Multiz Alignments of 35 Vertebrates

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 393 in window, 56745427 - 56745587, 161 bps 
B D                 Mouse  actgcaa-agacca-gca------ggcagttgggaatc---------agtg--atggctttctggtac-a
B D                   Rat  acggcag-caaata-gcgtcagacagtagttgtgaatc---------agtc--atggcttcctggtac-a
            GCF_003668045  aaggcaa-aggcca-tca------ggcc----tgaacc---------agcc--atggcttcctgctgc-a
                   Beaver  aaggcaa-agagag-tca------ggcagttctggact--------aaaac--acaacttcctggtgc-a
B D              Squirrel  aaggcaa-agaac--tca------ggcagttctggacc---------caa---acagtctcttggtgcaa
B D            Guinea pig  aaggcag-aaaagagtca------ggcagttttgtacc---------aaa---acagtttcctggtgcaa
B D                Rabbit  aaggcaa-ggagag-aca------ggcagttctggacc--------taaac--accccatcctggtgc-a
B D                  Pika  agggcaatggggag-atg------aggggttttggacc--------caaac--accctttcctggtac-a
B D                 Human  aaggcaa-agacag-aca------ggcagttctggacc--------aaaac--acagtttcctggtgc--
B D                 Chimp  aaggcaa-agacag-aca------ggcagttctggacc--------aaaac--acagtttcctggtgc--
B D                Bonobo  aaggcaa-agacag-aca------ggcagttctggacc--------aaaac--acagtttcctggtgc--
B D               Gorilla  aaggcaa-agacag-aca------ggcagttctggacc--------aaaac--acagtttcctggtgc--
B D                Rhesus  aaggcaa-agacag-aca------ggcagttctggacc--------aaaac--acagtttcctggtgc--
B D              Marmoset  aaggcaa-aaacag-aca------ggcagttttgaacc--------aaaac--acagtttcctggtgc--
B D               Tarsier  aaggcaa-agagag-aca------ggcagctctggacc--------caaac--acagattcctggtgc--
B D              Bushbaby  aaggcaa-agagag-aca------ggcagtaatggacc--------aaaac--acagtttcttggtgc--
B D            Tree shrew  aaggc---agagag-aca------ggcagttttagacc--------aaa----acagtttcctggtgc--
B D  Malayan flying lemur  aaggtaa-agagag-aca------ggcagttctggatc--------aaaac--acagtttcctggtgt--
B D                   Pig  aaggcaa-ggagag-att------ggcaattctgggcc--------aaggc--acagtttcctggtgc--
B D               Dolphin  aaggcaa-gaagag-act------ggcagttctgggcc--------aaaat--acagtttcctggtgc--
B D                   Cow  aaggcaa-ggaaag-act------ggcagttctgggcc--------aaaat--cctgtttcctggtgc--
B D                 Sheep  aaggcaa-ggaaag-act------ggcagttctgggcc--------aaaat--actatttcctggtgc--
B D                 Horse  aaggcaa-agagag-act------ggcagttcagcacc--------aaaac--actgtttcctggtgc--
B D      Chinese pangolin  aaggc-----agag-act------ggcagttctgggcc--------aaaa---acggtttcctggtgc--
B D                   Dog  aaggcaa-agagag-att------ggcagttctttgcc--------aaaat--acggtttcctggtgc--
B D    Hawaiian monk seal  aaggcaa-agagag-act------ggcagttctttgcc--------aaaac--gcagtttcctggtgc--
B D              Hedgehog  aaggcaa-agagaa-act------ggaagttgggggggggggaggcaaagc--acagcttcctggtgc--
B D                 Shrew  aaggcaa-aaagag-aca------ggcagttctgggca--------aaaac--acaatttcctggtac--
B D              Elephant  aaggtaa---agag-ata------ggcagttctgggac--------aaaac--atggtttcctggtgc--
B D                Tenrec  aaagcaa-ctagag-aca------ggcacttctgggcc--------caaac--atgctttcttggtgc--
B D               Opossum  aagacga-agagat-ata------gaaagccctgagct--------ggaacagagagagcctcaatcc--
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  aaaataggagc-ac--aatc-tacttc-tttgga--------gggggagac--agt---g----------
                      Rat  aaaatgggaac-ac--aatc-tttgtc-tttgga--------gggggagacaaaat---g----------
            GCF_003668045  aaaatgagcctggc--aatc-tacttg-tttgga---------ggggaggcatggt---g----------
                   Beaver  aaaatgggaac-ac--aa-c-tatttc-tttgga-------aggggtaggcatagt---g----------
                 Squirrel  aaaataggagc-ac--aatc-tatttc-tttgga-------agggggagacatagt---g----------
               Guinea pig  aaaataggaac-ac--aa-----tttc-ttggga--------gggggggtaatggt---g----------
                   Rabbit  aaaatgggaac-ac--agtc-taatc--tttgag--------gggggaggcatggt---g----------
                     Pika  aaactgggagc-ccggagtt-tagtttgtttagt--------gtgggaggcacggt---g----------
                    Human  -aaatggg-ac-tc--aatc-taattc-ttgggggtggtagaggaggagacatagt---g----------
                    Chimp  -aaatggg-ac-tc--aatc-taattc-ttgggggtggtagaggaggagacatagt---gaaa-------
                   Bonobo  -aaatggg-ac-tc--aatc-taattc-ttgggggtggtagaggaggagacatagt---g----------
                  Gorilla  -aaatggg-ac-tc--aatc-taattc-ttgggggtggtagaggaggagacacagt---gaaa-------
                   Rhesus  -aaatggg-ac-tc--aatc-caattc-ttgggggtggtagaggaggaaacatagt---g----------
                 Marmoset  -aaatggg-ac-tc--aatc-taattc-ttgagggtggtagaggaggagacatagt---g----------
                  Tarsier  -aaatagg-aa-tc--catt-taattc-ttggagg-------ggggggagcatagt---g----------
                 Bushbaby  -aaatggg-aa-tc--aatc-tagttc-tttggggtt-----gggaaaaatatagt---g----------
               Tree shrew  -aaatgggaac-gc--aatc-taattc-tttgga-------ggagggaggcatagt---gaaaagacaaa
     Malayan flying lemur  -gaatgggaac-ac--aatc-tagttc-tttggat------agggggaagcagagc--------------
                      Pig  -aaactggaac-ac--aatc-taattc-tttgga------gagggggaggcagagt---g----------
                  Dolphin  -aaattggaac-ac--aatc-taattc-tttgga------gagggggaggcatagt---g----------
                      Cow  -aaattggaac-ac--aatcttaattc-ttcggc------gagggggaggcatagt---g----------
                    Sheep  -aaattggaac-ac--aatcttaattc-tttggc------gagggggaggcatagt---g----------
                    Horse  -aaattagaac-ac--aatc-taattc-tttgga------gaggg-gaggaataat---g----------
         Chinese pangolin  -aaattggaac-ac--aatc-taattc-tttgga------gagggagaggaatagt---g----------
                      Dog  -aaattggaac-ac--aatc-tgattc-tttgga------gaggg---ggaggaag---g----------
       Hawaiian monk seal  -aaattggaac-ac--aatc-taattc-tttgga------ggggg---ggaatagg---g----------
                 Hedgehog  -aaattggaac-cc--aatc-taatta-tttgga------gaaggggacccttaat---g----------
                    Shrew  -aaaacggaat-ac--aacc-taattc-tttgga------gagggggaagcatagt---g----------
                 Elephant  -aaataggaac-ac--aatc-----ta-atgggt-------gggggcggtcatagt--gg----------
                   Tenrec  -aaataagaac-ac--attc--aattc-tttagg-------gggagagggcaaagtgggg----------
                  Opossum  -aaatgagaac-ac--gacc-taatta-aattgt--------gggggaaactcatt---c----------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ------------------------------------------------------a--------------g
                      Rat  ------------------------------------------------------a--------------a
            GCF_003668045  ------------------------------------------------------a--------------a
                   Beaver  ------------------------------------------------------c--------------a
                 Squirrel  ------------------------------------------------------a--------------a
               Guinea pig  ------------------------------------------------------a--------------c
                   Rabbit  ------------------------------------------------------a--------------a
                     Pika  ----------------------------------------------------------------------
                    Human  ---------------------------------------aaaaaaaaaaaaaaaa--------------a
                    Chimp  ---------------------------------------aaaaaaaaaaaaaaaa--------------a
                   Bonobo  ---------------------------------------aaaaaaaaaaaaaaaa--------------a
                  Gorilla  ---------------------------------------aaaaaaaaaaaaaaaa--------------a
                   Rhesus  ----------------------------------------gaaaaaaaaaaaaaa--------------a
                 Marmoset  --------------------------------------------------gaaaa--------------a
                  Tarsier  ------------------------------------------------------a--------------c
                 Bushbaby  ----------------------------------------------------gac--------------g
               Tree shrew  agaaaagaaaagaagagaaaaggaaagaaaaaagaaaagaaagaagagaagaaaa--------------g
     Malayan flying lemur  -----------------------------------------------------aa--------------g
                      Pig  ------------------------------------------------------a--------------a
                  Dolphin  ------------------------------------------------------a--------------a
                      Cow  ------------------------------------------------------a--------------a
                    Sheep  ------------------------------------------------------a--------------a
                    Horse  ------------------------------------------------------a--------------a
         Chinese pangolin  ------------------------------------------------------a--------------a
                      Dog  ------------------------------------------------------ggcggggggagagttg
       Hawaiian monk seal  ------------------------------------------------------a--------------a
                 Hedgehog  -----------------------------------------------ggaaaaaa--------------a
                    Shrew  ------------------------------------------------------a--------------a
                 Elephant  ------------------------------------------------------a--------------a
                   Tenrec  ------------------------------------------------------a--------------a
                  Opossum  ---------------------------------------------------------------------a
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================

                    Mouse  aataagctgac---agttgaaaagaaaactttccac-ctctggggaatcctgcaaccagaccaaatgtca
                      Rat  aataggctgac---agtagaaaaaaaaacttttcac-ctctgcatagtcctgcaaccagaccgaatgtca
            GCF_003668045  aataggctgac---agttgaaaagaaaacttttctt-ctctggggaaccctgcaatcagaccagatgtca
                   Beaver  aaaagattgat-agagctgaaaagaaaacttttctt-ccctaggga-ccctacaatcagaccaaatgtca
                 Squirrel  aaaaggctgat-ggagttgaaaagaaaacttttctt-ctctaggga-tcctacaatcagaccaaatgtca
               Guinea pig  aaaaggctgac-agagatgaaaag--------tttt-ctctaggga-gcctacaatcggaccaactatca
                   Rabbit  aacagactgac-agagttgcaaagaaaaattttctt-cttgagaga-ttctgcagtcagaccaaatgtca
                     Pika  ------------------ggggggaaaaagtctcct-ctctggaga-ttctacagacagatcaaaagtca
                    Human  aaaaggctgac-agagtttaaaagaaaacttttcct-gcctaggga-tcctaccatcagagcaaatgtca
                    Chimp  aaaaggctgac-agagtttaaaagaaaacttttcct-gcctaggga-tcctaccatcagagcaaatgtca
                   Bonobo  aaaaggctgac-agagtttaaaagaaaacttttcct-gcctaggga-tcctaccatcagagcaaatgtca
                  Gorilla  aaaaggctgac-agagtttaaaagaaaacttttcct-gcctaggga-tcctaccatcagagcaaatgtca
                   Rhesus  aaaagactgac-agagttgaaaataaaacttttctt-gcctaggga-tattaccatcagagcaaacgtca
                 Marmoset  aaaaggctgac---agttgaaaagaaaacttttcct--cctaggga-ttctcccatcagagcgaatgtca
                  Tarsier  aaaaggctgac-agaattgaaaagaaaacttttctt-gcctaggga-tcctgcaaccagaccaaatgtca
                 Bushbaby  aaaaagctgac-agaattgaaaagcaaacttttctt-gcctcagga-tcctacaatcagactaaaggtca
               Tree shrew  gaaaggttgac-agagttgaaaagaaaacttttctt-ccccaggga-tcttacagtcagaccaaaggtca
     Malayan flying lemur  aaaaggctgat-agagttgaagagaaaacttttctt-ccctaggga-tcctacaatcagaccaaatgtca
                      Pig  aaaagactgac-agacttgaaaagaaaacttttcct-ccctaggga-tcctacaatcagaccaaatgtca
                  Dolphin  aaaagactgac-agagttgaaaagaaaacttttctt-ccctaggga-gcctacaatcagaccaaatgtca
                      Cow  aaaagactgac-agagttgaaaagaaaacctttctt-ccctaggga-gcctacaatcagaccaaatgtca
                    Sheep  aaaagactgac-agagttgaaaagaaaacctttctt-ccctaggga-acctacaatcagaccagatgtca
                    Horse  aaaagactgac-agagttgaaaagaaaactttcctt-ccctaggga-tcctacaatcagaccaaatgtca
         Chinese pangolin  aaaagactgacaagagttgaaaagaaaacttttctt-ctctaggga-ttctacaatcagaccaaatgtca
                      Dog  aaaagac-------------------aaccgtgctt-ccctagggg-tcctatagtcagaccaactatcc
       Hawaiian monk seal  aaaagactgac-------------agagttgatctt-ccctgggga-ttctacaatcagaccaagtatca
                 Hedgehog  aaaagactgac-agagttgaaaagaaaacttttctc-aactaggaa-tcctacagccagagcaaatatca
                    Shrew  aaaagactgac-agaattgaaaagaaaacttttttc-ccctaggga-ccctacaaaaagaccatatggta
                 Elephant  aaaagtctgac-agagttgaaaagaaaactttttttcccccagggactcctacaatcagagtaaatgtca
                   Tenrec  aaaagcctgat-ggagttgaaaagagaacttgtctt-ccctagggactcccacaagcagagcaaatgcca
                  Opossum  agggggtagac-aaaatttaaaagaaag---ttctt-ccacagaaa-tc--atagttagactaagtgtca
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================

                    Mouse  g
                      Rat  g
            GCF_003668045  g
                   Beaver  g
                 Squirrel  a
               Guinea pig  g
                   Rabbit  g
                     Pika  g
                    Human  g
                    Chimp  g
                   Bonobo  g
                  Gorilla  g
                   Rhesus  g
                 Marmoset  g
                  Tarsier  g
                 Bushbaby  c
               Tree shrew  g
     Malayan flying lemur  g
                      Pig  g
                  Dolphin  g
                      Cow  g
                    Sheep  g
                    Horse  g
         Chinese pangolin  g
                      Dog  g
       Hawaiian monk seal  g
                 Hedgehog  g
                    Shrew  g
                 Elephant  g
                   Tenrec  g
                  Opossum  g
                Zebrafish  =
            X. tropicalis  =
                  Chicken  =

Inserts between block 1 and 2 in window
B D              Opossum 1545bp

Alignment block 2 of 393 in window, 56745588 - 56745985, 398 bps 
B D                 Mouse  gtcgggaagaatcggat--ta-tagaaggcagtggtgc-ctccacgtagatac-tgttgtctgtttgtga
B D                   Rat  gtagggaggaattggag--ta-gagaaggcagtgatgc-ttccgggtagataagtgttgtctatttgtga
            GCF_003668045  gtaggaaagcatgggat--ta-tgggagggagtgacgg-ttccttgtagacac-tgttgtttattttcga
                   Beaver  ttaggaaagtattggat--ta-tggagaggagcaactc-ttcattgtaggtat-tgctgttgattctgga
B D              Squirrel  ttaggaaagtataggat--ca-tggagaggcacaactt-ttc---------at-tgttgttgattgtgga
B D            Guinea pig  tcgaggaaatattggat--ta-tagagaagagcaactc-ttccctgttgctat-tgctgatgattctgga
B D                Rabbit  ttggcaaaggattggct--tactggagag-agcaaatc-ttcatggcagatac-ttgtgttgactctggg
B D                  Pika  ctggaaaagtgttggat--tg-tggtg------aaaac-ttcactgtagtgac-tttggttggttctggg
B D                 Human  ttgggaaagtattggag--aa-tggaaaggagcaactt-ttcctttcagatat-tattg-tgattttgga
B D                 Chimp  ttgggaaagtattggag--aa-tggaaaggagcaactt-ttcctttcagatat-tattg-tgattttgga
B D                Bonobo  ttgggaaagtattggag--aa-tggaaaggagcaactt-ttcctttcagatat-tattg-tgattttgga
B D               Gorilla  ttgggaaagtattggag--aa-tggaaaggagcaactt-ttcctttcagatat-tattg-tgattttgga
B D                Rhesus  ttgggaaagcattggac--aa-tggaaaggagcaactt-ttccttttagatat-tgttg-tgattttgga
B D              Marmoset  ctgggaaagtactggag--aa-tggaaaggagcaactc-ttccttatagacat-tgttg-tgattttcga
B D               Tarsier  ttaggaaatgtttgaag--ta-tggagaggagcagctgactcctcgtagatat-tgttgttgattttgga
B D              Bushbaby  ttggaaaacgattggat--tg-tggaaaggaacaactc-ttccttgtagatgt-------tgattctgga
B D            Tree shrew  ttggaaaggtattggat--ta------aggaacaactc-ttctttggagatag-tgtgcttgattctggg
B D  Malayan flying lemur  ttgggaaagtattggat--ta-tggagaggagcaactc-ttcactatc-atat-tgttgttgattctcga
B D                   Pig  ctgaaaaggtattagat--ca-tggagaggagcaactc-ttcattctacatgt-tgt---tgattctaga
B D               Dolphin  ttgaaaaagtattagat--ta-tggagaggagcaactc-ttcattctacatgt-tgt---tgattctgga
B D                   Cow  tcggaaaagtattagat--ta-tggagagaagcaaccc-ttcgttctacatat-ggt---tgattctggg
B D                 Sheep  ttggaaaagtattagat--ta-tggagagaagcaactc-ttcattctacatat-tgt---tgattctggg
B D                 Horse  ttggaaaagtattggct--ta-tggagaggagcaactt-ttcattctagatgt-tgt---tgattctgca
B D      Chinese pangolin  ttggaaaagtattggattata-tggagagaagcaactc-ttcattctaga----tgt---cgattctgga
B D                   Dog  ctggaaaagtagtggattata-tggagaggagtaactc-ttcattctaga----tgt---tgattctgga
B D    Hawaiian monk seal  ttggaaaagtaatggattata-tgcagaggagcaattt-tttattctagatgt-tgt---tgattctgga
B D              Hedgehog  ctaggaaagtactgggt--ta--gcaaaggagcaactc-agaagggtgga----tgt---tgattctgaa
B D                 Shrew  atgggaaag-attgg----------------gcaactc-tttatactaga----------tgattctgga
B D              Elephant  ttgagacagtatcggat--ta-tggtgaggagcaactc---aattccagatat-tgttgttaattctgag
B D                Tenrec  tccagaaagtattggat--ta-tggttcgatgcaactc-ttaattccagatat-ggttgttgcttctgag
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  tgtcacctttaaacaaa------------------caggtttctgac-aaatctgtgcatat-aagaagg
                      Rat  tgtcacttttaaacaag------------------cagggttctgac-aaatctgtgcatgt-aaaaggg
            GCF_003668045  tgtcacctttagacaac------------------caggtttccgacaaaatctgtgcatat-aacaagg
                   Beaver  tgtcagctttaaacaac------------------ctggtttctgaa-aattttgtgaatat-gaaaaga
                 Squirrel  tgtcagcgttgaacaac------------------atggtttcagac-aaatctgtaaacac-agaatga
               Guinea pig  gactggctctaagcaac------------------ttgcttactgac-aaatctgcgaacat-aaaacaa
                   Rabbit  tgccagctttaaacaag------------------gtggtt------------tgtgaacat-aaaatga
                     Pika  ---cagctttaggcagt------------------gtggtttctgac-acatctgtgaaagg-aaaatga
                    Human  tgccagctttaaacaac------------------ccagtttgtgac-acatttgtgattataaaaatga
                    Chimp  tgccagctttaaacaac------------------ccagtttgtgac-acatttgtgattataaaaatga
                   Bonobo  tgccagctttaaacaac------------------ccagtttgtgac-acatttgtgattataaaaatga
                  Gorilla  tgccagctttaaacaac------------------ccagtttgtgac-acatttgtgattataaaaatga
                   Rhesus  tgccagctttaaacaac------------------ccagcttgtgac-aaatttgtgattataaaaatga
                 Marmoset  tgccagctttaaacaac------------------ccagattctgac-aaatttgtgactat-aaaatga
                  Tarsier  caccaactttgaacaac------------------ctggtttctgac-taatctaggaatat-gaaatga
                 Bushbaby  tgtcagctttaaacaactagatttttagacaaccacatatttttgac-agatctgtgaatatgaa----a
               Tree shrew  tgccaactttaaac-ac------------------taggtttctgac-aaatttgtgaacac-caaatga
     Malayan flying lemur  tgccagctttaaacgac------------------ctagtttctgac-aaatctgtgaatat-aaaacga
                      Pig  tgccagctttaaacaac------------------ctgttttctgacaaaaattgtgaatat-aagatga
                  Dolphin  taccagctttaaacaac------------------ctgttttctgac-aagtctgtgaatat-aaaatga
                      Cow  tgccagctttaaacaac------------------ctgttttctgac-aaatctatgaatat-aaaatga
                    Sheep  tgccagctttaaacaac------------------ctgttttctgac-aaatctgtgaatat-aaaatga
                    Horse  tgccagctttaaacaac------------------ctgttttctgac-aaatctgtgaatct-aaaatga
         Chinese pangolin  tgccagatttaaacgac------------------ctgttttctgac-aaatctgtgactat-aaaatgt
                      Dog  tgccagctttaaacgac------------------ctgttctctgac-aaatctatgaatat-aaaatga
       Hawaiian monk seal  tgccagctttaaacaac------------------ctgttttctgac-aaatctgtgactat-aaaatga
                 Hedgehog  tgccagctt---acagc-------------------------ataac-ctattt---tctga-caagt-c
                    Shrew  tgccaactttaaacagc-------------------------ctaac-aaatttgtatatgt-aaaataa
                 Elephant  tgccagctttaaacaac------------------ctggtttttgac-aaatttgtgaatat-agca---
                   Tenrec  tgccaacttcatacaac------------------ccaacttcagac-acatttgtgactag-ag-----
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  taatttct-----------------ccaagt-gactgctc--t--ttg-----aag-cacctgtatcaga
                      Rat  taatttct-----------------ccaaat-gaccgctc--t--ttg-----aaa-cacctgtatcaga
            GCF_003668045  taacttcc-----------------ctggat-ggccactc--t--ttg-----aag-gacctataccaga
                   Beaver  taattcctg----------------caaaac-aaccaccc--a--ttt-----gaa-gccctgtgtcaga
                 Squirrel  taatttctt----------------tgaaat-gatcaccc--c--ttt-----aaa-acactgttttgga
               Guinea pig  ggatttgta----------------caaaat-gaacatcc--c--ttc-----taa-gctctttatcaga
                   Rabbit  tcatttcta----------------taaaat-gatcaccc--c--ctc-----aaa-gcactaggtcaca
                     Pika  tcatttcta----------------taaaat-gatcaccc--c--tac-----aaatgccctgtgg---a
                    Human  tcatttcta----------------caaaaatgctcactc--t--ttt-----aaa-gcactgtgttaga
                    Chimp  tcatttcta----------------caaaaatgctcactc--t--ttt-----aaa-acactgtgttaga
                   Bonobo  tcatttcta----------------caaaaatgctcactc--t--ttt-----aaa-acactgtgttaga
                  Gorilla  tcatttcta----------------caaaaatgctcacac--t--ttt-----aaa-gcactgtgttaga
                   Rhesus  tcatttctg----------------caaaaatgatcactc--t--ctt------aa-gcactgtgttaga
                 Marmoset  tgatttcta----------------caaaaatgatcactc--t--ctt-----aaa-gcact-tgtcaga
                  Tarsier  tcatttcta----------------caagat-----------------------ga-ttactgtgtcgga
                 Bushbaby  tcattt-tg----------------tagaaa--------------------------------tgtcaga
               Tree shrew  taattt----------------------------ttactc--c--ttc-----aaa-gcactgcatcaga
     Malayan flying lemur  tcatttcta----------------caaaac-gatcacac--c--ttc-----tga-gcactgtgtcaga
                      Pig  ttctttccataaatgatcatttctacaaaat-gactgccc--c--ttt-----gaa-gcactgtgttaga
                  Dolphin  ttagttctaccaatgatcgtttctacaaaat-gattgccc--c--ttt-----gaa-gcactgtatcaga
                      Cow  ttatttctaccaatgatctttcct-caaaat-gattgccctgc--ttt-----gaa-gctcagtatcaga
                    Sheep  ttatttctacaaatgatctttcct-caaaat-gattgccctgc--ttt-----gaa-gctcagtatcaga
                    Horse  ttat-------------------------at-gatcaccc--c--gtg-----gaa-gcactgtgtcaga
         Chinese pangolin  ttatttctataaatgaacagttctacaaaat-gactgccc--c--taa-----gaa-gcac--ggtcaga
                      Dog  ttatttctagaagtgatcatttctacaaaat-gattgccc--t--ttca----aaa-gcactgtgtcaga
       Hawaiian monk seal  ttatttctataagtgatcaattttac-aaat-gatcattt--c--tacaaatcaaa-gcactgtgtcaga
                 Hedgehog  ttagagtacaaaataatgatttctacaaaat-catgacca--ccatcc-----tgt-g------------
                    Shrew  ttattttttcaaatgatcctttctacaaaag-gattttca--t--ttc-----tga-g------------
                 Elephant  --ctttgta----------------taaaat-gatcatcc--t--gtt-----gaa-gcaccgtgtcaga
                   Tenrec  --ctttcta----------------cacagt-ggccatct--t--ttc-----tga-gcacagtgtcaga
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ggg-------------aag---------------tg-tgt-aaaaccaag-tataaacggcactgtc-ac
                      Rat  tgg-------------gag---------------tg-tat-aaaatcaag-tataaaagacactgtc-aa
            GCF_003668045  tag-------------aag---------------tg-ttt-aaaatcaag-tttaaacgacaccctg-aa
                   Beaver  -ag-------------aag---------------tg-ttt-aaaatcaagatatagatg-cgttgtc-aa
                 Squirrel  tgg-------------aag---------------tg-ttt-aaaattaag-ctatggtggctttgtc-aa
               Guinea pig  tga-------------aag---------------tg-ttt-aaaatcaaa-tc---atagttttgtc-aa
                   Rabbit  tgg-------------aag---------------tg-ttt-aaaaccaagttttaagtgccttggtc-ac
                     Pika  tggaaggaagtgcttaaag---------------tg-ttt-aaaaccagattataagggacttcctc-ac
                    Human  tgg-------------aag---------------tg-ttt-aaaatcaag-ttacaatggctttgcc-aa
                    Chimp  tga-------------aag---------------tg-ttt-aaaattaag-ttacaatggctttgcc-aa
                   Bonobo  tgg-------------aag---------------tg-ttt-aaaattaag-ttacaatggctttgcc-aa
                  Gorilla  tgg-------------aag---------------tg-ttt-aaaatcaag-ttacaatggctttgcc-aa
                   Rhesus  tgg-------------acg---------------tg-ttt-aaaatcaag-ttacaatggctttgcc-aa
                 Marmoset  tgg-------------aag---------------tg-ttt-aaaatcaag-ttacaatggctttgtc-aa
                  Tarsier  tgg-------------aagctagctatagtgacttg-tta-aaaattaag-ctatagtggctttgtc-aa
                 Bushbaby  tgg-------------aag---------------tg-ttt-aaaatcaag-ttacagtggctttgtc-aa
               Tree shrew  tgg-------------aag---------------tg-ttt--aaatccag-ttataatggctttatc-aa
     Malayan flying lemur  tgg-------------aag---------------tg-tttaaaaatcaag-ttatagtggctttgtc-aa
                      Pig  tgg-------------aag---------------ta-ttt-aaaatcaag-ttgtactagctttgtc-aa
                  Dolphin  tgg-------------aag---------------ta-ttt-aaaatcaag-ttgtagtagttttgtc-aa
                      Cow  tgg-------------aag---------------tgtttt-aagatc--g-tagtagtagctttgtc-aa
                    Sheep  tgg-------------aag---------------tg-ttt-aagatc--g-tagtagtagctttgtc-aa
                    Horse  tgc-------------aaa---------------tg-ttt-aaaatcaag-ttgtagtggctttgtc-aa
         Chinese pangolin  tgg-------------aag---------------ta-ttt-ataatcaag-ttgtagaggctttgta-aa
                      Dog  tgg-------------aag---------------ta-ttt-aaactcaag-ttgtggtggctttgtc-aa
       Hawaiian monk seal  tgg-------------aag---------------ta-ttt-aaaatcagg-ttgtagtggctttgtcaaa
                 Hedgehog  ----------------aag---------------tg-cat-ccaatcagg-ttgtagcagcgttgtc-aa
                    Shrew  ----------------ga-------------------------aatcaag-ttatagtggctttgtc-aa
                 Elephant  tgg-------------aag---------------ta-ttt-aaaatcaag-ttccagtggctttgtc-aa
                   Tenrec  tgg-------------aga---------------ta-ttt--aaatcagg-ttgccgaggcttggtc-aa
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ac-----------ttctatgcgcggagtcca-----gaag-cagaactagat-gaa----tgtag-----
                      Rat  ac-----------ttctatacatggggccca-----gaag-cagaattagat-gca----tgcaa-----
            GCF_003668045  ac------------tctatacacaggaccaa-----ggag-caaaa-tatat-aca----tgtag-----
                   Beaver  ac-----------ttccacccgtacaaccca-----gaaa-caaaaatatatcgtt----ttcag-----
                 Squirrel  ac----gtcactcttcaatccctagctccaaaataggaaa-caaaaagacatcact----tgtgg-----
               Guinea pig  at----gtggtccttctgcccataggacctg-----gaga-taataatatattgtg----tctag-----
                   Rabbit  ac----ttcactccttcatccgtaggactca-----aaga-cgaaaatatattg----------------
                     Pika  at----ttcactccttcatctatagtaccca-----aaga-tgcgaatacatt-----------------
                    Human  ac------cactcctccacccataggaccca-----aaga-caaacatacattgtt----tgtag-----
                    Chimp  ac------cactcctccacccataggaccca-----aaga-caaacatacattgtt----tgtag-----
                   Bonobo  ac------cactcctccacccataggaccca-----aaga-caaacatacattgtt----tgtag-----
                  Gorilla  ac------cactcctccacccataggaccca-----aaga-caaacatacattgtt----tgtag-----
                   Rhesus  ac----ttcgctcctccatccataggaccca-----aaga-caaacatacattgtt----tgtag-----
                 Marmoset  ac----ttccatcctccacccataggaccca-----aaga-caaaaatacattgtt----tgtag-----
                  Tarsier  ac----ttcgctcctccacccatgggaccct-----aaaa-tgaaaatatattgct----tgtag-----
                 Bushbaby  ac----tttgctcctccacccaaagtaccca-----aaga-taaaaacatcatcttcaaatgtct-----
               Tree shrew  ac------cactcctccacccgtagacccca-----tgga-cacaaatgcatttct----tggag-----
     Malayan flying lemur  ac----tttgttcctccagtcattggaccca-----aaga-taaaaatacattgtt----cataa-----
                      Pig  ac----ttcggttctc-acccacaggttcca-----aaga-caa------actgct----catag-----
                  Dolphin  acttcattcagtcctctacccatgggtccca-----aaga-cca------actgct----catag-----
                      Cow  ac----ttcagtcgtccacccatgggtccca-----aaga-caa------actgct----cctag-----
                    Sheep  ac----ttccgtcctccacccatgggtccca-----aaga-caa------actgct----cctag-----
                    Horse  at----ttaggtcctacacccataggtccca-----aaga-caaaaacacattgct----tccag-----
         Chinese pangolin  ac----attggtcctccacccataggtccca-----aaga-caaaaatacattgct----caaac-----
                      Dog  ac----ttcagtcctccacccataggtccca-----aaga-caaaaacacattgct----catag-----
       Hawaiian monk seal  ac----ttcagtcctccacctataggttcca-----aaga-caaaaacatattgct----catag-----
                 Hedgehog  at----tttgttccttcatccctagagccca-----caga-gaaaaacaaattgct----gatag-----
                    Shrew  a------ttgcttctccacctatagaaccca-----caaattcaaaacaaactgct----gactg-----
                 Elephant  ac----ttcgctcctttacccacaggtacca-----ggca-caaaaatacattcct----tgtaatcttc
                   Tenrec  ac----ttgagtcctccatccataggtgcca-----aaca-caaaaatacattcct----ggtag-----
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  --------tc------------ttcaaa------------------------------------------
                      Rat  --------tc------------ttcaaa------------------------------------------
            GCF_003668045  --------tc------------ttcaaa------------------------------------------
                   Beaver  --------tc------------ttcaaa------------------------------------------
                 Squirrel  --------tc------------t--aag------------------------------------------
               Guinea pig  --------tc------------ttcaaa------------------------------------------
                   Rabbit  ---------c------------ttcaaa------------------------------------------
                     Pika  ----------------------------------------------------------------------
                    Human  --------cc------------ttcaca------------------------------------------
                    Chimp  --------cc------------ttcaca------------------------------------------
                   Bonobo  --------cc------------ttcaca------------------------------------------
                  Gorilla  --------cc------------ttcaca------------------------------------------
                   Rhesus  --------cc------------ttcaca------------------------------------------
                 Marmoset  --------cc------------ttcacc------------------------------------------
                  Tarsier  --------cc------------ttcaaa------------------------------------------
                 Bushbaby  --------cctctttgaaattattcaaa------------------------------------------
               Tree shrew  --------cc------------ttcaaa------------------------------------------
     Malayan flying lemur  --------tc------------ttcaaa------------------------------------------
                      Pig  --------tc------------ttcaaa------------------------------------------
                  Dolphin  --------tt------------ttcaaa------------------------------------------
                      Cow  --------tt------------ttcaaa------------------------------------------
                    Sheep  --------tt------------ttcaaa------------------------------------------
                    Horse  --------tc------------tttaag------------------------------------------
         Chinese pangolin  --------tc------------tttaaa------------------------------------------
                      Dog  --------tc------------ttcaaa------------------------------------------
       Hawaiian monk seal  --------tc------------ttcaaa------------------------------------------
                 Hedgehog  --------tt------------ttcata------------------------------------------
                    Shrew  --------tt------------ttcaga------------------------------------------
                 Elephant  aaataccttc------------tttgaaattacacttggtcacaaaaaagatgccaatgattcaaaactt
                   Tenrec  --------cc------------tttaaaattacacctgatc-----------------------------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -----------------------------------------------------tatct--ttt---tt--
                      Rat  -----------------------------------------------------tatct--ttt---ttc-
            GCF_003668045  -----------------------------------------------------tactt--ttc---tt--
                   Beaver  -----------------------------------------------------tattt--cct---cttt
                 Squirrel  -----------------------------------------------------tatct--cct---tt--
               Guinea pig  -----------------------------------------------------tattt--cct---tttt
                   Rabbit  -----------------------------------------------------tacct--cct---cttt
                     Pika  ----------------------------------------------------------------------
                    Human  -----------------------------------------------------tatct--ctt---t---
                    Chimp  -----------------------------------------------------tatct--ctt---t---
                   Bonobo  -----------------------------------------------------tatct--ctt---t---
                  Gorilla  -----------------------------------------------------tatct--ctt---t---
                   Rhesus  -----------------------------------------------------tatct--ctt---t---
                 Marmoset  -----------------------------------------------------aatct--ctt---t---
                  Tarsier  -----------------------------------------------------tagct--cct---tttg
                 Bushbaby  -----------------------------------------------------tatct--cctctat---
               Tree shrew  -----------------------------------------------------tatcc--cctcttt---
     Malayan flying lemur  -----------------------------------------------------tatct--cttcttt---
                      Pig  -----------------------------------------------------tatcc--tct---cttt
                  Dolphin  -----------------------------------------------------tatct--tct---cttt
                      Cow  -----------------------------------------------------tatct--tct---cttt
                    Sheep  -----------------------------------------------------tatct--ttt---cttt
                    Horse  -----------------------------------------------------tatct--tcc---tttt
         Chinese pangolin  -----------------------------------------------------tatct--tct---cttt
                      Dog  -----------------------------------------------------tatct--ttt---cttt
       Hawaiian monk seal  -----------------------------------------------------tatct--ttt---cttt
                 Hedgehog  ------------------------------------------------------acctctctt---ctct
                    Shrew  -----------------------------------------------------tatcttattt---ttta
                 Elephant  cgctcctttacccacaggtaccaggcacaaaaatacattccttgtagtcttcaaatac--ctt---cttt
                   Tenrec  -------------------------------------tctctctctctctctctctct--ctc---tctc
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ----------------------------------------------ccaatatg-----cataactg-ta
                      Rat  ---------------------------------------------ccccatatg-----ca-aactg-ta
            GCF_003668045  -----------------------------------------------cagtatg-----catgactg-ta
                   Beaver  aa----a-----attatacttggtcac-ttaaagtt-gccagtgattcaacatg-----cacaacta-ta
                 Squirrel  aa----a-----attttatttggtcac-ttaaagat-gccactaattcaatatg-----cacaacaa-tc
               Guinea pig  aa----a-----attacacttggtcac-ttaaagaa-g--------tcagtg-----------------a
                   Rabbit  ga----aattacact----ttagtcac-ttaaagat-gccaatgatttaatatg-----gacaactc-tg
                     Pika  -------------------------------cgaat-gccagtgatcccatatg-----gactattcggg
                    Human  ga----a-----actatacctggtcac-tgaaaaat-gccaataattcaatatt-----ctcaaccc-ca
                    Chimp  ga----a-----actatacctggtcac-tgaaaaac-gccaataattcaatatt-----ctcaaccc-ca
                   Bonobo  ga----a-----actatacctggtcac-tgaaaaac-gccaataattcaatatt-----ctcaaccc-ca
                  Gorilla  ga----a-----actatacctggtcac-tgaaaaac-gccaataattcaatatt-----ctcaaccc-ca
                   Rhesus  ga----a-----actacacctggacac-cgaaaaat-gccaataattcaatatg-----cacaaccc-ta
                 Marmoset  gaaacta-----actatacctggtcac-tgaaaaat-ggcaatgattcaatatg-----cacaactc-ca
                  Tarsier  ga----a-----attatacctgggcac-tgaaaaat-gtcagtgactcagtatg-----cacaaacc-ta
                 Bushbaby  ga----a-----attactcctggccac-tgaaaaac-accagtgattcaatatg-----cacaaccc-ca
               Tree shrew  aa----a-----attacact-ggtttc-tttaaaat-accaatgattcaatatg-----cacaaccc-tg
     Malayan flying lemur  aa----a-----attacacc--ttcac-ttagagatggcaaaggattcaatatgcacaacacaacca-ta
                      Pig  ta----a-----aatgtacttgctcac-ttaaagat-gccaatgattcagtatg-----catacttt-ta
                  Dolphin  aa----a-----attctacttgctcac-ttaaagat-gccagtgattcaatatg-----tacacctc-ta
                      Cow  aa----a-----attgtacttgctcac-ttaaagat-gccgatgattcaacatg-----cacacctc-tt
                    Sheep  aa----a-----attgtacttgctcac-ttaaaggt-gccgatgatttaacatg-----cacacctc-tt
                    Horse  aa----a-----atggcactttgtcac-ttaaagac-gccagtgattcaatatg-----cacaaccc-ta
         Chinese pangolin  aa----a-----attgcacttggtcac-ttaaagat-gccagtgattccatatg-----cacactcc-ta
                      Dog  aa----a-----actgcacttagtcat-ttaaggat-ggcagtgattcaagagg-----cacacttc-ta
       Hawaiian monk seal  aa----a-----actgcactaagtcat-ttaaagat-ggcagtgattcaatagg-----cacacttc-ta
                 Hedgehog  aa----a-----actgtacttgattac-taagagat-gcaagcaattcactata-----cacaaccc-ta
                    Shrew  aa----a-----attgcacttggttat-tta-agat-gacagtgatttgatatg-----cacaacta-ta
                 Elephant  aa----a-----attacacttggtcacaaaaaagat-gccaatgattcaatatc-----cacaaccc-tc
                   Tenrec  ac----a-----cacacac---------acacacac-cccaatgatccaatatg-----cacaaact-tc
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gatattattattattattt---------------------ggtctgtatttccttt--aagaacagagag
                      Rat  gatgttatgaaaatctttt-------aggg--------ggggtctgtatctccttt--aagaacagaaag
            GCF_003668045  gatactgtgacaatcaccttact-ctagaagt-t-tttgttgtttgtatctccttt--gagaacagaaaa
                   Beaver  ggtattgtggtaattaccttaca-ctatataa-t-tt---tctttgtgcttccttc--aagaacagaaag
                 Squirrel  gatattgtggtaatcaccttaca-ctatataa-t-tt---tctttgcatctccatc--aagaaataaaag
               Guinea pig  tttggtatgtacaacatactgta-ctatgtag-g-tt---tccttacatctccagc--aagaaaagaaaa
                   Rabbit  tgtacagtagtaatcaccttata-acacataa-t-tt---tctttgcttttctatc--aagaacagagag
                     Pika  tgcgctgtagccagtaccttata-aggcataa-t-tt---gcttcacttgtctgtc--aagaatagaggg
                    Human  ggtattatagtaattactttaca-ccatacaa-t-tt---tctttgcatctccacc--aagaacagaaag
                    Chimp  ggtattatagtaattactttaca-ccatacaa-t-tt---tctttgcatctccacc--aagaacagaaag
                   Bonobo  ggtattatagtaattactttaca-ccatacaa-t-tt---tctttgcatctccacc--aagaacagaaag
                  Gorilla  ggtattatagtaattactttaca-ccatacaa-t-tt---tctttgcatctccacc--aagaacagaaag
                   Rhesus  ggtattatagtaattattttaca-ccatacaatt-tt---tctttgcatctccacc--aagaacagaaag
                 Marmoset  agtatcatagtaa-----ttaca-ccatacaa-t-tt---tctttgcatctccaac--aagaacagaaag
                  Tarsier  cgtattctagtaatctgtgtaca-ccatgcaa-t-tt---tctttgcatcttcatc--aagttcaggaag
                 Bushbaby  agtactgtggtaatcacttgaca-ccatataa-t-tt---tctttccatcttcatt--aagaagagaaag
               Tree shrew  tatattgcggtaatcaccccaca-ccatataa-t-tt---tctttgtgtctttatg--aagaacagaaag
     Malayan flying lemur  ggtgttgtggtaatcaccttaca-ccacagaa-t-tt---tctttgcatctctgtc--aagaacagaaag
                      Pig  ggta--------atcagtttaca-caatataa-t-tg---tctttgcatctctgct--aagaacataaag
                  Dolphin  ggtatcgtggtaatcagtttacgcccgtataa-t-tt---tctttgcatctctatt--aaaaacataaag
                      Cow  ggtattgtggtaatcggtttaca-tcatataa-t-tt---tctttgcgtctctata--aagagaataaag
                    Sheep  ggtattgtggtgatcggtttaca-tcatataa-t-tt---tctttgcggctctata--aagagcataaag
                    Horse  agtattgtggtaatcactttaca-ccatataa-t-tt---tcttcgcatctctgtt--aagaacataaag
         Chinese pangolin  ggtattgtggtaatcagtttaca-ccctataa-t-tt---tctttgcaactctatt--aagaacataaag
                      Dog  ggtattgtggtcatcagtttaca-acatataa-t-tt---tctttatatctctattaaaaaaacataaag
       Hawaiian monk seal  ggtattgtggtaatcagtttaca-gcatataa-t-tc---tctttgtatctctatt--aagaacataaag
                 Hedgehog  ggcattgtggtaagcagtttaca-ctgtataa-c-tg---ccttttcatttgtgtt--aggaatggaaag
                    Shrew  tgtattgtggtaatcgatatgca-tcataaaa-agtt---tctttgcatct-tatt--aaggacaataag
                 Elephant  agtattgtaataatcagtttaca-ccatataa-t-tt---tctttgcatctccatt--aagaacagaaag
                   Tenrec  agcattgtggtaattatttcaca-ccatataa-t-tt---tctttgcatctcc-tt--aagaactgaaag
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tttggcagatggctt-ggct----ttgct-cttttt-tttttaaatgttaaattctactttcattttctt
                      Rat  attggtaga-----t-ggtt----ttgct-cccttt-ctt---aacgttaaattctactttcattttctt
            GCF_003668045  ataggcaca-----t-ggtt----tcatc-cctttt-ctt---aa-attgaattttactttca-------
                   Beaver  ggtaagtta-----t-gact----ttact-cctttc-ctt---aacactgaattctactttcattttctt
                 Squirrel  ggtaactgg-----t-ggct----tcccc-cctttt-ctt---aatacttgattctactttcattt----
               Guinea pig  ggtaac--------t-gttt----taact-cctttt-ctt---aacacttaattttacttccattttctt
                   Rabbit  gataaccta-----t-ggct----ttctt-cccttc-ctt---aacatttaattctactttcgttttgtt
                     Pika  gataactga-----t-ggct----ttgtt-ccattt-c----------ttatttctactttcgttttctt
                    Human  aataactga-----t-ggca----ttaca-c------ctt---aacacttaattttactttcattttctt
                    Chimp  aataactga-----t-ggca----ttaca-c------ctt---aacacctaattttactttcattttctt
                   Bonobo  aataactga-----t-ggca----ttaca-c------ctt---aacacctaattttactttcattttctt
                  Gorilla  aataactga-----t-ggca----ttaca-c------ctt---aacacttaattttactttcattttctt
                   Rhesus  aataacaga-----a-agaa----aaaaa-t--------------aacttaattttactttcattttctt
                 Marmoset  aataactga-----t-gaca----ttaca-c------ctt---aacacttaattctactttcattttctt
                  Tarsier  aataactca-----t-ggta----tcaca-c------tgt---aacacttaattctactttcattttctt
                 Bushbaby  ggcaactga-----t-ttct----ttact-cctttt-ctt---aacacttcattctactttcattttctt
               Tree shrew  ggtaactga-----tgggtt----ttact-cctttt-ctt---aatgcttaattccactttcattttctt
     Malayan flying lemur  gataagtga-----t-ggct----ttgct-cctttt-ctt---aacacttaattctactttcattttctt
                      Pig  gagagctga-----t-ggct----ttact-tcttttccaa---aatacgtaattctactatcattttctt
                  Dolphin  gatagctga-----c-ggct----ttact-tcttttccaa---aatactta----tactttaattatcct
                      Cow  gatagttga-----c-agct----ttagc-tcttttccaa---aacacttaattccactttaattttcct
                    Sheep  catagttga-----c-agct----ttacc-tcttttccaa---aacacttaattcctctttaattttcct
                    Horse  gataactga-----t-gattttacttact-cctgtttcaa---aacacttaatcctactttcattttctt
         Chinese pangolin  g-taact-a-----t-ggct----ttaca-ccttttttag---cacacttaattctactttcattttctt
                      Dog  gataactga-----c-agct----ttact-cctttttcaa---aacccttaattctaccttcattttctt
       Hawaiian monk seal  gataaatga-----c-agcg----ttactccctttttaaa---aacacttaattctgccttcatttcctt
                 Hedgehog  aataacgga-----c-gatt----ttact-cctttttcaa---aacacttgattctac-----tcctctt
                    Shrew  gaaa----a-----t-tatt----ttact-cctttttcaa---aacaattaatttga-------------
                 Elephant  gataactga-----t-ggct----tgact-cctttt-tta---aacacttaatagtattttctgtttctt
                   Tenrec  ttcaactaa-----t-ggc-------------------ca---aacacttcactctacttgcactggttt
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  aaca-ttttatttca
                      Rat  taca-ctttatttca
            GCF_003668045  ---------------
                   Beaver  aacc-tcttatttca
                 Squirrel  -------ttatttca
               Guinea pig  aaca-ttttatttaa
                   Rabbit  aacc-ttgtattcaa
                     Pika  aacc-tttttttc--
                    Human  aacc-t---atttca
                    Chimp  aacc-t---atttca
                   Bonobo  aacc-t---atttca
                  Gorilla  aacc-t---atttca
                   Rhesus  aacc-t---atttca
                 Marmoset  aacc-g---atttca
                  Tarsier  aagc-gttaatttca
                 Bushbaby  aacc-ttttatttca
               Tree shrew  aaca-ttttatttca
     Malayan flying lemur  aacc-ttttattcca
                      Pig  accc-ttttattgca
                  Dolphin  aacc-ttttgtttca
                      Cow  aacc-ttttgtttca
                    Sheep  aacc-ttttgtttca
                    Horse  aatc-gtctgtttca
         Chinese pangolin  aacctttttatttca
                      Dog  aac--ttttatttca
       Hawaiian monk seal  aact-ttttatttca
                 Hedgehog  agcg-tttca-----
                    Shrew  ---------------
                 Elephant  aacc-ttttatttct
                   Tenrec  gcac-ttttattttc
                Zebrafish  ===============
            X. tropicalis  ===============
                  Opossum  ===============
                  Chicken  ===============

