Multiz Alignments of 35 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 407 in window, 56747477 - 56747497, 21 bps 
B D                 Mouse  cttttactctc------tgaaa----------gaaaa
B D                   Rat  cctctactctc------tgaaa----------gaaaa
            GCF_003668045  cctctactctc------tgaag----------gaaaa
                   Beaver  cccctactctc------caaaa----------ggaaa
B D              Squirrel  ccccaactctc------caaaa----------taaaa
B D            Guinea pig  ctttgactctc------cagaa----------gaaaa
B D                Rabbit  ccccgattctc------caaaa----------gaaaa
B D                  Pika  ccccggttctc------caaaa----------agaaa
B D                 Human  cctcatgtctc------caaag----------gaaaa
B D                 Chimp  cctcatgtctc------caaag----------gaaaa
B D                Bonobo  cctcatgtctc------caaag----------gaaaa
B D               Gorilla  cctcatgtctc------caaag----------gaaaa
B D                Rhesus  cctcatgtctc------caaag----------gaaaa
B D              Marmoset  cctcaagtctc------caaag----------gaaaa
B D               Tarsier  ccccaaccctc------caaaa----------gaaaa
B D              Bushbaby  ccccaattctc------caaaa----------gaaaa
B D            Tree shrew  ccccaactctc------caaaa----------gaata
B D  Malayan flying lemur  ctctgactctc------caaaa----------gaaaa
B D                   Pig  ccccgactctc------taaaa----------gaaaa
B D               Dolphin  ccccgactctc------cataa----------gaaaa
B D                   Cow  cctcgactctc------caaaa----------gaaaa
B D                 Sheep  cctcgactctc------caaaa----------gaaaa
B D                 Horse  ccccaactctcaaaaaaaaaaa----------aaaaa
B D      Chinese pangolin  ccccgactctc------cgaaa----------gaaaa
B D                   Dog  ccccgactctg------cagaa----------gaaaa
B D    Hawaiian monk seal  ccccgactctg------caaaa----------gaaaa
B D              Hedgehog  cccccacttcc------aaaaaaaaaaaagttgaaaa
B D                 Shrew  ccccgactctc------agaaa----------gaaac
B D              Elephant  cctccactctc------caaga----------gaaaa
B D                Tenrec  ctcctactctc------ccaaa----------gaaaa
B D               Opossum  ccccatttttc--------aaa----------gaaaa
B D             Zebrafish  =====================================
B D         X. tropicalis  =====================================
B D               Chicken  =====================================

Inserts between block 1 and 2 in window
B D              Opossum 3607bp

Alignment block 2 of 407 in window, 56747498 - 56747943, 446 bps 
B D                 Mouse  tttaaaaca-ctga-----t-----ttttt-----cccttttttcc--------c---cc---tccttga
B D                   Rat  tttaaaaca-ctgg-----tgtttcttttt-----ttttttttttc--------t---cc---tccttga
            GCF_003668045  tttaaaaca-ctcg-----t-----gcttc-----cttttcttttt--------t---cc---ccgttga
                   Beaver  tttaaaaca-ctcg-----t-----gtttt-----gttgttttttc--------t---tc---c---tga
B D              Squirrel  tttaaaaca-cttg-----t-----g---------------tcccc--------c---tc---cccctgg
B D            Guinea pig  gtgaaaaca-ctcc-----t-----gtttt-------------------------------------taa
B D                Rabbit  tgtcaaacg-ctcg-----c-----gatct-----gggctttccct--------g---a-----------
B D                  Pika  attcaaa-a-cacc-----c-----gttct-----gtgttttacct--------t---ac---------g
B D                 Human  tttaaaaca-ctcg-----t-----gtttt------------tatt--------t---tc---cccccga
B D                 Chimp  tttaaaaca-ctcg-----t-----gtttt------------tatt--------t---tc---cccccga
B D                Bonobo  tttaaaaca-ctcg-----t-----gtttt------------tatt--------t---tc---cccccga
B D               Gorilla  tttaaaaca-ctcg-----t-----gtttt------------tatt--------tccccc---cccccga
B D                Rhesus  tttaaaaca-ctcg-----t-----gtttt------------t---------------tc---cccccga
B D              Marmoset  tttaaaaca-ccgg-----t-----gtttt------------c-tt--------t---tc---ccccaga
B D               Tarsier  tttaaaaca-ctcg-----t-----gttttg----ctgggggtttt--------t---ct---cccctga
B D              Bushbaby  tttaaaaca-cttg-----t-----gtcct------------cccc--------cc--ac---cccccgc
B D            Tree shrew  cttaaaaca-ctcg-----t-----gattt-----------ttttt--------t---tt---tccctga
B D  Malayan flying lemur  tttaaaaca-ctcg-----t-----gtttt-----attttatttta--------t---tt---ttcctga
B D                   Pig  attaaaaca-cccg-----t-----gt----------tcttttttt--------t---cc---cccttga
B D               Dolphin  attaaaaca-cccg-----t-----gtt---------ttttttttt--------c---tt---cctttga
B D                   Cow  cttaaaacaccccg-----t-----gttgttgt----ttttttttc--------t---tt---tccttga
B D                 Sheep  cttgaaacaccccg-----t-----gttgttgt--tgttgtttttc--------t---tt---tccttga
B D                 Horse  attaaaaca-cccg-----t-----gg------------ttttttt--------t---tt---tccctga
B D      Chinese pangolin  tttaaaaca-cccg-----t-----gt------------tttgttttgttttgct---tt---ttcctga
B D                   Dog  attaaaaca-ctcg-----t-----g--------------ttttta--------t---tc---cccctga
B D    Hawaiian monk seal  attaaaaca-ctcg-----t-----g-------------ttttttt--------t---tc---cccctga
B D              Hedgehog  agtaaaaca-ttca-----t-----tttcttccacc------tcta--------t---cc---ctcctga
B D                 Shrew  agggaaaca-cccgtctttt-----ttttttccccccttccttctt--------c---tt---cccctga
B D              Elephant  a----aaca-ccca-----c-----------------------ttt--------t---cc---cccctga
B D                Tenrec  gt---tacc-ccca-----c-----------------------ccc--------t---tccaactctcca
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  gaagaattaagcaaccgccacacgaa------------ag-------tgtg-agtccaaa-ttcgtc---
                      Rat  gaagaatgaagcaacagtcacacaaa------------ag-------tgtg-agtccaaatttcgtc---
            GCF_003668045  gaagaactaagcagccgccacacaaa------------ac-------cgtg-agtccaaa-tatatc---
                   Beaver  gaaaagctaaacaaccgtgacaataaaag--ccc---gag-------tctg-agtctaag-ttcatccct
                 Squirrel  gggaggctaaggaatcaccacaaggaaac--cccaa-gag-------actg-agtctaaa-ttccgc---
               Guinea pig  aaacctctgagcactcactacaacaaaag--cccg---ag-------gctg-agtctgaa-ttcatg---
                   Rabbit  -----------caaccg---------------ccgggagg-------tttg-attctaaa-ttcatc---
                     Pika  aaaaagctaagcgaccgctccaacagacg--cccaagagg-------gtcg-agtctaaa-ttcatc---
                    Human  gaaaagctaaacaaccaccacaacaaaag--cccca--ga-------ttta-agtctaaa-ttcatc---
                    Chimp  gaaaagctaaacaaccaccacaacaaaag--cccca--ga-------ttta-agtctaaa-ttcatc---
                   Bonobo  gaaaagctaaacaaccaccacaacaaaag--cccca--ga-------ttta-agtctaaa-ttcatc---
                  Gorilla  gaaaagctaaacaatcaccacaacaaaag--cccca--ga-------ttta-agtctaaa-ttcatc---
                   Rhesus  gaaaagctaagcaaccaccacaacaaaag--cccca--ga-------ttta-agtctaaa-ttcatc---
                 Marmoset  gaaaagctaagcaaccaccacaacaaaag--ctcca--ga-------ttta-agtctaaa-ttcatc---
                  Tarsier  gaaaagccaagcaaccaccgccacaaaag--cccaa--gagt-----gttg-agtctaaa-tgcatc---
                 Bushbaby  aaaaatctaagcaaaccccaccacaaaag--ctggc--gt-------ttgg-ggtctaag-ttcatc---
               Tree shrew  gaaaagctaagca---accacaacaaacg--ctcaa--gagt-----tttg-ggtctaaa-ttcatc---
     Malayan flying lemur  gagaagctaagcaaccaccacaacaaaag--tccaa--gagt-----tttgagatttaaa-ttcacc---
                      Pig  gaataactaagcaaccacaacaacaaaag--cccaa--gaat-----tttg-agtctaaa-ttcatc---
                  Dolphin  gaaaaactaagcaaccacaacaacagaag--cccag--gagt-----tttg-agtttata-ttcatc---
                      Cow  gaaaagctaaacaaccataacaacaaaag--ccccc--gagt-----tttg-agtctaaa-ttcatc---
                    Sheep  gaaaagctaaacaaccgtaacaacaaaag--cccca--gagt-----tttg-agtctaaa-ttcatc---
                    Horse  gaaaaactactcaaccacaccaacaaaaa--tccaa--gagt-----tttg-agtctaaa-ttcatc---
         Chinese pangolin  gaaaaaataagcaattacagcaataaaaaagcccac--gagt-----tttg-agtctaaa-ttcttc---
                      Dog  ggaaaactaagcaaccaccaccacaaaag--cccta--gagt-----tttg-agtctaaa-ttcatc---
       Hawaiian monk seal  gaaaaactaagcaaccaccaccacaaaag--cccta--gagt-----ttta-agtctaaa-ttcatc---
                 Hedgehog  aaaac--taagcagccacaacagcacaag--cctac--gagtt----tttg-aatctaaa-ttcatc---
                    Shrew  gtaacaatgagcaagcacaatagcaaaag--cccag--gggtttaagtctg-aat-taaa-gtcacc---
                 Elephant  gaaaagctacgctaccaccaccacaaaag--cccaa--gaat-----tttg-ggtctaaa-ttcatc---
                   Tenrec  gaaaagct--------gctaccacaaaag--cccaa--gaat-----tttg-tgtctaaa-tttatc---
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  a-gtac----gttagaatgaagacgagtttaaaa--ct--c-aaat------------------------
                      Rat  a-gtat----gctagaatgaa---gagttcaaaa--ct--c-aaat------------------------
            GCF_003668045  a-gtat----gctagaatgaa---gatttcaaaa--ct--c-aaat------------------------
                   Beaver  a-ctat----gctagagtcaa---gacttcaaacctct--c-aaaa------------------------
                 Squirrel  a-ctaa----gatag--tcaa---gagttggaaactct--c-aaaa------------------------
               Guinea pig  a-ctattctcactggagtcaa---gaattcaaaa--ct--c-gtaa------------------------
                   Rabbit  a-ccac----gctggagtcaa---gagttcaaaactct--c-aaaa------------------------
                     Pika  a-ccac----gctggagtcaa---gagttcaaaactct--c-agaa------------------------
                    Human  a-ccgt----cctggagtcaa---gagttcaaaactct--caaaaa------------------------
                    Chimp  a-ccgt----cctggagtcaa---gagttcaaaactct--caaaaa------------------------
                   Bonobo  a-ccgt----cctggagtcaa---gagttcaaaactct--caaaaa------------------------
                  Gorilla  a-ccgt----cctggagtcaa---gagttcaaaactct--c-aaaa------------------------
                   Rhesus  a-ccgt----cctggagtcaa---gagttcaaaactct--c-aaaa------------------------
                 Marmoset  a-ccgc----cgtggagtcaa---gagttcaaaactct--c-aaaa------------------------
                  Tarsier  a-ccat----gttggaatcaa---gagttcaaaactct--c-aaaa------------------------
                 Bushbaby  a-ccat----gctggagttga---gagttcaaaacttt--c-taaa------------------------
               Tree shrew  a-gcac----attggagtcaa---gagttcaaaactcc-ac-aaaa------------------------
     Malayan flying lemur  a-ctac----gctggagtcaa---gagttcaaaactct--c-aacc------------------------
                      Pig  a-ccag----gctggagtttg---gagttctaaattct--c-aaaaaccct--cac--------------
                  Dolphin  a-ccac----ggtggagtcag---gagttcaaagctct--c-aaaaaagca--aacaacaacaaa-----
                      Cow  a-ccac----ggtggagtcag---gagttcaaagctct--c-aaaaaacca--aac--------------
                    Sheep  a-ccac----ggtggagtcag---gagttcaaagctcg--c-aaaaaacca--aac--------------
                    Horse  a-ccgc----gctcgagtcag---gagctccaagctct--c-agaagcc--------------------c
         Chinese pangolin  a-tcac----gctggagtcag---gagtccaaagctct--c-aaaaaccaa--aaca-aaatgcaaaaac
                      Dog  a-tcat----gatggagtcag---gggttcaaacctct--g-aaacacaca--cacacacacacacacac
       Hawaiian monk seal  a-ccag----gatggagtctg---gagctcaaagctct--g-aaaagcaag--caaacaaacaca-----
                 Hedgehog  a-tgaa----actggagccag---gagttcaaaatttt--c-aataagcaa--atc--------------
                    Shrew  actcgg----gatggagtcag---gagtataaagttct--t-agaaaacaaacaca--------------
                 Elephant  a-tcac----cccggagtcag---gagttgcaaacttaaac-aaaaacaaacaaacaaacg---------
                   Tenrec  a-ccac----ctcaag-------------ccaaactta----aaaaaaagaagaagaaagg---------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -------ggca------------------aaacttcaaggcactgtacgg--tattcccg----------
                      Rat  -------ggca------------------aaacttcaaggcagtgtgcct--tattcccg----------
            GCF_003668045  -------gcgg------------------a---cttaaggcagtgtaagg--catttacg----------
                   Beaver  -------accg------------------g-cctttaaggcagcataagg--ttttccta------ctt-
                 Squirrel  -------accg------------------gactttgaaggcagactgaga--tgtccttgagcagacct-
               Guinea pig  -------tggg------------------a--ctttaaggcagagtgagg--ttttcctgagcagactt-
                   Rabbit  -------accg------------------gaccttcggg-cagcgggagg--tttcccggagcagccct-
                     Pika  -------accg------------------gactttcgggccagcgggagg--tttcccggagcaaacct-
                    Human  -------accg------------------gacc-ttaaggcaatgtaagg--tttcccc-agcagaccc-
                    Chimp  -------accg------------------gacc-ttaaggcaatgtaagg--tttcccc-agcagaccc-
                   Bonobo  -------accg------------------gacc-ttaaggcaatgtaagg--tttcccc-agcagaccc-
                  Gorilla  -------accg------------------gacc-ttaaggcaatgtaagg--tttcccc-agcagaccc-
                   Rhesus  -------accg------------------aacc-ttaaggcaatgtaagg--tttcccc-agcagacct-
                 Marmoset  -------acct------------------gatc-ttaaggcagtgtaaga--tttcccc-agcagacct-
                  Tarsier  -------accg------------------gaac-ttaaggcagcgtgagg--tttccctgagcagacct-
                 Bushbaby  -------acgg------------------gacctttaagagaatgcgagg--ttttcttgagtagacat-
               Tree shrew  -------actg------------------aacc-ttaaaccagcgtaagggttttcctg-agcggacct-
     Malayan flying lemur  -------accg------------------gacc-ttaagactatgtaagg--tttcccg-ggcagacct-
                      Pig  -------aacaagtaaccca---------gacc-ttagagcagg--------tttctctgagc-------
                  Dolphin  -------aaca---aacctg---------gacc-ttaaagcagcgtaagg--tttatttgagcagacct-
                      Cow  -------aaca---aagccg---------gacc-t-------------------tctttgaacagaccta
                    Sheep  -------aaca---aagccg---------gacc-t-----------------tctctctgaacagacct-
                    Horse  ctccccaccca---aagccgca-------gacc-ttaaagcagcgaaagc--tttctttgagcagacct-
         Chinese pangolin  aaaacaaaaca---aaactg---------gacc-ttaaacgaatggaag---tttcttagagtatacct-
                      Dog  acacacacaca---cacacacacggacctgacc-tgaaggcagcctaagg--tttctaagagcggatct-
       Hawaiian monk seal  -----------------------------gatc-ttaaggcagcctaagg--tttcttagagcagatct-
                 Hedgehog  -------agca---aagcaaag-------gatg-ttaaggca-------------gttggaccagatct-
                    Shrew  -------aaca---aacaaaag-------ggcg-gcaaagcaccccaggt--ttcattgg-tcagacct-
                 Elephant  -------aaag------------------gatg-tt-aagcctcctaagg--tttcctttggcagaact-
                   Tenrec  -------aaaa------------------gatg-ctaaaggcatttacag--tgtccttgagcagaact-
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ------------------------------------------------------a---------------
                      Rat  ------------------------------------------------------a---------------
            GCF_003668045  ------------------------------------------------------g---------------
                   Beaver  g------gg--------------------------------------------ta---------------
                 Squirrel  c------tg--------------------------------------------ta---------------
               Guinea pig  a------gg--------------------------------------------ca---------------
                   Rabbit  g------gg--------------------------------------------ct---------------
                     Pika  g------gc--------------------------------------------tt---------------
                    Human  c------ag--------------------------------------------ta---------------
                    Chimp  c------ag--------------------------------------------ta---------------
                   Bonobo  c------ag--------------------------------------------ta---------------
                  Gorilla  c------ag--------------------------------------------ta---------------
                   Rhesus  c------ag--------------------------------------------ta---------------
                 Marmoset  c------ag--------------------------------------------ta---------------
                  Tarsier  g------gg--------------------------------------------taggtttgcagtttttt
                 Bushbaby  g------gg--------------------------------------------ta---------------
               Tree shrew  g------gg--------------------------------------------aa---------------
     Malayan flying lemur  g------gg--------------------------------------------ta---------------
                      Pig  agacctgcg--------------------------------------------ta---------------
                  Dolphin  g------tg--------------------------------------------ta---------------
                      Cow  a------tg--------------------------------------------ta---------------
                    Sheep  a------tg--------------------------------------------ta---------------
                    Horse  g------ag--------------------------------------------ta---------------
         Chinese pangolin  g------gg--------------------------------------------tg---------------
                      Dog  g------cg--------------------------------------------ta---------------
       Hawaiian monk seal  g------gg--------------------------------------------ta---------------
                 Hedgehog  g-----agg--------------------------------------------ta---------------
                    Shrew  g------gg--------------------------------------------ta---------------
                 Elephant  g------gg--------------------------------------------ta---------------
                   Tenrec  g------gggcaaacccttcaaaactccctgcccttcagccggttccccctcaga---------------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ------------------------------------agt---------------------agacgccacc
                      Rat  ------------------------------------agt---------------------ag-----acc
            GCF_003668045  ------------------------------------agt---------------------agactccacc
                   Beaver  ------------------------------------agtttg-----------taactccaaactccaat
                 Squirrel  ------------------------------------ggtttgc--aaatttcttaatcctcaactccaac
               Guinea pig  ------------------------------------cctctgc--aaatttcttcatcccaaactccagt
                   Rabbit  ------------------------------------ggtttgc--aaattgcttcatcccagaggccagt
                     Pika  ------------------------------------ga-----------------acctcccgctccaac
                    Human  ------------------------------------ggtttgc--aaatctcttaatcccaaactc-aat
                    Chimp  ------------------------------------ggtttgc--aaatctcttaatcccaaactc-aat
                   Bonobo  ------------------------------------ggtttgc--aaatctcttaatcccaaactc-aat
                  Gorilla  ------------------------------------ggtttgc--aaatctcttaatcccaaactc-aat
                   Rhesus  ------------------------------------ggtttgc--aaatttcttaatcccaaactc-aat
                 Marmoset  ------------------------------------ggtttgc--aaatttcttaatccaaaattctaat
                  Tarsier  tttaaaaatggttaaacctatttaattatccattttggtttgc--aaatttcttaatctcaaactccaat
                 Bushbaby  ------------------------------------ggtttgc--aaatttctgagtcac-------aat
               Tree shrew  ------------------------------------ggtctgc--aaatgtcttagtcccagacttcaat
     Malayan flying lemur  ------------------------------------ggtttgc--aagttgcttaaacccaaactctaat
                      Pig  ------------------------------------ggtttgc--aaaattattcataccaaactccaga
                  Dolphin  ------------------------------------ggtttgc--aaatttattcataccaaactccaat
                      Cow  ------------------------------------ggtttgc--aaatttattcatgccaaactcctat
                    Sheep  ------------------------------------ggtttgc--aaatttattcatgccaaactcctat
                    Horse  ------------------------------------ggtttgc--gaatttcctaataccaaactccaat
         Chinese pangolin  ------------------------------------agtttgc--tgattgtttcttacgaaactccaat
                      Dog  ------------------------------------gatttgc--aaatttcttaatcccaaactccaat
       Hawaiian monk seal  ------------------------------------gatttgc--aaatttcttaataccaaattctaat
                 Hedgehog  ------------------------------------gggttacaaatatttcttaatagtaaacgccaat
                    Shrew  ------------------------------------gctttgc--ccatttctt-------aacactaat
                 Elephant  ------------------------------------gatttgc--aaggttcttaatcctaaaccccaat
                   Tenrec  ------------------------------------ggtctgc--aaatgccttcatcctaaatcccagc
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tccaaagcttcaa-agtact------------tagt-----------------cttattttaaagcctta
                      Rat  tccaaagcctcaa-cgtact------------tagt-----------------cttattttagagcctta
            GCF_003668045  ttggaagcttcaa-agtact------------tagt-----------------gttatcttaaagcctca
                   Beaver  tccaaagccttaa-aacacg------------tagtttttt-tttcttttttcttttttttgaagtctta
                 Squirrel  ttcaaagcctcaa-aatact------------tagtttttg-tttg-------attattttgaaggctta
               Guinea pig  accaaagcctcaa-aatatg------------tatttttcg-tttg-------attatcttaaagtctta
                   Rabbit  cccacagcctcaa-aacact--------------gtttcgg-tttggtttt--attatttcgaagtctta
                     Pika  gccacagcttcag-agcgct--------------gtttggg-tt--------------------gtatta
                    Human  tccaaagcctcaa-gctatt------------cagttttcc-tttt-------attattttgaagactta
                    Chimp  tccaaagcctcaa-gctatt------------cagttttcc-tttt-------attattttgaagactta
                   Bonobo  tccaaagcctcaa-gctatt------------cagttttcc-tttt-------attattttgaagactta
                  Gorilla  tccaaagcctcaa-gctatt------------cagttttcg-tttt-------attattttgaagactta
                   Rhesus  tccaaagcctcaa-gctatt------------cagttttcg-tttt-------attattttgaagactta
                 Marmoset  tccaaagcctcaa-gctatt------------cagttttcg-tttt-------attattttgaagtctta
                  Tarsier  accagagcttcaa-actaca------------cagtttatg-tttt-------attattttgaagtcttg
                 Bushbaby  tccaaagcctcaa-actact------------caattttca-ttgc-------attattttgaagtctta
               Tree shrew  gccaaagtctcagaaatact------------aagttttcg-tttt-------cttattttgaagccttt
     Malayan flying lemur  tctgaagccttcg-aatact------------cagttttcg-tttt-------attattttgaagtcttt
                      Pig  tcta-agcctcaa-aagacc------------cggttttcg-tt----------ttattttgaaatctta
                  Dolphin  tccaaagcctcaa-aatacc------------cagttttca-tttt-------attattttgaaatctta
                      Cow  tccagagcctcaa-agtact------------cagttttcg-tttt-------attattttgaaatctta
                    Sheep  tccagagtctcaa-aatacc------------cagttttcg-tttt-------attattttgaaatctta
                    Horse  tctaaagcctcaa-aatacc------------cagttttcg-tttt-------attattttgaagtctta
         Chinese pangolin  tccaaagcctcaa-aatatc------------cagtttccg-tttt-------attattttgaattatta
                      Dog  tccaaagcctcaa-aatacc--------------gtttgca-tttt-------attattttgaagccgta
       Hawaiian monk seal  tccaaagcctcaa-aatacc------------caattttcgttttt-------attattgtgaagtcata
                 Hedgehog  tccaaagctttaa-aaaatctttttttttttttttttttttttttt-------accattttgaagtgttt
                    Shrew  tcccaagcctcca-aacacc------------cactttcccctttg-------atcatgttgaagtcttt
                 Elephant  gccaaagtctgaa-aatact------------cagctttta-tttt-------attactttgaagcctta
                   Tenrec  tccagaggtgcaa-gttgcc------------caatttctg-ttgt-------agtctttcgaaccctta
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  aaacttttt-t-tta---tgtcttctca-------aaaatcagtt----------------------tta
                      Rat  aa----ttt-t-ttaaagtgtcttctca-------aaaatcagtt------------------at-aata
            GCF_003668045  aaa---ctt-t-tta---tttcttgtc--------aaaatcagtt------------------ac-aata
                   Beaver  aaa---ctt-t-taa---tgttttgtc---------aaatcagct-----------------ttt-aaaa
                 Squirrel  caa---agt-t-taa---tgctttcttacaggtt-aaaatcagctgttaaacttattattaataa-atta
               Guinea pig  aaa---ctt-t-caa---catttccttg-------gaagtcagct----------------tcta-aaaa
                   Rabbit  aaa---ctc-c-tac---tgttttcctatctgtc-caagtcggct-----------------tttcaaaa
                     Pika  aca---ctc-cgcgg---ggttttctcatctgtc-cacatcaact-----------------tgt-aaaa
                    Human  aaa---ttt-t-taa---tgcttttttgtctgtc-aaaatcagct-----------------ttt-aaaa
                    Chimp  aaa---ttt-t-taa---tgtttttttgtctgtc-aaaatcagct-----------------ttt-aaaa
                   Bonobo  aaa---ttt-t-taa---tgtttttttgtctgtc-aaaatcagct-----------------ttt-aaaa
                  Gorilla  aaa---ttt-t-taa---tgttttcttgtctgtc-aagatcagct-----------------ttt-aaaa
                   Rhesus  aaa---ttt-t-taa---tgttttcttatctgtc-aaaatcagct-----------------ttt-aaca
                 Marmoset  aaa---ttt-t-taa---agttttcttatctgtc-aaaattagcc-----------------tttaaaaa
                  Tarsier  aaa---cgt-t-tga---tgtttacttgtctgtc-aaaatcagct-----------------ttt-gaaa
                 Bushbaby  aac---ttt-t-aga---tgttttcttatctgtc-aaaacgaact-----------------ttt-aaaa
               Tree shrew  aaa---acgtt-taa---tgttttctt---tgtc-aaaatcagat-----------------ttt-aaaa
     Malayan flying lemur  aaa---ctg-t-taa---tgttttcttatctgtc-aaaatcagct-----------------ttt-aaga
                      Pig  aaa---cat-t-taa---tgttttcttatctgta-aaaatcagct-----------------ttt-taag
                  Dolphin  aaa---ctt-t-taa---tgttttcttatctgtt-aaaataaact-----------------ttt-taag
                      Cow  aaa---ctt-t-gaa---tgttttcatatctgta-aaaatcagtt-----------------ttt-tccg
                    Sheep  aaa---ctt-t-caa---tgttttcatat--------aatcagtt-----------------ttt-tcca
                    Horse  aaa---ctt-t-taa---tgttttcttatctgtt-aaaatcagct-----------------ctt-tagt
         Chinese pangolin  aac---ctt-c-taa---agtt---ttatcggtt-caaatcagct-----------------ttt-tagg
                      Dog  aaa---ctc-c-ta----tgttttcttatctgtc-aaaattagcg-----------------ttt-taca
       Hawaiian monk seal  gaa---ctc-t-tag---tgttttcttatctgtc-aaaatcagcg-----------------ttt-t---
                 Hedgehog  a------------ag---tattttcttacctgtc-aaattcaact-----------------ttt-taag
                    Shrew  --------------g---cgttttcttccgtgtcaaaagtcaaca-----------------ttt-gaag
                 Elephant  aaa---ctt-t-tag---tgccttcttatctgtcaaaaaccagct-----------------ttt-taaa
                   Tenrec  caa---cat-t-gca---tgctttcttaactgcccacacccagct-----------------ttt-caaa
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tttatt-gg-aattta-ttattcttatcta-------------------------------------t--
                      Rat  tttgtt-gg-aattta-ttatttttatcta-------------------------------------t--
            GCF_003668045  tttatt-gg-aactta-ttatccttatcca-------------------------------------t--
                   Beaver  ttaaga-tg-aactta-ttattattattcg-------------------------------------t--
                 Squirrel  ttaata-at-aatgta-ttattcttattca-------------------------------------t--
               Guinea pig  ttaagt-ga-aacttg-ttattttcattca-------------------------------------c--
                   Rabbit  ttagat-ag-aacttg-ctcctctcactca-------------------------------------tct
                     Pika  ttaggtcag-aacgtg-ctattcttactct-------------------------------------ccc
                    Human  ttaagt-gg-aatttg-ttcctcttattca-------------------------------------ct-
                    Chimp  ttaagt-gg-aatttg-ttcctcttattca-------------------------------------ct-
                   Bonobo  ttaagt-gg-aatttg-ttcctcttattca-------------------------------------ct-
                  Gorilla  ttaagt-gg-aatttg-ttcctcttattca-------------------------------------ct-
                   Rhesus  ttaagt-gg-aacttg-ttcctctcattca-------------------------------------ct-
                 Marmoset  ttaagt-gg-aacgtg-tccctcttattca-------------------------------------ca-
                  Tarsier  ttaatt-ga-aacatg-ttactcttattca-------------------------------------gt-
                 Bushbaby  ttaagt-gg-aattcg-ttcctcttattca-------------------------------------gt-
               Tree shrew  ttaaat-gg-aagtgg-tcactcctatgca-------------------------------------ct-
     Malayan flying lemur  ttaagt-gg-aacatg-ttactctaatcca-------------------------------------ct-
                      Pig  tgaaat-gg-aactcg-taactttgggtca-------------------------------------ct-
                  Dolphin  cacaat-ag-aacttg-caacgtttattca-------------------------------------at-
                      Cow  ctcagt-ga-aacttg-taacttttattca-------------------------------------ct-
                    Sheep  ctcaat-gg-aacttg-tagctcttattca-------------------------------------ct-
                    Horse  ggaa-t-gg-aacttg-ttacttttattcg-------------------------------------ct-
         Chinese pangolin  tgaa-----------a-ttacttttattta-------------------------------------ct-
                      Dog  tgaaat-gt-aacttg-ttacttttattca-------------------------------------ct-
       Hawaiian monk seal  -----------acttg-ttacttttgttca-------------------------------------ct-
                 Hedgehog  tggaag-ggaaatttgatagtttttattaa-------------------------------------tg-
                    Shrew  taaaat-ag-aacttattaagtcttactaactttggtggtggtggtgtgagtgtgtgtgtgtatgtgtg-
                 Elephant  ttaaat-ga-aatttg-ctacttctattca-------------------------------------ct-
                   Tenrec  ctaaat-ga-aatttg-ctacttctgttcc-------------------------------------ct-
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ----t-g-------ag---------------gggtta--tcc-t-aatcatc-a-ctgtcgttaacaaat
                      Rat  ----t-g-------gg---------------cggata--tcc-t-aaccat-----tttcgctaataaat
            GCF_003668045  ----t-g-------gg----------------ggaca--tcc-c-aaccatc-a-ttttctctaacaaat
                   Beaver  ----t-g-------gg---------------ggaaaa--act-t-agttgtt-a-ttttctctcacaaac
                 Squirrel  ----g-g-------gggacagcccggtgtgtgtgtga--tcc-t-agtcact-a-ttttctctaacaaag
               Guinea pig  ----t-g-------gg---------------gggaaa--tcc-t----cacg-c-atttctctaa-ggag
                   Rabbit  t---g-g-------ga---------------tggaac--tcc-t-agtcgat-a-ttctgcgtcccagtt
                     Pika  tcagg-g-------aa---------------gaaaac--tcc-g-ggtggttcg-ttttgtgtgacaatt
                    Human  ----t-g-------aa---------------aaaaca--tct-t-agtcatt-a-ttttctgtaacaaat
                    Chimp  ----t-g-------aa---------------aaaaca--tct-t-agtcatt-a-ttttctgtaacaaat
                   Bonobo  ----t-g-------aa---------------aaaaca--tct-t-agtcatt-a-ttttctgtaacaaat
                  Gorilla  ----t-g-------aa---------------aaaaca--tct-t-agtcatt-a-ttttctgtaacaaat
                   Rhesus  ----t-g-------ca---------------aaaaaa--tcc-t-ggtcatt-a-ttttctgtaacaaat
                 Marmoset  ----t-g-------gc---------------aaaaaa--tcc-t-agtcgtt-g-ttttctgtaacaaat
                  Tarsier  ----tgg-------aa---------------aaaaaa--tcc-t-agtcatc-a-ttttttctaacaaat
                 Bushbaby  ----t-g-------ag---------------aaaaaac-tct-t-attcatt-a-ttttctctaacaaat
               Tree shrew  ----t-g-------ga---------------aaaaagagtct-t-agtcctt-a-ttttccctaataagt
     Malayan flying lemur  ----t-g-------ga---------------aaacc---cctgt-agccgtt-a-ttttctctaacaaat
                      Pig  ----t-g-------gg-------------aaaaaaaa--gcc-tcagtcgtt-a-ttttctctaacaaac
                  Dolphin  ----t-g-------gg-------------aaaaaaaa--tcc-t-agtcttt-a-ttttccctaacaaac
                      Cow  ----t-g-------ga-------------aaaaaaaa--tcc-t-agtcttt-a-ttttctctaacaaac
                    Sheep  ----c-g-------gg-------------agaaaaaa--tcc-t-agtcttt-a-ttttctctaacagac
                    Horse  ----t-g-------gg---------------aaaaaa--tcc-t-agtcgtt-a-ttttctctgacaaac
         Chinese pangolin  ----t-g-------gg---------------gaaaaa--tcc-t-aatcgtt-a-ttttctctaacgaac
                      Dog  ----t-g-------gg-------------aaaaaaaa--tcc-t-catcctt-a-ttttctctaacaaac
       Hawaiian monk seal  ----t-g-------gg---------------aaaaaa--tcc-t-aatcctt-g-ttttcttgaacaaac
                 Hedgehog  ----t-g-------gg---------------gggaaa--tcc-t-agttgtt-atttttccctaacaaac
                    Shrew  ----t-g-------tg---------------tggggt--gcc-t-agtctgt-a-ttttctctaacaaat
                 Elephant  ----t-gtaaaaaaaa---------------aaaaaa--atc-a-ag-ggtg-atttttctctaacaaag
                   Tenrec  ----t-gt------ga---------------aaaata--tcc-a-agtggtg-a-ttttctcaaacaaat
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tacattttg--------atttcctcttctctctcaaggtttgt-----------cagaat-tc-------
                      Rat  cgcattttg--------atttcctcgtctctctcaaggtttgt-----------cagaat-tc-------
            GCF_003668045  tacatttct--------atttcctagtccctctcaagtattgt-----------caggat-gc-------
                   Beaver  tctatttcc--------acttccgtttccgtccttagttttgttcaa------gtagaat-taaaatgag
                 Squirrel  cccatttcc--------acttcctcttccctccctgatttcgttcaatcagagtcagaat-gc-------
               Guinea pig  cccgtttcc--------acgtcctcttccctctcagtttttgttaaag------cagggt-ga-------
                   Rabbit  cttgg---c--------gcttcc-ctgcccaccctcgtttgtt-----------tgaagcttc-------
                     Pika  ttcaagtcc--------acttcc-ctgcccgcccttggttggt-----------gggagc-ac-------
                    Human  cccatttcc--------acttcctcttccctctcttattttgttgaaatagaatcagaat-ac-------
                    Chimp  cccatttcc--------acttcctcttccctctcttattttgttgaaatagaatcagaat-ac-------
                   Bonobo  cccatttcc--------acttcctcttccctctcttattttgttgaaatagaatcagaat-ac-------
                  Gorilla  tccatttcc--------acttcctcttccctctcttattttgttgaaatagaatcagaat-ac-------
                   Rhesus  cccatttcc--------acttcctcttccctctcttattttgttgaaatagaatcagaat-ac-------
                 Marmoset  cccatttcc--------acgtcctcttccttctctta-ttcgttgaagctgaatcagaat-ac-------
                  Tarsier  cctgtttcc--------atgtcctcttgtctcttgtattttgttgaagtagagttagaat-ac-------
                 Bushbaby  cccatttcc--------ccttccctttacctctctgattttgttgaagcagggtcagaat-at-------
               Tree shrew  cccatttcg--------actt---cttccctctctgatttggtcgaagcaggaccggaat-ac-------
     Malayan flying lemur  tccatttcc--------acttccacttccctctcttattttgttgaagcagagtcagaat-ac-------
                      Pig  cccatttcc--------acttcattttccttcccttattttgttaaaacagaatccga-t-ac-------
                  Dolphin  cccattttc--------agttcctcttccctcccttattttgttaaaacagaatccca-t-at-------
                      Cow  accatttcc--------acgttctcttccctcctttattttgttaaaacagaatcccg-t-at-------
                    Sheep  accatttcc--------actttctcttcgctcctttattttgttaaaacagaatgccg-t-ag-------
                    Horse  tccatttcc--------acgtcctcttccctcccttattttgttaaaat--agtcaga-t-ac-------
         Chinese pangolin  actatttcc--------acttactcttctttccattattttgttgaaacagagtcaga-t-ac-------
                      Dog  cccatttcc--------acttccttttctctccctgattttgctaaaacagaattaga-t-ac-------
       Hawaiian monk seal  accatttcc--------atttccttttctctcccttattttgctaaaacagagtcaga-t-ac-------
                 Hedgehog  cccattttcaccaacaaactccct-----tccctttattttgtt--------ttttaa-a-aa-------
                    Shrew  ctcatttct--------actttct-----ctcccttactctgttgaga---gtccaga-t-aa-------
                 Elephant  gctatttcc--------actccgtcttctctccctcattttattaaaacagaatcacaat-ac-------
                   Tenrec  accttctcc--------actc--tcttccctcctgc--ttcgttaagacagcatcacaa-----------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -a-----------------ttagtagcta---atttc-cttgcaaa--t-----gtcacc-aaaaaac--
                      Rat  -a-----------------ttagtagcta---atttc-ctggcaaa--t-----attacc--aaaaac--
            GCF_003668045  -a-----------------ttagtagctagctattcc-ctggcaaa--t-----aacacc--aaaaac--
                   Beaver  ga-----------------ttagtacgt----atcct-gtggcgaa--t-----atcaca--gaaaat--
                 Squirrel  -a------------------tatcagct----atccc-atgataaa--c-----accacacagaaaat--
               Guinea pig  ga-----------------atagcagcg----atccc-atggcaag--t-----atcata--gcaaat--
                   Rabbit  -a-------gactgtgtacatagtcgct----tcccc-gtggccaa--g-----accgca--ggcaac--
                     Pika  -a-------ga--------gaagtagct----ttccc-ggagccaa--t-----agcaca--gaactc--
                    Human  -a-------ta--------ttagtggct----ctcca-atggcaaa--t-----aacaca--gaaaat--
                    Chimp  -a-------ta--------ttagtggct----ctcca-atggcaaa--t-----a--aca--gaaaat--
                   Bonobo  -a-------ta--------ttagtggct----ctcca-atggcaaa--t-----a--aca--gaaaat--
                  Gorilla  -a-------ta--------ttagtggct----ctcca-atggcaaa--t-----aacaca--gaaaat--
                   Rhesus  -a-------ca--------ttggtggct----ctcca-ataacaaa--t-----aacaca--gaaaat--
                 Marmoset  -a-------tg--------tcagtggct----ctcca-atagcaaa--t-----agcaca--gaaaat--
                  Tarsier  -a-------ta--------tcagtaact----ctctt-gtagcaga--------aataca--gaaaaa--
                 Bushbaby  -g-------ta--------tccgtctct----tgcttcatggcata--g-----accaca--gaaaat--
               Tree shrew  -g-------ta--------ttagtagct----ctccc-a-ggcaac--t-----attacc--gagaatac
     Malayan flying lemur  -a-------ta--------ttagtagct----gtccc-atggcaca--t-----accaca--aaaaa---
                      Pig  -a-------ta--------ttagtagct----ctcct-atgacaaa--c-----atcaca--gaaaat--
                  Dolphin  -a-------ta--------ttagtagct----ctccc-atgacaaa--t-----atcaca--gaaaat--
                      Cow  -a-------ta--------ttagtagct----ctccc-atgacaaa--t-----atcaca--gaaaat--
                    Sheep  -a-------ta--------ttagtagct----ctccc-atgacaaa--t-----atcaca--gaaaat--
                    Horse  -g-------ta--------ttagtagct----ctccc-atgacaaa--c-----atccca--gaaaac--
         Chinese pangolin  -a-------ca--------ttagtaaca----gtctc-aaga-aaa--t-----gtcaca--gaaaat--
                      Dog  -c-------ta--------taagtagct----ctccc-gtgacaaattt-----ctccca--agaaat--
       Hawaiian monk seal  -a-------ta--------ttagtagct----ctccc-atgacaaa--t-----atccca--gaaaat--
                 Hedgehog  -gttttttttt--------tttgtagct----cttgc-ataacaaa--a-----atttca--gaa-----
                    Shrew  -g-------gt--------ttaatagct----ctccc-aggaaaaa--a-----gtcaca--gagagt--
                 Elephant  -a-------tt--------ttagtagcc----cttcc-atggcaaa--tttgccatcaca--gaaacc--
                   Tenrec  -----------------------tagct----cttgg-gtagcaag--tttgccttctca--gaaaca--
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ------agcaaggagagagtga---gccgcttttctaagtc-tggtt------------------ccact
                      Rat  ------agcaaggagagagcaa---gccgcttttctaagtc-tggtt------------------ccact
            GCF_003668045  ------agcaaggaaagag--a---gccgc-tttcttagtc-tggtt------------------ccact
                   Beaver  ---------------------a---gtcatttttctta--c-tgttt------------------ctgct
                 Squirrel  ------agcaagaggag----a---atcctcttccttagtc-tcttt------------------ctgtt
               Guinea pig  ------agcacataga-----a---gttcctttccttagtc-tgttt------------------ctatt
                   Rabbit  ------agcagccagggc---a---gccccttccctcgctc-tgttt------------------ccact
                     Pika  ------ggctgccaaggc---a---gccacc-------ccc-tgttt------------------ctgcc
                    Human  ------agcaaggaaagag--a---gcccttttccttagtc-tgttt------------------ctact
                    Chimp  ------agcaaggaaagag--a---gcccttttccttagtc-tgttt------------------ctact
                   Bonobo  ------agcaaggaaagag--a---gcccttttccttagtc-tgttt------------------ctact
                  Gorilla  ------agcaaggaaagag--a---gcccttttccttagtc-tgttt------------------ctact
                   Rhesus  ---agcagcaaagaaagag--a---gcccttttccttagtc-tgttt------------------ctact
                 Marmoset  ---ggcagcaaggaaagag--a---gccctttttcttagtc-tgctt------------------ctact
                  Tarsier  --------------aagag--a---gtcattttcattagtg-tgttt------------------ccact
                 Bushbaby  ---agcagtaaggaaagag--a---gttcttttccttagtc-gtctt------------------ctact
               Tree shrew  tgaagcagcaaggaaagag--c---gttcctttccctggtc-tatct------------------ctact
     Malayan flying lemur  -atagcaacaggaaaagag--a---atccttttccttagtc-tgttt------------------ctact
                      Pig  ---agcaacaagg----aa--a---atccctctccggaatc-ccttt------------------ctaca
                  Dolphin  ---agcagcaaggaaggag--g---gtccctttcctgaatc-tcctt------------------ctacc
                      Cow  ---agcagcaaggaaggag--g---gtccctttcctgaatc-tctat------------------tt---
                    Sheep  ---agca----------ag--g---aatcctttcctga-----ctat------------------tt---
                    Horse  ---agcagcaa----ggag--a---gtccctttcctgagtc-tgttt------------------ct---
         Chinese pangolin  ---agcaagga-----aag--a---ggccctttcctgaatt-ggtat------------------ctata
                      Dog  ---agcagcaaag--aaaa--agaggtccctttcctgagtt-tgttt------------------ctact
       Hawaiian monk seal  ---agcagcgaag--aaag--a---gtccctttcccgagta-tgttt------------------ctact
                 Hedgehog  ---aacagcatggagagtt--t---ctttctttcctgggtc-tgttt------------------ctact
                    Shrew  ---aactgcaaggaaagag--a---gccccctttctgagtc-ctactgaaactaatacaagtgagatact
                 Elephant  --taacatcaagc--aaag--a---gtccctttcctgagtc-ttttt------------------ctagt
                   Tenrec  --tggcagccagc----ag--a---gcccctttctttagtcgtttgc------------------ctagg
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gtaaagaataccc
                      Rat  gtaaagaataccc
            GCF_003668045  gtaaagaatgccc
                   Beaver  gtaaaaaatgcca
                 Squirrel  gcaaagaatgcca
               Guinea pig  gcataaactgcca
                   Rabbit  gtcaagaacgctg
                     Pika  gtccagagcgc--
                    Human  gtgaagaatgtca
                    Chimp  gtgaagaatgtca
                   Bonobo  gtgaagaatgtca
                  Gorilla  gtgaagaatgtca
                   Rhesus  gtaaagaatgtca
                 Marmoset  gtaaagaatgcca
                  Tarsier  gtaaagaatacca
                 Bushbaby  ggagagaaagcca
               Tree shrew  gcaaagaatgcca
     Malayan flying lemur  gtaaagaatttca
                      Pig  gtaaagaatgcca
                  Dolphin  gtaaagaatgcca
                      Cow  gcaaagcacgcga
                    Sheep  gtaaagcatgcga
                    Horse  ----agaatgtca
         Chinese pangolin  gtaaagaatgcca
                      Dog  gtaaacaatgcca
       Hawaiian monk seal  gtaaagaatgcca
                 Hedgehog  gcaaagaatatcc
                    Shrew  gaaactaatacaa
                 Elephant  gaaaagaatgcca
                   Tenrec  gacaaaaatgcca
                Zebrafish  =============
            X. tropicalis  =============
                  Opossum  =============
                  Chicken  =============

