Multiz Alignments of 35 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 256 in window, 56694976 - 56695279, 304 bps 
B D                 Mouse  gaaaatcctagtgccagccatcagccacctccctatgagttgttagacagggaggactctgaggtcaccc
B D                   Rat  gaaaatcctagtgccaggcaccagtcacctccctatgagatgttggacagggaggactctgaggtcacct
                   Beaver  aaaaatattggtgccaga-gttagctacctccctgtgagttgtggaccagaggggtccctgaggtcaccc
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D                Rhesus  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D                   Dog  ======================================================================
B D                 Horse  ======================================================================
B D              Marmoset  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D                Tenrec  ======================================================================
B D               Tarsier  ======================================================================
B D            Tree shrew  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D                   Cow  ======================================================================
B D               Chicken  ======================================================================
B D                 Shrew  ======================================================================
B D              Elephant  ======================================================================
B D              Squirrel  ======================================================================
B D                   Pig  ======================================================================
B D                Rabbit  ======================================================================
B D      Chinese pangolin  ======================================================================
B D              Bushbaby  ======================================================================
B D  Malayan flying lemur  ======================================================================
           GCF_003668045  ======================================================================

                    Mouse  aaacagtaca----agctgttgtcacggctgttgattgcacatcagaactgggtgatacattcctattac
                      Rat  atacggtaca----agctattgccactgctattggttgcacattagagctgggtggtaagttcctattgc
                   Beaver  acacttaacactacacatactgccactgtagttggt--cacatgacaactggaccataagtccctattgc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tga-gacaatacgtgctctgattttagaacctgcagaaatcaagctatg-------------------cc
                      Rat  tgaagatatcacatgctctgattttagaacctgcagaaatcaagctatgattgagctgaatgcatcacca
                   Beaver  tgaagtcaccacatgctctacttgcagggcatggaaaaattaa-ctgggaccaaactggaagc-----ct
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  cccccccaccattgcc------------------------------------------------------
                      Rat  caccaccaccaccgccgccgccgccgccgccgccgccgccgccgccgccgccgccgccgccgccgccgcc
                   Beaver  cctccatactaag---------------------------------------------------------
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ---------------------------tggcatctgtagagctggtaggcacca-gaagactgaaaggaa
                      Rat  gccgccgccgtcaccagccctgccacctggtatctgtggagctggtagacacca-ggaggttggaaggga
                   Beaver  ---------------------------tagaattcatagtgccagaggtcaccatgcaggctgccagaag
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  agaactgtttccaacagttt-gttcaactccgcatcctgcgtgttctgctatcagcatgcc
                      Rat  tgagctgtttccaacagttttgttcagctctgcatcctgggtgttatgttatcagcatgcc
                   Beaver  aaaattgtctccagtggtcctgctcaactatagcccccatgtgttacaccatcaacgcccc
               Guinea pig  =============================================================
                    Sheep  =============================================================
                   Rhesus  =============================================================
       Hawaiian monk seal  =============================================================
                      Dog  =============================================================
                    Horse  =============================================================
                 Marmoset  =============================================================
                  Gorilla  =============================================================
                   Bonobo  =============================================================
                    Chimp  =============================================================
                    Human  =============================================================
                   Tenrec  =============================================================
                  Tarsier  =============================================================
               Tree shrew  =============================================================
                 Hedgehog  =============================================================
                     Pika  =============================================================
                Zebrafish  =============================================================
            X. tropicalis  =============================================================
                      Cow  =============================================================
                  Chicken  =============================================================
                    Shrew  =============================================================
                 Elephant  =============================================================
                 Squirrel  =============================================================
                      Pig  =============================================================
                   Rabbit  =============================================================
         Chinese pangolin  =============================================================
                 Bushbaby  =============================================================
     Malayan flying lemur  =============================================================
            GCF_003668045  =============================================================

Alignment block 2 of 256 in window, 56695280 - 56697035, 1756 bps 
B D                 Mouse  agata--------------gtgaaatagtgacctgactgctatggttgtgaagtggtctgaatgagaacc
B D                   Rat  agataaaatttgcctactggtgaaatagtgacctg----ctatggttgtgaagtggtttaaatgagaatt
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D                Rhesus  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D                   Dog  ======================================================================
B D                 Horse  ======================================================================
B D              Marmoset  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D                Tenrec  ======================================================================
B D               Tarsier  ======================================================================
B D            Tree shrew  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D                   Cow  ======================================================================
B D               Chicken  ======================================================================
B D                 Shrew  ======================================================================
B D              Elephant  ======================================================================
B D              Squirrel  ======================================================================
B D                   Pig  ======================================================================
B D                Rabbit  ======================================================================
B D      Chinese pangolin  ======================================================================
B D              Bushbaby  ======================================================================
                  Beaver  ======================================================================
B D  Malayan flying lemur  ======================================================================
           GCF_003668045  ======================================================================

                    Mouse  cccccctcctctgagactcatagatttgactgctccattcaaagttgatggaactgttttggaaaagact
                      Rat  ctcctctcctctgaggctcatatatttgaatgcttggttcaaagttggtggaactattt-ggaaaagact
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  gggaggtgtggccttgttggaggaagtgtgctaccggggttgggatttggggtttcaaaagcccacactg
                      Rat  aagaggtgtggccttgttgaaggaagtgtg------------ggctttgaggtttcaaaaacctatattg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tacccagttacctttctctcaatct-----ctctctccctctct----cctcttctccctctcccctctc
                      Rat  tacccacttacctttctctttttcttccccctctctccctctcttcttcctctcctccctcctccctcct
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ttcctcttc-------ctctctctctttccttcctctctctcctctcccct------ctctttcctcctt
                      Rat  ctccccttctccctctctttttctcttcccctcttcctcttcctctcccctttctccctcttccctctct
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ccccctctctccctctctcc--------------------------------------------------
                      Rat  ctccctctctccctctctccctctctccctctctccccctttctctctccctctctctttctctccctct
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ----------------------------------------tccctgcctcatgtttgtggaccagatata
                      Rat  ctccctcctcctcctctctccccctctccctctctccctctccctgtctcatgtttgtagaccaggtgta
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  actcccatctgcttcttcagtaccatgcctgcctgcctgcctgctgccatgcttcctatcatgatagtca
                      Rat  actcccagctacttcttcagcacagtgcctgcctgcctacctgct--------tcccatcataatgatca
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tggactctagaccctaaattaacctgaacctcaaaattgaatgcttccttgtataagttgccttgtttat
                      Rat  tggactctagtccctaaattaacctgaacctcaaaattaaatgctttcttttataagttgccttgttcat
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ggtgttttt--------ccagggcaatagacaaggtgaaactaactatttttaaaccagatataaggtct
                      Rat  gatagtttttttttttaccaaggaaatagacagggtgaactcgactatatatgtataagatataagatct
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tctccacagaagatatctatgtttggtagcc----tatgcctaggcaaaacttctcactgggacaataaa
                      Rat  tctccacagaaagaatctatgcttagtacctaccataagcctgggcaaaacccctcacttgggcagtaga
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tgataggcctcaataacaaggctattattattgtttggttaaatgtatatactttgcctatcaagttgtc
                      Rat  ttatagtcctttacaatgaggctactattattgctttgataaatgaatatactttgcctatccagttgtc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ttctaggttacagctactattacacataatggaaggaaattctttttttttttttttttttttgtagtag
                      Rat  ctctaggttacaggtactattatacataatgggaggaaattcctttttttct-------------agtag
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  gagacagttactgcacagacttaaaaagggaccaaactactgagaataaatatctacagtccaaactgtt
                      Rat  gagacagttcctgcagagattcaaaaaatgaccaaactgctgggaataaatatctatacttcatactgtt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  accatg---tcatagcattccaaaatggaagaaaataa------------cctctgtggtggtttgagcc
                      Rat  accatgatatagtagtattccaaaatggaagaaaatgataatatcatggccctctgtggtggattgaacc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  cccataggctcatatatttgcatacttggttctcagttggtggactttttgagaagggtcaagaggtgtg
                      Rat  cccataggcttttatatttgtatatttgaatcacagttggtggacattttaggaagggtcaagaggtgtg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  actttgttggtgaaggtgtgtcactaggggtggcttagagatttcaaaaacccataccaggcatagtctg
                      Rat  accttgttggtaaaggtatgtcactgggggtgacttagagatt-caaaagcccatgccaggctctctctc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tctctctctc-ctctctctctctctcatgtctgtggcttgaagatcagctacttcagcaccatgcctgac
                      Rat  tctctctctctctctctctctccctccctccc------------cccccctctttagcaccatgcctga-
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tgcctgccaccatgttccctgccatgataataatggactctctctctctctctgaaactataagctagcc
                      Rat  tgccttccaccatgcttcctgccatgatgataatggacttt---------tctgaaactgtaagctagca
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ctcaattagatgctttcctttgtagaagctgccttggtcatggtgcctcttcacagcaatagaacactga
                      Rat  -tcaattacatgctttcctttgtaaaagctgccttggccatg-tgtctcttcatagcaatagaacactga
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  aacaccctccagcatgggtgggtcaccatggaagagagagcaccttccagcatgggtggagcaccatgga
                      Rat  gacaccctctaacatgggtgg--------------------------------------aacagcacgga
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  agagagagcagggagaatagaagagtcaaaggaagggctagaacgctgtgaagatatttctgtttagttg
                      Rat  agagagagcagggagcatataagagtcacaggaaggactaggctgctgtgaagatatttctgtttagtgg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tgagcctagcctttaatgtctgtgtcagatctctggaccttgggtctattacttacaggcgggacgtgac
                      Rat  cgagtctagcctttcatgtctgttccagttctctggttcttggatctatttcttacag-------gtgac
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  catcaatatcttatatcagggaaactgtgatcatctgtgcgagacactcatgagataagggctattagca
                      Rat  cactgctatctcatatta----------------------gagacactcatgagataaggcctattagca
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ccgaggtggtaaagttcatggggctcagaggactcatgggactgatggtatttatga----------gat
                      Rat  atgaggtattaaagttcctggggctcagagaactcatgggactgatggtatctatgaaccctcatgggat
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  c-----tttatgagtccttc-ctacttctcaatgtgatacaggagatgcaagattaattgg-tgggggag
                      Rat  cttttttttatgaagccttctccactgctcaatgttatataggtgatgtaggatttattggaaggggaag
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ctctgatacagtagctaccagtacatcat--------atggggggttctttgaagatgcaattgataacc
                      Rat  ctctgatacagtagctaccagtgcatcatctgtgggggtggagggctcattgaaggtgcaattgataacc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ttaaaaataacctgggttgtttgggagggtcttgtgaggtccctt
                      Rat  ttaaaaatagcctcagttgtttggg-ggaccctatggggtccctt
               Guinea pig  =============================================
                    Sheep  =============================================
                   Rhesus  =============================================
       Hawaiian monk seal  =============================================
                      Dog  =============================================
                    Horse  =============================================
                 Marmoset  =============================================
                  Gorilla  =============================================
                   Bonobo  =============================================
                    Chimp  =============================================
                    Human  =============================================
                   Tenrec  =============================================
                  Tarsier  =============================================
               Tree shrew  =============================================
                 Hedgehog  =============================================
                     Pika  =============================================
                Zebrafish  =============================================
            X. tropicalis  =============================================
                      Cow  =============================================
                  Chicken  =============================================
                    Shrew  =============================================
                 Elephant  =============================================
                 Squirrel  =============================================
                      Pig  =============================================
                   Rabbit  =============================================
         Chinese pangolin  =============================================
                 Bushbaby  =============================================
                   Beaver  =============================================
     Malayan flying lemur  =============================================
            GCF_003668045  =============================================