Inserts between block 2 and 3 in window
B D                Shrew 63bp

Alignment block 3 of 393 in window, 56745986 - 56746020, 35 bps 
B D                 Mouse  ttttttctttctga------------------------------------tgtttta----aaaaaa-a-
B D                   Rat  ttttctctatctga------------------------------------tgcctaa----aaaaaaga-
            GCF_003668045  ---tctctttctga------------------------------------tacttaa----aaac---a-
                   Beaver  ttttttctgcctta------------------------------------tacttga----aaaag--c-
B D              Squirrel  ttttctctt----a------------------------------------tacttaa----aaaaa--a-
B D            Guinea pig  ttttctcttccttg------------------------------------tccttaa----aaaaaa-a-
B D                Rabbit  ttc-----------------------------------------------tttttaa----a------a-
B D                  Pika  ---------------------------------------------------ccttta----a------a-
B D                 Human  ttttctctttcttg----------------------------tatatacatttttta----aa-----c-
B D                 Chimp  ttttctctttcttg----------------------------tatatatatatttta----aa-----c-
B D                Bonobo  ttttctctttcttg----------------------------tatatatatttttta----aa-----c-
B D               Gorilla  ttttctctttcttg----------------------------tatatatatatttta----aa-----c-
B D                Rhesus  ttttctctttcttg----------------------------tatatacatatttga----aa-----ct
B D              Marmoset  ttttctctttcttgtatatatatatatacaaatatatatatatatatatatatttaa----aa-----c-
B D               Tarsier  ttttctctttttcg----------------------------tatgcat-ttttaaa----ag-----c-
B D              Bushbaby  ttttctctgtcttg----------------------------tatatg--tttttaa----aa-----c-
B D            Tree shrew  catt---tttcttg----------------------------tat-----taaaaaaaaagaa-----t-
B D  Malayan flying lemur  ctttctctttcttg----------------------------tgt-----tttttaa----aa-----c-
B D                   Pig  ----------------------------------------------------------------------
B D               Dolphin  ----------------------------------------------------------------------
B D                   Cow  ----------------------------------------------------------------------
B D                 Sheep  ----------------------------------------------------------------------
B D                 Horse  ----------------------------------------------------------------------
B D      Chinese pangolin  ----------------------------------------------------------------------
B D                   Dog  ----------------------------------------------------------------------
B D    Hawaiian monk seal  ----------------------------------------------------------------------
B D              Hedgehog  ----------------------------------------------------------------------
B D              Elephant  ---------------------------------------------------------------------t
B D                Tenrec  ---------------------------------------------------------------------t
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D                 Shrew  ======================================================================

                    Mouse  ----------ccattct-----------------------------------
                      Rat  ----------acattct-----------------------------------
            GCF_003668045  ----------cctttct-----------------------------------
                   Beaver  ----------cccatct-----------------------------------
                 Squirrel  ----------acactgt-----------------------------------
               Guinea pig  ----------catctcc-----------------------------------
                   Rabbit  ----------accctct-----------------------------------
                     Pika  ----------tccctct-----------------------------------
                    Human  ----------tctttca-----------------------------------
                    Chimp  ----------tctttca-----------------------------------
                   Bonobo  ----------tctttca-----------------------------------
                  Gorilla  ----------tctttca-----------------------------------
                   Rhesus  ----------tttttca-----------------------------------
                 Marmoset  ----------tctttta-----------------------------------
                  Tarsier  ----------cctgtct-----------------------------------
                 Bushbaby  ----------tctt--------------------------------------
               Tree shrew  ----------gacctct-----------------------------------
     Malayan flying lemur  ----------cctttct-----------------------------------
                      Pig  -------------ttga-----------------------------------
                  Dolphin  -------------ttga-----------------------------------
                      Cow  -------------ttga-----------------------------------
                    Sheep  -------------ttga-----------------------------------
                    Horse  -------------ttaa-----------------------------------
         Chinese pangolin  -------------ctaa-----------------------------------
                      Dog  -------------ttaa-----------------------------------
       Hawaiian monk seal  -------------ttaa-----------------------------------
                 Hedgehog  ------------cttaa-----------------------------------
                 Elephant  gta----------ttaaaaaaaaaaaaa--------------------ccct
                   Tenrec  atatgtgtcggatttgaaaacagcagaagcagtagcaacaaaacccttctct
                Zebrafish  ====================================================
            X. tropicalis  ====================================================
                  Opossum  ====================================================
                  Chicken  ====================================================
                    Shrew  ====================================================

Inserts between block 3 and 4 in window
B D                 Pika 4bp
B D                  Pig 10bp
B D              Dolphin 10bp
B D                  Cow 10bp
B D                Sheep 10bp
B D                Horse 24bp
B D     Chinese pangolin 13bp
B D                  Dog 20bp
B D   Hawaiian monk seal 20bp
B D             Hedgehog 7bp

Alignment block 4 of 393 in window, 56746021 - 56746056, 36 bps 
B D                 Mouse  t--tata-attctacc----attaa-----c----aatta-cggtat-------ttccag
B D                   Rat  t--taca-attccacc----gttga-----c----aatcg-cggtat-------ttccag
            GCF_003668045  t--tttt-atttattt----attag--ttct----agtca-gggaacaagcttgtttcac
                   Beaver  c--tatg-actctgcc----acttgactggc----actta-tggtat-------ttacaa
B D              Squirrel  c--tata-tttctgcc----actgg-----c----actaa-tgctat-------ttacag
B D            Guinea pig  a--taag-accctgcc----attgc-----c----gctca-tggtat-------tcacag
B D                Rabbit  a--taaa-ccccattcct--actga-----t----acttg-tggcat-------tcacag
B D                  Pika  g--taaa-tcccactcctgaactg------t----acttg-tggcat-------tcagag
B D                 Human  g--gaaa-accctgcc----actaa-----c----accca-tggcat-------gtatag
B D                 Chimp  g--gaaa-accctgcc----actaa-----c----accca-tggcat-------gtatag
B D                Bonobo  g--gaaa-accctgcc----actaa-----c----accca-tggcat-------gtatag
B D               Gorilla  g--gaaa-accctgcc----actaa-----c----accca-tggcat-------atatag
B D                Rhesus  g--gaaa-accctgcc----actaa-----c----accca-tggcat-------gtatag
B D              Marmoset  g--gata-accctgcc----actga-----c----accca-tgacat-------gtagag
B D               Tarsier  c--tata-accctgcc----actga-----c----accca-tggcat-------gaataa
B D              Bushbaby  ---aaca-accctgcc----agt----------------a-tggaat-------acatag
B D            Tree shrew  c--tcta-accctgcc----actgc-----t----actgg-aggcgt-------ttatag
B D  Malayan flying lemur  t--tata-atcctgct----attga-----c----attcg-tggcat-------ttatag
B D                   Pig  ctatata-acctcatc----actaa-----c----actgg-tggcat-------ttacag
B D               Dolphin  c--tata-accttacc----tctga-----c----actgg-tggcat-------ttacag
B D                   Cow  c--tatg-accttacc----tctga-----c----actgg-tggcac-------ttacag
B D                 Sheep  c--tatg-accttacc----tctga-----c----actgg-tggcac-------ttacag
B D                 Horse  c--tcta-accttacc----actga-----c----atagg-tggcat-------ttacag
B D      Chinese pangolin  c--tctatacctcact----accaa-----c----actgg-aggtat-------ttacag
B D                   Dog  c--taca-accttgcc----actga-----c----actggttggcat-------ttactg
B D    Hawaiian monk seal  t--tata-accttacc----actga-----c----gctgg-tggcat-------ttacag
B D              Hedgehog  t--cata-acttcaca----agtga-----tactcattca-cggcat-------ttt---
B D                 Shrew  t--tagc-cttttacc----catga-----t----cttta-tggcat-------tct-ac
B D              Elephant  c--tgta-tccctgcc----actgc-----c----atttg-tggggt-------ttag--
B D                Tenrec  c--ttta-accctgcc----actgc-----t----gttgt-tgcggg-------gcag--
B D             Zebrafish  ============================================================
B D         X. tropicalis  ============================================================
B D               Opossum  ============================================================
B D               Chicken  ============================================================

Inserts between block 4 and 5 in window
B D           Guinea pig 43bp
B D               Rabbit 12bp
B D                 Pika 12bp
B D                  Pig 1bp
B D              Dolphin 1bp
B D                  Cow 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp
B D             Hedgehog 1bp
B D                Shrew 1bp

Alignment block 5 of 393 in window, 56746057 - 56746067, 11 bps 
B D                 Mouse  aatta---------------ctat----tt
B D                   Rat  acttag--------------ttat----tt
            GCF_003668045  atgtaa--------------gtcc----ct
                   Beaver  tagcag--------------ttacaggatt
B D              Squirrel  tgtcagcgacaga-----atttat----tt
B D                Rabbit  ------------attttttttttt----tt
B D                  Pika  ------------g-----attgtt----tc
B D                 Human  -----------------tggtaat----t-
B D                 Chimp  -----------------tggtaat----t-
B D                Bonobo  -----------------tggtaat----t-
B D               Gorilla  -----------------tggtaat----t-
B D                Rhesus  -----------------tggcaat----t-
B D              Marmoset  -----------------tggtaat----t-
B D               Tarsier  -----------------tggtcac----t-
B D              Bushbaby  -----------------tgttaat----t-
B D            Tree shrew  -----------------tggtaat----t-
B D  Malayan flying lemur  -----------------tggtaat----t-
B D                   Pig  ------------------ggtaat----t-
B D               Dolphin  ------------------gataac----t-
B D                   Cow  ------------------ggtaac----t-
B D                 Sheep  ------------------ggtaat----t-
B D                 Horse  ------------------ggtaac----t-
B D      Chinese pangolin  ------------------ggtaac----t-
B D                   Dog  ------------------ggtaac----t-
B D    Hawaiian monk seal  ------------------ggtaat----t-
B D              Hedgehog  ------------------gggtgt------
B D                 Shrew  ------------------ggtaac------
B D              Elephant  ---------------agtggt---------
B D                Tenrec  ---------------agtggt---------
B D            Guinea pig  ==============================
B D             Zebrafish  ==============================
B D         X. tropicalis  ==============================
B D               Opossum  ==============================
B D               Chicken  ==============================

Inserts between block 5 and 6 in window
B D                Human 13bp
B D                Chimp 13bp
B D               Bonobo 13bp
B D              Gorilla 13bp
B D               Rhesus 14bp
B D             Marmoset 10bp
B D              Tarsier 13bp
B D             Bushbaby 14bp
B D           Tree shrew 41bp
B D Malayan flying lemur 14bp
B D                  Pig 2bp
B D              Dolphin 2bp
B D                  Cow 2bp
B D                Sheep 2bp
B D                Horse 2bp
B D     Chinese pangolin 2bp
B D                  Dog 2bp
B D   Hawaiian monk seal 2bp

Alignment block 6 of 393 in window, 56746068 - 56746087, 20 bps 
B D                 Mouse  aaaaaca------------------atatgcatataa---c
B D                   Rat  aaaaaga------------------ataggcatatac---c
            GCF_003668045  aaaaacacctttctttagctgacccattaacattcac---g
                   Beaver  aaaaaaa---------------ataatgtgcacataa---c
B D              Squirrel  ctgagtc------------------atacacatataa---c
B D                Rabbit  ttgagtc------------------agaggcacaaaa---c
B D                  Pika  aaaagtc------------------agaggtgcataa---c
B D                 Human  ttaagtc------------------atatgcacatat---c
B D                 Chimp  ttaagtc------------------atatgcacatat---c
B D                Bonobo  ttaagtc------------------atatgtacatat---c
B D               Gorilla  ttaagtc------------------atatgcacatat---c
B D                Rhesus  ttaagtc------------------atatgcacatat---c
B D              Marmoset  ---agtc------------------atatgcacttat---c
B D               Tarsier  tt--gtc------------------acgtgcacatatcagc
B D              Bushbaby  ttgaatc------------------atatgtaggtga---c
B D  Malayan flying lemur  ttgagtc------------------atacgcatattt---a
B D                   Pig  ----------------------------agtatttat---t
B D               Dolphin  ----------------------------agtatttat---t
B D                   Cow  ----------------------------actatttgt---t
B D                 Sheep  ----------------------------actgtttgt---t
B D                 Horse  ----------------------------agtatttgt---t
B D      Chinese pangolin  ----------------------------catatttat---t
B D                   Dog  ----------------------------agtctttat---t
B D    Hawaiian monk seal  ----------------------------agtatttac---t
B D              Hedgehog  ------------------------------tacttat---t
B D                 Shrew  ------------------------------tatttat---c
B D              Elephant  ------------------aattgtaaaatttattt------
B D                Tenrec  ------------------ggcggtgaaatgcattt------
B D            Guinea pig  =========================================
B D            Tree shrew  =========================================
B D             Zebrafish  =========================================
B D         X. tropicalis  =========================================
B D               Opossum  =========================================
B D               Chicken  =========================================

Inserts between block 6 and 7 in window
B D                  Pig 29bp
B D              Dolphin 998bp
B D                  Cow 1bp
B D                Sheep 2bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp
B D             Hedgehog 1bp
B D                Shrew 1bp

Alignment block 7 of 393 in window, 56746088 - 56746103, 16 bps 
B D                 Mouse  tctaaattatatgcat------
B D                   Rat  ctta------------------
            GCF_003668045  gtttaattaaaaatat------
                   Beaver  cttc------------------
B D              Squirrel  ctca------------------
B D                Rabbit  caca------------------
B D                  Pika  cata------------------
B D                 Human  a---------------------
B D                 Chimp  a---------------------
B D                Bonobo  a---------------------
B D               Gorilla  a---------------------
B D                Rhesus  a---------------------
B D              Marmoset  a---------------------
B D               Tarsier  a---------------------
B D              Bushbaby  actg------------------
B D  Malayan flying lemur  a---------------------
B D                   Cow  -------ttgagtcat------
B D                 Sheep  -------ttgagtcat------
B D                 Horse  ------tttgagtcat------
B D      Chinese pangolin  ------tttgaatc--------
B D                   Dog  ------tttaagttat------
B D    Hawaiian monk seal  ------tttaagttat------
B D              Hedgehog  ------cttgagtcac------
B D                 Shrew  ------tttgagtcat------
B D              Elephant  ------tctgagttatatgcat
B D                Tenrec  ------tctaactcttatacac
B D            Guinea pig  ======================
B D            Tree shrew  ======================
B D             Zebrafish  ======================
B D         X. tropicalis  ======================
B D               Opossum  ======================
B D               Chicken  ======================
B D                   Pig  ======================
B D               Dolphin  ======================

Inserts between block 7 and 8 in window
B D             Elephant 114bp

Alignment block 8 of 393 in window, 56746104 - 56746122, 19 bps 
B D                 Mouse  atatataaatatgcat--ata
B D                   Rat  ------------------ctt
            GCF_003668045  gcatatagactta-----ctc
                   Beaver  ------------------cat
B D              Squirrel  ------------------tat
B D                Rabbit  ------------------cgg
B D                  Pika  ------------------caa
B D                 Human  ------------------cat
B D                 Chimp  ------------------cat
B D                Bonobo  ------------------cat
B D               Gorilla  ------------------cat
B D                Rhesus  ------------------cat
B D              Marmoset  ------------------cat
B D               Tarsier  ------------------cat
B D              Bushbaby  ------------------caa
B D  Malayan flying lemur  ------------------tgt
B D                   Cow  atgca-------------cat
B D                 Sheep  atgca-------------cat
B D                 Horse  atgca-------------cat
B D      Chinese pangolin  atgca-------------caa
B D                   Dog  gtgca-------------cat
B D    Hawaiian monk seal  atgca-------------cat
B D              Hedgehog  a--ca-------------cat
B D                 Shrew  atgca-------------cat
B D                Tenrec  --------acaaaccttacgt
B D            Guinea pig  =====================
B D            Tree shrew  =====================
B D             Zebrafish  =====================
B D         X. tropicalis  =====================
B D               Opossum  =====================
B D               Chicken  =====================
B D              Elephant  =====================
B D                   Pig  =====================
B D               Dolphin  =====================

Inserts between block 8 and 9 in window
B D                Human 5bp
B D                Chimp 5bp
B D               Bonobo 5bp
B D              Gorilla 5bp
B D               Rhesus 5bp
B D             Marmoset 5bp
B D              Tarsier 5bp
B D             Bushbaby 5bp
B D                  Cow 9bp
B D                Sheep 9bp
B D                Horse 10bp
B D     Chinese pangolin 10bp
B D                  Dog 10bp
B D   Hawaiian monk seal 10bp
B D             Hedgehog 10bp
B D                Shrew 10bp

Alignment block 9 of 393 in window, 56746123 - 56746137, 15 bps 
B D                 Mouse  atttagcaggcagag
B D                   Rat  atttagcaggcagtg
            GCF_003668045  atttagcaggcagag
                   Beaver  atttaatgcatagag
B D              Squirrel  atttaatgtgtacag
B D                Rabbit  atttagtgtgtggag
B D                  Pika  atttaatgtctaggg
B D                 Human  -----atgt------
B D                 Chimp  -----atgt------
B D                Bonobo  -----atgt------
B D               Gorilla  -----atgt------
B D                Rhesus  -----atgt------
B D              Marmoset  -----atgt------
B D               Tarsier  -----acgt------
B D              Bushbaby  -----aggc------
B D            Tree shrew  atttaatgt------
B D                   Pig  atttaatgtgcagag
B D                   Cow  atttaacgtgtagag
B D                 Sheep  atttaatgtgtagag
B D                 Horse  atttagtgtgtagag
B D      Chinese pangolin  atttaacatgtagac
B D                   Dog  atttaacgtgtagac
B D    Hawaiian monk seal  acttaatgtgtagac
B D              Hedgehog  atttaatacgtagag
B D                 Shrew  acttattgtatggag
B D                Tenrec  atttcgcgt------
B D            Guinea pig  ===============
B D             Zebrafish  ===============
B D         X. tropicalis  ===============
B D               Opossum  ===============
B D               Chicken  ===============
B D              Elephant  ===============
B D               Dolphin  ===============
B D  Malayan flying lemur  ---------------

Alignment block 10 of 393 in window, 56746138 - 56746170, 33 bps 
B D                 Mouse  gcagaagcagagaaagta-----------agga---agtcctgta----------gg
B D                   Rat  gc----------gatgta-----------gggt---agtcctgaa----------tc
            GCF_003668045  ------------aacgtagg---------gggg---ggtcccata----------ta
                   Beaver  atag--------catgca-----------gggt---agtttcatg----------ca
B D              Squirrel  agagc-------acagaa-----------gaat---agtcccttg----------ct
B D            Guinea pig  gtagaggcaaagcttgca-----------gagt---agacctagg----------ca
B D                Rabbit  ------------------agggagcatcagggt---agtcctatg----------ta
B D                 Human  gtagaggtagtgtatcaa-----------gggg---agccctatg----------ca
B D                 Chimp  gtagaggtagtgtatcaa-----------gggg---agccctatg----------ca
B D                Bonobo  gtagaggtagtgtatcaa-----------gggg---agccctatg----------ca
B D               Gorilla  gtagaggtagagtatcaa-----------gggg---agccctatg----------ca
B D                Rhesus  gtagaggtagagtatcaa-----------gggg---agccctatg----------ca
B D              Marmoset  gtagaggtagagtatcaa-----------gggg---agccctatg----------ca
B D               Tarsier  gtagccacagagaaccca-----------gggg---ggtcccttg----------ca
B D              Bushbaby  agagagctagggtaccca-----------ggct---aggc--agg----------ca
B D            Tree shrew  gctgagatacagcagcaa-----------gggc---agtcc----------------
B D  Malayan flying lemur  gtagagatagagcatcaa-----------gggt---cgtcctatg----------ca
B D                   Pig  ------atggagcatcaa-----------gggt---agtcacaca-cggtagacgca
B D                   Cow  ------atagagcgcgga-----------gggt---agt------------------
B D                 Sheep  ------atagagcacgaa-----------gggt---agtcaca------------ca
B D                 Horse  ------atagagcatcaa-----------gggtttgacccacacagtacac-----a
B D      Chinese pangolin  ------atagagcattaa-----------gggt---agtcacacattaaattatgaa
B D                   Dog  ------atagagcattaa-----------gggc---agtcacata-tgaattacgca
B D    Hawaiian monk seal  ------atagagcatcaa-----------aggt---agtcacata-taaattatgca
B D              Hedgehog  ------ctcaagtatcaa-----------gggt---agtcacaca-ggggttatgta
B D                 Shrew  ------ct--agtagcaa-----------gg--------------------tatgta
B D                Tenrec  -------------------------------------gtcctagg----------ct
B D                  Pika  ---------------------------------------------------------
B D             Zebrafish  =========================================================
B D         X. tropicalis  =========================================================
B D               Opossum  =========================================================
B D               Chicken  =========================================================
B D              Elephant  =========================================================
B D               Dolphin  =========================================================

Alignment block 11 of 393 in window, 56746171 - 56746227, 57 bps 
B D                 Mouse  cacacaacgtgg-gaatctatgtacttagattttgcatatgtattgtg-----ggcatcactt
B D                   Rat  catacaatgcgg-gaatctgtgtacttacattttgcataggtattgtg-----ggcatcgctc
            GCF_003668045  cacacaacgtgg-agatctgtgcatggatattttgcatgcgcattgtg-----ggcgtcattt
                   Beaver  cacagaaggtgg-aagtctatgtacagatactttgcatgtgtattgtg-----ggcatcattt
B D              Squirrel  caaacaagttgg-aaatct-------tgcattttgcatgtgtattgtg-----tgcatcattt
B D            Guinea pig  cacacaaggcag-agatccacgcatgtatattttgcacgtgtattgtg-----cacatcattt
B D                Rabbit  cacacaaggtgg-aaatctgtgcacatatattttgcatgtgtattgtg-----ggcatcgttt
B D                  Pika  -----------------------------attttgcacgcgcattgtg-----ggcatccttg
B D                 Human  cacacaaagcag-aaatctgtgcatgtatattttgcac-tgtatcgtg-----ggaataattt
B D                 Chimp  cacacaaagcag-aaatctgtgcatgtatattttgcac-tgtatcgtg-----ggaatagttt
B D                Bonobo  cacacaaagcag-aaatctgtgcatgtatattttgcac-tgtatcgtg-----ggaatagttt
B D               Gorilla  cacacaaagcag-aaatctgtgcatgtatattttgcac-tgtatcgtg-----ggaataattt
B D                Rhesus  cgcacaaagcag-aaatctgtgcacgtatattttgcac-cgtatcgtg-----ggaataattt
B D              Marmoset  catacaaagcag-aaatctgtgaacatatcttttgcac-tgaattgtg-----ggaatcattt
B D               Tarsier  cacacaaagcag--aatctacgcatgtatattctgcatgcgtattgtg-----ggcatcgttt
B D              Bushbaby  ccctcaaaacag-aaatctatgcacatatattttgcatgtatattatg-----gacatcgttt
B D            Tree shrew  cccacaaggcag-acacccactccggtgtagtctgcatgtgtattacg-----ggcatcattt
B D  Malayan flying lemur  cacccaaggtag-aaatctatgcatgtgtattttgcatgtgtattgtg-----ggcatcgt--
B D                   Pig  cacaggaggcag-aaacctacacacctatgttttgca-------tgtg-----ggcatccttt
B D                   Cow  ---------cac-acacctatgcatttctgctttgcatgtatattgtg-----ggcatccttt
B D                 Sheep  caaggtaggcac-acacctatgcactcatgctttgcatgtatattgtg-----ggcatccttt
B D                 Horse  tacacaaggcagaaaacctatgcacttatattttgcatatgtattgca-----ggcatcattt
B D      Chinese pangolin  cacacaaggcag-aaacctatggatgtacattttgcatgtgtgctgtg--------atcattt
B D                   Dog  cacacaagacaa-a---ctacgcatgtctattttgcgtgtgtattgtg-----ggcatcatgc
B D    Hawaiian monk seal  cacacaagacaa-a---ctatgcatgtacattttgcatgtgcattgtg-----ggtatcttgt
B D              Hedgehog  cacgcagg-cag-gaatctatgcaggtatattgtgtgtgtatattgtg-----ggcatctttt
B D                 Shrew  cacacaggacag-aagcctttgcagggatagtttgcatgtgtattgtgcatgtggcatcattt
B D              Elephant  tactctaggcag-aaacctatgcacgtgtacttggcatgtgtattgta-----ggcaacgttt
B D                Tenrec  taccttctgcag-aaaccgaagcaagcagactttgcatgtatattgta-----ggcttcggtt
B D             Zebrafish  ===============================================================
B D         X. tropicalis  ===============================================================
B D               Opossum  ===============================================================
B D               Chicken  ===============================================================
B D               Dolphin  ===============================================================