Inserts between block 2 and 3 in window
B D                  Dog 189bp

Alignment block 3 of 407 in window, 56747944 - 56748024, 81 bps 
B D                 Mouse  at-gaggtctctataagcaaactcgcc---attttctttcgc-----a-aagacctgc--ctgtaactct
B D                   Rat  gt-taggtatctataagcaaattcacc---attttctttcgc-----a-aagacctgc--ctataactct
            GCF_003668045  at-gaggtatc-gtaagcaaactcacc---attttcttt-gc-----a-aagacctgc--ctgtaacaat
                   Beaver  at-aggatatt-ctaagcaagtttgtc---attttcttttat-----a----acttgtaattgtaattcg
B D              Squirrel  at-gggatatt-ataaggaagtttatc---gttttcttttac-----aaaagggcccc--atttatttca
B D            Guinea pig  at-gagtcac--ataagtaagtttgcc---gttttcttttac-----a-a--aactgc---cataatttg
B D                Rabbit  at-gaggaggt-gtgagaaagtctgcc---atttttccttca--tgaa-agggcccat--ccaagctcgt
B D                  Pika  -------------tgagaaggtct-----------------------a-agggggca-------------
B D                 Human  at-gagaaatg-ataaggaagtttgtc---attttcttttac---taa-acgacccac--ccttaattcg
B D                 Chimp  at-gagaaatg-ataaggaagtttgtc---attttcttttac---taa-acgacccac--ccttaattcg
B D                Bonobo  at-gagaaatg-ataaggaagtttgtc---attttcttttac---taa-acgacccac--ccttaattcg
B D               Gorilla  at-gagaaatg-ataaggaagtttgtc---attttcttttac---taa-acgacccac--ccttaattcg
B D                Rhesus  at-gagaaatg-ataaggaagtttgtc---attttcttttgc---taa-agcacccac--ccttaattcg
B D              Marmoset  at-ggaaaatg-ataaggaagtttgtc---attttcttttac---tat-aggacccac--ccttaacttg
B D               Tarsier  at-aagaaatt-atatgaaagtctgtt---attttcttttac---taa-atggcccac--ccttaattct
B D              Bushbaby  gt-gagacatt-acaagaaagtttgtg---actttctttcac---aat-agggcctgc--ctttatatcg
B D            Tree shrew  gt-gagaaatt-ataaggaagtttgcc---attttcttttacaataaa-agggtgtac--c-------ca
B D  Malayan flying lemur  at-gaaaaatt-atgagaaagtttgtc---attttcttttac---aca-agggcctac--ctgtaactca
B D                   Pig  ga-gagaaatt-ataggaaagtttgtc---attatctgctac-aaaaa-aaagcaggt------------
B D               Dolphin  aa-gagaaatt-gtaagaaagtttgtc---actaccttccac---aga-agagcaggt------------
B D                   Cow  ac-aagaaatt-ataagaaagtttgtc---actaccttctgc---aaa-aaagcaggt------------
B D                 Sheep  aaggagaaatg-ataagaaagtgtgtcattaccaccttctgc---aaa-agagcaggt------------
B D                 Horse  at-gagaaatt-ataagaaagcttgtc---gttttcttcgac---aaa-agggcctgt------------
B D      Chinese pangolin  at-gagcaatt-ataagaaaggttgtc---attttcttttat---aaa-aagggccct------------
B D                   Dog  ag-gggaaatt-atatgaaagtttgca---attttcttttat---aag-aa-gccccc------------
B D    Hawaiian monk seal  ag-gagaaatt-atatgaaaacttgcc---attttcttttat---aaa-aa-gccctt------------
B D              Hedgehog  at-gagaaatt-gtaggaaggttgttc----ttttctttgac----aa-agggcctgc------------
B D                 Shrew  gt-gagaaatt-ttaagaaagcttttc---attttcttttac---aaa-agggcctgc---------ata
B D              Elephant  tt-gagaaatt-ataataatgtatatc---attttctttaac---aaa-agggttggc------------
B D                Tenrec  at-cagaaatt-ataagaacctatata---attttctttaac---aa----ggccagt------------
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  ca---------------------------------------------------gcac---cgtgatt--a
                      Rat  cagctc--------ac-------------------t-gagc---ggtggt-gtgcgc---catgatt--a
            GCF_003668045  ctgctc--------ac-------------------a-gaga---ggcggtggtgcgc---agtggtt--a
                   Beaver  caattc--------ac-----------------aga-gaga---ggcagt-acctac---aatggtt--a
                 Squirrel  ccattc--------at-------------------c-aaat----------atgtgc---aatggtt--a
               Guinea pig  caa--------------------------------a-gaaa---ggcagt-atgtgc---agtgatt--a
                   Rabbit  taactc--------gc-------------------a-gagt----------acaggc---agtggag--a
                     Pika  ---------------------------------------------------acaggc---agtg--g--a
                    Human  taattt--------gc-------------------a-aagaaaaggcagaatagtac---aatggtt--a
                    Chimp  taattt--------gc-------------------a-aagaaaaggcagaatagtac---aatggtt--a
                   Bonobo  taattt--------gc-------------------a-aagaaaagacagaatagtac---aatggtt--a
                  Gorilla  taattt--------gc-------------------a-aagaaaaggcagaatagtac---aatggtt--a
                   Rhesus  taattt--------gc-------------------a-aagaaaaggcagaatagtac---aatggtt--a
                 Marmoset  caattt--------acaaaaaaaaaaaaaaaaaaaa-aaaaaaaggcagaatagtac---aatggtt--a
                  Tarsier  taattc--------gc-------------------a-aagaaaaaatagtgtagtac---aatggtt--a
                 Bushbaby  taattt--------gc-------------------a-aagaaaaggcagtatagcac---aatggtt--a
               Tree shrew  taattt--------ac-------------------a-aagaaga-gcagtata-tac---aatggtt--a
     Malayan flying lemur  taattc--------at-------------------a-aagaagaggcagtataggat---aatggtt--a
                      Pig  -aattc--------at-------------------a-aagaagagac----gtgta--------------
                  Dolphin  -aattc--------at-------------------a-aagaagaggcatt-atgtac---aat-------
                      Cow  -a------------gt-------------------a-cagaagaggcttt-atgttc---agt-------
                    Sheep  -a------------gt-------------------a-cagaagaggcttt-atgttc---aat-------
                    Horse  -aattg--------gt-------------------a-aggaacaggcagt-atgtac---aatggtt--a
         Chinese pangolin  -aattt--------gt-------------------a-aagaagaagcatt-atgtacaataatagtt--a
                      Dog  -cattc--------at-------------------a-aagaagaggcagt-atgtac---aatgattaca
       Hawaiian monk seal  -cattc--------at-------------------a-aagaagaggcagt-ata-gc---attggtt--a
                 Hedgehog  -tgttt--------gt-------------------a-aggaagaggtgat-atgttt---agtggtta--
                    Shrew  taattt--------at-------------------atatatacatatata-agattc---aatggtta--
                 Elephant  -aattctcagggaagt-------------------a-gccg-------------tac---catggtt--a
                   Tenrec  -agttct-------gt-------------------a-attgattacaatt-gattac---tgtcatc--t
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gaagctcct
                      Rat  aaagctcgg
            GCF_003668045  gacgcctgg
                   Beaver  ggagctcca
                 Squirrel  gaagctctg
               Guinea pig  ggagttttg
                   Rabbit  ggaccacgg
                     Pika  ggaccgtgg
                    Human  ggagctccg
                    Chimp  ggagctccg
                   Bonobo  ggagctccg
                  Gorilla  ggagctccg
                   Rhesus  ggagctcca
                 Marmoset  ggagctctg
                  Tarsier  ggaggtacg
                 Bushbaby  ggagtt-tg
               Tree shrew  -gaactttg
     Malayan flying lemur  ggagctcca
                      Pig  ---------
                  Dolphin  ---------
                      Cow  ---------
                    Sheep  ---------
                    Horse  ggagctttc
         Chinese pangolin  ggagcccct
                      Dog  ggagctccg
       Hawaiian monk seal  ggaactccg
                 Hedgehog  ---------
                    Shrew  ---------
                 Elephant  tgagctctg
                   Tenrec  agagttcct
                Zebrafish  =========
            X. tropicalis  =========
                  Opossum  =========
                  Chicken  =========

Inserts between block 3 and 4 in window
B D             Elephant 2bp
B D               Tenrec 177bp

Alignment block 4 of 407 in window, 56748025 - 56748065, 41 bps 
B D                 Mouse  t-ac------gcaccacag-cttcttaagcaagttg-ttt-acccagt----tag
B D                   Rat  taac------ccaccacag-cttcttaagcaagcgg-ttt-acccatt----tag
            GCF_003668045  c-gct-t-tggtactgctg-cttctgaagcaagctg-tta-gctcatt----tag
                   Beaver  a-tc------ttttggctg-ctt-----------ta-tt-------tt----tag
B D              Squirrel  a-tc----tagcaccacca-cttcttaagcaagtta-tttaatttttt----tag
B D            Guinea pig  a-cct-tctggtaccactg-cttcttaagc----ta-ttt-aattctt----tag
B D                Rabbit  t--g----aggcacctccg-cttcttctgcaagttc-gtt-----att----tag
B D                  Pika  g-ag----aggtgccccag-cttcggaagcaaggtc-gtt-----att-------
B D                 Human  a-tc--tctggctgtacga-cttctt-aggaaaata-ttt-aattttt-------
B D                 Chimp  a-tc--tctggctgtacga-cttctt-aggaaaata-ttt-aattttt-------
B D                Bonobo  a-tc--tctggctgtacga-cttctt-aggaaaata-ttt-aattttt-------
B D               Gorilla  a-tc--tctggctgtacga-cttctt-aggaaatta-ttt-aatgttt-------
B D                Rhesus  a-tc--tctggctgtacga-ctcctt-cggaaaata-ttt-aattttt----tag
B D              Marmoset  a-tc--tctggctgtatga-cttctt-agtaaaata-ttt-aattttt----tag
B D               Tarsier  a-tc--tcgggcactatca-cttcttcagcaagtta-ttt-aaagttt----tag
B D              Bushbaby  g-gc--tctggcactaccagcttcttaagcaagtta-att-aatttctttttttg
B D            Tree shrew  a-tct-tctgaaactacca-ttttctaagcaaattatttc-atttttt----aag
B D  Malayan flying lemur  a-tct-tctggcaacactg-cttcttaagca------ttt-aattttg----tag
B D                   Pig  --------------cattg-ccacggaagcaagtta-ttt-aaccttt----tag
B D               Dolphin  ---------ggcaccattg-ccacttactcaagtta-tt--aaccttt----tag
B D                   Cow  ---------ggcaccactg-ccacttaagcaagtta-ttg-aaccttt----tag
B D                 Sheep  ---------ggcaccactg-ccacctaagcaagtta-ttt-aaccttt----tag
B D                 Horse  a-tct-tcaggcaccacca-ccgcttaggcaagtta-ttt-aaccttt----tag
B D      Chinese pangolin  a-tct-tctggtaccacca-ccatttaagcaagtta-ttt-aacttcc----tag
B D                   Dog  a-tct-tctggcacca--g-tcactaaagcaagtta-ttt-aaccttt----tag
B D    Hawaiian monk seal  a-tct-tctggtaccattg-tcactaaagcaagtta-ttt-aaccttt----tag
B D              Hedgehog  ---------aacaatattg-tcaccatagcatgttg-ttt-ggcttct----tag
B D                 Shrew  ---------ggcaccccta-ccac---------tta-ttt-accct-t----tag
B D              Elephant  ----cacctggcgccataggctttttaagcaagtta-ttt-aaccttt----taa
B D                Tenrec  =======================================================
B D             Zebrafish  =======================================================
B D         X. tropicalis  =======================================================
B D               Opossum  =======================================================
B D               Chicken  =======================================================

Alignment block 5 of 407 in window, 56748066 - 56748148, 83 bps 
B D                 Mouse  -------------------------------------------------agcctcttcattttcttagac
B D                   Rat  -------------------------------------------------agcctcttcattttcttagac
            GCF_003668045  -------------------------------------------------agcc-----------------
                   Beaver  -------------------------------------------------agctcc--------------a
B D              Squirrel  -------------------------------------------------agccctc-------------a
B D            Guinea pig  -------------------------------------------------agccttc-------------a
B D                Rabbit  -------------------------------------------------agcctcc-------------g
B D                  Pika  ----------------------------------------------------------------------
B D                 Human  -------------------------------------------------agtctct-------------a
B D                 Chimp  -------------------------------------------------agtctct-------------a
B D                Bonobo  -------------------------------------------------agtctct-------------a
B D               Gorilla  -------------------------------------------------agtctct-------------a
B D                Rhesus  -------------------------------------------------agtctct-------------a
B D              Marmoset  -------------------------------------------------agtttct-------------a
B D               Tarsier  -------------------------------------------------aacttca-------------a
B D              Bushbaby  -------------------------------------------------agtttac-------------a
B D            Tree shrew  -------------------------------------------------aaccctt-------------a
B D  Malayan flying lemur  -------------------------------------------------agcctcc-------------a
B D                   Pig  -------------------------------------------------agtctct-------------g
B D               Dolphin  -------------------------------------------------agactcc-------------a
B D                   Cow  -------------------------------------------------agtctct-------------g
B D                 Sheep  -------------------------------------------------agtctct-------------g
B D                 Horse  -------------------------------------------------agccttc-------------a
B D      Chinese pangolin  -------------------------------------------------agcctcc-------------a
B D                   Dog  -------------------------------------------------cacctcc-------------a
B D    Hawaiian monk seal  -------------------------------------------------cacctcc-------------a
B D              Hedgehog  -------------------------------------------------aacctct-------------g
B D                 Shrew  -------------------------------------------------gctctct-------------a
B D              Elephant  -------------------------------------------------agcctca-------------a
B D                Tenrec  ggcctcctctcttttggctccactttaaacaatttgtttaaacttgcaacacctca-------------g
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  -tttcttca-tt-ttcaaaataa-ggaactaatagtcccaaagtcaa-----------------------
                      Rat  -tttcttca-tt-ttcaaaataa-ggaactagtaattccaaagtc-a-----------------------
            GCF_003668045  ------tca-gt-ttcgagataa-gaaaataatagtcccaaagtc-------------------------
                   Beaver  -tttcttca-tc-ttcaaaataa-ggatacaatag-cccaacctcaaaaggtgttaca---aaagattca
                 Squirrel  -tttcttta-tc-tttaaaagga-agaaataatagtcccaacgtcaaaagatattatg---agacttcaa
               Guinea pig  -tttcttca-tc-cttaaaaatc-ggaaataatagtcctaacctcaaaaggtgttatg---gggatacag
                   Rabbit  -tggcttcc-tg-tttaaaagta-ggaaatcatagtgccaggctccaacgaggtcctg---gggactcag
                     Pika  ---gcttca-cg-attaaaa---------------tgctaagttgtagagatgtcccc---aggactcac
                    Human  -tttcttca-tc-tttaaaacag-ggaaatgatattcccaaccc--agagatgttatg---agtattcaa
                    Chimp  -tttcttca-tc-tttaaaacag-ggaaatgatattcccaaccc--agagatgttatg---agtattcaa
                   Bonobo  -tttcttca-tc-tttaaaacag-ggaaatgatattcccaaccc--agagatgttatg---agtattcaa
                  Gorilla  -tttcttca-tc-tttaaaacag-agaaatgatattcacaaccc--agagatgttatg---agtattcaa
                   Rhesus  -tttcttca-tc-tttaaaacag-ggaaatcatactcccaaccc--agaggtgttatg---agtattcaa
                 Marmoset  -tttcttca-tc-tttaaaacag-ggagatgatactcccaaccccaagagatgttatg---ggtattcaa
                  Tarsier  -atgcttca-tctttttaaatgg-ggaaatgatagtctcaacctcaagagatgttatg---agtattcaa
                 Bushbaby  tttttttca-cc-ttaaaaacag-ggaaatgctagttctaacct-----------------------caa
               Tree shrew  -tttttttgatg-tttaaaatga-aggaataatggtcccactctcaagagagattatg---aggatttaa
     Malayan flying lemur  -tttcttcg-tc-tttgaaatgagaaaaataatagtcccaacctccagagatgttaag---agtattcaa
                      Pig  -ttttttcg-tc-tatgaaac---agaaataataggcccaacttcaagagatgtt------gagtttcaa
                  Dolphin  -ttttttca-tc-tataaaac---ggaaataatagggtcaacctcaagagatgtg------aaatttcaa
                      Cow  -ttttttca-ct-tatgaagcac-ggaaataataggcccaacctcaagcagtgtg-------aatttcaa
                    Sheep  -ttttttca-tc-tataaaacag-ggaaataataggcccaacctcaagcagtgtg------aaatttcaa
                    Horse  -tttcttca-tc-tgtaaaacgg-aga---aatagtcccaacctcaagagatgttgac---aagagtcaa
         Chinese pangolin  -tttcttca-tc-tgtaaaacag-caaaataataatcctaacctcaagagatgttggttgaaagattcag
                      Dog  -tttcttca-tc-tgtaaacccg-ggacacaatagtcctaacctcaggagatgttgtg---aagattcaa
       Hawaiian monk seal  -tttcttca-tc-tttaaaaggg-ggaaataatagtcccaacctcaggagatgttgtg---aagattcag
                 Hedgehog  -ttttttca-tt-tgtaaaactg-agaa----tagatccagtctcagaagatgttgtg---aaaattcag
                    Shrew  -ttttt----tt-catcaaacaa-ggac-------------tctcaagaga---tagg---aagattcaa
                 Elephant  -tttcttca-tc-tataaaaaag-ggaaataagagtttcatcctcaagagatgtcatg---aggattcaa
                   Tenrec  -tttgttca-tc-tgtaaaaagg-ggaagggatatttccaacctcaggagctgtcagg--------ccca
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  --gagtca-------gtacaactatatg
                      Rat  --gagtca-------gtacaatgttaag
            GCF_003668045  -------a-------gtacatcgatagg
                   Beaver  gtgagacg-------atgtaaccatatg
                 Squirrel  t-gagatg-------atgcaaccatatg
               Guinea pig  t-gagata-------atgcagtcatatg
                   Rabbit  g-aagc-a-------gtgcaaccatatg
                     Pika  c-gagtgg-------gtgccaccttatg
                    Human  t-gagata-------atgcaaccatatg
                    Chimp  t-gagata-------atgcaaccatatg
                   Bonobo  t-gagata-------atgcaaccatatg
                  Gorilla  t-gagata-------atgcaaccatatg
                   Rhesus  t-gagata-------atgcaaccatatg
                 Marmoset  t-gagata-------atgcaaccatatg
                  Tarsier  t-gagata-------gtgcaacctcata
                 Bushbaby  --gagata-------atgtaaccatatg
               Tree shrew  t-gaaata-------atgcaaccatatg
     Malayan flying lemur  t-aagata-------atgcaaccatatg
                      Pig  t-gaggta-------atgcaaccatgtg
                  Dolphin  t-gagata-------atgcaaccatagg
                      Cow  t-gtgata-------atacaaccatggg
                    Sheep  t-gtgata-------atacaaccagggg
                    Horse  t-gagata-------atgcaaccatatg
         Chinese pangolin  t-gagtta-------gtgcaaccatatg
                      Dog  t-gagata-------atgcagccctatg
       Hawaiian monk seal  t-gagata-------atgcagccgtatg
                 Hedgehog  c-aagaca-------atgcaactgtagg
                    Shrew  t-gagata-------atgcaaacatggg
                 Elephant  t-gagata-------gtgcgaccatatg
                   Tenrec  t-aagatatgtacacatgcaaccatatg
                Zebrafish  ============================
            X. tropicalis  ============================
                  Opossum  ============================
                  Chicken  ============================

