B D          Platypus  ====================
B D         Zebrafish  ====================
B D       Zebra finch  ====================
B D            Baboon  ====================
B D           Chicken  ====================
B D     X. tropicalis  ====================
B D        Coelacanth  ====================
B D    Painted turtle  ====================
B D            Turkey  ====================

Alignment block 18 of 120 in window, 37105642 - 37105644, 3 bps 
B D             Mouse  gct
B D               Cow  gtt
B D               Pig  ===
B D           Manatee  ---
B D            Rabbit  ===
B D          Elephant  ===
B D        Guinea pig  ===
B D            Rhesus  ===
B D          Squirrel  ===
B D             Horse  ---
B D             Panda  ===
B D          Bushbaby  ---
B D               Dog  ===
B D            Gibbon  ===
B D         Orangutan  ===
B D           Gorilla  ===
B D             Chimp  ===
B D             Human  ---
B D    Naked mole-rat  ===
B D   Squirrel monkey  ===
B D          Marmoset  ===
B D               Rat  ===
B D            Alpaca  ===
  D  Little brown bat  ---
B D           Dolphin  ===
B D           Megabat  ---
B D             Shrew  ===
B D         Armadillo  ===
B D             Sloth  ===
B D          Hedgehog  ===
B D           Tarsier  ===
B D       Mouse lemur  ===
B D           Wallaby  ===
B D               Cat  ===
B D      Kangaroo rat  ===
B D        Rock hyrax  ===
B D           Opossum  ===
B D            Lizard  ===
B D        Budgerigar  ===
B D   Tasmanian devil  ===
B D          Platypus  ===
B D         Zebrafish  ===
B D       Zebra finch  ===
B D            Baboon  ===
B D           Chicken  ===
B D     X. tropicalis  ===
B D        Coelacanth  ===
B D    Painted turtle  ===
B D            Turkey  ===

Alignment block 19 of 120 in window, 37105645 - 37105664, 20 bps 
B D             Mouse  cacaaccaccta---taatgata
B D           Gorilla  caaaacttcttg---cagtgaaa
B D          Bushbaby  ----ttttgata---tatttaat
B D               Cow  tacatacacata---ta------
B D             Horse  ------tactttttctagtgagt
  D  Little brown bat  ------gacata---cagtgaaa
B D           Megabat  ------tacatg---cag-----
B D           Manatee  -------acata---cagtga--
B D               Pig  =======================
B D            Rabbit  =======================
B D          Elephant  =======================
B D        Guinea pig  =======================
B D            Rhesus  =======================
B D          Squirrel  =======================
B D             Panda  =======================
B D               Dog  =======================
B D            Gibbon  =======================
B D         Orangutan  =======================
B D             Chimp  =======================
B D             Human  -----------------------
B D    Naked mole-rat  =======================
B D   Squirrel monkey  =======================
B D          Marmoset  =======================
B D               Rat  =======================
B D            Alpaca  =======================
B D           Dolphin  =======================
B D             Shrew  =======================
B D         Armadillo  =======================
B D             Sloth  =======================
B D          Hedgehog  =======================
B D           Tarsier  =======================
B D       Mouse lemur  =======================
B D           Wallaby  =======================
B D               Cat  =======================
B D      Kangaroo rat  =======================
B D        Rock hyrax  =======================
B D           Opossum  =======================
B D            Lizard  =======================
B D        Budgerigar  =======================
B D   Tasmanian devil  =======================
B D          Platypus  =======================
B D         Zebrafish  =======================
B D       Zebra finch  =======================
B D            Baboon  =======================
B D           Chicken  =======================
B D     X. tropicalis  =======================
B D        Coelacanth  =======================
B D    Painted turtle  =======================
B D            Turkey  =======================

Inserts between block 19 and 20 in window
B D          Gorilla 7bp
B D         Bushbaby 1bp
B D            Horse 2bp
B D          Megabat 2bp

Alignment block 20 of 120 in window, 37105665 - 37105672, 8 bps 
B D             Mouse  cctgatgc
B D            Rabbit  cctcatgc
  D  Little brown bat  -----tgc
B D           Manatee  ---aatgc
B D               Pig  ========
B D          Elephant  ========
B D        Guinea pig  ========
B D               Cow  --------
B D            Rhesus  ========
B D          Squirrel  ========
B D             Horse  ========
B D             Panda  ========
B D          Bushbaby  ========
B D               Dog  ========
B D            Gibbon  ========
B D         Orangutan  ========
B D           Gorilla  ========
B D             Chimp  ========
B D             Human  --------
B D    Naked mole-rat  ========
B D   Squirrel monkey  ========
B D          Marmoset  ========
B D               Rat  ========
B D            Alpaca  ========
B D           Dolphin  ========
B D           Megabat  ========
B D             Shrew  ========
B D         Armadillo  ========
B D             Sloth  ========
B D          Hedgehog  ========
B D           Tarsier  ========
B D       Mouse lemur  ========
B D           Wallaby  ========
B D               Cat  ========
B D      Kangaroo rat  ========
B D        Rock hyrax  ========
B D           Opossum  ========
B D            Lizard  ========
B D        Budgerigar  ========
B D   Tasmanian devil  ========
B D          Platypus  ========
B D         Zebrafish  ========
B D       Zebra finch  ========
B D            Baboon  ========
B D           Chicken  ========
B D     X. tropicalis  ========
B D        Coelacanth  ========
B D    Painted turtle  ========
B D            Turkey  ========

Alignment block 21 of 120 in window, 37105673 - 37105703, 31 bps 
B D             Mouse  cctcttctggtgcgtctgaaggcagctccac
B D            Rabbit  cctcc-ctcctgcccttgcacttgccctctc
B D               Pig  ctttttgtagtgagtcagaa-----------
  D  Little brown bat  --actgacagtt-------------------
B D           Manatee  ------------actgtacatccagttttat
B D          Elephant  ===============================
B D        Guinea pig  ===============================
B D               Cow  -------------------------------
B D            Rhesus  ===============================
B D          Squirrel  ===============================
B D             Horse  ===============================
B D             Panda  ===============================
B D          Bushbaby  ===============================
B D               Dog  ===============================
B D            Gibbon  ===============================
B D         Orangutan  ===============================
B D           Gorilla  ===============================
B D             Chimp  ===============================
B D             Human  -------------------------------
B D    Naked mole-rat  ===============================
B D   Squirrel monkey  ===============================
B D          Marmoset  ===============================
B D               Rat  ===============================
B D            Alpaca  ===============================
B D           Dolphin  ===============================
B D           Megabat  ===============================
B D             Shrew  ===============================
B D         Armadillo  ===============================
B D             Sloth  ===============================
B D          Hedgehog  ===============================
B D           Tarsier  ===============================
B D       Mouse lemur  ===============================
B D           Wallaby  ===============================
B D               Cat  ===============================
B D      Kangaroo rat  ===============================
B D        Rock hyrax  ===============================
B D           Opossum  ===============================
B D            Lizard  ===============================
B D        Budgerigar  ===============================
B D   Tasmanian devil  ===============================
B D          Platypus  ===============================
B D         Zebrafish  ===============================
B D       Zebra finch  ===============================
B D            Baboon  ===============================
B D           Chicken  ===============================
B D     X. tropicalis  ===============================
B D        Coelacanth  ===============================
B D    Painted turtle  ===============================
B D            Turkey  ===============================

Inserts between block 21 and 22 in window
  D Little brown bat 12bp
B D          Manatee 15bp

Alignment block 22 of 120 in window, 37105704 - 37105705, 2 bps 
B D             Mouse  tg
B D            Rabbit  tg
B D          Elephant  ta
B D           Manatee  tg
B D               Pig  --
B D        Guinea pig  ==
B D               Cow  --
B D            Rhesus  ==
B D          Squirrel  ==
B D             Horse  ==
B D             Panda  ==
B D          Bushbaby  ==
B D               Dog  ==
B D            Gibbon  ==
B D         Orangutan  ==
B D           Gorilla  ==
B D             Chimp  ==
B D             Human  --
B D    Naked mole-rat  ==
B D   Squirrel monkey  ==
B D          Marmoset  ==
B D               Rat  ==
B D            Alpaca  ==
  D  Little brown bat  ==
B D           Dolphin  ==
B D           Megabat  ==
B D             Shrew  ==
B D         Armadillo  ==
B D             Sloth  ==
B D          Hedgehog  ==
B D           Tarsier  ==
B D       Mouse lemur  ==
B D           Wallaby  ==
B D               Cat  ==
B D      Kangaroo rat  ==
B D        Rock hyrax  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D   Tasmanian devil  ==
B D          Platypus  ==
B D         Zebrafish  ==
B D       Zebra finch  ==
B D            Baboon  ==
B D           Chicken  ==
B D     X. tropicalis  ==
B D        Coelacanth  ==
B D    Painted turtle  ==
B D            Turkey  ==