Alignment block 12 of 393 in window, 56746228 - 56746737, 510 bps 
B D                 Mouse  agt--tatttgtttgcaaaggactttgcgggtc-ttttgttctgtcttattgacatagctatcagatccc
B D                   Rat  agt--tatttgtttgcaaaggactttgcgggcc-ttttgttctgtcttattgacatagctatcagatccc
            GCF_003668045  agt--tatttgtttgcaaaggactttgcaggtc-ttttgttctgtcgtgttgacagaactatcagatccc
                   Beaver  agt--tatttgtttgtaaaggactttgcaggtc-ttttgttctgtc-tattgacataagtaccagatccc
B D              Squirrel  agg--tatttgtttgcaaaggactttgcaggtc-tttcgccctatt-tgttgacataagtaccagatccc
B D                Rabbit  agt--tatttgtttgcaaaggactttgcagat--ctttgttttgtt-tcttggcgtcagttccagacatc
B D                  Pika  ggc--ta----tttgcaaaatattttgcaggtc-ctttgttttgtc-ttttggtatacattgcagatact
B D                 Human  agt--tatttgtttgcaaaggacagtgcaggtctttttgttc--tc-tattgacataagtaccagatccc
B D                 Chimp  agt--tatttgtttgcaaaggactgtgcaggtctttttgttc--tc-tattgacataagtaccagatccc
B D                Bonobo  agt--tatttgtttgcaaaggactgtgcaggtctttttgttc--tc-tattgacataagtaccagatccc
B D               Gorilla  agt--tatttgtttgcaaaggactgtgcaggtctttttgttc--tc-tattgacataagtaccagatccc
B D                Rhesus  agt--tatttgtttgcaaaggactttgcaggtcgttttgttc--tc-tattgacataagtaccagatccc
B D              Marmoset  ag------ttgtttgcaaaggactttgcaggtcattttgttc--tt-tattgacaaaagtgccagatccc
B D               Tarsier  agt--tacttgtttgcaaaggtctttgcaagtcttcttg--------ggttgacataagtaccagatccc
B D              Bushbaby  agt--ta--tgtttgcaaaagactttgcaggtc-ttttgttc-----tattgacataggcactagatccc
B D            Tree shrew  agt--tacttgtttgcaaaggactttacagctc-ttttgttctgtc-ttttgacgtaaacacaagagacc
B D  Malayan flying lemur  --t--tatttgcttgcaaaggactttgtgggtc-ttttgttctatc-tattgatataagcaccagatccc
B D                   Pig  agt--tatttgtttgcaaaggactttgcaggtc-ttttgtt-cgtc-tgttgacaaaagtactagatccc
B D                   Cow  agt--catttgtttgcaaaagactttacaggtc-ttttgttccatc-tgttgacttaagtactagatccc
B D                 Sheep  agt--catttgtttgcagaagactttacaggtc-ttttgtttcatc-tgttgacttaagtactagatccg
B D                 Horse  agt--tatttgtttgcaaaggactttgcaagtc-ttttgttccatc-tgttgacataaaaa---------
B D      Chinese pangolin  agt--tacttgtttgcaaagga----------c-ttttgctccatc-tattgacagaagtactaggtccc
B D                   Dog  agt--tatttgtttgcaaaggactttgcaggtc-tttggtc---tc-tgttgacctaagtgcgagatccc
B D    Hawaiian monk seal  agt--tacttgtttgcaaaggactttgtaggtc-ttttgtctcatc-tattgacataagtactagatccc
B D              Hedgehog  agttctacttgtttgcaaaggattttgcaaatc-ttttgttccaac-tgttgacttaaataccagattgc
B D                 Shrew  agt--tatttgtttgcaaaggactttgcaggtc-ttttg-tccatc-tgttaacataagtactagaattc
B D              Elephant  agt--tatttgtttgcaaatgatct-gtgggtc-ttttattctatc-tgttgac-----------acagt
B D                Tenrec  agt--ggttggtttgcaaatgacccagcggatc-ttttgttcggtc-tgttgactcacttacccgacctt
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D               Dolphin  ======================================================================

                    Mouse  cacagtgtagtgagcatttttc--ag-cctgtctctg------agcatca--gccaggtc-----acact
                      Rat  cacagtgtagtgagcatttgtc--ag-gttgtttctg------cgcatca---ccgggtc-----acact
            GCF_003668045  cacagtgcggtgagcatttttc--ag-gctgtctttg------agcaaga---------c-----acact
                   Beaver  cacagagcagtgagc-------------ctgtttctg------gata------------c-----acctt
                 Squirrel  cacaatgcactgagcacttttc--ta-gatgtctctg------aacaccaa-gccagg-t-----ac-ct
                   Rabbit  cacagcacagtgagc----------------gctctg------agcacgga-tacagg-c-----aa-ct
                     Pika  cgcagcgcaaccaga---------------ggctcct------agggtagagtgcagg-c-----ac-ct
                    Human  cacagtgcag-------------------------tg------agcaccag-tgcagg-c-----accct
                    Chimp  cacagtgcag-------------------------tg------agcaccag-tgcagg-c-----accct
                   Bonobo  cacagtgcag-------------------------tg------agcaccag-tgcagg-c-----accct
                  Gorilla  cacagtgcag-------------------------tg------agcaccag-tgcagg-c-----accct
                   Rhesus  cacagcgcag-------------------------tg------agcaccag-tgcagg-c-----accct
                 Marmoset  cacagtgcag-------------------------tg------agcaccag-tgcagg-c-----accct
                  Tarsier  cacagtgtagtgagagcactt---tgggatgtctctg------agcagcag-aggcag-c-----acctt
                 Bushbaby  cacagcgcaatgagcacttttc--tgcaaagtctctg------aacacca---gcagg-c-----gccct
               Tree shrew  -acagcactgtgaacacttttc--t--gatgtctttg------agcacgcg-cacggg-c-----accct
     Malayan flying lemur  tggagcacagtgagcacttttc--tg-gacgtctctc------agctccag-cacagt-c-----accct
                      Pig  cgaggcacagtgagcactcttc--tg-gatgcctctg------agagccag-cacggg-c-----tcagt
                      Cow  cacagcacagtgagcact-ttc--tg-gacgtttctg------agagccag-aacagg-c-----atagt
                    Sheep  cacagcacagtgaacact-ttc--tg-gacgtttctg------agcgccag-aacagg-c-----atagt
                    Horse  --------agtgaggacttttc--tg-aatgtctttg------agcaccag-cacagg-c-----gcggt
         Chinese pangolin  cacagtgcagtgaacacttaac--tg-gatgtctttg------agcaccag-cacagg-c-----tccat
                      Dog  cactgcgcggcgagcacttttc--tg-gatgtctcggagcagcagcagcag-cacagg-cccaagacggt
       Hawaiian monk seal  cacagcacggtgagcacttttc--tg-gatgtctctg------agcaccgg-cccagg-ccaaggacggt
                 Hedgehog  cacagca----gagcagttttttcta-gatgtctctg------aacacaag-ta-tga-c-----taggg
                    Shrew  cgcaataaattgagcacttttt--ta-gatgattctg------agcaccgg-cactgg-c-----agaga
                 Elephant  actagcactgtgagcacttttc--tg-gatatctccg------tatgccag-cgcagg-c-----accct
                   Tenrec  cccagcatggtgagcactttgc--tg-aacgtctctg------gat--cag-tgcagg-c------ttct
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
                  Dolphin  ======================================================================

                    Mouse  tgggcca--gg---cctcctc-aac--------------------------------------gtcacct
                      Rat  tgggcca--gg---cctcctc-tcttcct--catca----gt----c-----c-tccccactggtcatgt
            GCF_003668045  taggcca--ct---actcctc-tctcccg--catca----gtcttcc-----c-tccccaat-ggcaggt
                   Beaver  tggatct--gg---acgcttc-tctctcgtttttca----gc----c-----t-gctccatt-accagga
                 Squirrel  caggtca--gg---gcactcc-tctctccattttca----aa----c-----t-gccacaat-ctcagat
                   Rabbit  taggtca--gggtctctcctc-tcttcct--tttta----gt----cctagag-atcccggt-actgcat
                     Pika  ----tta--gg-----ttctt-gctgccc--tttca----at----c-----------------cagcat
                    Human  taggtca--ga--cgctcctc-tctttct--tttca----gc----c-----a-gccccact-gccaaat
                    Chimp  taggtca--ga--cgctcctc-----tct--tttca----gc----c-----a-gccccact-gccaaat
                   Bonobo  taggtca--ga--cgctcctc-tctttct--tttca----gc----c-----a-gccccact-gccaaat
                  Gorilla  taggtca--ga--cgctcctc-tctttct--tttca----gc----c-----a-gccccact-gccaaaa
                   Rhesus  taggtca--ga--cgcccctc-tctttct--tttca----gc----c-----a-gccccact-cccaaat
                 Marmoset  taggtcc--gg--cgc-------ctttct--tttta----gc----c-----a-gccccagt-cccaaaa
                  Tarsier  taggtca--ga--ctcccccaatctctct--tttca----ag----t-----g------agt-cctagat
                 Bushbaby  caggtta-gga--agctgctc-----tct--ttttt----ga----c-----a-gccctagt-cccagat
               Tree shrew  taggtga-gga--tg------------ct--tttca----gt----t-----c-atcatagt-cccaggg
     Malayan flying lemur  caggtca-gga--agctcctc-tttgcct--cttca----gc----c-----c-gccccagt-ctcagat
                      Pig  taggcta-gag--cgaccttc-tctccct--tttcagtccgc----a-----c-gcaccaat-ttgagat
                      Cow  taggcca-gca--cgaccctt-tctcc-------------------------c-gcaccagt-ctcagat
                    Sheep  taggcca-gca--cgaccctt-tctc--------------------------------------------
                    Horse  gaggcca-gga--cactcctc-tctccct--tttca----gt----c-----c-c-----------agac
         Chinese pangolin  taggcca-gga--cgctcccc-tctccct--tttca----gt----c-----c-tcaccaat-gcaggat
                      Dog  taggccaggga--cgctcctc-tctcccc--tttcactccgc----c-----c-gcaccagt-cc-ctgt
       Hawaiian monk seal  taggccaaggg--cgctcctc-tctccct--tttca----gt----c-----c-gcaccagt-cc-ccgt
                 Hedgehog  tagacca-aaa--cacc--ct-tcttcct--tttca----ac----c-----c-aagccagt-cccaggg
                    Shrew  taggcca-gga--cacccacc-tctccct--tttca----gc----c-----t-gcctcagt-cccagat
                 Elephant  tagccca-gga--cactcctc-tctccct--ttcca----gc----c-----g-gcgccagt-cctagat
                   Tenrec  tagacca-gga--cgtatctc-attccat--gcccc----cc----c-----gcggcccagt-cccagac
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
                  Dolphin  ======================================================================

                    Mouse  ctttgcctctctc-c--t-------------------ttag-----tagg------------------g-
                      Rat  ctttgccactctc-c--t-------------------tcag-----tagg------------------g-
            GCF_003668045  ctttgccactctc-c--t-------------------ccag-----taag------------------g-
                   Beaver  ttttatcactctcgc--t-------------------ccag-----tcggtcctgtgttagtactggag-
                 Squirrel  ctttgccacctcc-c--t-------------------ccag-----ttcg------------------c-
                   Rabbit  ctttgtcagtctc-cagt-------------------ccag-----cctg------------------g-
                     Pika  ctttgtccatttc-caac-------------------gtag----ccctg------------------a-
                    Human  tgttgtcaacccc-cagt-------------------cggc----cttgg------------------g-
                    Chimp  cgttgtcaacccc-cagt-------------------cggc----cttgg------------------g-
                   Bonobo  cgttgtcaacccc-cagt-------------------cggc----cttgg------------------g-
                  Gorilla  cgttgtcaacccc-cagt-------------------cggc----cttgg------------------g-
                   Rhesus  cgttgtcaacccc-cagt-------------------cggc----cttgg------------------g-
                 Marmoset  cgttgtcaacccc-cagt-------------------cggc----cttgg------------------gt
                  Tarsier  ctttgtcaa-ccc-tggt-------------------tggc----cttgg------------------g-
                 Bushbaby  ctttgtcaaccca-gagt--------------------ggc----cttgg------------------g-
               Tree shrew  cct-------ccc-tcct-------------------catcctcacctct------------------g-
     Malayan flying lemur  catagttaacccc-cagt-------------------cggtcgc-cctgg------------------g-
                      Pig  ttttgtcaacccc-cagtggatcctgggttaggattgggac----cctgg------------------g-
                      Cow  ttttgtcaacccc-cagt-------------------cgac----cctgg------------------g-
                    Sheep  ---------cccc-cagt-------------------cgac----tctgg------------------g-
                    Horse  tcttgtgaagccc-cagt-------------------cggc----cctgg------------------g-
         Chinese pangolin  ttttgtcaactcc-caga-------------------cgac----cctgg------------------g-
                      Dog  ttcctgc-ctccc-gagt-------------------cgac----cccgg------------------a-
       Hawaiian monk seal  tttcgtcaatccc-gagt-------------------cgac----cctgg------------------g-
                 Hedgehog  ttatg---------gagt-----------------------------tgg------------------g-
                    Shrew  cttt----------------------------------------------------------------g-
                 Elephant  ctttgtcagtcct-cact-------------------cggc----cctgg------------------g-
                   Tenrec  tttggccggttcc-cacc-------------------cggg----cctgg------------------g-
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
                  Dolphin  ======================================================================

                    Mouse  --acagagatgagga--acaga----tatc---------------c------cac-ttca----------
                      Rat  --acagaggtaagga--acaaa----tatc---------------c------ca--ttta----------
            GCF_003668045  --acaggggtgatga--attaa----tatc---------------c------aac-ttca----------
                   Beaver  --aaagagagaatgg-----gg----catc---------------c------aac-ctca----------
                 Squirrel  --cccaggttaaagaaaaaagg----tatt---------------c------aac-ctca----------
                   Rabbit  --attaggatgggcg-agttgg----gaac---------------a------gcg-catc----------
                     Pika  --gttaggatgggga-ggtgga----gaag---------------c------aag-cgcg----------
                    Human  --ttaagaatgagga-ggtgga----gaac-----ggcacgt--gc------agc-ctta----------
                    Chimp  --ttaagaatgagga-ggtgga----gaac-----ggcacgt--gc------agc-ctta----------
                   Bonobo  --ttaagaatgagga-ggtgga----gaac-----ggcacgt--gc------agc-ctta----------
                  Gorilla  --ttaagaatgagga-ggtgga----gaac-----ggcacgt--gc------agc-ctta----------
                   Rhesus  --ttaagaatgagga-ggtgga----aaac-----ggcgcgt--gc------agc-ctta----------
                 Marmoset  tattaagactgagga-ggtaga----gaacccgcgggcgcgt--gc------agc-ctta----------
                  Tarsier  --ttaggactgagga-ggtgga----gaat-----ggcctga--cc------agt-ctca----------
                 Bushbaby  --ttaagattgagga-ggtgga----gaat-----ggcgtgt--cc------agc-ctct----------
               Tree shrew  --cca----tgaggg-ggtaga----gcag-----aatgcat--cc------aac-ttta----------
     Malayan flying lemur  --ttaggattgggga-ggtgaa----gaag-----ggcccat--ct------agc-ctca----------
                      Pig  --ttaggactgggga-----------gaat-----ggcgcat--cc------agt-ttca----------
                      Cow  --ttaggactgagga-----------gaac-----agcgcgt--cc------agt-ttca----------
                    Sheep  --ttagtactgggga-----------gaac-----ggggcgt--cc------agt-ttca----------
                    Horse  --tcagggtgggga------------gaac-----cacgcat--cc------gac-ttca----------
         Chinese pangolin  --tcaggattgggat-----------gaac-----agggcat--cc------aac-ttca----------
                      Dog  --cgaggactgggac-----------gagc-----ggcgcgt--cc------agc-ttcg----------
       Hawaiian monk seal  --ttaggactgggac-----------gaac-----agcgcat--cc------agc-ttca----------
                 Hedgehog  --ttaga-------------------gaac-----agcattt--cc------agc-ttcag--ggtttgt
                    Shrew  --tcagc-------------------cacc-----aatcgtc--ccccgggtagcattcagcaggaaaat
                 Elephant  --ttagtattgagga-ggaggaggaagaat-----atggtgcatcc------agc-ctca----------
                   Tenrec  --ttcgtcctgggga-ggacaag---aaat-----gtggcgc--tc------agc-ctaa----------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
                  Dolphin  ======================================================================

                    Mouse  ---------caactttggg--tttttct------tc-tgtttgg-----------gggga----------
                      Rat  ---------caggtttggatttttttct------tc-tgtttgg-----------gaaaa----------
            GCF_003668045  ---------caactctggg-ttctttct------tc-catttgg--------------------------
                   Beaver  ---------c------ggg-ttctttct------tc-aatttgg--------------------------
                 Squirrel  ---------c------agg-ttctttctatgaggtt-cattcgg--------------------------
                   Rabbit  ---------c------agc-ttctgtcc------ca-gatttgg--------------------------
                     Pika  ---------c------agg-c----acc------ca-gatttgg--------------------------
                    Human  ---------a------ggg-ttccttct------cc-gattt----------------------------
                    Chimp  ---------a------ggg-ttccttct------cc-gattt----------------------------
                   Bonobo  ---------a------ggg-ttccttct------cc-gattt----------------------------
                  Gorilla  ---------a------ggg-ttccttct------ct-gattt----------------------------
                   Rhesus  ---------a------ggg-ttccttcc------cc-tattt----------------------------
                 Marmoset  ---------a------gag-ttccttc-------ct-gattt----------------------------
                  Tarsier  ---------c------gag-ctctttcc------tc-gattt----------------------------
                 Bushbaby  ---------g------gac-ttctttcc------ccagattt----------------------------
               Tree shrew  ---------a------agg-ttatttct------ct-gatttgg-----------agaaatttgggaaaa
     Malayan flying lemur  ---------c------ggg-ttctttcc------tt-gatttgg-----------gaaaatttggg-aaa
                      Pig  ---------c------ggg-ttctttcc------cc-gatttgg-----------gaaaagtt-------
                      Cow  ---------c------gcg-ttctttcc------cc-gatttga-----------gaaaattc-------
                    Sheep  ---------c------gcg-ttctttcc------cc-gatttaa-----------gaaaattc-------
                    Horse  ---------c------gga-ttctttcc------ca-gatttgg-----------gaatactg-------
         Chinese pangolin  ---------c------ggg-ttctttcc------tc-gatttgg-----------gaaaac---------
                      Dog  ---------c------gtg-ttcgttcc------tc-gatttag-----------gaaaac---------
       Hawaiian monk seal  ---------c------gtgtttcattcc------tc-gatttag-----------gaaaac---------
                 Hedgehog  ttgttttt-t------gtt-ttttttcc---------tgttgtg-----------ggaatgtt-------
                    Shrew  ctgcttccac------agg-ttcattcc---------gactggg-----------gaaaattt-------
                 Elephant  ---------a------ggg-ttctttcc------ct-gatttgggagaatattgaggaaattt-------
                   Tenrec  ---------c------agg-ttcttttt------cc-cactcgg-----------agaaattt-------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
                  Dolphin  ======================================================================

                    Mouse  -----aa--------------aaaaaa----------------------------------ccctctttc
                      Rat  -----ac--------------aaacaaacaaacaacaaacaaaaatcaaaacaagactc--ctctctttc
            GCF_003668045  -----aa--------------aaatat------------------------------tc--gtctctttc
                   Beaver  -----ag--------------aaatta------------------------------tcgggtttctttc
                 Squirrel  -----ga--------------aaattc------------------------------tca-atttcttcc
                   Rabbit  -----ga--------------aaacgc------------------------------tcgggtttctttc
                     Pika  -----gaaactctgagggggcaaaacc------------------------------tcagattttctcc
                    Human  -----ag------------------------------------------------------gtttcttcc
                    Chimp  -----ag------------------------------------------------------gtttcttcc
                   Bonobo  -----ag------------------------------------------------------gtttcttcc
                  Gorilla  -----ag------------------------------------------------------gtttcttcc
                   Rhesus  -----ag------------------------------------------------------atttcttcc
                 Marmoset  -----gg------------------------------------------------------gtttcttcc
                  Tarsier  -----gg------------------------------------------------------gtttctacc
                 Bushbaby  -----gg------------------------------------------------------gtttcttcc
               Tree shrew  ctctcag------------------------------------------------------atttcttcc
     Malayan flying lemur  ctctcag------------------------------------------------------gtttcttgc
                      Pig  -----gg--------------gggaaa---------------------------ctctcgggttccttcc
                      Cow  -----gg--------------gggaaa--------------------------attttcagattccttcc
                    Sheep  -----gg--------------gggaaa----------------------------cttcagattccttcc
                    Horse  -----gg--------------gggcaa---------------------------ctttcaggccccttcc
         Chinese pangolin  ---------------------------------------------------------tcaggttccttcc
                      Dog  -------------------------------------------------------tctcaggttccttcc
       Hawaiian monk seal  -------------------------------------------------------tctcaggttccttgc
                 Hedgehog  -----tg------------tagagaaa---------------------------ctttctgactcttctg
                    Shrew  -----tg--------------ggaaaa---------------------------ctcctgggttctttcc
                 Elephant  -----gg--------------gaaatc----------------------------tcccaggtttcttcc
                   Tenrec  -----gg--------------aaaatc----------------------------tctccggtttctttc
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
                  Dolphin  ======================================================================

                    Mouse  aat--cc-attccct--ggga----------gatcaagaagggagaaaggaaatc-taatgctgacttag
                      Rat  aat--cc-gttccct--ggga----------gatcaaggaggaagaaagaaaatc-taatgctgccttag
            GCF_003668045  aac--cc-attccct--gaga----------gatcaagaagggagaaaggaaatc-taacgctggtttaa
                   Beaver  act--tg-tttccct--gagt----------taccaagggcagag---ggaaatc-aaaggccagttgaa
                 Squirrel  ac----------------------------------ggaaaggaggagggaaatc-cagggctgcttgaa
                   Rabbit  actcgct-ttcctcg--gggt----------agtgaagaggggaggagggaaatc-gaaggttagcagaa
                     Pika  actaaca-gtcttcg--gaga----------agcgcagaggggagctgggaaatc-gaaggttggtggga
                    Human  act--cc-tttgccc--tggg----------agagcaaaggggcgaagggaaatc-aaaaaccggttga-
                    Chimp  act--cc-tttgccc--tggg----------agagcaaaggggcggagggaaatc-aaaaaccggttga-
                   Bonobo  act--cc-tttgccc--tggg----------agagcaaaggggcggagggaaata-aaaaaccggttga-
                  Gorilla  act--cc-tttgccc--tggg----------agagcaaaggggcggagggaaatc-aaaaaccggttga-
                   Rhesus  act--cc-tttgccc--tggg----------agagcggagggtcggagggaaata-aaatactggttga-
                 Marmoset  act--cc-tttgccc--tggg----------agagcggaggagtggagggaaagc-aaagaccggttga-
                  Tarsier  acc--ca-tttccgc--gtgg----------agtgaggagggatggagggaaatc-aagggctgattgaa
                 Bushbaby  act--tt-tttcctt--gggg----------attgaggaggggaggagggaaatc-aaagtctggttgaa
               Tree shrew  act--ta-ttccctg--gggg----------agccaaaaggggaggagggaaact-gaaggctgattga-
     Malayan flying lemur  act--tgttttccca--ggga----------atcgaggaggggaggagggatata-aaaaaccggttga-
                      Pig  att--cg-ttttccc-cgggg----------agagaggatgggaaga-agaaacc-aaaggccggcccg-
                      Cow  act--cg-ttt-ccc-agggg----------agcgaggacgggagga-ggtaatc-aaaggccgttggg-
                    Sheep  act--cg-tttcccc-agggg----------agcgaggatgggagga-ggtaatc-aaaggccggttaa-
                    Horse  act--ca-tttcccc--ggga----------agcgaggag-ggagga-ggaactc-aaaggccggttga-
         Chinese pangolin  act--cg-tttcccttggggg----------agcgaggag----ggg-agaaatc-aaatgcaggctga-
                      Dog  att--cg-cttcccc-ggggg----------aacaaggagaggagga-gggaatc-aaaggcttttgaa-
       Hawaiian monk seal  att--cg-atttccc-ggggg----------aatgaggaggggagga-ggaaatc-aaaggctgttgaa-
                 Hedgehog  act--tt-gtggtgc---act----------a------agaggggga-ggaaatc-taaggtctgttga-
                    Shrew  act--tg-tttcccc-agact----------agcgaggaggggagga-agaagccaaaaggccagatga-
                 Elephant  act--cg-ttttccc--gggggagcgaggacagaaggaggaggagga-aaaaatc-aaaggccggtaga-
                   Tenrec  act--cc-ttgtcac--ggagaa--------agccgggcaaggagga-ggaactc-aaagaccagtgggg
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
                  Dolphin  ======================================================================

                    Mouse  gaa---aagaaag--aaaggg---g-aaa---------a---aattaaaaaacaaaaacacttcagtcag
                      Rat  gaaacgaagaaaggaaaaaaa---a-aaa---------a---aaaaaaaaaaaaaaaaaacatccgccag
            GCF_003668045  aaa------------aaataa---a-aca---------a---aacaaagcaaaacaaaa--ttccgtcag
                   Beaver  aac------------gaagaa---a-aaa---------a---aa-----------aaaatcttcctgcag
                 Squirrel  aac------------aaaagg---c-aaa---------acccaccaaaatcccaaacgatcttcacgcag
                   Rabbit  aa-----------------gg---g-aaa---------a-----------------ctgtcttcttgcaa
                     Pika  aag------------gagggg---g-gga---------g-----------------ggagcttctcccag
                    Human  ---------------aaaaga---a-aaa---------a-----------------gtgtcttccctcag
                    Chimp  ---------------aaaaga---a-aaa---------a-----------------gtatcttccctcag
                   Bonobo  ---------------aaaaga---a-aaa---------a-----------------gtatcttccctcag
                  Gorilla  ---------------aaaaga---a-aaa---------a-----------------gtatcttccctcag
                   Rhesus  ---------------aaaaga---a-aaa---------a-----------------atattttccctcag
                 Marmoset  ---------------aaaaga---a-aaa---------a-----------------atatcttccctcag
                  Tarsier  aaa---taagaaattaaaaaa---a-aaa---------a-----------------aaatcttccctcag
                 Bushbaby  aaa---g--------aaaaaa---a-aaa---------a-----------------aaatcctcccgcag
               Tree shrew  ---------------aaaaaa---a-aat---------t-----------------a---------gaag
     Malayan flying lemur  ---------------aaaaga---a-aaa---------a-----------------a-atcctcccacag
                      Pig  ---------------aaaaag------aa----aaaaaa-----------------gtatcttcctgcgg
                      Cow  ---------------ggtggg---g-ggg----ggggga-----------------atgtcttcccgcgg
                    Sheep  ---------------aaaaagaaaa-aaa----aaaaaa-----------------atgtcttcccgcgg
                    Horse  ---------------aaaaga---a-aaa---------g-----------------cggcctcctggcag
         Chinese pangolin  ---------------aaaaga---a-aaataaaaaatga-----------------aaaccttcccgcag
                      Dog  ---------------aaaaag---g-ggg--------aa-----------------accccttcccgcag
       Hawaiian monk seal  ---------------aagggg---g-ggg----gaaaaa-----------------aaatcttcccgcag
                 Hedgehog  ---------------aaaaga---a-aaa-----------------------------aatatctcgcag
                    Shrew  ---------------aaagga---atcaa-----------------------------attctctcgcag
                 Elephant  ----------------aaaaa---a-aaa---------a-----------------aaatctccccacag
                   Tenrec  gtgcggggg------tggggg---g-aca---------a-----------------ctttctacccacag
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
                  Dolphin  ======================================================================

                    Mouse  gcgtgggtgaaacttaactc----aggcctactt--ttaggcc-gttaaaacg-tctcc-aggccctaga
                      Rat  gagtgggtgaaacttaactc--agaggcctactt--tcaggcc-attaaaact-tctcc-aggccctagc
            GCF_003668045  gcgtgggtgaaacttaactc--acaggcctactt--tcaggcc-attaaaact-tctcc-aggccctaag
                   Beaver  gcatgagtgaaac--aactc--agaggcctactc--tcaagcg-agaaaacct-tcagc-aggccctagg
                 Squirrel  gcaggggtggaac--gactcagagaggcctactc--ttaggcg-agtacaact-ttact-aggtcctggg
                   Rabbit  gcac-----------gactg--gaaggcctggtc--tcaggcg-aggcgaact-tcacc-aggccccggg
                     Pika  gcgc-----------cgcgg--aaaggcctcttt--tcaggag-agtgacact-tggcc-ag---ccacg
                    Human  gcgtgggtcagag--aatttggaaaggcctactc--tgagggg-agtaaaact-tcacc-aggccctggg
                    Chimp  gcgtgggtcagag--aatttggaaaggcctactc--tgagggg-agtaaaact-tcacc-aggccctggg
                   Bonobo  gcgtgggtcagag--aatttggaaaggcctactc--tgagggg-agtaaaact-tcacc-aggccctggg
                  Gorilla  gcgtgggtcagag--aatttggaaaggcctactc--tgagcgg-agtaaaact-tcacc-aggccctggg
                   Rhesus  gcgtgggtcagag--aatttggaaaggcctactc--tcaggca-agtaaaact-tcacc-agg-cctggg
                 Marmoset  ac----gtcagat--aactcggaaaggcctgcat--tcaggcg-agtaaagct-tcacc-aggccctggg
                  Tarsier  gcgtgggtgacag--aattcggggaggcctactc----aggcg-agcaaaact-tcacc-aggccctgga
                 Bushbaby  gcgtgggtgagag--aacttggagaggcctactc--tcaggcg-agtgaaact-tctcc-aggcctgggg
               Tree shrew  acttgggagagaa--cgcggagagagatctattc--tcaaagg-aataaaacttccgcc-gggtcgccag
     Malayan flying lemur  gcgtaggtgagag--acctcggagaggccta--c--tcaggag-agtaaagctcttgtc-aggccgtggg
                      Pig  cctgggggc-gag--agctgggagaggcctactc--cgaggcg-ggt-cacct-tcgcc--ggccctggg
                      Cow  gcgtggggcagag--agcggggagaggcctactc--cgaggc---gt-cacct-gggcc-ggggcctggg
                    Sheep  gcgtggggcagag--agcggggagaggcctactc--cgaggc---gt-cacct-gggcc-gggccctggg
                    Horse  gcgtgggtgagag--agctgggaaaggcctac-c--cgaggcg-agt-ccgct-ccacc---agcccggg
         Chinese pangolin  gcgtgggtaagag--agctgagagaggcctactc--tggggcg-agc-aaatt-tcacccggggtctggg
                      Dog  gcgtgggggagag--cgctgggagaggcctacgc--cgagggg-cgt-gaact-gcgcc-ggggcccggg
       Hawaiian monk seal  gcgtgggtgaaag--agctgggagaggcctactc--tgaggag-agt-aaact-tcgcc-gggccctggg
                 Hedgehog  gggtgggcgtgag--ctctcagagagagcttttt--------------------tctca--------gtg
                    Shrew  gcctttgtgagag--agctgggagaggcccacttagagaggcg-agt-gcacg-tccca--ggccttgcg
                 Elephant  gcgtgggggaaaa--agcttggcagggcctactc--tgaggag-tgtaaaaat-ccacccaggccctgga
                   Tenrec  gggtg----------agtttggcgaggcctactc--cgaggcgaaataaaagt-tcccccaggcctgagg
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
                  Dolphin  ======================================================================

                    Mouse  -ctgaaa---actg----aggagtctatgcttaggcccagcg-tc----cctaggaggc--------cta
                      Rat  -ctgaaa---acag----aggagtctgcgcctaggcccagcg-tc----cttaggaggc--------cta
            GCF_003668045  -ctgaaa---accg----agaggtctacccttgggcccagcg-cc----ggtaggaagc--------cta
                   Beaver  -ctgaca---gcag----acgaggcagcagctgggctcagcg-tt----cctgggaggc--------cta
                 Squirrel  -ctgtga---gtgg----tggaggccgcagatggccacaggg-ac----cctctgggccaccctcttccc
                   Rabbit  ----------------------------ggctggtgtcggc--cc----ccggcgatgc--------cga
                     Pika  ----------------------------ggctggc-----------------------------------
                    Human  -ctggaa---gcac----aggaggtcgcggctgggcccagcg-cc----ctcgggaggc--------caa
                    Chimp  -ctggaa---gcac----aggaggtcgcggctgggcccagcg-cc----ctcgggaggc--------caa
                   Bonobo  -ctggaa---gcac----aggaggtcgcggctgggcccagcg-cc----ctcgggaggc--------caa
                  Gorilla  -ctggca---gcac----aggaggtcgcggctgggcccagcg-cc----ctcgggaggc--------caa
                   Rhesus  -ttggaa---gcac----aggaggtcgcggctgggcctagcg-cc----ctcgggaggc--------caa
                 Marmoset  -ctggaa---gcaccggacggaggtcgcggctgggcccagcg-cc----ctcgggagac--------cga
                  Tarsier  -ctggaa---gcag----aggaggccgcggctggaccccgcgccc----ctggggaggc--------ctt
                 Bushbaby  -ctgg-----------------ggctgtaactgggcccagcg-tc----c-gagcaggc--------tta
               Tree shrew  -ctagaa---gctg----agaaggtcctggctg------gtg-ct----cttgggaggc--------cta
     Malayan flying lemur  -ctggaa---gc-g----gggagaccgcggctgggcccagcg-tc----cctgggaggc--------cta
                      Pig  -ctgcca---gcgg----gagagacccggcccgcgcc------------cccgggaggc--------cga
                      Cow  -ctgccg---gccg----gagaggtgggccccgcgcc------------cctgggaggc--------gga
                    Sheep  -ctgccg---gccg----gagaggcgggccccgcacc------------ccttggaggc--------gga
                    Horse  -ccggga---g-cg----gagaggcggcgcccgggcccagcg-c-----cccgggaggc--------cga
         Chinese pangolin  -ctggaa---gccg----gaaaggccgcgcctgggcccggcg-c-----cccgggaggc--------tga
                      Dog  -ctgcga---gccg----ccgaggccgcg--------------------cccgggaggt--------cgg
       Hawaiian monk seal  cctggaa---gccg----gcgaggccgcgcctgggcccggcg-cc----cccgggaggt--------cga
                 Hedgehog  -ttacaaactgtca----c-tagac----cctggacaccgta-ctcctgcctgggaggc--------ca-
                    Shrew  -ctggaa---gtca----g-ggggccctgcctgggtcccgcg-ct----cctgggaggc--------caa
                 Elephant  -ctggaa---gcgg----aggaggccgcggttgggcccagag-cc----cctgggaggc--------cga
                   Tenrec  -ctagaa---tcga----aggaggagacggctggggcccgcg-tc----cccgggagtt--------cga
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
                  Dolphin  ======================================================================

                    Mouse  g----ttcaggggagttgaccaaaggtcttagcctagga---------ccttt--gt-------------
                      Rat  g----tgcaggggagtggaccaaaggtcttagcctagga---------ccttt--gtggtaggggatt-c
            GCF_003668045  g----tgca-aggagttgacccaaggtcttagccctgaa---------gcttt--gtggttagggatt-c
                   Beaver  g----cgca-gggggcccaccggaggttttagccccaga---------gctta--gtggtcacgggtt-c
                 Squirrel  g----cccccgggagc--acccgggttgctgggctagg----------------------------tt-c
                   Rabbit  g----ggca-gggggcctagccgaggtcgcggg---------------------------------tg-c
                     Pika  ----------ggagtcctggccgaggtcggg---------------------------------------
                    Human  g----ggca-gggagccgacccaaggtctaagccctcca---------gctct--c-cgtcgcgggtt-t
                    Chimp  g----ggca-gggagccgacccaaggtctaagccctcca---------gctct--c-cgtcgcgggtt-t
                   Bonobo  g----ggca-gggagccgacccaaggtctaagccctcca---------gctct--c-cgtcgcgggtt-t
                  Gorilla  g----ggca-gggagccgacccaaggtctaagccctcca---------gctct--c-cgtcgcgggtt-t
                   Rhesus  g----ggca-gggggccgacccaaggtcttagccctcca---------gctct--c-cgtcgcgggtt-t
                 Marmoset  g----ggca-gggggccgacccaaggtctgagccctcga---------gctct--ctcgtcgcttact-t
                  Tarsier  g----ggc---ggggcggacccgaggtctgagctctcat---------gctct--cgggtcgcgggtt-c
                 Bushbaby  gggaaggca-gggggtccacccgaggccggagtccaggc---------gcttt--ctaggctaggatt-c
               Tree shrew  g----ggca-aatagacgatccgagatcggagctctagt---------gctct--ctgatcgagggtt-c
     Malayan flying lemur  g----ggca-gg-ggctgaacgtcggtcagagccctcga---------gctct--ctggtcgcagact-c
                      Pig  g----ggca-gggggccga-ccgaggtcgcaagcctcgc---------gctcg----------------c
                      Cow  g----ggca-gggggccga-ccgaggtcgcggccctggc---------gctcg----------------c
                    Sheep  g----ggca-gggggccga-ccgaggtcgcggccccggc---------gctcg----------------c
                    Horse  g----ggca--ggggccg--ccgaggtccgggcgcgggt---------gctcg----------------c
         Chinese pangolin  g----ggca-gggggccg--acgaggtcggagcccttgt---------gctca----------------c
                      Dog  g----ggca-------------ggggtcggcgccccgga---------gctcg----------------c
       Hawaiian monk seal  g----ggca-------------ggggtcggagccctgga---------gctcg----------------c
                 Hedgehog  -----------------gc-acaaggtgggggggcagtgtcaaccaaggtcagcccaagtgcctgctgcc
                    Shrew  g----ggca-------ggc-acgaggcaaaggacctggg-------agactag----------tattg-c
                 Elephant  g----ggca-gggggccgacccgaggtcggagtcctcgt---------gccct--ctggtcttgggtt-c
                   Tenrec  a----ggca-gggggtcgccccaaggtcgg---------------------------------ggctt-c
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
                  Dolphin  ======================================================================