Inserts between block 2 and 3 in window
B D                  Rat 107bp

Alignment block 3 of 256 in window, 56697036 - 56697880, 845 bps 
B D                 Mouse  tgggactctttagggatgtggttgcttatccattgctcaagggcttctccatgtcctctaagtcccacat
B D                   Rat  tgggactctccagggatgtggt---ttatacattgctctagggcttctctgagtcctcaaagtctcaca-
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D                Rhesus  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D                   Dog  ======================================================================
B D                 Horse  ======================================================================
B D              Marmoset  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D                Tenrec  ======================================================================
B D               Tarsier  ======================================================================
B D            Tree shrew  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D                   Cow  ======================================================================
B D               Chicken  ======================================================================
B D                 Shrew  ======================================================================
B D              Elephant  ======================================================================
B D              Squirrel  ======================================================================
B D                   Pig  ======================================================================
B D                Rabbit  ======================================================================
B D      Chinese pangolin  ======================================================================
B D              Bushbaby  ======================================================================
                  Beaver  ======================================================================
B D  Malayan flying lemur  ======================================================================
           GCF_003668045  ======================================================================

                    Mouse  gctcctctatgtaacccaataaaccaggctgaatttgagtaaagtctttttcttagtttcttgtttatgt
                      Rat  -cacctgtaagtaacccaataaaccaaactgtatttgagtgaactcttattcttagtttcttgcttgtgt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ctccctaggaaaagtcatatgacatttaagaataactaggagagag--gttgattttctcagtataaacc
                      Rat  ctccccagg--aagtcacataacatttaagaataactaggagagagacattgactttctcaatataaagc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  agtgataaatgtttaaggagatgggagtactaattattctaagccccaacagattgtatatat-taccaa
                      Rat  agtggtaaatgtttaaggagatgggagtactggtgat--taagctccaacaggttgtatatatgtaccaa
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  attaacatcttatacctctaaatatatacaattatgtcaatttttatattttttattcatttacat--gg
                      Rat  attaacatactgcaacatgaaatatgtacaattatgtcgatttttatatt-----ttcatttatgtgggg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  gggcatacatgcatgccacagcacacatgtgaaggttcaaggacaccgttcaggagtgggttctctcctt
                      Rat  gggcatgcatgcacaccatggcacacatgtgagggttcaagggcaactttt-ggagtagcttctctcctt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ccaccaagtaagtcttggggatttgaactcatgtcaccaggcttagtgtcaagcagttttacctgaatca
                      Rat  ccaccatgtaagcctcagggatttgaactcgtgtcatcaggcttagtgtcaagtagttctacctgaacca
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tctcactagccttgtgctaaggttttgggatggaaaagagagagagatagctaaagttaagtgcctttga
                      Rat  tctcaccagcactgtgt--agg----gggatggaaa--agggagagatagctaaaattaagtgcctttga
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tgagtcatatcagaacctaatacagtagatgcttcctttttcatatataaatatatatatatatgtgtgt
                      Rat  cgggtcctgtcaaagtctaatacagtagacgattcct--------aaaaaatat----------------
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  gtgtatatatatacatacatatatacatatatgtatttacttatatctttgatttttttctctctatgta
                      Rat  -------ttttcatatgcatatatataaaactgtatttacttatatctttga--tttttctctctatgtg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tatatagaccttctgcttattttgttaaatttgtctctgagaatttgatgttaattcataaatgctatct
                      Rat  tatatagaacttcttttcattttgttacatttatctctgagaatttgatgttaattcataaatgctattt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  caacttcaactgcctattgctaattgattgcaaatttcatttttattactgcatttatatcctatcatct
                      Rat  ttacttcaattgcctattgtttattgattgcaaatttca-ttttattgctgactttatatccggtcacct
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tgatttttat
                      Rat  tgatttttat
               Guinea pig  ==========
                    Sheep  ==========
                   Rhesus  ==========
       Hawaiian monk seal  ==========
                      Dog  ==========
                    Horse  ==========
                 Marmoset  ==========
                  Gorilla  ==========
                   Bonobo  ==========
                    Chimp  ==========
                    Human  ==========
                   Tenrec  ==========
                  Tarsier  ==========
               Tree shrew  ==========
                 Hedgehog  ==========
                     Pika  ==========
                Zebrafish  ==========
            X. tropicalis  ==========
                      Cow  ==========
                  Chicken  ==========
                    Shrew  ==========
                 Elephant  ==========
                 Squirrel  ==========
                      Pig  ==========
                   Rabbit  ==========
         Chinese pangolin  ==========
                 Bushbaby  ==========
                   Beaver  ==========
     Malayan flying lemur  ==========
            GCF_003668045  ==========