Inserts between block 5 and 6 in window
B D                Shrew 4bp
B D             Elephant 212bp

Alignment block 6 of 407 in window, 56748149 - 56748168, 20 bps 
B D                 Mouse  gctggaaagaaacattcatt
B D                   Rat  gctcttaggaaacattcatt
            GCF_003668045  gcccttaggaaacattcatt
                   Beaver  gcacatagtaagcattcatt
B D              Squirrel  gcacatagtaagcactcagt
B D            Guinea pig  agccatagtaaatgttcatt
B D                Rabbit  gcacgccataagccctcttc
B D                  Pika  gcactcaggaatccctcatt
B D                 Human  gcacatagtaagcatttatt
B D                 Chimp  gcacatagtaagcatttatt
B D                Bonobo  gcacatagtaagcatttatt
B D               Gorilla  gcacatagtaagcatttatt
B D                Rhesus  gcacatagtaagcatttatt
B D              Marmoset  gcacatagtaaacagttatt
B D               Tarsier  gcacataataagcattcatt
B D              Bushbaby  gcatatagtaagcattcatt
B D            Tree shrew  gcacatagtaagcattcatt
B D  Malayan flying lemur  gcatagagtaagcattcagt
B D                   Pig  gcacacagtaagctttcatt
B D               Dolphin  gcacatagtaggcattcatt
B D                   Cow  gcacatagtaagtcttcatt
B D                 Sheep  gcaca---taagtcttcatt
B D                 Horse  gcacacactgaacattcatt
B D      Chinese pangolin  gcacatagtaagcattcatt
B D                   Dog  gctcatagtaagcacgcatt
B D    Hawaiian monk seal  gcacatagtaagcttccatt
B D              Hedgehog  ggacattataag----catt
B D                 Shrew  tgaca-cataag----catt
B D                Tenrec  gcacacagcaaatattcagt
B D             Zebrafish  ====================
B D         X. tropicalis  ====================
B D               Opossum  ====================
B D               Chicken  ====================
B D              Elephant  ====================

Inserts between block 6 and 7 in window
B D               Rabbit 55bp
B D                 Pika 108bp

Alignment block 7 of 407 in window, 56748169 - 56748202, 34 bps 
B D                 Mouse  aagtaa-----------------------cctc--------cctggttaaaaatggcagcaagag
B D                   Rat  aagtat-----------------------cccc--------tgtggttaaaaatggcagtgagag
            GCF_003668045  aaatat-----------------------cccc--------tgtggttccaaatggcagttagag
                   Beaver  aactgt-----------------------tacc--------tgtggttataagtggcagttagag
B D              Squirrel  aaagat-----------------------tacc--------tat-gttctaaatggtacagattg
B D            Guinea pig  aaatgt-----------------------tacc--------tgtggttataaatggtagagactg
B D                Rabbit  attttt-----------------------cacccccctttttgaagttataaatggtgtttagag
B D                 Human  aagtat-----------------------tgtc--------tgtggttctaagtggcagttaaaa
B D                 Chimp  aagtat-----------------------tgcc--------tgtggttctaagtggcagtttaaa
B D                Bonobo  aagtat-----------------------tccc--------tgtggttctaagtggcagtttaaa
B D               Gorilla  cagtat-----------------------tgcc--------tgtggttctaagtggcagttaaaa
B D                Rhesus  aagtat-----------------------tacc--------tgtggttctaagtggcagttaaag
B D              Marmoset  aagtatttattaagcatttattaagtatatacc--------tgtggttctaagtggcagttaaag
B D               Tarsier  aaatat-----------------------tacc--------ta------taagtggcagttagag
B D              Bushbaby  aaatat-----------------------tacc--------tgtggttaaaactgacagataaca
B D            Tree shrew  aaatat-----------------------tacc--------tgtggttataaatggcggttacag
B D  Malayan flying lemur  aaatat-----------------------tagt--------catatttataaatggctattagag
B D                   Pig  aaatat-----------------------tacc--------tgtggatacaaatgagggttagcg
B D               Dolphin  aaatat-----------------------tacc----------ctgatagaaatggcgttagag-
B D                   Cow  aaatat-----------------------tgcc--------tatggatagaaatggcacttagag
B D                 Sheep  aaatat-----------------------tgcc--------tatggatagaataggcattaaata
B D                 Horse  aaatat-----------------------tacc--------tgtgcttacaaatgtcggtcagag
B D      Chinese pangolin  gaattt-----------------------tacc--------tgtggttataaatggcagttagag
B D                   Dog  aaatag-----------------------tacc--------tgtggttataaatggcggttggaa
B D    Hawaiian monk seal  taatag-----------------------tacc--------tgtggttataaatggcggttggag
B D              Hedgehog  atctac-----------------------tacc--------tatactgatcaatgttgcttagag
B D                 Shrew  aaatat-----------------------tacc--------tgtggttataaatggcagttagag
B D                Tenrec  aaatat-----------------------tacc--------tctggttctgagtggtgattaaag
B D                  Pika  =================================================================
B D             Zebrafish  =================================================================
B D         X. tropicalis  =================================================================
B D               Opossum  =================================================================
B D               Chicken  =================================================================
B D              Elephant  =================================================================

Inserts between block 7 and 8 in window
B D                Sheep 68bp

Alignment block 8 of 407 in window, 56748203 - 56748220, 18 bps 
B D                 Mouse  acaggctttt--------taaaaaaa
B D                   Rat  a----ctttt--------t-------
            GCF_003668045  attgactttt--------a-------
                   Beaver  a----tattt--------t-------
B D              Squirrel  a----ctttt--------a-------
B D            Guinea pig  a-----tttt--------a-------
B D                Rabbit  attaactttt--------a-------
B D                 Human  agacacgtgt--------a-------
B D                 Chimp  agacacgtgt--------a-------
B D                Bonobo  agacacgtgt--------a-------
B D               Gorilla  agacacgtgt--------a-------
B D                Rhesus  agagacgtgt--------a-------
B D              Marmoset  agagacttgt--------a-------
B D               Tarsier  gatgactttt--------a-------
B D              Bushbaby  ----accttt--------a-------
B D            Tree shrew  attgccttgt--------a-------
B D  Malayan flying lemur  attgactt-t--------g-------
B D                   Pig  attgacttct----------------
B D               Dolphin  attgactca-----------------
B D                   Cow  attgactta-----------------
B D                 Horse  attgactttt----------------
B D      Chinese pangolin  attgactttt----------------
B D                   Dog  atcgactttt----------------
B D    Hawaiian monk seal  attgactttt----------------
B D              Hedgehog  accgactttt----------------
B D                 Shrew  attgatttctcaagaaca--------
B D                Tenrec  -ataacattt----------------
B D                 Sheep  ==========================
B D                  Pika  ==========================
B D             Zebrafish  ==========================
B D         X. tropicalis  ==========================
B D               Opossum  ==========================
B D               Chicken  ==========================
B D              Elephant  ==========================

Inserts between block 8 and 9 in window
B D             Hedgehog 7bp
B D                Shrew 227bp

Alignment block 9 of 407 in window, 56748221 - 56748234, 14 bps 
B D                 Mouse  caaaaaacaaaaaa
B D                   Pig  ---------aaaaa
B D               Dolphin  ---------aaaaa
B D                 Horse  ---------aaaaa
B D      Chinese pangolin  ---------aaaaa
B D                   Dog  ---------aaaaa
B D    Hawaiian monk seal  ---------aaaaa
B D            Guinea pig  --------------
B D                 Sheep  ==============
B D                Rhesus  --------------
B D              Marmoset  --------------
B D               Gorilla  --------------
B D                Bonobo  --------------
B D                 Chimp  --------------
B D                 Human  --------------
B D                Tenrec  --------------
B D               Tarsier  --------------
B D            Tree shrew  --------------
B D              Hedgehog  ==============
B D                  Pika  ==============
B D             Zebrafish  ==============
B D         X. tropicalis  ==============
B D                   Cow  --------------
B D               Opossum  ==============
B D               Chicken  ==============
B D                 Shrew  ==============
B D              Elephant  ==============
B D              Squirrel  --------------
B D                Rabbit  --------------
B D              Bushbaby  --------------
                  Beaver  --------------
B D  Malayan flying lemur  --------------
           GCF_003668045  --------------
B D                   Rat  --------------

Inserts between block 9 and 10 in window
B D                  Pig 6bp
B D              Dolphin 19bp
B D                Horse 9bp
B D     Chinese pangolin 19bp
B D                  Dog 19bp
B D   Hawaiian monk seal 19bp

Alignment block 10 of 407 in window, 56748235 - 56748261, 27 bps 
B D                 Mouse  aacccaaacaaacaacaaaaacaaaac
B D                   Cow  -----------------------aaat
B D                Tenrec  -------------------------a-
B D            Guinea pig  ---------------------------
B D                 Sheep  ===========================
B D                Rhesus  ---------------------------
B D    Hawaiian monk seal  ===========================
B D                   Dog  ===========================
B D                 Horse  ===========================
B D              Marmoset  ---------------------------
B D               Gorilla  ---------------------------
B D                Bonobo  ---------------------------
B D                 Chimp  ---------------------------
B D                 Human  ---------------------------
B D               Tarsier  ---------------------------
B D            Tree shrew  ---------------------------
B D              Hedgehog  ===========================
B D                  Pika  ===========================
B D             Zebrafish  ===========================
B D         X. tropicalis  ===========================
B D               Opossum  ===========================
B D               Chicken  ===========================
B D                 Shrew  ===========================
B D              Elephant  ===========================
B D              Squirrel  ---------------------------
B D                   Pig  ===========================
B D                Rabbit  ---------------------------
B D      Chinese pangolin  ===========================
B D               Dolphin  ===========================
B D              Bushbaby  ---------------------------
                  Beaver  ---------------------------
B D  Malayan flying lemur  ---------------------------
           GCF_003668045  ---------------------------
B D                   Rat  ---------------------------

Inserts between block 10 and 11 in window
B D                  Cow 9bp

Alignment block 11 of 407 in window, 56748262 - 56748266, 5 bps 
B D                 Mouse  aaaac
B D                   Rat  ---ac
            GCF_003668045  aaaac
                   Beaver  aaagt
B D              Squirrel  aaaat
B D            Guinea pig  agaat
B D                Rabbit  aaagc
B D                 Human  aaagt
B D                 Chimp  aaagt
B D                Bonobo  aaagt
B D               Gorilla  aaagt
B D                Rhesus  aaagc
B D              Marmoset  aaagc
B D               Tarsier  aaaac
B D              Bushbaby  aaaac
B D            Tree shrew  aaaac
B D  Malayan flying lemur  aaacc
B D                 Sheep  aaaac
B D              Elephant  ataac
B D                Tenrec  aaaac
B D    Hawaiian monk seal  =====
B D                   Dog  =====
B D                 Horse  =====
B D              Hedgehog  =====
B D                  Pika  =====
B D             Zebrafish  =====
B D         X. tropicalis  =====
B D                   Cow  =====
B D               Opossum  =====
B D               Chicken  =====
B D                 Shrew  =====
B D                   Pig  =====
B D      Chinese pangolin  =====
B D               Dolphin  =====

Alignment block 12 of 407 in window, 56748267 - 56748275, 9 bps 
B D                 Mouse  aagtgatat
B D                   Rat  aagtgatac
            GCF_003668045  aagtgacat
                   Beaver  aagcaatat
B D              Squirrel  cagccatat
B D            Guinea pig  cagcagcat
B D                  Pika  aaatgatgt
B D                 Human  aagtaatat
B D                 Chimp  aagtaatat
B D                Bonobo  aagtaatat
B D               Gorilla  aagtaatat
B D                Rhesus  aagtaatat
B D              Marmoset  aagtaatat
B D               Tarsier  aagcaatat
B D              Bushbaby  aagctatat
B D            Tree shrew  aagcaatat
B D  Malayan flying lemur  aggcaatat
B D                   Cow  --------t
B D                 Sheep  aagcagttt
B D                 Horse  --------t
B D      Chinese pangolin  --tgtgtgt
B D    Hawaiian monk seal  --------t
B D              Hedgehog  aagcttttt
B D              Elephant  aagcaattt
B D                Tenrec  aagtggtta
B D                   Dog  =========
B D             Zebrafish  =========
B D         X. tropicalis  =========
B D               Opossum  =========
B D               Chicken  =========
B D                 Shrew  =========
B D                   Pig  =========
B D                Rabbit  ---------
B D               Dolphin  =========

Inserts between block 12 and 13 in window
B D                  Cow 9bp
B D                Sheep 9bp
B D                Horse 3bp
B D     Chinese pangolin 3bp
B D   Hawaiian monk seal 3bp
B D             Hedgehog 21bp

Alignment block 13 of 407 in window, 56748276 - 56748308, 33 bps 
B D                 Mouse  tc------------------ataatatacattgtttagaa---aatccgtagta
B D                   Rat  ac------------------ataatattcatggtttagaa---aatctatagta
            GCF_003668045  tc------------------ataataggcattgtttagaa---aatctatagta
                   Beaver  tta---------------tgataatatgctttgtttagag---agcccatagta
B D              Squirrel  tta---------------aaataatacacgttgtttagag---agcccatagca
B D            Guinea pig  tta---------------aaagaatgtactttgtttagag---aggccatagta
B D                Rabbit  -------------------------aagcactgtttatcg--------------
B D                  Pika  ttagagattgact--tttaaaaagcaatcactgtttatcagacgtctcatagta
B D                 Human  tta---------------tcagagtatactttgttctgag---agaccatagtc
B D                 Chimp  tta---------------tcagagtatactttgttctgag---agaccatagtc
B D                Bonobo  tta---------------tcagagtatactttgttctgag---agaccatagtc
B D               Gorilla  tta---------------tcagagtatacttcgttctgag---agaccatagtc
B D                Rhesus  tta---------------tcagagtatactttgttctgag---agaccatagtc
B D              Marmoset  tta---------------tcagagtatatcttgttcagag---agcccatagtc
B D               Tarsier  tta---------------ggagaatatactttgttccaag---agcccatagta
B D              Bushbaby  tta---------------tcagaatatactttgttcagag---aggccgtactc
B D            Tree shrew  ata---------------ccagaatatagtttgtc-agaa---agtccatggtc
B D  Malayan flying lemur  tta---------------tcagaatatactttgttgggag---agcccatagtt
B D                   Pig  ---------------------------actttgttcagag---agcccatagtc
B D               Dolphin  ------------------tcagaatatactttggtcagcc---agctcatagtc
B D                   Cow  ------------------tcacaatttactttgatcaggg---aatacatagtc
B D                 Sheep  ------------------tcacaatatactttgatcaggg---agttcat----
B D                 Horse  ------------------taagagaatactttgttcagag---agctcattgtc
B D      Chinese pangolin  ------------------tgaggatatactttatttaggg---agctcatagtc
B D                   Dog  ------------------tgagaatatactttgttcagag---agctcatagtc
B D    Hawaiian monk seal  ------------------tgagaatagactttattcagag---agctcatagcc
B D              Hedgehog  ------------------tgagtgtatgctttgctctgag---aactc--tgtc
B D              Elephant  -------ttatcc--------gagtattctttgcccagag---agcttatagtc
B D                Tenrec  -------cctcccccactccataatattccttgcttagag---agcttatagtc
B D             Zebrafish  ======================================================
B D         X. tropicalis  ======================================================
B D               Opossum  ======================================================
B D               Chicken  ======================================================
B D                 Shrew  ======================================================

Inserts between block 13 and 14 in window
B D                  Pig 10bp
B D              Dolphin 10bp
B D                  Cow 10bp
B D                Sheep 10bp
B D                Horse 10bp
B D     Chinese pangolin 10bp
B D                  Dog 10bp
B D   Hawaiian monk seal 10bp
B D             Hedgehog 10bp

Alignment block 14 of 407 in window, 56748309 - 56748448, 140 bps 
B D                 Mouse  agaa--------------a---------------------cactt-gtg----acagacaa--taaaa--
B D                   Rat  agaa--------------a---catcctacca------agcatct-atg----acaaacaa--tggaa--
            GCF_003668045  agaa--------------a---cattcctcca------agcattt-gtg----acaaacaa--tagga--
                   Beaver  aaaa--------------a----aagtggcga------ggcatttcgtt----acaaacaa--tagaa--
B D              Squirrel  aaag--------------aaaaaaaaagtcaa------agcattttgct----acaaacac--taaaaag
B D            Guinea pig  aaaa--------------t-----aaagtcaa------gccattttggt----acaagcaa--tagaa--
B D                Rabbit  -----------------------------gaa------tatactttgtt-----cagacagcctagag--
B D                  Pika  aaaa--------------aaaaaaggtgtgaa------ggcatgttgttacccacaga-----tagag--
B D                 Human  aaaa--------------a------gcttcaa------gagattttgtt----acaaacaa--tagaaag
B D                 Chimp  aaaa--------------a------gcttcaa------gggattttgtt----acaaacaa--tagaaag
B D                Bonobo  aaaa--------------a------gcttcaa------gggattttgtt----acaaacaa--tagaaag
B D               Gorilla  aaaa--------------a------gcttcaa------gggattttgtt----acaaacaa--tagaaag
B D                Rhesus  aaaa----------------------cttcaa------gggattttgtt----acaaac-a--tagaaag
B D              Marmoset  aaaa--------------a------gcttcaa------gggattttgtt----acgaacaa--tagaaag
B D               Tarsier  aaaaacaaaacaaaacaaa------acttcaa------ggcattttgtt----acaaacaa--tagaaag
B D              Bushbaby  aaaa--------------a------gctttga------ggcattttgtt----gcaaacaa--tagaaag
B D            Tree shrew  aaaa--------------a------gtgtcaa------ggtattttgct----acaaacaa--tagaagg
B D  Malayan flying lemur  gaaa--------------a------cagtcaa------ggtgttttgtt----acagacaa--tggaaag
B D                   Pig  ------------------------------aa------ggtattttgtt----acaaacca--tag----
B D               Dolphin  ------------------------------aa------ggtattttgtt----acaaacaa--aag----
B D                   Cow  ------------------------------aa------ggtattttgtt----acaaacaa--tag----
B D                 Sheep  ------------------------------aa------ggtattttgtt----acaaacaa--tag----
B D                 Horse  ------------------------------aa------ggcatttcgtt----acaaacaa--tagaaag
B D      Chinese pangolin  ------------------------------aa------ggcattttgtt----acaaacaa--tagaggg
B D                   Dog  ------------------------------aa------ggcattttgtt----acaaacaa--tag-agg
B D    Hawaiian monk seal  ------------------------------aa------ggcattttgtt----acaaacgt--tagaagg
B D              Hedgehog  ------------------------------at------agcattttgtc----ggaaacag--tgtg---
B D                 Shrew  ------------------------------accttaaaagcaaaaaaaa----aaaaaaaa--agta---
B D              Elephant  --------------------aacaagtgtcaa------ggcattttgtt----ccaaacaa--tag----
B D                Tenrec  --------------------aaaacatttcaa------ggcatttagtt----acaaacaa--tag----
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  agtgtacacaaagcctggag-----aacagtagcag----------------gca------ttt-aacag
                      Rat  aatgtacagaaagcctggag-----aacagtagcag----------------gta------ttt-aacag
            GCF_003668045  agtgtacacaaagcatcaag-----aacagtaggga----------------gcatttaacttt-aacag
                   Beaver  --cgtatataaagcgctgag-----catagtaacaa----------------gca------ttt-aatag
                 Squirrel  agtgcatacaaaacactgaa-----catagtagcaa----------------gca------tttaaaaag
               Guinea pig  aatgtatataaagcactgag-----cttagaaacaa----------------gca------tca-agtat
                   Rabbit  tcca---------aacgtag-----catagtagcaa----------------gca------ttt-aatag
                     Pika  gctgtgcacatgcagtgtag-----cctagtagcaa----------------acg------ttt-aatag
                    Human  agtgtatataaagcacctac-----catagaagcaa----------------gca------ttt-aatag
                    Chimp  agtgtatataaagcacctac-----catagaagcaa----------------gca------ttt-aatag
                   Bonobo  agtgtatataaagcacctac-----catagaagcaa----------------gca------ttt-aatag
                  Gorilla  agtgtatataaagcacctac-----catagaagcaa----------------gca------ttt-aatag
                   Rhesus  agtgtatacaaggcacctac-----cagagaagcaa----------------gca------ttt-aatag
                 Marmoset  agtgtatataaagcgtctac-----catagaagcaa----------------gca------ttt-aatag
                  Tarsier  agtgtatataaagtgcctaa-----cataatagcaa----------------gca------ttt-aatag
                 Bushbaby  agtatatataaagctcctac-----cagagcagcaa----------------aca------ttt-attag
               Tree shrew  agtggatataaaacaaccac-----tgtagtagcaa----------------gca------ttt-aatag
     Malayan flying lemur  agt-------------------------------------------------------------------
                      Pig  agtgtctataaagcacctagtata-cagagtagcaa----------------gca------ttt-aatag
                  Dolphin  agcatctataaagcacctagtata-cagagtagtaa----------------gca------ttt-aattg
                      Cow  agtgtctataaagcacctagcata-tagagtagtaa----------------gca------ttt-actag
                    Sheep  cgtgtctataaagcacccagcata-tagagtagtaa----------------gca------ttt-aatag
                    Horse  agtgtatataaagtgcctagtatt-catagtagcta----------------gca------ttt--atag
         Chinese pangolin  agtgtatacaaagcacctag-----catagtagcaa----------------gaa------ttc-aatag
                      Dog  agtgtttttaaagcactgag-----cagagtagcaa----------------gca------ttt-aatag
       Hawaiian monk seal  agtgtttttaaagcacctag-----catagtagcaa----------------gca------ttt-aatag
                 Hedgehog  agtgcatgcaaagcgcctacctgg-cctagtagcaa----------------gca------ttt-aatag
                    Shrew  -------gcaaggtattttgatggaaataataggaatgactataaaacaccttta------ttt-aacag
                 Elephant  agtctatctaaagcatttag-----caaagcagcaa----------------gcg------ttt-aatag
                   Tenrec  tagctatctaaagcatttag-----tatagtagcaa----------------aca------ttt-aatag
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gggctcag-tgctgtc-------------------tgga--------gtcacatcatgaagttcagagtt
                      Rat  gagctctg-cgctgtct------------------tgga--------atcacatcatgaagttctgagtt
            GCF_003668045  gggctcag-tgccttctgtt-gctcattg-ttttgggga--------atcacactgtgaagactggagtt
                   Beaver  gtgctcag-tgcttattattaggtcatca-tttcttgga--------ataacattgcgaagtatacagct
                 Squirrel  gtatttag-tgctttttattagctcacca-tttcttgga--------ataacattgtgaagtatggtttt
               Guinea pig  gtgctcag-agcttttcattag---atca-tttcttgga--------ataacattgtgaagcatagagct
                   Rabbit  gtgcccag-tgcttttgattaggtcatca-tttcttgga--------ataacattgtgaagtatagagtt
                     Pika  gtgcccag-cacttttgattaggtcatgg-tttcttgga--------ataacattgtgaagtacagagtt
                    Human  gcgctcag-tgctttttattaggtcatca-ttgattgga--------ataacattgtgaagtatagagtt
                    Chimp  gcgctcag-tgctttttattaggtcatca-ttgattgga--------ataacattgtgaagtatagagtt
                   Bonobo  gcgctcag-tgctttttattaggtcatca-ttgattgga--------ataacattgtgaagtatagagtt
                  Gorilla  gtgctcag-tgctttttattaggtcatca-tttattgga--------ataacattgtgaagtatagagtt
                   Rhesus  gcgcttag-tgctttttattaggtcatca-tttattgga--------ctaacgttgtgaagtatagagtt
                 Marmoset  gcactcag-tgctttttattaggtcatca-tttattgaa--------ataacgttgtgatgtatagagtt
                  Tarsier  gtgctcag-tgctttttattaggtcatca-tttcttgga--------ataatattgtgaagcatagaatt
                 Bushbaby  gtgcttat-tgctccttattagatcatca-ttcctagaa--------ataacat------gtgaagagct
               Tree shrew  atgctcag-tgctttcgatgagatcatca-ttgcttggaagaacatcataacatcatgaagcacagagtt
     Malayan flying lemur  -----------------------------------------------atagtgtc---------------
                      Pig  gtgatggg-ttatgtttactagatcataa-tttcctgga--------ataacattgtaaagtatgaagtt
                  Dolphin  gtgctcag-taatgtttattaggtcttca-tttcctgga--------ataacattgtgaagtacagagtt
                      Cow  gtgctcag-taatgtttattaggtcatca-tttcctgaa--------ataacattgtgaagtacagagct
                    Sheep  gtgctcag-taatgtttattaggtcatca-tttcctgaa--------ataacattgtgaagtatagagct
                    Horse  gtgctcag-taggttttattgggtcatca-tttcctgga--------ataacatcgtgaagtatagagtt
         Chinese pangolin  gtgctcag-tagtttttattaagtcatca-tttcttgga--------ataccatcatgaagtatagagtt
                      Dog  gtgctcag-gagtttttattaggtcatca-tttgttgga--------ataacatcaggaagtatagagtc
       Hawaiian monk seal  gtgctcag-tagtttttattgggtcatca-tttgttata--------ataacatcaggaagtaaagagtt
                 Hedgehog  gtagtcag-ttatttgtatgaggttatcatttttttgga--------atgacaccatgaaatacagaatt
                    Shrew  gtattcag-taatttttatgaggtcatta-ttttctgga--------atatcttcatggagtatagagta
                 Elephant  gtgtgcag-taatttttattaggtcatca-tttcttaga--------ataacattgtgaagtacagagtt
                   Tenrec  acatgcagttaatttttatgaggccatca-tttcttaga--------ataacactgtgcagtatcaggct
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  c----aaaa-t-cag---cttctgttcccacaagcagtc
                      Rat  c----aaaa-t-cag---ccccagttcccacaatccgtc
            GCF_003668045  c----agaa-a-aag---ctccaattcccacaggcagtc
                   Beaver  g----aaaa-a-tag--tctctaattcccacatgtagtt
                 Squirrel  a----aaag-t-------ttctaattcttctgggtagtt
               Guinea pig  g----aaag-a-taa--tctctatttcccatgcaccgtt
                   Rabbit  g----aaaa-a-tag--tctctaattcccacatgtagtt
                     Pika  g----aaaa-g-tag--cctctaattc------------
                    Human  g----aaaa----ag--tttctaattcccacatgtcatt
                    Chimp  g----aaaa----ag--tttctaattcccacatgtcatt
                   Bonobo  g----aaaa----ag--tttctaattcccacatgtcatt
                  Gorilla  g----aaaa----ag--tttctagttcccacatgtcatt
                   Rhesus  g----aaaa----ag--tttctaattcccacatgtcatt
                 Marmoset  g----aaaa----ac--tttctaact-ccacatgtcatt
                  Tarsier  gaaaaaaaa----ag--tatctaacttccacatggggtt
                 Bushbaby  g----aaaa-a-tag--tctctaatccccacactgggct
               Tree shrew  a----aaaaaa-taa--tctc-aattcccacatatagtt
     Malayan flying lemur  -----gaaaaa-tag--tctctaattcccacatgtagtt
                      Pig  g----aaaa-a-aag--cctttaatttccacatacagtt
                  Dolphin  g----aaaa-t-aaaggtctctaattcccacatgtagtt
                      Cow  g----aaaa-a-aaaaa-----gtctcccacatagagtt
                    Sheep  g----aaaa-a-aaa--------tctcccccatagagtt
                    Horse  g----agaa-a-tag--tctgtaattcccagatattgtt
         Chinese pangolin  g----aaaa-a-tag--tttctaattcccacatacaggt
                      Dog  g----aaaa-a-tag--ttttaaattcttacatatagtt
       Hawaiian monk seal  g----aaaa-a-tag--tttttaattctcacatgtagtt
                 Hedgehog  g----aaaa-agcag--cctcttttt--cacagatagct
                    Shrew  g----aaaa-a-cag--tttgtaatt--ctcgtgtattt
                 Elephant  g----aaaa-a-gag--tct-gaattcccacatggagat
                   Tenrec  g----ag--------------gattttctacatgtagtt
                Zebrafish  =======================================
            X. tropicalis  =======================================
                  Opossum  =======================================
                  Chicken  =======================================

Inserts between block 14 and 15 in window
B D                Human 355bp
B D                Chimp 84bp
B D               Bonobo 338bp
B D              Gorilla 350bp
B D               Rhesus 82bp
B D             Marmoset 278bp
B D             Bushbaby 4bp