                    Mouse  -ggtctt
                      Rat  gggtctt
            GCF_003668045  gggtgtt
                   Beaver  gggtcgc
                 Squirrel  cggccgc
                   Rabbit  gggtctc
                     Pika  -------
                    Human  gggtccc
                    Chimp  gggtccc
                   Bonobo  gggtccc
                  Gorilla  gggtccc
                   Rhesus  gggtccc
                 Marmoset  gggtccc
                  Tarsier  aggtcct
                 Bushbaby  cggtccg
               Tree shrew  gggtccc
     Malayan flying lemur  gggtccc
                      Pig  gggtggg
                      Cow  gggtcgc
                    Sheep  gggtcgc
                    Horse  ggggggc
         Chinese pangolin  aggtcgc
                      Dog  cggtcgc
       Hawaiian monk seal  gggtcgc
                 Hedgehog  ggaccct
                    Shrew  gggtcac
                 Elephant  gggtcca
                   Tenrec  gggtcct
               Guinea pig  NNNNNNN
                Zebrafish  =======
            X. tropicalis  =======
                  Opossum  =======
                  Chicken  =======
                  Dolphin  =======

Inserts between block 12 and 13 in window
B D                  Pig 13bp
B D                  Cow 13bp
B D                Sheep 13bp
B D                Horse 13bp
B D     Chinese pangolin 13bp
B D                  Dog 13bp
B D   Hawaiian monk seal 13bp
B D             Hedgehog 13bp
B D                Shrew 13bp

Alignment block 13 of 393 in window, 56746738 - 56746741, 4 bps 
B D                 Mouse  gtct
B D                   Rat  gtct
            GCF_003668045  gtct
                   Beaver  gtct
B D              Squirrel  gtct
B D                Rabbit  gtct
B D                  Pika  gtct
B D                 Human  gtct
B D                 Chimp  gtct
B D                Bonobo  gtct
B D               Gorilla  gtct
B D                Rhesus  atct
B D              Marmoset  gtct
B D               Tarsier  gtct
B D              Bushbaby  gtct
B D            Tree shrew  ttct
B D  Malayan flying lemur  ctct
B D                   Pig  gtct
B D               Dolphin  gtct
B D                   Cow  gtct
B D                 Sheep  gtct
B D                 Horse  gtgt
B D      Chinese pangolin  gtct
B D                   Dog  gtct
B D    Hawaiian monk seal  gtct
B D              Hedgehog  cttt
B D                 Shrew  gtct
B D              Elephant  gtct
B D                Tenrec  gtct
B D            Guinea pig  NNNN
B D             Zebrafish  ====
B D         X. tropicalis  ====
B D               Opossum  ====
B D               Chicken  ====

Alignment block 14 of 393 in window, 56746742 - 56746761, 20 bps 
B D                 Mouse  c-aggaggggg--gcg----cg-ggttg
B D                   Rat  c-aggaggggg-cgcg----cg-ggttg
            GCF_003668045  c-aggaggggg-cgcg----cg-ggttg
                   Beaver  c-aggaggggggcgcg----cg-ggtta
B D              Squirrel  c-cggaggggggcaag----cg-ggcag
B D                Rabbit  c-aggaggggg-cgcg----cg-ggttg
B D                  Pika  t-tgga---------g----cg-ggttg
B D                 Human  c-aagagtggggcgcg----cg-ggctg
B D                 Chimp  c-aagagtggggcgcg----cg-ggctg
B D                Bonobo  c-aagagtggggcgcg----cg-ggctg
B D               Gorilla  c-aagagtggggcgcg----cg-ggctg
B D                Rhesus  c-aagagtggggcgcg----cg-ggctg
B D              Marmoset  c-atgagtggggcgtg----cg-ggctg
B D               Tarsier  c-aggagggggacgcg----cgcggctg
B D              Bushbaby  c-cggaggggggcgcg----ca-gttgg
B D            Tree shrew  c-aggagtggggcgcg----cg-agttg
B D  Malayan flying lemur  c-gggaagggggcgcg----cg-ggtcg
B D                   Pig  c-aggaggggg-cgcg----c--ggttg
B D               Dolphin  cgagggagggg-cgcg----c--ggtta
B D                   Cow  c-aggaggggg-cgcg----c--ggtcg
B D                 Sheep  c-aggaggggg-cgcg----c--ggtcg
B D                 Horse  c-aggcggggg-cgc-----ag-ggtcg
B D      Chinese pangolin  c-aggaggggg-cgct----cg-ggttg
B D                   Dog  c-cggaggggg-cgcg----cg-ggtcg
B D    Hawaiian monk seal  c-aggaggggg-cgcg----cg-ggttg
B D              Hedgehog  g-gggtgtggg-ggtgggtagg-ggtga
B D                 Shrew  c-aggaggggg-cgcg----ct-ggtgg
B D              Elephant  c-tggagggag----g----tt-gg---
B D                Tenrec  c-tggagggag----g----ct-g----
B D               Chicken  c-aggaggcga--ggg----ac-ggctg
B D             Zebrafish  ============================
B D         X. tropicalis  ============================
B D               Opossum  ============================

Alignment block 15 of 393 in window, 56746762 - 56746780, 19 bps 
B D                 Mouse  a----a-c-ccccgc-------ct-------gaaatttc
B D                   Rat  a----g---ccccgc-------ct-------gaaatctc
            GCF_003668045  a----g--------c-------ct-------gacaactc
                   Beaver  g----tgc-ctcagc-------ct-------gaca--tc
B D              Squirrel  g----c-c-atcagc-------tt-------gaca--tc
B D                Rabbit  g----g-ctaccaac-------ct-------gaca--cc
B D                  Pika  g----a-c-acccac-------ct-------gata--cc
B D                 Human  g----g-cctccggc-------ct-------gaca--cc
B D                 Chimp  g----g-cctctggc-------ct-------gaca--cc
B D                Bonobo  g----g-cctccggc-------ct-------gaca--cc
B D               Gorilla  g----g-cctccggc-------ct-------gaca--cc
B D                Rhesus  g----g-cctccggc-------ct-------gaca--cc
B D              Marmoset  g----g-cctccggc-------ct-------gaca--cc
B D               Tarsier  g----g-cttccagc-------ct-------gaca--cc
B D              Bushbaby  g----a-cctccagc-------ct-------gaca--cc
B D            Tree shrew  g----g-cctccagc-------ct-------gaca--cc
B D  Malayan flying lemur  g----g-cctccagc-------ct-------gaca--cc
B D                   Pig  g----c-cctcggac-------ct-------gatg--cc
B D               Dolphin  g----c-cctccagc-------ct-------gacg--cc
B D                   Cow  g----c-cctacagc-------ct-------gacg--gc
B D                 Sheep  g----c-cctccagc-------ct-------gacg--gc
B D                 Horse  g----a-gctccggc--------t-------gacg--cc
B D      Chinese pangolin  g----a-cctccagc--------g-------g--g--tc
B D                   Dog  g----c-cctcccgc-------tt-------gacg--cc
B D    Hawaiian monk seal  g----a-tctccagc-------tt-------gacg--cc
B D              Hedgehog  atactc-tgcttgga-------ctccagttggatg--ct
B D                 Shrew  a----c-tgcgtggc-------ct-------gacg--cc
B D              Elephant  -----g-gctccggt-------ct-------gatg--cc
B D                Tenrec  ----------------------------------a--cc
B D               Opossum  ------aacttctgc-------ct-------t-----tt
B D               Chicken  ------ccccttagctctacctct-------aacc--cc
B D             Zebrafish  =======================================
B D         X. tropicalis  =======================================

Alignment block 16 of 393 in window, 56746781 - 56746944, 164 bps 
B D                 Mouse  tcttccac--cttct--caggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D                   Rat  ccttccac--cttct--caggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
            GCF_003668045  tcttccac--cttcc--taggagtgagcgatagctccccctaccacagccccaaggtggaggagtggagc
                   Beaver  ttgtcctc--cttcg--caggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D              Squirrel  ttctcctc--cttcc--caggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D                Rabbit  ttctcctc--ctt-c--caggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D                  Pika  ctctcccg--cttcc--caggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D                 Human  ctctctt---ctctc--catcagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D                 Chimp  ctctctt---ctctc--catcagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D                Bonobo  ctctctt---ctctc--catcagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D               Gorilla  ctctctt---ctctc--catcagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D                Rhesus  ttctctc---ctctt--cagcagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D              Marmoset  ttctcttc--ctctc--cagcagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D               Tarsier  ttctcctc--ctctc--caggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D              Bushbaby  tctcctc---ctccc--caggagtgagcgacagctccccctaccacagccccaaaatggaggagtggagc
B D            Tree shrew  ttctcctc--ctccc--caggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D  Malayan flying lemur  ttctgctc--cttcc--caggagtgagcgacagctccccctaccacagtcccaaagtggaggagtggagc
B D                   Pig  ctctcctc--ctccc--caggcgtgagcgacagctccccgtaccacagccccaaggtggaggagtggagc
B D               Dolphin  ctctcctc--ctccc--caggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D                   Cow  ctctcctc--ctcccctcaggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D                 Sheep  ctctcctc--ctccccccaggagtgagcgacagctccccctaccacagccccaaggtcgaggagtggagc
B D                 Horse  ttctcctc--ct-cc--cagcagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D      Chinese pangolin  ttcttctc-----cc--caggagtgagcgagagctccccctaccacagccccaaggtggaggagtggagc
B D                   Dog  ttcttctc--ctccc--caggcgtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D    Hawaiian monk seal  tcctcctc--ctccc--caggcgtgagcgacagctccccctaccccagccccaaagtggaggagtggagc
B D              Hedgehog  ttctcttc--ctccc--caggagtgagcgacagctcctcctaccacagccccaaggtggaggagtggagc
B D                 Shrew  ttctgttc--ttccc--caggagtgagcgacagctccccctaccacagccctaaggtggaggagtggagc
B D              Elephant  ttctcctc--ctccc--taggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D                Tenrec  ctttcctc--ctccg--caggagtgagcgacagctccccctaccacagccccaaggtggaggagtggagc
B D               Opossum  tcctgtac--ttcca--ccacagtgagcgacagctccccctaccacagtccaaaggtagaagagtggagc
B D               Chicken  ttgcccccgtgtttc--cctcagtgagcgacacctcgtcgtaccccagccccaaggtggaggagtggagc
B D         X. tropicalis  ---tcccc--caccc--ta---gtcagtgacacctcgccgtaccccagtcccaagctggaggagtggagc
B D             Zebrafish  ======================================================================

                    Mouse  agcctgggccgcaacaacttccctgccgccgccccgcacgcagtgaatggattggagaagggagccttgg
                      Rat  agcctgggccgcaacaacttctctgctgcagccccgcacgcagtgaatggattggagaagggagccttgg
            GCF_003668045  agcttgggccgcaacaacttcccggccgccgccccgcacgcagtgaacggactggagaagggggccttgg
                   Beaver  agcttgggccgcaacaacttccccgccaccggcccgcacgcggtgaacgggctggagaagggagcgttgg
                 Squirrel  agcctgggccgcaacaacttccctgctgccgctccgcacgcggtgaacgggctggagaagggagccttgg
                   Rabbit  agcctgggccgcaacaacttccctgccgccgccccgcacgcggtgaacgggctggacaagggagccttgg
                     Pika  agcctggcccgcaacaacttccctgcggctgctccgcacgcggtgaacggactggacaagggcgccttgg
                    Human  agcctgggccgcaacaacttccccgccgccgccccgcacgcggtgaacgggttggagaagggagccctgg
                    Chimp  agcctgggccgcaacaacttccccgccgccgccccgcacgcggtgaacgggttggagaagggagccctgg
                   Bonobo  agcctgggccgcaacaacttccccgccgccgccccgcacgcggtgaacgggttggagaagggagccctgg
                  Gorilla  agcctgggccgcaacaacttccccgccgccgccccgcacgcggtgaacgggttggagaagggagccctgg
                   Rhesus  agcctgggccgcaacaacttccccgccaccgccccgcacgcggtgaacgggttggaaaagggagtcctgg
                 Marmoset  agcctgggccgcaacaacttccccgccgccgccccgcacgcggtgaacgggctggagaagggagccctgg
                  Tarsier  agcctgggccgcaacaacttccctgccaccgccccgcacgcggtgaacgggctggagaagggagccttgg
                 Bushbaby  agcctgggccgcaacaacttccctgccgctgccccgcacgccgtgaacgggctggagaagggagccttgg
               Tree shrew  agcctgggccgcaacaactttcctgccaccgccccgcatgcggtgaacgggctggagaagggaaccttgg
     Malayan flying lemur  agcctgggccgcaacaacttccctgccgcggccccgcacgcggtgaacgggctggagaagggagccttgg
                      Pig  agcctgggccgcagcaacttcccggccgccgccccgcacgcggtgaacgggctggagaagggggccttgg
                  Dolphin  agcctgggccgcagcaacttccccgccgccgccccgcacgcggtgaacgggctggagaagggggccttgg
                      Cow  agcctgggccgcagcaacttccccgccgccgccccgcacgcggtcaacgggctggagaagggggccttgg
                    Sheep  agcctgggccgcagcaacttccccgccgccgccccgcacgcggtcaacgggctggagaagggggccttgg
                    Horse  agcctgggccgcgccagcttccccgccgccgccccgcacgcggtgaacgggctggagaagggagccttgg
         Chinese pangolin  agcctgggccgcaacaacttccctgccgccggcccgcacgcggtgaacgggctggagaagggagccctgg
                      Dog  agcctgggccggaacaacttcccggcggccgccccgcacgcggtgaacgggctggagaagggcgccctgg
       Hawaiian monk seal  agcctgggccggaacaacttcccggccgccgccccgcacgcggtgaacgggctggagaagggagccctgg
                 Hedgehog  agcctaggccgcaacaacttctctgccactgccccgcacgctgtgaacgggctggagaagggagccttgg
                    Shrew  agcttgggccgcaataactttcccgcggccaccccgcacgcggtgaacggcctggagaagggcaccttgg
                 Elephant  agcctaggccgcagcaacttccctgccgccgcgccgcacgcggtgaacgggctggagaagggagccttgg
                   Tenrec  agcttgggccgcagcaacttccccgccgccgcgcctcacgcggtcaacgggctggacaagggcgccctgg
                  Opossum  agtttgggccgcaacaacttttccacccctgccccgcacccggtcaatgggctggagaaagggtctttgg
                  Chicken  agcctgggccggagcagcttccccgctgcagcccagcatgccgtgaacgggctggagaagagctccctgg
            X. tropicalis  agcctgagcagaaaca-cgtttcagtcg--gcccagcatgtcctcaatggcttagagaagagctcactgg
                Zebrafish  ======================================================================

                    Mouse  agcaggaagccaagtacggccaggtgag
                      Rat  agcaagaagccaagtacggccaggtgag
            GCF_003668045  agcaggaggccaagtacggccaggtgag
                   Beaver  agcaggaagccaagtacggccaggtgag
                 Squirrel  agcaggaagtcaagtacggccaggtgag
                   Rabbit  agcaggaagccaagtacgggcaggtgag
                     Pika  aacaggaggccaagtacgggcaggtgag
                    Human  agcaggaagccaagtacggtcaggtgag
                    Chimp  agcaggaagccaagtacggtcaggtgag
                   Bonobo  agcaggaagccaagtacggtcaggtgag
                  Gorilla  agcaggaagccaagtacggtcaggtgag
                   Rhesus  agcaggaagccaagtacggtcaggtgag
                 Marmoset  agcaggaaaccaagtacagtcaggtgag
                  Tarsier  agcaggaagccaagtacggtcaggtgag
                 Bushbaby  agcaggaagccaagtacggtcaggtgag
               Tree shrew  agcaggaagccaagtacggtcaggtgag
     Malayan flying lemur  agcaggaagccaagtacggccaggtgag
                      Pig  agcaagaagccaagtacgctcaggtgag
                  Dolphin  agcaggaagccaagtacgctcaggtgag
                      Cow  agcaggaagccaagtacgcgcaggtgag
                    Sheep  agcaggaagccaagtacgcgcaggtgag
                    Horse  agcaggaggccaagtacgggcaggtgag
         Chinese pangolin  agcaagaagccaagtacggtcaggtgag
                      Dog  agcaggaagccaagtacgctcaggtgag
       Hawaiian monk seal  agcaggaagccaagtacggccaggtgag
                 Hedgehog  aacaagaagccaagtacggtcaggtgag
                    Shrew  agcaggaagccaagtacggtcaggtgag
                 Elephant  agcaggaagccaagtacggtcaggtgag
                   Tenrec  agcaggaagccaagtacggtcaggtgag
                  Opossum  agcaggaggtcaaatatggacaggtaag
                  Chicken  aacaggaggccaagtacagccaggtaaa
            X. tropicalis  aacaggaggtcaagtacagccaggtaag
                Zebrafish  ============================

Inserts between block 16 and 17 in window
B D        X. tropicalis 20321bp

Alignment block 17 of 393 in window, 56746945 - 56746946, 2 bps 
B D                 Mouse  ga
B D                   Rat  ga
            GCF_003668045  ga
                   Beaver  ga
B D              Squirrel  ga
B D                Rabbit  gc
B D                  Pika  ga
B D                 Human  ga
B D                 Chimp  ga
B D                Bonobo  ga
B D               Gorilla  ga
B D                Rhesus  ga
B D              Marmoset  ga
B D               Tarsier  ga
B D              Bushbaby  ga
B D            Tree shrew  ga
B D  Malayan flying lemur  ga
B D                   Pig  ca
B D               Dolphin  ga
B D                   Cow  ga
B D                 Sheep  ga
B D                 Horse  ca
B D      Chinese pangolin  ga
B D                   Dog  ga
B D    Hawaiian monk seal  ga
B D              Hedgehog  ga
B D                 Shrew  ga
B D              Elephant  ga
B D                Tenrec  ga
B D               Opossum  ga
B D               Chicken  g-
B D            Guinea pig  NN
B D             Zebrafish  ==
B D         X. tropicalis  ==

Inserts between block 17 and 18 in window
B D             Bushbaby 3bp
B D                Shrew 11bp
B D              Opossum 1351bp

Alignment block 18 of 393 in window, 56746947 - 56746952, 6 bps 
B D                 Mouse  ---ggagag
B D                   Rat  ---ggagag
            GCF_003668045  ---ggagag
                   Beaver  ---ggcgag
B D              Squirrel  ---ggcgag
B D                Rabbit  ---ggcgag
B D                  Pika  ---ggcgag
B D                 Human  ---ggcgag
B D                 Chimp  ---ggcgag
B D                Bonobo  ---ggcgag
B D               Gorilla  ---ggcgag
B D                Rhesus  ---ggcgag
B D              Marmoset  ---ggcgag
B D               Tarsier  ---ggcgag
B D              Bushbaby  ---ggcgag
B D            Tree shrew  ---ggcgag
B D  Malayan flying lemur  ---ggcgag
B D                   Pig  ---ggcgag
B D               Dolphin  ---cgcgag
B D                   Cow  ---ggcggg
B D                 Sheep  ---ggcggg
B D                 Horse  ---ggcgcg
B D      Chinese pangolin  ---ggtgag
B D                   Dog  ---ggc-ag
B D    Hawaiian monk seal  ---ggcgag
B D              Hedgehog  ---ggcggg
B D                 Shrew  ---ggtggg
B D              Elephant  ---ggcgag
B D                Tenrec  ---ggtgcg
B D               Chicken  gtagac---
B D            Guinea pig  NNNNNNNNN
B D             Zebrafish  =========
B D         X. tropicalis  =========
B D               Opossum  =========

Alignment block 19 of 393 in window, 56746953 - 56746984, 32 bps 
B D                 Mouse  ggct-tggc-c----ag--gc-agctgcc-tggtgtgggggg
B D                   Rat  ggct-tagc-t----cg--gcgggctgcc-tgctgttgggga
            GCF_003668045  ggct-tggc-c----ag--gcaggcctcc-tggtgcggggga
                   Beaver  ggct-tggc-c----ag--gtgggccgcg-tggcggcggggg
B D              Squirrel  ggcc-tggc-c----ag--gtgggccgcg-cgccg--agggg
B D                Rabbit  ggcc-gggg-c----ag--gtgggccgcg-tggcggctgggt
B D                  Pika  cacc-agggcc----ag--gggggccaagagggccgcggggt
B D                 Human  ggtc-aggc-c----ag--gtgggccgcg-tggcggcgggga
B D                 Chimp  ggtc-aggc-c----ag--gtgggccgcg-tggcggcgggga
B D                Bonobo  ggtc-aggc-c----ag--gtgggccgcg-tggcggcgggga
B D               Gorilla  ggtc-cggc-c----ag--gtgggccgcg-tggcggcgggga
B D                Rhesus  ggtc-aggt-c----ag--gtgggtcgct-tggcggcaggga
B D              Marmoset  gtcc-cggc-c----ag--gtggaccgcg-tggcgccgggga
B D               Tarsier  ggcc-aggc-c----ag--gtgggctgcg-tggcagcgggga
B D              Bushbaby  cgcc-cggc-c----at--ttgggccgcg-tggcggcggggg
B D            Tree shrew  ggcc-cagc-c----ag--gtgggccgcg-tggcgacggggg
B D                   Pig  ggcc-ccgc-c----gg--gtgggccgcg-ggg--------g
B D               Dolphin  ggcc-ccgc-c----gg--gtgggccgcg-ggg--------g
B D                   Cow  ggcc-ccgc-c----gg--gtgggccgcg-gcg--------g
B D                 Sheep  ggcc-ccgc-c----gg--gtgggccgcg-ggg--------g
B D                 Horse  ggccgccgg-c----ggccgcgggcggcg-ggg---------
B D      Chinese pangolin  ggcc-ccgt-c----gg--gtgggcagca-gggcagcgggcg
B D                   Dog  ggcc-ccgc-c----gg--ctgcgccgcg-tggcggc-cggg
B D    Hawaiian monk seal  ggcc-ccgc-c----gg--gtgggccgct-tggcggcggggg
B D              Hedgehog  gaga-catg-t----gg-------ctgct-gaa---------
B D                 Shrew  tggg-cgcg-c----gg-------ccacg-gga---------
B D              Elephant  ggtc-gggc-cgcgtgg--ggccgcggc--ggcgagcggggg
B D                Tenrec  gctc-gggc-c----gg--ggccgctgcg-ggctcggggagg
B D               Chicken  -ggc-cggc-c----gg--gtggg----g-gggtgcgtgggg
B D             Zebrafish  ==========================================
B D         X. tropicalis  ==========================================
B D               Opossum  ==========================================

Inserts between block 19 and 20 in window
B D             Hedgehog 16bp
B D                Shrew 1bp
B D              Chicken 7572bp

Alignment block 20 of 393 in window, 56746985 - 56746986, 2 bps 
B D                 Mouse  tt
B D                   Rat  tt
            GCF_003668045  tt
                   Beaver  cg
B D              Squirrel  tt
B D                Rabbit  tt
B D                  Pika  tg
B D                 Human  tt
B D                 Chimp  tt
B D                Bonobo  tt
B D               Gorilla  tt
B D                Rhesus  tt
B D              Marmoset  tt
B D               Tarsier  tt
B D              Bushbaby  tt
B D            Tree shrew  tt
B D                   Pig  tc
B D               Dolphin  tt
B D                   Cow  tt
B D                 Sheep  tt
B D                 Horse  -t
B D      Chinese pangolin  tt
B D                   Dog  tt
B D    Hawaiian monk seal  tc
B D              Elephant  c-
B D                Tenrec  c-
B D            Guinea pig  NN
B D              Hedgehog  ==
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D               Opossum  ==
B D               Chicken  ==
B D                 Shrew  ==
B D  Malayan flying lemur  NN

Inserts between block 20 and 21 in window
B D                Human 1bp
B D                Chimp 1bp
B D               Bonobo 1bp
B D              Gorilla 1bp
B D               Rhesus 1bp
B D             Marmoset 1bp
B D              Tarsier 1bp
B D             Bushbaby 1bp
B D           Tree shrew 14bp
B D                  Pig 1bp
B D              Dolphin 1bp
B D                  Cow 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp

Alignment block 21 of 393 in window, 56746987 - 56747007, 21 bps 
B D                 Mouse  --------gggggttggggg-at-gaaggat
B D                   Rat  ----------------ggag-at-gagggac
            GCF_003668045  ---------------gggag-at-ggaggac
                   Beaver  --------------tgggag-tt-ggaggac
B D              Squirrel  --------------tgggag-gt-ggaggac
B D                Rabbit  ---------------gggcg-gt-ggaggac
B D                  Pika  ---------------gggcc-at-ggaggac
B D                 Human  ---------------aggcg-at-ggaacac
B D                 Chimp  ---------------aggcg-at-ggaacac
B D                Bonobo  ---------------aggcg-at-ggaacac
B D               Gorilla  ---------------aggcg-at-ggaacac
B D                Rhesus  ---------------aggcg-at-ggag-ac
B D              Marmoset  ---------------aggcg-ataagaagac
B D               Tarsier  ---------------gggcg-at-ggagtac
B D              Bushbaby  ---------------gggcg-at-ggaggac
B D                   Pig  ---------------gggcg-ac-gcaggcc
B D               Dolphin  ---------------gggcg-ac-ggaggcc
B D                   Cow  ---------------gggcg-ac-ggagg-c
B D                 Sheep  ---------------gggcg-ac-ggagg-c
B D                 Horse  ---------------gggcg-ct-gcaggac
B D      Chinese pangolin  ---------------gggcg-at-g-aggac
B D                   Dog  ---------------gcgcg-ac-ggaggac
B D    Hawaiian monk seal  ---------------gggcg-ac-gggggac
B D                 Shrew  ---------------cgaag-at-gccaggc
B D              Elephant  gaccggctta-----gggcg-ag-ggag---
B D                Tenrec  g------tgg-----gggcgcag-cgcg---
B D            Tree shrew  ===============================
B D              Hedgehog  ===============================
B D             Zebrafish  ===============================
B D         X. tropicalis  ===============================
B D               Opossum  ===============================
B D               Chicken  ===============================

Inserts between block 21 and 22 in window
           GCF_003668045 15bp
                  Beaver 16bp
B D             Squirrel 16bp
B D               Rabbit 16bp
B D                 Pika 16bp
B D                Human 22bp
B D                Chimp 16bp
B D               Bonobo 16bp
B D              Gorilla 16bp
B D               Rhesus 16bp
B D             Marmoset 16bp
B D              Tarsier 24bp
B D             Bushbaby 16bp
B D                  Pig 7bp
B D              Dolphin 16bp
B D                  Cow 16bp
B D                Sheep 16bp
B D                Horse 17bp
B D     Chinese pangolin 16bp
B D                  Dog 15bp
B D   Hawaiian monk seal 15bp
B D                Shrew 16bp

Alignment block 22 of 393 in window, 56747008 - 56747050, 43 bps 
B D                 Mouse  ------------------gcctc----------------------------------gaag-gggagaag
B D                   Rat  ------------------gcctt----------------------------------gaagagggagaag
            GCF_003668045  ------------------gcctc----------------------------------gacg-gagagaaa
                   Beaver  ------------------gcttt----------------------------------gacg-gacagaag
B D              Squirrel  ------------------gccct----------------------------------aacc-aagaggaa
B D                Rabbit  ------------------gcctc----------------------------------gagc-gaggggag
B D                  Pika  --------------------------------------------------------------gaggcaag
B D                 Human  ------------------gcttc----------------------------------ccgc-gagagaag
B D                 Chimp  ------------------gcttc----------------------------------ccgc-gagagaag
B D                Bonobo  ------------------gcttc----------------------------------ccgc-gagagaag
B D               Gorilla  ------------------gcttc----------------------------------ccgc-gagagaag
B D                Rhesus  ------------------gcttc----------------------------------ccgc-gagagaag
B D              Marmoset  ------------------gcctc----------------------------------ccgg-gagaaaaa
B D               Tarsier  ------------------gcttc----------------------------------ggtc-gagagaag
B D              Bushbaby  ------------------gcctcgactcactgctgtcactatgcggatccctcgtagttgg-gggcgaaa
B D            Tree shrew  ------------------gcctc----------------------------------gacg-gagggaag
B D                   Pig  ----------------------------------------------------------------------
B D               Dolphin  ------------------acctc----------------------------------gaccgaggagagg
B D                   Cow  ------------------gcctc----------------------------------gaccgaggagaag
B D                 Sheep  ------------------gcctc----------------------------------gaccgaggggaag
B D                 Horse  ------------------acctc----------------------------------gaccgaggggcag
B D      Chinese pangolin  ------------------gcttc----------------------------------caccaaggggcag
B D                   Dog  ------------------gcctc----------------------------------gacc-aggggaag
B D    Hawaiian monk seal  ------------------gcctc----------------------------------gacctaggggaag
B D              Hedgehog  ------------------gccca----------------------------------ccagggaaggaag
B D                 Shrew  ------------------ccctg----------------------------------cacttaagaggag
B D              Elephant  gacccaggtcctttctgagcctc----------------------------------gaccgaggggaag
B D                Tenrec  gacccgggccctctctgggcggt----------------------------------cgtcg------ag
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  ctcaggctgg-cgaccc-tctggggcc---------------g
                      Rat  t---ggctgc-cgaccc-actggggcc----------------
            GCF_003668045  t------------gccc-actggtgcc---------------a
                   Beaver  cccagccggg-cgaccc-gttgcggctggatccggactgaacg
                 Squirrel  cccaggctga-ggacct-gctgctgcc---------------a
                   Rabbit  cccgggccgg-cgacccggctgctgac---------------a
                     Pika  cccgagctggtcacccccgttggtgcc---------------a
                    Human  cccaggctgg-cgtccc-tttgctgct---------------a
                    Chimp  cccaggctgg-cgtccc-tttgctgct---------------a
                   Bonobo  cccaggctgg-cgtccc-attgctgct---------------a
                  Gorilla  cccaggctgg-cgtccc-tttgctgct---------------a
                   Rhesus  cccaggctgg-cgcccc-tttgctgct---------------a
                 Marmoset  cccaggcccg-cgccca-tttgctgct---------------a
                  Tarsier  cccaggcccg-cg-----gttgctgac---------------a
                 Bushbaby  ttgaggtccc-agcgcc-ttgacaccc---------------a
               Tree shrew  cccgggctgg-cgaccc-tttgctgcc---------------a
                      Pig  -ccaggccga-ctaccc-ctggaggcc---------------a
                  Dolphin  cccaggtcca-ctcccc-gtggcggcc---------------a
                      Cow  ccctggccgc-ctcccc-gtgacggcc---------------a
                    Sheep  ccctggccgc-ctcccc-gtgacggcc---------------a
                    Horse  tccaggccga-ggaccc-gtcgcggcc---------------a
         Chinese pangolin  cccagaccgg-ctacac-gtcgccgcc---------------g
                      Dog  ccgcggccga-cccccc-gccaatgcc---------------g
       Hawaiian monk seal  cccaggccga-ccaccc-gtcactgcc---------------g
                 Hedgehog  ----ggtcaa-gctatg-tcggccacc---------------c
                    Shrew  ----ggcc----ccctc-gcggcggcc---------------c
                 Elephant  cccaggccga-cctccc-gggactgcc---------------t
                   Tenrec  cccagcccgg-tcccct-ggg---gcc---------------t
                Zebrafish  ===========================================
            X. tropicalis  ===========================================
                  Opossum  ===========================================
                  Chicken  ===========================================

Inserts between block 22 and 23 in window
B D     Chinese pangolin 807bp
B D             Hedgehog 22bp
B D                Shrew 16bp

Alignment block 23 of 393 in window, 56747051 - 56747249, 199 bps 
B D                 Mouse  -------------------------gga----------------ggcgga-accc------ggctaggct
B D                   Rat  -------------------------gga----------------gatgga-tccc------gggttggct
            GCF_003668045  -------------------------gga----------------gatggg-tccc------aggttgact
                   Beaver  -------------------------ggg----------------gctcgg-gcct------tggaaggcg
B D              Squirrel  -------------------------cta----------------gccgga-atcc------cagtcgatg
B D                Rabbit  -------------------------gga----------------gcccgacgctcagttgctggggggcg
B D                  Pika  -------------------------gga----------------acccga-gttc---------------
B D                 Human  -------------------------cga----------------gccaga-tcct------tcgtggact
B D                 Chimp  -------------------------cga----------------gccaga-tcct------tcgtggact
B D                Bonobo  -------------------------cga----------------gccaga-tcct------tcgtggact
B D               Gorilla  -------------------------cga----------------gccaga-tcct------tcgtggacc
B D                Rhesus  -------------------------cca----------------gtcaga-tcct------tcgtggact
B D              Marmoset  -------------------------cca----------------gccaga-tcct------ctgtgcttt
B D               Tarsier  -------------------------cga----------------gccggg-gccc------cggttgatt
B D              Bushbaby  -------------------------ctagggtcggggagcgctcgccagg-gcac------atacagact
B D            Tree shrew  -------------------------ctt----------------gtcgga-ttcc------acgttgatt
B D                   Pig  -------------------------cga----------------gcctga-agcc------gaggtgacg
B D               Dolphin  -------------------------cga----------------gcccca-agcc------ggggcaatg
B D                   Cow  -------------------------cga----------------gcccca-ggcc------acggcggcg
B D                 Sheep  -------------------------cga----------------gccccg-ggcc------agggcggcg
B D                 Horse  -------------------------cga----------------gcccga-tgcc------cggttgccc
B D                   Dog  -------------------------gga----------------gcccat-t-cc------gggtcgggc
B D    Hawaiian monk seal  -------------------------gga----------------gtccta-t-cc------cggtcggct
B D              Hedgehog  --------------------------gg------------------c------tc------agatcctcc
B D                 Shrew  --------------------------gg----------------gcc------cc------aggcccccg
B D              Elephant  cgagccttatccgggcagattggggcgt----------------gaccaa-agcc------cgg-ccttc
B D                Tenrec  cgagct-----------------ggcct----------------ggcgca-aacc------cggaccccc
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D      Chinese pangolin  ======================================================================