Alignment block 23 of 120 in window, 37105706 - 37105708, 3 bps 
B D             Mouse  tat
B D            Rabbit  taa
B D             Chimp  tat
B D           Gorilla  tag
B D         Orangutan  tat
B D               Pig  t--
B D           Dolphin  t--
B D          Elephant  tat
B D           Manatee  tat
B D         Armadillo  tat
B D        Guinea pig  ===
B D               Cow  ---
B D            Rhesus  ===
B D          Squirrel  ===
B D             Horse  ===
B D             Panda  ===
B D          Bushbaby  ===
B D               Dog  ===
B D            Gibbon  ===
B D             Human  ---
B D    Naked mole-rat  ===
B D   Squirrel monkey  ===
B D          Marmoset  ===
B D               Rat  ===
B D            Alpaca  ===
  D  Little brown bat  ===
B D           Megabat  ===
B D             Shrew  ===
B D             Sloth  ===
B D          Hedgehog  ===
B D           Tarsier  ===
B D       Mouse lemur  ===
B D           Wallaby  ===
B D               Cat  ===
B D      Kangaroo rat  ===
B D        Rock hyrax  ===
B D           Opossum  ===
B D            Lizard  ===
B D        Budgerigar  ===
B D   Tasmanian devil  ===
B D          Platypus  ===
B D         Zebrafish  ===
B D       Zebra finch  ===
B D            Baboon  ===
B D           Chicken  ===
B D     X. tropicalis  ===
B D        Coelacanth  ===
B D    Painted turtle  ===
B D            Turkey  ===

Alignment block 24 of 120 in window, 37105709 - 37105732, 24 bps 
B D             Mouse  ttatgtataataataaatacatct
B D            Rabbit  ctacttttca-aataaataaacct
B D             Chimp  atttgtatacctatgtaaccatca
B D           Gorilla  at---tatac-------agtttca
B D         Orangutan  atttgtatacctatgtaaccatca
B D          Bushbaby  -------tacctatgtaaccatca
B D               Pig  --ttacatacaattaaatgcactg
B D           Dolphin  --ttatatat------atatattt
B D               Cow  -----------------tatattt
B D               Cat  --atatatgt------atacacct
B D             Horse  --aaatttgc------atacagtt
  D  Little brown bat  --acatatat------acatactt
B D           Megabat  --gaatgcac--------------
B D          Elephant  acctgtgtaaccataaccccagtt
B D           Manatee  acatctgtaaccatcaccccggtc
B D         Armadillo  atctgtgcattgatcaccccactg
B D        Guinea pig  ========================
B D            Rhesus  ========================
B D          Squirrel  ========================
B D             Panda  ========================
B D               Dog  ========================
B D            Gibbon  ========================
B D             Human  ------------------------
B D    Naked mole-rat  ========================
B D   Squirrel monkey  ========================
B D          Marmoset  ========================
B D               Rat  ========================
B D            Alpaca  ========================
B D             Shrew  ========================
B D             Sloth  ========================
B D          Hedgehog  ========================
B D           Tarsier  ========================
B D       Mouse lemur  ========================
B D           Wallaby  ========================
B D      Kangaroo rat  ========================
B D        Rock hyrax  ========================
B D           Opossum  ========================
B D            Lizard  ========================
B D        Budgerigar  ========================
B D   Tasmanian devil  ========================
B D          Platypus  ========================
B D         Zebrafish  ========================
B D       Zebra finch  ========================
B D            Baboon  ========================
B D           Chicken  ========================
B D     X. tropicalis  ========================
B D        Coelacanth  ========================
B D    Painted turtle  ========================
B D            Turkey  ========================

Alignment block 25 of 120 in window, 37105733 - 37105737, 5 bps 
B D             Mouse  tt-----aaa
B D    Naked mole-rat  tt-----aaa
B D            Rabbit  tt-----aaa
B D             Chimp  tt--------
B D           Gorilla  ttaa------
B D         Orangutan  tt--------
B D          Bushbaby  tc--cca---
B D               Pig  -------taa
B D           Dolphin  -------ata
B D               Cow  -------gtg
B D               Cat  -------gtg
B D             Horse  -------gaa
  D  Little brown bat  -------gtg
B D           Megabat  --------tg
B D          Elephant  ------agaa
B D           Manatee  ------agaa
B D         Armadillo  ------aaaa
B D        Guinea pig  ==========
B D            Rhesus  ==========
B D          Squirrel  ==========
B D             Panda  ==========
B D               Dog  ==========
B D            Gibbon  ==========
B D             Human  ----------
B D   Squirrel monkey  ==========
B D          Marmoset  ==========
B D               Rat  ==========
B D            Alpaca  ==========
B D             Shrew  ==========
B D             Sloth  ==========
B D          Hedgehog  ==========
B D           Tarsier  ==========
B D       Mouse lemur  ==========
B D           Wallaby  ==========
B D      Kangaroo rat  ==========
B D        Rock hyrax  ==========
B D           Opossum  ==========
B D            Lizard  ==========
B D        Budgerigar  ==========
B D   Tasmanian devil  ==========
B D          Platypus  ==========
B D         Zebrafish  ==========
B D       Zebra finch  ==========
B D            Baboon  ==========
B D           Chicken  ==========
B D     X. tropicalis  ==========
B D        Coelacanth  ==========
B D    Painted turtle  ==========
B D            Turkey  ==========

Inserts between block 25 and 26 in window
B D           Rabbit 20bp
B D          Gorilla 2bp
B D              Pig 2bp
B D          Dolphin 2bp
B D              Cow 2bp
B D              Cat 2bp
B D            Horse 2bp
  D Little brown bat 2bp
B D          Megabat 1bp

Alignment block 26 of 120 in window, 37105738 - 37105742, 5 bps 
B D             Mouse  gtttg
B D    Naked mole-rat  atttg
B D            Rabbit  ataag
B D             Human  ---aa
B D          Bushbaby  gtcaa
B D             Horse  ---ca
B D               Pig  =====
B D           Manatee  -----
B D          Elephant  -----
B D        Guinea pig  =====
B D               Cow  =====
B D            Rhesus  =====
B D          Squirrel  =====
B D             Panda  =====
B D               Dog  =====
B D            Gibbon  =====
B D         Orangutan  -----
B D           Gorilla  =====
B D             Chimp  -----
B D   Squirrel monkey  =====
B D          Marmoset  =====
B D               Rat  =====
B D            Alpaca  =====
  D  Little brown bat  =====
B D           Dolphin  =====
B D           Megabat  =====
B D             Shrew  =====
B D         Armadillo  -----
B D             Sloth  =====
B D          Hedgehog  =====
B D           Tarsier  =====
B D       Mouse lemur  =====
B D           Wallaby  =====
B D               Cat  =====
B D      Kangaroo rat  =====
B D        Rock hyrax  =====
B D           Opossum  =====
B D            Lizard  =====
B D        Budgerigar  =====
B D   Tasmanian devil  =====
B D          Platypus  =====
B D         Zebrafish  =====
B D       Zebra finch  =====
B D            Baboon  =====
B D           Chicken  =====
B D     X. tropicalis  =====
B D        Coelacanth  =====
B D    Painted turtle  =====
B D            Turkey  =====

Inserts between block 26 and 27 in window
B D            Human 3bp
B D         Bushbaby 8bp
B D            Horse 2bp

Alignment block 27 of 120 in window, 37105743 - 37105744, 2 bps 
B D             Mouse  ct
B D    Naked mole-rat  gt
B D            Rabbit  cg
B D             Human  ct
B D             Chimp  ct
B D         Orangutan  ct
B D            Gibbon  ct
B D               Pig  ==
B D           Manatee  --
B D          Elephant  --
B D        Guinea pig  ==
B D               Cow  ==
B D            Rhesus  ==
B D          Squirrel  ==
B D             Horse  ==
B D             Panda  ==
B D          Bushbaby  ==
B D               Dog  ==
B D           Gorilla  ==
B D   Squirrel monkey  ==
B D          Marmoset  ==
B D               Rat  ==
B D            Alpaca  ==
  D  Little brown bat  ==
B D           Dolphin  ==
B D           Megabat  ==
B D             Shrew  ==
B D         Armadillo  --
B D             Sloth  ==
B D          Hedgehog  ==
B D           Tarsier  ==
B D       Mouse lemur  ==
B D           Wallaby  ==
B D               Cat  ==
B D      Kangaroo rat  ==
B D        Rock hyrax  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D   Tasmanian devil  ==
B D          Platypus  ==
B D         Zebrafish  ==
B D       Zebra finch  ==
B D            Baboon  ==
B D           Chicken  ==
B D     X. tropicalis  ==
B D        Coelacanth  ==
B D    Painted turtle  ==
B D            Turkey  ==