Alignment block 15 of 407 in window, 56748449 - 56748491, 43 bps 
B D                 Mouse  agtacattccgtttttt------aca---taaaaagcagctgccccat--ct---aa---
B D                   Rat  aatccatcccg---ttt------gca---taaaaagcagcttcctcat--cg---aa---
            GCF_003668045  aatgaa-ccag---cttaaaaaaaaa---aaaaaagcggtttcctcat--cc---aa---
                   Beaver  gatgaacccag---ttt------gta---taagacac-----------------------
B D              Squirrel  gatgaacccag---ctt------atg---tataaaccagccttataat--cc---aa---
B D            Guinea pig  aatgaaaccag---ttt------ata---catgatgtagtcttata----ca---aa---
B D                Rabbit  gatgaactcaa---ctt------atg---tgtaaagcagactcataat--gc---aa---
B D                  Pika  ----aactcca---ctt------ata---tgtaaagcaaactcataat--gc---aa---
B D                 Chimp  gtctagctctg---tcg------ccaggttggagtgcagtggcgcgat--ct---ct---
B D                Rhesus  gtctagctctg---tcc------ccaggctggagtgcagtggcacgat--ct---ca---
B D               Tarsier  gatgaatccag---ttt------aca---tataaaacagcctcataat--cc---aa---
B D              Bushbaby  ----agtccaa---t---------------------cagtctcataat--cc---aa---
B D            Tree shrew  gatgaacac-------t------ata---tataaagctgtctcattat--ccaaaaa---
B D  Malayan flying lemur  gatgaacccag---ttt------ata---tataaaacagtctcataat--cc---aa---
B D                   Pig  gatgaacatgg---ttt------ata---tataaagcagtattataat--cc---aa---
B D               Dolphin  gatgaacccag---ttt------ata---tataaagcagcatcataat--cc---aa---
B D                   Cow  gatgaacctag---tta------ata---aataaagcagtattataat--cc---aa---
B D                 Sheep  gatgaacctag---ttt------ata---aataaagcagtgtcataat--cc---aa---
B D                 Horse  gatgaacccag---ttt------aaa---aacaaagcaatgtcataatccca---aa---
B D      Chinese pangolin  gatgaacccag---ttt------ata---tataaagcagcatcataat---a---aa---
B D                   Dog  gatacacccgg---ttt------att---tatgaagcagtgtcataat--tc---aa---
B D    Hawaiian monk seal  gataaacccag---ttt------ata---tataaagcagtgtcataat--tc---aa---
B D              Hedgehog  cataaacccag---ttc------ata---tgtagaacactgtcttaat--cc---aa---
B D                 Shrew  cacgatcctac---tt--------ta---tataaaacagtgtcaaaat--ga---aa---
B D              Elephant  gatgaatccag---cct------gta------acagctgtctcactgg--cc---caaaa
B D                Tenrec  gatgaagccag---ttt------gcc------atagcagtctcacatg--cc---ccaaa
B D              Marmoset  ============================================================
B D               Gorilla  ============================================================
B D                Bonobo  ============================================================
B D                 Human  ============================================================
B D             Zebrafish  ============================================================
B D         X. tropicalis  ============================================================
B D               Opossum  ============================================================
B D               Chicken  ============================================================

Inserts between block 15 and 16 in window
B D               Rabbit 3bp
B D                 Pika 15bp
B D                Chimp 211bp
B D               Rhesus 47bp
B D              Tarsier 2bp
B D             Bushbaby 4bp
B D           Tree shrew 1bp
B D Malayan flying lemur 1bp
B D                  Pig 1bp
B D              Dolphin 1bp
B D                  Cow 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp
B D             Hedgehog 1bp
B D                Shrew 1bp

Alignment block 16 of 407 in window, 56748492 - 56748499, 8 bps 
B D                 Mouse  a--ac---------ctcca
B D                   Rat  a--ac---------cttcc
            GCF_003668045  a--aaccttcatagcttca
                   Beaver  ---ac---------cttta
B D              Squirrel  a--ac---------attta
B D            Guinea pig  a--cc---------tttta
B D                Rabbit  a--gc---------ctttg
B D                  Pika  a--ac---------cttcg
B D                 Chimp  a--gc---------caccg
B D                Bonobo  a--gc---------cacca
B D                Rhesus  a--gc---------ctccg
B D              Marmoset  a--gc---------ctcct
B D               Tarsier  a--ac---------tttta
B D              Bushbaby  a--ac---------cttta
B D            Tree shrew  a--ac---------cttta
B D  Malayan flying lemur  a--ac---------cttca
B D                   Pig  a--at---------cttta
B D               Dolphin  a--at---------cttta
B D                   Cow  a--at---------cttta
B D                 Sheep  a--at---------cttta
B D                 Horse  t--ct---------ctat-
B D      Chinese pangolin  a--at---------cttt-
B D                   Dog  a--at---------cttt-
B D    Hawaiian monk seal  a--at---------cctt-
B D              Hedgehog  attgt---------tgtga
B D                 Shrew  a--aa---------tctaa
B D              Elephant  --tgt---------tttta
B D                Tenrec  --tgc---------cttct
B D               Gorilla  ===================
B D                 Human  ===================
B D             Zebrafish  ===================
B D         X. tropicalis  ===================
B D               Opossum  ===================
B D               Chicken  ===================

Inserts between block 16 and 17 in window
B D                Chimp 8bp
B D               Bonobo 8bp
B D               Rhesus 172bp
B D             Marmoset 40bp

Alignment block 17 of 407 in window, 56748500 - 56748500, 1 bps 
B D                 Mouse  -t
B D                   Rat  -t
            GCF_003668045  -t
                   Beaver  -t
B D              Squirrel  -t
B D            Guinea pig  -t
B D                Rabbit  -t
B D                  Pika  -t
B D               Tarsier  -t
B D              Bushbaby  -t
B D            Tree shrew  -t
B D  Malayan flying lemur  -c
B D                   Pig  -t
B D               Dolphin  -t
B D                   Cow  -g
B D                 Sheep  -g
B D              Hedgehog  -t
B D                 Shrew  -t
B D              Elephant  c-
B D                Tenrec  g-
B D                Rhesus  ==
B D    Hawaiian monk seal  --
B D                   Dog  --
B D                 Horse  --
B D              Marmoset  ==
B D               Gorilla  ==
B D                Bonobo  ==
B D                 Chimp  ==
B D                 Human  ==
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D               Opossum  ==
B D               Chicken  ==
B D      Chinese pangolin  --

Alignment block 18 of 407 in window, 56748501 - 56748603, 103 bps 
B D                 Mouse  agctactttca--ttttc--ctctct---gaatgatgtacc-tgtcagtgaggcttgttt----------
B D                   Rat  agctactttca--cttcc--ctctct---------tgaatc-tctcagtgaagcttgttt----------
            GCF_003668045  agctactttca--ttttc--tcctcccttgaatgatgtatc-tgtcagtgaaacttgttt----------
                   Beaver  agttattttca--ttttta-ctctct-tgaattaatgtatc-tggcattgaagcttgttt----------
B D              Squirrel  agttattttca--ttttta-ctcttt--tgacttacatatg-ttgtaaatcattttattcttttgattta
B D            Guinea pig  agttattttca--ttttt--actgtt---gacttatatgtc-tagtcttaagacttgtag----------
B D                Rabbit  agttattgtcactttttta-ctccct--tgaattatagaac-tggcgtttaaacttggtt----------
B D                  Pika  ag-----------ttttct-ctccct--taagttataatac-cagcatttacgcttgttt----------
B D                 Human  agtaattttta--ttttct-cttcct--tgaattatagatc-taacattgaaatttgttt----------
B D                 Chimp  agtaattttta--ttttct-cttcct--tgaattatagatc-taacattgaaatttgttt----------
B D                Bonobo  agtaattttta--ttttct-cttcct--tgaattatagatc-taacattgaaatttgttt----------
B D               Gorilla  agttattttta--tttgct-cttcct--tgaattatagatc-taacattgaaatttgttt----------
B D                Rhesus  agttattttta--ttttca-cttcct--tgaattatagatc-tagcattgaaacttgttt----------
B D              Marmoset  agttatgttaa--ttttca-cttcct--tgaattatagatc-tagcatttaaacttgttt----------
B D               Tarsier  agctatttata--ttttta-ttccct--tgaattatacatc-tagcatttaaacttgttt----------
B D              Bushbaby  aattattttta--t-------tccct--tgaattagagatc-catcatttaaacttgttt----------
B D            Tree shrew  agttactttta--ttttta-cttcct--tgaatcacagatc-tagcatttaaattcactt----------
B D  Malayan flying lemur  agttattttta--ttttta-ctacct--tgacttatacatc-tagaatttaaacttgttt----------
B D                   Pig  gattactttta--ttttta-ctccct--tgaattacagacc-tcgtatttaatcttgttt----------
B D               Dolphin  gattactttta--ttttta-ctcctt--tgaattatagacc-tagtg-----tattgttt----------
B D                   Cow  ggttactttta--ttttta-ctctcc--tgaattatagacc-tagtgtttaatcttgttt----------
B D                 Sheep  ggttactttta--ttttta-ctccct--tgaattatagacc-tagtgtttaatcttgttt----------
B D                 Horse  gattattttta--ttttta-ctctct--tgaattatagact-tagcatttaagcttgttt----------
B D      Chinese pangolin  gattattttaa--ttttta-ct-tct--tgaattataggtc-tagcatttgaacttgttt----------
B D                   Dog  gattatttca---tttttt-ctctct--tcaattatagatc-tagtgtttatactcattt----------
B D    Hawaiian monk seal  ggttatttcgt--tttttt-ctccct--cgaattatagatc-tagtgtttatactcattt----------
B D              Hedgehog  tattattatta--ttttttactcagt--tgaatac-agacc-tagagttgaaactggttt----------
B D                 Shrew  gattaatttta--tatttc-ctccct--tgaatta-agatcatatacataaaatt-gttt----------
B D              Elephant  acttattttca--ttttaa-ctgctt--tgaattattgacc-tagattttaaacttgttc----------
B D                Tenrec  a-ttattttca--ttttta-gttctt--tgaattacagacc-tagattttcaacttcctt----------
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  ------ataaagggctaatt--tata-atatgctt--caaaattaaactta-caacttattta-------
                      Rat  ------agaaagggctaatt--taaa-atatgctt--cagaactaaacttg-caacttattt--------
            GCF_003668045  ------agaaatggctaatt--tatc-atatgctt--taaaactaaactga-cagtttattt--------
                   Beaver  ------agaagtagttaatt--tcta-atacactt--ca-aactaaac---------tattt--------
                 Squirrel  cattgaagaaatggttaatt--tatg-atacattt--caaaaccaaactgt-caattaattt--------
               Guinea pig  ------agatattgttaatt--tatt-atgtactt--caaaattaatctgg-caatttatct--------
                   Rabbit  ------agcaatgatgaatt--tata-atacactt--caaaactaaactga-caagttactt--------
                     Pika  ------cgggatgatgaatttgtata-atacactt--caaagccaaactga-caagttactc--------
                    Human  ------ggaaatgcttaatt--tata-atacactt--caaaactaaactga-caaattattt--------
                    Chimp  ------ggaaatgcttaatt--tata-atacactt--caaaactaaactga-caaattattt--------
                   Bonobo  ------ggaaatgcttaatt--tata-atacactt--caaaactaaactga-caaattattt--------
                  Gorilla  ------ggaaatgcttaatt--tata-atacactt--caaaactaaactga-caaattattt--------
                   Rhesus  ------ggaaatgcttaatt--tata-atacactt--caaaactaaactga-caaattattt--------
                 Marmoset  ------gggaatgcttaatt--tata-atacactt--caaaactaaactga-caaattattt--------
                  Tarsier  ------aga-------aatt--tgta-atacactt--ctaaactaaaatga-cagattattt--------
                 Bushbaby  ------agaa-------------ata-atacactt--caaaacaaaacaca-caaatcattt--------
               Tree shrew  ------ggagacggttcatt--tata-atacactt--caaccctaaaggga-caaattatgt--------
     Malayan flying lemur  ------agaaatggttaatt--t-ta-acacactt--taaaactaaactga-caatttattt--------
                      Pig  ------agaaatggttaatt--tatatatgtattt--caaaatgaaactagtcaattta-----------
                  Dolphin  ------agaaatggttagtt--aatacatacactt--caaaatgaaactaatcaattta-----------
                      Cow  ------agaaatggttagtt--aatacacacactt--caaaatgaaaccaatcaattta-----------
                    Sheep  ------agaaatggttagtt--aatacacacactt--caaaatgaaaccagtcaattta-----------
                    Horse  ------agaaatggttaatt--tatatatacacct--caaacctaaactgatcaattta-----------
         Chinese pangolin  ------agaagtacttaatt--tataccaacactt--caaaacaaaaccgataaattta-----------
                      Dog  ------agaaatggttaatt--catacac----ct--caaaaccacactgaccaattta-----------
       Hawaiian monk seal  ------agaaatggttaatt--tatacacacatat--caaaaccacacagacaggttta-----------
                 Hedgehog  ------agcaagagttaatt--tatactggcactt--caacattcacctgaataatttc-----------
                    Shrew  ------agaaatggttca-t--tatatgtgcacttagctaagttcac-----tgattta-----------
                 Elephant  ------agaaatgg-----t--tatgcattcactt--caaacctaaattga-tgaaatattt-------a
                   Tenrec  ------agaaatgg-----t--tacacaatcaatt--caagcctaaaccga-taaagtattt-taaatga
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

Inserts between block 18 and 19 in window
B D               Rabbit 1bp
B D                 Pika 33bp
B D                Human 1bp
B D                Chimp 1bp
B D               Bonobo 1bp
B D              Gorilla 1bp
B D               Rhesus 1bp
B D             Marmoset 1bp
B D              Tarsier 1bp
B D             Bushbaby 1bp
B D           Tree shrew 1bp
B D Malayan flying lemur 1bp

Alignment block 19 of 407 in window, 56748604 - 56748616, 13 bps 
B D                 Mouse  aaaataaa------------------tagca--
B D                   Rat  aaaataaa------------------tagca--
            GCF_003668045  aaaataaa------------------tagca--
                   Beaver  aaaataga-------------aaattaaaca--
B D              Squirrel  aaaatgaga------------aaattaaata--
B D            Guinea pig  aagacaag--------------ttttaaacc--
B D                Rabbit  --------atttgttttactaattttaaatt--
B D                 Human  -aaataaa------------------aaatt--
B D                 Chimp  -aaataaa------------------aaatt--
B D                Bonobo  -aaataaa------------------aaatt--
B D               Gorilla  -aaataaa------------------aaatt--
B D                Rhesus  -aaataaa------------------aaatt--
B D              Marmoset  -aaataaa------------------aattt--
B D               Tarsier  -aaataaa------------------atttt--
B D              Bushbaby  -aaagaaa------------------aaatt--
B D            Tree shrew  -aaatcaa------------------aattt--
B D  Malayan flying lemur  -aaagaaa------------------aa-gt--
B D                   Pig  -aaataaa------------------aatag--
B D               Dolphin  -aaataaa------------------aatag--
B D                   Cow  -aaataaa------------------aatag--
B D                 Sheep  -aaataaa------------------aatag--
B D                 Horse  -aaataaa------------------aatag--
B D      Chinese pangolin  -aaataaa------------------aatag--
B D                   Dog  -aaataaa------------------aatag--
B D    Hawaiian monk seal  -aaataaa------------------aatag--
B D              Hedgehog  -caataaa------------------aatat--
B D                 Shrew  -aaattaa------------------aatag--
B D              Elephant  aaattcaa------------------aacatta
B D                Tenrec  aaatttaa------------------aacatga
B D                  Pika  =================================
B D             Zebrafish  =================================
B D         X. tropicalis  =================================
B D               Opossum  =================================
B D               Chicken  =================================

Inserts between block 19 and 20 in window
B D               Rabbit 1bp
B D                Human 5bp
B D                Chimp 5bp
B D               Bonobo 5bp
B D              Gorilla 5bp
B D               Rhesus 5bp
B D             Marmoset 5bp
B D              Tarsier 9bp
B D             Bushbaby 9bp
B D           Tree shrew 9bp
B D Malayan flying lemur 9bp
B D                  Pig 7bp
B D              Dolphin 7bp
B D                  Cow 5bp
B D                Sheep 5bp
B D                Horse 6bp
B D     Chinese pangolin 6bp
B D                  Dog 7bp
B D   Hawaiian monk seal 7bp
B D             Hedgehog 1bp
B D                Shrew 3bp

Alignment block 20 of 407 in window, 56748617 - 56748698, 82 bps 
B D                 Mouse  t---ttcaagtaa---atgc-------tgttt--------c-----act-aaaaat-cattca-------
B D                   Rat  t---ttcaagtga---atgc-------cattt--------c-----act-aaaaat-cactca-------
            GCF_003668045  ----ttcgagtaat--ttgc-------tgttt--------c-----cttaaaaaat-cattta-------
                   Beaver  tggcttcagat-----actc-------tattc----tgaac-----att-gaaaat-tgatta-atttta
B D              Squirrel  tgatttcaaataatccactc-------tatgtattctgaac-----act--aaaat-agattacctttta
B D            Guinea pig  tagtttcaaatct---attc-------tatgt--tacgaac-----att-aaaatt-tgactagattata
B D                Rabbit  ---tttcaaacgatatactc-------tatat--tctgaat-----gtt-aaaa-t-tgattacatttta
B D                  Pika  ---tttcaagtaatgaactg-------tgtat--tctaaat-----gtt-aaaatt-tgattacatttta
B D                 Human  ---ttttaaat-----aatt-------gatat--tctgatt-----att-aaaaat-agattacatttta
B D                 Chimp  ---ttttaaat-----aatt-------gatat--tctgatt-----att-aaaaat-agattacatttta
B D                Bonobo  ---ttttaaat-----aatt-------gatat--tctgatt-----att-aaaaat-agattacatttta
B D               Gorilla  ---ttttaaat-----aatt-------gatat--tctgatt-----att-aaaaat-agattacatttta
B D                Rhesus  ---tttcaagt-----aatt-------gatat--tctgatt-----agt-aaaaat-agattatctttta
B D              Marmoset  ---ttttaaac-----aatt-------gatat--tttgat--------t-aaaaat-agat---gtttta
B D               Tarsier  ---tttaaaat-----aatc-------tattt--tctgatc-----att--atatt-gggtaacatttta
B D              Bushbaby  ---tttcaaac-----aatctactctgtatat--cctgatc-----att-aaaaat-ggtttacatttta
B D            Tree shrew  ---ttttgaat------------------tat--cttgcag-----att-taaaat-tgattacatttta
B D  Malayan flying lemur  ---ttttaaat-----actctgctctgtgtat--tcaaaac-----att-aaaaat-tggttacatttta
B D                   Pig  ---tgtcaagt-----aatctgctctctatat--tctgaatattttatt-aaaaataacatgacatttta
B D               Dolphin  ---tgtcaagt-----aatctatcctgcatat--tctgaac-----att-aaaaat-ccattacatttta
B D                   Cow  ---tgttaagt-----aatctattttgtattt--tctgaac------tt-aaaaat-ccattacatttta
B D                 Sheep  ---tgttaagt-----aatctactttgtattt--tctgaac-----att-aaaaat-ccattacatttta
B D                 Horse  ----ttcaaat-----aatctactctgtatat--tctgaag-----att-aaaaat-ctattacatttta
B D      Chinese pangolin  ----ttcaaat-----aatttactctatatat--tctgaac-----att-aaaaat-ata-tacacttta
B D                   Dog  ---attcaaat-----aatctactctgtatac--tttgacc-----att-tatatt-gat-taca-ttta
B D    Hawaiian monk seal  ---attcaaat-----aatctactctgtatat--tctgaac-----att-aaaatt-gat-taca-ttta
B D              Hedgehog  --------------------------gcagaa--taaaatg-----att-aaaaat-aaatgacattttg
B D                 Shrew  ---tttctgat-----tatgtactttgtacat--tctgaac-----att-aaaaat-ggattgtatttaa
B D              Elephant  ---ttaaaaac-----aatttaccctgtgtgt--tttgaac-----aat-aaaaat-tgattatatact-
B D                Tenrec  ---cttcaaac-----aacctactttgtgtat--tctcaac-----att-aaaaat-tgattatgttgt-
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  --caaagaattttaa---------agtagtaaatgat--gttttataaaagcaaataatt
                      Rat  --cgaagaattttaa---------agtagtaaacaat--gtttcataaaagcaaataact
            GCF_003668045  --caaagaattttag---------atgactgaattac--attttataaaagcaagtaatt
                   Beaver  ttcactgaattttaa---------atcattaagttatcagttttataaaaacaagtaatt
                 Squirrel  tacactgaatttgaaatcatatttattattgattagttagttttacaaaagcaagtgatt
               Guinea pig  tacact-aatttaaa---------ataatcaaattaccagtttgataagaggagataatt
                   Rabbit  cactctaaagtgtaa---------atcactaatgtatcagatttgtaaaagcaagtaatt
                     Pika  cacaatgaagtgcaa---------atcactaatttaccggattaatagaagcaagtaatt
                    Human  tatactaaattttaa---------atcactaaattatcacatttataaaagaatataatt
                    Chimp  tatactaaattttaa---------atcactaaattatcacatttataaaagaatataatt
                   Bonobo  tatactaaattttaa---------atcactaaattatcacatttataaaagaatataatt
                  Gorilla  tatactaaattttaa---------atcactaaattatcacatttataaaagaatataatt
                   Rhesus  tatactaaattttaa---------accactaaattatcacatttataaaataatataatt
                 Marmoset  tatactaaattttaa---------atcactaaattatcacatttataaaagaata-----
                  Tarsier  tatgccgaat----------------cac-aaattatcagatttttaaaagcaagtaat-
                 Bushbaby  tacactgaat----------------cactaaattaccagattcataaaaccaggcaatt
               Tree shrew  tacactgaatattaa---------atcattaaattatcagatttacagaagcaagaaatt
     Malayan flying lemur  tacactgaattttaa---------atcattaa---atcagattcatataagcaagtaatt
                      Pig  tacagtgaatatcaa---------atcactaaattgtcagattta------tgagtaaca
                  Dolphin  tacagtgaatatcaa---------gtcacttaattatcagatttataagagtaagtaact
                      Cow  tgcagtgactatcaa---------atcactaaattatcagatttataaaaatgagtaatt
                    Sheep  tgcagtgactatcaa---------atcactaaatgatcaggtttataagaatgagtaatt
                    Horse  tacagtgaatattaa---------atcactaaattatcagatttataagagcaagtaact
         Chinese pangolin  tacact-aatattta---------attaccaaattgtcagatttataaaagcaagcaaat
                      Dog  aacact-gatattat---------atcactaaattatgagatttgtaaaggcaagtaaat
       Hawaiian monk seal  aacactaaatattat---------atcactaaattatgagatttataaaagcaagcaaat
                 Hedgehog  -acactgaatattaa---------at----atatcacttaatttataaaatc-aacaact
                    Shrew  tacactgaatattaa---------attctcaaattataagatttataaaagcaaataact
                 Elephant  ------gaatattaa---------atcactaaattcttggatttatataagtaag----t
                   Tenrec  ---------tactga---------atgactaaattttgggacttataaaaggaagcaact
                Zebrafish  ============================================================
            X. tropicalis  ============================================================
                  Opossum  ============================================================
                  Chicken  ============================================================

Alignment block 21 of 407 in window, 56748699 - 56748737, 39 bps 
B D                 Mouse  caaggaaaggg-ggcagac--aaat----aaa-tgt--tgttctcaata
B D                   Rat  tcaggaaaatg-ggtggac--aaat----aaa-tgt--tgttctaaata
            GCF_003668045  taaggaaaa---agtggcc--aaat----aga-tgc--tgttctaaatg
                   Beaver  taaagaaat-a-agtggcc--aaataataaaa-tat--cgatcta----
B D              Squirrel  t-----aaatc-agtggcc--acat---------at--tgctcta----
B D            Guinea pig  taaagaaat------agcc--aaat----caa-tat--tgctctg----
B D                Rabbit  aaaagaaat---aagtggc--caat----gaa-tgt--tgctcta----
B D                  Pika  taaa--------agggggcaaaaaa----aaa-tac--tgctcta----
B D                 Human  taaagaaat-a-agtaacc--aaat----aaa-tat--tgctcta----
B D                 Chimp  taaagaaat-a-agtaacc--aaat----aaa-tat--tgctcta----
B D                Bonobo  taaagaaat-a-agtaacc--aaat----aaa-tat--tgctcta----
B D               Gorilla  taaagaaat-a-agtaacc--aaat----aaa-tat--tgctcta----
B D                Rhesus  taaagaaat-a-agtagcc--aaat----aaa-tat--tactcta----
B D              Marmoset  taaagaaat-a-agtagcc----------aaa-tat--tgctcta----
B D               Tarsier  taaagggaa-a-agtggcc--aaat----aaa-tat--tgctcta----
B D              Bushbaby  taaagaaat-a-agtggcc--aaac----aaattat--ttcttga----
B D            Tree shrew  taaag-----a-agtaacc--aaat----aaa-tattatgctcta----
B D                   Pig  t----aaat-a-agtgaac---agc------t-tat--tgttcta----
B D               Dolphin  t----aaat-a-agtggcc--aaat----aag-tat--tgctcta----
B D                   Cow  t----aaac-a-agtggcc---aat----aag-tat--tgttctg----
B D                 Sheep  t----aaac-a-agtggcc---aat----aag-cat--tgttcta----
B D                 Horse  t----aaat-a-agtgttc--aaat----aag-tat--tgttcta----
B D      Chinese pangolin  taaagaaat-a-agtggct--ggat----aag-tat--tgttcta----
B D                   Dog  gagagacat-a-agtggct--aaat----aag-tat--tgttcta----
B D    Hawaiian monk seal  gaaagacgc-a-agtggcc--aaat----aag-tat--tattcta----
B D              Hedgehog  t----aa---a-agtagcc--aaat----aag-tac--tgttcta----
B D                 Shrew  t----aaag-a-agtggtt--aaat----a-------------------
B D              Elephant  --cagaaat-a-agtgctc--gaat----aag-tat--tgttcta----
B D                Tenrec  --caaaaaa-atagtgctg--aaat----aaa-tat--tgtttta----
B D             Zebrafish  =================================================
B D         X. tropicalis  =================================================
B D               Opossum  =================================================
B D               Chicken  =================================================
B D  Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 21 and 22 in window
B D                  Pig 4bp
B D              Dolphin 4bp
B D                  Cow 4bp
B D                Sheep 4bp
B D                  Dog 251bp
B D             Hedgehog 4bp

Alignment block 22 of 407 in window, 56748738 - 56748791, 54 bps 
B D                 Mouse  ttataatactt-----aa-----gaga-------acagggc------------------ccc--agata-
B D                   Rat  ttataatactt-----aa-----gaga-------acaggcc------------------ccc--agata-
            GCF_003668045  ttataatgctt-----aa-----gaga-------acaggcc------------------acc--aaatc-
                   Beaver  ----aatactt-----ag-----gaga-------acaaatc-----------tttt-t-cca--gaatg-
B D              Squirrel  ----aatattt-----aa-----gaga-------acacatttt--atttttttttt-t-aca--gaata-
B D            Guinea pig  ----aatactt-----ag-----gaga-------ataagtt----------tttct-t-ctg--aacta-
B D                Rabbit  ----agtattt-----aa-----gaga-------atgaggc----------atttt-t-cca--aaata-
B D                  Pika  ----gatagtg-----aa-----gaga-------atg-----------------------ca--gaata-
B D                 Human  ----aatactt-----aa-----taag-------cta--------------ttttt-t-cca--gaata-
B D                 Chimp  ----aatactt-----aa-----taag-------cta--------------ttttt-t-cca--gaata-
B D                Bonobo  ----aatactt-----aa-----taag-------cta--------------ttttt-t-cca--gaata-
B D               Gorilla  ----aatactt-----aa-----taag-------cta--------------ttttt-t-cca--gaata-
B D                Rhesus  ----aatactt-----aa-----taaa-------cta--------------atttt-t-cca--gaata-
B D              Marmoset  ----aatactt-----tg-----ttat-------ttagatg------ttacttttt-t-cca--gaata-
B D               Tarsier  ----aattctt-----ag-----aaaaaacaagtttc--------------tttcc-t-aaa--gtata-
B D              Bushbaby  ----aatactt-----aaaagagcaag-------tta--------------tttttgt-cca--gagtaa
B D            Tree shrew  ----aatacttgtaagaa-----caag-------ata--------------tgtat-a-tct--gatat-
B D                   Pig  --------ttt-----aa-----gaga-------acaagttaa--aa----gtttt-t-tca--gcaga-
B D               Dolphin  --------ctt------------gagg-------acaagtcaa--aa----ttttt-ttgca--gaaga-
B D                   Cow  --------ctt------------gaga-------aaaaattaa--aa----ttttt-t------gaaga-
B D                 Sheep  --------ctt------------gaga-------aaaaattaa--aa----aattt-t------gaaca-
B D                 Horse  ----aatactt-------------aga-------acaagttaa--at----ttttt-t-cta--gaaga-
B D      Chinese pangolin  ----aatactc-----aa-----gaga-------acaagttaa--at----atttt-t-cta--gaacc-
B D    Hawaiian monk seal  ----aatacat-----aa-----gaga-------acaagttaa--tt----ttttt-t-cca--gaaga-
B D              Hedgehog  --------tct-----aa-----gaga-------acaaattaa--ca----tgttt-t-ttagaaaaaa-
B D                 Shrew  ----------------aa-----ataa-------acaagttac--aa----ttttt-c-c----aaaag-
B D              Elephant  ----aatgctt-----aa-----gaga-------ataagttaa--at----ttttt-c-cca--gaaga-
B D                Tenrec  ----agtcctt-----aa-----gaga-------acatgttaagtat----ttttt-c-cca--gaaga-
B D                   Dog  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D  Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                    Mouse  -aaagg--at-attta----------tatc----------acgttg
                      Rat  -aaagg--at-actta----------tgtc----------aagtta
            GCF_003668045  -aaagg--at-atttc----------catc----------aaattt
                   Beaver  -aaaag--at-ttttg----------tatc----------aagcta
                 Squirrel  -aaaat--g--atttt----------aatc----------aaacta
               Guinea pig  -aaaag--at-attta----------tata----------aaacta
                   Rabbit  -aaaag--aa-attta----------catt----------atactt
                     Pika  -aaaagatac-atgta----------tgct----------caactt
                    Human  -aaa----at-attta----------tatg----------aaactt
                    Chimp  -aaa----at-gttta----------tatg----------aaactt
                   Bonobo  -aaa----at-attta----------tatg----------aaactt
                  Gorilla  -aaa----at-attta----------tatg----------aaactt
                   Rhesus  -aaa----a------a----------tatc----------aaactt
                 Marmoset  -aat----aa-aatta----------tatt----------aaactt
                  Tarsier  -aag----at-attta----------tatc----------atactt
                 Bushbaby  caag----at-gttta----------catc----------aaacct
               Tree shrew  -ata----at-ttttaacagcatacctatc----------acattt
                      Pig  -g-aag--ac-attca----------tatc----------aaactt
                  Dolphin  -aaaag--ac-atttg----------tatc----------aaactt
                      Cow  -aaaag--ac-atttg----------tatc----------agactt
                    Sheep  -gaaag--ac-atttg----------tatc----------aaactt
                    Horse  -agaag--at-atttg----------aatc----------gaactt
         Chinese pangolin  -aaaaa--at-at--------------att----------aaactt
       Hawaiian monk seal  -aaaag--at-attta----------tatcttaaatttggaaactt
                 Hedgehog  -aaaag--at-agcta----------tacc----------aaaatg
                    Shrew  -aaaag------gcta----------tcac----------aaactt
                 Elephant  -aaaag--atggttta----------tatt----------aaactc
                   Tenrec  -aaaag--atggttta----------tgct----------aaactt
                      Dog  ==============================================
                Zebrafish  ==============================================
            X. tropicalis  ==============================================
                  Opossum  ==============================================
                  Chicken  ==============================================
     Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 22 and 23 in window
B D   Hawaiian monk seal 25bp