                    Mouse  gagtctg--------ggcc-taggg--ct-------------------------------------gggc
                      Rat  gagtctg--------ggct-gatgc--ct-------------------------------------gggt
            GCF_003668045  aagtctg--------ggct-gaagt--tt-------------------------------------gagt
                   Beaver  gagtgag--------gcct-ccacc--ctgcca--------------------------------agggc
                 Squirrel  gaggcaggacag--aggct-gctgc--ctccga------------------------gg----gcagagt
                   Rabbit  ggacggc--------ggtt-cgggc--ctccga------------------------gg----gcggagc
                     Pika  -----ga--------ggct-cgggc--ctgaga------------------------gggagcgcagagt
                    Human  ggggcgaagcag--aggcc-tgagc--cttgga------------------------ag----gcggagc
                    Chimp  ggggcgaagcag--aggcc-tgagc--cttgga------------------------ag----gcggagc
                   Bonobo  ggggcgaagcag--aggcc-tgagc--cttgga------------------------ag----gcggagc
                  Gorilla  ggggcgaagcag--aggcc-tgagc--cttgga------------------------ag----gcggagc
                   Rhesus  ggggctaagcag--aggcc-cgagc--cttgga------------------------ag----gcggagc
                 Marmoset  ggggtgaaacag--aggcc-cgggc--cttcga------------------------ag----gcggagc
                  Tarsier  gggagggaacag--aggtc-cg-gc--ctcccg------------------------ag----gcagagc
                 Bushbaby  ggggtgccagct--aggc------c--cttggg------------------------aa----gc-----
               Tree shrew  ggggaggaacag--aggcc-cgggc--cttcct------------------------gg----gcggagt
                      Pig  gggctg--------aggcc-tcgac--ccccg------------------------------------gc
                  Dolphin  ggggcgggacag--aggcc-cggac--ccgcga------------------------gg----gcgtagt
                      Cow  ggggcgggaca---acgcc-cagac--gcgcga------------------------gg----gcggggt
                    Sheep  gggccgggacgggtacgcc-cagacgggcgcga------------------------gg----gcgggtt
                    Horse  ggcgcgggacag--aggcc-c-gac--cctcga------------------------gg----gcgctgt
                      Dog  gaggcgggaccg--gggcc-cggag--cttccg------------------------gg----gcgcagt
       Hawaiian monk seal  gaggcgggaccg--aggcc-cggac--cgtccg------------------------gg----gcggagt
                 Hedgehog  agggcagagtag--aggcc-agact--cctccc------------------------c------------
                    Shrew  acgacc---tcg--aggac-aggac--ccccgt------------------------cg----c------
                 Elephant  gaggcggagccg--aggcctcggcc--ctcgcccccgggagctcagagccctggtcggg----acgtaag
                   Tenrec  gcggtggagccc--aggcc-cgggc--ctccccgcggggtgc---------------gg----gcgcacg
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  aaaagcc-------tggc-atccagcc-----------------------------------------gc
                      Rat  taaagcc-------tagc-atcccgcc-----------------------------------------gc
            GCF_003668045  agaagtc-------taac-atcccgct-----------------------------------------gc
                   Beaver  cgcggcctccgggatggt-ggctcgcc-----------------------------------------gg
                 Squirrel  tgaggcc---------ac-gaccc-ct-----------------------------------------tc
                   Rabbit  tgaggcc-------tcga-ccctcgcc-----------------------------------------ag
                     Pika  tgaggcc-------tgga-tc-------------------------------------------------
                    Human  tggggcc-------tcga-cccccgccaggggccgg------------------gagcgctcgtcagggc
                    Chimp  tggggcc-------tcga-cccccgccaggggccgg------------------gagcgctcgtcagggc
                   Bonobo  tggggcc-------tcga-cccccgccaggggccgg------------------gagcgctcgtcagggc
                  Gorilla  tgggacc-------tcga-cccccgccaggggccgg------------------gagctctcgtcagggc
                   Rhesus  tggggcc-------tcga-cccctgccaggggtcgg------------------gagagctcgccagggc
                 Marmoset  ttgggcc-------tcaaccccccgccaggggccgggagcgctcgccagggcgcggg-------------
                  Tarsier  ggaggcc-------tcga-cccccgccagggtcccg------------------gggcgctcg-cacagc
                 Bushbaby  -----------------a-cccccaggcctgtttgg--------------------------------cc
               Tree shrew  tgaggtt-------tcgt-cccccgccgggaggcta------------------ccgcgcgctccgaggc
                      Pig  -cgggcc-------ccgg-agcggcgg-------------------------------------------
                  Dolphin  -gaggcc-------tcga-ccccc----------------------------------------------
                      Cow  -gaggcc-------tcga-cccctcgg-------------------------------------------
                    Sheep  -gaggcc-------tcga-cccgc--g-------------------------------------------
                    Horse  ggaggcc-------tcg--ccccgcgccg---------------------------------------gg
                      Dog  tgaggcc-------tcga-cccccccccc---------------------------------------cc
       Hawaiian monk seal  tgaggcc-------tcga-ccccccgc-------------------------------------------
                 Hedgehog  -----ct-------ccgc-ccgaggtcgg---------------------------------------ga
                    Shrew  -gacgcc-------ccgc-cagag----------------------------------------------
                 Elephant  -ggggct-------tcgg-gccgcggc---------------------------------tccccgaggc
                   Tenrec  tggggct-------gcga-ac----------------------------------------------ggt
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  gc-ct-----------gtggcc-cc------------------cag------------------------
                      Rat  gc-ct-----------gtgg-c-tc------------------caa------------------------
            GCF_003668045  ac-gt-----------ttggcc-cc------------------cag------------------------
                   Beaver  gc--------------gcgacc-ctggg---------------aag------------------------
                 Squirrel  ac-cc-----------gcgccc-gc------------------cag------------------------
                   Rabbit  ga--------------gtgggc-ctgggt--------------cag------------------------
                     Pika  ----------------gctggt-ccg-----------------ccc------------------------
                    Human  gc-tg-----------ggggtc-tggggc------------ggcag-ctccccggggcgaggctctggga
                    Chimp  gc-tg-----------ggggtc-tggggc------------ggcag-ctccccggggcgaggctctggga
                   Bonobo  gc-tg-----------ggggtc-tggggc------------ggcag-ctccccggggcgaggctctggga
                  Gorilla  gcggg-----------ggggtc-tggggc------------ggcag-ctccccggggcgaggctctggga
                   Rhesus  gc-gg-----------ggggtc-tggggc------------ggtgg-ctccccggggcgcggctctggga
                 Marmoset  ------------------ggtc-tggggc------------ggccg-ctccccggggcgcggctctggga
                  Tarsier  gc-gc-----------ggggtcagggggc------------ggcggcccccccgaggcgtggccctggga
                 Bushbaby  gc-tg-----------gacatt-ttagaa------------gtccg------------------------
               Tree shrew  gc-tc-----------ggggtc-tccggc------------ggcgg-ct-ctcggggcgcagcacttgga
                      Pig  -t-tg-----------c----c-cgaagc-------------gctg-----------------ccctgga
                  Dolphin  ------------------------------------------gcgg-----------------ccctgga
                      Cow  -c-tg-----------gaggcc-cggggc------------ggcgg-----------------ccctgga
                    Sheep  -c-cg-----------g----c-cggagc-------------gcgg-----------------gcctgga
                    Horse  cc-gg-----------gggcct-gggaggcggctccccgggcgcgg------------------cctgga
                      Dog  gc-gc-----------ccgccc-ccgcgcccg-----cccccgcgg--------------------tgga
       Hawaiian monk seal  -c-ag-----------gagccc-aggagcccggggtcctggggcgg--------------------tgga
                 Hedgehog  tc-tggggcagaggcagctccc-taaggc-------------cggg-----------------ccctgga
                    Shrew  ----------------gctccc-cgaggc-------------ctgg-----------------tttcgga
                 Elephant  ag-gc-----------gcggcc-cgggaa----------------g------------------------
                   Tenrec  cc-gg-----------gcggcc-gggccc----------------g------------------------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  --cccttcca----gg----ccag-cc-------gggttt------------------------------
                      Rat  --accttcca----gc----ccag-cc-------gggttc------------------------------
            GCF_003668045  --ccctttcactacac----ctag-cc-------gatctc------------------------------
                   Beaver  --cgcctcca----gg----ccgg-tt-------tggcctcc----------------------------
                 Squirrel  ---------a----gg----ccag-ga-------gcgctcgccag-------------------------
                   Rabbit  --cgcctgca----gg----cccg-tg-------tggcttcg----------------------------
                     Pika  --cgcctgca----gg----ccc--cg-------tggcttcc----------------------------
                    Human  agcgcctcca----gg----cctg-tc-------ggcctccgggagcttggggaggcggctcccgaagcc
                    Chimp  agcgcctcca----gg----cctg-tc-------ggcctccgggggcttggggaggcggctcccgaagcc
                   Bonobo  agcgcctcca----gg----cctg-tc-------ggcctccgggggcttggggaggcggctcccgaagcc
                  Gorilla  agcgcctcca----gg----cctg-tc-------ggcctccgggggcttgggga----------------
                   Rhesus  agcgcctcca----gg----cctc-tc-------ggcctctgggggcttggagaggcggctcccgaagcc
                 Marmoset  agcgcctcca----gg----cctt-tc-------ggtctctggaggcttggggaggcggctcccgaag-c
                  Tarsier  agcgcctcta----ag----cctgctt-------ggcctttgggggctcggggaggcctcgcctgagccc
                 Bushbaby  --tgcctaaa----gc----ccac-tc-------ggctcctcgca-------------------------
               Tree shrew  agagcctcca----gg----tctgttt-------ggcccctggaggt--------------------gcc
                      Pig  aatgcgttcg----gg----cctattt-------ggct-ccggaggctcggggaggccgcgcc-------
                  Dolphin  agcgcctccg----gg----cctgctc-------ggccgctggaggcgcggggaggtcgcgcc-------
                      Cow  agcgcctcgg----gg----cc-tgtt-------ggcc-----aaac------ggcttgcgcc-------
                    Sheep  agcgcctcgg----gg----ccttgtg-------ggcc-----aaac-----gggcttgcgcc-------
                    Horse  ggcccctgca----gg----cctctgg-------ggccggt---ggagcggggaggccgcgcc-------
                      Dog  ggcgccgccg----gg----cccgcct-------ggcctccgc-ggcgcggggaggcggcgcc-------
       Hawaiian monk seal  agcgcctcca----gg----cctgcgt-------ggcctctgcaagcgccgggaggccgcgcc-------
                 Hedgehog  agtgccccca----aa----cctactt-------ggcctctggaggctcaggcaggccgagc--------
                    Shrew  agcagccccg----caggcgcccgctgaccaagaggccgcaggaggcgcggggaggccgcgc--------
                 Elephant  --cgcttcca----gg----cctgctt-------ggcctctggaggg-----gaggccgcgtg-------
                   Tenrec  --cg----------------------t-------ggcctcgggaggagccgcgaggccgcatc-------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  ------------------------------------------a--g--tcaagc----ca--------ag
                      Rat  ------------------------------------------a--g--tctatc----ca--------ag
            GCF_003668045  ------------------------------------------a--g--ttaacc----ca--------ag
                   Beaver  ----------------------g------------------ga--g--cgcccg----ca--------gg
                 Squirrel  ----------------------g------------------gc--g--tgtgcc----ct--------gg
                   Rabbit  ------------------------------------------a--g--agcgca----cg--------ga
                     Pika  ------------------------------------------c--c--agcgcg----cg--------gg
                    Human  ctttcggcggctctcgttggggg----------------taga--g--ttaacc----aa--------ag
                    Chimp  ctttcggcggctctcactggggg----------------taga--g--tcaacc----aa--------ag
                   Bonobo  ctttcggcggctctcactggggg----------------taga--g--tcaacc----aa--------ag
                  Gorilla  -----ggcggctgtcattggggg----------------taga--g--ttaacc----aa--------ag
                   Rhesus  ctttcagcggctctcattgaggg----------------taga--g--ttaacc----aa--------ag
                 Marmoset  ctttcagcgactcatattggggg----------------taga--g--ttagcc----aa--------ag
                  Tarsier  -----------------tagtggctgcttgccttgaggctaga--t--ttaacc---aaa--------aa
                 Bushbaby  -----------------cggggc----------------taga--g--ttaacc----aa--------ag
               Tree shrew  -----------------cggagg----------------ccgt--gcctgaacctttcag--------tg
                      Pig  ---------------------------------------tgaa--g--cccatt----cg----------
                  Dolphin  ---------------------------------------tgaa--g--ccttt---------------aa
                      Cow  ---------------------------------------ccag--c--cctctc----cgcggctcg-ag
                    Sheep  ---------------------------------------cggagcc--cctctc----cgcggctcgaag
                    Horse  ---------------------------------------tgag--c--cttcct----gc--------cg
                      Dog  ---------------------------------------tgaa--g--cccac-----------------
       Hawaiian monk seal  ---------------------------------------cgaa--g--ccca------------------
                 Hedgehog  ----------------------------------------aag--g--ca--------------------
                    Shrew  ----------------------------------------gaa--g--cgctcg----ga--------gc
                 Elephant  ---------------------------------------tcaa--g--gccttt----ct--------gc
                   Tenrec  ---------------------------------------tcag--g--ccttcc----ct----------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  g--------------------------ccg------agct-------------tt--gg-----------
                      Rat  g--------------------------ccg------agct-------------tc--gg-----------
            GCF_003668045  g--------------------------ccg------agct-------------tc--gg-----------
                   Beaver  c--------------------------ctgtccgctaccc-------------cc--gg-----------
                 Squirrel  g--------------------------aag------cgct-------------ttcagg-----------
                   Rabbit  ggccgcaactgaagccccttcggctgctcg------cgcc-----------------gg-----------
                     Pika  g--------------------------ccg------tgcc-----------------gg-----------
                    Human  a--------------------------agg------cgct-------------tc--tg-----------
                    Chimp  a--------------------------agg------cgct-------------tc--tg-----------
                   Bonobo  a--------------------------agg------cgct-------------tc--tg-----------
                  Gorilla  a--------------------------agg------cgct-------------tc--tg-----------
                   Rhesus  a--------------------------agg------cgct-------------tc--cg-----------
                 Marmoset  a--------------------------aga------ccct-------------tc--cg-----------
                  Tarsier  a--------------------------agg------cgct-------------tc--cg---------a-
                 Bushbaby  a--------------------------aga------gtct-------------tc--ca-----------
               Tree shrew  t--------------------------gtt------cgca-------------tc--cg-----------
                      Pig  ---------------------------gcg------gctc-------------gc--gt-cgggccccgc
                  Dolphin  c--------------------------gcg------gctc-------------gc--gtcggggtacac-
                      Cow  t--------------------------cgg------ggct-------------ac--ag-----------
                    Sheep  t--------------------------cgg------ggcc-------------ac--at-----------
                    Horse  c--------------------------tct------gctc-------------gc--cg-----------
                      Dog  ------------------------------------------------------c--cg-----------
       Hawaiian monk seal  ---------------------------------------------------------cg-----------
                 Hedgehog  ------------------------------------------------------t--ag-----------
                    Shrew  t--------------------------gcg------gccg-------------tc--gg-----------
                 Elephant  tgctggtac------------------aag------ggctggagttatggagatg--cg-----------
                   Tenrec  -----------------------------g------ggccggcg---------ag--cg-----------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  --cacggcc-------a--gg---------ctt--tg---ggg---ttc------------ga------g
                      Rat  --cacggcc-------a--ga---------ctt--tg---ggg---ttc------------ag------a
            GCF_003668045  --agtggcc-------g--gg---------ctt--tg---ggc---ttt------------ag------a
                   Beaver  --cggggct-------g--ga---------------g---gtc---acc------------aa------a
                 Squirrel  --cctgttt-------g--ga---------cc----g---gg----------------------------
                   Rabbit  --ccagggt-------t--aa---------ccg--ca---gca---g-----------------------
                     Pika  --ct------------------------------------------------------------------
                    Human  --aagggcc-------g--agcggagcagccct--gg---ggc---ctc------------ag------a
                    Chimp  --aagggcc-------g--ggtggagcggccct--gg---ggc---ctc------------ag------a
                   Bonobo  --aagggcc-------g--ggcggagcggccct--gg---ggc---ctc------------ag------a
                  Gorilla  --aagggcc-------g--ggcggagcagccct--gg---ggc---ctc------------ag------a
                   Rhesus  --aagggcc-------a--ggcggagcagccct--gg---ggc---ctc------------ag------a
                 Marmoset  --aagggcc-------g--ggtcgagcaaccct--gg---ggc---ttc------------gg------a
                  Tarsier  --aaaggct-------g--ggcctcgcggccct--gg---ggt---ctc---------------------
                 Bushbaby  --atagggc-------g--agc-aagcag-cct--gg---gat---ccc------------cg------a
               Tree shrew  --gctggc------------gttgaccaaagaa--gg---cgc---ttctccatgctgagccg------a
                      Pig  actt--acc-------c--gggaaggcggctcc--ga---ggg---g-c------------gg------g
                  Dolphin  --tt--acc-------c--gggaaggcgcctcc--ga---ggg---gcc------------gg------g
                      Cow  --tc--acc-------t--gggacggcgtctcc--ga---ggg---gcc------------ag------g
                    Sheep  --tc--acccc--ggac--gggacggcgtctcccgag---ggg---gcc------------ag------g
                    Horse  --gc--gctgcagggac--gggcaggcgctccg--gg---agg---gcc------------cg------g
                      Dog  --gccggccgctcgcac--gggctggcgagccg--gg-cctgg---gtc------------ct------c
       Hawaiian monk seal  --gc--gctgctcgcacaggggctggtgaccca--cg-cgaggcgcgtc------------cg------c
                 Hedgehog  --ag--acc-------c--gg--------------gggaaggt---gct------------cgcaaaagg
                    Shrew  --gg--gcc-------c--ga----gtgtctcc--gggacggc---gcg------------cgcgc---g
                 Elephant  --aaaggca-------c--ggccaggtggcctg--gg---gcc---ccc------------ag------a
                   Tenrec  --ccaggcc-------c--ggc------gcccg--gg---gcc---ccg------------gg------a
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  -----gggc------------------------------gc-------c-------------c----cg-
                      Rat  gcagcgagc------------------------------gc-------c-------------c----gg-
            GCF_003668045  g----cagc------------------------------gc-------c-------------c----tg-
                   Beaver  ga---aggg------------------------------gc-------c-------------t----cg-
                 Squirrel  -----gagc------------------------------gc-------c---------------------
                   Rabbit  -----gagc------------------------------gt-------g-------------c-------
                     Pika  ----------------------------------------------------------------------
                    Human  g----ccgc------------------------------gc-------c-------------ttca-cg-
                    Chimp  g----ccgc------------------------------gc-------c-------------ttca-cg-
                   Bonobo  g----ccgc------------------------------gc-------c-------------ttca-cg-
                  Gorilla  g----ccgc------------------------------gc-------c-------------ttca-cg-
                   Rhesus  c----ccgc------------------------------ac-------c-------------ttca-cg-
                 Marmoset  g----ccg--------------------------------c-------c-------------tcca-cg-
                  Tarsier  ----------------------------------------------------------------ca-cg-
                 Bushbaby  g----cagc------------------------------gc-------t-------------tcca-ct-
               Tree shrew  g----cggccgggttcccggggcagcgcgggcccccacggc-------c-------------tcca-cg-
                      Pig  c----aagc------------------------------gg-------c-------------gatg-ggc
                  Dolphin  a----gagc------------------------------gg-------c-------------cgtg-gg-
                      Cow  c----gagc------------------------------gg-------c-------------cgtg-gg-
                    Sheep  c----ga-c------------------------------gg-------c-------------c----tg-
                    Horse  c----cagc------------------------------gg-------c-------------ctcc-tc-
                      Dog  g----gagc------------------------------gg-------c-------------ctccgtg-
       Hawaiian monk seal  a----gggc------------------------------cgggcgaccc-------------cgctggg-
                 Hedgehog  c----gtgc------------------------------gg-------agccccctgcgtctctc--tg-
                    Shrew  g----gtgc------------------------------gg-------g-------------ctc--gg-
                 Elephant  g----caac------------------------------gc-------g-------------ggtg-gg-
                   Tenrec  c----ccgc------------------------------gc-------g-------------ggc--gg-
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  tt-----agt-----------g--------agctgc-g---cctggaggcctc-----------------
                      Rat  ct-----agc-----------g--------ggctgc-g---cctggag----------------------
            GCF_003668045  cc-----agc-----------g--------ggctgcag---cctggacaccgc-----------------
                   Beaver  cc-----gactcggcttctcag--------cgcagc-g---ccgcggcctcgc-----------------
                 Squirrel  -------ggc-----------a--------ggccgc-g---cctgaagcccttccgttattcgcaaaggg
                   Rabbit  -------gaa-----------g--------ggccgc-g---t-------ccgt-----------------
                     Pika  -------------------------------gacgc-g---tt----aacctt-----------------
                    Human  cc-----cgc-----------g--------aaacgc-g--------------------------------
                    Chimp  cc-----cgc-----------g--------aaacgc-g--------------------------------
                   Bonobo  cc-----cgc-----------g--------aaacgc-g--------------------------------
                  Gorilla  cc-----cgc-----------g--------aaacgc-g--------------------------------
                   Rhesus  cc-----cgc-----------g--------aaacgc-g--------------------------------
                 Marmoset  cc-----cgc-----------g--------aaatgc-c--------------------------------
                  Tarsier  cc-----agc-----------g--------ggtcgc-g--------------------------------
                 Bushbaby  cc-----tca-----------a--------aag----g--------------------------------
               Tree shrew  cc-----cgc-----------c--------aaatgc-g--------------------------------
                      Pig  tcccc--agc-----------t--------gcgcgc-g---gcgcgag----------------------
                  Dolphin  ttccc--agc-----------t--------gcgcgc-g---ggacgag----------------------
                      Cow  ttccc--agc-----------t--------gcgcgc-g---cggcgag----------------------
                    Sheep  ttccc--agc-----------t----------gcgc-g---cggcgag----------------------
                    Horse  tccgccgagc-----------g--------cctgcc-g----aggtcg----------------------
                      Dog  cccgcgaagc-----------g-------cacgccc-g----aggtcg----------------------
       Hawaiian monk seal  ttctcagggc-----------g--------acgccc-g---ccgagcg----------------------
                 Hedgehog  acc----agc-----------a--------ccagct-ggcatgtcttc----------------------
                    Shrew  gccgcggggc-----------g--------ccgtct-g--------------------------------
                 Elephant  -------agc-----------gcctcggacgcccgc-g---acacgcgcgc-------------------
                   Tenrec  -------agc-----------g--------gcccgc-a---------gcgc-------------------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  -------------------------------a----a-gccaga-gtcgc-a--
                      Rat  --------------------------------------gccgga-gtcgc-a--
            GCF_003668045  -------------------------------c----a-gctgga-gtcgc-a--
                   Beaver  -------------------------------a----c-gccccaggtcgc-g--
                 Squirrel  gctagaattaaccaaaaaaggaatttcctaaa----g-gccggg-gcctc-g--
                   Rabbit  -------------------------------g----g-cctcgg-gtcgc-g--
                     Pika  -------------------------------a----a-cctggg-gtcgc-a--
                    Human  -------------------------------c----g-ccccgg-gtctc-g--
                    Chimp  -------------------------------c----g-ccccgg-gtctc-g--
                   Bonobo  -------------------------------c----g-ccccgg-gtctc-g--
                  Gorilla  -------------------------------c----g-ccccgg-gtctc-g--
                   Rhesus  -------------------------------c----g-caccgg-gtctc-g--
                 Marmoset  -------------------------------c----g-ccccgg-gtctc-g--
                  Tarsier  -------------------------------c----g-cccagg-gtcgc-g--
                 Bushbaby  -------------------------------c----a-caggag-gtcgc-g--
               Tree shrew  -------------------------------c----g-cccgag-gtcgc-g--
                      Pig  -------------------------------c----g-gcccgc-acgcc-c--
                  Dolphin  -------------------------------c----g-gtctgc-acgcc-c--
                      Cow  -------------------------------c----g-gcctgt-acgcc-c--
                    Sheep  -------------------------------c----c-ggcggc-gcgac-a--
                    Horse  -------------------------------g----g-ccgtgc-gca---c--
                      Dog  -------------------------------c----g-gcctgc-gggtc-g--
       Hawaiian monk seal  -------------------------------c----acgcttgc-gggtctg--
                 Hedgehog  -------------------------------c----a-ccctct-gccct-g--
                    Shrew  -------------------------------c----a-gccgcg-aagct-c--
                 Elephant  -------------------------------cctgaa-gtcggg-gccct-gcg
                   Tenrec  -------------------------------c----g-gccggt-ggatc-gcg
                Zebrafish  ======================================================
            X. tropicalis  ======================================================
                  Opossum  ======================================================
                  Chicken  ======================================================
         Chinese pangolin  ======================================================

Inserts between block 23 and 24 in window
B D                 Pika 71bp
B D                Human 13bp
B D                Chimp 13bp
B D               Bonobo 13bp
B D              Gorilla 13bp
B D               Rhesus 13bp
B D             Marmoset 13bp
B D              Tarsier 9bp
B D             Bushbaby 8bp
B D           Tree shrew 12bp
B D                  Pig 1bp
B D              Dolphin 1bp
B D                  Cow 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp
B D             Hedgehog 1bp
B D                Shrew 1bp

Alignment block 24 of 393 in window, 56747250 - 56747257, 8 bps 
B D                 Mouse  agg-cttgt------
B D                   Rat  agg-cttgt------
            GCF_003668045  agg-cttgt------
                   Beaver  cggccctga------
B D              Squirrel  cag-cctgg------
B D                 Human  -a-------------
B D                 Chimp  -a-------------
B D                Bonobo  -a-------------
B D               Gorilla  -a-------------
B D                Rhesus  -g-------------
B D              Marmoset  -a-------------
B D               Tarsier  -a-------------
B D              Bushbaby  -a-------------
B D                   Pig  ------agg------
B D               Dolphin  ------agg------
B D                   Cow  ------agg------
B D                 Sheep  ------agg------
B D                 Horse  ------agg------
B D                   Dog  ------ggg------
B D    Hawaiian monk seal  ------ggg------
B D              Hedgehog  ------aag------
B D                 Shrew  ------agg------
B D              Elephant  -------gggactgc
B D                Tenrec  -------ggca----
B D            Guinea pig  NNNNNNNNNNNNNNN
B D            Tree shrew  ===============
B D                  Pika  ===============
B D             Zebrafish  ===============
B D         X. tropicalis  ===============
B D               Opossum  ===============
B D               Chicken  ===============
B D                Rabbit  ---------------
B D      Chinese pangolin  ===============
B D  Malayan flying lemur  NNNNNNNNNNNNNNN

Inserts between block 24 and 25 in window
B D                  Pig 2bp
B D              Dolphin 2bp
B D                  Cow 2bp
B D                Sheep 2bp
B D                Horse 2bp
B D                  Dog 2bp
B D   Hawaiian monk seal 2bp
B D             Hedgehog 2bp
B D                Shrew 2bp

Alignment block 25 of 393 in window, 56747258 - 56747297, 40 bps 
B D                 Mouse  gg-----ga-ggctg-c----g---------------ggctc-------------c-tgtg---------
B D                   Rat  gg-----ga-ggctg-c----g---------------gggtc-------------a-tgtg---------
            GCF_003668045  gg-----gc-ggctg-c----g---------------ggc-c-------------c-cgtg---------
                   Beaver  gg-----ga-ccctg-a----g---------------ggacc-------------c-tgtgggaccctgg
B D              Squirrel  ggttctcag-aactg-c----gcccgacatggatcgcggcct-------------c-cgag---ccaggg
B D                Rabbit  ----------agctg-c----acc-------------ggctc-------------c-cgca---------
B D                 Human  -----ctgc-ggctg-c----g---------------gggtc-------------ctcacg---------
B D                 Chimp  -----cggc-ggctg-c----g---------------gggtc-------------ctcacg---------
B D                Bonobo  -----cggc-ggctg-c----g---------------gggtc-------------ctcacg---------
B D               Gorilla  -----cggc-ggctg-c----a---------------gggtc-------------ctcacg---------
B D                Rhesus  -----cagc-ggctg-c----g---------------gggtc-------------ctcagg---------
B D              Marmoset  -----cggc-ggctg-t---gg---------------gggtc-------------ctcgcg---------
B D               Tarsier  -----ctgc--gctg-c----g---------------ggctc-------------ctggcg---------
B D              Bushbaby  -----ccgccggctg-c----a---------------gcgtc-------------cccgcg---------
B D            Tree shrew  ------ggc-gaacg-c----g---------------gggtc---------------cgtg---------
B D  Malayan flying lemur  ------ggc-ggcctcc----g---------------gggtc-------------ctcgcg---------
B D                   Pig  --------------g-c----g---------------gccct----gcggct--cctcccg---------
B D               Dolphin  --------------g-c----g---------------ccgct----gcggct--cctcccg---------
B D                   Cow  --------------g-c----g---------------gcgcc----gcggct--cctcccg---------
B D                 Sheep  --------------g-c----g---------------gcgcc----gcgtct--actcccg---------
B D                 Horse  --------------g-c----g---------------gggcc---------------cacg---------
B D                   Dog  --------------g-c----g---------------gggcc-------------ctcgcg---------
B D    Hawaiian monk seal  --------------g-c----g---------------gggtc-------------cgcacg---------
B D              Hedgehog  --------------g-cagcag---------------aggccactggctgctgtcctcatg---------
B D                 Shrew  --------------a-acgtgg---------------gggac-----caggcggccacgcg---------
B D              Elephant  ---------gggctg-c----c---------------ggggc-------------ctcgcg---------
B D                Tenrec  ---------gggcgg-t----c---------------gggcc-------------ggcagg---------
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D      Chinese pangolin  ======================================================================

                    Mouse  -------------------------cac-----agaca--gc-------t-cc--------------ctg
                      Rat  -------------------------cac-----agaca--gc-------tccc--------------ccg
            GCF_003668045  -------------------------caa-----agaca--gt-------tccc--------------ctg
                   Beaver  ccaccg---------cgcctcgc-cctc-----ggaca--gt-------tccc--------------ctg
                 Squirrel  gcgcaggaggatggtcgctcggc-cctg-----gggga--cc-------ccgc--------------ctg
                   Rabbit  ---------------gcctccacgcccg-----agccc--gc-------ggcc--------------ctg
                    Human  -------------------------ttc-----ggact--tt-------ctct--------------ccg
                    Chimp  -------------------------ttc-----ggact--tt-------ctct--------------ccg
                   Bonobo  -------------------------ttc-----ggact--tt-------ctct--------------ccg
                  Gorilla  -------------------------ttc-----ggact--tt-------ctct--------------ccg
                   Rhesus  -------------------------ctc-----ggact--tt-------ccct--------------ccc
                 Marmoset  -------------------------ctc-----ggact--tt-------tgcc--------------ccc
                  Tarsier  -------------------------ctg-----ggaca--tt-------cccc--------------gcc
                 Bushbaby  -------------------------ctc-----ggccaggtc-------cgct--------------act
               Tree shrew  -------------------------gtc-----ggaca--tttc-----tccc--------------act
     Malayan flying lemur  -------------------------ctc-----ggaca--ctgc-----ccct--------------gcc
                      Pig  -------------------------tgc-----ggacg--gtcg--gcgccgc--------------ggc
                  Dolphin  -------------------------cgc-----gggcg--gt-------ccgc--------------ggc
                      Cow  -------------------------cat-----ggacg--gc-------ccgc--------------ggc
                    Sheep  -------------------------cgc-----ggacg--gt-------ccgc--------------ggc
                    Horse  -------------------------ctc-----ggagc--tgttgcgcgccct--------------ggc
                      Dog  -------------------------ccc-----ggcgg--gctctcgtgccgc--------------ggc
       Hawaiian monk seal  -------------------------ctc-----ggaca--tttctcgggccgt--------------ggc
                 Hedgehog  -------------------------gta-----ggccg--cttcgcttcccac--------------tcc
                    Shrew  -------------------------gtgctcgcgtcca--ctccacccccagc--------------cca
                 Elephant  -------------------------ctt-----ggacg--tttcggtgactctcagaaaacgaacaaccg
                   Tenrec  -------------------------ctc------------ctgcggaagctcc--------------ctc
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  tc----g
                      Rat  tg----c
            GCF_003668045  cctggac
                   Beaver  cg-gtgg
                 Squirrel  tggcggg
                   Rabbit  cg-----
                    Human  g------
                    Chimp  g------
                   Bonobo  g------
                  Gorilla  g------
                   Rhesus  g------
                 Marmoset  g------
                  Tarsier  g------
                 Bushbaby  t------
               Tree shrew  g------
     Malayan flying lemur  g------
                      Pig  t------
                  Dolphin  t------
                      Cow  t------
                    Sheep  t------
                    Horse  t------
                      Dog  t------
       Hawaiian monk seal  t------
                 Hedgehog  a------
                    Shrew  g------
                 Elephant  -------
                   Tenrec  -------
               Guinea pig  NNNNNNN
                     Pika  =======
                Zebrafish  =======
            X. tropicalis  =======
                  Opossum  =======
                  Chicken  =======
         Chinese pangolin  =======

Inserts between block 25 and 26 in window
B D                Human 4bp
B D                Chimp 4bp
B D               Bonobo 4bp
B D              Gorilla 4bp
B D               Rhesus 4bp
B D             Marmoset 4bp
B D              Tarsier 4bp
B D             Bushbaby 4bp
B D           Tree shrew 4bp
B D Malayan flying lemur 4bp

Alignment block 26 of 393 in window, 56747298 - 56747313, 16 bps 
B D                 Mouse  t---ggcggacac----ca---------act-t
B D                   Rat  t---tccagacat----ca---------gct-t
            GCF_003668045  t---tccagagac----ca---------gct-t
                   Beaver  c---tccaggggc----aagaga----ggct-g
B D              Squirrel  a---cctggagct----cc---------gac-c
B D            Guinea pig  t---gtcggagag----ca---------gcg-c
B D                Rabbit  g---atcagaaac----gagcaagcgtggct-c
B D                 Human  t---ctcgg--ac----aaacacgcttggcc-a
B D                 Chimp  t---ctcgg--ac----aaacacgcttggcc-a
B D                Bonobo  t---ctcgg--ac----aaacacgcttggcc-a
B D               Gorilla  t---ctcgg--ac----aaacacgcttggcc-a
B D                Rhesus  t---ctcgg--ac----aaatccgcttggcc-a
B D              Marmoset  t---ctcgg--ac----aaacccgcgtggtt-c
B D               Tarsier  g---ctcagaaac----agacaagcgcggct-c
B D              Bushbaby  t---ctaagacac----aaacaagcgtggct-t
B D            Tree shrew  t---ctcggaaac----aaatgagcggggctcc
B D  Malayan flying lemur  t-------------------------------t
B D                   Pig  c---cgcgacaag----aggcgc----------
B D               Dolphin  c---ccagagaac----gggcgc----------
B D                   Cow  c---ccggggcac----aagcgc----------
B D                 Sheep  c---cgcgggcac----aggcgc----------
B D                 Horse  c---ccggaacac----aagcca----------
B D                   Dog  c---cccgaagac----aaacaa----------
B D    Hawaiian monk seal  c---cccgaaagc----aaacaa----------
B D              Hedgehog  cgg-tcctaacac----acacag----------
B D                 Shrew  c---tccaggcaccccaacacac----------
B D              Elephant  -tggcgtgt------------------------
B D                Tenrec  -tgcccagc------------------------
B D                  Pika  =================================
B D             Zebrafish  =================================
B D         X. tropicalis  =================================
B D               Opossum  =================================
B D               Chicken  =================================
B D      Chinese pangolin  =================================

Inserts between block 26 and 27 in window
B D                  Pig 5bp
B D              Dolphin 5bp
B D                  Cow 5bp
B D                Sheep 5bp
B D                Horse 4bp
B D                  Dog 5bp
B D   Hawaiian monk seal 5bp
B D             Hedgehog 2bp
B D                Shrew 2bp

Alignment block 27 of 393 in window, 56747314 - 56747330, 17 bps 
B D                 Mouse  gtcc-----g--------tccggcg-----agaat
B D                   Rat  ---------g--------tccggtg-----agaat
            GCF_003668045  ---------g--------tccggcg-----ataat
                   Beaver  ---------g--------acccgcg-----gtaat
B D              Squirrel  ---------g--------ctccccg-----aaggt
B D            Guinea pig  ---------gcgcggtgctgcggcg-----cggag
B D                Rabbit  ---------g--------tcctgcg-----tggta
B D                 Human  ---------a--------tcctgcg----------
B D                 Chimp  ---------a--------tcctgcg----------
B D                Bonobo  ---------a--------tcctgcg----------
B D               Gorilla  ---------a--------tcctgcg----------
B D                Rhesus  ---------g--------tcctgtg----------
B D              Marmoset  ---------c--------tcctgcg----------
B D               Tarsier  ---------g--------tctt--g----------
B D              Bushbaby  ---------g--------tcctgcg----------
B D            Tree shrew  ---------t--------ccttgcgagagt-----
B D  Malayan flying lemur  ---------g--------tcctgcgataga-----
B D                   Pig  gctt-----g--------tcccgcg-----acagt
B D               Dolphin  gctg-----g--------tcctgcg-----acggc
B D                   Cow  gcgg-----g--------tcccgcg-----acggc
B D                 Sheep  gcgg-----g--------ccccgcg-----acggc
B D                 Horse  gccg-----g--------tcctgcg-----acagt
B D      Chinese pangolin  gctt-----g--------tcctgcg-----gtaat
B D                   Dog  gctt-----g--------ccctgcg-----acggc
B D    Hawaiian monk seal  gctc-----g--------ccctgcg-----atagt
B D              Hedgehog  gcct-----a--------tcctctg-----agagt
B D                 Shrew  gcctggcagg--------tcccgtg-----ctcgt
B D              Elephant  ccta-----a--------catgaag----------
B D                Tenrec  gccg-----g--------ccacacg----------
B D                  Pika  ===================================
B D             Zebrafish  ===================================
B D         X. tropicalis  ===================================
B D               Opossum  ===================================
B D               Chicken  ===================================