Alignment block 28 of 120 in window, 37105745 - 37105749, 5 bps 
B D             Mouse  tgcag
B D    Naked mole-rat  tgcag
B D            Rabbit  tgcac
B D               Pig  tttaa
B D           Dolphin  tttat
B D               Cow  tgta-
B D          Elephant  tgcgg
B D           Manatee  tgcag
B D         Armadillo  tg-aa
B D        Guinea pig  =====
B D            Rhesus  =====
B D          Squirrel  =====
B D             Horse  =====
B D             Panda  =====
B D          Bushbaby  =====
B D               Dog  =====
B D            Gibbon  -----
B D         Orangutan  -----
B D           Gorilla  =====
B D             Chimp  -----
B D             Human  -----
B D   Squirrel monkey  =====
B D          Marmoset  =====
B D               Rat  =====
B D            Alpaca  =====
  D  Little brown bat  =====
B D           Megabat  =====
B D             Shrew  =====
B D             Sloth  =====
B D          Hedgehog  =====
B D           Tarsier  =====
B D       Mouse lemur  =====
B D           Wallaby  =====
B D               Cat  =====
B D      Kangaroo rat  =====
B D        Rock hyrax  =====
B D           Opossum  =====
B D            Lizard  =====
B D        Budgerigar  =====
B D   Tasmanian devil  =====
B D          Platypus  =====
B D         Zebrafish  =====
B D       Zebra finch  =====
B D            Baboon  =====
B D           Chicken  =====
B D     X. tropicalis  =====
B D        Coelacanth  =====
B D    Painted turtle  =====
B D            Turkey  =====

Inserts between block 28 and 29 in window
B D   Naked mole-rat 1bp
B D           Rabbit 24bp
B D              Cow 30bp

Alignment block 29 of 120 in window, 37105750 - 37105757, 8 bps 
B D             Mouse  aggtgcag
B D               Rat  ggatgcag
B D    Naked mole-rat  gaaaatac
B D            Rabbit  agagggtg
B D             Human  ------tg
B D             Chimp  ------ag
B D         Orangutan  ------ag
B D            Gibbon  ------ag
B D               Pig  ------tg
B D           Dolphin  ------tt
B D          Elephant  -------g
B D           Manatee  -------g
B D         Armadillo  -------g
B D        Guinea pig  ========
B D               Cow  ========
B D            Rhesus  ========
B D          Squirrel  ========
B D             Horse  ========
B D             Panda  ========
B D          Bushbaby  ========
B D               Dog  ========
B D           Gorilla  ========
B D   Squirrel monkey  ========
B D          Marmoset  ========
B D            Alpaca  ========
  D  Little brown bat  ========
B D           Megabat  ========
B D             Shrew  ========
B D             Sloth  ========
B D          Hedgehog  ========
B D           Tarsier  ========
B D       Mouse lemur  ========
B D           Wallaby  ========
B D               Cat  ========
B D      Kangaroo rat  ========
B D        Rock hyrax  ========
B D           Opossum  ========
B D            Lizard  ========
B D        Budgerigar  ========
B D   Tasmanian devil  ========
B D          Platypus  ========
B D         Zebrafish  ========
B D       Zebra finch  ========
B D            Baboon  ========
B D           Chicken  ========
B D     X. tropicalis  ========
B D        Coelacanth  ========
B D    Painted turtle  ========
B D            Turkey  ========

Inserts between block 29 and 30 in window
B D            Human 38bp
B D            Chimp 27bp
B D        Orangutan 27bp
B D           Gibbon 27bp
B D              Pig 6bp
B D          Dolphin 6bp

Alignment block 30 of 120 in window, 37105758 - 37105758, 1 bps 
B D             Mouse  t
B D               Rat  t
B D    Naked mole-rat  t
B D            Rabbit  t
B D             Human  t
B D           Gorilla  t
B D          Marmoset  t
B D   Squirrel monkey  t
B D               Pig  t
B D           Dolphin  t
B D           Manatee  -
B D          Elephant  -
B D        Guinea pig  =
B D               Cow  =
B D            Rhesus  =
B D          Squirrel  =
B D             Horse  =
B D             Panda  =
B D          Bushbaby  =
B D               Dog  =
B D            Gibbon  =
B D         Orangutan  =
B D             Chimp  =
B D            Alpaca  =
  D  Little brown bat  =
B D           Megabat  =
B D             Shrew  =
B D         Armadillo  -
B D             Sloth  =
B D          Hedgehog  =
B D           Tarsier  =
B D       Mouse lemur  =
B D           Wallaby  =
B D               Cat  =
B D      Kangaroo rat  =
B D        Rock hyrax  =
B D           Opossum  =
B D            Lizard  =
B D        Budgerigar  =
B D   Tasmanian devil  =
B D          Platypus  =
B D         Zebrafish  =
B D       Zebra finch  =
B D            Baboon  =
B D           Chicken  =
B D     X. tropicalis  =
B D        Coelacanth  =
B D    Painted turtle  =
B D            Turkey  =

Inserts between block 30 and 31 in window
B D              Pig 15bp
B D          Dolphin 30bp

Alignment block 31 of 120 in window, 37105759 - 37105762, 4 bps 
B D             Mouse  gtac
B D               Rat  gtac
B D    Naked mole-rat  gtac
B D            Rabbit  gtat
B D             Human  tgat
B D           Gorilla  tgat
B D          Marmoset  gtac
B D   Squirrel monkey  gtac
B D          Bushbaby  --at
B D               Cat  --ac
B D             Horse  gtac
  D  Little brown bat  --ac
B D           Megabat  --ac
B D          Elephant  --ac
B D           Manatee  --at
B D         Armadillo  --ac
B D               Pig  ====
B D        Guinea pig  ====
B D               Cow  ====
B D            Rhesus  ====
B D          Squirrel  ====
B D             Panda  ====
B D               Dog  ====
B D            Gibbon  ====
B D         Orangutan  ====
B D             Chimp  ====
B D            Alpaca  ====
B D           Dolphin  ====
B D             Shrew  ====
B D             Sloth  ====
B D          Hedgehog  ====
B D           Tarsier  ====
B D       Mouse lemur  ====
B D           Wallaby  ====
B D      Kangaroo rat  ====
B D        Rock hyrax  ====
B D           Opossum  ====
B D            Lizard  ====
B D        Budgerigar  ====
B D   Tasmanian devil  ====
B D          Platypus  ====
B D         Zebrafish  ====
B D       Zebra finch  ====
B D            Baboon  ====
B D           Chicken  ====
B D     X. tropicalis  ====
B D        Coelacanth  ====
B D    Painted turtle  ====
B D            Turkey  ====

Inserts between block 31 and 32 in window
B D         Marmoset 18bp
B D  Squirrel monkey 18bp
B D              Cat 5bp
B D            Horse 3bp
  D Little brown bat 3bp
B D          Megabat 3bp

Alignment block 32 of 120 in window, 37105763 - 37105768, 6 bps 
B D             Mouse  attttc
B D               Rat  agtttc
B D    Naked mole-rat  cattgc
B D            Rabbit  ttgttc
B D             Human  atattt
B D           Gorilla  attttt
B D            Rhesus  atattc
B D            Baboon  atattc
B D          Marmoset  atatgt
B D   Squirrel monkey  atatgt
B D          Bushbaby  attttc
B D               Pig  ---ctt
B D           Dolphin  ---gtc
B D               Cow  ---gtc
B D               Cat  ---ctc
B D             Horse  ---ttc
  D  Little brown bat  ---cac
B D           Megabat  ---ttc
B D          Elephant  atttcc
B D           Manatee  atttcc
B D         Armadillo  atttct
B D        Guinea pig  ======
B D          Squirrel  ======
B D             Panda  ======
B D               Dog  ======
B D            Gibbon  ======
B D         Orangutan  ======
B D             Chimp  ======
B D            Alpaca  ======
B D             Shrew  ======
B D             Sloth  ======
B D          Hedgehog  ======
B D           Tarsier  ======
B D       Mouse lemur  ======
B D           Wallaby  ======
B D      Kangaroo rat  ======
B D        Rock hyrax  ======
B D           Opossum  ======
B D            Lizard  ======
B D        Budgerigar  ======
B D   Tasmanian devil  ======
B D          Platypus  ======
B D         Zebrafish  ======
B D       Zebra finch  ======
B D           Chicken  ======
B D     X. tropicalis  ======
B D        Coelacanth  ======
B D    Painted turtle  ======
B D            Turkey  ======