Alignment block 4 of 256 in window, 56697881 - 56697882, 2 bps 
B D                 Mouse  tg
B D                   Rat  ta
B D      Chinese pangolin  ta
B D            Guinea pig  ==
B D                 Sheep  ==
B D                Rhesus  ==
B D    Hawaiian monk seal  ==
B D                   Dog  ==
B D                 Horse  ==
B D              Marmoset  ==
B D               Gorilla  ==
B D                Bonobo  ==
B D                 Chimp  ==
B D                 Human  ==
B D                Tenrec  ==
B D               Tarsier  ==
B D            Tree shrew  ==
B D              Hedgehog  ==
B D                  Pika  ==
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D                   Cow  ==
B D               Chicken  ==
B D                 Shrew  ==
B D              Elephant  ==
B D              Squirrel  ==
B D                   Pig  ==
B D                Rabbit  ==
B D              Bushbaby  ==
                  Beaver  ==
B D  Malayan flying lemur  ==
           GCF_003668045  ==

Alignment block 5 of 256 in window, 56697883 - 56697885, 3 bps 
B D                 Mouse  aaa
B D                   Rat  aaa
B D               Dolphin  aaa
B D      Chinese pangolin  aaa
B D            Guinea pig  ===
B D                 Sheep  ===
B D                Rhesus  ===
B D    Hawaiian monk seal  ===
B D                   Dog  ===
B D                 Horse  ===
B D              Marmoset  ===
B D               Gorilla  ===
B D                Bonobo  ===
B D                 Chimp  ===
B D                 Human  ===
B D                Tenrec  ===
B D               Tarsier  ===
B D            Tree shrew  ===
B D              Hedgehog  ===
B D                  Pika  ===
B D             Zebrafish  ===
B D         X. tropicalis  ===
B D                   Cow  ===
B D               Chicken  ===
B D                 Shrew  ===
B D              Elephant  ===
B D              Squirrel  ===
B D                   Pig  ===
B D                Rabbit  ===
B D              Bushbaby  ===
                  Beaver  ===
B D  Malayan flying lemur  ===
           GCF_003668045  ===

Inserts between block 5 and 6 in window
B D              Dolphin 2bp
B D     Chinese pangolin 2bp

Alignment block 6 of 256 in window, 56697886 - 56698030, 145 bps 
B D                 Mouse  ataattttctgctttagt-t-ctttcttttacccatattccct-----gctta-ttcactgagaatatca
B D                   Rat  ataattttttgctttagt-t-ctttattttaaccatattttct-----gtttatttcattgagaatatta
B D               Dolphin  actatgttct-tttcgtcttactttatattaaccatattttct---atgtttattaaaatgggaatatta
B D      Chinese pangolin  ac-atgttca-ctttggc-tattttatattaaccatattttctgtcatgtttactaaattaggaacatta
B D                 Shrew  acaatgttca-ctttagt---ctttatattaatcataatttctatcatg------aaattggaaatagta
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D                Rhesus  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D                   Dog  ======================================================================
B D                 Horse  ======================================================================
B D              Marmoset  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D                Tenrec  ======================================================================
B D               Tarsier  ======================================================================
B D            Tree shrew  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D                   Cow  ======================================================================
B D               Chicken  ======================================================================
B D              Elephant  ======================================================================
B D              Squirrel  ======================================================================
B D                   Pig  ======================================================================
B D                Rabbit  ======================================================================
B D              Bushbaby  ======================================================================
                  Beaver  ======================================================================
B D  Malayan flying lemur  ======================================================================
           GCF_003668045  ======================================================================

                    Mouse  ggattaattatatatatatacac--------acacacac-acacacatttccttg-ctttttttccagat
                      Rat  ggattaactatatgta-----at--------agatatac-atacacatttctctgtctttttattcagat
                  Dolphin  -----aaatacattttcaagtatttcattccaaattcaaggcactttctctcttc-ctttcttcccagga
         Chinese pangolin  -----aaacacattttcagatat--------atgttcaagataccttctcacttg-ctt--ttcccaggt
                    Shrew  -----aaatatgttttcacacat--------atgcccag--------cagttttg-ctt--ttcctgggt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  aagggaa-atcacacttctttgaa
                      Rat  aagggag-gtaacactgttttgaa
                  Dolphin  aagaaaagattacaactttttgaa
         Chinese pangolin  aagaaaagatcacacctttttcaa
                    Shrew  aaggaaatatctcactgttttcta
               Guinea pig  ========================
                    Sheep  ========================
                   Rhesus  ========================
       Hawaiian monk seal  ========================
                      Dog  ========================
                    Horse  ========================
                 Marmoset  ========================
                  Gorilla  ========================
                   Bonobo  ========================
                    Chimp  ========================
                    Human  ========================
                   Tenrec  ========================
                  Tarsier  ========================
               Tree shrew  ========================
                 Hedgehog  ========================
                     Pika  ========================
                Zebrafish  ========================
            X. tropicalis  ========================
                      Cow  ========================
                  Chicken  ========================
                 Elephant  ========================
                 Squirrel  ========================
                      Pig  ========================
                   Rabbit  ========================
                 Bushbaby  ========================
                   Beaver  ========================
     Malayan flying lemur  ========================
            GCF_003668045  ========================

Inserts between block 6 and 7 in window
B D              Dolphin 35bp
B D                Shrew 5bp

Alignment block 7 of 256 in window, 56698031 - 56698031, 1 bps 
B D                 Mouse  g
B D                   Rat  g
B D      Chinese pangolin  a
B D                 Shrew  g
B D            Guinea pig  =
B D                 Sheep  =
B D                Rhesus  =
B D    Hawaiian monk seal  =
B D                   Dog  =
B D                 Horse  =
B D              Marmoset  =
B D               Gorilla  =
B D                Bonobo  =
B D                 Chimp  =
B D                 Human  =
B D                Tenrec  =
B D               Tarsier  =
B D            Tree shrew  =
B D              Hedgehog  =
B D                  Pika  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  =
B D               Chicken  =
B D              Elephant  =
B D              Squirrel  =
B D                   Pig  =
B D                Rabbit  =
B D               Dolphin  =
B D              Bushbaby  =
                  Beaver  =
B D  Malayan flying lemur  =
           GCF_003668045  =

Inserts between block 7 and 8 in window
B D     Chinese pangolin 34bp

Alignment block 8 of 256 in window, 56698032 - 56698042, 11 bps 
B D                 Mouse  -------atgtcatggcc
B D                   Rat  --------tgtgactgcc
B D                 Shrew  attctttaagtgatatt-
B D            Guinea pig  ==================
B D                 Sheep  ==================
B D                Rhesus  ==================
B D    Hawaiian monk seal  ==================
B D                   Dog  ==================
B D                 Horse  ==================
B D              Marmoset  ==================
B D               Gorilla  ==================
B D                Bonobo  ==================
B D                 Chimp  ==================
B D                 Human  ==================
B D                Tenrec  ==================
B D               Tarsier  ==================
B D            Tree shrew  ==================
B D              Hedgehog  ==================
B D                  Pika  ==================
B D             Zebrafish  ==================
B D         X. tropicalis  ==================
B D                   Cow  ==================
B D               Chicken  ==================
B D              Elephant  ==================
B D              Squirrel  ==================
B D                   Pig  ==================
B D                Rabbit  ==================
B D      Chinese pangolin  ==================
B D               Dolphin  ==================
B D              Bushbaby  ==================
                  Beaver  ==================
B D  Malayan flying lemur  ==================
           GCF_003668045  ==================

Alignment block 9 of 256 in window, 56698043 - 56698043, 1 bps 
B D                 Mouse  c
B D      Chinese pangolin  t
B D                 Shrew  c
B D            Guinea pig  =
B D                 Sheep  =
B D                Rhesus  =
B D    Hawaiian monk seal  =
B D                   Dog  =
B D                 Horse  =
B D              Marmoset  =
B D               Gorilla  =
B D                Bonobo  =
B D                 Chimp  =
B D                 Human  =
B D                Tenrec  =
B D               Tarsier  =
B D            Tree shrew  =
B D              Hedgehog  =
B D                  Pika  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  =
B D               Chicken  =
B D              Elephant  =
B D              Squirrel  =
B D                   Pig  =
B D                Rabbit  =
B D               Dolphin  =
B D              Bushbaby  =
                  Beaver  =
B D  Malayan flying lemur  =
           GCF_003668045  =
B D                   Rat  -