Inserts between block 27 and 28 in window
B D               Rabbit 3bp

Alignment block 28 of 393 in window, 56747331 - 56747497, 167 bps 
B D                 Mouse  g-----g--aa--------gaggggcaaccagataaac--g-ta--------------ataaagttac--
B D                   Rat  g-----g--aa--------gaggggcaaccagataaac--g-ta--------------ataaagttac--
            GCF_003668045  g-----g--aa--------gaggtgcagccagataaat--g-ta--------------ataaacttac--
                   Beaver  g----cc--gg--------gaggagcaa-caaatgacc--t-ta--------------gtcaagttac--
B D              Squirrel  ggttccg--agagagacccgaggggcgacccgagaaac--c-ta--------------acagagttac--
B D            Guinea pig  g-----g--aa--------gaggggccagcggataaac--c-gacgccgtgcgcgcagataaaccgacgc
B D                Rabbit  g-----g--ac--------gtgggacaactaggtaacc--g-cc--------------gtaaagttac--
B D                  Pika  g-----g--aa--------gagggacaacccgataactcga-ta--------------gtaaagtgac--
B D                 Human  ---------ga--------gaggggcacccagataaac--g-ta--------------acaaagctac--
B D                 Chimp  ---------ga--------gaggggcacccagataaac--g-ta--------------acaaagctac--
B D                Bonobo  ---------ga--------gaggggcacccagataaac--g-ta--------------acaaagctac--
B D               Gorilla  ---------ga--------gaggggcacccagataaac--gtta--------------acaaagctac--
B D                Rhesus  ---------aa--------gaggggcactcagataaac--g-ta--------------acagagctac--
B D              Marmoset  ---------aa--------gaggggcacccagataaac--g-ta--------------acaaagctac--
B D               Tarsier  ---------ga--------gaggggcgacc-gataaac--g-ta--------------atgaggttac--
B D              Bushbaby  ---------aa--------gaggggcaaccagataaac--g-tt--------------ataaagtaac--
B D            Tree shrew  ------ggaaa--------gaggggcaaccagataaat-gg-ta--------------ataaagttac--
B D  Malayan flying lemur  ------gagga--------gaggggcagccagataaac--a-ca--------------ggaaagtcac--
B D                   Pig  -------gagg--------agcgagcaggcggagagac--c-tg--------------gtaaagttgc--
B D               Dolphin  -------gagg--------agagggcaagcagataaac--t-gc----------------gtagttac--
B D                   Cow  -------gagt--------agagggcagccagagaaac--t-tc--------------agacagttcc--
B D                 Sheep  -------gagt--------agagggccgccagagaaac--t-tc--------------agacagttcc--
B D                 Horse  -------gaga--------ggagggcaagcagataaac--g-ca--------------gtaaagttac--
B D      Chinese pangolin  -------caga--------agaaggcaaccagataaac--t-ta--------------ataaagttac--
B D                   Dog  -------gaag--------agagggccaccagataaac--c-ta--------------ataaagttac--
B D    Hawaiian monk seal  -------gaag--------agagggcaaccagataaac--t-ta--------------ata---ttac--
B D              Hedgehog  -------gaga--------aggggcccaccagataaac--c-ta--------------atgaagttac--
B D                 Shrew  -------gaga--------agggggcgatcagatcaac--c-gg--------------caaaagtgac--
B D              Elephant  -------ggaa--------gaggggcaaccagacaaac--t-ca--------------ataaagttac--
B D                Tenrec  -------ggaa--------gagggacagccggatgaac--g-ta--------------atgaagttac--
B D               Opossum  -------ggaa--------gtggagcaactagataaat--t-ta--------------gtcaaagtag--
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  ----------ca-tttcccgatt--aaaggtcacatcgtaatttcccaggggaggttag--tgag-aaaa
                      Rat  ----------ca-tttcccgatt--aaaggtcacatcgtaatttcccaggggaggttag--tgag-aaaa
            GCF_003668045  ----------ca-tttcccgatt--aaaggtcacatcataatttcccaagggaggttag--tgag-aaaa
                   Beaver  ----------ca-gttcccgatt--aaaggtcacctcgctatctccctggagaggttag--tggg-aaaa
                 Squirrel  ----------ca-tttcccgatt--aaaggtcgcatcgtcctctcccgagggaggttag--tgag-aaaa
               Guinea pig  cgtgcgcgcgcc-cgccccgagt--aaaggtcacgtcgtaagctcccgagggagagcac--tgag-aaaa
                   Rabbit  ----------ca-tttcccgatgaaaaaggtcacctcgtcatctcccaagggaggttgg--tgag-aaaa
                     Pika  ----------cg-tttcccgatt--gaaggtctctccgtcatctcccaagggaggttgg--tgag-aaaa
                    Human  ----------cattttctcgact--aaaggtcacattgtaatctcccaa-ggaagttag--tgag-aaaa
                    Chimp  ----------cattttctcgact--aaaggtcacattgtaatctcccaa-ggaagttag--tgag-aaaa
                   Bonobo  ----------cattttctcgact--aaaggtcacattgtaatctcccaa-ggaagttag--tgag-aaaa
                  Gorilla  ----------cattttctcgact--aaaggtcacattgtaatctcccaa-ggaagttag--tgag-aaaa
                   Rhesus  ----------cattttctcgact--aaaggtcacattgtaatctcccaa-ggaagttag--tgag-aaaa
                 Marmoset  ----------cattttctcgact--aaaggtcacatcgtaatctcccaa-agaagttag--tgag-aaaa
                  Tarsier  ----------ca-tttcccgatt--aaaggtcacgtcgtcatctcccaagggaggttag--taag-aaaa
                 Bushbaby  ----------ca-tttcccgatt--aaaggtcacgtcgtaatctcccaagggaggttag--tgag-aaaa
               Tree shrew  ----------ca-tttcccgatt--aaaggtcacatcgtaatctcccaagggaggttag--tgag-aaaa
     Malayan flying lemur  ----------cc-tttccagatt--aaaggtcacatcaaaatctctgaagggaggttag--tgag-aaaa
                      Pig  ----------cg-cttcccggtg--aaaggtcagggcgcagtctccccagggaggttag--tgag-aaaa
                  Dolphin  ----------ca-tttcccgatt--aaaggtcacgtcgtaatctccccagggaggttag--tgag-aaaa
                      Cow  ----------cg-cgccccgatt--aaaggtcacgtcgtcatctccccagggaggttag--tgag-aaaa
                    Sheep  ----------cg-cgccccgatt--aaaggtcacgtcgtcatctccccagggaggttag--tgag-aaaa
                    Horse  ----------ca-ttgccccagc--aaaggtcacgtcggcatctcccaggggaggttag--tgag-aaaa
         Chinese pangolin  ----------ca-ttccccgatg--aaaggtcacgtcgtaatctccccggggaggttag--tgag-aaaa
                      Dog  ----------ca-ttccccgatt--aaaggtcacgtcgtaatctcccaagggaggtttg--tgag-aaaa
       Hawaiian monk seal  ----------ca-tttcccgatt--aaaggtcacggtgtaatctcccaaaggaggtttg--tgagaaaaa
                 Hedgehog  ----------ca-ct----------gaaggtcatgttgtaatctcctaagggagcttag--tgagaaaaa
                    Shrew  ----------ca-ttccccgatg--aaaggtcacttcgtcatctcccaagggaggcgag--cgag-aaaa
                 Elephant  ----------ca-tttccccact--aaaggtcacatcgtaatctcccaagggatgttag--tgag-aaaa
                   Tenrec  ----------ct-tttcccgatt--aaaggtcacgtcgtaatctcccaagggaggttcg--tgag-aaaa
                  Opossum  ----------ca-tttgacgatt--aaaggtcaaatcataatctcccaaaagagatttagttgga-aaaa
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================

                    Mouse  cctcaaattatacggactggctgt-----ggaccgtttaatt-ccccctcctgcccc-----------cc
                      Rat  cctcaaattatacggactggctgt-----ggaccgtttaattcccccctcctgcccccccctccccgtcc
            GCF_003668045  cctcaaattatacggactggctgt-----ggaccgtttaattttcctttccctccct-------ctggcc
                   Beaver  cctccaattatacggactggctgt------aaccgcttaatttttctttccttctat-----------cc
                 Squirrel  cctcaaattatacggactggcttt-----ggaccatttaatttttctttccctccgt-----------cc
               Guinea pig  cctcaaattatgcggactggctgc-----ggaccgcttaatt-tcctttcccttctt-----------ca
                   Rabbit  cctcaaattatacggactggctgt-----ggaccgtttaatttttcttccactccgt-----------cc
                     Pika  cctcaaattacacggactggctgt-----ggaccgtttaatttttctacccctccat-----------cc
                    Human  cctcaaattatacggactggctgt-----ggaccgtttaatttttctttccctccgt-----------cc
                    Chimp  cctcaaattatacggactggatgt-----ggaccgtttaatttttctttccctccgt-----------cc
                   Bonobo  cctcaaattatacggactggctgt-----ggaccgtttaatttttctttccctccgt-----------cc
                  Gorilla  cctcaaattatacggactggctgt-----ggaccgtttaatttttctttccctccgt-----------cc
                   Rhesus  cctcaaattatacggactggctgc-----ggaccgtttaatttttctttccctctgt-----------cc
                 Marmoset  cctcaaattatacggactggctgt-----ggaccgtttaatttttctttccctccgt-----------cc
                  Tarsier  cctcaaattatacggactggctgt-----ggaccgtttaatttttctttccctcctt-----------cc
                 Bushbaby  cctcaaattatacggcctggctgt-----ggaccgtttaattttt-tccccctccgt-----------cc
               Tree shrew  cctcaaattatacggactggctgt-----ggaccgtttaatttttcttttcctccgt-----------tc
     Malayan flying lemur  cctcaaattatacggactggctgt-----ggaccgtttaatttttcttccccccttc-----------cc
                      Pig  cctcaaattatacggaccggctgt-----ggaccatttaatttttctttccctctgt-----------cc
                  Dolphin  cctcaaattatacggaccggctgt-----ggaccgtttaatttttctttccctctcg-----------cc
                      Cow  cctcaaattatacggactggctgt-----cgaccgtttaatttttctttccctctgt-----------cc
                    Sheep  cctcaaattatacggactggctgt-----cgaccgtttaatttttctttccctctgt-----------cc
                    Horse  cctcaaattatacggcctggctgt-----ggaccgtttaatttctctttccctctgt-----------cc
         Chinese pangolin  cctcaaattatacggactggcggt-----gcaccg-----tttttcttgctctctgt-----------cc
                      Dog  cctcaaattatacggactggctgt-----ggaccgtttaatttttctttccctccgt-----------cc
       Hawaiian monk seal  cctcaaattatacggactggctgt-----ggaccgtttaatttttccttccctctgt-----------tc
                 Hedgehog  cctcaaattatacggactggctgc-----ggaccttttaatttt--tttccctc----------------
                    Shrew  cctcaaattacacgcactggctgcggtgtggaccttttaatttttctttccctctat-----------cc
                 Elephant  cctcaaattagaccgactggctgt-----ggaccgtttaatttttccttccctctgt-----------cc
                   Tenrec  cctcaaattataccgactggctgt-----ggaccgtttaatttttctttccc------------------
                  Opossum  cctcaaattgtactaaatggtgat-----agactgtttaatttttatttcctt---------------ac
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================

                    Mouse  c-tccttttactctc------tgaaa----------gaaaa
                      Rat  c-tccctctactctc------tgaaa----------gaaaa
            GCF_003668045  c-tccctctactctc------tgaag----------gaaaa
                   Beaver  t-tccccctactctc------caaaa----------ggaaa
                 Squirrel  c-acccccaactctc------caaaa----------taaaa
               Guinea pig  g-tcctttgactctc------cagaa----------gaaaa
                   Rabbit  c-tcccccgattctc------caaaa----------gaaaa
                     Pika  c-tcccccggttctc------caaaa----------agaaa
                    Human  c-tccctcatgtctc------caaag----------gaaaa
                    Chimp  c-tccctcatgtctc------caaag----------gaaaa
                   Bonobo  c-tccctcatgtctc------caaag----------gaaaa
                  Gorilla  c-tccctcatgtctc------caaag----------gaaaa
                   Rhesus  c-tccctcatgtctc------caaag----------gaaaa
                 Marmoset  c-tccctcaagtctc------caaag----------gaaaa
                  Tarsier  c-tcccccaaccctc------caaaa----------gaaaa
                 Bushbaby  c-tcccccaattctc------caaaa----------gaaaa
               Tree shrew  c-tcccccaactctc------caaaa----------gaata
     Malayan flying lemur  t-ccctctgactctc------caaaa----------gaaaa
                      Pig  c-tcccccgactctc------taaaa----------gaaaa
                  Dolphin  c-tcccccgactctc------cataa----------gaaaa
                      Cow  c-tccctcgactctc------caaaa----------gaaaa
                    Sheep  c-tccctcgactctc------caaaa----------gaaaa
                    Horse  c-tcccccaactctcaaaaaaaaaaa----------aaaaa
         Chinese pangolin  c-tcccccgactctc------cgaaa----------gaaaa
                      Dog  c-tcccccgactctg------cagaa----------gaaaa
       Hawaiian monk seal  c-tcccccgactctg------caaaa----------gaaaa
                 Hedgehog  ----cccccacttcc------aaaaaaaaaaaagttgaaaa
                    Shrew  c-t-ccccgactctc------agaaa----------gaaac
                 Elephant  cttccctccactctc------caaga----------gaaaa
                   Tenrec  --tcctcctactctc------ccaaa----------gaaaa
                  Opossum  c-tcccccatttttc--------aaa----------gaaaa
                Zebrafish  =========================================
            X. tropicalis  =========================================
                  Chicken  =========================================

Inserts between block 28 and 29 in window
B D              Opossum 3607bp

Alignment block 29 of 393 in window, 56747498 - 56747943, 446 bps 
B D                 Mouse  tttaaaaca-ctga-----t-----ttttt-----cccttttttcc--------c---cc---tccttga
B D                   Rat  tttaaaaca-ctgg-----tgtttcttttt-----ttttttttttc--------t---cc---tccttga
            GCF_003668045  tttaaaaca-ctcg-----t-----gcttc-----cttttcttttt--------t---cc---ccgttga
                   Beaver  tttaaaaca-ctcg-----t-----gtttt-----gttgttttttc--------t---tc---c---tga
B D              Squirrel  tttaaaaca-cttg-----t-----g---------------tcccc--------c---tc---cccctgg
B D            Guinea pig  gtgaaaaca-ctcc-----t-----gtttt-------------------------------------taa
B D                Rabbit  tgtcaaacg-ctcg-----c-----gatct-----gggctttccct--------g---a-----------
B D                  Pika  attcaaa-a-cacc-----c-----gttct-----gtgttttacct--------t---ac---------g
B D                 Human  tttaaaaca-ctcg-----t-----gtttt------------tatt--------t---tc---cccccga
B D                 Chimp  tttaaaaca-ctcg-----t-----gtttt------------tatt--------t---tc---cccccga
B D                Bonobo  tttaaaaca-ctcg-----t-----gtttt------------tatt--------t---tc---cccccga
B D               Gorilla  tttaaaaca-ctcg-----t-----gtttt------------tatt--------tccccc---cccccga
B D                Rhesus  tttaaaaca-ctcg-----t-----gtttt------------t---------------tc---cccccga
B D              Marmoset  tttaaaaca-ccgg-----t-----gtttt------------c-tt--------t---tc---ccccaga
B D               Tarsier  tttaaaaca-ctcg-----t-----gttttg----ctgggggtttt--------t---ct---cccctga
B D              Bushbaby  tttaaaaca-cttg-----t-----gtcct------------cccc--------cc--ac---cccccgc
B D            Tree shrew  cttaaaaca-ctcg-----t-----gattt-----------ttttt--------t---tt---tccctga
B D  Malayan flying lemur  tttaaaaca-ctcg-----t-----gtttt-----attttatttta--------t---tt---ttcctga
B D                   Pig  attaaaaca-cccg-----t-----gt----------tcttttttt--------t---cc---cccttga
B D               Dolphin  attaaaaca-cccg-----t-----gtt---------ttttttttt--------c---tt---cctttga
B D                   Cow  cttaaaacaccccg-----t-----gttgttgt----ttttttttc--------t---tt---tccttga
B D                 Sheep  cttgaaacaccccg-----t-----gttgttgt--tgttgtttttc--------t---tt---tccttga
B D                 Horse  attaaaaca-cccg-----t-----gg------------ttttttt--------t---tt---tccctga
B D      Chinese pangolin  tttaaaaca-cccg-----t-----gt------------tttgttttgttttgct---tt---ttcctga
B D                   Dog  attaaaaca-ctcg-----t-----g--------------ttttta--------t---tc---cccctga
B D    Hawaiian monk seal  attaaaaca-ctcg-----t-----g-------------ttttttt--------t---tc---cccctga
B D              Hedgehog  agtaaaaca-ttca-----t-----tttcttccacc------tcta--------t---cc---ctcctga
B D                 Shrew  agggaaaca-cccgtctttt-----ttttttccccccttccttctt--------c---tt---cccctga
B D              Elephant  a----aaca-ccca-----c-----------------------ttt--------t---cc---cccctga
B D                Tenrec  gt---tacc-ccca-----c-----------------------ccc--------t---tccaactctcca
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  gaagaattaagcaaccgccacacgaa------------ag-------tgtg-agtccaaa-ttcgtc---
                      Rat  gaagaatgaagcaacagtcacacaaa------------ag-------tgtg-agtccaaatttcgtc---
            GCF_003668045  gaagaactaagcagccgccacacaaa------------ac-------cgtg-agtccaaa-tatatc---
                   Beaver  gaaaagctaaacaaccgtgacaataaaag--ccc---gag-------tctg-agtctaag-ttcatccct
                 Squirrel  gggaggctaaggaatcaccacaaggaaac--cccaa-gag-------actg-agtctaaa-ttccgc---
               Guinea pig  aaacctctgagcactcactacaacaaaag--cccg---ag-------gctg-agtctgaa-ttcatg---
                   Rabbit  -----------caaccg---------------ccgggagg-------tttg-attctaaa-ttcatc---
                     Pika  aaaaagctaagcgaccgctccaacagacg--cccaagagg-------gtcg-agtctaaa-ttcatc---
                    Human  gaaaagctaaacaaccaccacaacaaaag--cccca--ga-------ttta-agtctaaa-ttcatc---
                    Chimp  gaaaagctaaacaaccaccacaacaaaag--cccca--ga-------ttta-agtctaaa-ttcatc---
                   Bonobo  gaaaagctaaacaaccaccacaacaaaag--cccca--ga-------ttta-agtctaaa-ttcatc---
                  Gorilla  gaaaagctaaacaatcaccacaacaaaag--cccca--ga-------ttta-agtctaaa-ttcatc---
                   Rhesus  gaaaagctaagcaaccaccacaacaaaag--cccca--ga-------ttta-agtctaaa-ttcatc---
                 Marmoset  gaaaagctaagcaaccaccacaacaaaag--ctcca--ga-------ttta-agtctaaa-ttcatc---
                  Tarsier  gaaaagccaagcaaccaccgccacaaaag--cccaa--gagt-----gttg-agtctaaa-tgcatc---
                 Bushbaby  aaaaatctaagcaaaccccaccacaaaag--ctggc--gt-------ttgg-ggtctaag-ttcatc---
               Tree shrew  gaaaagctaagca---accacaacaaacg--ctcaa--gagt-----tttg-ggtctaaa-ttcatc---
     Malayan flying lemur  gagaagctaagcaaccaccacaacaaaag--tccaa--gagt-----tttgagatttaaa-ttcacc---
                      Pig  gaataactaagcaaccacaacaacaaaag--cccaa--gaat-----tttg-agtctaaa-ttcatc---
                  Dolphin  gaaaaactaagcaaccacaacaacagaag--cccag--gagt-----tttg-agtttata-ttcatc---
                      Cow  gaaaagctaaacaaccataacaacaaaag--ccccc--gagt-----tttg-agtctaaa-ttcatc---
                    Sheep  gaaaagctaaacaaccgtaacaacaaaag--cccca--gagt-----tttg-agtctaaa-ttcatc---
                    Horse  gaaaaactactcaaccacaccaacaaaaa--tccaa--gagt-----tttg-agtctaaa-ttcatc---
         Chinese pangolin  gaaaaaataagcaattacagcaataaaaaagcccac--gagt-----tttg-agtctaaa-ttcttc---
                      Dog  ggaaaactaagcaaccaccaccacaaaag--cccta--gagt-----tttg-agtctaaa-ttcatc---
       Hawaiian monk seal  gaaaaactaagcaaccaccaccacaaaag--cccta--gagt-----ttta-agtctaaa-ttcatc---
                 Hedgehog  aaaac--taagcagccacaacagcacaag--cctac--gagtt----tttg-aatctaaa-ttcatc---
                    Shrew  gtaacaatgagcaagcacaatagcaaaag--cccag--gggtttaagtctg-aat-taaa-gtcacc---
                 Elephant  gaaaagctacgctaccaccaccacaaaag--cccaa--gaat-----tttg-ggtctaaa-ttcatc---
                   Tenrec  gaaaagct--------gctaccacaaaag--cccaa--gaat-----tttg-tgtctaaa-tttatc---
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  a-gtac----gttagaatgaagacgagtttaaaa--ct--c-aaat------------------------
                      Rat  a-gtat----gctagaatgaa---gagttcaaaa--ct--c-aaat------------------------
            GCF_003668045  a-gtat----gctagaatgaa---gatttcaaaa--ct--c-aaat------------------------
                   Beaver  a-ctat----gctagagtcaa---gacttcaaacctct--c-aaaa------------------------
                 Squirrel  a-ctaa----gatag--tcaa---gagttggaaactct--c-aaaa------------------------
               Guinea pig  a-ctattctcactggagtcaa---gaattcaaaa--ct--c-gtaa------------------------
                   Rabbit  a-ccac----gctggagtcaa---gagttcaaaactct--c-aaaa------------------------
                     Pika  a-ccac----gctggagtcaa---gagttcaaaactct--c-agaa------------------------
                    Human  a-ccgt----cctggagtcaa---gagttcaaaactct--caaaaa------------------------
                    Chimp  a-ccgt----cctggagtcaa---gagttcaaaactct--caaaaa------------------------
                   Bonobo  a-ccgt----cctggagtcaa---gagttcaaaactct--caaaaa------------------------
                  Gorilla  a-ccgt----cctggagtcaa---gagttcaaaactct--c-aaaa------------------------
                   Rhesus  a-ccgt----cctggagtcaa---gagttcaaaactct--c-aaaa------------------------
                 Marmoset  a-ccgc----cgtggagtcaa---gagttcaaaactct--c-aaaa------------------------
                  Tarsier  a-ccat----gttggaatcaa---gagttcaaaactct--c-aaaa------------------------
                 Bushbaby  a-ccat----gctggagttga---gagttcaaaacttt--c-taaa------------------------
               Tree shrew  a-gcac----attggagtcaa---gagttcaaaactcc-ac-aaaa------------------------
     Malayan flying lemur  a-ctac----gctggagtcaa---gagttcaaaactct--c-aacc------------------------
                      Pig  a-ccag----gctggagtttg---gagttctaaattct--c-aaaaaccct--cac--------------
                  Dolphin  a-ccac----ggtggagtcag---gagttcaaagctct--c-aaaaaagca--aacaacaacaaa-----
                      Cow  a-ccac----ggtggagtcag---gagttcaaagctct--c-aaaaaacca--aac--------------
                    Sheep  a-ccac----ggtggagtcag---gagttcaaagctcg--c-aaaaaacca--aac--------------
                    Horse  a-ccgc----gctcgagtcag---gagctccaagctct--c-agaagcc--------------------c
         Chinese pangolin  a-tcac----gctggagtcag---gagtccaaagctct--c-aaaaaccaa--aaca-aaatgcaaaaac
                      Dog  a-tcat----gatggagtcag---gggttcaaacctct--g-aaacacaca--cacacacacacacacac
       Hawaiian monk seal  a-ccag----gatggagtctg---gagctcaaagctct--g-aaaagcaag--caaacaaacaca-----
                 Hedgehog  a-tgaa----actggagccag---gagttcaaaatttt--c-aataagcaa--atc--------------
                    Shrew  actcgg----gatggagtcag---gagtataaagttct--t-agaaaacaaacaca--------------
                 Elephant  a-tcac----cccggagtcag---gagttgcaaacttaaac-aaaaacaaacaaacaaacg---------
                   Tenrec  a-ccac----ctcaag-------------ccaaactta----aaaaaaagaagaagaaagg---------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -------ggca------------------aaacttcaaggcactgtacgg--tattcccg----------
                      Rat  -------ggca------------------aaacttcaaggcagtgtgcct--tattcccg----------
            GCF_003668045  -------gcgg------------------a---cttaaggcagtgtaagg--catttacg----------
                   Beaver  -------accg------------------g-cctttaaggcagcataagg--ttttccta------ctt-
                 Squirrel  -------accg------------------gactttgaaggcagactgaga--tgtccttgagcagacct-
               Guinea pig  -------tggg------------------a--ctttaaggcagagtgagg--ttttcctgagcagactt-
                   Rabbit  -------accg------------------gaccttcggg-cagcgggagg--tttcccggagcagccct-
                     Pika  -------accg------------------gactttcgggccagcgggagg--tttcccggagcaaacct-
                    Human  -------accg------------------gacc-ttaaggcaatgtaagg--tttcccc-agcagaccc-
                    Chimp  -------accg------------------gacc-ttaaggcaatgtaagg--tttcccc-agcagaccc-
                   Bonobo  -------accg------------------gacc-ttaaggcaatgtaagg--tttcccc-agcagaccc-
                  Gorilla  -------accg------------------gacc-ttaaggcaatgtaagg--tttcccc-agcagaccc-
                   Rhesus  -------accg------------------aacc-ttaaggcaatgtaagg--tttcccc-agcagacct-
                 Marmoset  -------acct------------------gatc-ttaaggcagtgtaaga--tttcccc-agcagacct-
                  Tarsier  -------accg------------------gaac-ttaaggcagcgtgagg--tttccctgagcagacct-
                 Bushbaby  -------acgg------------------gacctttaagagaatgcgagg--ttttcttgagtagacat-
               Tree shrew  -------actg------------------aacc-ttaaaccagcgtaagggttttcctg-agcggacct-
     Malayan flying lemur  -------accg------------------gacc-ttaagactatgtaagg--tttcccg-ggcagacct-
                      Pig  -------aacaagtaaccca---------gacc-ttagagcagg--------tttctctgagc-------
                  Dolphin  -------aaca---aacctg---------gacc-ttaaagcagcgtaagg--tttatttgagcagacct-
                      Cow  -------aaca---aagccg---------gacc-t-------------------tctttgaacagaccta
                    Sheep  -------aaca---aagccg---------gacc-t-----------------tctctctgaacagacct-
                    Horse  ctccccaccca---aagccgca-------gacc-ttaaagcagcgaaagc--tttctttgagcagacct-
         Chinese pangolin  aaaacaaaaca---aaactg---------gacc-ttaaacgaatggaag---tttcttagagtatacct-
                      Dog  acacacacaca---cacacacacggacctgacc-tgaaggcagcctaagg--tttctaagagcggatct-
       Hawaiian monk seal  -----------------------------gatc-ttaaggcagcctaagg--tttcttagagcagatct-
                 Hedgehog  -------agca---aagcaaag-------gatg-ttaaggca-------------gttggaccagatct-
                    Shrew  -------aaca---aacaaaag-------ggcg-gcaaagcaccccaggt--ttcattgg-tcagacct-
                 Elephant  -------aaag------------------gatg-tt-aagcctcctaagg--tttcctttggcagaact-
                   Tenrec  -------aaaa------------------gatg-ctaaaggcatttacag--tgtccttgagcagaact-
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ------------------------------------------------------a---------------
                      Rat  ------------------------------------------------------a---------------
            GCF_003668045  ------------------------------------------------------g---------------
                   Beaver  g------gg--------------------------------------------ta---------------
                 Squirrel  c------tg--------------------------------------------ta---------------
               Guinea pig  a------gg--------------------------------------------ca---------------
                   Rabbit  g------gg--------------------------------------------ct---------------
                     Pika  g------gc--------------------------------------------tt---------------
                    Human  c------ag--------------------------------------------ta---------------
                    Chimp  c------ag--------------------------------------------ta---------------
                   Bonobo  c------ag--------------------------------------------ta---------------
                  Gorilla  c------ag--------------------------------------------ta---------------
                   Rhesus  c------ag--------------------------------------------ta---------------
                 Marmoset  c------ag--------------------------------------------ta---------------
                  Tarsier  g------gg--------------------------------------------taggtttgcagtttttt
                 Bushbaby  g------gg--------------------------------------------ta---------------
               Tree shrew  g------gg--------------------------------------------aa---------------
     Malayan flying lemur  g------gg--------------------------------------------ta---------------
                      Pig  agacctgcg--------------------------------------------ta---------------
                  Dolphin  g------tg--------------------------------------------ta---------------
                      Cow  a------tg--------------------------------------------ta---------------
                    Sheep  a------tg--------------------------------------------ta---------------
                    Horse  g------ag--------------------------------------------ta---------------
         Chinese pangolin  g------gg--------------------------------------------tg---------------
                      Dog  g------cg--------------------------------------------ta---------------
       Hawaiian monk seal  g------gg--------------------------------------------ta---------------
                 Hedgehog  g-----agg--------------------------------------------ta---------------
                    Shrew  g------gg--------------------------------------------ta---------------
                 Elephant  g------gg--------------------------------------------ta---------------
                   Tenrec  g------gggcaaacccttcaaaactccctgcccttcagccggttccccctcaga---------------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ------------------------------------agt---------------------agacgccacc
                      Rat  ------------------------------------agt---------------------ag-----acc
            GCF_003668045  ------------------------------------agt---------------------agactccacc
                   Beaver  ------------------------------------agtttg-----------taactccaaactccaat
                 Squirrel  ------------------------------------ggtttgc--aaatttcttaatcctcaactccaac
               Guinea pig  ------------------------------------cctctgc--aaatttcttcatcccaaactccagt
                   Rabbit  ------------------------------------ggtttgc--aaattgcttcatcccagaggccagt
                     Pika  ------------------------------------ga-----------------acctcccgctccaac
                    Human  ------------------------------------ggtttgc--aaatctcttaatcccaaactc-aat
                    Chimp  ------------------------------------ggtttgc--aaatctcttaatcccaaactc-aat
                   Bonobo  ------------------------------------ggtttgc--aaatctcttaatcccaaactc-aat
                  Gorilla  ------------------------------------ggtttgc--aaatctcttaatcccaaactc-aat
                   Rhesus  ------------------------------------ggtttgc--aaatttcttaatcccaaactc-aat
                 Marmoset  ------------------------------------ggtttgc--aaatttcttaatccaaaattctaat
                  Tarsier  tttaaaaatggttaaacctatttaattatccattttggtttgc--aaatttcttaatctcaaactccaat
                 Bushbaby  ------------------------------------ggtttgc--aaatttctgagtcac-------aat
               Tree shrew  ------------------------------------ggtctgc--aaatgtcttagtcccagacttcaat
     Malayan flying lemur  ------------------------------------ggtttgc--aagttgcttaaacccaaactctaat
                      Pig  ------------------------------------ggtttgc--aaaattattcataccaaactccaga
                  Dolphin  ------------------------------------ggtttgc--aaatttattcataccaaactccaat
                      Cow  ------------------------------------ggtttgc--aaatttattcatgccaaactcctat
                    Sheep  ------------------------------------ggtttgc--aaatttattcatgccaaactcctat
                    Horse  ------------------------------------ggtttgc--gaatttcctaataccaaactccaat
         Chinese pangolin  ------------------------------------agtttgc--tgattgtttcttacgaaactccaat
                      Dog  ------------------------------------gatttgc--aaatttcttaatcccaaactccaat
       Hawaiian monk seal  ------------------------------------gatttgc--aaatttcttaataccaaattctaat
                 Hedgehog  ------------------------------------gggttacaaatatttcttaatagtaaacgccaat
                    Shrew  ------------------------------------gctttgc--ccatttctt-------aacactaat
                 Elephant  ------------------------------------gatttgc--aaggttcttaatcctaaaccccaat
                   Tenrec  ------------------------------------ggtctgc--aaatgccttcatcctaaatcccagc
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tccaaagcttcaa-agtact------------tagt-----------------cttattttaaagcctta
                      Rat  tccaaagcctcaa-cgtact------------tagt-----------------cttattttagagcctta
            GCF_003668045  ttggaagcttcaa-agtact------------tagt-----------------gttatcttaaagcctca
                   Beaver  tccaaagccttaa-aacacg------------tagtttttt-tttcttttttcttttttttgaagtctta
                 Squirrel  ttcaaagcctcaa-aatact------------tagtttttg-tttg-------attattttgaaggctta
               Guinea pig  accaaagcctcaa-aatatg------------tatttttcg-tttg-------attatcttaaagtctta
                   Rabbit  cccacagcctcaa-aacact--------------gtttcgg-tttggtttt--attatttcgaagtctta
                     Pika  gccacagcttcag-agcgct--------------gtttggg-tt--------------------gtatta
                    Human  tccaaagcctcaa-gctatt------------cagttttcc-tttt-------attattttgaagactta
                    Chimp  tccaaagcctcaa-gctatt------------cagttttcc-tttt-------attattttgaagactta
                   Bonobo  tccaaagcctcaa-gctatt------------cagttttcc-tttt-------attattttgaagactta
                  Gorilla  tccaaagcctcaa-gctatt------------cagttttcg-tttt-------attattttgaagactta
                   Rhesus  tccaaagcctcaa-gctatt------------cagttttcg-tttt-------attattttgaagactta
                 Marmoset  tccaaagcctcaa-gctatt------------cagttttcg-tttt-------attattttgaagtctta
                  Tarsier  accagagcttcaa-actaca------------cagtttatg-tttt-------attattttgaagtcttg
                 Bushbaby  tccaaagcctcaa-actact------------caattttca-ttgc-------attattttgaagtctta
               Tree shrew  gccaaagtctcagaaatact------------aagttttcg-tttt-------cttattttgaagccttt
     Malayan flying lemur  tctgaagccttcg-aatact------------cagttttcg-tttt-------attattttgaagtcttt
                      Pig  tcta-agcctcaa-aagacc------------cggttttcg-tt----------ttattttgaaatctta
                  Dolphin  tccaaagcctcaa-aatacc------------cagttttca-tttt-------attattttgaaatctta
                      Cow  tccagagcctcaa-agtact------------cagttttcg-tttt-------attattttgaaatctta
                    Sheep  tccagagtctcaa-aatacc------------cagttttcg-tttt-------attattttgaaatctta
                    Horse  tctaaagcctcaa-aatacc------------cagttttcg-tttt-------attattttgaagtctta
         Chinese pangolin  tccaaagcctcaa-aatatc------------cagtttccg-tttt-------attattttgaattatta
                      Dog  tccaaagcctcaa-aatacc--------------gtttgca-tttt-------attattttgaagccgta
       Hawaiian monk seal  tccaaagcctcaa-aatacc------------caattttcgttttt-------attattgtgaagtcata
                 Hedgehog  tccaaagctttaa-aaaatctttttttttttttttttttttttttt-------accattttgaagtgttt
                    Shrew  tcccaagcctcca-aacacc------------cactttcccctttg-------atcatgttgaagtcttt
                 Elephant  gccaaagtctgaa-aatact------------cagctttta-tttt-------attactttgaagcctta
                   Tenrec  tccagaggtgcaa-gttgcc------------caatttctg-ttgt-------agtctttcgaaccctta
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  aaacttttt-t-tta---tgtcttctca-------aaaatcagtt----------------------tta
                      Rat  aa----ttt-t-ttaaagtgtcttctca-------aaaatcagtt------------------at-aata
            GCF_003668045  aaa---ctt-t-tta---tttcttgtc--------aaaatcagtt------------------ac-aata
                   Beaver  aaa---ctt-t-taa---tgttttgtc---------aaatcagct-----------------ttt-aaaa
                 Squirrel  caa---agt-t-taa---tgctttcttacaggtt-aaaatcagctgttaaacttattattaataa-atta
               Guinea pig  aaa---ctt-t-caa---catttccttg-------gaagtcagct----------------tcta-aaaa
                   Rabbit  aaa---ctc-c-tac---tgttttcctatctgtc-caagtcggct-----------------tttcaaaa
                     Pika  aca---ctc-cgcgg---ggttttctcatctgtc-cacatcaact-----------------tgt-aaaa
                    Human  aaa---ttt-t-taa---tgcttttttgtctgtc-aaaatcagct-----------------ttt-aaaa
                    Chimp  aaa---ttt-t-taa---tgtttttttgtctgtc-aaaatcagct-----------------ttt-aaaa
                   Bonobo  aaa---ttt-t-taa---tgtttttttgtctgtc-aaaatcagct-----------------ttt-aaaa
                  Gorilla  aaa---ttt-t-taa---tgttttcttgtctgtc-aagatcagct-----------------ttt-aaaa
                   Rhesus  aaa---ttt-t-taa---tgttttcttatctgtc-aaaatcagct-----------------ttt-aaca
                 Marmoset  aaa---ttt-t-taa---agttttcttatctgtc-aaaattagcc-----------------tttaaaaa
                  Tarsier  aaa---cgt-t-tga---tgtttacttgtctgtc-aaaatcagct-----------------ttt-gaaa
                 Bushbaby  aac---ttt-t-aga---tgttttcttatctgtc-aaaacgaact-----------------ttt-aaaa
               Tree shrew  aaa---acgtt-taa---tgttttctt---tgtc-aaaatcagat-----------------ttt-aaaa
     Malayan flying lemur  aaa---ctg-t-taa---tgttttcttatctgtc-aaaatcagct-----------------ttt-aaga
                      Pig  aaa---cat-t-taa---tgttttcttatctgta-aaaatcagct-----------------ttt-taag
                  Dolphin  aaa---ctt-t-taa---tgttttcttatctgtt-aaaataaact-----------------ttt-taag
                      Cow  aaa---ctt-t-gaa---tgttttcatatctgta-aaaatcagtt-----------------ttt-tccg
                    Sheep  aaa---ctt-t-caa---tgttttcatat--------aatcagtt-----------------ttt-tcca
                    Horse  aaa---ctt-t-taa---tgttttcttatctgtt-aaaatcagct-----------------ctt-tagt
         Chinese pangolin  aac---ctt-c-taa---agtt---ttatcggtt-caaatcagct-----------------ttt-tagg
                      Dog  aaa---ctc-c-ta----tgttttcttatctgtc-aaaattagcg-----------------ttt-taca
       Hawaiian monk seal  gaa---ctc-t-tag---tgttttcttatctgtc-aaaatcagcg-----------------ttt-t---
                 Hedgehog  a------------ag---tattttcttacctgtc-aaattcaact-----------------ttt-taag
                    Shrew  --------------g---cgttttcttccgtgtcaaaagtcaaca-----------------ttt-gaag
                 Elephant  aaa---ctt-t-tag---tgccttcttatctgtcaaaaaccagct-----------------ttt-taaa
                   Tenrec  caa---cat-t-gca---tgctttcttaactgcccacacccagct-----------------ttt-caaa
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tttatt-gg-aattta-ttattcttatcta-------------------------------------t--
                      Rat  tttgtt-gg-aattta-ttatttttatcta-------------------------------------t--
            GCF_003668045  tttatt-gg-aactta-ttatccttatcca-------------------------------------t--
                   Beaver  ttaaga-tg-aactta-ttattattattcg-------------------------------------t--
                 Squirrel  ttaata-at-aatgta-ttattcttattca-------------------------------------t--
               Guinea pig  ttaagt-ga-aacttg-ttattttcattca-------------------------------------c--
                   Rabbit  ttagat-ag-aacttg-ctcctctcactca-------------------------------------tct
                     Pika  ttaggtcag-aacgtg-ctattcttactct-------------------------------------ccc
                    Human  ttaagt-gg-aatttg-ttcctcttattca-------------------------------------ct-
                    Chimp  ttaagt-gg-aatttg-ttcctcttattca-------------------------------------ct-
                   Bonobo  ttaagt-gg-aatttg-ttcctcttattca-------------------------------------ct-
                  Gorilla  ttaagt-gg-aatttg-ttcctcttattca-------------------------------------ct-
                   Rhesus  ttaagt-gg-aacttg-ttcctctcattca-------------------------------------ct-
                 Marmoset  ttaagt-gg-aacgtg-tccctcttattca-------------------------------------ca-
                  Tarsier  ttaatt-ga-aacatg-ttactcttattca-------------------------------------gt-
                 Bushbaby  ttaagt-gg-aattcg-ttcctcttattca-------------------------------------gt-
               Tree shrew  ttaaat-gg-aagtgg-tcactcctatgca-------------------------------------ct-
     Malayan flying lemur  ttaagt-gg-aacatg-ttactctaatcca-------------------------------------ct-
                      Pig  tgaaat-gg-aactcg-taactttgggtca-------------------------------------ct-
                  Dolphin  cacaat-ag-aacttg-caacgtttattca-------------------------------------at-
                      Cow  ctcagt-ga-aacttg-taacttttattca-------------------------------------ct-
                    Sheep  ctcaat-gg-aacttg-tagctcttattca-------------------------------------ct-
                    Horse  ggaa-t-gg-aacttg-ttacttttattcg-------------------------------------ct-
         Chinese pangolin  tgaa-----------a-ttacttttattta-------------------------------------ct-
                      Dog  tgaaat-gt-aacttg-ttacttttattca-------------------------------------ct-
       Hawaiian monk seal  -----------acttg-ttacttttgttca-------------------------------------ct-
                 Hedgehog  tggaag-ggaaatttgatagtttttattaa-------------------------------------tg-
                    Shrew  taaaat-ag-aacttattaagtcttactaactttggtggtggtggtgtgagtgtgtgtgtgtatgtgtg-
                 Elephant  ttaaat-ga-aatttg-ctacttctattca-------------------------------------ct-
                   Tenrec  ctaaat-ga-aatttg-ctacttctgttcc-------------------------------------ct-
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ----t-g-------ag---------------gggtta--tcc-t-aatcatc-a-ctgtcgttaacaaat
                      Rat  ----t-g-------gg---------------cggata--tcc-t-aaccat-----tttcgctaataaat
            GCF_003668045  ----t-g-------gg----------------ggaca--tcc-c-aaccatc-a-ttttctctaacaaat
                   Beaver  ----t-g-------gg---------------ggaaaa--act-t-agttgtt-a-ttttctctcacaaac
                 Squirrel  ----g-g-------gggacagcccggtgtgtgtgtga--tcc-t-agtcact-a-ttttctctaacaaag
               Guinea pig  ----t-g-------gg---------------gggaaa--tcc-t----cacg-c-atttctctaa-ggag
                   Rabbit  t---g-g-------ga---------------tggaac--tcc-t-agtcgat-a-ttctgcgtcccagtt
                     Pika  tcagg-g-------aa---------------gaaaac--tcc-g-ggtggttcg-ttttgtgtgacaatt
                    Human  ----t-g-------aa---------------aaaaca--tct-t-agtcatt-a-ttttctgtaacaaat
                    Chimp  ----t-g-------aa---------------aaaaca--tct-t-agtcatt-a-ttttctgtaacaaat
                   Bonobo  ----t-g-------aa---------------aaaaca--tct-t-agtcatt-a-ttttctgtaacaaat
                  Gorilla  ----t-g-------aa---------------aaaaca--tct-t-agtcatt-a-ttttctgtaacaaat
                   Rhesus  ----t-g-------ca---------------aaaaaa--tcc-t-ggtcatt-a-ttttctgtaacaaat
                 Marmoset  ----t-g-------gc---------------aaaaaa--tcc-t-agtcgtt-g-ttttctgtaacaaat
                  Tarsier  ----tgg-------aa---------------aaaaaa--tcc-t-agtcatc-a-ttttttctaacaaat
                 Bushbaby  ----t-g-------ag---------------aaaaaac-tct-t-attcatt-a-ttttctctaacaaat
               Tree shrew  ----t-g-------ga---------------aaaaagagtct-t-agtcctt-a-ttttccctaataagt
     Malayan flying lemur  ----t-g-------ga---------------aaacc---cctgt-agccgtt-a-ttttctctaacaaat
                      Pig  ----t-g-------gg-------------aaaaaaaa--gcc-tcagtcgtt-a-ttttctctaacaaac
                  Dolphin  ----t-g-------gg-------------aaaaaaaa--tcc-t-agtcttt-a-ttttccctaacaaac
                      Cow  ----t-g-------ga-------------aaaaaaaa--tcc-t-agtcttt-a-ttttctctaacaaac
                    Sheep  ----c-g-------gg-------------agaaaaaa--tcc-t-agtcttt-a-ttttctctaacagac
                    Horse  ----t-g-------gg---------------aaaaaa--tcc-t-agtcgtt-a-ttttctctgacaaac
         Chinese pangolin  ----t-g-------gg---------------gaaaaa--tcc-t-aatcgtt-a-ttttctctaacgaac
                      Dog  ----t-g-------gg-------------aaaaaaaa--tcc-t-catcctt-a-ttttctctaacaaac
       Hawaiian monk seal  ----t-g-------gg---------------aaaaaa--tcc-t-aatcctt-g-ttttcttgaacaaac
                 Hedgehog  ----t-g-------gg---------------gggaaa--tcc-t-agttgtt-atttttccctaacaaac
                    Shrew  ----t-g-------tg---------------tggggt--gcc-t-agtctgt-a-ttttctctaacaaat
                 Elephant  ----t-gtaaaaaaaa---------------aaaaaa--atc-a-ag-ggtg-atttttctctaacaaag
                   Tenrec  ----t-gt------ga---------------aaaata--tcc-a-agtggtg-a-ttttctcaaacaaat
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tacattttg--------atttcctcttctctctcaaggtttgt-----------cagaat-tc-------
                      Rat  cgcattttg--------atttcctcgtctctctcaaggtttgt-----------cagaat-tc-------
            GCF_003668045  tacatttct--------atttcctagtccctctcaagtattgt-----------caggat-gc-------
                   Beaver  tctatttcc--------acttccgtttccgtccttagttttgttcaa------gtagaat-taaaatgag
                 Squirrel  cccatttcc--------acttcctcttccctccctgatttcgttcaatcagagtcagaat-gc-------
               Guinea pig  cccgtttcc--------acgtcctcttccctctcagtttttgttaaag------cagggt-ga-------
                   Rabbit  cttgg---c--------gcttcc-ctgcccaccctcgtttgtt-----------tgaagcttc-------
                     Pika  ttcaagtcc--------acttcc-ctgcccgcccttggttggt-----------gggagc-ac-------
                    Human  cccatttcc--------acttcctcttccctctcttattttgttgaaatagaatcagaat-ac-------
                    Chimp  cccatttcc--------acttcctcttccctctcttattttgttgaaatagaatcagaat-ac-------
                   Bonobo  cccatttcc--------acttcctcttccctctcttattttgttgaaatagaatcagaat-ac-------
                  Gorilla  tccatttcc--------acttcctcttccctctcttattttgttgaaatagaatcagaat-ac-------
                   Rhesus  cccatttcc--------acttcctcttccctctcttattttgttgaaatagaatcagaat-ac-------
                 Marmoset  cccatttcc--------acgtcctcttccttctctta-ttcgttgaagctgaatcagaat-ac-------
                  Tarsier  cctgtttcc--------atgtcctcttgtctcttgtattttgttgaagtagagttagaat-ac-------
                 Bushbaby  cccatttcc--------ccttccctttacctctctgattttgttgaagcagggtcagaat-at-------
               Tree shrew  cccatttcg--------actt---cttccctctctgatttggtcgaagcaggaccggaat-ac-------
     Malayan flying lemur  tccatttcc--------acttccacttccctctcttattttgttgaagcagagtcagaat-ac-------
                      Pig  cccatttcc--------acttcattttccttcccttattttgttaaaacagaatccga-t-ac-------
                  Dolphin  cccattttc--------agttcctcttccctcccttattttgttaaaacagaatccca-t-at-------
                      Cow  accatttcc--------acgttctcttccctcctttattttgttaaaacagaatcccg-t-at-------
                    Sheep  accatttcc--------actttctcttcgctcctttattttgttaaaacagaatgccg-t-ag-------
                    Horse  tccatttcc--------acgtcctcttccctcccttattttgttaaaat--agtcaga-t-ac-------
         Chinese pangolin  actatttcc--------acttactcttctttccattattttgttgaaacagagtcaga-t-ac-------
                      Dog  cccatttcc--------acttccttttctctccctgattttgctaaaacagaattaga-t-ac-------
       Hawaiian monk seal  accatttcc--------atttccttttctctcccttattttgctaaaacagagtcaga-t-ac-------
                 Hedgehog  cccattttcaccaacaaactccct-----tccctttattttgtt--------ttttaa-a-aa-------
                    Shrew  ctcatttct--------actttct-----ctcccttactctgttgaga---gtccaga-t-aa-------
                 Elephant  gctatttcc--------actccgtcttctctccctcattttattaaaacagaatcacaat-ac-------
                   Tenrec  accttctcc--------actc--tcttccctcctgc--ttcgttaagacagcatcacaa-----------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -a-----------------ttagtagcta---atttc-cttgcaaa--t-----gtcacc-aaaaaac--
                      Rat  -a-----------------ttagtagcta---atttc-ctggcaaa--t-----attacc--aaaaac--
            GCF_003668045  -a-----------------ttagtagctagctattcc-ctggcaaa--t-----aacacc--aaaaac--
                   Beaver  ga-----------------ttagtacgt----atcct-gtggcgaa--t-----atcaca--gaaaat--
                 Squirrel  -a------------------tatcagct----atccc-atgataaa--c-----accacacagaaaat--
               Guinea pig  ga-----------------atagcagcg----atccc-atggcaag--t-----atcata--gcaaat--
                   Rabbit  -a-------gactgtgtacatagtcgct----tcccc-gtggccaa--g-----accgca--ggcaac--
                     Pika  -a-------ga--------gaagtagct----ttccc-ggagccaa--t-----agcaca--gaactc--
                    Human  -a-------ta--------ttagtggct----ctcca-atggcaaa--t-----aacaca--gaaaat--
                    Chimp  -a-------ta--------ttagtggct----ctcca-atggcaaa--t-----a--aca--gaaaat--
                   Bonobo  -a-------ta--------ttagtggct----ctcca-atggcaaa--t-----a--aca--gaaaat--
                  Gorilla  -a-------ta--------ttagtggct----ctcca-atggcaaa--t-----aacaca--gaaaat--
                   Rhesus  -a-------ca--------ttggtggct----ctcca-ataacaaa--t-----aacaca--gaaaat--
                 Marmoset  -a-------tg--------tcagtggct----ctcca-atagcaaa--t-----agcaca--gaaaat--
                  Tarsier  -a-------ta--------tcagtaact----ctctt-gtagcaga--------aataca--gaaaaa--
                 Bushbaby  -g-------ta--------tccgtctct----tgcttcatggcata--g-----accaca--gaaaat--
               Tree shrew  -g-------ta--------ttagtagct----ctccc-a-ggcaac--t-----attacc--gagaatac
     Malayan flying lemur  -a-------ta--------ttagtagct----gtccc-atggcaca--t-----accaca--aaaaa---
                      Pig  -a-------ta--------ttagtagct----ctcct-atgacaaa--c-----atcaca--gaaaat--
                  Dolphin  -a-------ta--------ttagtagct----ctccc-atgacaaa--t-----atcaca--gaaaat--
                      Cow  -a-------ta--------ttagtagct----ctccc-atgacaaa--t-----atcaca--gaaaat--
                    Sheep  -a-------ta--------ttagtagct----ctccc-atgacaaa--t-----atcaca--gaaaat--
                    Horse  -g-------ta--------ttagtagct----ctccc-atgacaaa--c-----atccca--gaaaac--
         Chinese pangolin  -a-------ca--------ttagtaaca----gtctc-aaga-aaa--t-----gtcaca--gaaaat--
                      Dog  -c-------ta--------taagtagct----ctccc-gtgacaaattt-----ctccca--agaaat--
       Hawaiian monk seal  -a-------ta--------ttagtagct----ctccc-atgacaaa--t-----atccca--gaaaat--
                 Hedgehog  -gttttttttt--------tttgtagct----cttgc-ataacaaa--a-----atttca--gaa-----
                    Shrew  -g-------gt--------ttaatagct----ctccc-aggaaaaa--a-----gtcaca--gagagt--
                 Elephant  -a-------tt--------ttagtagcc----cttcc-atggcaaa--tttgccatcaca--gaaacc--
                   Tenrec  -----------------------tagct----cttgg-gtagcaag--tttgccttctca--gaaaca--
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ------agcaaggagagagtga---gccgcttttctaagtc-tggtt------------------ccact
                      Rat  ------agcaaggagagagcaa---gccgcttttctaagtc-tggtt------------------ccact
            GCF_003668045  ------agcaaggaaagag--a---gccgc-tttcttagtc-tggtt------------------ccact
                   Beaver  ---------------------a---gtcatttttctta--c-tgttt------------------ctgct
                 Squirrel  ------agcaagaggag----a---atcctcttccttagtc-tcttt------------------ctgtt
               Guinea pig  ------agcacataga-----a---gttcctttccttagtc-tgttt------------------ctatt
                   Rabbit  ------agcagccagggc---a---gccccttccctcgctc-tgttt------------------ccact
                     Pika  ------ggctgccaaggc---a---gccacc-------ccc-tgttt------------------ctgcc
                    Human  ------agcaaggaaagag--a---gcccttttccttagtc-tgttt------------------ctact
                    Chimp  ------agcaaggaaagag--a---gcccttttccttagtc-tgttt------------------ctact
                   Bonobo  ------agcaaggaaagag--a---gcccttttccttagtc-tgttt------------------ctact
                  Gorilla  ------agcaaggaaagag--a---gcccttttccttagtc-tgttt------------------ctact
                   Rhesus  ---agcagcaaagaaagag--a---gcccttttccttagtc-tgttt------------------ctact
                 Marmoset  ---ggcagcaaggaaagag--a---gccctttttcttagtc-tgctt------------------ctact
                  Tarsier  --------------aagag--a---gtcattttcattagtg-tgttt------------------ccact
                 Bushbaby  ---agcagtaaggaaagag--a---gttcttttccttagtc-gtctt------------------ctact
               Tree shrew  tgaagcagcaaggaaagag--c---gttcctttccctggtc-tatct------------------ctact
     Malayan flying lemur  -atagcaacaggaaaagag--a---atccttttccttagtc-tgttt------------------ctact
                      Pig  ---agcaacaagg----aa--a---atccctctccggaatc-ccttt------------------ctaca
                  Dolphin  ---agcagcaaggaaggag--g---gtccctttcctgaatc-tcctt------------------ctacc
                      Cow  ---agcagcaaggaaggag--g---gtccctttcctgaatc-tctat------------------tt---
                    Sheep  ---agca----------ag--g---aatcctttcctga-----ctat------------------tt---
                    Horse  ---agcagcaa----ggag--a---gtccctttcctgagtc-tgttt------------------ct---
         Chinese pangolin  ---agcaagga-----aag--a---ggccctttcctgaatt-ggtat------------------ctata
                      Dog  ---agcagcaaag--aaaa--agaggtccctttcctgagtt-tgttt------------------ctact
       Hawaiian monk seal  ---agcagcgaag--aaag--a---gtccctttcccgagta-tgttt------------------ctact
                 Hedgehog  ---aacagcatggagagtt--t---ctttctttcctgggtc-tgttt------------------ctact
                    Shrew  ---aactgcaaggaaagag--a---gccccctttctgagtc-ctactgaaactaatacaagtgagatact
                 Elephant  --taacatcaagc--aaag--a---gtccctttcctgagtc-ttttt------------------ctagt
                   Tenrec  --tggcagccagc----ag--a---gcccctttctttagtcgtttgc------------------ctagg
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gtaaagaataccc
                      Rat  gtaaagaataccc
            GCF_003668045  gtaaagaatgccc
                   Beaver  gtaaaaaatgcca
                 Squirrel  gcaaagaatgcca
               Guinea pig  gcataaactgcca
                   Rabbit  gtcaagaacgctg
                     Pika  gtccagagcgc--
                    Human  gtgaagaatgtca
                    Chimp  gtgaagaatgtca
                   Bonobo  gtgaagaatgtca
                  Gorilla  gtgaagaatgtca
                   Rhesus  gtaaagaatgtca
                 Marmoset  gtaaagaatgcca
                  Tarsier  gtaaagaatacca
                 Bushbaby  ggagagaaagcca
               Tree shrew  gcaaagaatgcca
     Malayan flying lemur  gtaaagaatttca
                      Pig  gtaaagaatgcca
                  Dolphin  gtaaagaatgcca
                      Cow  gcaaagcacgcga
                    Sheep  gtaaagcatgcga
                    Horse  ----agaatgtca
         Chinese pangolin  gtaaagaatgcca
                      Dog  gtaaacaatgcca
       Hawaiian monk seal  gtaaagaatgcca
                 Hedgehog  gcaaagaatatcc
                    Shrew  gaaactaatacaa
                 Elephant  gaaaagaatgcca
                   Tenrec  gacaaaaatgcca
                Zebrafish  =============
            X. tropicalis  =============
                  Opossum  =============
                  Chicken  =============