Inserts between block 32 and 33 in window
B D              Pig 3bp
B D          Dolphin 3bp
B D              Cow 3bp
B D              Cat 3bp
B D            Horse 3bp
  D Little brown bat 3bp
B D          Megabat 3bp

Alignment block 33 of 120 in window, 37105769 - 37105778, 10 bps 
B D             Mouse  a----------------------------------------gatttgatc----
B D               Rat  a----------------------------------------gatttgatc----
B D    Naked mole-rat  atga------------------------------------gaagttcatt----
B D          Squirrel  ------------------------------------------agataatt----
B D            Rabbit  -tgagtgactatatagtgaaatatgctgtatagttttgtggattttgata----
B D             Human  -----------------------------------------------gta----
B D           Gorilla  -----------------------------------------------gta----
B D            Rhesus  -----------------------------------------------ata----
B D            Baboon  -----------------------------------------------ata----
B D          Marmoset  -----------------------------------------------gta----
B D   Squirrel monkey  -----------------------------------------------gta----
B D          Bushbaby  -----------------------------------------------atc----
B D               Pig  -----------------------------------------------aac----
B D           Dolphin  -----------------------------------------------ata----
B D               Cow  -----------------------------------------------att----
B D               Cat  -----------------------------------------------agt----
B D             Horse  -----------------------------------------------agt----
  D  Little brown bat  -----------------------------------------------agt----
B D           Megabat  -----------------------------------------------agt----
B D          Elephant  -----------------------------------------------atcatcc
B D           Manatee  -----------------------------------------------atcatcc
B D         Armadillo  -----------------------------------------------gtcttgc
B D        Guinea pig  ======================================================
B D             Panda  ======================================================
B D               Dog  ======================================================
B D            Gibbon  ======================================================
B D         Orangutan  ======================================================
B D             Chimp  ======================================================
B D            Alpaca  ======================================================
B D             Shrew  ======================================================
B D             Sloth  ======================================================
B D          Hedgehog  ======================================================
B D           Tarsier  ======================================================
B D       Mouse lemur  ======================================================
B D           Wallaby  ======================================================
B D      Kangaroo rat  ======================================================
B D        Rock hyrax  ======================================================
B D           Opossum  ======================================================
B D            Lizard  ======================================================
B D        Budgerigar  ======================================================
B D   Tasmanian devil  ======================================================
B D          Platypus  ======================================================
B D         Zebrafish  ======================================================
B D       Zebra finch  ======================================================
B D           Chicken  ======================================================
B D     X. tropicalis  ======================================================
B D        Coelacanth  ======================================================
B D    Painted turtle  ======================================================
B D            Turkey  ======================================================

Inserts between block 33 and 34 in window
B D            Human 4bp
B D          Gorilla 4bp
B D           Rhesus 4bp
B D           Baboon 4bp
B D         Marmoset 4bp
B D  Squirrel monkey 4bp
B D         Bushbaby 3bp
B D              Pig 7bp
B D          Dolphin 7bp
B D              Cow 7bp
B D              Cat 8bp
B D            Horse 7bp
  D Little brown bat 7bp
B D          Megabat 7bp

Alignment block 34 of 120 in window, 37105779 - 37105780, 2 bps 
B D             Mouse  ca
B D               Rat  ca
B D    Naked mole-rat  ta
B D          Squirrel  tc
B D            Rabbit  ta
B D          Elephant  cc
B D           Manatee  ca
B D         Armadillo  ca
B D               Pig  ==
B D        Guinea pig  ==
B D               Cow  ==
B D            Rhesus  ==
B D             Horse  ==
B D             Panda  ==
B D          Bushbaby  ==
B D               Dog  ==
B D            Gibbon  ==
B D         Orangutan  ==
B D           Gorilla  ==
B D             Chimp  ==
B D             Human  ==
B D   Squirrel monkey  ==
B D          Marmoset  ==
B D            Alpaca  ==
  D  Little brown bat  ==
B D           Dolphin  ==
B D           Megabat  ==
B D             Shrew  ==
B D             Sloth  ==
B D          Hedgehog  ==
B D           Tarsier  ==
B D       Mouse lemur  ==
B D           Wallaby  ==
B D               Cat  ==
B D      Kangaroo rat  ==
B D        Rock hyrax  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D   Tasmanian devil  ==
B D          Platypus  ==
B D         Zebrafish  ==
B D       Zebra finch  ==
B D            Baboon  ==
B D           Chicken  ==
B D     X. tropicalis  ==
B D        Coelacanth  ==
B D    Painted turtle  ==
B D            Turkey  ==

Inserts between block 34 and 35 in window
B D         Elephant 3bp
B D          Manatee 3bp
B D        Armadillo 13bp

Alignment block 35 of 120 in window, 37105781 - 37105816, 36 bps 
B D             Mouse  tgtctccttc-atgtcacctac----tgctctag-----------------tcaa-----aac
B D               Rat  tgtgtccctc--tgtcacctat----tgctctag-----------------tcac-----aac
B D    Naked mole-rat  tgtatatacccatgtaac--at----caccctta-----------------tcaa-----agt
B D          Squirrel  tatgctccct-------------------tccag-----------------tca---------
B D            Rabbit  tgtatatgcctgtgtaat-gac----cactgcag-----------------tcca-----aag
B D             Human  ----------tatgtaac-cat----cattctag-----------------tcaa-----aat
B D           Gorilla  ----------tatgtaac-cgt----cattctag-----------------tcaa-----aat
B D            Rhesus  ----------tatgtaac-cat----cattttag-----------------tcaa-----aat
B D            Baboon  ----------tatgtaac-cat----cattttag-----------------tcaa-----aat
B D          Marmoset  ----------tctgtaac-cat----cactctag-----------------tcaa-----aat
B D   Squirrel monkey  ----------tgtgtaac-cat----cactctag-----------------tcaa-----aat
B D           Tarsier  ----------catatttc-cat----catttca------------------------------
B D          Bushbaby  ----------------ca-ccc----ccttctag-----------------ttaattcctgat
B D               Pig  --------------cttt-ctt----catctcag-------------------aa-----aa-
B D            Alpaca  --------------tttt-cat----catctcag-------------------aa-----aa-
B D           Dolphin  --------------tttt-ctt----catttcag-------------------aa-----aa-
B D               Cow  --------------cttt-ctt----catctcaa-------------------aa-----aa-
B D               Cat  --------------tttt-cat--------------------cagttccagaaaa-----tat
B D             Horse  --------------tatg-tat---atacctctg--taactaccacttcagtcaa-----aat
  D  Little brown bat  --------------cagg-acatttttatctcag-------------------aa-----aat
B D           Megabat  --------------tatg-tattgtacacacctgtataaccatcacaccagtcaa-----aat
B D          Elephant  ------tgtattttcatt-cct----gcttctag-----------------ttaa-----tgc
B D           Manatee  ------tgtatcttcatg-cct----tcttccag-----------------ttaa-----ccc
B D         Armadillo  ----------------tg-tta----ccttccag-----------------taaa-----tta
B D             Sloth  ----------------tg-tcc----ccttccat-----------------ttaa-----ttt
B D        Guinea pig  ===============================================================
B D             Panda  ===============================================================
B D               Dog  ===============================================================
B D            Gibbon  ===============================================================
B D         Orangutan  ===============================================================
B D             Chimp  ===============================================================
B D             Shrew  ===============================================================
B D          Hedgehog  ===============================================================
B D       Mouse lemur  ===============================================================
B D           Wallaby  ===============================================================
B D      Kangaroo rat  ===============================================================
B D        Rock hyrax  ===============================================================
B D           Opossum  ===============================================================
B D            Lizard  ===============================================================
B D        Budgerigar  ===============================================================
B D   Tasmanian devil  ===============================================================
B D          Platypus  ===============================================================
B D         Zebrafish  ===============================================================
B D       Zebra finch  ===============================================================
B D           Chicken  ===============================================================
B D     X. tropicalis  ===============================================================
B D        Coelacanth  ===============================================================
B D    Painted turtle  ===============================================================
B D            Turkey  ===============================================================

Inserts between block 35 and 36 in window
B D   Naked mole-rat 2bp
B D         Squirrel 1bp
B D           Rabbit 31bp
B D          Tarsier 18bp
B D              Pig 6bp
B D           Alpaca 6bp
B D          Dolphin 6bp
B D              Cow 6bp
B D              Cat 3bp
B D            Horse 70bp
  D Little brown bat 5bp
B D          Megabat 13bp