Inserts between block 9 and 10 in window
B D     Chinese pangolin 30bp

Alignment block 10 of 256 in window, 56698044 - 56698048, 5 bps 
B D                 Mouse  ctgat
B D                 Shrew  ttaat
B D            Guinea pig  =====
B D                 Sheep  =====
B D                Rhesus  =====
B D    Hawaiian monk seal  =====
B D                   Dog  =====
B D                 Horse  =====
B D              Marmoset  =====
B D               Gorilla  =====
B D                Bonobo  =====
B D                 Chimp  =====
B D                 Human  =====
B D                Tenrec  =====
B D               Tarsier  =====
B D            Tree shrew  =====
B D              Hedgehog  =====
B D                  Pika  =====
B D             Zebrafish  =====
B D         X. tropicalis  =====
B D                   Cow  =====
B D               Chicken  =====
B D              Elephant  =====
B D              Squirrel  =====
B D                   Pig  =====
B D                Rabbit  =====
B D      Chinese pangolin  =====
B D               Dolphin  =====
B D              Bushbaby  =====
                  Beaver  =====
B D  Malayan flying lemur  =====
           GCF_003668045  =====
B D                   Rat  -----

Alignment block 11 of 256 in window, 56698049 - 56698049, 1 bps 
B D                 Mouse  t
B D               Dolphin  t
B D                 Shrew  t
B D            Guinea pig  =
B D                 Sheep  =
B D                Rhesus  =
B D    Hawaiian monk seal  =
B D                   Dog  =
B D                 Horse  =
B D              Marmoset  =
B D               Gorilla  =
B D                Bonobo  =
B D                 Chimp  =
B D                 Human  =
B D                Tenrec  =
B D               Tarsier  =
B D            Tree shrew  =
B D              Hedgehog  =
B D                  Pika  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  =
B D               Chicken  =
B D              Elephant  =
B D              Squirrel  =
B D                   Pig  =
B D                Rabbit  =
B D      Chinese pangolin  =
B D              Bushbaby  =
                  Beaver  =
B D  Malayan flying lemur  =
           GCF_003668045  =
B D                   Rat  -

Inserts between block 11 and 12 in window
B D              Dolphin 30bp

Alignment block 12 of 256 in window, 56698050 - 56698051, 2 bps 
B D                 Mouse  -ac
B D                 Shrew  gg-
B D            Guinea pig  ===
B D                 Sheep  ===
B D                Rhesus  ===
B D    Hawaiian monk seal  ===
B D                   Dog  ===
B D                 Horse  ===
B D              Marmoset  ===
B D               Gorilla  ===
B D                Bonobo  ===
B D                 Chimp  ===
B D                 Human  ===
B D                Tenrec  ===
B D               Tarsier  ===
B D            Tree shrew  ===
B D              Hedgehog  ===
B D                  Pika  ===
B D             Zebrafish  ===
B D         X. tropicalis  ===
B D                   Cow  ===
B D               Chicken  ===
B D              Elephant  ===
B D              Squirrel  ===
B D                   Pig  ===
B D                Rabbit  ===
B D      Chinese pangolin  ===
B D               Dolphin  ===
B D              Bushbaby  ===
                  Beaver  ===
B D  Malayan flying lemur  ===
           GCF_003668045  ===
B D                   Rat  ---

Inserts between block 12 and 13 in window
B D                Shrew 52bp

Alignment block 13 of 256 in window, 56698052 - 56698073, 22 bps 
B D                 Mouse  cccttacctttcttgtttccta
B D                   Rat  ---------ttcttgtttccta
B D            Guinea pig  ======================
B D                 Sheep  ======================
B D                Rhesus  ======================
B D    Hawaiian monk seal  ======================
B D                   Dog  ======================
B D                 Horse  ======================
B D              Marmoset  ======================
B D               Gorilla  ======================
B D                Bonobo  ======================
B D                 Chimp  ======================
B D                 Human  ======================
B D                Tenrec  ======================
B D               Tarsier  ======================
B D            Tree shrew  ======================
B D              Hedgehog  ======================
B D                  Pika  ======================
B D             Zebrafish  ======================
B D         X. tropicalis  ======================
B D                   Cow  ======================
B D               Chicken  ======================
B D                 Shrew  ======================
B D              Elephant  ======================
B D              Squirrel  ======================
B D                   Pig  ======================
B D                Rabbit  ======================
B D      Chinese pangolin  ======================
B D               Dolphin  ======================
B D              Bushbaby  ======================
                  Beaver  ======================
B D  Malayan flying lemur  ======================
           GCF_003668045  ======================

Alignment block 14 of 256 in window, 56698074 - 56698074, 1 bps 
B D                 Mouse  c
B D                   Rat  c
B D               Dolphin  c
B D      Chinese pangolin  t
B D            Guinea pig  =
B D                 Sheep  =
B D                Rhesus  =
B D    Hawaiian monk seal  =
B D                   Dog  =
B D                 Horse  =
B D              Marmoset  =
B D               Gorilla  =
B D                Bonobo  =
B D                 Chimp  =
B D                 Human  =
B D                Tenrec  =
B D               Tarsier  =
B D            Tree shrew  =
B D              Hedgehog  =
B D                  Pika  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  =
B D               Chicken  =
B D                 Shrew  =
B D              Elephant  =
B D              Squirrel  =
B D                   Pig  =
B D                Rabbit  =
B D              Bushbaby  =
                  Beaver  =
B D  Malayan flying lemur  =
           GCF_003668045  =

Inserts between block 14 and 15 in window
B D              Dolphin 140bp

Alignment block 15 of 256 in window, 56698075 - 56698102, 28 bps 
B D                 Mouse  aaagaatgctctgtcctactgagtaagc
B D                   Rat  aaagaattctcttccctactaagtaagc
B D            Guinea pig  ============================
B D                 Sheep  ============================
B D                Rhesus  ============================
B D    Hawaiian monk seal  ============================
B D                   Dog  ============================
B D                 Horse  ============================
B D              Marmoset  ============================
B D               Gorilla  ============================
B D                Bonobo  ============================
B D                 Chimp  ============================
B D                 Human  ============================
B D                Tenrec  ============================
B D               Tarsier  ============================
B D            Tree shrew  ============================
B D              Hedgehog  ============================
B D                  Pika  ============================
B D             Zebrafish  ============================
B D         X. tropicalis  ============================
B D                   Cow  ============================
B D               Chicken  ============================
B D                 Shrew  ============================
B D              Elephant  ============================
B D              Squirrel  ============================
B D                   Pig  ============================
B D                Rabbit  ============================
B D      Chinese pangolin  ============================
B D               Dolphin  ============================
B D              Bushbaby  ============================
                  Beaver  ============================
B D  Malayan flying lemur  ============================
           GCF_003668045  ============================

Alignment block 16 of 256 in window, 56698103 - 56698106, 4 bps 
B D                 Mouse  -aaaa
B D                   Rat  -aaag
B D                 Shrew  ggaa-
B D            Guinea pig  =====
B D                 Sheep  =====
B D                Rhesus  =====
B D    Hawaiian monk seal  =====
B D                   Dog  =====
B D                 Horse  =====
B D              Marmoset  =====
B D               Gorilla  =====
B D                Bonobo  =====
B D                 Chimp  =====
B D                 Human  =====
B D                Tenrec  =====
B D               Tarsier  =====
B D            Tree shrew  =====
B D              Hedgehog  =====
B D                  Pika  =====
B D             Zebrafish  =====
B D         X. tropicalis  =====
B D                   Cow  =====
B D               Chicken  =====
B D              Elephant  =====
B D              Squirrel  =====
B D                   Pig  =====
B D                Rabbit  =====
B D      Chinese pangolin  =====
B D               Dolphin  =====
B D              Bushbaby  =====
                  Beaver  =====
B D  Malayan flying lemur  =====
           GCF_003668045  =====

Inserts between block 16 and 17 in window
B D                Shrew 96bp

Alignment block 17 of 256 in window, 56698107 - 56698168, 62 bps 
B D                 Mouse  tttttaaatggattatcccaacagccataattcagacagaagacagaagcctcccaggggaa
B D                   Rat  ttttgaaatggattatcctaacagcaataattcaaagagaagatggaagcctccaaagag-a
B D            Guinea pig  ==============================================================
B D                 Sheep  ==============================================================
B D                Rhesus  ==============================================================
B D    Hawaiian monk seal  ==============================================================
B D                   Dog  ==============================================================
B D                 Horse  ==============================================================
B D              Marmoset  ==============================================================
B D               Gorilla  ==============================================================
B D                Bonobo  ==============================================================
B D                 Chimp  ==============================================================
B D                 Human  ==============================================================
B D                Tenrec  ==============================================================
B D               Tarsier  ==============================================================
B D            Tree shrew  ==============================================================
B D              Hedgehog  ==============================================================
B D                  Pika  ==============================================================
B D             Zebrafish  ==============================================================
B D         X. tropicalis  ==============================================================
B D                   Cow  ==============================================================
B D               Chicken  ==============================================================
B D                 Shrew  ==============================================================
B D              Elephant  ==============================================================
B D              Squirrel  ==============================================================
B D                   Pig  ==============================================================
B D                Rabbit  ==============================================================
B D      Chinese pangolin  ==============================================================
B D               Dolphin  ==============================================================
B D              Bushbaby  ==============================================================
                  Beaver  ==============================================================
B D  Malayan flying lemur  ==============================================================
           GCF_003668045  ==============================================================