Inserts between block 29 and 30 in window
B D                  Dog 189bp

Alignment block 30 of 393 in window, 56747944 - 56748024, 81 bps 
B D                 Mouse  at-gaggtctctataagcaaactcgcc---attttctttcgc-----a-aagacctgc--ctgtaactct
B D                   Rat  gt-taggtatctataagcaaattcacc---attttctttcgc-----a-aagacctgc--ctataactct
            GCF_003668045  at-gaggtatc-gtaagcaaactcacc---attttcttt-gc-----a-aagacctgc--ctgtaacaat
                   Beaver  at-aggatatt-ctaagcaagtttgtc---attttcttttat-----a----acttgtaattgtaattcg
B D              Squirrel  at-gggatatt-ataaggaagtttatc---gttttcttttac-----aaaagggcccc--atttatttca
B D            Guinea pig  at-gagtcac--ataagtaagtttgcc---gttttcttttac-----a-a--aactgc---cataatttg
B D                Rabbit  at-gaggaggt-gtgagaaagtctgcc---atttttccttca--tgaa-agggcccat--ccaagctcgt
B D                  Pika  -------------tgagaaggtct-----------------------a-agggggca-------------
B D                 Human  at-gagaaatg-ataaggaagtttgtc---attttcttttac---taa-acgacccac--ccttaattcg
B D                 Chimp  at-gagaaatg-ataaggaagtttgtc---attttcttttac---taa-acgacccac--ccttaattcg
B D                Bonobo  at-gagaaatg-ataaggaagtttgtc---attttcttttac---taa-acgacccac--ccttaattcg
B D               Gorilla  at-gagaaatg-ataaggaagtttgtc---attttcttttac---taa-acgacccac--ccttaattcg
B D                Rhesus  at-gagaaatg-ataaggaagtttgtc---attttcttttgc---taa-agcacccac--ccttaattcg
B D              Marmoset  at-ggaaaatg-ataaggaagtttgtc---attttcttttac---tat-aggacccac--ccttaacttg
B D               Tarsier  at-aagaaatt-atatgaaagtctgtt---attttcttttac---taa-atggcccac--ccttaattct
B D              Bushbaby  gt-gagacatt-acaagaaagtttgtg---actttctttcac---aat-agggcctgc--ctttatatcg
B D            Tree shrew  gt-gagaaatt-ataaggaagtttgcc---attttcttttacaataaa-agggtgtac--c-------ca
B D  Malayan flying lemur  at-gaaaaatt-atgagaaagtttgtc---attttcttttac---aca-agggcctac--ctgtaactca
B D                   Pig  ga-gagaaatt-ataggaaagtttgtc---attatctgctac-aaaaa-aaagcaggt------------
B D               Dolphin  aa-gagaaatt-gtaagaaagtttgtc---actaccttccac---aga-agagcaggt------------
B D                   Cow  ac-aagaaatt-ataagaaagtttgtc---actaccttctgc---aaa-aaagcaggt------------
B D                 Sheep  aaggagaaatg-ataagaaagtgtgtcattaccaccttctgc---aaa-agagcaggt------------
B D                 Horse  at-gagaaatt-ataagaaagcttgtc---gttttcttcgac---aaa-agggcctgt------------
B D      Chinese pangolin  at-gagcaatt-ataagaaaggttgtc---attttcttttat---aaa-aagggccct------------
B D                   Dog  ag-gggaaatt-atatgaaagtttgca---attttcttttat---aag-aa-gccccc------------
B D    Hawaiian monk seal  ag-gagaaatt-atatgaaaacttgcc---attttcttttat---aaa-aa-gccctt------------
B D              Hedgehog  at-gagaaatt-gtaggaaggttgttc----ttttctttgac----aa-agggcctgc------------
B D                 Shrew  gt-gagaaatt-ttaagaaagcttttc---attttcttttac---aaa-agggcctgc---------ata
B D              Elephant  tt-gagaaatt-ataataatgtatatc---attttctttaac---aaa-agggttggc------------
B D                Tenrec  at-cagaaatt-ataagaacctatata---attttctttaac---aa----ggccagt------------
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  ca---------------------------------------------------gcac---cgtgatt--a
                      Rat  cagctc--------ac-------------------t-gagc---ggtggt-gtgcgc---catgatt--a
            GCF_003668045  ctgctc--------ac-------------------a-gaga---ggcggtggtgcgc---agtggtt--a
                   Beaver  caattc--------ac-----------------aga-gaga---ggcagt-acctac---aatggtt--a
                 Squirrel  ccattc--------at-------------------c-aaat----------atgtgc---aatggtt--a
               Guinea pig  caa--------------------------------a-gaaa---ggcagt-atgtgc---agtgatt--a
                   Rabbit  taactc--------gc-------------------a-gagt----------acaggc---agtggag--a
                     Pika  ---------------------------------------------------acaggc---agtg--g--a
                    Human  taattt--------gc-------------------a-aagaaaaggcagaatagtac---aatggtt--a
                    Chimp  taattt--------gc-------------------a-aagaaaaggcagaatagtac---aatggtt--a
                   Bonobo  taattt--------gc-------------------a-aagaaaagacagaatagtac---aatggtt--a
                  Gorilla  taattt--------gc-------------------a-aagaaaaggcagaatagtac---aatggtt--a
                   Rhesus  taattt--------gc-------------------a-aagaaaaggcagaatagtac---aatggtt--a
                 Marmoset  caattt--------acaaaaaaaaaaaaaaaaaaaa-aaaaaaaggcagaatagtac---aatggtt--a
                  Tarsier  taattc--------gc-------------------a-aagaaaaaatagtgtagtac---aatggtt--a
                 Bushbaby  taattt--------gc-------------------a-aagaaaaggcagtatagcac---aatggtt--a
               Tree shrew  taattt--------ac-------------------a-aagaaga-gcagtata-tac---aatggtt--a
     Malayan flying lemur  taattc--------at-------------------a-aagaagaggcagtataggat---aatggtt--a
                      Pig  -aattc--------at-------------------a-aagaagagac----gtgta--------------
                  Dolphin  -aattc--------at-------------------a-aagaagaggcatt-atgtac---aat-------
                      Cow  -a------------gt-------------------a-cagaagaggcttt-atgttc---agt-------
                    Sheep  -a------------gt-------------------a-cagaagaggcttt-atgttc---aat-------
                    Horse  -aattg--------gt-------------------a-aggaacaggcagt-atgtac---aatggtt--a
         Chinese pangolin  -aattt--------gt-------------------a-aagaagaagcatt-atgtacaataatagtt--a
                      Dog  -cattc--------at-------------------a-aagaagaggcagt-atgtac---aatgattaca
       Hawaiian monk seal  -cattc--------at-------------------a-aagaagaggcagt-ata-gc---attggtt--a
                 Hedgehog  -tgttt--------gt-------------------a-aggaagaggtgat-atgttt---agtggtta--
                    Shrew  taattt--------at-------------------atatatacatatata-agattc---aatggtta--
                 Elephant  -aattctcagggaagt-------------------a-gccg-------------tac---catggtt--a
                   Tenrec  -agttct-------gt-------------------a-attgattacaatt-gattac---tgtcatc--t
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gaagctcct
                      Rat  aaagctcgg
            GCF_003668045  gacgcctgg
                   Beaver  ggagctcca
                 Squirrel  gaagctctg
               Guinea pig  ggagttttg
                   Rabbit  ggaccacgg
                     Pika  ggaccgtgg
                    Human  ggagctccg
                    Chimp  ggagctccg
                   Bonobo  ggagctccg
                  Gorilla  ggagctccg
                   Rhesus  ggagctcca
                 Marmoset  ggagctctg
                  Tarsier  ggaggtacg
                 Bushbaby  ggagtt-tg
               Tree shrew  -gaactttg
     Malayan flying lemur  ggagctcca
                      Pig  ---------
                  Dolphin  ---------
                      Cow  ---------
                    Sheep  ---------
                    Horse  ggagctttc
         Chinese pangolin  ggagcccct
                      Dog  ggagctccg
       Hawaiian monk seal  ggaactccg
                 Hedgehog  ---------
                    Shrew  ---------
                 Elephant  tgagctctg
                   Tenrec  agagttcct
                Zebrafish  =========
            X. tropicalis  =========
                  Opossum  =========
                  Chicken  =========

Inserts between block 30 and 31 in window
B D             Elephant 2bp
B D               Tenrec 177bp

Alignment block 31 of 393 in window, 56748025 - 56748065, 41 bps 
B D                 Mouse  t-ac------gcaccacag-cttcttaagcaagttg-ttt-acccagt----tag
B D                   Rat  taac------ccaccacag-cttcttaagcaagcgg-ttt-acccatt----tag
            GCF_003668045  c-gct-t-tggtactgctg-cttctgaagcaagctg-tta-gctcatt----tag
                   Beaver  a-tc------ttttggctg-ctt-----------ta-tt-------tt----tag
B D              Squirrel  a-tc----tagcaccacca-cttcttaagcaagtta-tttaatttttt----tag
B D            Guinea pig  a-cct-tctggtaccactg-cttcttaagc----ta-ttt-aattctt----tag
B D                Rabbit  t--g----aggcacctccg-cttcttctgcaagttc-gtt-----att----tag
B D                  Pika  g-ag----aggtgccccag-cttcggaagcaaggtc-gtt-----att-------
B D                 Human  a-tc--tctggctgtacga-cttctt-aggaaaata-ttt-aattttt-------
B D                 Chimp  a-tc--tctggctgtacga-cttctt-aggaaaata-ttt-aattttt-------
B D                Bonobo  a-tc--tctggctgtacga-cttctt-aggaaaata-ttt-aattttt-------
B D               Gorilla  a-tc--tctggctgtacga-cttctt-aggaaatta-ttt-aatgttt-------
B D                Rhesus  a-tc--tctggctgtacga-ctcctt-cggaaaata-ttt-aattttt----tag
B D              Marmoset  a-tc--tctggctgtatga-cttctt-agtaaaata-ttt-aattttt----tag
B D               Tarsier  a-tc--tcgggcactatca-cttcttcagcaagtta-ttt-aaagttt----tag
B D              Bushbaby  g-gc--tctggcactaccagcttcttaagcaagtta-att-aatttctttttttg
B D            Tree shrew  a-tct-tctgaaactacca-ttttctaagcaaattatttc-atttttt----aag
B D  Malayan flying lemur  a-tct-tctggcaacactg-cttcttaagca------ttt-aattttg----tag
B D                   Pig  --------------cattg-ccacggaagcaagtta-ttt-aaccttt----tag
B D               Dolphin  ---------ggcaccattg-ccacttactcaagtta-tt--aaccttt----tag
B D                   Cow  ---------ggcaccactg-ccacttaagcaagtta-ttg-aaccttt----tag
B D                 Sheep  ---------ggcaccactg-ccacctaagcaagtta-ttt-aaccttt----tag
B D                 Horse  a-tct-tcaggcaccacca-ccgcttaggcaagtta-ttt-aaccttt----tag
B D      Chinese pangolin  a-tct-tctggtaccacca-ccatttaagcaagtta-ttt-aacttcc----tag
B D                   Dog  a-tct-tctggcacca--g-tcactaaagcaagtta-ttt-aaccttt----tag
B D    Hawaiian monk seal  a-tct-tctggtaccattg-tcactaaagcaagtta-ttt-aaccttt----tag
B D              Hedgehog  ---------aacaatattg-tcaccatagcatgttg-ttt-ggcttct----tag
B D                 Shrew  ---------ggcaccccta-ccac---------tta-ttt-accct-t----tag
B D              Elephant  ----cacctggcgccataggctttttaagcaagtta-ttt-aaccttt----taa
B D                Tenrec  =======================================================
B D             Zebrafish  =======================================================
B D         X. tropicalis  =======================================================
B D               Opossum  =======================================================
B D               Chicken  =======================================================

Alignment block 32 of 393 in window, 56748066 - 56748148, 83 bps 
B D                 Mouse  -------------------------------------------------agcctcttcattttcttagac
B D                   Rat  -------------------------------------------------agcctcttcattttcttagac
            GCF_003668045  -------------------------------------------------agcc-----------------
                   Beaver  -------------------------------------------------agctcc--------------a
B D              Squirrel  -------------------------------------------------agccctc-------------a
B D            Guinea pig  -------------------------------------------------agccttc-------------a
B D                Rabbit  -------------------------------------------------agcctcc-------------g
B D                  Pika  ----------------------------------------------------------------------
B D                 Human  -------------------------------------------------agtctct-------------a
B D                 Chimp  -------------------------------------------------agtctct-------------a
B D                Bonobo  -------------------------------------------------agtctct-------------a
B D               Gorilla  -------------------------------------------------agtctct-------------a
B D                Rhesus  -------------------------------------------------agtctct-------------a
B D              Marmoset  -------------------------------------------------agtttct-------------a
B D               Tarsier  -------------------------------------------------aacttca-------------a
B D              Bushbaby  -------------------------------------------------agtttac-------------a
B D            Tree shrew  -------------------------------------------------aaccctt-------------a
B D  Malayan flying lemur  -------------------------------------------------agcctcc-------------a
B D                   Pig  -------------------------------------------------agtctct-------------g
B D               Dolphin  -------------------------------------------------agactcc-------------a
B D                   Cow  -------------------------------------------------agtctct-------------g
B D                 Sheep  -------------------------------------------------agtctct-------------g
B D                 Horse  -------------------------------------------------agccttc-------------a
B D      Chinese pangolin  -------------------------------------------------agcctcc-------------a
B D                   Dog  -------------------------------------------------cacctcc-------------a
B D    Hawaiian monk seal  -------------------------------------------------cacctcc-------------a
B D              Hedgehog  -------------------------------------------------aacctct-------------g
B D                 Shrew  -------------------------------------------------gctctct-------------a
B D              Elephant  -------------------------------------------------agcctca-------------a
B D                Tenrec  ggcctcctctcttttggctccactttaaacaatttgtttaaacttgcaacacctca-------------g
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  -tttcttca-tt-ttcaaaataa-ggaactaatagtcccaaagtcaa-----------------------
                      Rat  -tttcttca-tt-ttcaaaataa-ggaactagtaattccaaagtc-a-----------------------
            GCF_003668045  ------tca-gt-ttcgagataa-gaaaataatagtcccaaagtc-------------------------
                   Beaver  -tttcttca-tc-ttcaaaataa-ggatacaatag-cccaacctcaaaaggtgttaca---aaagattca
                 Squirrel  -tttcttta-tc-tttaaaagga-agaaataatagtcccaacgtcaaaagatattatg---agacttcaa
               Guinea pig  -tttcttca-tc-cttaaaaatc-ggaaataatagtcctaacctcaaaaggtgttatg---gggatacag
                   Rabbit  -tggcttcc-tg-tttaaaagta-ggaaatcatagtgccaggctccaacgaggtcctg---gggactcag
                     Pika  ---gcttca-cg-attaaaa---------------tgctaagttgtagagatgtcccc---aggactcac
                    Human  -tttcttca-tc-tttaaaacag-ggaaatgatattcccaaccc--agagatgttatg---agtattcaa
                    Chimp  -tttcttca-tc-tttaaaacag-ggaaatgatattcccaaccc--agagatgttatg---agtattcaa
                   Bonobo  -tttcttca-tc-tttaaaacag-ggaaatgatattcccaaccc--agagatgttatg---agtattcaa
                  Gorilla  -tttcttca-tc-tttaaaacag-agaaatgatattcacaaccc--agagatgttatg---agtattcaa
                   Rhesus  -tttcttca-tc-tttaaaacag-ggaaatcatactcccaaccc--agaggtgttatg---agtattcaa
                 Marmoset  -tttcttca-tc-tttaaaacag-ggagatgatactcccaaccccaagagatgttatg---ggtattcaa
                  Tarsier  -atgcttca-tctttttaaatgg-ggaaatgatagtctcaacctcaagagatgttatg---agtattcaa
                 Bushbaby  tttttttca-cc-ttaaaaacag-ggaaatgctagttctaacct-----------------------caa
               Tree shrew  -tttttttgatg-tttaaaatga-aggaataatggtcccactctcaagagagattatg---aggatttaa
     Malayan flying lemur  -tttcttcg-tc-tttgaaatgagaaaaataatagtcccaacctccagagatgttaag---agtattcaa
                      Pig  -ttttttcg-tc-tatgaaac---agaaataataggcccaacttcaagagatgtt------gagtttcaa
                  Dolphin  -ttttttca-tc-tataaaac---ggaaataatagggtcaacctcaagagatgtg------aaatttcaa
                      Cow  -ttttttca-ct-tatgaagcac-ggaaataataggcccaacctcaagcagtgtg-------aatttcaa
                    Sheep  -ttttttca-tc-tataaaacag-ggaaataataggcccaacctcaagcagtgtg------aaatttcaa
                    Horse  -tttcttca-tc-tgtaaaacgg-aga---aatagtcccaacctcaagagatgttgac---aagagtcaa
         Chinese pangolin  -tttcttca-tc-tgtaaaacag-caaaataataatcctaacctcaagagatgttggttgaaagattcag
                      Dog  -tttcttca-tc-tgtaaacccg-ggacacaatagtcctaacctcaggagatgttgtg---aagattcaa
       Hawaiian monk seal  -tttcttca-tc-tttaaaaggg-ggaaataatagtcccaacctcaggagatgttgtg---aagattcag
                 Hedgehog  -ttttttca-tt-tgtaaaactg-agaa----tagatccagtctcagaagatgttgtg---aaaattcag
                    Shrew  -ttttt----tt-catcaaacaa-ggac-------------tctcaagaga---tagg---aagattcaa
                 Elephant  -tttcttca-tc-tataaaaaag-ggaaataagagtttcatcctcaagagatgtcatg---aggattcaa
                   Tenrec  -tttgttca-tc-tgtaaaaagg-ggaagggatatttccaacctcaggagctgtcagg--------ccca
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  --gagtca-------gtacaactatatg
                      Rat  --gagtca-------gtacaatgttaag
            GCF_003668045  -------a-------gtacatcgatagg
                   Beaver  gtgagacg-------atgtaaccatatg
                 Squirrel  t-gagatg-------atgcaaccatatg
               Guinea pig  t-gagata-------atgcagtcatatg
                   Rabbit  g-aagc-a-------gtgcaaccatatg
                     Pika  c-gagtgg-------gtgccaccttatg
                    Human  t-gagata-------atgcaaccatatg
                    Chimp  t-gagata-------atgcaaccatatg
                   Bonobo  t-gagata-------atgcaaccatatg
                  Gorilla  t-gagata-------atgcaaccatatg
                   Rhesus  t-gagata-------atgcaaccatatg
                 Marmoset  t-gagata-------atgcaaccatatg
                  Tarsier  t-gagata-------gtgcaacctcata
                 Bushbaby  --gagata-------atgtaaccatatg
               Tree shrew  t-gaaata-------atgcaaccatatg
     Malayan flying lemur  t-aagata-------atgcaaccatatg
                      Pig  t-gaggta-------atgcaaccatgtg
                  Dolphin  t-gagata-------atgcaaccatagg
                      Cow  t-gtgata-------atacaaccatggg
                    Sheep  t-gtgata-------atacaaccagggg
                    Horse  t-gagata-------atgcaaccatatg
         Chinese pangolin  t-gagtta-------gtgcaaccatatg
                      Dog  t-gagata-------atgcagccctatg
       Hawaiian monk seal  t-gagata-------atgcagccgtatg
                 Hedgehog  c-aagaca-------atgcaactgtagg
                    Shrew  t-gagata-------atgcaaacatggg
                 Elephant  t-gagata-------gtgcgaccatatg
                   Tenrec  t-aagatatgtacacatgcaaccatatg
                Zebrafish  ============================
            X. tropicalis  ============================
                  Opossum  ============================
                  Chicken  ============================