Alignment block 36 of 120 in window, 37105817 - 37105824, 8 bps 
B D             Mouse  tcaatggt------
B D               Rat  tcagtggt------
B D      Kangaroo rat  tccatgtt------
B D    Naked mole-rat  tacattgt------
B D          Squirrel  tccaagg-------
B D            Rabbit  tgcatgtc------
B D             Human  -----gc-------
B D           Gorilla  -----gc-------
B D            Rhesus  -----gc-------
B D            Baboon  -----gc-------
B D          Marmoset  -----gc-------
B D   Squirrel monkey  -----cc-------
B D        Tree shrew  tccatgc-------
B D               Pig  tg------------
B D            Alpaca  ta------------
B D           Dolphin  tt------------
B D               Cow  ta------------
B D               Cat  tc------------
B D             Panda  tg------------
  D  Little brown bat  tg------------
B D           Megabat  tc------------
B D          Elephant  -------ctagtag
B D           Manatee  -------ctagtag
B D         Armadillo  -------ctagtag
B D             Sloth  -------ttactag
B D        Guinea pig  ==============
B D             Horse  ==============
B D          Bushbaby  --------------
B D               Dog  ==============
B D            Gibbon  ==============
B D         Orangutan  ==============
B D             Chimp  ==============
B D             Shrew  ==============
B D          Hedgehog  ==============
B D           Tarsier  ==============
B D       Mouse lemur  ==============
B D           Wallaby  ==============
B D        Rock hyrax  ==============
B D           Opossum  ==============
B D            Lizard  ==============
B D        Budgerigar  ==============
B D   Tasmanian devil  ==============
B D          Platypus  ==============
B D         Zebrafish  ==============
B D       Zebra finch  ==============
B D           Chicken  ==============
B D     X. tropicalis  ==============
B D        Coelacanth  ==============
B D    Painted turtle  ==============
B D            Turkey  ==============

Inserts between block 36 and 37 in window
B D            Human 18bp
B D          Gorilla 18bp
B D           Rhesus 18bp
B D           Baboon 18bp
B D         Marmoset 18bp
B D  Squirrel monkey 18bp
B D       Tree shrew 1bp
B D              Pig 4bp
B D           Alpaca 4bp
B D          Dolphin 4bp
B D              Cow 4bp
B D              Cat 4bp
B D            Panda 4bp
  D Little brown bat 4bp
B D          Megabat 23bp

Alignment block 37 of 120 in window, 37105825 - 37105841, 17 bps 
B D             Mouse  tgtcctcatt------------------------------caagcat
B D               Rat  tgtcatcacttcagagggcgtttccatgccacctttcaggcaagcat
B D      Kangaroo rat  cctttcccgt------------------------------cagtcgt
B D    Naked mole-rat  tatcatcc--------------------------------cag----
B D            Rabbit  cctttccagt------------------------------cag----
B D             Human  catttccagt------------------------------gaatccc
B D             Chimp  catttccagt------------------------------gaatccc
B D           Gorilla  catttccggt------------------------------gaatccc
B D         Orangutan  cacttccagt------------------------------gaatccc
B D            Gibbon  cacttccagt------------------------------gaatccc
B D            Rhesus  cacttccagt------------------------------caatccc
B D            Baboon  cacttccagt------------------------------caatccc
B D          Marmoset  tacttccagt------------------------------cagtc--
B D   Squirrel monkey  cacttccagt------------------------------cagtcct
B D           Tarsier  cccttccagt------------------------------taatccc
B D       Mouse lemur  cccttccagt------------------------------taatccc
B D        Tree shrew  -tctttccgt------------------------------caattct
B D               Pig  ctcttctggt------------------------------caagccc
B D            Alpaca  ctcatgtagt------------------------------caatccc
B D           Dolphin  ctcttctagt------------------------------caatcct
B D               Cow  ctcatctagt------------------------------caatccc
B D               Cat  tttttccagt------------------------------caattc-
B D             Panda  tttttccagt------------------------------caattc-
  D  Little brown bat  cccttctgga------------------------------cagttct
B D           Megabat  ctcttccagt------------------------------cagtccc
B D           Manatee  -----------------------------------------------
B D          Elephant  -----------------------------------------------
B D        Guinea pig  ===============================================
B D          Squirrel  -----------------------------------------------
B D             Horse  ===============================================
B D          Bushbaby  -----------------------------------------------
B D               Dog  ===============================================
B D             Shrew  ===============================================
B D         Armadillo  -----------------------------------------------
B D             Sloth  -----------------------------------------------
B D          Hedgehog  ===============================================
B D           Wallaby  ===============================================
B D        Rock hyrax  ===============================================
B D           Opossum  ===============================================
B D            Lizard  ===============================================
B D        Budgerigar  ===============================================
B D   Tasmanian devil  ===============================================
B D          Platypus  ===============================================
B D         Zebrafish  ===============================================
B D       Zebra finch  ===============================================
B D           Chicken  ===============================================
B D     X. tropicalis  ===============================================
B D        Coelacanth  ===============================================
B D    Painted turtle  ===============================================
B D            Turkey  ===============================================

Inserts between block 37 and 38 in window
B D           Rabbit 5bp
B D            Human 1bp
B D            Chimp 1bp
B D          Gorilla 1bp
B D        Orangutan 1bp
B D           Gibbon 1bp
B D           Rhesus 1bp
B D           Baboon 1bp
B D  Squirrel monkey 1bp
B D          Tarsier 1bp
B D      Mouse lemur 1bp
B D       Tree shrew 1bp
B D              Pig 1bp
B D           Alpaca 1bp
B D          Dolphin 1bp
B D              Cow 1bp
B D              Cat 1bp
B D            Panda 1bp
  D Little brown bat 1bp
B D          Megabat 1bp

Alignment block 38 of 120 in window, 37105842 - 37105843, 2 bps 
B D             Mouse  gg
B D               Rat  gg
B D      Kangaroo rat  ag
B D            Rabbit  gg
B D              Pika  gg
B D             Human  ca
B D             Chimp  ca
B D           Gorilla  ca
B D         Orangutan  ca
B D            Gibbon  ca
B D            Rhesus  ta
B D            Baboon  ta
B D   Squirrel monkey  ca
B D           Tarsier  ga
B D       Mouse lemur  gg
B D        Tree shrew  gg
B D               Pig  gt
B D            Alpaca  gg
B D           Dolphin  gg
B D               Cow  gg
B D               Cat  gg
B D             Panda  gg
  D  Little brown bat  ag
B D           Megabat  gg
B D           Manatee  --
B D          Elephant  --
B D        Guinea pig  ==
B D          Squirrel  --
B D             Horse  ==
B D          Bushbaby  --
B D               Dog  ==
B D    Naked mole-rat  --
B D          Marmoset  --
B D             Shrew  ==
B D         Armadillo  --
B D             Sloth  --
B D          Hedgehog  ==
B D           Wallaby  ==
B D        Rock hyrax  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D   Tasmanian devil  ==
B D          Platypus  ==
B D         Zebrafish  ==
B D       Zebra finch  ==
B D           Chicken  ==
B D     X. tropicalis  ==
B D        Coelacanth  ==
B D    Painted turtle  ==
B D            Turkey  ==

Alignment block 39 of 120 in window, 37105844 - 37105845, 2 bps 
B D             Mouse  ga
B D               Rat  ga
B D      Kangaroo rat  ca
B D    Naked mole-rat  -a
B D        Guinea pig  ga
B D          Squirrel  ga
B D            Rabbit  ta
B D              Pika  ta
B D             Human  ta
B D             Chimp  ta
B D           Gorilla  ta
B D         Orangutan  ta
B D            Gibbon  ta
B D            Rhesus  ta
B D            Baboon  ta
B D   Squirrel monkey  ta
B D           Tarsier  ta
B D       Mouse lemur  ta
B D          Bushbaby  -a
B D        Tree shrew  ta
B D               Pig  ta
B D            Alpaca  ta
B D           Dolphin  ta
B D               Cow  ta
B D               Cat  ta
B D             Panda  ta
  D  Little brown bat  ta
B D           Megabat  ta
B D           Manatee  --
B D          Elephant  --
B D             Horse  ==
B D               Dog  ==
B D          Marmoset  --
B D             Shrew  ==
B D         Armadillo  --
B D             Sloth  --
B D          Hedgehog  ==
B D           Wallaby  ==
B D        Rock hyrax  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D   Tasmanian devil  ==
B D          Platypus  ==
B D         Zebrafish  ==
B D       Zebra finch  ==
B D           Chicken  ==
B D     X. tropicalis  ==
B D        Coelacanth  ==
B D    Painted turtle  ==
B D            Turkey  ==