Alignment block 23 of 407 in window, 56748792 - 56748814, 23 bps 
B D                 Mouse  atattta---------aaaagccctt-a-------------c--tgaa
B D                   Rat  atattta---------aacagttctt-a-------------c--tgaa
            GCF_003668045  atatttg---------aagagctctgaa-------------t--tgag
                   Beaver  atatctg---------aaaaattcttaa-------------ttgtgat
B D              Squirrel  atatttg---------aaaagttctgaa-------------ttgtaac
B D            Guinea pig  tcatttg---------aaaaatccttaa-------------ccgtagc
B D                Rabbit  acatttg---------gaaatttcttac-------------ttgcaat
B D                  Pika  acctata---------gaacatttttaa-------------ttgcaat
B D                 Human  acatttg---------cgaagttcttaa-------------ttgcaat
B D                 Chimp  acatttg---------cgaagttcttaa-------------ttgcaat
B D                Bonobo  acatttg---------cgaagttcttaa-------------ttgcaat
B D               Gorilla  acacttg---------cgaagttcttaa-------------ttgcaat
B D                Rhesus  acttttg---------caaagttctcaa-------------ttgcaat
B D              Marmoset  acatttg---------cagagttcttaa-------------ttgcaat
B D               Tarsier  acatttg---------cagagttcttaa-------------ttgcaat
B D              Bushbaby  gcgtttg---------aaaagtt---aa-------------ctgcaat
B D            Tree shrew  acatttg---------gaaagttcttaa-------------ttagcaa
B D                   Pig  tcatttg---------gaaagttct----------------tgga---
B D               Dolphin  tcgtttg---------gaaagttcttaa-------------tggc---
B D                   Cow  tcatttg---------gaaagttcttaa-------------tggc---
B D                 Sheep  tcatttg---------gaaagttcttaa-------------tggc---
B D                 Horse  aaatttg---------gaaagttcttaa-------------ttgc---
B D      Chinese pangolin  aaatttg---------caaagttcgtaa-------------ttgc---
B D                   Dog  aaatttg---------gaaacttcttaa-------------ttgc---
B D    Hawaiian monk seal  ttatttgagagagagagagacagcacaa---------------gc---
B D              Hedgehog  gagtttg---------gaaatttcttaa-------------ttac---
B D                 Shrew  aaa-ttg---------aataattcttaa-------------ttgc---
B D              Elephant  ccctttg---------gaaaattcttac--------------------
B D                Tenrec  acctttg---------gacaatttttatcatagtttgtaaa-------
B D             Zebrafish  ================================================
B D         X. tropicalis  ================================================
B D               Opossum  ================================================
B D               Chicken  ================================================
B D  Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 23 and 24 in window
B D                  Pig 3bp
B D              Dolphin 3bp
B D                  Cow 3bp
B D                Sheep 3bp
B D                Horse 3bp
B D     Chinese pangolin 3bp
B D                  Dog 3bp
B D   Hawaiian monk seal 153bp
B D             Hedgehog 3bp
B D                Shrew 3bp

Alignment block 24 of 407 in window, 56748815 - 56748933, 119 bps 
B D                 Mouse  atgt---tatcccattctgccat------------tta----------------ggttgatacttcaaat
B D                   Rat  atgt---tattccattctgccat------------tta----------------ggtagataattcaaat
            GCF_003668045  atgt---tgccccatactgccat------------gtc----------------aggagataattcaaat
                   Beaver  atgc---tattctgcaatgccat------------gta----------------tttagataattcaaat
B D              Squirrel  atgcttgtcttctgccttgtcat------------gta----------------ggtaggaaattaaaat
B D            Guinea pig  atactaatcttctgtatttccatgtatataggtaggta----------------ggtagataatttaaat
B D                Rabbit  atgctaatcttctgcatggtgac------------gta----------------gttagaaaattgaaat
B D                  Pika  atgctaatcttctaccttatggt------------gta----------------attagaaaattcaaat
B D                 Human  atgctaatcttctgcattgcaat------------gta---------tttaatagttagataattcaaat
B D                 Chimp  atgctaatcttctgcattgcaat------------gta---------tttaatagttagataattcaaat
B D                Bonobo  atgctaatcttctgcattgcaat------------gta---------tttaatagttagataattcaaat
B D               Gorilla  aggctaatcttctgcattgcaat------------gta---------tttaatagttagataattcaaat
B D                Rhesus  atgctaatcttctgcattgcaat------------gta---------tttaatagttagataattcaaat
B D              Marmoset  atgctaatcttctgcattgccat------------gtat--------tttaatagttagataattcaaat
B D               Tarsier  gtgtgaatcttctgca-tgccat------------gta----------------gttagataattc-aat
B D              Bushbaby  atgctaatcttccgtattgccct------------gta----------------gttagataattcaaat
B D            Tree shrew  atgctaatcatgtgcattgccat------------aca----------------gttagaccatttcaat
B D                   Pig  atgctaatcttctgcattgccat------------gta----------------gtacggtaatactaat
B D               Dolphin  atgctaatcttctgcattgccat------------gta----------------gcaagataatacaaat
B D                   Cow  ctgctaaccttctgcattgccat------------gtt----------------gtaagataatataaat
B D                 Sheep  ctgctaaccttctgcattgctat------------gtt----------------gtaagatactataaac
B D                 Horse  atgctaatcttctgcattgccat------------gta----------------ataaaataattcaaat
B D      Chinese pangolin  gtgttgaccttctacattgccat------------ata----------------gtaaggtaattaaaat
B D                   Dog  atgctaatcttctccattgccag------------gta----------------ataatataattcagat
B D    Hawaiian monk seal  atgctaatcttctgcattgccat------------gta----------------gtaatataattcagat
B D              Hedgehog  atgccaatattgtgcagtgtcat------------gta----------------gtaagataatttaaac
B D                 Shrew  atgccaaatttctacatcattat------------gta----------------gtaagataattcaaat
B D              Elephant  ---------------------------------------------------------atgtaat------
B D                Tenrec  -------ttttaagcagtgccag------------gcattaaggcaatttaaagatgaggcaatttaag-
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D  Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                    Mouse  aacacacaatcataaaaac-tt-cagagtttctaagcacaacata-------------------gatcag
                      Rat  gacacaggatcataaaacg-tt-cagagtttctaagcacaacatg-------------------aatcag
            GCF_003668045  gttacacaatcataaaact-gc-aagagtttctaagcacaaccta-------------------aaccag
                   Beaver  gatgcaaaatttcaaaaac-ctgaaaagtttctaagcacaatatg-------------------aatcag
                 Squirrel  gatacagaatttcagaata-tg-aaaag---------------ta-------------------aatcag
               Guinea pig  gttgcaaagtttcaaaacc-tg-aactttttctgagtataatgta-------------------aatcaa
                   Rabbit  gttgaaaaatttcaaaacc-tg-aaaagtttctaagcataatgta-------------------agttag
                     Pika  gtt-agaaatataaaaacc-tg-aaaagtttggaaagccaacata-------------------aattag
                    Human  gatgtaaaatttcaaaacc-tg-aaaagtttctaagaataatata-------------------aattag
                    Chimp  gatgtaaaatttcaaaacc-tg-aaaagtttctaagaataatata-------------------aattag
                   Bonobo  gatgtaaaatttcaaaacc-tg-aaaagtttctaagaataatata-------------------aattag
                  Gorilla  gatgtaaaatttcaaaacc-tg-aaaagtttctaagaataatata-------------------aattag
                   Rhesus  gatgtaaaatttcaaaacc-tg-aaaagtttttaagaataatata-------------------aatcag
                 Marmoset  gatgtaaaatttccaaacc-tg---gagtttctaagaataatata-------------------agtcag
                  Tarsier  aatgtaaaacttcaagaac-tg-aaaagtttctaagcacaatgta-------------------aatcac
                 Bushbaby  gacttaacatttaaaaacc-tg-aaaagtctccaagcagaatgtt-------------------aatcag
               Tree shrew  gatgtgaaattttaaaatc-tg-aaaagtttctaggcaaaatgca-------------------aggtag
                      Pig  gatgtaaattatcaaaact-tg--aacattttaaagcataat-ta-------------------aatcag
                  Dolphin  gatgtaaaatatcaaaact-tg-aaaaatttctgtgcataat-ta-------------------aatcag
                      Cow  gatgtaaaatttcaaaact-tg-aaaaatttccatgcataat-ta-------------------agtcag
                    Sheep  gatgtaaaatttcaaaact-tg-aaaaatttccatgcataat-taagtcagttcagttcagttcagtcag
                    Horse  gatataaaatttccaaacc-tg---aaaagtttaagcacaat-ga-------------------aattgg
         Chinese pangolin  gatgtaaattttcaaaact-tc---aagtttctaagcacaat-ta-------------------aatcag
                      Dog  gatgtaaaatttcaaaact-tg-aaaagtttctaagtacaat-ta-------------------aatcag
       Hawaiian monk seal  gatgtaaaatttcaaaact-tg-aaaagtttctaagcacaat-ta-------------------aatcag
                 Hedgehog  actgtagaatttataaact-ta-aaagatccca-aatccaat-ta-------------------aattat
                    Shrew  gatgtaaaatttctgaact-tg-aaatgtttcacaatcaaat-tt-------------------agtta-
                 Elephant  -atgcaaatttccaaaacccgg-aaaagtttctaagcacagtgca-------------------gatcag
                   Tenrec  gatgcaaatttccaaaacagtg-aaaagtttctgagcacagtgaa-------------------aattgg
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
     Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                    Mouse  tggatac---------------tcttagga----------------tgaagactaaagatat
                      Rat  tggatac---------------tcttat----------------------gacaaaagatat
            GCF_003668045  tgtgtac--------aa-----cattatga----------------taaaggctgaagatag
                   Beaver  tagttat--------tc-----tattatcaaaatggta-ct-----taaatgctaaagatat
                 Squirrel  ttgctag--------tc-----tattatgattattaaa-atagtgcttaatactgacaatag
               Guinea pig  tgac------------------tattatgtttgtcaaa-gtaatgtttagtgctgaaggtat
                   Rabbit  tggctac--------ac-----tattaggattatttaa-atggtg-tttatgctgaagatat
                     Pika  tggctgc--------tc-----tgtcaagactgttaga-atagtc-tttttgctgaagattt
                    Human  tggctac--------tc-----tatgataattatcaaa-atagtgcttaatgttgaagatgt
                    Chimp  tggctac--------tc-----tatgataattatcaaa-atagtgcttaatgttgaagatgt
                   Bonobo  tggctac--------tc-----tatgataattatcaaa-atagtgcttaatgttgaagatgt
                  Gorilla  tggctac--------tc-----tatgataattatgaaa-atagtgcttaatgttgaagatgt
                   Rhesus  tggctac--------tc-----tatgataattatcaaa-atagtgcttaatgctgaagatgt
                 Marmoset  tggctac--------tc-----taagataattatcaaa-atagtgcttaatgctgaagaagt
                  Tarsier  tagctac--------tc-----tattataatcatcaaa-atagtgcttagtgctgaagatgt
                 Bushbaby  tagctgc--------tc-----tgttatgatga-gaaa-atagtgctcagtgctg-agatgt
               Tree shrew  tggctat--------tcaataatatgatgattatggaa-at---------------------
                      Pig  tagctac--------tc-----tattataattatcaaa-atagtgcttaatgctgaagatgt
                  Dolphin  tagctac--------tc-----tattatgattatcaaa-atagtgcttaatgctgaaggtgt
                      Cow  cagctac--------tc----------taactatcaaa-atagtgcttaatgctgaagatgt
                    Sheep  cagctac--------tc-----tattatagctgtcaaa-atagtgcttaatgctgaaggtgt
                    Horse  tagctac--------tc-----tatt---gttatcaaa-atagtgcttaatgctgaaagtgt
         Chinese pangolin  tggttat--------tc-----tattataattatcaga-atagtgcttaacgatgaaggtgt
                      Dog  tggttac--------tc-----tattataattatcaaa-atagtccttaatgatgaaggtgt
       Hawaiian monk seal  tggttac--------tc-----tattataattatcaaa-attgtgcttaatgatgaaggtgt
                 Hedgehog  aaattagcgcttgtcct-----tgttacaatgatcaca-atagttcttgatgctgaagatat
                    Shrew  ---------------ct-----cattacaatgtccaaa-acagagtttaatggtgaaggtat
                 Elephant  tggatac--------tc-----tattataatgattaaa-atagtgcttggtgctgaagatgt
                   Tenrec  tggatat--------tc-----taatataatgatcacatttagtgcttaggattgaaga-gt
                Zebrafish  ==============================================================
            X. tropicalis  ==============================================================
                  Opossum  ==============================================================
                  Chicken  ==============================================================
     Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 24 and 25 in window
B D           Tree shrew 522bp

Alignment block 25 of 407 in window, 56748934 - 56748953, 20 bps 
B D                 Mouse  gttaaggagacaaa---------------------------------------------cacttc
B D                   Rat  gttaaggagacaaa---------------------------------------------aacctc
            GCF_003668045  gttaaggaggcaaa---------------------------------------------cacttc
                   Beaver  gttaagtaggcaca------taaac--aggttg--tcaatttttgat------------cagttt
B D              Squirrel  gctacataggcata------taagcttaggttgtatcagtttttgatctgtttt----ggacttt
B D            Guinea pig  tctaagtaggttca------taaacttatgctgtctttttttttttttttttttttgagcaattt
B D                Rabbit  gtgaagtaggctga------------taggagataccattttttgag------------aaattt
B D                  Pika  gctaagtaggcaca----------tgtaggctgtatcatttttggag------------ccattt
B D                 Human  gccaag-------------------ttc-------------------------------------
B D                 Chimp  gccaag-------------------ttc-------------------------------------
B D                Bonobo  gccaag-------------------ttc-------------------------------------
B D               Gorilla  gccaag-------------------ttc-------------------------------------
B D                Rhesus  gctaagtaggcaca------taaacttc-------------------------------------
B D              Marmoset  accaagtaggcaca------taaatttc-------------------------------------
B D               Tarsier  gctaagtaggcaca------taagctta-------------------------------------
B D              Bushbaby  ggcaagtaggcaca------tacactta-------------------------------------
B D                   Pig  gctaagtagac------------acttagagtatgttatctt-----------------------
B D               Dolphin  gctaagtagacaca------tacacttagactgtgtcatttt-----------------------
B D                   Cow  gctaagtagacaca------tatacttagaatgtatcatttt-----------------------
B D                 Sheep  gctaagtagacaca------tatacttagaatgtatcatttt-----------------------
B D                 Horse  gctaagtggacac--------aaacttaggctgtgtcatttt-----------------------
B D      Chinese pangolin  gctaattaggcaca------taaacttaggccgtgccatttt-----------------------
B D                   Dog  tctaagtaggcaca------gaaatttaggctgtgtcatttt-----------------------
B D    Hawaiian monk seal  gctgagtaggcgca------gaaactgaggctgtgtcatttt-----------------------
B D              Hedgehog  gctaaattggcaag------taga-----acgttatcatttt-----------------------
B D                 Shrew  gcaaagtaggcgca------tagctt---acactgtcatttt-----------------------
B D              Elephant  gctaagtagccaca------tagact---------------------------------------
B D                Tenrec  gctaagtagtcataacaacttaagct---------------------------------------
B D            Tree shrew  =================================================================
B D             Zebrafish  =================================================================
B D         X. tropicalis  =================================================================
B D               Opossum  =================================================================
B D               Chicken  =================================================================
B D  Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 25 and 26 in window
B D           Guinea pig 3bp
B D               Rabbit 4bp
B D                 Pika 3bp
B D                Human 29bp
B D                Chimp 29bp
B D               Bonobo 29bp
B D              Gorilla 29bp
B D               Rhesus 27bp
B D             Marmoset 27bp
B D              Tarsier 28bp
B D             Bushbaby 29bp
B D                  Pig 14bp
B D              Dolphin 14bp
B D                  Cow 14bp
B D                Sheep 14bp
B D                Horse 14bp
B D     Chinese pangolin 14bp
B D                  Dog 14bp
B D   Hawaiian monk seal 14bp
B D             Hedgehog 14bp
B D                Shrew 14bp

Alignment block 26 of 407 in window, 56748954 - 56749100, 147 bps 
B D                 Mouse  ------------------acgttagacattaat-------ttggtgtaaaatta----cat---ttaaaa
B D                   Rat  ------------------actttagagattaat-------ttggtgtaaaatta----ca----taaaaa
            GCF_003668045  ------------------actttagacactgatt-t-c--ttgatgtaatatta----ca-----ataag
                   Beaver  ------------------tcttcagatattgag-----------ggtaaaatta----ta----tattaa
B D              Squirrel  ------------------acctt---cattaag-----------ggtaaagtga----ta----tattaa
B D            Guinea pig  ------------------actttggatattgatt-t-caatgaggattaaatta----ta------tcaa
B D                Rabbit  ------------------aacttagacattgatg-t-cattaaatgtaaaattaattata----tcttaa
B D                  Pika  ------------------accttggacattgatg-t-cactaagggtaaaattaaatgta----tcctaa
B D                 Human  ------------------actttagacattgatt-t-catgtaaggttaaattg----ca----cattaa
B D                 Chimp  ------------------actttagacattgatt-t-catgtaaggttaaattg----ca----cattaa
B D                Bonobo  ------------------actttagacattgatt-t-catgtaaggttaaattg----ca----cattaa
B D               Gorilla  ------------------actttagacattgatt-t-catgtaaggttaaattg----ca----cattaa
B D                Rhesus  ------------------actttagacattgatt-t-cgtgtaaagttaaatta----ca----cagtaa
B D              Marmoset  ------------------actttagacattgatt-t-catgtaggcttaaatta----ca----cataaa
B D               Tarsier  ------------------actttagacatttatt-t-cattgagggcaaaattg----tc----tattaa
B D              Bushbaby  ------------------attttagacattgatt-t-cgttgaaggtaaaatta----ta----ttttac
B D            Tree shrew  ------------------actttagacattgatt-t-cattaagggtacaatta----ca----tattaa
B D                   Pig  ------------------aatttagacattaatt-a-ccttgagggtaaaatta----ta----cattaa
B D               Dolphin  ------------------aatttagatgttgatt---------------aaata----ta----cattaa
B D                   Cow  ------------------agtttagacattaatt-t-ccttgagggtaaagtta----ta----cattaa
B D                 Sheep  ------------------agtttagacattaatt-t-ccttgagggtaaagtta----ta----cattaa
B D                 Horse  ------------------aatttagacattgttt-tccatgagggt-aaaatta----ta----cattaa
B D      Chinese pangolin  ------------------aatttagactttgatt-t-ccttgagggtaaaatta----ta----tat---
B D                   Dog  ------------------aatttagaccttgact-t-ccttgagggtaaaattc----ta----tactaa
B D    Hawaiian monk seal  ------------------aatttagacattgatt-t-ccttgagtgtaaaattc----ta----tactaa
B D              Hedgehog  ------------------agtgcaggcattgactat-tcttgaagataaaatca----tatttccattaa
B D                 Shrew  ------------------agcatagacattgatt-t-ccttgagggcaaaatca----ta----cataaa
B D              Elephant  atgtaatttttgtgaacaattttgga-----att-t-ccttgagggtaaaatta----ta----cattag
B D                Tenrec  atgtca--tttgtgagtaattttgga-----att-t-c----agcattgatttc----ct----tgaggg
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D  Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                    Mouse  ct-cataggaactaa------------ga----ac----acatag-----------------g--att--
                      Rat  tg-cttaagaactta------------ga----ac----acacag-----------------g--att--
            GCF_003668045  ct-cataaga-------------------------------atag-----------------g--agt--
                   Beaver  ta-ctttctgacaaa------------at----gc----aaaaa--------------------------
                 Squirrel  ca-ttcacttataaaaatgcaaaggtgaa----gt----gtatag-----------------c--ata--
               Guinea pig  ca-cttgctcagaaa------------aa----at----gcaaagataaagc----------a--tgt--
                   Rabbit  ta-cttgttca-aaa------------ac----at----gcagagatcaagtgtgttgcatat--att--
                     Pika  ca-cttgctc--aaa------------ac----at----gccaagatcaagtgtgttgtgcag--tct--
                    Human  ta-cttgttta-taa------------ac----at----acaaaggtaaa------------g--tgt--
                    Chimp  ta-cttgttta-taa------------ac----at----acaaaggtaaa------------g--tgt--
                   Bonobo  ta-cttgttta-taa------------ac----at----acaaaggtaaa------------g--tgt--
                  Gorilla  ta-cttgttta-taa------------ac----at----acaaaggtaaa------------g--tgt--
                   Rhesus  ta-cttgttta-taa------------ac----at----acaaaggtaaa------------g--tgt--
                 Marmoset  ta-cttgttca-taa------------ag----aa----acaaaggtaaa------------g--tgt--
                  Tarsier  ta-cttgctca-taa------------ac----ag----g-aaaggtaaact----------g--tgt--
                 Bushbaby  ta-ctttttca-taa------------ac----at----gcaaaagtaaa------------g--tg---
               Tree shrew  ta-cttgccca-taa------------ac----at----gtggatgtaaa------------gtatgt--
                      Pig  ag-ctggctca-tag------------aca----t----gcaaatgtaaggc----------a--tgt--
                  Dolphin  aa-cttgctca-taa------------acaaacat----gcaaat-----gt----------g--tgt--
                      Cow  aa-tttgctca-tca------------acaaactt----ggaaatgtaaggt----------g--tgt--
                    Sheep  aa-tttgttca-tca------------acaaactt----ggaaatgtaaggt----------g--tgt--
                    Horse  ta-cttgctca-tga------------ac----at----gcaaagataagtt----------g--tgt--
         Chinese pangolin  ---------------------------at----at----acatatata----------------------
                      Dog  ta-tttgctca-taa------------acaagaaa----gcagtgataaggt----------g--tctca
       Hawaiian monk seal  ta-cttgctca-taa------------acaaaaaa----gcaatggtaaggt----------g--tgt--
                 Hedgehog  ta-tttctgcc-taa------------acaa--ac----atagagttgcagc----------a--agt--
                    Shrew  ta-cttgctca-taa------------gcaaacac----atacaggcaaagc----------a--aac--
                 Elephant  ta-gctcttca-tag------------acaaatat----gcaaaggttagat----------g--tgt--
                   Tenrec  aatgtatttca-tac------------atgaatatttcctcataaacaaa--------------------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
     Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                    Mouse  ---------------------------------------tgca----tatgtgtgtatttctctta----
                      Rat  ---------------------------------------tgca----tatgtgtgtatttctcttg----
            GCF_003668045  ---------------------------------------tgcatgtgtgtgtgtgtatttctcttg----
                   Beaver  ---------------------------------------tgaa----gaaatttgcatttctcttgc---
                 Squirrel  ---------------------------------------tgtg----tgtgtgtgcatttctctta----
               Guinea pig  ---------------------------------------tgca----tatatgcatgcatttcttac---
                   Rabbit  ---------------------------------------agta----tatgtgtgcattcctcttac---
                     Pika  ---------------------------------------agca----tatgtgtgcattcccctcgc---
                    Human  ---------------------------------------tgcc--catatatgtgcatttctcttac---
                    Chimp  ---------------------------------------tgcc--catatatgtgcatttctcttac---
                   Bonobo  ---------------------------------------tgcc--catatatgtgcatttctcttac---
                  Gorilla  ---------------------------------------tgcc--catatatgtgcatttctcttac---
                   Rhesus  ---------------------------------------tgcc--catatatgtgcatttctcttac---
                 Marmoset  ---------------------------------------taca--catatatgttcatttctcttac---
                  Tarsier  ---------------------------------------tgta--ctcatatgtccatttctgttac---
                 Bushbaby  -------------------------------------------------------catttctcttac---
               Tree shrew  ---------------------------------------tcca--tgtatacatgtatttttctttc---
                      Pig  ----------------tgtgtgtgtgt--------------------cacacacacacttctcttac---
                  Dolphin  ----------------tgtgtgtgtgtattcc----------a--tacatatatgcatttctcctac---
                      Cow  ------------tgtgtgtgtgtgtgtattcc--------ata--tatgtatatgcatttctcctac---
                    Sheep  --------------tgtgtgtgtgtgtattccatatatatata--tatatatatgcatttctcctac---
                    Horse  -------------------------------------tgtata--tgtatatgtgcatttctcatac---
         Chinese pangolin  -------------------------------------tatata--tatatatatgtat-----atat---
                      Dog  tatatatatatatatatatatataagtgtctcatatatatgca--tatatatatgcatttctcttac---
       Hawaiian monk seal  -----------------------------------tgtgtgta--tatatatgtgcatttctcttac---
                 Hedgehog  --------------------------------------------------ctcagcaattctcttgcctt
                    Shrew  --------------------------------------------------atatgtgtttgtcttaccat
                 Elephant  ---------------------------------------tata--t-tgtgtttacattgctcttac---
                   Tenrec  ---------------------------------------catg--c-aaaggtta-gttg-tgatat---
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
     Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                    Mouse  ------------aaata--------------------ttctaaa--------gctaattttaatgtta-c
                      Rat  ------------aaata--------------------ttctaaa--------gctaagtttaatttta-c
            GCF_003668045  ------------caata-------------------tttttaaa--------gctaactttaatttta-c
                   Beaver  ------------cagta--------------------gtcaaaa--------ggcagctttaatttta-g
                 Squirrel  -------------------------------------cttg-----------------------------
               Guinea pig  ------------cagta--------------------ttcaaag--------ggcagctttaattttt-a
                   Rabbit  ------------ccata--------------------ttcaaag--------ggcagctttatttttc-a
                     Pika  ------------tcata--------------------tacagaa--------agaaactttcttgctc-a
                    Human  ------------caata--------------------ttcaaag--------ggcagatttattttta-a
                    Chimp  ------------caata--------------------ttcaaag--------ggcagatttattttta-a
                   Bonobo  ------------caata--------------------ttcaaag--------ggcagatttattttta-a
                  Gorilla  ------------caata--------------------ttcaaag--------ggcagatttattttta-a
                   Rhesus  ------------caatg--------------------ttcaaag--------ggcagatttattttta-a
                 Marmoset  ------------caata--------------------tttaaag--------gacagattta-gttta-a
                  Tarsier  ------------caaca--------------------tacaaag--------ggaagatttatctttt-a
                 Bushbaby  ------------tgata--------------------ctaaaag--------ggcagatttatttttg-a
               Tree shrew  ------------taata--------------------ctcaatg--------ggcaattttattttta-a
                      Pig  ------------cagta--------------------ttcaaagggcagcttggtagctttattttttaa
                  Dolphin  ------------aaata--------------------ttcaaag--------ggtagttttatttttt-t
                      Cow  ------------aaata--------------------tttgaag--------ggtaattttatttttt-a
                    Sheep  ------------aaata--------------------tttgaag--------ggtaatttta----tt-a
                    Horse  ------------caata--------------------ttcaaag--------ggcagctttattttta-c
         Chinese pangolin  ------------atata-----------------------------------------tatatatata-c
                      Dog  ------------aaata--------------------ttcaaag--------ggcaggtttattttta-a
       Hawaiian monk seal  ------------caata--------------------ttcaaag--------ggcagctttattttta-a
                 Hedgehog  ctg-ccagtatgcaata--------------------ttcaaag--------ggcaact-----------
                    Shrew  atattcagatctcaaaa--------------------tttaagg--------gtggagttaattt-ta-a
                 Elephant  ------------cagta--------------------tttaaag--------ggcagcttta-tttta-a
                   Tenrec  ------------atgtagcagtttctctcacccatatttaaaag--------agcagctttgtttttt-a
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
     Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                    Mouse  atgt--ccaccacccccccaccactaccaca
                      Rat  a-----acacccccccccaaaca----cata
            GCF_003668045  aagttgccactgcccc-------------ta
                   Beaver  aag---tcattt-----------------tt
                 Squirrel  ------ttatct-----------------tt
               Guinea pig  ggta--caactt-----------------tt
                   Rabbit  aagttttttttt-----------------tt
                     Pika  aag---tcattt-----------------tc
                    Human  aag---ttattt-----------------tt
                    Chimp  aag---ttattt-----------------tt
                   Bonobo  aag---ttattt-----------------tt
                  Gorilla  aag---ttattt-----------------tt
                   Rhesus  aag---ttattt-----------------tt
                 Marmoset  aag---ttattt-----------------tt
                  Tarsier  aag---ttattt-----------------tt
                 Bushbaby  aag---ttattt-----------------tt
               Tree shrew  aag---ttactt-----------------tt
                      Pig  aag---tcattt-----------------tt
                  Dolphin  aag---ttatat-----------------tt
                      Cow  agg---ttattt-----------------tt
                    Sheep  agg---ttattt-----------------tt
                    Horse  aag---ttactt-----------------tt
         Chinese pangolin  aca---tttctc-----------------tt
                      Dog  aaa---tcattt-----------------tt
       Hawaiian monk seal  aag---ttattt-----------------tt
                 Hedgehog  ------ttattt-----------------tt
                    Shrew  agg---ttattt-----------------tt
                 Elephant  aag---ttattt-----------------tt
                   Tenrec  aag---ttgttc-----------------tt
                Zebrafish  ===============================
            X. tropicalis  ===============================
                  Opossum  ===============================
                  Chicken  ===============================
     Malayan flying lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 26 and 27 in window
B D           Tree shrew 2bp