Inserts between block 32 and 33 in window
B D                Shrew 4bp
B D             Elephant 212bp

Alignment block 33 of 393 in window, 56748149 - 56748168, 20 bps 
B D                 Mouse  gctggaaagaaacattcatt
B D                   Rat  gctcttaggaaacattcatt
            GCF_003668045  gcccttaggaaacattcatt
                   Beaver  gcacatagtaagcattcatt
B D              Squirrel  gcacatagtaagcactcagt
B D            Guinea pig  agccatagtaaatgttcatt
B D                Rabbit  gcacgccataagccctcttc
B D                  Pika  gcactcaggaatccctcatt
B D                 Human  gcacatagtaagcatttatt
B D                 Chimp  gcacatagtaagcatttatt
B D                Bonobo  gcacatagtaagcatttatt
B D               Gorilla  gcacatagtaagcatttatt
B D                Rhesus  gcacatagtaagcatttatt
B D              Marmoset  gcacatagtaaacagttatt
B D               Tarsier  gcacataataagcattcatt
B D              Bushbaby  gcatatagtaagcattcatt
B D            Tree shrew  gcacatagtaagcattcatt
B D  Malayan flying lemur  gcatagagtaagcattcagt
B D                   Pig  gcacacagtaagctttcatt
B D               Dolphin  gcacatagtaggcattcatt
B D                   Cow  gcacatagtaagtcttcatt
B D                 Sheep  gcaca---taagtcttcatt
B D                 Horse  gcacacactgaacattcatt
B D      Chinese pangolin  gcacatagtaagcattcatt
B D                   Dog  gctcatagtaagcacgcatt
B D    Hawaiian monk seal  gcacatagtaagcttccatt
B D              Hedgehog  ggacattataag----catt
B D                 Shrew  tgaca-cataag----catt
B D                Tenrec  gcacacagcaaatattcagt
B D             Zebrafish  ====================
B D         X. tropicalis  ====================
B D               Opossum  ====================
B D               Chicken  ====================
B D              Elephant  ====================

Inserts between block 33 and 34 in window
B D               Rabbit 55bp
B D                 Pika 108bp

Alignment block 34 of 393 in window, 56748169 - 56748202, 34 bps 
B D                 Mouse  aagtaa-----------------------cctc--------cctggttaaaaatggcagcaagag
B D                   Rat  aagtat-----------------------cccc--------tgtggttaaaaatggcagtgagag
            GCF_003668045  aaatat-----------------------cccc--------tgtggttccaaatggcagttagag
                   Beaver  aactgt-----------------------tacc--------tgtggttataagtggcagttagag
B D              Squirrel  aaagat-----------------------tacc--------tat-gttctaaatggtacagattg
B D            Guinea pig  aaatgt-----------------------tacc--------tgtggttataaatggtagagactg
B D                Rabbit  attttt-----------------------cacccccctttttgaagttataaatggtgtttagag
B D                 Human  aagtat-----------------------tgtc--------tgtggttctaagtggcagttaaaa
B D                 Chimp  aagtat-----------------------tgcc--------tgtggttctaagtggcagtttaaa
B D                Bonobo  aagtat-----------------------tccc--------tgtggttctaagtggcagtttaaa
B D               Gorilla  cagtat-----------------------tgcc--------tgtggttctaagtggcagttaaaa
B D                Rhesus  aagtat-----------------------tacc--------tgtggttctaagtggcagttaaag
B D              Marmoset  aagtatttattaagcatttattaagtatatacc--------tgtggttctaagtggcagttaaag
B D               Tarsier  aaatat-----------------------tacc--------ta------taagtggcagttagag
B D              Bushbaby  aaatat-----------------------tacc--------tgtggttaaaactgacagataaca
B D            Tree shrew  aaatat-----------------------tacc--------tgtggttataaatggcggttacag
B D  Malayan flying lemur  aaatat-----------------------tagt--------catatttataaatggctattagag
B D                   Pig  aaatat-----------------------tacc--------tgtggatacaaatgagggttagcg
B D               Dolphin  aaatat-----------------------tacc----------ctgatagaaatggcgttagag-
B D                   Cow  aaatat-----------------------tgcc--------tatggatagaaatggcacttagag
B D                 Sheep  aaatat-----------------------tgcc--------tatggatagaataggcattaaata
B D                 Horse  aaatat-----------------------tacc--------tgtgcttacaaatgtcggtcagag
B D      Chinese pangolin  gaattt-----------------------tacc--------tgtggttataaatggcagttagag
B D                   Dog  aaatag-----------------------tacc--------tgtggttataaatggcggttggaa
B D    Hawaiian monk seal  taatag-----------------------tacc--------tgtggttataaatggcggttggag
B D              Hedgehog  atctac-----------------------tacc--------tatactgatcaatgttgcttagag
B D                 Shrew  aaatat-----------------------tacc--------tgtggttataaatggcagttagag
B D                Tenrec  aaatat-----------------------tacc--------tctggttctgagtggtgattaaag
B D                  Pika  =================================================================
B D             Zebrafish  =================================================================
B D         X. tropicalis  =================================================================
B D               Opossum  =================================================================
B D               Chicken  =================================================================
B D              Elephant  =================================================================

Inserts between block 34 and 35 in window
B D                Sheep 68bp

Alignment block 35 of 393 in window, 56748203 - 56748220, 18 bps 
B D                 Mouse  acaggctttt--------taaaaaaa
B D                   Rat  a----ctttt--------t-------
            GCF_003668045  attgactttt--------a-------
                   Beaver  a----tattt--------t-------
B D              Squirrel  a----ctttt--------a-------
B D            Guinea pig  a-----tttt--------a-------
B D                Rabbit  attaactttt--------a-------
B D                 Human  agacacgtgt--------a-------
B D                 Chimp  agacacgtgt--------a-------
B D                Bonobo  agacacgtgt--------a-------
B D               Gorilla  agacacgtgt--------a-------
B D                Rhesus  agagacgtgt--------a-------
B D              Marmoset  agagacttgt--------a-------
B D               Tarsier  gatgactttt--------a-------
B D              Bushbaby  ----accttt--------a-------
B D            Tree shrew  attgccttgt--------a-------
B D  Malayan flying lemur  attgactt-t--------g-------
B D                   Pig  attgacttct----------------
B D               Dolphin  attgactca-----------------
B D                   Cow  attgactta-----------------
B D                 Horse  attgactttt----------------
B D      Chinese pangolin  attgactttt----------------
B D                   Dog  atcgactttt----------------
B D    Hawaiian monk seal  attgactttt----------------
B D              Hedgehog  accgactttt----------------
B D                 Shrew  attgatttctcaagaaca--------
B D                Tenrec  -ataacattt----------------
B D                 Sheep  ==========================
B D                  Pika  ==========================
B D             Zebrafish  ==========================
B D         X. tropicalis  ==========================
B D               Opossum  ==========================
B D               Chicken  ==========================
B D              Elephant  ==========================

Inserts between block 35 and 36 in window
B D             Hedgehog 7bp
B D                Shrew 227bp

Alignment block 36 of 393 in window, 56748221 - 56748234, 14 bps 
B D                 Mouse  caaaaaacaaaaaa
B D                   Pig  ---------aaaaa
B D               Dolphin  ---------aaaaa
B D                 Horse  ---------aaaaa
B D      Chinese pangolin  ---------aaaaa
B D                   Dog  ---------aaaaa
B D    Hawaiian monk seal  ---------aaaaa
B D            Guinea pig  --------------
B D                 Sheep  ==============
B D                Rhesus  --------------
B D              Marmoset  --------------
B D               Gorilla  --------------
B D                Bonobo  --------------
B D                 Chimp  --------------
B D                 Human  --------------
B D                Tenrec  --------------
B D               Tarsier  --------------
B D            Tree shrew  --------------
B D              Hedgehog  ==============
B D                  Pika  ==============
B D             Zebrafish  ==============
B D         X. tropicalis  ==============
B D                   Cow  --------------
B D               Opossum  ==============
B D               Chicken  ==============
B D                 Shrew  ==============
B D              Elephant  ==============
B D              Squirrel  --------------
B D                Rabbit  --------------
B D              Bushbaby  --------------
                  Beaver  --------------
B D  Malayan flying lemur  --------------
           GCF_003668045  --------------
B D                   Rat  --------------

Inserts between block 36 and 37 in window
B D                  Pig 6bp
B D              Dolphin 19bp
B D                Horse 9bp
B D     Chinese pangolin 19bp
B D                  Dog 19bp
B D   Hawaiian monk seal 19bp

Alignment block 37 of 393 in window, 56748235 - 56748261, 27 bps 
B D                 Mouse  aacccaaacaaacaacaaaaacaaaac
B D                   Cow  -----------------------aaat
B D                Tenrec  -------------------------a-
B D            Guinea pig  ---------------------------
B D                 Sheep  ===========================
B D                Rhesus  ---------------------------
B D    Hawaiian monk seal  ===========================
B D                   Dog  ===========================
B D                 Horse  ===========================
B D              Marmoset  ---------------------------
B D               Gorilla  ---------------------------
B D                Bonobo  ---------------------------
B D                 Chimp  ---------------------------
B D                 Human  ---------------------------
B D               Tarsier  ---------------------------
B D            Tree shrew  ---------------------------
B D              Hedgehog  ===========================
B D                  Pika  ===========================
B D             Zebrafish  ===========================
B D         X. tropicalis  ===========================
B D               Opossum  ===========================
B D               Chicken  ===========================
B D                 Shrew  ===========================
B D              Elephant  ===========================
B D              Squirrel  ---------------------------
B D                   Pig  ===========================
B D                Rabbit  ---------------------------
B D      Chinese pangolin  ===========================
B D               Dolphin  ===========================
B D              Bushbaby  ---------------------------
                  Beaver  ---------------------------
B D  Malayan flying lemur  ---------------------------
           GCF_003668045  ---------------------------
B D                   Rat  ---------------------------

Inserts between block 37 and 38 in window
B D                  Cow 9bp

Alignment block 38 of 393 in window, 56748262 - 56748266, 5 bps 
B D                 Mouse  aaaac
B D                   Rat  ---ac
            GCF_003668045  aaaac
                   Beaver  aaagt
B D              Squirrel  aaaat
B D            Guinea pig  agaat
B D                Rabbit  aaagc
B D                 Human  aaagt
B D                 Chimp  aaagt
B D                Bonobo  aaagt
B D               Gorilla  aaagt
B D                Rhesus  aaagc
B D              Marmoset  aaagc
B D               Tarsier  aaaac
B D              Bushbaby  aaaac
B D            Tree shrew  aaaac
B D  Malayan flying lemur  aaacc
B D                 Sheep  aaaac
B D              Elephant  ataac
B D                Tenrec  aaaac
B D    Hawaiian monk seal  =====
B D                   Dog  =====
B D                 Horse  =====
B D              Hedgehog  =====
B D                  Pika  =====
B D             Zebrafish  =====
B D         X. tropicalis  =====
B D                   Cow  =====
B D               Opossum  =====
B D               Chicken  =====
B D                 Shrew  =====
B D                   Pig  =====
B D      Chinese pangolin  =====
B D               Dolphin  =====

Alignment block 39 of 393 in window, 56748267 - 56748275, 9 bps 
B D                 Mouse  aagtgatat
B D                   Rat  aagtgatac
            GCF_003668045  aagtgacat
                   Beaver  aagcaatat
B D              Squirrel  cagccatat
B D            Guinea pig  cagcagcat
B D                  Pika  aaatgatgt
B D                 Human  aagtaatat
B D                 Chimp  aagtaatat
B D                Bonobo  aagtaatat
B D               Gorilla  aagtaatat
B D                Rhesus  aagtaatat
B D              Marmoset  aagtaatat
B D               Tarsier  aagcaatat
B D              Bushbaby  aagctatat
B D            Tree shrew  aagcaatat
B D  Malayan flying lemur  aggcaatat
B D                   Cow  --------t
B D                 Sheep  aagcagttt
B D                 Horse  --------t
B D      Chinese pangolin  --tgtgtgt
B D    Hawaiian monk seal  --------t
B D              Hedgehog  aagcttttt
B D              Elephant  aagcaattt
B D                Tenrec  aagtggtta
B D                   Dog  =========
B D             Zebrafish  =========
B D         X. tropicalis  =========
B D               Opossum  =========
B D               Chicken  =========
B D                 Shrew  =========
B D                   Pig  =========
B D                Rabbit  ---------
B D               Dolphin  =========

Inserts between block 39 and 40 in window
B D                  Cow 9bp
B D                Sheep 9bp
B D                Horse 3bp
B D     Chinese pangolin 3bp
B D   Hawaiian monk seal 3bp
B D             Hedgehog 21bp

Alignment block 40 of 393 in window, 56748276 - 56748308, 33 bps 
B D                 Mouse  tc------------------ataatatacattgtttagaa---aatccgtagta
B D                   Rat  ac------------------ataatattcatggtttagaa---aatctatagta
            GCF_003668045  tc------------------ataataggcattgtttagaa---aatctatagta
                   Beaver  tta---------------tgataatatgctttgtttagag---agcccatagta
B D              Squirrel  tta---------------aaataatacacgttgtttagag---agcccatagca
B D            Guinea pig  tta---------------aaagaatgtactttgtttagag---aggccatagta
B D                Rabbit  -------------------------aagcactgtttatcg--------------
B D                  Pika  ttagagattgact--tttaaaaagcaatcactgtttatcagacgtctcatagta
B D                 Human  tta---------------tcagagtatactttgttctgag---agaccatagtc
B D                 Chimp  tta---------------tcagagtatactttgttctgag---agaccatagtc
B D                Bonobo  tta---------------tcagagtatactttgttctgag---agaccatagtc
B D               Gorilla  tta---------------tcagagtatacttcgttctgag---agaccatagtc
B D                Rhesus  tta---------------tcagagtatactttgttctgag---agaccatagtc
B D              Marmoset  tta---------------tcagagtatatcttgttcagag---agcccatagtc
B D               Tarsier  tta---------------ggagaatatactttgttccaag---agcccatagta
B D              Bushbaby  tta---------------tcagaatatactttgttcagag---aggccgtactc
B D            Tree shrew  ata---------------ccagaatatagtttgtc-agaa---agtccatggtc
B D  Malayan flying lemur  tta---------------tcagaatatactttgttgggag---agcccatagtt
B D                   Pig  ---------------------------actttgttcagag---agcccatagtc
B D               Dolphin  ------------------tcagaatatactttggtcagcc---agctcatagtc
B D                   Cow  ------------------tcacaatttactttgatcaggg---aatacatagtc
B D                 Sheep  ------------------tcacaatatactttgatcaggg---agttcat----
B D                 Horse  ------------------taagagaatactttgttcagag---agctcattgtc
B D      Chinese pangolin  ------------------tgaggatatactttatttaggg---agctcatagtc
B D                   Dog  ------------------tgagaatatactttgttcagag---agctcatagtc
B D    Hawaiian monk seal  ------------------tgagaatagactttattcagag---agctcatagcc
B D              Hedgehog  ------------------tgagtgtatgctttgctctgag---aactc--tgtc
B D              Elephant  -------ttatcc--------gagtattctttgcccagag---agcttatagtc
B D                Tenrec  -------cctcccccactccataatattccttgcttagag---agcttatagtc
B D             Zebrafish  ======================================================
B D         X. tropicalis  ======================================================
B D               Opossum  ======================================================
B D               Chicken  ======================================================
B D                 Shrew  ======================================================

Inserts between block 40 and 41 in window
B D                  Pig 10bp
B D              Dolphin 10bp
B D                  Cow 10bp
B D                Sheep 10bp
B D                Horse 10bp
B D     Chinese pangolin 10bp
B D                  Dog 10bp
B D   Hawaiian monk seal 10bp
B D             Hedgehog 10bp

Alignment block 41 of 393 in window, 56748309 - 56748448, 140 bps 
B D                 Mouse  agaa--------------a---------------------cactt-gtg----acagacaa--taaaa--
B D                   Rat  agaa--------------a---catcctacca------agcatct-atg----acaaacaa--tggaa--
            GCF_003668045  agaa--------------a---cattcctcca------agcattt-gtg----acaaacaa--tagga--
                   Beaver  aaaa--------------a----aagtggcga------ggcatttcgtt----acaaacaa--tagaa--
B D              Squirrel  aaag--------------aaaaaaaaagtcaa------agcattttgct----acaaacac--taaaaag
B D            Guinea pig  aaaa--------------t-----aaagtcaa------gccattttggt----acaagcaa--tagaa--
B D                Rabbit  -----------------------------gaa------tatactttgtt-----cagacagcctagag--
B D                  Pika  aaaa--------------aaaaaaggtgtgaa------ggcatgttgttacccacaga-----tagag--
B D                 Human  aaaa--------------a------gcttcaa------gagattttgtt----acaaacaa--tagaaag
B D                 Chimp  aaaa--------------a------gcttcaa------gggattttgtt----acaaacaa--tagaaag
B D                Bonobo  aaaa--------------a------gcttcaa------gggattttgtt----acaaacaa--tagaaag
B D               Gorilla  aaaa--------------a------gcttcaa------gggattttgtt----acaaacaa--tagaaag
B D                Rhesus  aaaa----------------------cttcaa------gggattttgtt----acaaac-a--tagaaag
B D              Marmoset  aaaa--------------a------gcttcaa------gggattttgtt----acgaacaa--tagaaag
B D               Tarsier  aaaaacaaaacaaaacaaa------acttcaa------ggcattttgtt----acaaacaa--tagaaag
B D              Bushbaby  aaaa--------------a------gctttga------ggcattttgtt----gcaaacaa--tagaaag
B D            Tree shrew  aaaa--------------a------gtgtcaa------ggtattttgct----acaaacaa--tagaagg
B D  Malayan flying lemur  gaaa--------------a------cagtcaa------ggtgttttgtt----acagacaa--tggaaag
B D                   Pig  ------------------------------aa------ggtattttgtt----acaaacca--tag----
B D               Dolphin  ------------------------------aa------ggtattttgtt----acaaacaa--aag----
B D                   Cow  ------------------------------aa------ggtattttgtt----acaaacaa--tag----
B D                 Sheep  ------------------------------aa------ggtattttgtt----acaaacaa--tag----
B D                 Horse  ------------------------------aa------ggcatttcgtt----acaaacaa--tagaaag
B D      Chinese pangolin  ------------------------------aa------ggcattttgtt----acaaacaa--tagaggg
B D                   Dog  ------------------------------aa------ggcattttgtt----acaaacaa--tag-agg
B D    Hawaiian monk seal  ------------------------------aa------ggcattttgtt----acaaacgt--tagaagg
B D              Hedgehog  ------------------------------at------agcattttgtc----ggaaacag--tgtg---
B D                 Shrew  ------------------------------accttaaaagcaaaaaaaa----aaaaaaaa--agta---
B D              Elephant  --------------------aacaagtgtcaa------ggcattttgtt----ccaaacaa--tag----
B D                Tenrec  --------------------aaaacatttcaa------ggcatttagtt----acaaacaa--tag----
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  agtgtacacaaagcctggag-----aacagtagcag----------------gca------ttt-aacag
                      Rat  aatgtacagaaagcctggag-----aacagtagcag----------------gta------ttt-aacag
            GCF_003668045  agtgtacacaaagcatcaag-----aacagtaggga----------------gcatttaacttt-aacag
                   Beaver  --cgtatataaagcgctgag-----catagtaacaa----------------gca------ttt-aatag
                 Squirrel  agtgcatacaaaacactgaa-----catagtagcaa----------------gca------tttaaaaag
               Guinea pig  aatgtatataaagcactgag-----cttagaaacaa----------------gca------tca-agtat
                   Rabbit  tcca---------aacgtag-----catagtagcaa----------------gca------ttt-aatag
                     Pika  gctgtgcacatgcagtgtag-----cctagtagcaa----------------acg------ttt-aatag
                    Human  agtgtatataaagcacctac-----catagaagcaa----------------gca------ttt-aatag
                    Chimp  agtgtatataaagcacctac-----catagaagcaa----------------gca------ttt-aatag
                   Bonobo  agtgtatataaagcacctac-----catagaagcaa----------------gca------ttt-aatag
                  Gorilla  agtgtatataaagcacctac-----catagaagcaa----------------gca------ttt-aatag
                   Rhesus  agtgtatacaaggcacctac-----cagagaagcaa----------------gca------ttt-aatag
                 Marmoset  agtgtatataaagcgtctac-----catagaagcaa----------------gca------ttt-aatag
                  Tarsier  agtgtatataaagtgcctaa-----cataatagcaa----------------gca------ttt-aatag
                 Bushbaby  agtatatataaagctcctac-----cagagcagcaa----------------aca------ttt-attag
               Tree shrew  agtggatataaaacaaccac-----tgtagtagcaa----------------gca------ttt-aatag
     Malayan flying lemur  agt-------------------------------------------------------------------
                      Pig  agtgtctataaagcacctagtata-cagagtagcaa----------------gca------ttt-aatag
                  Dolphin  agcatctataaagcacctagtata-cagagtagtaa----------------gca------ttt-aattg
                      Cow  agtgtctataaagcacctagcata-tagagtagtaa----------------gca------ttt-actag
                    Sheep  cgtgtctataaagcacccagcata-tagagtagtaa----------------gca------ttt-aatag
                    Horse  agtgtatataaagtgcctagtatt-catagtagcta----------------gca------ttt--atag
         Chinese pangolin  agtgtatacaaagcacctag-----catagtagcaa----------------gaa------ttc-aatag
                      Dog  agtgtttttaaagcactgag-----cagagtagcaa----------------gca------ttt-aatag
       Hawaiian monk seal  agtgtttttaaagcacctag-----catagtagcaa----------------gca------ttt-aatag
                 Hedgehog  agtgcatgcaaagcgcctacctgg-cctagtagcaa----------------gca------ttt-aatag
                    Shrew  -------gcaaggtattttgatggaaataataggaatgactataaaacaccttta------ttt-aacag
                 Elephant  agtctatctaaagcatttag-----caaagcagcaa----------------gcg------ttt-aatag
                   Tenrec  tagctatctaaagcatttag-----tatagtagcaa----------------aca------ttt-aatag
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gggctcag-tgctgtc-------------------tgga--------gtcacatcatgaagttcagagtt
                      Rat  gagctctg-cgctgtct------------------tgga--------atcacatcatgaagttctgagtt
            GCF_003668045  gggctcag-tgccttctgtt-gctcattg-ttttgggga--------atcacactgtgaagactggagtt
                   Beaver  gtgctcag-tgcttattattaggtcatca-tttcttgga--------ataacattgcgaagtatacagct
                 Squirrel  gtatttag-tgctttttattagctcacca-tttcttgga--------ataacattgtgaagtatggtttt
               Guinea pig  gtgctcag-agcttttcattag---atca-tttcttgga--------ataacattgtgaagcatagagct
                   Rabbit  gtgcccag-tgcttttgattaggtcatca-tttcttgga--------ataacattgtgaagtatagagtt
                     Pika  gtgcccag-cacttttgattaggtcatgg-tttcttgga--------ataacattgtgaagtacagagtt
                    Human  gcgctcag-tgctttttattaggtcatca-ttgattgga--------ataacattgtgaagtatagagtt
                    Chimp  gcgctcag-tgctttttattaggtcatca-ttgattgga--------ataacattgtgaagtatagagtt
                   Bonobo  gcgctcag-tgctttttattaggtcatca-ttgattgga--------ataacattgtgaagtatagagtt
                  Gorilla  gtgctcag-tgctttttattaggtcatca-tttattgga--------ataacattgtgaagtatagagtt
                   Rhesus  gcgcttag-tgctttttattaggtcatca-tttattgga--------ctaacgttgtgaagtatagagtt
                 Marmoset  gcactcag-tgctttttattaggtcatca-tttattgaa--------ataacgttgtgatgtatagagtt
                  Tarsier  gtgctcag-tgctttttattaggtcatca-tttcttgga--------ataatattgtgaagcatagaatt
                 Bushbaby  gtgcttat-tgctccttattagatcatca-ttcctagaa--------ataacat------gtgaagagct
               Tree shrew  atgctcag-tgctttcgatgagatcatca-ttgcttggaagaacatcataacatcatgaagcacagagtt
     Malayan flying lemur  -----------------------------------------------atagtgtc---------------
                      Pig  gtgatggg-ttatgtttactagatcataa-tttcctgga--------ataacattgtaaagtatgaagtt
                  Dolphin  gtgctcag-taatgtttattaggtcttca-tttcctgga--------ataacattgtgaagtacagagtt
                      Cow  gtgctcag-taatgtttattaggtcatca-tttcctgaa--------ataacattgtgaagtacagagct
                    Sheep  gtgctcag-taatgtttattaggtcatca-tttcctgaa--------ataacattgtgaagtatagagct
                    Horse  gtgctcag-taggttttattgggtcatca-tttcctgga--------ataacatcgtgaagtatagagtt
         Chinese pangolin  gtgctcag-tagtttttattaagtcatca-tttcttgga--------ataccatcatgaagtatagagtt
                      Dog  gtgctcag-gagtttttattaggtcatca-tttgttgga--------ataacatcaggaagtatagagtc
       Hawaiian monk seal  gtgctcag-tagtttttattgggtcatca-tttgttata--------ataacatcaggaagtaaagagtt
                 Hedgehog  gtagtcag-ttatttgtatgaggttatcatttttttgga--------atgacaccatgaaatacagaatt
                    Shrew  gtattcag-taatttttatgaggtcatta-ttttctgga--------atatcttcatggagtatagagta
                 Elephant  gtgtgcag-taatttttattaggtcatca-tttcttaga--------ataacattgtgaagtacagagtt
                   Tenrec  acatgcagttaatttttatgaggccatca-tttcttaga--------ataacactgtgcagtatcaggct
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  c----aaaa-t-cag---cttctgttcccacaagcagtc
                      Rat  c----aaaa-t-cag---ccccagttcccacaatccgtc
            GCF_003668045  c----agaa-a-aag---ctccaattcccacaggcagtc
                   Beaver  g----aaaa-a-tag--tctctaattcccacatgtagtt
                 Squirrel  a----aaag-t-------ttctaattcttctgggtagtt
               Guinea pig  g----aaag-a-taa--tctctatttcccatgcaccgtt
                   Rabbit  g----aaaa-a-tag--tctctaattcccacatgtagtt
                     Pika  g----aaaa-g-tag--cctctaattc------------
                    Human  g----aaaa----ag--tttctaattcccacatgtcatt
                    Chimp  g----aaaa----ag--tttctaattcccacatgtcatt
                   Bonobo  g----aaaa----ag--tttctaattcccacatgtcatt
                  Gorilla  g----aaaa----ag--tttctagttcccacatgtcatt
                   Rhesus  g----aaaa----ag--tttctaattcccacatgtcatt
                 Marmoset  g----aaaa----ac--tttctaact-ccacatgtcatt
                  Tarsier  gaaaaaaaa----ag--tatctaacttccacatggggtt
                 Bushbaby  g----aaaa-a-tag--tctctaatccccacactgggct
               Tree shrew  a----aaaaaa-taa--tctc-aattcccacatatagtt
     Malayan flying lemur  -----gaaaaa-tag--tctctaattcccacatgtagtt
                      Pig  g----aaaa-a-aag--cctttaatttccacatacagtt
                  Dolphin  g----aaaa-t-aaaggtctctaattcccacatgtagtt
                      Cow  g----aaaa-a-aaaaa-----gtctcccacatagagtt
                    Sheep  g----aaaa-a-aaa--------tctcccccatagagtt
                    Horse  g----agaa-a-tag--tctgtaattcccagatattgtt
         Chinese pangolin  g----aaaa-a-tag--tttctaattcccacatacaggt
                      Dog  g----aaaa-a-tag--ttttaaattcttacatatagtt
       Hawaiian monk seal  g----aaaa-a-tag--tttttaattctcacatgtagtt
                 Hedgehog  g----aaaa-agcag--cctcttttt--cacagatagct
                    Shrew  g----aaaa-a-cag--tttgtaatt--ctcgtgtattt
                 Elephant  g----aaaa-a-gag--tct-gaattcccacatggagat
                   Tenrec  g----ag--------------gattttctacatgtagtt
                Zebrafish  =======================================
            X. tropicalis  =======================================
                  Opossum  =======================================
                  Chicken  =======================================

Inserts between block 41 and 42 in window
B D                Human 355bp
B D                Chimp 84bp
B D               Bonobo 338bp
B D              Gorilla 350bp
B D               Rhesus 82bp
B D             Marmoset 278bp
B D             Bushbaby 4bp

Alignment block 42 of 393 in window, 56748449 - 56748491, 43 bps 
B D                 Mouse  agtacattccgtttttt------aca---taaaaagcagctgccccat--ct---aa---
B D                   Rat  aatccatcccg---ttt------gca---taaaaagcagcttcctcat--cg---aa---
            GCF_003668045  aatgaa-ccag---cttaaaaaaaaa---aaaaaagcggtttcctcat--cc---aa---
                   Beaver  gatgaacccag---ttt------gta---taagacac-----------------------
B D              Squirrel  gatgaacccag---ctt------atg---tataaaccagccttataat--cc---aa---
B D            Guinea pig  aatgaaaccag---ttt------ata---catgatgtagtcttata----ca---aa---
B D                Rabbit  gatgaactcaa---ctt------atg---tgtaaagcagactcataat--gc---aa---
B D                  Pika  ----aactcca---ctt------ata---tgtaaagcaaactcataat--gc---aa---
B D                 Chimp  gtctagctctg---tcg------ccaggttggagtgcagtggcgcgat--ct---ct---
B D                Rhesus  gtctagctctg---tcc------ccaggctggagtgcagtggcacgat--ct---ca---
B D               Tarsier  gatgaatccag---ttt------aca---tataaaacagcctcataat--cc---aa---
B D              Bushbaby  ----agtccaa---t---------------------cagtctcataat--cc---aa---
B D            Tree shrew  gatgaacac-------t------ata---tataaagctgtctcattat--ccaaaaa---
B D  Malayan flying lemur  gatgaacccag---ttt------ata---tataaaacagtctcataat--cc---aa---
B D                   Pig  gatgaacatgg---ttt------ata---tataaagcagtattataat--cc---aa---
B D               Dolphin  gatgaacccag---ttt------ata---tataaagcagcatcataat--cc---aa---
B D                   Cow  gatgaacctag---tta------ata---aataaagcagtattataat--cc---aa---
B D                 Sheep  gatgaacctag---ttt------ata---aataaagcagtgtcataat--cc---aa---
B D                 Horse  gatgaacccag---ttt------aaa---aacaaagcaatgtcataatccca---aa---
B D      Chinese pangolin  gatgaacccag---ttt------ata---tataaagcagcatcataat---a---aa---
B D                   Dog  gatacacccgg---ttt------att---tatgaagcagtgtcataat--tc---aa---
B D    Hawaiian monk seal  gataaacccag---ttt------ata---tataaagcagtgtcataat--tc---aa---
B D              Hedgehog  cataaacccag---ttc------ata---tgtagaacactgtcttaat--cc---aa---
B D                 Shrew  cacgatcctac---tt--------ta---tataaaacagtgtcaaaat--ga---aa---
B D              Elephant  gatgaatccag---cct------gta------acagctgtctcactgg--cc---caaaa
B D                Tenrec  gatgaagccag---ttt------gcc------atagcagtctcacatg--cc---ccaaa
B D              Marmoset  ============================================================
B D               Gorilla  ============================================================
B D                Bonobo  ============================================================
B D                 Human  ============================================================
B D             Zebrafish  ============================================================
B D         X. tropicalis  ============================================================
B D               Opossum  ============================================================
B D               Chicken  ============================================================

Inserts between block 42 and 43 in window
B D               Rabbit 3bp
B D                 Pika 15bp
B D                Chimp 211bp
B D               Rhesus 47bp
B D              Tarsier 2bp
B D             Bushbaby 4bp
B D           Tree shrew 1bp
B D Malayan flying lemur 1bp
B D                  Pig 1bp
B D              Dolphin 1bp
B D                  Cow 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp
B D             Hedgehog 1bp
B D                Shrew 1bp

Alignment block 43 of 393 in window, 56748492 - 56748499, 8 bps 
B D                 Mouse  a--ac---------ctcca
B D                   Rat  a--ac---------cttcc
            GCF_003668045  a--aaccttcatagcttca
                   Beaver  ---ac---------cttta
B D              Squirrel  a--ac---------attta
B D            Guinea pig  a--cc---------tttta
B D                Rabbit  a--gc---------ctttg
B D                  Pika  a--ac---------cttcg
B D                 Chimp  a--gc---------caccg
B D                Bonobo  a--gc---------cacca
B D                Rhesus  a--gc---------ctccg
B D              Marmoset  a--gc---------ctcct
B D               Tarsier  a--ac---------tttta
B D              Bushbaby  a--ac---------cttta
B D            Tree shrew  a--ac---------cttta
B D  Malayan flying lemur  a--ac---------cttca
B D                   Pig  a--at---------cttta
B D               Dolphin  a--at---------cttta
B D                   Cow  a--at---------cttta
B D                 Sheep  a--at---------cttta
B D                 Horse  t--ct---------ctat-
B D      Chinese pangolin  a--at---------cttt-
B D                   Dog  a--at---------cttt-
B D    Hawaiian monk seal  a--at---------cctt-
B D              Hedgehog  attgt---------tgtga
B D                 Shrew  a--aa---------tctaa
B D              Elephant  --tgt---------tttta
B D                Tenrec  --tgc---------cttct
B D               Gorilla  ===================
B D                 Human  ===================
B D             Zebrafish  ===================
B D         X. tropicalis  ===================
B D               Opossum  ===================
B D               Chicken  ===================

Inserts between block 43 and 44 in window
B D                Chimp 8bp
B D               Bonobo 8bp
B D               Rhesus 172bp
B D             Marmoset 40bp

Alignment block 44 of 393 in window, 56748500 - 56748500, 1 bps 
B D                 Mouse  -t
B D                   Rat  -t
            GCF_003668045  -t
                   Beaver  -t
B D              Squirrel  -t
B D            Guinea pig  -t
B D                Rabbit  -t
B D                  Pika  -t
B D               Tarsier  -t
B D              Bushbaby  -t
B D            Tree shrew  -t
B D  Malayan flying lemur  -c
B D                   Pig  -t
B D               Dolphin  -t
B D                   Cow  -g
B D                 Sheep  -g
B D              Hedgehog  -t
B D                 Shrew  -t
B D              Elephant  c-
B D                Tenrec  g-
B D                Rhesus  ==
B D    Hawaiian monk seal  --
B D                   Dog  --
B D                 Horse  --
B D              Marmoset  ==
B D               Gorilla  ==
B D                Bonobo  ==
B D                 Chimp  ==
B D                 Human  ==
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D               Opossum  ==
B D               Chicken  ==
B D      Chinese pangolin  --

Alignment block 45 of 393 in window, 56748501 - 56748603, 103 bps 
B D                 Mouse  agctactttca--ttttc--ctctct---gaatgatgtacc-tgtcagtgaggcttgttt----------
B D                   Rat  agctactttca--cttcc--ctctct---------tgaatc-tctcagtgaagcttgttt----------
            GCF_003668045  agctactttca--ttttc--tcctcccttgaatgatgtatc-tgtcagtgaaacttgttt----------
                   Beaver  agttattttca--ttttta-ctctct-tgaattaatgtatc-tggcattgaagcttgttt----------
B D              Squirrel  agttattttca--ttttta-ctcttt--tgacttacatatg-ttgtaaatcattttattcttttgattta
B D            Guinea pig  agttattttca--ttttt--actgtt---gacttatatgtc-tagtcttaagacttgtag----------
B D                Rabbit  agttattgtcactttttta-ctccct--tgaattatagaac-tggcgtttaaacttggtt----------
B D                  Pika  ag-----------ttttct-ctccct--taagttataatac-cagcatttacgcttgttt----------
B D                 Human  agtaattttta--ttttct-cttcct--tgaattatagatc-taacattgaaatttgttt----------
B D                 Chimp  agtaattttta--ttttct-cttcct--tgaattatagatc-taacattgaaatttgttt----------
B D                Bonobo  agtaattttta--ttttct-cttcct--tgaattatagatc-taacattgaaatttgttt----------
B D               Gorilla  agttattttta--tttgct-cttcct--tgaattatagatc-taacattgaaatttgttt----------
B D                Rhesus  agttattttta--ttttca-cttcct--tgaattatagatc-tagcattgaaacttgttt----------
B D              Marmoset  agttatgttaa--ttttca-cttcct--tgaattatagatc-tagcatttaaacttgttt----------
B D               Tarsier  agctatttata--ttttta-ttccct--tgaattatacatc-tagcatttaaacttgttt----------