Alignment block 18 of 256 in window, 56698169 - 56698204, 36 bps 
B D                 Mouse  aaattctagatttctctgccttccccaaaatatttt
B D                   Rat  aaattctagattccttttcctt-cccaaaatatttt
B D               Tarsier  --aatctatatttatttgtcttttctcatattcatt
B D            Guinea pig  ====================================
B D                 Sheep  ====================================
B D                Rhesus  ====================================
B D    Hawaiian monk seal  ====================================
B D                   Dog  ====================================
B D                 Horse  ====================================
B D              Marmoset  ====================================
B D               Gorilla  ====================================
B D                Bonobo  ====================================
B D                 Chimp  ====================================
B D                 Human  ====================================
B D                Tenrec  ====================================
B D            Tree shrew  ====================================
B D              Hedgehog  ====================================
B D                  Pika  ====================================
B D             Zebrafish  ====================================
B D         X. tropicalis  ====================================
B D                   Cow  ====================================
B D               Chicken  ====================================
B D                 Shrew  ====================================
B D              Elephant  ====================================
B D              Squirrel  ====================================
B D                   Pig  ====================================
B D                Rabbit  ====================================
B D      Chinese pangolin  ====================================
B D               Dolphin  ====================================
B D              Bushbaby  ====================================
                  Beaver  ====================================
B D  Malayan flying lemur  ====================================
           GCF_003668045  ====================================

Alignment block 19 of 256 in window, 56698205 - 56698208, 4 bps 
B D                 Mouse  ttcc
B D                   Rat  tt-c
B D               Tarsier  ctcc
B D                 Shrew  ttcc
B D            Guinea pig  ====
B D                 Sheep  ====
B D                Rhesus  ====
B D    Hawaiian monk seal  ====
B D                   Dog  ====
B D                 Horse  ====
B D              Marmoset  ====
B D               Gorilla  ====
B D                Bonobo  ====
B D                 Chimp  ====
B D                 Human  ====
B D                Tenrec  ====
B D            Tree shrew  ====
B D              Hedgehog  ====
B D                  Pika  ====
B D             Zebrafish  ====
B D         X. tropicalis  ====
B D                   Cow  ====
B D               Chicken  ====
B D              Elephant  ====
B D              Squirrel  ====
B D                   Pig  ====
B D                Rabbit  ====
B D      Chinese pangolin  ====
B D               Dolphin  ====
B D              Bushbaby  ====
                  Beaver  ====
B D  Malayan flying lemur  ====
           GCF_003668045  ====

Alignment block 20 of 256 in window, 56698209 - 56698209, 1 bps 
B D                 Mouse  -a
B D                   Rat  -a
B D                 Shrew  t-
B D            Guinea pig  ==
B D                 Sheep  ==
B D                Rhesus  ==
B D    Hawaiian monk seal  ==
B D                   Dog  ==
B D                 Horse  ==
B D              Marmoset  ==
B D               Gorilla  ==
B D                Bonobo  ==
B D                 Chimp  ==
B D                 Human  ==
B D                Tenrec  ==
B D               Tarsier  ==
B D            Tree shrew  ==
B D              Hedgehog  ==
B D                  Pika  ==
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D                   Cow  ==
B D               Chicken  ==
B D              Elephant  ==
B D              Squirrel  ==
B D                   Pig  ==
B D                Rabbit  ==
B D      Chinese pangolin  ==
B D               Dolphin  ==
B D              Bushbaby  ==
                  Beaver  ==
B D  Malayan flying lemur  ==
           GCF_003668045  ==

Alignment block 21 of 256 in window, 56698210 - 56698220, 11 bps 
B D                 Mouse  gacaatatatt
B D                   Rat  gacaatatatt
B D            Guinea pig  ===========
B D                 Sheep  ===========
B D                Rhesus  ===========
B D    Hawaiian monk seal  ===========
B D                   Dog  ===========
B D                 Horse  ===========
B D              Marmoset  ===========
B D               Gorilla  ===========
B D                Bonobo  ===========
B D                 Chimp  ===========
B D                 Human  ===========
B D                Tenrec  ===========
B D               Tarsier  ===========
B D            Tree shrew  ===========
B D              Hedgehog  ===========
B D                  Pika  ===========
B D             Zebrafish  ===========
B D         X. tropicalis  ===========
B D                   Cow  ===========
B D               Chicken  ===========
B D                 Shrew  ===========
B D              Elephant  ===========
B D              Squirrel  ===========
B D                   Pig  ===========
B D                Rabbit  ===========
B D      Chinese pangolin  ===========
B D               Dolphin  ===========
B D              Bushbaby  ===========
                  Beaver  ===========
B D  Malayan flying lemur  ===========
           GCF_003668045  ===========

Alignment block 22 of 256 in window, 56698221 - 56698231, 11 bps 
B D                 Mouse  ctgacccctgg-
B D                   Rat  ctgaccctagg-
B D               Dolphin  -caatcccttgt
B D            Guinea pig  ============
B D                 Sheep  ============
B D                Rhesus  ============
B D    Hawaiian monk seal  ============
B D                   Dog  ============
B D                 Horse  ============
B D              Marmoset  ============
B D               Gorilla  ============
B D                Bonobo  ============
B D                 Chimp  ============
B D                 Human  ============
B D                Tenrec  ============
B D               Tarsier  ============
B D            Tree shrew  ============
B D              Hedgehog  ============
B D                  Pika  ============
B D             Zebrafish  ============
B D         X. tropicalis  ============
B D                   Cow  ============
B D               Chicken  ============
B D                 Shrew  ============
B D              Elephant  ============
B D              Squirrel  ============
B D                   Pig  ============
B D                Rabbit  ============
B D      Chinese pangolin  ============
B D              Bushbaby  ============
                  Beaver  ============
B D  Malayan flying lemur  ============
           GCF_003668045  ============

Inserts between block 22 and 23 in window
B D              Dolphin 11bp

Alignment block 23 of 256 in window, 56698232 - 56698234, 3 bps 
B D                 Mouse  ttc
B D                   Rat  ttc
B D            Guinea pig  ===
B D                 Sheep  ===
B D                Rhesus  ===
B D    Hawaiian monk seal  ===
B D                   Dog  ===
B D                 Horse  ===
B D              Marmoset  ===
B D               Gorilla  ===
B D                Bonobo  ===
B D                 Chimp  ===
B D                 Human  ===
B D                Tenrec  ===
B D               Tarsier  ===
B D            Tree shrew  ===
B D              Hedgehog  ===
B D                  Pika  ===
B D             Zebrafish  ===
B D         X. tropicalis  ===
B D                   Cow  ===
B D               Chicken  ===
B D                 Shrew  ===
B D              Elephant  ===
B D              Squirrel  ===
B D                   Pig  ===
B D                Rabbit  ===
B D      Chinese pangolin  ===
B D               Dolphin  ===
B D              Bushbaby  ===
                  Beaver  ===
B D  Malayan flying lemur  ===
           GCF_003668045  ===

Alignment block 24 of 256 in window, 56698235 - 56698237, 3 bps 
B D                 Mouse  tcc
B D                   Rat  ccc
B D               Dolphin  ttc
B D            Guinea pig  ===
B D                 Sheep  ===
B D                Rhesus  ===
B D    Hawaiian monk seal  ===
B D                   Dog  ===
B D                 Horse  ===
B D              Marmoset  ===
B D               Gorilla  ===
B D                Bonobo  ===
B D                 Chimp  ===
B D                 Human  ===
B D                Tenrec  ===
B D               Tarsier  ===
B D            Tree shrew  ===
B D              Hedgehog  ===
B D                  Pika  ===
B D             Zebrafish  ===
B D         X. tropicalis  ===
B D                   Cow  ===
B D               Chicken  ===
B D                 Shrew  ===
B D              Elephant  ===
B D              Squirrel  ===
B D                   Pig  ===
B D                Rabbit  ===
B D      Chinese pangolin  ===
B D              Bushbaby  ===
                  Beaver  ===
B D  Malayan flying lemur  ===
           GCF_003668045  ===