Alignment block 27 of 407 in window, 56749101 - 56749533, 433 bps 
B D                 Mouse  caaagtattg-------tcaat---at-at---------tctgataaaaa-attaac------ttaggca
B D                   Rat  cacagtgttg-------tcaac---at-at---------tctgataaaaa-gttaac------tcacgta
            GCF_003668045  caaagtattg-------ttagc---at-at---------tcggataaaaaggttaac------tcaggta
                   Beaver  taaaatgtta-------tcaat----------------------caaagc-ataaac------tcaggta
B D              Squirrel  caaaatgtta-------tta------t-at---------tccaaccaaaatgtgaac------tcaggta
B D            Guinea pig  ggaaatgtcg-------ttctcataat-at---------tctagccaaatgatgaac------tcaggta
B D                Rabbit  cacagtgtta-------tcagc---at-at---------tccaatccaaatgtaaat------ctaggta
B D                  Pika  cacaatgtaa-------ccagc---at-at---------tccaactcagttgtgaac------ccaggca
B D                 Human  caaaatggaa-------tcagc---at-at---------ttcaaccaaaatgtaaac------tctggta
B D                 Chimp  caaaatggaa-------tcagc---at-at---------ttcaaccaaaatgtaaac------tctggta
B D                Bonobo  caaaatggaa-------tcagc---at-at---------ttcaaccaaaatgtaaac------tctggta
B D               Gorilla  caaaatggaa-------tcagc---at-at---------ttcaaccaaaatgtaaac------tctggta
B D                Rhesus  caaaatggaa-------tcagc---at-at---------ttcaaccaaaatgtaaac------tcaggta
B D              Marmoset  caaaatggtg-------tcagc---at-at---------ttcaaccaaaatgtaaac------tcaggca
B D               Tarsier  caaaatgtta-------tcagc---at-at---------ttcagccaaaatgtaaac------tcaggta
B D              Bushbaby  caaactgctagtacttgtcgct---gt-at---------ttcaaccaaaatgtcaat------ccaggta
B D            Tree shrew  -aaaatgttt-------ttggc---ataat---------tttgaccaaaatgtaagc------tcaggtg
B D  Malayan flying lemur  caaaatgtta-------tcagc---at-at---------tccaaccaaaatgtaaac------tcagata
B D                   Pig  caaagtgtta-------tcagt---gt------------tacaacccaagtttagcc------ttgggta
B D               Dolphin  caaaatgtta-------tcagc---at-atgtccatttccacaaccctagtgtaaac------ttaggta
B D                   Cow  caaaatgtta-------tcagc---at-atgtaagtttctacaatcctagtataaac------ttgggta
B D                 Sheep  caaagtgtta-------tcagc---at-atgtatgtttctacaatcctagtgtaaac------ttgggta
B D                 Horse  caaaatgttg-------taagc---at-atgtacatttttacaaccaaaatgtaaac------tcaggta
B D      Chinese pangolin  -------------------------------------------accaatattcaaag------ggaagt-
B D                   Dog  caaaatgtta-------tcagc---at-aagtacacttttacaat-caaatgtaaac------ttaagta
B D    Hawaiian monk seal  caaaatgtta-------tcagc---at-aagtacacttttacaacaaaaatgtaaac------ttaagaa
B D              Hedgehog  aaaaatatta-------tcagc---at-atgt-tgtttttacaac-aaaatgtgaac------tcagcta
B D                 Shrew  caaaatatta-------taaat---at-gta--catttttacaaa-caaatataaat------tcaggta
B D              Elephant  caaaacgtta-------tcagt---at-at---------ttcaaccaaaatgtaaac------tcaagta
B D                Tenrec  caaagtatta-------tcagt---at-at---------ttcaaccaaaatgtaaacttaaagtcaggtt
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  cca---tt-tg------cccc--------------------tgtg-------------gccagcaa-aac
                      Rat  cca---tt-tg------tctc--------------------tctg-------------gccagcaa-acc
            GCF_003668045  ccc---at-tg------cccc--------------------tctg-------------gccaacaa-aac
                   Beaver  tca---tt-tt------cctc--------------------tctgt---------ataattaataa-aac
                 Squirrel  aca---tt-tc------cccc--------------------tctgt---at--gaataactatcaa-aac
               Guinea pig  gcc---tt-tt------tttc--------------------tctg---------tataattaacaa-aac
                   Rabbit  aca---tc-tc------cacc-c------------------tctg---------tatagtgagcaa-aac
                     Pika  aca---gc-tc------cccctt------------------tctg---------tataatgaacaa-aac
                    Human  aca---cg-ta--tttttccc--------------------tctgc---tt--atattatggacaataac
                    Chimp  aca---ca-ta--tttttccc--------------------tctgc---tt--atattatggacaaaaac
                   Bonobo  aca---ca-ta---ttttccc--------------------tctgc---tt--atattatggacaaaaac
                  Gorilla  aca---cg-ta--tttttccc--------------------tctgc---tt--atattatggacaaaaac
                   Rhesus  aca---ca-ta--tttttccc--------------------tctgt---tt--atattatggacaaaaac
                 Marmoset  aca---ca-tt-cttttttcc--------------------tcagt---tt--atattatggacaaaatc
                  Tarsier  aca---tg-t---ttggaaaa--------------------catgt---tt--atattatggacaa-aac
                 Bushbaby  aca---t------tttttcct--------------------tctgt---tt--atattttggacaa-aac
               Tree shrew  tat---tcatcccctgcccct--------------------gccat---ct---taataagaacaa-agc
     Malayan flying lemur  aca---tc-ccccctgccccc--------------------ccccc---ctccatattatgaacaa-aac
                      Pig  aga---ct-tt------tctc--------------------tat-----tt--gtattatgaacaa-aaa
                  Dolphin  aaa---ct-tt------tctc--------------------tat-----tt--gtattataaacaa-aaa
                      Cow  aca---ct-tt------tctc-----------------------------t--gtgttatgaacaa-aaa
                    Sheep  aca---ct-tt------tctc-----------------------------t--gtgttatgaacaa-aaa
                    Horse  aca---at-tt------ttct-c------------------tat-----tt--gtattatgaacaa-aat
         Chinese pangolin  ------------------------------------------------------tattatgaacaa-aat
                      Dog  aca---tt-tc------tcct--------------------tat-----tt--gtattatgaacaa-aat
       Hawaiian monk seal  aca---tt-tc------tcct-c------------------tat-----tt--gtattatgaacaa-aat
                 Hedgehog  aca---tt-tt------ttt---------------------tttccatctt--gtactatgaacaa-aca
                    Shrew  aca---ta-tt------ttct-ctatttgtatagagtaaaatttgtatttt--ctatt-tgggcaa-aat
                 Elephant  aca-gttt-tt------tttc--------------------tccat---tt--atattatgaacaa-act
                   Tenrec  acatgctt-ct------tccc--------------------tccat---tt--gtact----actc-cat
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ttgaatgtccttgag----------aaagg-aa------a---g-c------------------------
                      Rat  ttgaaagtcttaggg----------aaagg-ga------a---g-c------------------------
            GCF_003668045  ttaaaagcccttaac----------aaagg-aa------a---g-c------------------------
                   Beaver  ttgaaggtctttcgc----------a------a------a---g-c------------------------
                 Squirrel  ttgaaagtttttgac----------aa-----a------a---g-c------------------------
               Guinea pig  ttgaaagtatttgat----------aaagg-aa------a---g-a------------------------
                   Rabbit  ttgaaagtctttcac----------caaaa-aa------a---g-gg---gggggaggg-----------
                     Pika  tttaaagcctttcac----------caaaa-aa------a---g-gaggcgggggagggaggaagaatat
                    Human  ttgaatgtctttggc--c-------aaaaa-aa------a---g-c------------------------
                    Chimp  ttgaatgtctttggc--c-------aaaaa-aa------a---g-c------------------------
                   Bonobo  ttgaatgtctttggc--c-------aaaaa-aa------a---g-c------------------------
                  Gorilla  ttgaatgtctttggc--c-------aaaaa-aa------a---g-c------------------------
                   Rhesus  ttgaatgtctttggc--c-------aaaaa-aa------a---atc------------------------
                 Marmoset  ttgaatgtctttggc--c-------aaata-aa------a---g-c------------------------
                  Tarsier  ttgaaagtctttggc--c-------aaaat-a-------------t------------------------
                 Bushbaby  ttgaaagtctttggc--c-------aaaaa-a-------g---g-c------------------------
               Tree shrew  ttggaaatttttcct--caagggaaaaaaa-aa------t---g-c------------------------
     Malayan flying lemur  ttgcaagtctctggc--caaaagaaaaaaa-ga------a---a-c------------------------
                      Pig  ttgaaagtctttg-c----------aaaaa-aa------aaaat-c------------------------
                  Dolphin  ttgaaagtctttggc--a-------aaaaa-aa------aaatt-c------------------------
                      Cow  ttgaaagtctttgacaaa-------aaaaa-aa------aaatt-c------------------------
                    Sheep  ttg--agtctttgac----------aaaaa-aa------aaatt-c------------------------
                    Horse  ttgaaagtcttcagc----------aaaaa-aa------aaatt-c------------------------
         Chinese pangolin  tataaagtgtttgcc----------aaaaa-at------g---t-c------------------------
                      Dog  tt-aaagttttcagc----------aaaag-ag------a--tt-c------------------------
       Hawaiian monk seal  ttgaaagcttttgac----------aa------------a--tt-c------------------------
                 Hedgehog  ttcaaagtatttagc----------aaaca-aa------g---c-t------------------------
                    Shrew  ttt--ggtctttggc----------aaaaataa------a---t-t------------------------
                 Elephant  ttgagggtctttggt--taaa----gataa-aa------a---t-c------------------------
                   Tenrec  ttgaaagtctttggt--taaa----aaaga-aaggaagta---t-c------------------------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ---tg-aagaaatttgc-----------ct-gtaatgctttttgggcgtttgca-gttgtaaataattac
                      Rat  ---tg-aagaaatttgc-----------ct-gtgatac-ttttgggcttttgcc-gttataactaattac
            GCF_003668045  ---tgaaaaaaaatcac-----------ct-gcaatat-atttgggtgttcaca-gttataattaactac
                   Beaver  ---tgtaacatagttgc-----------cc-ctacaactttcagggcatttata-gttgttattaaatag
                 Squirrel  ---tg-aaaatttttgc-----------cc-aaaataa-tttagggcatttatg-gttgttattaaataa
               Guinea pig  ---tc-aagaattttgc-----------tt-ataatactttcagggtactcaca-gttgttattaaatag
                   Rabbit  ---ta-aaaatgttttc-----------cc-ataatactttcagggaatttata-gtagttattaagtag
                     Pika  taata-aatttgcttcc-----------cctacattactttcagggcatttgca-gttgttactaagtag
                    Human  ---tt-taaaatttttc-----------cc------actttcagggcatttgtg-attgttattaaatag
                    Chimp  ---tt-taaaaattttc-----------cc------actttcagggcatttgtg-attgttattaaatag
                   Bonobo  ---tt-taaaaattttc-----------cc------actttcagggcatttgtg-attgttattaaatag
                  Gorilla  ---tt-taaaaattttc-----------cc------actttcagggcatttgtg-attgttattaaatag
                   Rhesus  ---tt-taaaaattttc-----------ca------actttcagagcatttgtg-attgttattaaatag
                 Marmoset  ---tt-taaaaattttc-----------cc------actttcagggcatttgtg-attgttattaaataa
                  Tarsier  ---ct-taaaaattttg-----------cccacaatactttcagggcattttta-gttgttattaactag
                 Bushbaby  ---ta-cagaaag-----------------------gggggaaggatatgtttacaattttattaaatag
               Tree shrew  ---ta-aaaatttcttg-----------accataatacttccagggcatttatg-gttgttattaaatag
     Malayan flying lemur  ---ct-aaaaatttttg-----------tccctaacttttccaaggcatttatg-attgttattaaatac
                      Pig  ---tc-aaaaattttgc-----------at-ataatacttttagggcatttata-gttgttactgattcg
                  Dolphin  ---tc-aaaatttttgc-----------ac-ataatacttttagttcatttatg-gttgttattaaatag
                      Cow  ---tt-aagatttttgc-----------cc-ataatacttttatggtatttatg-gttgttattaaatag
                    Sheep  ---tc-aagatttttgc-----------cc-ataatacttttatggtatttatg-gttgttattaaatag
                    Horse  ---ta-aaagtttttgc-----------ac-atagtgctttcagggcatttaca-gttgttattaaatag
         Chinese pangolin  ---aa-atttttcttgc-----------at-attatactttcagggcattta----tgcttattaaatag
                      Dog  ---tc-aaaaattatgc-----------ac-ataatactttcagggcatttata-atttttggtaaatag
       Hawaiian monk seal  ---tc-aaaaattatgc-----------ac-ataatactttcagggcacttata-atttttattaaatag
                 Hedgehog  ---ct-aaagattttttttttttttttgac-aaaacactttcagggcattt-ta-gttgctattgaatag
                    Shrew  ---ct-aaaaattttgc-----------ac-gtaacattttaagtgaattt----atcattactaaataa
                 Elephant  ---tt-gcaattttggc-----------ac-atgatattttcagggcatttaca----gttattaaagag
                   Tenrec  ----a-acatttttggc-----------ac-aca----ttttagggcatttacc-tttgttattaaaaag
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tgtgatacc---ctttaatgctag-tttccttctggtgtgcaca--g-gggagactgagagttcagact-
                      Rat  tgtgttttc---ctttaatgctag-tttccttttggtgtgcaca--g-gggagattgagagttcagact-
            GCF_003668045  cgtgctatt---cttaaaagctag-tttccttttggtgcactca--gtgggggattgagagaacagact-
                   Beaver  tgagatatt---atgtgatatcag-tttcattttttaatataaa--ggaggaaactaaggttctcgaatg
                 Squirrel  tgcaaaatg---atattataccag-tttcattttagtgtataaa--ggaggaaattgagaattcagaat-
               Guinea pig  cgcagtatt--------atactag-tttcattttagtatataaa--ggaggaagttgagaattcagtatc
                   Rabbit  tgcaatatt----tgtgatagcag-tttcattttagcatgcaaa--ggaggaaattgagacttcagagtc
                     Pika  agcaatagt---atgtaatacctg-tttcatttcggcatgcaaa--ggagaaaattcagatttcagaatc
                    Human  tgcaaaatt---atatgatactag-tttaattttattatacaaa--gaaggaaattgagaattcagaatc
                    Chimp  tgcaaaatt---atatgatactag-tttaattttattatacaaa--gaaggaaattgagaattcagaatc
                   Bonobo  tgcaaaatt---atatgatactag-tttaattttattatacaaa--gaaggaaattgagaattcagaatc
                  Gorilla  tgcaaaatt---atatgatactag-tttaattttattatacaaa--gaaggaaattgagaattcagaatc
                   Rhesus  cgcaatatt---atgtgatactag-tttaattttattatataaa--gaaggaaattgagaattcagaatc
                 Marmoset  tgcgatact---atacgatactag-tttaattttattatataaa--gaaggaaattgagaattcagaatc
                  Tarsier  tacagtatt---atatgatgccag-tttag------tatataaa--ggaggaaatcaagaattcagaatc
                 Bushbaby  cacaatatt---atatgacgccagctttcattttagtatctgaactgaaggagactgagaacttataatc
               Tree shrew  tacggtatt---atatgatatcgg-tttcat---------------------------------------
     Malayan flying lemur  tgcaatatt---atatgattccag-tttcattttatcatataaa--ggaggaaattgagaattcagaatc
                      Pig  tgcactattataatatggtctcag-tttcattttattacatgaa--ggaggaaattgagggttcaggatc
                  Dolphin  tgtagtatt---atataatctcag-tttcattttagtatataaa--ggaggaaatcaagggttcaggatt
                      Cow  cgcactatt---acatgatctcag-tttcattttagttaataaa--ggaggaaattgagagttcaggatc
                    Sheep  cacactatt---atatgatctcag-tttcattttagttaataaa--ggaggaaattgagagttcaggatc
                    Horse  cgccatatt---gtatgatcctag-ttttattttagtatataaa--ggaagaaattgagaattcagaatc
         Chinese pangolin  ttcaatatt---atatgatctcag-cttcattttagtacacaaa--ggaggaagttgagaattcagaatc
                      Dog  tgcaacatt---atatgagcctag-tttcaatttagtatataga--ggaggaaattgagaattcaaaatc
       Hawaiian monk seal  tgcaatatt---atctgatcccag-tttcaatttagtatataga--ggaggaaattgagaattcagaatc
                 Hedgehog  tgcaatatg---atatgatcccag-tttcattttaacatataga--ggaggaaattgagactttagaatc
                    Shrew  ttcaatatt---atatgtccccag-tttagtttttatatgtaaa--ggaggatattgaaaattcagaatc
                 Elephant  tgcggtatt---atctaatgccag-gttcattttagtgtacaaa--ggtagaaattaagaatt-----ct
                   Tenrec  ggtagtctg---acatagcatcag-tttcattttg--atataaa--ggaagaaattaagaattgagagcc
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -cagagcttagagc-gtg----ctttc---ttgggagacacctgtaaa-atggctacagaa-t-aagctg
                      Rat  -cagagcttagagc-atg----ttttc---ttggaagacacctgtaaa-atggctatagaa-c-aagctg
            GCF_003668045  -cagagctcagggt-ata----ttttc---ttggaagacacctgtaaa-atgaccacagaa-c-aagccg
                   Beaver  ataaagcttagagcaata----gcttc---tcagaagacacctgtgaa-attaccaaaggg-ctgaactg
                 Squirrel  -caggacttagagc-aca----ttttc---tcagaagtcccctataaa-attaccaaatgg-ctgaactg
               Guinea pig  ataggacttagagc-aga----tttt----ttggaagacatttgttaa-attacca-agcc-t-gagtcg
                   Rabbit  acagggcttggtgc-ata----tttcc---ccagaagacacctgtaaa-attaccaaaggg-ttgaattg
                     Pika  atagggcttcatgt-gta----ttttg---ccaggagacacctgtaaa-attaccagaggg-ttgaactg
                    Human  atagagcttaaagc-ata----ttttt---cttgaggacatctgtaga-attaccaaaggg-ctaaacta
                    Chimp  atagagcttaaagc-ata----ttttt---cttgaggacatctgtaga-attaccaaaggg-ctaaacta
                   Bonobo  atagagcttaaagc-ata----ttttt---cttgaggacatctgtaga-attaccaaaggg-ctaaacta
                  Gorilla  atagagcttaaagc-ata----ttttt---cttgaggacatctgtaga-attaccaaaggg-ctaaacta
                   Rhesus  atagtgcttaaagc-ata----ttttt---cctgaggacacctgtaga-attaccaagggg-ctaaacta
                 Marmoset  ataggatttaaagc-ata----ttttt---cctgaggacacctggaga-attaccaaaggg-ctaaacta
                  Tarsier  atagagcttagaac-ata----ttttc---ccaaaagacaactgtaaa-attaccataggg-ctgaactg
                 Bushbaby  ataaggcttagagc-ata----tttttttcccagatgacacctgtaaa-attaccaaaagg-ctgaacta
               Tree shrew  ----------------------tttcc---ccagaagacacctgtaaa-attaccaaaggg-atgaaata
     Malayan flying lemur  ataggtcttagagc-ata----ttttt---ccagaagacacctgtaaa-attaccaaaggg-ctgaactg
                      Pig  ataggacttaga-c-acaatc-ctttc---tcaaaagacacctgtaaattttaccaaagtatataaattg
                  Dolphin  atagggtttagagc-ataatc-ctttg---tcagaatatacctgtaaa-attaccagaggggctgacttg
                      Cow  ataggacttagagc-ataatc-ctttg---tcagaatatacctgtaaa-attacca--------------
                    Sheep  ataggacttagagc-ataatc-ctttg---tcagaatatacctgtaaa-attacca--------------
                    Horse  gtaggacttacagc-ataatc-ttttc---ccagaagacacctgtaaa-attaccaaaagggctgaattg
         Chinese pangolin  ataggatttcaagc-ataatc-ttttt---ccagaagacatctgtaaa-attaccaaaggggctgaattg
                      Dog  ataggaattagagc-ataatc-ttttc---ccagaagacacctgtaaa-attaccaaagggactgaattg
       Hawaiian monk seal  ctaggaattagagc-ataatc-ttttc---ccagaagacacctgtaaa-attaccaaagggactgaattg
                 Hedgehog  atagaactcagagc-ataatc-ttctc---ccaggggacacctgtaaa-ttaacaaagggg--tgattga
                    Shrew  acagtacacatggc-ata--c-ttttc---cca-gacacacctgtaaa-attaccaagggggctgaatta
                 Elephant  ac----ctttgaac-atg----ttttc---ttggaagacatcggtaca-attactaaagggggtgaattg
                   Tenrec  atagggcttagcgc-atactattttcc---caagaagacatctgtaga-attaccgaagtgggtgaattg
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -gaacc---------------tgagcac------tgatactattggccaccatgatctagactttctatt
                      Rat  -gaggc---------------tgagccc------tgatactgttggttatcatgatctagactttctat-
            GCF_003668045  -gcaac---------------tgagtac------tgagtctatgggctaccatgatctagagttcctatt
                   Beaver  -gcaac---------------tgattat------tgatgttattgattaccataatctagaatctctatt
                 Squirrel  -gcaac---------------taattat------ggatcctattgattactgtaatctacagttttta--
               Guinea pig  -ccagc---------------cgattat------caaaactattgattaatacaatggagagtttctgtt
                   Rabbit  -gcaac---------------tgattat------agattctgttcattaccataatctagagttt-tctt
                     Pika  -gcaac---------------caattat------agatcctattgtttagcataatgtagagtttctatt
                    Human  tgcaac---------------tgagtat------agatactattgattaccataatctagagtttctatt
                    Chimp  tgcaac---------------tgagtat------agatactattgattaccataatctagagtttctatt
                   Bonobo  tgcaat---------------tgagtat------agatactattgattaccataatctagagtttctatt
                  Gorilla  tgcaac---------------tgagtat------agatactattgattaccataatctagagtttctatt
                   Rhesus  cacaac---------------tgagtat------agatactattgattaccataacctagagtttctatt
                 Marmoset  tgcaac---------------taagtat------agatactattgattaccataatctagagtttctatt
                  Tarsier  -gcaac---------------tgattat------agatactattgattactgtaatctagggtttctatt
                 Bushbaby  ----at---------------tgattac------agatactattgattactataatctagagtttctatt
               Tree shrew  -gcaac---------------tgattat------agataccgttgattatcataatctggactttctatt
     Malayan flying lemur  -gcatc---------------tgattgt------agagattattgattactttaatctagaatttctatt
                      Pig  -acaac---------------tgatcat------aggttctattgattatcataacctagagtttctatt
                  Dolphin  -acaac---------------tgatcat------aggttctattgattactgtaatctagagtttctatt
                      Cow  -acaat---------------tgatcat------aggttttattgattactgtaatctagagtttctgtt
                    Sheep  -acaat---------------tgatcat------agattctattgattactatagtctagagtttctgtt
                    Horse  -acaac---------------tgattat------aggtactattgattactgtaatttagagtttctact
         Chinese pangolin  -ataat---------------tgattgt------aggtactattgattaccgtaaactagagtttctatt
                      Dog  -acaac---------------tgattgt------aggtactagtgattaccgtaatctagagattctatt
       Hawaiian monk seal  -acaag---------------tgattgt------aggtac--gtgattaccgtaatctagagtttctatt
                 Hedgehog  ---------------------tgattcc------aggtcctactgattactgtaatctagagtttttact
                    Shrew  -aaaac---------------tgattgc------aggtacgattgattactgtaatctagagttcctatt
                 Elephant  -acaac---------------tgagtac------aggtacaattaatgacagtaatcgagagtttgtatt
                   Tenrec  -acaactgttatgggtaaaattgattactgtaataggtacaattgattactgtcatctagagttcctatt
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ctcaa--taaac------------------------tgc----------aaagatgccc---------ga
                      Rat  -tcaa--taact------------------------tgc----------aaacaggtcc---------aa
            GCF_003668045  ttcaggtcagac------------------------ttc----------aaagatgact---------ga
                   Beaver  ttcagcttaaac------------------------tgc------aaagaaagatgcct---------ga
                 Squirrel  ---ag--ttaca------------------------tgg----------aaagat---------------
               Guinea pig  ttcaccttaaac------------------------tgatttaagacagaaagacacct---------ga
                   Rabbit  tgcaacttcaac-------------------------gt------aaagaacgatgtgc---------ca
                     Pika  tgcagcttcaac------------------------tgt------aaagaaagatgccc---------ca
                    Human  ttcagcttaaac------------------------tgt------aaagacagatgtcc--------tga
                    Chimp  ttcagcttaaac------------------------tgt------aaagacagatgtcc--------tga
                   Bonobo  ttcagcttaaac------------------------tgt------aaagacagatgtcc--------tga
                  Gorilla  ttcagcttaaac------------------------tgt------aaagacagatgtcc--------tga
                   Rhesus  ttcagcttaaac------------------------tgt------agagacagatgccc--------tga
                 Marmoset  ttcagctt-aac------------------------tgt------aaagacagatgccc--------tga
                  Tarsier  ttcagcttaagc------------------------tgc------aaagaaa----------------ga
                 Bushbaby  tttcacttaaat------------------------cgc------aaagaaagatgtctgactcgtagga
               Tree shrew  tttagacc-aac------------------------tac----------ataaatgtcc---------aa
     Malayan flying lemur  tttagcttaaac------------------------tgc------aaagaaagatgccc---------aa
                      Pig  gtcagcttaaac------------------------tgc------aaagaaagattccc---------aa
                  Dolphin  ttcagcttaaac------------------------tgc------aaagaaagatgccc---------aa
                      Cow  ttcagcttaaac------------------------tgc------aaagaaagttgccc---------ga
                    Sheep  ttcagcttaaac------------------------tgc------aaagaaagttgccc---------aa
                    Horse  ttcagcttaaac------------------------tgc------aaagaaagatgtct---------gc
         Chinese pangolin  ttcagcttaaac------------------------tgc------aaagaaagatgcct---------ga
                      Dog  ttcagcttaaac------------------------gca------aaaaaaggatgact---------ga
       Hawaiian monk seal  ttcagtttaaactgcaaaaaaaaaaaaaaaaaaaaagaa------aaagaaagatgcct---------ga
                 Hedgehog  atcagctgaaac------------------------tgt------aaaaaaagatgcct---------ga
                    Shrew  tttagcttaaac------------------------tgt------aaagaaagatgtcc---------ga
                 Elephant  ct-agcttaaac------------------------tgc------agataaagatgcct---------aa
                   Tenrec  ttcaacttaaac------------------------tgc------agagaaagatcctt---------gg
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ttgcc-aggaatcagaactgcatgcacatttcagccat-----atgtgtac---ctacttaaca-tgt-t
                      Rat  tccct-aggaattagaaatgcatgcatagttcagtcat-----acatgtac---ctcctattcactgtgt
            GCF_003668045  tcacc-aggaattagaactgtgtgcacatttcagtcat-----acccgtac---ctattcactg-tgt-t
                   Beaver  ttcat-aataattagaact--------atcttcgatat-----gcataagc---ttt--------tgttt
                 Squirrel  -------agaaagaggactgtg---------caactat-----atacatat---cttttg-----ttt-t
               Guinea pig  ttctt-actagttagaattgtatgcacattttagctatgtacagtatatac---ctatattttg-ttt-t
                   Rabbit  ttcct-agtcattataactgtgtgcaca-tacagccac-----atgcatgcaatcttttg-----ttt-t
                     Pika  ttcct-ggtaattac-actgtgtgcacatttcagcaac-----atgcacaaaa-catcta-----ttt-g
                    Human  ttcct-agtaattaaaactgtatgcacatttcagctat-----gcatatac---ctatcttttg-tct-t
                    Chimp  ttcct-agtaattaaaactgtatgcacatttcagctat-----gcatatac---ctatcttttg-tct-t
                   Bonobo  ttcct-agtaattaaaactgtatgcacatttcagctat-----gcatatac---ctatcttttg-tct-t
                  Gorilla  ttcct-agtaattaaaactgtatgcacatttcagctat-----gcatatac---ctatcttttg-tct-t
                   Rhesus  ttcct-actaattaaaactgtatgcacatttcagctat-----gcatatag---atatcttttg-tct-t
                 Marmoset  ttcct-agtaattaaaacggtatgcacatttcagctat-----gcgtatac---ctatcttttg-tct-t
                  Tarsier  ttccc-agtaattaccatcatatgcacatttcagctat-----aaacacac---ctatcttttg-ttt-c
                 Bushbaby  gtccc-agtaattggaactgcgcacacatttctgctat-----acacacac---ctatcttttg-ttt-t
               Tree shrew  ttcct-gctaattagaactctatgtacatttcagctat-----acagacac---ctatcttttg-tat-t
     Malayan flying lemur  ttcct-agtaagtagaactgcatgcacatttcaggtat-----ctacacac---ctatcttttg-ttt-t
                      Pig  ttgct-agtaataataaccttataca--------------------cacat---ctatc--ttg-ttt-t
                  Dolphin  ttgct-agtaattagaaccttatgca--------------------cacat---ctatc--ttg-ttt-t
                      Cow  ttgct-agtaattagaaccttatgca--------------------cacat---ctatc--ttg-ttt-t
                    Sheep  ttgct-agtaattagaaccttatgca--------------------cacat---ctatc--ttg-ttt-t
                    Horse  ttgct-agtaattagaaccttatgcacatttcagctat-----acacacac---ctatcttttg-ttc-t
         Chinese pangolin  acgct-agtaattagaaccttatgcacatttcagctat-----acgcacac---ctatcttttg-ttt-t
                      Dog  tcact-agtaattagaaccttatgcacatttcagctat-----agacatac---ctatcttttg-ttt-t
       Hawaiian monk seal  tcgct-agtaattagaagcttatgtacatttcagctgt-----atacacac---ctatcttttg-ttt-t
                 Hedgehog  ct----------------ttcatgcacatttcagctat-----atgcacac-----agctcttg-ttt-t
                    Shrew  ttgct-agtaattagaaccttatgctcatttcagctat-----gcacatac---ctaccttttc-ttt-t
                 Elephant  ttcct-ggtaattataac---------atttcagccat-----acaca-tt---ttatctttgg-ttt-g
                   Tenrec  ttcctgggggatcaggac---------atttcagttat-----atacactc---ttatctttgg-tgt-g
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tg-aaaat-t-agttttgaatgtctgaa-ttta---tctta
                      Rat  tg-aaaat-t-agttgtgaatgcccaaa-ttta---tctta
            GCF_003668045  tg-aaaat-t-agtttagaatatccaaa-ttca---tcttg
                   Beaver  tt-gaaat-t-agtttagaatattcaaa-tctg---tcttg
                 Squirrel  aa-aaaat-t-agtttagaatattaaaattttc---tctta
               Guinea pig  tg-aaaat-t-agtttagaacactccta-tttgtgttctta
                   Rabbit  tg-aaaaa-t--gtctagaatattcaaa-tgtc---t-taa
                     Pika  tg-aaaat-ttagtttagaatattcaaa-tgtc---t----
                    Human  tg-aaaat-tcagtgtagaatattctaa-cttg---tctta
                    Chimp  tg-aaaat-tcagtgtagaatattctaa-cttg---tctta
                   Bonobo  tg-aaaat-tcagtgtagaatattctaa-cttg---tctta
                  Gorilla  tg-aaaat-tcagtttagaatattctaa-cttg---tctta
                   Rhesus  tg-aaaat-tcagtttagaatattccaa-cttg---tctta
                 Marmoset  tg-aaaat-ttagtttagaatattcaac-cttg---tctta
                  Tarsier  ag-gaaaa-ttagcttaaaatattcaaa-cttg---tctta
                 Bushbaby  tg-aaaaa-ttagtttacaacattcaaa-cttg---tctta
               Tree shrew  tg-aaaaa-ttagtttagaatattcaaa-cttg---aatta
     Malayan flying lemur  tg--aaaa-ttagtttagaatattgaaa-cttg---tctta
                      Pig  ta-aaaca-ttagcttagaatattcaaa-ctta---cctta
                  Dolphin  ta-aaaca-ttagtttagaatattcaaa-c-------tgta
                      Cow  ta-aaaca------ttagaatattcaaa-cttg---ttgta
                    Sheep  ta-aaaca------ttagaatattcaaa-cttg---ttgta
                    Horse  ta-aaatatctagtttagaatattcaaa-cttg---tctta
         Chinese pangolin  ta-aaatg-ctagtttagaatattcaaa-cttg---tctta
                      Dog  tt-aaata-ctaatttagaatattcaaa-cttg---tctta
       Hawaiian monk seal  ttaaaata-ctaatatagaatattcaag-cttg---tctta
                 Hedgehog  ta-aaaca-ctagtttagcatattcaaa-cgtg---cttta
                    Shrew  tg-aaa-----------------------------------
                 Elephant  tg-aaaca-ttagttcagaatattcaaa-cttg---tctta
                   Tenrec  tg-aaaca-tt-----gaaatattcaaa-ctta---tctta
                Zebrafish  =========================================
            X. tropicalis  =========================================
                  Opossum  =========================================
                  Chicken  =========================================