Alignment block 40 of 120 in window, 37105846 - 37105854, 9 bps 
B D             Mouse  aattcactg
B D               Rat  gaatcactg
B D      Kangaroo rat  gaatca---
B D    Naked mole-rat  aagtatttc
B D        Guinea pig  aagtatttc
B D          Squirrel  gaaccactt
B D            Rabbit  gaatcactg
B D              Pika  aaatcactg
B D             Human  gaactgctg
B D             Chimp  gaacagctg
B D           Gorilla  gaaccactg
B D         Orangutan  gaaccactg
B D            Gibbon  caaccactg
B D            Rhesus  gaaccactg
B D            Baboon  gaaccactg
B D          Marmoset  ---ccactg
B D   Squirrel monkey  gaaccactg
B D           Tarsier  gaaccacta
B D       Mouse lemur  gaagcactg
B D          Bushbaby  aaaccactg
B D        Tree shrew  gaaccacta
B D               Pig  gaaccactc
B D            Alpaca  gaaccaatg
B D           Dolphin  gaaccactg
B D               Cow  gaatcacta
B D               Cat  aaaccgttg
B D             Panda  caaccactg
  D  Little brown bat  gaaccacta
B D           Megabat  taaccactg
B D          Elephant  -aaccactg
B D           Manatee  -aaccactg
B D         Armadillo  -aatcactg
B D             Sloth  -aatcactg
B D            Medaka  aattcatcg
B D             Horse  =========
B D               Dog  =========
B D             Shrew  =========
B D          Hedgehog  =========
B D           Wallaby  =========
B D        Rock hyrax  =========
B D           Opossum  =========
B D            Lizard  =========
B D        Budgerigar  =========
B D   Tasmanian devil  =========
B D          Platypus  =========
B D         Zebrafish  =========
B D       Zebra finch  =========
B D           Chicken  =========
B D     X. tropicalis  =========
B D        Coelacanth  =========
B D    Painted turtle  =========
B D            Turkey  =========

Inserts between block 40 and 41 in window
B D          Tarsier 1bp
B D       Tree shrew 1bp

Alignment block 41 of 120 in window, 37105855 - 37105856, 2 bps 
B D             Mouse  ct-
B D               Rat  ct-
B D      Kangaroo rat  ct-
B D    Naked mole-rat  ca-
B D        Guinea pig  ca-
B D          Squirrel  tt-
B D            Rabbit  tt-
B D              Pika  tt-
B D             Human  tt-
B D             Chimp  tt-
B D           Gorilla  tt-
B D         Orangutan  tt-
B D            Gibbon  tt-
B D            Rhesus  tt-
B D            Baboon  tt-
B D          Marmoset  tt-
B D   Squirrel monkey  tt-
B D           Tarsier  tt-
B D       Mouse lemur  tt-
B D          Bushbaby  tt-
B D        Tree shrew  tt-
B D               Pig  tt-
B D            Alpaca  tt-
B D           Dolphin  tt-
B D               Cow  tc-
B D               Cat  tt-
B D               Dog  tt-
B D             Panda  tt-
  D  Little brown bat  tt-
B D           Megabat  tt-
B D          Elephant  tt-
B D           Manatee  gt-
B D         Armadillo  tt-
B D             Sloth  tt-
B D            Medaka  -ca
B D             Horse  ===
B D             Shrew  ===
B D          Hedgehog  ===
B D           Wallaby  ===
B D        Rock hyrax  ===
B D           Opossum  ===
B D            Lizard  ===
B D        Budgerigar  ===
B D   Tasmanian devil  ===
B D          Platypus  ===
B D         Zebrafish  ===
B D       Zebra finch  ===
B D           Chicken  ===
B D     X. tropicalis  ===
B D        Coelacanth  ===
B D    Painted turtle  ===
B D            Turkey  ===

Inserts between block 41 and 42 in window
B D         Bushbaby 1bp
B D              Pig 1bp
B D           Alpaca 1bp
B D          Dolphin 1bp
B D              Cow 1bp
B D              Cat 1bp
B D              Dog 1bp
B D            Panda 1bp
  D Little brown bat 1bp
B D          Megabat 1bp

Alignment block 42 of 120 in window, 37105857 - 37105888, 32 bps 
B D             Mouse  tca-------atttat------attacca-tag-tttagttttactt
B D               Rat  tca-------gtttga------atcacca-ttg-tttagtgttactt
B D      Kangaroo rat  taa-------aaatat------atcaccg-ta--cataactttgctt
B D    Naked mole-rat  tta-------attgat------atcactg-tag-attaattttgctt
B D        Guinea pig  tta-------attgga------attattg-tag-attaattttattt
B D          Squirrel  tc---------tttta------atcatcc-tagtattaattttactt
B D            Rabbit  tgt-------atttat------ataactg-tag-attaatttttctt
B D              Pika  -----------tttgt------ataac---tag-attaattttgctt
B D             Human  ta--------atttgt------atcatca-tag-gttaattttgctt
B D             Chimp  ta--------atttgt------atcatca-tag-attaattttgctt
B D           Gorilla  ta--------atttgt------atcatca-tag-attaattttgctt
B D         Orangutan  ta--------atttgt------atcatca-tag-attaattttgctt
B D            Gibbon  ta--------atttgt------atcatca-tag-attaattttgctt
B D            Rhesus  ta--------atctgt------atcatca-tag-attaattttgttt
B D            Baboon  ta--------atctgt------atcatca-tag-attaattttgttt
B D          Marmoset  ta--------atttgt------atcacca-tag-attaattttgctt
B D   Squirrel monkey  ta--------atttgt------atcacca-tag-attaattttgctt
B D           Tarsier  ta--------atttgt------atagcca-cag-attcattttggtt
B D       Mouse lemur  taattt----atttgt------gtcacca-cag-ataaaatattctt
B D          Bushbaby  taattt----attttt------attatca-tag-ataaattttgctt
B D        Tree shrew  ta--------atttgt------atcacca-tag-attaattttactt
B D               Pig  ta--------atttgg------atcacca-tgg-attaattttgcct
B D            Alpaca  ta--------ctttgg------atcacca-tag-attaattttgcct
B D           Dolphin  ta--------atttgg------atcacca-tag-attaattttgctt
B D             Sheep  ta--------atttgg------atcacta-tag-attaattttgcct
B D               Cow  ta--------atttgg------atcatta-tag-attaattttgcct
B D               Cat  ta--------atttgg------atcaaaa-taa-attaattttgctt
B D               Dog  ta--------atttgg------atcaata-tag-attaattttgctt
B D             Panda  ta--------atttgg------atcagca-tag-attaattttgctt
  D  Little brown bat  ta--------atttga------atcacca-tag-gttaattttactt
B D           Megabat  ta--------atttgg------atcacca-tag-attacttttgctt
B D          Elephant  ----ct----attcta------atcacca-tag-attaattttgttt
B D           Manatee  ----ctaa--attcta------atcacca-tag-attaattttgttt
B D         Armadillo  ----ctga---tttgt------atcactgctag-gttaattttcctt
B D             Sloth  ----ttga--ttttat------atcactgctag-attaattttgctt
B D            Medaka  ---tttgacaatttgtcatttgaaaacaa-tta-tgtaaatttactt
B D             Horse  ===============================================
B D             Shrew  ===============================================
B D          Hedgehog  ===============================================
B D           Wallaby  ===============================================
B D        Rock hyrax  ===============================================
B D           Opossum  ===============================================
B D            Lizard  ===============================================
B D        Budgerigar  ===============================================
B D   Tasmanian devil  ===============================================
B D          Platypus  ===============================================
B D         Zebrafish  ===============================================
B D       Zebra finch  ===============================================
B D           Chicken  ===============================================
B D     X. tropicalis  ===============================================
B D        Coelacanth  ===============================================
B D    Painted turtle  ===============================================
B D            Turkey  ===============================================