Inserts between block 24 and 25 in window
B D              Dolphin 39bp

Alignment block 25 of 256 in window, 56698238 - 56698273, 36 bps 
B D                 Mouse  ttccccatctctcactcagcttcccctcccccttct
B D                   Rat  tccaccatctccctcccaggttcccctccaccatct
B D            Guinea pig  ====================================
B D                 Sheep  ====================================
B D                Rhesus  ====================================
B D    Hawaiian monk seal  ====================================
B D                   Dog  ====================================
B D                 Horse  ====================================
B D              Marmoset  ====================================
B D               Gorilla  ====================================
B D                Bonobo  ====================================
B D                 Chimp  ====================================
B D                 Human  ====================================
B D                Tenrec  ====================================
B D               Tarsier  ====================================
B D            Tree shrew  ====================================
B D              Hedgehog  ====================================
B D                  Pika  ====================================
B D             Zebrafish  ====================================
B D         X. tropicalis  ====================================
B D                   Cow  ====================================
B D               Chicken  ====================================
B D                 Shrew  ====================================
B D              Elephant  ====================================
B D              Squirrel  ====================================
B D                   Pig  ====================================
B D                Rabbit  ====================================
B D      Chinese pangolin  ====================================
B D               Dolphin  ====================================
B D              Bushbaby  ====================================
                  Beaver  ====================================
B D  Malayan flying lemur  ====================================
           GCF_003668045  ====================================

Alignment block 26 of 256 in window, 56698274 - 56698274, 1 bps 
B D                 Mouse  c
B D                   Rat  c
B D               Dolphin  c
B D            Guinea pig  =
B D                 Sheep  =
B D                Rhesus  =
B D    Hawaiian monk seal  =
B D                   Dog  =
B D                 Horse  =
B D              Marmoset  =
B D               Gorilla  =
B D                Bonobo  =
B D                 Chimp  =
B D                 Human  =
B D                Tenrec  =
B D               Tarsier  =
B D            Tree shrew  =
B D              Hedgehog  =
B D                  Pika  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  =
B D               Chicken  =
B D                 Shrew  =
B D              Elephant  =
B D              Squirrel  =
B D                   Pig  =
B D                Rabbit  =
B D      Chinese pangolin  =
B D              Bushbaby  =
                  Beaver  =
B D  Malayan flying lemur  =
           GCF_003668045  =

Inserts between block 26 and 27 in window
B D              Dolphin 32bp

Alignment block 27 of 256 in window, 56698275 - 56698308, 34 bps 
B D                 Mouse  ccaggttcttcccactccacaaccacccaatccc
B D                   Rat  ccaggttcttcccactccccaactacccaacttc
B D            Guinea pig  ==================================
B D                 Sheep  ==================================
B D                Rhesus  ==================================
B D    Hawaiian monk seal  ==================================
B D                   Dog  ==================================
B D                 Horse  ==================================
B D              Marmoset  ==================================
B D               Gorilla  ==================================
B D                Bonobo  ==================================
B D                 Chimp  ==================================
B D                 Human  ==================================
B D                Tenrec  ==================================
B D               Tarsier  ==================================
B D            Tree shrew  ==================================
B D              Hedgehog  ==================================
B D                  Pika  ==================================
B D             Zebrafish  ==================================
B D         X. tropicalis  ==================================
B D                   Cow  ==================================
B D               Chicken  ==================================
B D                 Shrew  ==================================
B D              Elephant  ==================================
B D              Squirrel  ==================================
B D                   Pig  ==================================
B D                Rabbit  ==================================
B D      Chinese pangolin  ==================================
B D               Dolphin  ==================================
B D              Bushbaby  ==================================
                  Beaver  ==================================
B D  Malayan flying lemur  ==================================
           GCF_003668045  ==================================

Alignment block 28 of 256 in window, 56698309 - 56698314, 6 bps 
B D                 Mouse  aagcca
B D                   Rat  atgctg
B D               Dolphin  actccc
B D            Guinea pig  ======
B D                 Sheep  ======
B D                Rhesus  ======
B D    Hawaiian monk seal  ======
B D                   Dog  ======
B D                 Horse  ======
B D              Marmoset  ======
B D               Gorilla  ======
B D                Bonobo  ======
B D                 Chimp  ======
B D                 Human  ======
B D                Tenrec  ======
B D               Tarsier  ======
B D            Tree shrew  ======
B D              Hedgehog  ======
B D                  Pika  ======
B D             Zebrafish  ======
B D         X. tropicalis  ======
B D                   Cow  ======
B D               Chicken  ======
B D                 Shrew  ======
B D              Elephant  ======
B D              Squirrel  ======
B D                   Pig  ======
B D                Rabbit  ======
B D      Chinese pangolin  ======
B D              Bushbaby  ======
                  Beaver  ======
B D  Malayan flying lemur  ======
           GCF_003668045  ======

Alignment block 29 of 256 in window, 56698315 - 56699971, 1657 bps 
B D                 Mouse  tttttctctttctttttagaaaacaaacaaaccaataaaacacggtgaaa---aagtcaaagagaaacat
B D                   Rat  tctttctctttctttttagaaaacaaacaaaccaataaaacaagatgaaagtgaaagaaaagaaaaatag
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D                Rhesus  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D                   Dog  ======================================================================
B D                 Horse  ======================================================================
B D              Marmoset  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D                Tenrec  ======================================================================
B D               Tarsier  ======================================================================
B D            Tree shrew  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D                   Cow  ======================================================================
B D               Chicken  ======================================================================
B D                 Shrew  ======================================================================
B D              Elephant  ======================================================================
B D              Squirrel  ======================================================================
B D                   Pig  ======================================================================
B D                Rabbit  ======================================================================
B D      Chinese pangolin  ======================================================================
B D              Bushbaby  ======================================================================
                  Beaver  ======================================================================
B D  Malayan flying lemur  ======================================================================
           GCF_003668045  ======================================================================