Inserts between block 27 and 28 in window
B D             Hedgehog 86bp

Alignment block 28 of 407 in window, 56749534 - 56749538, 5 bps 
B D                 Mouse  cacat----
B D                   Rat  cacat----
            GCF_003668045  cacat----
                   Beaver  tacat----
B D              Squirrel  cacat----
B D            Guinea pig  tgcat----
B D                Rabbit  tacat----
B D                  Pika  tacat----
B D                 Human  catat----
B D                 Chimp  catat----
B D                Bonobo  catat----
B D               Gorilla  catat----
B D                Rhesus  catat----
B D              Marmoset  catat----
B D               Tarsier  cacat----
B D              Bushbaby  gatgt----
B D            Tree shrew  tacat----
B D  Malayan flying lemur  cacat----
B D                   Pig  cac------
B D               Dolphin  cac------
B D                   Cow  cac------
B D                 Sheep  cac------
B D                 Horse  cac------
B D      Chinese pangolin  cac------
B D                   Dog  ctg------
B D    Hawaiian monk seal  ctg------
B D              Elephant  aacgttaat
B D                Tenrec  aacactaat
B D              Hedgehog  =========
B D             Zebrafish  =========
B D         X. tropicalis  =========
B D               Opossum  =========
B D               Chicken  =========
B D                 Shrew  ---------

Inserts between block 28 and 29 in window
B D           Guinea pig 171bp
B D               Rabbit 4bp
B D                 Pika 4bp
B D                  Pig 1bp
B D              Dolphin 1bp
B D                  Cow 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp

Alignment block 29 of 407 in window, 56749539 - 56749539, 1 bps 
B D                 Mouse  -a
B D                   Rat  -t
            GCF_003668045  -t
                   Beaver  -t
B D              Squirrel  -t
B D                 Human  -t
B D                 Chimp  -t
B D                Bonobo  -t
B D               Gorilla  -t
B D                Rhesus  -t
B D              Marmoset  -t
B D               Tarsier  -g
B D              Bushbaby  -t
B D            Tree shrew  -t
B D  Malayan flying lemur  -t
B D              Elephant  a-
B D                Tenrec  a-
B D            Guinea pig  ==
B D                 Sheep  ==
B D    Hawaiian monk seal  ==
B D                   Dog  ==
B D                 Horse  ==
B D              Hedgehog  ==
B D                  Pika  ==
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D                   Cow  ==
B D               Opossum  ==
B D               Chicken  ==
B D                 Shrew  --
B D                   Pig  ==
B D                Rabbit  ==
B D      Chinese pangolin  ==
B D               Dolphin  ==

Inserts between block 29 and 30 in window
B D                Human 4bp
B D                Chimp 4bp
B D               Bonobo 4bp
B D              Gorilla 4bp
B D               Rhesus 4bp
B D             Marmoset 4bp
B D              Tarsier 4bp
B D             Bushbaby 4bp
B D           Tree shrew 95bp
B D Malayan flying lemur 4bp

Alignment block 30 of 407 in window, 56749540 - 56749575, 36 bps 
B D                 Mouse  tg-------agccttg--------tagctcata-----------------------tgggactcccgttc
B D                   Rat  aa-------tgtattg--------taactcata-----------------------tgggactcccgttc
            GCF_003668045  ca-------agc--tg--------taattcata-----------------------ttggaatcccattc
                   Beaver  aa------ttgcacta--------tagttgatatttttaacaatattattttaatgttttaatgcctttc
B D              Squirrel  aac----actacaccc--------taattgaca-----------------------t---attattattc
B D                Rabbit  -------atcacactg--------tatttaatatt---------------------ttataataccattc
B D                  Pika  -------ataacactt--------taattggtatt---------------------ttatagtaccataa
B D                 Human  --------ttacattg--------taattaatatt---------------------ttgcagtgccattc
B D                 Chimp  --------ttacattg--------taattaatatt---------------------ttgcagtgccattc
B D                Bonobo  --------ttacattg--------taattaatatt---------------------ttgcagtgccattc
B D               Gorilla  --------ttacattg--------taattaatatt---------------------ttgcagtgccattc
B D                Rhesus  --------ttacattg--------taattaacatt---------------------ttgcagtgccattc
B D              Marmoset  --------ttacattg--------taattaatatt---------------------ttgcactgccattc
B D               Tarsier  --------ttatggtgtattacaataattaatatt---------------------ttactgtgccaatc
B D              Bushbaby  --------tcacattgtaat----taattaatatt---------------------ttatagtgccaggc
B D  Malayan flying lemur  --------ttacactg--------tagttaatatt---------------------ttacagtgccattc
B D                   Pig  --ttaatattacactg--------taactgatacg---------------------ttatagtgccattc
B D               Dolphin  --ttaatattacactg--------caattgatatt---------------------ttatattgccattc
B D                   Cow  --ttactgttatactg--------caattgatatt---------------------ttatagtgccattc
B D                 Sheep  --ttactgttatatta--------caattgatatt---------------------ttatattgccattc
B D                 Horse  --ttaatgttacactg--------caatcaatgtt---------------------atatggtgccttcg
B D      Chinese pangolin  --ttaatattacactg--------ccaaggatatt---------------------ttatagtgccatgc
B D                   Dog  --ttaatattacattg--------aagtcaacatt---------------------tcacattgccatgc
B D    Hawaiian monk seal  --ttaatactacattg--------aagtcaatatt---------------------ttatattaccattc
B D              Elephant  --------ttacagag--------taactgatatt---------------------ttatagtgccattc
B D                Tenrec  --------ttgcactg--------tagttaatatt---------------------ttatagtgccattc
B D            Guinea pig  ======================================================================
B D            Tree shrew  ======================================================================
B D              Hedgehog  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D                 Shrew  ----------------------------------------------------------------------

                    Mouse  agaa
                      Rat  agaa
            GCF_003668045  agaa
                   Beaver  agaa
                 Squirrel  agaa
                   Rabbit  agaa
                     Pika  ataa
                    Human  agaa
                    Chimp  agaa
                   Bonobo  agaa
                  Gorilla  agaa
                   Rhesus  agaa
                 Marmoset  agaa
                  Tarsier  ggaa
                 Bushbaby  agaa
     Malayan flying lemur  agaa
                      Pig  agaa
                  Dolphin  tgaa
                      Cow  agaa
                    Sheep  agaa
                    Horse  ggag
         Chinese pangolin  agag
                      Dog  agaa
       Hawaiian monk seal  agaa
                 Elephant  agaa
                   Tenrec  tgaa
               Guinea pig  ====
               Tree shrew  ====
                 Hedgehog  ====
                Zebrafish  ====
            X. tropicalis  ====
                  Opossum  ====
                  Chicken  ====
                    Shrew  ----

Alignment block 31 of 407 in window, 56749576 - 56749657, 82 bps 
B D                 Mouse  ctcgttgttgact-----------------aggag---------agaatatttctt----tatct---tg
B D                   Rat  ctctttgttaact-----------------aggat---------agaatatttatt----tatct---ta
            GCF_003668045  gtctttgttgact-----------------aggat---------agaatatttatt----tatct---ta
                   Beaver  gtctttattgtccaattcta----------agaac---------agaatactcatt----tattt---ta
B D              Squirrel  gactttattgagtatctctg----------aagat---------agaatatttact----tcttt---ta
B D            Guinea pig  gcccttatggtgtatctctg----------aagat---------agaatatttatt----tattt---ta
B D                Rabbit  gtccttattgtccatctctg----------agaac---------agaatatttattttagttttt---ta
B D                  Pika  gtccttgttgtctatctctg-----------gaac---------agaatatttagtgt--ttttt---tt
B D                 Human  gtccttattgtc----tctg----------aggat---------agaatattta--------ttt---tg
B D                 Chimp  gtccttattgtc----tctg----------aggat---------agaatgttta--------ttt---tg
B D                Bonobo  gtccttattgtc----tctg----------aggat---------agaatgttta--------ttt---tg
B D               Gorilla  gtccttattgtc----tctg----------aggat---------agaatattta--------ttt---tg
B D                Rhesus  gtccttattgtc----tctg----------aggat---------agaatattta--------ttt---tg
B D              Marmoset  gtccttattgtc----tctg----------aggat---------agaatattta--------ttt---tg
B D               Tarsier  gtctttattgtctatatctg----------aggac---------aggatatttatt----tgttt---tg
B D              Bushbaby  gtccttattgtctatctctg----------cagat---------agaatatttatt----tattt---tg
B D  Malayan flying lemur  gtccttattgtctgtctctg----------aggat---------agagtattgatt----tattt---tg
B D                   Pig  gtccttattgtctacctctg----------aggatggaagaaaaagaatatttatt----tatttaggtt
B D               Dolphin  gtcc-tattgtctatcttta----------aggataggagaaaaaggatatttagt----t-------tg
B D                   Cow  atccttattgtctatcttt----------------------aaaaggatatttatt----t-------tt
B D                 Sheep  atccttattgtctatctttg----------aggatagaagaaaaaggatatttatt----t-------tt
B D                 Horse  tt-cttattgtctacctctg----------aggttagaagaaaaagaatacttatt----tattt---tg
B D      Chinese pangolin  gt-cctattgtctacctctg----------gggatagaagaaaaagagtacatatt----tattt---tg
B D                   Dog  gtccttattgtctaccgttg----------aggatagaagaagaggaatacttatt----tgttt---tg
B D    Hawaiian monk seal  gtacttattatctacccttt----------gggatagaagaagaagaagatttatt----tg-tt---tg
B D                 Shrew  -----tactgact-------------------------------------------------------ta
B D              Elephant  atccatattgtctacttctgaggataaaaaaggatagaggaaagataatatttatt--------t---tg
B D                Tenrec  ttccatattaccacctttgg-----------ggagagaggaaa-ataatatttact--------t---tg
B D            Tree shrew  ======================================================================
B D              Hedgehog  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  ga----tt-at-tc---aac-----cacatttgtaagt-aaggaagtacactgagaaaag
                      Rat  ga----ct-tt-tc---aac-----tacatttgtaagt-aagg---------------ag
            GCF_003668045  ga--tttt-tt-tc---aac-----cacacttactatt-gggc---------------ag
                   Beaver  gc--cttt-ct-tc---acc-----tgtatttaatatt-gggc---------------aa
                 Squirrel  gc----tt-tt-cc---acc-----tacatttaatatt-gagc---------------tg
               Guinea pig  gcttttct-tt-tc---act-----tccttttaatatt-ggac---------------ta
                   Rabbit  aa---------------atc-----tacatctaatatt-ggac---------------ta
                     Pika  aa---------------gcc-----ctcatgtaatatc-ggac---------------ta
                    Human  gc--tttt-tt-at---acc-----cacagttaatattggggc---------------ta
                    Chimp  gc--tttt-tt-at---acc-----cacagttaatattggggc---------------ta
                   Bonobo  gc--tttt-tt-at---acc-----cacagttaatattggggc---------------ta
                  Gorilla  gc--tttt-tc-at---acc-----cacagttaatattggggc---------------ta
                   Rhesus  gc--tttt-tt-aa---acc-----cacagttagtatgggggc---------------ta
                 Marmoset  gc--tttt-ta-aa---acc-----cacagttaatattgaggc---------------ta
                  Tarsier  gc--tttt-tt--c---act-----cactttttctatt-aggc---------------ta
                 Bushbaby  gc--tttt-tt--c---acc-----tacatttcatatt-gggc---------------ta
     Malayan flying lemur  gc--tttt-ttttc---acc-----tacttttaatatt-gggc---------------ta
                      Pig  tt--tttt-tt--taaaacc-----caca-ttaatatt-gggc---------------ta
                  Dolphin  gc--tttt-tt--c---acc-----cacatttaatatt-gggc---------------ta
                      Cow  ac--tttt-tt--c---acc-----tacatttaatgtt-gggc---------------tc
                    Sheep  ac--tttt-tt--c---act-----tacatttaatgtt-gggc---------------tt
                    Horse  gc-ttttt-tt--c---tcc-----cgcatttaatatt-gggc---------------ta
         Chinese pangolin  gc--tttt-tt--c---acc-----tacatttaatatg-tggc---------------ta
                      Dog  gc--tttt-tt--c---acc-----tgcatttaatatt-gggc---------------ta
       Hawaiian monk seal  gc--tttt-tt--c---acc-----tgcatttaatatt-gggc---------------ca
                    Shrew  aa--atat-tc--c---actgattatacaattaacatt-acac---------------ag
                 Elephant  ac--tttt-tctcc---tct-----cacatttaatttt-gggc---------------ta
                   Tenrec  gc--ttttcttttt---tcc-----cacatttaatatt-gggc---------------ta
               Tree shrew  ============================================================
                 Hedgehog  ============================================================
                Zebrafish  ============================================================
            X. tropicalis  ============================================================
                  Opossum  ============================================================
                  Chicken  ============================================================

Inserts between block 31 and 32 in window
B D                  Pig 1bp
B D              Dolphin 1bp
B D                  Cow 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 22bp
B D   Hawaiian monk seal 1bp
B D                Shrew 1bp

Alignment block 32 of 407 in window, 56749658 - 56749704, 47 bps 
B D                 Mouse  g----aaatccttagcc-----tcg-----------tctgactgtgaa-ggaaacgttg---tctacttg
B D                   Rat  g----aaatccttactc-----tca-----------tcttactgcgaagggaaacaatg---tttacttg
            GCF_003668045  g----aaatccttactc-----tca-----------tctacttgtgaaaggaaacaatg---ttttctat
                   Beaver  g----aaatccttaat--------a-----------tctcattctgaatggcagcaatg---ttctctgg
B D              Squirrel  g----acat-tttaatc-----tca-----------gccaattctgaatggcaacaatg---ttccctgg
B D            Guinea pig  g----aagtctttagat-----ttagtaaactattttctaattgtgaatgggcacagtt---ttgtctgg
B D                Rabbit  c----aagttcttaata-----cca-----------tctaattctgaatggcaacaatg---ttctctgg
B D                  Pika  g----aaatctttaata-----cca-----------actaattctgaatgacaccaatg---ttttctgg
B D                 Human  g----aagtacttaatt-----cca-----------tttacttctgaatggcaacaatg---ttctctgc
B D                 Chimp  g----aagtacttaatt-----cca-----------tttacttctgaatggcaacaatg---ttctctgc
B D                Bonobo  g----aagtacttaatt-----cca-----------tttacttctgaatggcaacaatg---ttctctgc
B D               Gorilla  g----aagtacttaatt-----cca-----------tttacttctgaatggcaacaatg---ttctctgc
B D                Rhesus  g----aagtacttaatc-----cca-----------tttgcttctgaatggcaacaatg---ttctctgg
B D              Marmoset  a----aagtccttaatc-----tca-----------tttacttctgaatggcaacaatg---ttctctgg
B D               Tarsier  g----aaatccctaatc-----tta-----------cttaattctgaat-gcaacaatg---ttctctga
B D              Bushbaby  g----aaatccttaatctaaaatca-----------tttaattcttaatggcaacagtg---ttccctcg
B D            Tree shrew  g----caatccttaatc-----tca-----------tcactttttgaatg---acagtg---ctctctgg
B D  Malayan flying lemur  g----aaatccttaatc-----tca-----------tttaattctgaatggcaacaatg---ttctct-g
B D                   Pig  -----aattctttaatc-----tca-----------tctaaccctgaatatcaacaaagctgttctcttg
B D               Dolphin  -----aactctttaatc-----tca-----------tctaactctgaatgacaataatg---ttctctgg
B D                   Cow  -----aactctttaatc-----tca-----------tctaactctcaatgacaataatgt--ttctctgg
B D                 Sheep  -----aactctttaatc-----tca-----------tttaactctcagtgacaataatgt--ttctctgg
B D                 Horse  -----aactctttaatc-----tct-----------tctgtttt-gaatggtaacagtg---ctccctgg
B D      Chinese pangolin  -----aaatctttactc-----tca-----------tctaattc-tgatggcaacaatg---ctctctgg
B D                   Dog  aaaaaaaatccttaaac-----tca-----------tctaattctgaatggcaaaca-----ttctctgt
B D    Hawaiian monk seal  -----aaatccttaatc-----tca-----------tctaattctgaatggcaaccatg---ttctcttg
B D                 Shrew  -----aatttat----------------------------------------------------------
B D              Elephant  g----aaatctttcatc-----tca-----------gctaattctgaatgacagcaatg---ttctctgg
B D                Tenrec  g----aaatcattaatc-----tca-----------tctaattctgaatgacaacaatg---ttctctgg
B D              Hedgehog  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  t
                      Rat  t
            GCF_003668045  t
                   Beaver  t
                 Squirrel  t
               Guinea pig  c
                   Rabbit  c
                     Pika  c
                    Human  t
                    Chimp  t
                   Bonobo  t
                  Gorilla  t
                   Rhesus  t
                 Marmoset  t
                  Tarsier  t
                 Bushbaby  t
               Tree shrew  t
     Malayan flying lemur  t
                      Pig  t
                  Dolphin  t
                      Cow  g
                    Sheep  a
                    Horse  t
         Chinese pangolin  t
                      Dog  t
       Hawaiian monk seal  t
                    Shrew  -
                 Elephant  c
                   Tenrec  t
                 Hedgehog  =
                Zebrafish  =
            X. tropicalis  =
                  Opossum  =
                  Chicken  =

Inserts between block 32 and 33 in window
B D                  Pig 151bp
B D              Dolphin 15bp
B D                  Cow 15bp
B D                Sheep 15bp
B D                Horse 15bp
B D     Chinese pangolin 15bp
B D                  Dog 14bp
B D   Hawaiian monk seal 14bp

Alignment block 33 of 407 in window, 56749705 - 56749857, 153 bps 
B D                 Mouse  tct----------ttct-atgt-agtcaaatgaaagcacaaaaa-tc-tgacttaaagtgatc-aagtgg
B D                   Rat  tct----------ttct-attt-agtcaaatgaaagcacaaaaa-tt-tgacttgatgtgatc-aagtgg
            GCF_003668045  tga----------tttt-cttc-tgt----tgaaggcaaaaaaa-tcttgacttaatgttatc-aagtga
                   Beaver  ttctaatggctggtttt-cttc-tgt----tgaaagcataaaac-ct-ctatggaatgcaatc-aaatgg
B D              Squirrel  cct-aatgtctgattct-gttc-tgt----taaaagcataaaac-tg-ctattgaatataatc-aaatgg
B D            Guinea pig  tcc----------tgatggttg-tgt----tgaaagcataaaac-ct-ctattgagtaccaac-aaatag
B D                Rabbit  tcctaacagctggtttt-cttcttgt----gggaagcataatgc-tg-ctgttgaatacaaga-gaatgg
B D                  Pika  tcctaa-agctggtttt-cttc-tgt----ggaaagtggagtat-tg-ctgttgaatacaata-gaatgg
B D                 Human  tcctgatggccggttct-cttc-tgt----tgaaagcataaaac-tc-caatggaataaaatt-gagtgg
B D                 Chimp  tcctgatggccggttct-cttc-tgt----tgaaagcataaaac-tc-caatggaataaaatt-gaatgg
B D                Bonobo  tcctgatggccggttct-cttc-tgt----tgaaagcataaaac-tc-caatggaataaaatt-gaatgg
B D               Gorilla  tcctgatggccggttct-cttc-tgt----tgaaagcataaaac-tc-caatggaataaaatt-gaatgg
B D                Rhesus  tccttatggctggttct-tttc-tgt----tgaaagcataaaac-tc-caatagaatacaattggaatgg
B D              Marmoset  tgctgatggtgggttct-cttc-tgt----tgaaagcataaaac-tc-caatggaatacaattggaatgg
B D               Tarsier  ttcaaatgactggttct-tttc-tgt----tgacagcataaaac-ct-ctattgaatataattgaaatgg
B D              Bushbaby  ttgtaatggttggttct-attc-tgt----tgaaagcataaaat-ct-ctattaaatacaatg-gaatgg
B D            Tree shrew  ttgtaatggctggctct-ctgc-tgt----tgaaagcataaaaatct-atattgaatacaatc-aaatgg
B D  Malayan flying lemur  tcctagtggctagttct-cttc-tgt----tgaaaggataaaaa-ct-ctaatgaaaacaatt-aaatgg
B D                   Pig  ---------------tc-tctc-tat---------atatacaca-ta-catatacatgtatat-atatgg
B D               Dolphin  ---------------ct-tttc-tgt----ggaaaatgtaaaac-ct-ctcttgaatgcaact-gcatgg
B D                   Cow  ---------------ct-ttta-agt----tgaaaatataaaa--ct-ctcttgaatgcaact-gcatgg
B D                 Sheep  ---------------ct-tttc-tgt----tggaaatataaaa--ct-ctcttgaatgcaact-gcatgg
B D                 Horse  ---------------gt-cttc-tgc----tgaaagcattaaac-ct-ctattgaatgcaatt-gcatgg
B D      Chinese pangolin  ---------------ct-cttc-tgt----tgaaagcataaatc-ct-tgactgaatgcaatt-gcatgg
B D                   Dog  ---------------ct-cttc-tgt----tgaaagcataaaac-ct-ctactgaatgcaatt-gcatgg
B D    Hawaiian monk seal  ---------------ct-cttc-tgt----tgaaaac--aaaat-ct-ctactgaatgcaatt-gcatgg
B D                 Shrew  ----------------------------------------------------------------------
B D              Elephant  tcttagtggctggttcc-cttc-tgt----tgaaagcctaaaac-cc-ctat-gaacacaatt-gcacag
B D                Tenrec  tcttaat------ttat-cttc-tgt----tgaatgtctaaaag-tc-ctat-gaacataacc-acatag
B D              Hedgehog  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  ata-----------------aaa--------------gt-g----aga--------tggacagc-c----
                      Rat  ata-----------------aaa--------------at-g----aaa--------tgg-----------
            GCF_003668045  aaa-----------------aaa--------------ac-a----tgat-------tagataaa-c----
                   Beaver  aaa-----------------aaa--------------ag-a----acat---caaatagagaaa-c----
                 Squirrel  --c-----------------aaa--------------ag-a----acat---taaagagacaaa-c----
               Guinea pig  --c-----------------aaa--------------ag-c----acattt-tacatagagaaa-c----
                   Rabbit  --c-----------------aaa--------------ag-g----atatta-----tagaaaga-a----
                     Pika  --c-----------------aaa--------------ag-a----acattc-----tatgaaga-a----
                    Human  --c-----------------caa--------------aa-a----acct---tatatagagaat-c----
                    Chimp  --c-----------------caa--------------aa-a----acct---tatatagagaat-c----
                   Bonobo  --c-----------------caa--------------aa-a----acct---tatatagagaat-c----
                  Gorilla  --c-----------------caa--------------aa-a----acct---tatatagagaat-c----
                   Rhesus  --t-----------------caa--------------aa-a----acct---catatagagaat-c----
                 Marmoset  --c-----------------caa--------------aaca----acct---tatatagagaat-c----
                  Tarsier  --c-----------------aaa--------------at-a----actt---tagatagagaat-c----
                 Bushbaby  --a-----------------aaa--------------aa-a----acattg-tatacaggggat-c----
               Tree shrew  --c-----------------aag--------------a---------------ataaacagaaagc----
     Malayan flying lemur  --c-----------------aaa--------------ag-a----acattattataaagagaaa-c----
                      Pig  --agagagatcgaaacagagatatcgagacaaagaaaga-gaggcagag------agagagaaa-c----
                  Dolphin  --c-----------------aaaacaaaacaaaaacaaa-a----acat------acagagaaa-c----
                      Cow  --c-------------aaaaaaaacccaacaacaaacaa-a----acat------acagagaaa-c----
                    Sheep  --c--------aaaaaaaaaaaaacccaacaacaaacaa-a----acat------atagagaaa-c----
                    Horse  --c-----------------aaa--------------aa-a----gcat------ataggaaaa-c----
         Chinese pangolin  --c-----------------aaa--------------aa-a----cccc------atggaggaa-c----
                      Dog  --c-----------------aaa-----------------------------------gagaag-gcggc
       Hawaiian monk seal  --c-----------------aaa-----------------------------------gaaaag-g----
                    Shrew  ----------------------------------------------------------------------
                 Elephant  --c-----------------aaa--------------ag-a----acat---tgtacagagaaa-t----
                   Tenrec  --t-----------------aaa--------------ga-a----ccat---tgtatagagaaa-c----
                 Hedgehog  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -------------ataggtgttgagctatatc---tgttcttttccatgaaatttggtaaaatt-aataa
                      Rat  -------------ataggtgttgagctgtatc---tgttcttttacatggaatttggt-aaatt-agtaa
            GCF_003668045  -------------ataggtgttgggctatatc---tgt------------aatttgga-aagtt-aataa
                   Beaver  -------------atagaggttggaatatgtc---tgcccttttacg-------tagt-gaatc-aatac
                 Squirrel  -------------a-agaggttggactatata---tgcccttttacatggaacttgtc-gaatt-aatgc
               Guinea pig  -------------atgggggttgggatacatc---tgtcctttcacatgggacttagt-gagtt-gatgc
                   Rabbit  -------------atgaaaattggaacatatc---tgtccttcaatgtgatactt-----aatt-agagc
                     Pika  -------------a-------tggaatgtatc---tgtcctttattgtagtatttaga-gaatt-aaaga
                    Human  -------------atagggactggaatacatt---tgcccttttaggaagtatttcat-gaatt-aatgc
                    Chimp  -------------acagggactggaatacatt---tgcccttttaggaagtatttcat-gaatt-aatgc
                   Bonobo  -------------acagggactggaatacatt---tgcccttttaggaagtatttcat-gaatt-aatgc
                  Gorilla  -------------atagggactggaatacatt---tgcccttttaggaagtatttcat-gaatt-aatgc
                   Rhesus  -------------acaggggctggaatacatt---tgtccttttaggaagtctttagt-gaatt-aatgc
                 Marmoset  -------------ataggggctggaatacatt---tgcccttttaggaagtatttagt-gaatt-aatgc
                  Tarsier  -------------atagggattggagtatttc---tgcccttttgcatggtacttaat-gaatcaaatgc
                 Bushbaby  -------------atggggtttggaatgtatc---tgcccttttacatggtgcttagt-gaact-aatgc
               Tree shrew  -------------atgtagattggaatatatc---tgcccttttatgaggtgctt-----aatt-aatac
     Malayan flying lemur  -------------atggggattggaatatatc---tgctcttttacatggtacttagt-gagtt-aatgc
                      Pig  -------------at-gaggttggaatatatc---tactcttttacatggtactgagt-aaatt-aatgc
                  Dolphin  -------------at-gaggttggaatagatc---tacccttatacgtggtacttagt-gaatt-aatgc
                      Cow  -------------at-gaggttggaatatatc---tacccttttatatggtacttagt-gaatt-attgc
                    Sheep  -------------gt-gaggttggactatatc---tacccttttatatagtacttagt-gaatt-actgc
                    Horse  -------------at-ggggtgggaatatatc---tacccttatatgtggtacttagt-gaatc-aatgc
         Chinese pangolin  -------------at-gaggttgggatatatc---taccctt-tacattgtacctagt-gaatt-aatgc
                      Dog  atgtggtggtggtgg-aggattgaaatatatc---tacccttttacatggtacttagt-gaatt-aatgc
       Hawaiian monk seal  -------------gg-gggattggaatatatc---tacccttttacatggtacttagt-gaatt-aatgc
                    Shrew  -------------------att---ttatatcaggaattcctttgtctgctccatttt-aagtt-aatac
                 Elephant  -------------cgaggggttggaatatatc---tgccctttaaaat---------------------g
                   Tenrec  -------------cga------ggaatatatc---tgcctttaaaaatattatttgaa-aaatt-gatag
                 Hedgehog  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ttg-attttattcacccagttc------------------------------------------------
                      Rat  ttg-atcttattcacacagttc------------------------------------------------
            GCF_003668045  ttg-attttatttacacagttc------------------------------------------------
                   Beaver  ctc-attttgttcaaacagttt------------------------------------------------
                 Squirrel  ctt-gttttattcaaacagttt------------------------------------------------
               Guinea pig  ttc-attgtgttcaatcagttt------------------------------------------------
                   Rabbit  cta-ttttttt--agacagttt------------------------------------------------
                     Pika  ctt-attttttccaagtagttt------------------------------------------------
                    Human  ctcaattttattcaaactatat------------------------------------------------
                    Chimp  ctcaattttattcaaactatat------------------------------------------------
                   Bonobo  ctcaattttattcaaactatat------------------------------------------------
                  Gorilla  ctcaattttattcaaactatat------------------------------------------------
                   Rhesus  ttcaattttattcaagctatgt------------------------------------------------
                 Marmoset  ctc-attttattcaaactagat------------------------------------------------
                  Tarsier  ttc-atttaattcaaaa-gttt------------------------------------------------
                 Bushbaby  ctc-attttattcaaacagttg------------------------------------------------
               Tree shrew  ctt-actttattagaagaattc------------------------------------------------
     Malayan flying lemur  ccc-tttttattaaaacagttt------------------------------------------------
                      Pig  ctc-a-tctgtttaaacagttt------------------------------------------------
                  Dolphin  ctc-attct-----aacagttt------------------------------------------------
                      Cow  ctc-attctttttaaagagttc------------------------------------------------
                    Sheep  ctc-attctttttaaagagttc------------------------------------------------
                    Horse  ctc-gttttatttaaacagttt------------------------------------------------
         Chinese pangolin  ttc-agtttatttaaagagttt------------------------------------------------
                      Dog  ttc-attttatttaaacagtttataaatagttgtatttttaaaaatttttttattggagttcaatttgcc
       Hawaiian monk seal  ttc-atttaatttaaaaagtct------------------------------------------------
                    Shrew  t------------------ttc------------------------------------------------
                 Elephant  cct-ccttttaaaaaacagtat------------------------------------------------
                   Tenrec  ttt-cttttaaaaattctttcc------------------------------------------------
                 Hedgehog  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ---------------ata
                      Rat  ---------------ata
            GCF_003668045  ---------------ata
                   Beaver  ---------------ata
                 Squirrel  ---------------ata
               Guinea pig  ---------------aca
                   Rabbit  ---------------ata
                     Pika  ---------------gta
                    Human  ---------------ata
                    Chimp  ---------------ata
                   Bonobo  ---------------ata
                  Gorilla  ---------------ata
                   Rhesus  ---------------ata
                 Marmoset  ---------------ata
                  Tarsier  ---------------ata
                 Bushbaby  ---------------aca
               Tree shrew  ---------------atc
     Malayan flying lemur  ---------------ata
                      Pig  ---------------atc
                  Dolphin  ---------------ata
                      Cow  ---------------ata
                    Sheep  ---------------ata
                    Horse  ---------------ata
         Chinese pangolin  ---------------ata
                      Dog  aacatatagcataacata
       Hawaiian monk seal  ---------------ata
                    Shrew  ---------------ata
                 Elephant  ---------------aaa
                   Tenrec  ---------------aaa
                 Hedgehog  ==================
                Zebrafish  ==================
            X. tropicalis  ==================
                  Opossum  ==================
                  Chicken  ==================