Alignment block 43 of 120 in window, 37105889 - 37105928, 40 bps 
B D             Mouse  caaataacaaaattattcaaataacaaacat--tcaatttta----
B D               Rat  caaataataaaaatattaaatt------cat--tgtgtttta----
B D      Kangaroo rat  caaagaacagctgtgttcaaactatca-catcatctgtatta----
B D    Naked mole-rat  taaaaaagagaaatgtaccaactatcagtct--------tta----
B D        Guinea pig  taaaaaggagaaatgtaccaactatcagtct--tatatatta----
B D          Squirrel  caaaaaatggaaatatcccaaatatcaatct--tctgcttt-----
B D            Rabbit  caaa---tagaagtgttccaaatatcaaatt--tatacatta----
B D              Pika  caaa---tagaaatgttccaaatatcaaacg--tacacatta----
B D             Human  catacaatagaaatgttccaag-gtcaatct--tctacatta----
B D             Chimp  catacaatagaaatgttccaag-gtcaatct--tctacatta----
B D           Gorilla  catacaatagaaatgtgccaag-gtcaatct--tctacatta----
B D         Orangutan  catacaatagaaatgttccaag-gtcaatct--tctatatta----
B D            Gibbon  catacaatagaaatgttccaag-gtcaatct--tctgcagta----
B D            Rhesus  catacaatagaaatgttccaag-gtctatct--tctgcatta----
B D            Baboon  catacaatagaaatgttccaag-gtctatct--tctgcatta----
B D          Marmoset  caaacaacagaaatgttccaag-gtcaatct--tctgcatta----
B D   Squirrel monkey  caaacaatagaaatgttccaag-gtcaatct--tctgcatta----
B D           Tarsier  caaatagtaaaaatgtttcaagtatcagtct--tctgcatta----
B D       Mouse lemur  caaacaaaagaaatattccaaatatcaatct--tctgcatta----
B D          Bushbaby  caaacagtagaaatatttcaaatatcagtct--tctgcatta----
B D        Tree shrew  caaacaatagaaatgttgtaaatataactct--tctgcatta----
B D               Pig  caaacaatagaattgttccaaatatccat-t--tctacttta----
B D            Alpaca  caaacaatagaaatgttccagatatccatct--tctgcttta----
B D           Dolphin  caaacaaaagaaatgttccaaatatccatcc--tctgcttta----
B D             Sheep  caaacagtagaaatgttccaaatatccatct--tttgcttta----
B D               Cow  caaacagtagaaattttccaaatatccatat--ttttcttta----
B D               Cat  caaacaata-aaatgctcca-atgtccatct--tct---tta----
B D               Dog  caaacagta-aaatgttcca-gt----atct--gct---tta----
B D             Panda  caaacaata-aaatgttcca-gtatccatct--tct---ttc----
  D  Little brown bat  taagcaataaaaatttaccaaatatccatct--tctac-ttc----
B D           Megabat  caaacaatagaaatgttccacatatccagct--tctgc-tta----
B D          Elephant  taaacaatagaaatactccagatatcaacct--tctgcttta----
B D            Tenrec  caaacagta-aaatgccccaaatagtaacct--tctgcttta----
B D           Manatee  taaacgatagaaatactccagatatcaacct--tctgcttta----
B D         Armadillo  caaaaaatagtatt--ttcaagcatcagtct--tctgctgta----
B D             Sloth  cagaaaatagtggt--ttcaaacatcgttct--tctgcttca----
B D            Medaka  ---ttaata--aatcatccaagtttctatca--taaaagtgaattc
B D             Horse  ==============================================
B D             Shrew  ==============================================
B D          Hedgehog  ==============================================
B D           Wallaby  ==============================================
B D        Rock hyrax  ==============================================
B D           Opossum  ==============================================
B D            Lizard  ==============================================
B D        Budgerigar  ==============================================
B D   Tasmanian devil  ==============================================
B D          Platypus  ==============================================
B D         Zebrafish  ==============================================
B D       Zebra finch  ==============================================
B D           Chicken  ==============================================
B D     X. tropicalis  ==============================================
B D        Coelacanth  ==============================================
B D    Painted turtle  ==============================================
B D            Turkey  ==============================================

Alignment block 44 of 120 in window, 37105929 - 37106036, 108 bps 
B D             Mouse  acttttgatgtagtatagt--aa--------cagg---ttaa----------------------tt----
B D               Rat  actttgggtgtagtacaat--aa--------caag---ttaa----------------------at----
B D      Kangaroo rat  atttttgacacaatactat--aa--------caag---ttaa----------------------ac----
B D    Naked mole-rat  atttttgatgtaatattat--aa--------taacaaactaggata---------------aa-tt----
B D        Guinea pig  atttttgatgtaacactat--aa--------taat---tcaagata---------------aattt----
B D          Squirrel  atttttaatataatactat--aatttacagctaat---ttaag---------------------ag----
B D            Rabbit  ----------tgatactgt--aactt-----caaa---taaaattg---------------aa--t----
B D              Pika  gctttt-atgtagtactataaaatgt-----taac---tgaaattt---------------aaatt----
B D             Human  atttttgatgcaatacta---aa--------taat---ttaaaatgtaat------ttaagaaatt----
B D             Chimp  atttttgatgcaatacta---aa--------taat---ttaaaatgtaat------ttaagaaatt----
B D           Gorilla  atttttgatgcaatacta---aa--------taat---ttaaaatgtaat------ttaagaaatt----
B D         Orangutan  atttttgatgcaatacta---aa--------taat---ttaaaatgtaat------ttaagaaatt----
B D            Gibbon  atttttgatgcaatacta---aa--------taat---ttaaaatgtaat------ttaagaaatt----
B D            Rhesus  atttttgatgcaatacta---aa--------taat---ttaaaacgtaat------gtaagaaatt----
B D            Baboon  atttttgatacaatacta---aa--------taat---ttaaaacgtaat------gtaagaaatt----
B D          Marmoset  atttttgatacaatacaa---aa--------taat---ttaaaatgtgat------ttgagaaatt----
B D   Squirrel monkey  atttttgatacaatacta---aa--------taat---ttaaaatgtaat------ttaagaaatt----
B D           Tarsier  atttttgatatgatattat--aa--------taat---ttaaactg-----------taagaaatt----
B D       Mouse lemur  atttttgatattctactgt--aa--------taat---ttaaacta------------aagaaatt----
B D          Bushbaby  agttttgatacactactat--ga--------taag---ttaaacta-----------taaaaggtt----
B D        Tree shrew  atttttgatgcactaccat--aa--------tatc---ttaaactataat------ttaaaaattc----
B D               Pig  att-ttaatgcaatatttt--ga--------taaa---tta-----taattttat-aaaagaaatt----
B D            Alpaca  ctttttaatgtaatactct--ga--------taac---ttaaattgtaattttat-taa--aaact----
B D           Dolphin  atttttaatgcagtactct--ga--------taac---ttaaactataatttcat-aaaagaaatt----
B D             Sheep  attcttaatgtaatactct--ga--------taac---atacac--taattttat-aaaagaaatt----
B D               Cow  attcttaatgtaatactct--ga--------taac---atacac--taattttat-aaaagaaatt----
B D               Cat  atttttaatgcaacactat--ag--------taac---taaaactgcaatttaataaaaagaaata----
B D               Dog  atttttaatgcaacact-----a--------taat---ttaaactgtaat----------aaaatt----
B D             Panda  atttttaatgcaacactat--aa--------taat---ttaagctgtaatttaat-aaaagaaatt----
  D  Little brown bat  aattttaatttgacactat--aa--------taac---ttaaaatgtaatttcat-taaagaaatg----
B D           Megabat  attttcagtgcaacactat--at--------taac---ttaaactgtaatttcat-taaaaaaatt----
B D          Elephant  atttttaatgcagaactat--aa--------tac----ttaaactataattttat-aaaagaaatt----
B D            Tenrec  attattaatgtagaagtat--aa--------aac----ttaaactgaaatgttat-taaagaaatg----
B D           Manatee  attattaatgcaggagtgt--aa--------tac----ttaaactgtaattttat-aaaagaaatt----
B D         Armadillo  gtttttaatgcaatatagt--aa--------tgct---ttaaactgtaattttat-aaaggaaatt----
B D             Sloth  atttctaatgcaatactat--aa--------tgct---ttaaattgaaattgtat-aaaagaaagt----
B D    Painted turtle  atctctgatct----------gg--------taaa---ctacaggat---------tgaaaagattttgc
B D            Medaka  ----------------------------acgttct---ttggtgttta--------aaaaaaggtc----
B D             Horse  ======================================================================
B D             Shrew  ======================================================================
B D          Hedgehog  ======================================================================
B D           Wallaby  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D   Tasmanian devil  ======================================================================
B D          Platypus  ======================================================================
B D         Zebrafish  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D     X. tropicalis  ======================================================================
B D        Coelacanth  ======================================================================
B D            Turkey  ======================================================================