                    Mouse  aagaaacacatacatgcacatgcacacaaacacacatgaaataaaaaataaaaacacaaaatcagaatcc
                      Rat  aaaaaacacatacatgcacacgaacacagaaatacacaaaataaaaaagtaaagcacaaaatcagaatcc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ataacctacaatcaagcaaacggtaaggtaaaaaacaaaaatgaccaaatgaagtaatatgcgattttta
                      Rat  ataacctacaat----caaacagtaaggtaa-----aaaaatatccaaatgaagtgatatgaga-tgtaa
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  aaagaatctccaaaaataccaatgaattcgttttgtgttgtccattagctgctgggcatagagcctgaca
                      Rat  aaaaaacctccaaaaatatgaatggacttgctttgtgttggccagttgctgctgggcatgaggtctgccc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ttaaacgaagtttgtttactcagtacgacgcctttggagttaacaaatggttgctaattagagagcgttt
                      Rat  ttaaatgaggtttgtgtacccagtaagactccaatggaataaacaaatgattgtcaattagagagctttt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tggttaggaatggaattcatgtccacagctctcagagagcagcactgagatccatggggcttggatctgt
                      Rat  gggttaggaatggaattcgtgtccactgtcctccgaaagcaacactggga-ccatgggatttggacctgg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  gcaagccatgtgcacattgctgtagtctctatgggattgcatgtgcctcagtcttatgtttggaagacac
                      Rat  gcaagccatgagagc--tgccgcggtctctgtgggattatatgcaccttgatcttgtgtttggaagacac
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tatttccctggtattgtctatccccactggcttgtcc-ttctgtctccccttctgcagtgttccatgggc
                      Rat  ----tctctggtatcgtctatccctactggcttgtcctttctgtcttccattctgcagtactccatgagc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  cccaagaggagaggtttgatggagacatcccatttaagactaagtattccaacatctctcgtcccaacaa
                      Rat  cccaagaggagaggtttgatggagaaaccacatttaagactaagtgttccaacatctctcattccaacag
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tttgcatgcaccttgt-catttgtggctctctgat---tagtttccatccacttcaagaggatgcttttc
                      Rat  tctgcat----cttgtccacttgtgggtccctaactagtagttcccatccacttcagggggaagcttttc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tgaggatggctgagtgagacactgatctctggggatagtagagtatctctagaggtccttgctacttggc
                      Rat  cgatgatggccgagtgaggcactaatctacgggtattgtagggtatcac-ggaagtccctgctacgtagt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  cacttgagccgtgttggggatgggcgccatctcatagtgtaggccttaaatccaatcagatagtggttgg
                      Rat  cgctagagaagtgttggggatggttg-catctcatggagtaggccttaaatcgaaccagatagtggctgg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ttacttccacatctttttgtgcctctattgtagcagcgttatgaggtcaccactatgcgtcaaagggttt
                      Rat  gtactttcatatccttttgtgcctctatcgtaccagtgttatgaggtcaccattatgtatcaaggggttt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  gtagctgggttggtgctacttt-----tctggtggcatgcagaataggttgcactactatgaacgatagt
                      Rat  gtagctgggatggtggcacttttctcctctgatggcatgcagagtgctttctgctactacgaacgatagt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  cagtgcagattaaggctttaattaaacaacagcttaacttccccacggtcaatgagtatataagtggtgt
                      Rat  cagtgtggattaaggctttgattaaacaacagcttaacttctccatgatcaatgaaaatat--gtgttgc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ctccaacaatagcacgattgttacaatcatcagtttgtggagaacaactaacagcttaggcaatgatcgg
                      Rat  cttcagcaatag-------ggcatgaccatcaatttgtggagaacaaccaatagcttaggcaatagtctg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  agttgtttaggggtttttatgggacccctttgaccaacaactcagttacatataacccattctgggtgcc
                      Rat  ggttggttaggggtttttatgggacccctttggtcaacaactcaattatatgtaccctgctcctggctct
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ggaggtttctcctagggcaagagatgtctggctggtgctttgtatttacattattcagtgacctccttta
                      Rat  ggagcttccacctagggcaagagatgcctagctggtgctttgtatttatatcgttcagtggcttccttta
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  gacttcttttgtctgtatgtattttaagaagcttctattgtgtcaggtttccatatgaccccttatacag
                      Rat  tatttcctttgtctgtatatatttt--taagcttctattatattaggtttccatatga-ccctcacatgg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  cccttagtgttagctgtctcactctgtaattactctgttccgcggccccgtccactcccccatcccttta
                      Rat  cacttagtgttagctgtctcaccctgcaattcctccattactc--ccctgttcacccccccatccctgta
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  atcctcccattccagtcttgcctgtctctccataactatacattctattcccccatacctctcacatctc
                      Rat  atgctcccgttccagtctc-cccatctctccataactatacattccatttccctgtccttctcatacctc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  aatctcttactctatacctaaccacctaacctctgtggttataggggttgtagcatgcctatcaaaggct
                      Rat  aatctcttactctat--------acctaacccttatggttataaggattgtagcatgcctatcaaaggct
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  gaaaagctaacacccacatataagagattacacaccatatattttggagtctgggttacccctctcagga
                      Rat  taaaagctaacatccacatataagagagtatataccatatattttggagtctggattac----ctcagga
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  gga-ttttttttctagttctatccatttgcctgtgaatttcaagatttca------tttttttttga
                      Rat  ggatttttttttctagctctatccatttacctgtgaatttcaagattttggggttttttttttttga
               Guinea pig  ===================================================================
                    Sheep  ===================================================================
                   Rhesus  ===================================================================
       Hawaiian monk seal  ===================================================================
                      Dog  ===================================================================
                    Horse  ===================================================================
                 Marmoset  ===================================================================
                  Gorilla  ===================================================================
                   Bonobo  ===================================================================
                    Chimp  ===================================================================
                    Human  ===================================================================
                   Tenrec  ===================================================================
                  Tarsier  ===================================================================
               Tree shrew  ===================================================================
                 Hedgehog  ===================================================================
                     Pika  ===================================================================
                Zebrafish  ===================================================================
            X. tropicalis  ===================================================================
                      Cow  ===================================================================
                  Chicken  ===================================================================
                    Shrew  ===================================================================
                 Elephant  ===================================================================
                 Squirrel  ===================================================================
                      Pig  ===================================================================
                   Rabbit  ===================================================================
         Chinese pangolin  ===================================================================
                 Bushbaby  ===================================================================
                   Beaver  ===================================================================
     Malayan flying lemur  ===================================================================
            GCF_003668045  ===================================================================

Inserts between block 29 and 30 in window
B D                  Rat 1810bp

Alignment block 30 of 256 in window, 56699972 - 56702915, 2944 bps 
B D                 Mouse  actttagaaacatcacatgtttatttggacaataacgtgaacatagctgacagttgtgctctttacaaag
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D                Rhesus  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D                   Dog  ======================================================================
B D                 Horse  ======================================================================
B D              Marmoset  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D                Tenrec  ======================================================================
B D               Tarsier  ======================================================================
B D            Tree shrew  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D                   Cow  ======================================================================
B D               Chicken  ======================================================================
B D                 Shrew  ======================================================================
B D              Elephant  ======================================================================
B D              Squirrel  ======================================================================
B D                   Pig  ======================================================================
B D                Rabbit  ======================================================================
B D      Chinese pangolin  ======================================================================
B D              Bushbaby  ======================================================================
                  Beaver  ======================================================================
B D  Malayan flying lemur  ======================================================================
           GCF_003668045  ======================================================================
B D                   Rat  ======================================================================

                    Mouse  cagtatatggatatattttctgctttgatttttaacactttgataatatggagatggtattatattttat
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  atccactcactagtcctttcttttttttctgttaagttgctactgtagcatctctccaatctcttttctt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  ttctttttttaaattggatattttctttatttacatttcaaaggttatcccctttccaggtctcccctcc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  agaaacctcctatcacatcacccctcctcttgcctctatgaggatgctccccccccccccacccactccc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  accttcctgccctggcattcccctccactaaggcatcgaatccagacaggaccaaggacaattcctccta
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  ctgatgtccaacacggccattctctgccacatacttggcctgagccatgggtccctccatgtgaactctt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  tggttggtggtccagtccccgggagctctggggttctggctggccagttgacactgtagctcctccatag
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  ggctgcaaatcccctcacctccttcagacctttctccaatttctggctattagaaatagagtagcaatga
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  ccatagatgagcaggtatctatgtagtctatgtagaatgtggtatcctttcagtacgtgaacaagagtga
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  tctagtaggatcttgaagtagatagcctaagtgcccaaagagctaccacactgatttccatagtgcctat
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  acactatgcagccccactagcagtgaatgagtgacttcttcaccccacatgctcaccatcatgagcggtc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  atttgtcttattgactccagccattttgactggtgtaagatgaaatctcagagtggtcttgatttgcatt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  tccctgagagctaaggatgttgagggtttttcttctttttaaaagtatttctcagccatttctgtttcct
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  ctgttgagaattctgtttatatctgtaccccattttttattggattatttgtttcttgttatctagtttc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  atgagttgtctgttttgagtattagtcctccattggatgtatagttagtgaaactcctttcccattctgt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  aggttgtttctttgtctgaatggtgctctcccatttctcttctaacaggttcagcatatatgattttata
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  ttgaggtcctggatccctttggagttgagttttgtgcagggtgattgtcttagtcagggtttctatttct
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  gcacaaacatcatgatcaagaaacaagttggggagaaaagtttattcagctcacatttccagattgctgt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  tcatcactgaaggaagtcaagactggaactcatgaggtcaaaaagcaggagctgatgcagaggccataga
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  gagatgttctttactggcttgcttcctctggcttgctcagcttgctttcttataggaccaagactaccag
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  cccagggaaggcaccacccaaaaggggcctttcccccttgatcactaattgagaaaatgccttacagctg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  gatcttgtggaggcatttcctcaactgaagctcctttctctgtgataactccagattgtgtcaagttgac
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  acaaaacttgccagtacagtgataaatattgatctatttggattcttctacatttacccatcaagtttga
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  cttccccttttgctgaagatgtcatttttatagtatgtatttctgacttttttgtaaaaaaacaaaagac
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  aacaacaaaaaaatccaaacaacaacaaaaaccaggtgtttacaaaagcatggacttatatatctggttc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  ttcaatttgattgcattgatctactcctgtgaccctgttaaactcacatagcagttcagaaattgttaaa
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  ggtcttagaatgccctgtgtagagaaacatgccatctgccaacagagctagttttacctctgtatacttt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  ctcggctttgctgtgccggcgaggactaacagtataacctctgctggatgggatggccatgttcttagtc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  ttaggggaaatattaagtgtttcattgtaggaccgtgaaaggcagcctggttcctggttgagctaaggct
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  agaatctctggtgattgtaaagggatgttagatgtttcacttgagtcctggacaccaggctcctggcacg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  aggctgcagccctccatagatttgttaccttcagttaggtaagggcaatgtctcaaaaccttccacagat
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  agaggacatgacccatagtcacatagactcaagaccgatctccattttaatgagctacctaaaggcctgg
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  aggacttagccaattaggcttttcttcccagacactcctccctgcaaaaggtatttaacctcaggccttc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  cctcagaagtggggtatagttttactcattcacgttttgccatgacaataaatgctttaaaaccatggac
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  tgcctcttttcaatgggatctgccatagggaaccatggagaaggccttcttcacctacagagccacctgt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  agaaggcctctcggtgctcccagccacagctgccaccaagctcaaaccagccaaggccaacaagccaaag
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  actttcccgagggaccagccagagctccccctcttttccccctcagcctccgggtctcatggctccccac
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  agcctgacaccctcccatccagtgactgtggaagttttaacgggaagctaaaactcccatgtcctgcctc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  cccagcagccgtgccctgtggtggggcagacacaggaccccactaaccctacatttcatgacttaagata
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  attaaggatcaatctttagttgtaagcccctccttgggtttgggagtttccttctattactagtttattt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  agaatttctattatgaaagaaatttggatttttttcaaatgtcttcttcctcattatatcttttgtagat
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================
                      Rat  ======================================================================