                Mouse  --agcttctgacag-caat-t----aaatacccagt---atacttcttac----ct---------aaa--
                  Rat  --tagctctgacag-cagt----------actcaga---atgcttcatat----ct---------aaa--
         Kangaroo rat  --caagaatattta-gaatgt----aaatatttaga---atgttttatat----gt---------aaa-a
       Naked mole-rat  --agcttcagaagg-taat-t-----aatgcttaga---atgatttttat----at---------aac-a
           Guinea pig  --aagtttaaaaag-taat-t----aaatgtttaga---atgaattttat----at---------aacaa
             Squirrel  --aaattaaggaag-taac-t----aaatattcaga---at---ttttat----gt---------aaaaa
               Rabbit  --agcttcagaaaagtaat-t----aagcattcaga---a-ggtttatgt----at---------aaa--
                 Pika  --acctccagaaag--aat-t----aaacattcaga---a-ggttcatgt----ac---------aaa--
                Human  --tacttcagaaag------t----aaatattaaga---atgcctcttat----gt-------aaaaa-a
                Chimp  --tacttcagaaag------t----aaatattaaga---atgcctcttat----gt--------aaaa-a
              Gorilla  --tacttcagaaag------t----aaatattaaga---atgcctcttat----gt---------aaa-a
            Orangutan  --tacttcagaaag------t-----aatattaaga---atgcctcttat----gt----------aa-a
               Gibbon  --tacttcagaaag------t----aaatattaaga---atgcctcttat----gt----------aa-a
               Rhesus  --tacttcagaaag------t----aaatattaaga---atgcctcttat----gt-------aaaaa-a
               Baboon  --tacttcagaaag------t----aaatattaaga---atgcctcttat----gt-------aaaac-a
             Marmoset  --tgattcaaaaag------taattaaatattaaga---atgcctcttat----gt---------aaa-a
      Squirrel monkey  --cgctttagaaag------taattaaatattaaga---atgcctcttat----gt---------aaa-a
              Tarsier  --agccacagaaag------t----aaacattaaga---attctttttat----gtaaaaaaaaaaaa-a
          Mouse lemur  --ggcttcagggat------t----aaatatcaaaa---atgtaaattat----gt---------aaa-a
             Bushbaby  --agctttaggaag------t----aaatattaaaa---attattttcat----gt---------aaa-a
           Tree shrew  --aactctaggaag------t----aaatattcata---atgctttttgt----gt------aaaaaa-a
                  Pig  --tgctt-agaaag-cagt-t----aaatattcaga---ataa-tttttt----gt---------aaa-g
               Alpaca  --agcttcagaa----agt-a-----aagattcaga---ataa-ttttat----gt---------aaa-a
              Dolphin  --agcttcagaa----agt-t----aaatattcaga---ataa-ttttat----gt--------aaaa-a
                Sheep  --agcttcagaaag-cagt-t----aaatattcaga---ataa-ttttat----at---------aga-a
                  Cow  --agcttcagaaaa-cagt-t-----aatactcaga---ataa-ttttat----at---------aga-a
                  Cat  --aacttcagaaaa-taat-t----aaatattcaga---acaattttcat----gt---------aaa--
                  Dog  --agcttcagaaag-ta---------aatattcaga---atga-ttttat----gt---------aaa-a
                Panda  --agctttagaaag-taat-t-----aatattcaga---acgatttttgt----gt---------aaa-a
     Little brown bat  --aacttcagacgg-taat-t------atattaaaa---ata--ttttat----gt---------aaa-a
              Megabat  --agcttcagaaag-taat-t----aaatattcaga---atat-ttttat----gt---------gaa-a
             Elephant  --gggttcagaaaa-taat-t----aaatattagaa---gtgattttttttcttat---------aaa-a
               Tenrec  --gggct--aaaaa-taat-t----aaatattagaa---atgagttttcaatt--------------a-a
              Manatee  --gaattcagaaag-taat-t----aaatattagaa---gttattttttttccata---------aaa-a
            Armadillo  --atcttcagaaag-taag-t----aaacaacaaga------------------gt---------aaa-a
                Sloth  --atcttcagaacg-taat-t----aaatattaaga---ataatttttat----gt---------aaa-a
       Painted turtle  caaccttccaatag-ctg--t----aattatggaggtttatacttcttaa----tt---------cca--
               Medaka  --taaataagaatg---ag-c----atgtgtttgaa--------ttgcat----ta---------aaa-t
                Horse  ======================================================================
                Shrew  ======================================================================
             Hedgehog  ======================================================================
              Wallaby  ======================================================================
           Rock hyrax  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
      Tasmanian devil  ======================================================================
             Platypus  ======================================================================
            Zebrafish  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
        X. tropicalis  ======================================================================
           Coelacanth  ======================================================================
               Turkey  ======================================================================

                Mouse  -gc-----tt-ctc---------------taca----tgtattcttc--t--gcct--aa----ct-ggg
                  Rat  agt-----tt-ctc---------------taca----tgtatttttc--t--ccct--aa----tt-tgg
         Kangaroo rat  agt-----tt-cac---------------taaa----ttcattg-----c--acat--ga----ct-c--
       Naked mole-rat  agt-----tt-cag---------------tact----tg----------t--acat--aa----tt-gag
           Guinea pig  agt-----tt-cac---------------tact----tg----------t--acat--gg----at-aag
             Squirrel  cat-----tt-cac---------------taca----tgcatcgtacata--atgt--aa----tt-ggg
               Rabbit  aat-----tt-tac---------------tgca----tacattg-----t--acat--aa----tc-aag
                 Pika  aat-----tt-tcc---------------tgca----aacatta-----t--acat--aa----tc-aaa
                Human  aaa-----at-tac---------------tatg----tatattg-----c--aaat--aa----tc-aag
                Chimp  aaa-----gt-tac---------------tatg----tatattg-----c--aaat--aa----tc-aag
              Gorilla  aaa-----at-tac---------------tatg----tatattg-----c--aaat--aa----tc-aag
            Orangutan  aaa-----at-cac---------------tatg----tatattg-----c--aaat--aa----tc-aag
               Gibbon  aaa-----aa-cac---------------tatg----tatattg-----c--aaat--aa----tc-aag
               Rhesus  cag-----tt-cac---------------tatg----tatattg-----c--aaat--aa----tc-aag
               Baboon  cag-----tt-cac---------------tatg----tatattg-----c--aaat--aa----tc-aag
             Marmoset  aga-----tt-cac---------------tatg----tatattg-----c--acat--aa----tt-aaa
      Squirrel monkey  aga-----tt-cac---------------tatg----tatattg-----c--aaat--aa----tt-aaa
              Tarsier  aaa-----tt-tac-----------------tg----ttcattg-----c--aaat--aa----tt-ggg
          Mouse lemur  --------at-aat---------------ttca----tgcgttg-----t--acat--aa----tg-ggg
             Bushbaby  taa----ctt-cat---------------ttta----tgtatca-----t--acat--aa----tg-gaa
           Tree shrew  aat-----tt-tac---------------tctg----tatttta-----c--acatcaaa----at-gag
                  Pig  aac-----tt-cat---------------tata----tgcactg-----c--acat--aa----tt-gag
               Alpaca  aaa-----tg-tgc---------------tata----tgca-tg-----c--acat--aa----tt-gag
              Dolphin  aat-----tt-cac---------------tata----tgcactg-----t--acat--aa----tt-gag
                Sheep  aat-----tt-cac---------------tatc----ttctctg-----t--gcat--aa----tt-gag
                  Cow  aat-----tt-cac---------------ta---------tctg-----t--gcat--aa----tt-gag
                  Cat  --------------------------------t----tgcattg-----t--acat--aa----ct-gag
                  Dog  atc-----tttcac---------------tatt----ttcattg-----c--acat--aa----ttggaa
                Panda  atc-----tttcac---------------tgtc----ttcattg-----t--atat--aa----ct-gag
     Little brown bat  aat-----tt-cac---------------tata----tgtattg-----c--acat-aaa----tc-gag
              Megabat  aat-----ttccac---------------tgta----tgcattg-----c--acat--aa----tt-gag
             Elephant  aattgtgttt-cat---------------aaca----catcttg-----c--aaat--aa----tc-tgg
               Tenrec  aattcagttt-aac----------------atg----ctttttg-----t--acat--aa----tc-tgg
              Manatee  aattctgttt-cac---------------agca----caccttg-----c--acaa--aa----tc-tgg
            Armadillo  aattctcttt-cagtaatcccttgaactacatg----tgctttg-----a--acat--aa----tt-tgg
                Sloth  aattctgttt-cagtaatgtcttgcactgtatg----tgctttg-----a--acat--aa----tt-tgg
       Painted turtle  --------tt-atc---------------tttg----ttcattt-----ctgctat--aa----gt-gga
               Medaka  cag-----cc-gac---------------tgcagggttgtcctt-----c--actt--aacttttt-ggg
                Horse  ======================================================================
                Shrew  ======================================================================
             Hedgehog  ======================================================================
              Wallaby  ======================================================================
           Rock hyrax  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
      Tasmanian devil  ======================================================================
             Platypus  ======================================================================
            Zebrafish  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
        X. tropicalis  ======================================================================
           Coelacanth  ======================================================================
               Turkey  ======================================================================

Inserts between block 44 and 45 in window
B D         Elephant 1bp
B D           Tenrec 1bp
B