                    Mouse  gtct
               Guinea pig  ====
                    Sheep  ====
                   Rhesus  ====
       Hawaiian monk seal  ====
                      Dog  ====
                    Horse  ====
                 Marmoset  ====
                  Gorilla  ====
                   Bonobo  ====
                    Chimp  ====
                    Human  ====
                   Tenrec  ====
                  Tarsier  ====
               Tree shrew  ====
                 Hedgehog  ====
                     Pika  ====
                Zebrafish  ====
            X. tropicalis  ====
                      Cow  ====
                  Chicken  ====
                    Shrew  ====
                 Elephant  ====
                 Squirrel  ====
                      Pig  ====
                   Rabbit  ====
         Chinese pangolin  ====
                 Bushbaby  ====
                   Beaver  ====
     Malayan flying lemur  ====
            GCF_003668045  ====
                      Rat  ====

Alignment block 31 of 256 in window, 56702916 - 56703710, 795 bps 
B D                 Mouse  tgtctgaaagtacaacatcgcatcagtaatggtgttagggtatgttgcttgcccatgagatggatctcaa
B D                   Rat  tgtctgcaagtgcaatgtagcatcagtaatagtgtcagagtctggcacttgcccataggatggatcccaa
B D            Guinea pig  ======================================================================
B D                 Sheep  ======================================================================
B D                Rhesus  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D                   Dog  ======================================================================
B D                 Horse  ======================================================================
B D              Marmoset  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D                Tenrec  ======================================================================
B D               Tarsier  ======================================================================
B D            Tree shrew  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D                   Cow  ======================================================================
B D               Chicken  ======================================================================
B D                 Shrew  ======================================================================
B D              Elephant  ======================================================================
B D              Squirrel  ======================================================================
B D                   Pig  ======================================================================
B D                Rabbit  ======================================================================
B D      Chinese pangolin  ======================================================================
B D              Bushbaby  ======================================================================
                  Beaver  ======================================================================
B D  Malayan flying lemur  ======================================================================
           GCF_003668045  ======================================================================

                    Mouse  gtaggactggtcattggttggcctttccttcaatct----gctccatttttgttcccacatttctcttaa
                      Rat  gttgggctggtcattggttggcaattcctttaatctctgttccccacttttgtccccacatttcttttag
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  acaggaacaattctcagtcaaaaatttgaggtggattggtgtccccatccctctactgggggccctgtct
                      Rat  acagaagcaattcttggttaaaaaaatgaagtggattggtgtccccattcttccactggaggtcctgact
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  aactaccggaggtggattcttcaggttccatcccctcaatgttgggcatttcatctaaggttacccatat
                      Rat  gactactggaggtgggctcttcaggttccatctcctcactgttggacattttggctcaggtcacccattc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tgagtgtcatggtttctctcacatcccaggtcttcgggactttctagttcttcccctctacttcctaccc
                      Rat  tgagt-cctgggtgcctttcacatcccagatctctgggactttctagaggttcccctctacttcccatcc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  cagcagtgg-atatttccatttattctcttggcccactggatttctctcctcttctcct-----ccatat
                      Rat  cagcagtggcatacttc-atttattctcctggcccactggaattctttcctgtctccccaacccccatat
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ctgatcctgcctcctttcccttatctccc-ctctcctactcatttcctttcctccctctgcctccaatga
                      Rat  ctgatcctgcccccttcccttcctcttcctctctcccactcagttccctccccacctctgctccccatga
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ttattttgttccccctt--aagtggaattgaagcatcttcacttgtactttccttcttgtttaacttctt
                      Rat  ttattctgtttccccttctaagtggaattgaagcatccttacctgggccttacttctcgtttaacttctt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  gttgtctgtggggtgtatcatgagtatcctatactttttggctaatatccacttatcagtgagtacatac
                      Rat  gcagtctgtgaggtgtatcatgggtattctgtacttttgggctaatatccacttatcagtgagtatatat
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tacccatgtcatttggggtctgtgttacctcacacaggatggtattttctagttccatccatttgcctac
                      Rat  catgcatgtccttttgggactgggttgcctcactcaggatggtattttctagttccatccatttgcctgc
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  ggaattcatgatgtccttgtttttaatagctgaatagtattccattgtgtaaatgaaccatgtttcatgt
                      Rat  aaaatttatgatgtcctcattgttaatagctgaatagcattccattgtg-aaatgaacctcattttctgt
               Guinea pig  ======================================================================
                    Sheep  ======================================================================
                   Rhesus  ======================================================================
       Hawaiian monk seal  ======================================================================
                      Dog  ======================================================================
                    Horse  ======================================================================
                 Marmoset  ======================================================================
                  Gorilla  ======================================================================
                   Bonobo  ======================================================================
                    Chimp  ======================================================================
                    Human  ======================================================================
                   Tenrec  ======================================================================
                  Tarsier  ======================================================================
               Tree shrew  ======================================================================
                 Hedgehog  ======================================================================
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                      Cow  ======================================================================
                  Chicken  ======================================================================
                    Shrew  ======================================================================
                 Elephant  ======================================================================
                 Squirrel  ======================================================================
                      Pig  ======================================================================
                   Rabbit  ======================================================================
         Chinese pangolin  ======================================================================
                 Bushbaby  ======================================================================
                   Beaver  ======================================================================
     Malayan flying lemur  ======================================================================
            GCF_003668045  ======================================================================

                    Mouse  tttttcccccactttttggttgagagacacct-ggttgc
                      Rat  at------ccattctttggttgagtgacatctaggttgc
               Guinea pig  =======================================
                    Sheep  =======================================
                   Rhesus  =======================================
       Hawaiian monk seal  =======================================
                      Dog  =======================================
                    Horse  =======================================
                 Marmoset  =======================================
                  Gorilla  =======================================
                   Bonobo  =======================================
                    Chimp  =======================================
                    Human  =======================================
                   Tenrec  =======================================
                  Tarsier  =======================================
               Tree shrew  =======================================
                 Hedgehog  =======================================
                     Pika  =======================================
                Zebrafish  =======================================
            X. tropicalis  =======================================
                      Cow  =======================================
                  Chicken  =======================================
                    Shrew  =======================================
                 Elephant  =======================================
                 Squirrel  =======================================
                      Pig  =======================================
                   Rabbit  =======================================
         Chinese pangolin  =======================================
                 Bushbaby  =======================================
                   Beaver  =======================================
     Malayan flying lemur  =======================================
            GCF_003668045  =======================================

Alignment block 32 of 256 in window, 56703711 - 56703716, 6 bps 
B D                 Mouse  ttccag
B D                   Rat  ttccag
B D      Chinese pangolin  tcccag
B D            Guinea pig  ======
B D                 Sheep  ======
B D                Rhesus  ======
B D    Hawaiian monk seal  ======
B D                   Dog  ======
B D                 Horse  ======
B D              Marmoset  ======
B D               Gorilla  ======
B D                Bonobo  ======
B D                 Chimp  ======
B D                 Human  ======
B D                Tenrec  ======
B D               Tarsier  ======
B