Alignment block 34 of 407 in window, 56749858 - 56750053, 196 bps 
B D                 Mouse  aataaatgcatagt--ttatgaaaagtttag--tctatattg-gcttgtttcctc-agaa-caa-acaca
B D                   Rat  aatacatgtatagt--ttatggaaagttgag--tctgcact--gtgcgttccctc-agaa-caa-acaca
            GCF_003668045  aataaatgcatagt--ttttgaaaagttatc--tccaaatag-gcatgtttcctc-agaa-caa-acata
                   Beaver  aataaatatgtatt--tcttgaaaacctttc--taca-ataa-gcatactttctc-agaa-aaa-aatta
B D              Squirrel  agtaactatattgt--tc--------ttttc--tacaaatga-atatactttctc-agaa-aaa-at---
B D            Guinea pig  aataattatatggc--ccttgaaagcct----------attc-acatacttactc-caaa-aat-atgca
B D                Rabbit  aataattgtgtagt--tctagaaacattttc--tactaacaggccctagtttctc-agaa-aac-a--ta
B D                  Pika  aacaatcttatagt--tttagcagaattttc--tacaaacagcacctactttctt-ggaa-aac-acgca
B D                 Human  aataattgtatagt--tcttgaaaaattttc--tacaaatgg-gcatactgtctc-aaga-aag-ataca
B D                 Chimp  aataattgtatagt--tcttgaaaaattttc--tacaaatgg-gcatactgtctc-aaga-aag-ataca
B D                Bonobo  aataattgtatagt--tcttgaaaaattttc--tacaaatgg-gcatactgtctc-aaga-aag-ataca
B D               Gorilla  aataattgtatagt--tcttgaaaaattttc--tacaaatgg-gcatactgtctc-aaga-aag-ataca
B D                Rhesus  aataattgtatagt--tcttgaaaatttttc--tacaaatgg-gcatacttgctc-agga-aaa-ataca
B D              Marmoset  aataattgtatagt--tcttgaaaatttttc--tacaaatga-gcatactttctc-agga-aaa-ataca
B D               Tarsier  gataattgtataat----atggaaacatttc--tacaaatgg-gcaccttttctc-agaagaaa-acaca
B D              Bushbaby  agtaattggatagt--tctggaaaatttatc--tacaattgg-gcatactttcta-aaaa-gat-atata
B D            Tree shrew  attaattgtataga--ttttgaaaacttttc--tacaaatca-acatactttctc-agaa-tagaatatg
B D  Malayan flying lemur  aataattgtataat--tctagaatatttttc--tacaaatgg-gcatactttctt-tgaa-aag-gtata
B D                   Pig  aatagttgtagagt--tctt-aaatttttttcctataattgg-gcatgctatttc---ag-aaa-aaaaa
B D               Dolphin  aacagttgtatagt--tcttgaaattttctttgtataattgg-gcatgctttctc------aga-aaaaa
B D                   Cow  agcagttgtatagg--tgttgaaattttcttcgtattattag-gcacactttctcaagaa-aaa-aaaaa
B D                 Sheep  agcagttgtatagg--tgttgaaattttctttgtattgttag-gcatactttctcaaggg-aaa-aaaaa
B D                 Horse  aactgttggatagt--tcttgaaaaattttc--tacagttgg-gtatactttctc-ag-a-aaa-aaaat
B D      Chinese pangolin  aatagttgtacgat--ttttgaaaacttttt--tgcaattag-gcatactttcac-agaa-aaa-aaaac
B D                   Dog  aatagttgtatagt--tcttgaaacattttc--tacaattgg-gcatattttctc-agaa-aaa-atata
B D    Hawaiian monk seal  aatagttgtatagt--tcttg--acattttc--tacaattgg-gcatactttctc-agaa-aaa-atata
B D              Hedgehog  agcatatgtatagt--tgttggaagtttttc--tacggctgc-acatagtttcct-aaag-aaa-ac-ta
B D                 Shrew  -----------att--ctttaaaaaattttc--tac-------------tttctt-aag---------ta
B D              Elephant  --tagctgtgtatagttcttgaatggttttc--tacaattgg-gcatactttctc-agaa-aaa-atata
B D                Tenrec  --tagttgtgtagg---cttgaaccattttc--tacaattgg-atttactttttc-tgga-aaa-a---a
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  taccgcttacctggtaggtagg----tt-----acaggaacatgaatggtagagt-tacaaat------t
                      Rat  tagggcttacctgtt-----gg----ct-----acagtaacatgaatatctgagt-tacaatt------t
            GCF_003668045  t--cacttacctgct----act----ct-----agagtaatatgaatgatggctt-tacaggt------t
                   Beaver  ca----ttgtctggt----act----ct-----caagtaatctgagtagtataat-tat--gt------t
                 Squirrel  tattgcttatctggt----cct----tt-----aaagtaatctgaatggtagatt-tacaagt------t
               Guinea pig  c-----ttg--tagt----act----ct-----aaaa---------------------------------
                   Rabbit  t--tgtaaatctggt----act--------------ctaatctggatgct--cat-tataatc------t
                     Pika  t--tataaatctggt----gttcaaatt-----aaactaatcctaatgct--gat-tataagc------t
                    Human  t--tgcatatctgat----act----ct-----aaagtaattggagtgacagatt-tataagc------t
                    Chimp  t--tgcatatctgat----act----ct-----aaagtaattggagtgacagatt-tataagc------t
                   Bonobo  t--tgcatatctgat----act----ct-----aaagtaattggagtgacagatt-tataagc------t
                  Gorilla  t--tgcatatctgat----act----ct-----aaagtaattggagtgacagatt-tataagc------t
                   Rhesus  t--tgaatatctgat----act----ct-----taagtaattggagacacagatt-tataagc------t
                 Marmoset  t--tgcatttctgat----act----c----------taattggagtgacagatt-tataagc------t
                  Tarsier  t--tgcatatctggc----att----ctaa-taaaagtaatttgagtgacagatt-tatatgc------t
                 Bushbaby  t--tatatagtgggt----act----ct-----aaagtaatctgactagcagatt-tataagc------t
               Tree shrew  t--tgaatatattgt----act----ctag-ttaaa------tcaatg----------------------
     Malayan flying lemur  t--tgtgtacctggt----act----ctaa-ttaaagtactctcaatggtagagt-tataaac------t
                      Pig  t--tgcatctctggt----act----c-----taaagtaatctgaatggcagatt-tataaac------t
                  Dolphin  a--tgaatatctggt----act----ctaa-ttaaagtcatctgaatggtagatt-tataatc------t
                      Cow  a--agaatatctggt----act----cgga-ttcaggtaatctgaatggtggatt-tacaagc------t
                    Sheep  a--agaatatctggt----act----ctga-ttcaagtaatctgaatggtggatt-tataagc------t
                    Horse  g--tgcatatttggt----act----ctaa-ttaaagtgatctgaatggtagatt-tataagc------c
         Chinese pangolin  t--tgcatatatggt----tcc----c-----tagggtaatctgaaaagtagatt-tataagc------t
                      Dog  t--tgcatatctggt----act----ctaa-ctgaagtaatctgaatgttagatt-tataagc------t
       Hawaiian monk seal  t--tgcatatctggt----act----ctaa-ctgaaataatctgaatgttagatt-tacaagc------t
                 Hedgehog  c--tgcatatctggt----ac----------ttaaagtgagtcaaatggtagata-gataaacagacgat
                    Shrew  g--tgcatatctgct----act----ttaa-ttaaagtagcataaatggtagacc-tacaagc------t
                 Elephant  t--tgcatatatggt----act----tgaagcaaaagtaatctaaatgttagatt-tataagc------t
                   Tenrec  t--agtatatatgat----acc----ccaagtaaaagcaatttgaatgtttgattatcctcat------t
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  cccagtatcttcattttggggttgaat-atgttaatag-agacagcaaagttattataacat-tagttag
                      Rat  cccaatatcttcatttaggggttgaag-atgataatgg-agacagcaaatttattatagcat-tagttag
            GCF_003668045  cccaggactttcattttgaggttgaat-atgttaatgg-ag-caagaagtttaatatgacat-tctttag
                   Beaver  ttcagtgtcttcattttgggtttccat-atgttaact-----tagtaattttaatataaca----gttac
                 Squirrel  ttcagtttcttcattttggggttgcat-atgttaact-----cagtagctttaatataacac-caattac
               Guinea pig  ------gtattcattttggatttgtat-attttaagt-----cagcaagtttcatat------tagttag
                   Rabbit  ttctgtatcttcattttggagttgtac-atgttaactc-taacagcaatttta-catgatgc-tagctgc
                     Pika  ttttgcatctttcttttggagttggat-gtggtgactc-tgataacaattttg-tataatat-tagcta-
                    Human  ttgggtatcttcattttggggttgcag-atattaatt-----tggcaagtttaatataacac-tagctac
                    Chimp  ttgggtatcttcattttggggttgcag-atattaatt-----tggcaagtttaatataacac-tagctac
                   Bonobo  ttgggtatcttcattttggggttgcag-atattaatt-----tggcaagtttaatataacac-tagctac
                  Gorilla  ttgggtatcttcattttggggttgcag-atattaatt-----tggcaagtttaatataacac-tagctac
                   Rhesus  ttgggtatcttcattttggggttgcag-atgttaact-----tggtaagtttaatataacac-tagctac
                 Marmoset  ttgggtatcttcattttggggttacag-atg-----t-----tgacaagtttaatataacac-tagctac
                  Tarsier  ----gtatcttcattttggaattgcaa-atattaactc-ggatggcaagtttaatatgacat-tagctat
                 Bushbaby  ttcagcatcttcatttgggggttgcat-atgttaactc-aggaagcaagtttaatgtgatat-tagctac
               Tree shrew  ------------------------cat-atgttaactt-ggacagcatg-ttagta---tgt-tagttac
     Malayan flying lemur  ttgaatattttcattttgtgtttacat-atgttaattc-agatagcaaatttaatatattat-tagctac
                      Pig  ttgagtgtcttcattttagggtggtgtaatattaact-----cagcaaatttaatataaagt-tagctat
                  Dolphin  ttgagtatcttcattttggggtagtat-acgtcaactc-agacagcaagtttaatataaaat-tagctac
                      Cow  ttgagtatctttattttggggtagtg--aaatcaact-----cagcaagtttaatataaaat-tagctac
                    Sheep  ttgagtatctttattttggagtagta--aaatcaactc-agacagtaagtttaatataaaat-tagctac
                    Horse  ttgagtatcttcatttttggatagtgt-atattaactc-agacagcaagtttaatagaacat-tagctac
         Chinese pangolin  ttgagtatcttcatttttgggtagtgt-atgttaactc-agacagcaagtttaatataacat-tagctac
                      Dog  tgtagtatcttcatatttgggtagtat-atgttagct----------attttaatataacat-aagctac
       Hawaiian monk seal  ttgagtatctccaattttgggtagtgt-atgttaactc-agacagcaagtttaatatcacgt-tagctac
                 Hedgehog  ctgcat--------tttgggatagtat-gttgc--ctt-gaacttcaatttgaatataacat-tagccac
                    Shrew  ttgagta-------ttttggattgtgt-atg----ctc-aggcaacaagtt-aatatggcat-taactac
                 Elephant  ttgagtatcttcatttttggatagcat-atgttaactc-aaacagcaagtttaatatagcatttagctcc
                   Tenrec  ttgagtaacctcattttaggataacac-atgttaactcaaaaaaacaagtttaatatagcatctagctgt
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  caat-tgagatgtt
                      Rat  caat-tgagatgtt
            GCF_003668045  caat-tgagatgtc
                   Beaver  aaat-tgatatgtc
                 Squirrel  aaat-tgagatatc
               Guinea pig  aaat-tgagatgtc
                   Rabbit  aaat-tgagatggc
                     Pika  --------------
                    Human  agac-tgagatgtc
                    Chimp  agat-tgagatgtc
                   Bonobo  agat-tgagatgtc
                  Gorilla  agat-tgagatgtc
                   Rhesus  aaac-tgggatgtc
                 Marmoset  aaat-tgagatgcc
                  Tarsier  aaat-tgagatgtg
                 Bushbaby  aaac-tgaaatgtc
               Tree shrew  aaatctgagatac-
     Malayan flying lemur  aaat-tgagatgta
                      Pig  aaat-tgagatatc
                  Dolphin  aaat-tgagatact
                      Cow  aaat-tgagatatc
                    Sheep  aaat-tgagatatc
                    Horse  aaat-taagatgtc
         Chinese pangolin  aaat-ttagatgtc
                      Dog  aaat-cgagatgtc
       Hawaiian monk seal  agat-tgaaatg-c
                 Hedgehog  agat-tcagatgtt
                    Shrew  a-at-ttagata-t
                 Elephant  aaac-tggtatgtc
                   Tenrec  aaac-ggatatgtt
                Zebrafish  ==============
            X. tropicalis  ==============
                  Opossum  ==============
                  Chicken  ==============

Inserts between block 34 and 35 in window
B D                  Pig 1bp
B D              Dolphin 122bp
B D                  Cow 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp
B D             Hedgehog 1bp
B D                Shrew 1bp

Alignment block 35 of 407 in window, 56750054 - 56750536, 483 bps 
B D                 Mouse  a-----gaataga----gaacag--------tctataaatact------tgca---ct----aa--aaat
B D                   Rat  ag----gagtaga----gaatag--------tctataaatact------tgca---ct----aa--aaat
            GCF_003668045  ag----aaataaa----gaatag--------tc-ataaataat------tgca---ct-----a--agat
                   Beaver  ag----gaataga----gaac-------------ataaatact------tgaa---ct----aa--aaat
B D              Squirrel  ag----aaataga----gaatag--------tctataaatgct------tgaatttct----aa--aa--
B D            Guinea pig  aa----taat---------atag--------tctataaatagt------tgaa---ct----ta--aacc
B D                Rabbit  ag----aaatgga----gaatag--------tctataaatat----------------------------
B D                  Pika  ag----aaacgga----gactgg--------tctatacatatt------tgga---ct----tt--aaaa
B D                 Human  ag----aaataga----gaatag--------tctataaatact------tgaa---cttt--tt--aaaa
B D                 Chimp  ag----aaataga----gaatag--------tctataaatact------tgaa---cttt--tt--aaaa
B D                Bonobo  ag----aaataga----gaatag--------tctataaatact------tgaa---cttt--tt--aaaa
B D               Gorilla  ag----aaataga----gaatag--------tctataaatact------tgaa---cttt--tt--aaaa
B D                Rhesus  ag----aaataga----gaatag--------tctataaataat------tgaa---cttt--tt--aaaa
B D              Marmoset  atttacaaatctt----gagaagttcaagtttctataaatacc------tgaa---cttt--ta--aaaa
B D               Tarsier  ag----aaataga----gaatcg--------tttatgaatacttgtacatgta---cttt--ta--aaaa
B D              Bushbaby  ag----acacaga----caataa--------tccacaaataca---------------tt--tt--aaaa
B D            Tree shrew  ca----gagcaga----gaatag--------tctataaatatt------tgaa---ct--------taaa
B D  Malayan flying lemur  aa----aaataga----aaatag--------tctataaatatt------tgaa---cttt--aaaatata
B D                   Pig  -g----gaatggataatggatag--------tttataaatact------tgaa---cttaa-ga--aaaa
B D               Dolphin  -g----gaatgga----gaatag--------tctataaacact------tgaa---tttat-ga--aaaa
B D                   Cow  -g----gaatgga----gaatag--------tctataaatact------tgaa---cataa-ga--aaaa
B D                 Sheep  -g----gaatgga----gaatag--------tctataaatact------tgaa---cttaa-ga--aaaa
B D                 Horse  -g----aaatgga----gaatag--------tctataaatact------tgaa---cttaa-ga--aaaa
B D      Chinese pangolin  -g----aaatgga----gaatag--------tctataaatact------tgaa---tttaa-ga--aaaa
B D                   Dog  -g----agatggg----gaatag--------tctatgcaaact------tgaa---ctt---ga--aaaa
B D    Hawaiian monk seal  -g----agatggg----gaatag--------tctatacaaact------tgaa---cttaa-ga--aaaa
B D              Hedgehog  -g----atatgga----gaacag--------tctacaatcact------tgaa---cataagaa--aaaa
B D                 Shrew  -a----atat--a----gaagag--------tctaaaaatata------agaa---tataa-aa--aaga
B D              Elephant  ag----aaatgga----gactag--------tctgtaaatact------tgaa---cttaa-ga--aaaa
B D                Tenrec  ag----aaatgga----gagtag--------tctgtaaaggct------tgaa---tttaa-gc--aaaa
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  -gttct-----ga------attaagca----------------a--ctggtg-acaagagcttaatttaa
                      Rat  -gttct-----ga------attaagca----------------aattttgtg-agaagaacctaatttcc
            GCF_003668045  -gttca-----ga------attaaatg----------------a--attgtg-aaaaaagctgggattaa
                   Beaver  agttca-----ga------attaaata----------------a--gttgtgaaaaagagttgaagttaa
                 Squirrel  -gttca-----ga------attaaata----------------t--gttgtg-agaacagttaaatttaa
               Guinea pig  agttca-----ga------attttaaa----------------a--tttgta-aagagggttgaactgaa
                   Rabbit  ----------------------------------------------------------------------
                     Pika  -agtca-----ga------attcaaca-------------------gttgtg-aaagtagttgaatttaa
                    Human  -gttca-----ga------att----a----------------a--gttgtg-aaaatagttgaatttaa
                    Chimp  -gttca-----ga------att----a----------------a--gttgtg-aaaatagttgaatttaa
                   Bonobo  -gttca-----ga------att----a----------------a--gttgtg-aaaatagttgaatttaa
                  Gorilla  -gttca-----ga------att----a----------------a--gttgtg-aaaatagttgaatttaa
                   Rhesus  -gttca-----ga------att----a----------------a--gttgtg-aaaatagttgaatttac
                 Marmoset  -gttca-----ga------att----a----------------a--gttgtg-aaaatagttgaatttaa
                  Tarsier  -gttca-----ga------tttaaaca----------------a--attatg-aaaatagttgaatttaa
                 Bushbaby  -gttca-----ga------attaaata----------------a--gttgta-aaaatagttgaatttaa
               Tree shrew  -gttca-----ga------attatac---------------------ttgca-aaaatagctaa------
     Malayan flying lemur  -gtgca-----ga------attaagca----------------a--gctgtg-aacataggtgaatttaa
                      Pig  -attca-----ga------gtcaaaca----------------a--gatatg-aaaa-agtttactttgg
                  Dolphin  -gttca-----ga------gttaaatg----------------a--gatgtg-aaaagagtttaatttgg
                      Cow  -gttca-----ga------gttaaatg----------------a--gatgtg-aaaagagtttaatttgg
                    Sheep  -gttca-----ga------gttaaatg----------------a--gatgtg-aaaagagtttaatttgg
                    Horse  -gttca-----ga------gttaaaca----------------a--gttgtg-aaaatagttgaattttg
         Chinese pangolin  -gctca-----ga------gttaaaca----------------a--gtagtg-aaaatggttgaa-tttg
                      Dog  -gttta-----ac------attaaaca----------------a-----gtg-aaaatgattggatttgg
       Hawaiian monk seal  -gttta-----gttttagagttaaacg----------------a--gttgtg-aaaatggttggattcgg
                 Hedgehog  -gttca-----aa------gttaaacatgtgaaaagaaaaaaaa--aatgtg-aaaagtactgaatttga
                    Shrew  -gttca-----ga------ggcaaacg----------------------gtg-aaaatacttgaatttgg
                 Elephant  -gttaagtattga------gttaaaca----------------a--attgtg-aaaatggttgaatttgg
                   Tenrec  -ataagtta--ga------gttcaaca----------------a--cttaag-aaaatggttgaatttgg
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  --aaatggagtttaac-ctaaaa-tcttata----aagtattca--------------tttgtgcatt--
                      Rat  --aaatgcagtttaac-ctaaaattctcata----aattattca--------------tttgtgtatt--
            GCF_003668045  --aaatgtagcttaat-ctaaat-tctcaca----aagtattca--------------tttgcacatt--
                   Beaver  --agatatatcttagt-ctgaaattttcata----aagcattca--------------cttgtaaattg-
                 Squirrel  --agaca-----tgat-ctgaaattttcaaa----aagcattcagtttgcgaaaattgtctttgaattg-
               Guinea pig  --aggcatgatttaat-ctgaaattattatg----aagcattca--------------ctagtacattg-
                   Rabbit  -----------------ctgaaattcttatg----aagcattca--------------tttgt-------
                     Pika  --aggtataatttaaacctggaattctcaca----cagcattca--------------tctgc-------
                    Human  --agata-----taat-ctgaaattcttatg----aagcattta--------------cttgcaca-tg-
                    Chimp  --agata-----taat-ctgaaattcttatg----aagcattta--------------cttgcaca-tg-
                   Bonobo  --agata-----taat-ctgaaattcttatg----aagcattta--------------cttgcaca-tg-
                  Gorilla  --agata-----taat-ctgaaattcttatg----aagcattta--------------cttgcaca-tg-
                   Rhesus  --agata-----taat-ctgaaattcttacg----aagcattta--------------cttgtaca-tg-
                 Marmoset  --agaca-----taat-ctgaaattcttatg----aagcattta--------------cttataca-tgt
                  Tarsier  --agacaact--taat-ttgaaattcttatg----aagcattta--------------tttgttcattg-
                 Bushbaby  --agacaaaa--caat-ctgaaattcctatgaagcaagcattca--------------ctcatacattg-
               Tree shrew  -----aataa--caat-ttgaaattcttttg----atg-actca--------------tttatgcattg-
     Malayan flying lemur  --aggaataa--caat-ctgaaattcttata----aagcattca--------------tttgtacattg-
                      Pig  gaagatgtaaattaat-ctg-aattcttatg----aaacattca--------------tttgtacaatg-
                  Dolphin  --agac--aaattaat-ctgaaattcttatg----aaacattca--------------tttgtacattg-
                      Cow  --agacataaattaat-ctgaaattcttatg----aaacattca--------------tttgtacatta-
                    Sheep  --agacataaattaat-ctgaaattcttatg----aaacattca--------------tttgtacatta-
                    Horse  --agacataaactaat-ctgaaattcttatg----gaacattca--------------tttgtacattg-
         Chinese pangolin  --ggacataaattaat-ctgaaattcttatg----aagcattca--------------ttgatatactg-
                      Dog  --agac--aaattaat-ctgaaatttttatg----aagcattta--------------tttgtatattg-
       Hawaiian monk seal  --aggc--aaattaat-ctggaattcttacg----gaacattca--------------tttgtgtattg-
                 Hedgehog  --agatgtagatttat-ctg-aatttttaca----aaggattca--------------tttacacacta-
                    Shrew  --aga--caaattaat-ttgaaattcttaca----aagcattga--------------tttatacaatg-
                 Elephant  --agacaaaaattaat-ctgaaacccttatg----gtgcat--------------------------tg-
                   Tenrec  --aagcacaa--caat-ctg-------taag----ctgtat--------------------------tg-
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  --------atg---atgatacatttgaatcatcttgaacatgatttcc------tcttggagaattgaaa
                      Rat  -attttaaata---atgatacacatggatcatctggaatataatttcc------tagtgagaaattgtaa
            GCF_003668045  -actttaaatg---atgataaaaatgaatcatcttgtatacaatttcc------tagtgaaatattttaa
                   Beaver  tgtttgaaata---aagatactatgtcagaatcctgaatataattttc------taatgcattatcctaa
                 Squirrel  tctttgaattg---aagatagtact-cagaatcctgaatgtaattttc------tagtgcatt-------
               Guinea pig  tgtttgaaatg---aagataatatttcagaataatgaatgtaatttta------tagtg-----------
                   Rabbit  -attagaaata--------aatatttcaaaattctgaacgtaattttc------tagtacaca-------
                     Pika  -attagaaata---aagttaatatttcagaatcctggagctaatttcc------cagcacata-------
                    Human  catttgaagtg---aagatagtcttctagaatcctgaatgtgattttc------tagtgtatt-------
                    Chimp  catttgaaggg---aagatagtcttctagaatcctgaatgtgattttc------tagtgtatt-------
                   Bonobo  catttgaaggg---aagatagtcttctagaatcctgaatgtgattttc------tagtgtatt-------
                  Gorilla  catttgaagtg---aagatagtcttctagaatcctgaatgtgattttc------tagtgtatt-------
                   Rhesus  catctgaaatg---aagatagtcttctagaatcctaaatgtgattttc------tagtgtatt-------
                 Marmoset  tatttgaagtg---aagatagtcttccagaatcctgaatgtgattttc------tagtgtgct-------
                  Tarsier  tatttgaaatg---aagatggtattttaaaatactgaatgtaactttc------tggtgtctt-------
                 Bushbaby  tattcaaaatg---aagatagtttttcagaatcctgaatataattttc------tagtgtatt-------
               Tree shrew  tacttgaaata---aaaatagtatttcagaattctga--gtaattttc------tagtgcatt-------
     Malayan flying lemur  tatttaaaatg---aagatagtatttcagaatccttaatgttactttc------tggtacatt-------
                      Pig  tatttaaaat-------gtagtatttcagcatcccgaatataactttc------tggtgcatt-------
                  Dolphin  tatttgaaata---aagatagtatttcagcatactgaatataattttc------tagtgcatt-------
                      Cow  tatttaaaat-------atagtatttc------ctgagtataattttc------tagtgcatt-------
                    Sheep  tatttaaaat-------atagtattgc------ctgagtataattttc------tagtgcatt-------
                    Horse  tatttgaaata---aagatagtacttcagaatcctgtgtataattttc------cagtgcatt-------
         Chinese pangolin  ta----------------------ttcagaatcctgaatataattatc------tagtgcatt-------
                      Dog  tatttgaaata---aagatagtatttcagaatcctgaatataattttc------tagtgcatt-------
       Hawaiian monk seal  tatttgaaata---aagatagtatttcagaatcatgaatataattttc------tagtgcatt-------
                 Hedgehog  tt--tgaaata---aaggtagtatttctaaatcttgaatataatttt-------tagtgcatt-------
                    Shrew  ta--caatgtacttgaaacagtactcctaaatctggagtataatcttcaatgtataatgtatt-------
                 Elephant  tgtttgaaatg---acgataatatttcacaatcatgagtgtaattttc------tagtgcattat-----
                   Tenrec  gatttaaaat------gatagtatttcaaaatcatgagcgtagttttc------tagtgtattat-----
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  aatattgtttgataattaaaaaacaaata-aatcca--aaaa--atttaaaactcatttttcagaacatg
                      Rat  aacattgtttgataattaaaaaacaaaagtagtcca--acaa--ctttataacttgtttttcaaaacaca
            GCF_003668045  aaac---tttgataatcaaaaaacaagta-agttca--aaaa--atttagaacttgtgttcctgaacata
                   Beaver  aa----------------------------agt------------------gtctatttttgtggacgta
                 Squirrel  ------------------------------atttta--aaaa--ct-----agctgtccttgggaacaca
               Guinea pig  -------------catt-------------attttt--aaag--ca-----ggctgtcctcgggaacata
                   Rabbit  ------------------------------actttaacaaag--ct-----agtcatctttgtgaacata
                     Pika  ------------------------------atttta--aaaa--cc-----tgtgatctttgtgcacata
                    Human  ------------------------------atttta--aaaa--ct-----ggctgtccttgtggatgta
                    Chimp  ------------------------------atttta--aaaa--ct-----ggctgtcctcgtggatgta
                   Bonobo  ------------------------------atttta--aaaa--ct-----ggctgtcctcgtggatgta
                  Gorilla  ------------------------------atttta--aaaa--ct-----ggctgtcctcgtggatgta
                   Rhesus  ------------------------------atttta--aaaa--ct-----ggctgttctagcggatgta
                 Marmoset  ------------------------------atgtta--aaaa--ct-----ggctgtcctcatggat-ta
                  Tarsier  ------------------------------attttt--aaaa--at-----ggctgtccttgtggccatt
                 Bushbaby  ------------------------------atttaa--aaaa--ca-----ggctgtccttgaagagata
               Tree shrew  ------------------------------atttta--aaaa--ct-----aac--------tggacgta
     Malayan flying lemur  ------------------------------atttta--aaaa--ct-----ggctgtccttgtggacgta
                      Pig  ------------------------------atttaa--caaa--ct-----ggctgtccttgaagaccta
                  Dolphin  ------------------------------atttaa--caga--ct-----ggctgtccttgcagacaca
                      Cow  ------------------------------atttaa--caga-----------ctgtccttgtagacata
                    Sheep  ------------------------------atttga--caga-----------ctgtccttgtagacata
                    Horse  ------------------------------attttt--gaaa--ct-----ggccgtccttgcagacata
         Chinese pangolin  ------------------------------atttta--aata--ct-----ggctgtccttgcagacata
                      Dog  ------------------------------atttta--aact--ct-----ggttgtccttgcagacata
       Hawaiian monk seal  ------------------------------atttta--aaca--ct-----ggttgtcctt-cagacata
                 Hedgehog  ------------------------------gtttta--aattctct-----ctctgtccttatagacata
                    Shrew  ------------------------------atttta--aataaatt-----gaat---cccatgggcata
                 Elephant  --------------------------------ttta--aaaa--ct-----ggctgtccatatagacaca
                   Tenrec  --------------------------------ttta--aaaa--tt-----ggttgtctatataattaca
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ctaacttcatgaagataaaa-aagaagctgtttggaa-ttttctt--cacaccaaacaaag-tt---aa-
                      Rat  ctattttcgtggagataaaatttgaagctgtgaggaa-ttttctt--tgcac----caaag-tt---aa-
            GCF_003668045  atattttcatgaagacagaa-atgaagttgcactgaa-ttttctt--cacagtaaataaag-tt---aag
                   Beaver  ctgttctcatgaaggtagaa-atgaagttgtgctgaa-ttttctt--catag----caaag-tt---aa-
                 Squirrel  tagttctcatgaaggtagaa-gtgaagttatactgaa-ttttctt--catttcaaataaag-tt---aa-
               Guinea pig  ctgttctcatgaagatacaa-ataaagtcgcactgaa-ttttttc-----------tgagg-ct---aa-
                   Rabbit  gtgttgtcatgaagatagaa-ataaaggtgcactgaatttttctt--tatatgaaataaaa-tc---aa-
                     Pika  gggtgctca---------ga-atgaagttgtgctgaagttgtctt--tgttgcaaaaaaag-tt---aa-
                    Human  ctattctcaggaagatataa-atgatattgcactaaatttgtctt--catat----taaag-tt---aa-
                    Chimp  ctattctcaggaagatataa-atgatattgcactaaatttgtctt--catat----taaag-tt---aa-
                   Bonobo  ctattctcaggaagatataa-atgatattgcactaaatttgtctt--catat----taaag-tt---aa-
                  Gorilla  ctattctcaggaagatataa-atgatattgcactaaatttgtctt--catat----taaag-tt---aa-
                   Rhesus  ctgttctcagaaagatataa-atgatattgcactaaatttttctt--catat----taaag-tt---aa-
                 Marmoset  ctgttctcaggaagatataa-aagatatggaactatgtttttttt--catat----tgaag-tt---aa-
                  Tarsier  ctgttcttgtgaagatataa-atgaaattgcactacatttttctt--catatccaataaaa-tt---aa-
                 Bushbaby  ctgttttcatgacggtat-g-atgaagttgcactaaatttttctt--cgtat----caaat-t-------
               Tree shrew  ctgttatcatgaagtaataa-atgaaggtgcactgaatttttctt--taattgaaataaac-tt---aa-
     Malayan flying lemur  ttgttctcatgaagatataa-atgaagttgcactgaatttttctt--catatcaaatacgt-tt---aa-
                      Pig  ctattattgtgaaaatat-----aaagttgccctatgtttttctt--catatcaaataaag-tg---aa-
                  Dolphin  ctgttcttgtgaaaatataa-gtgaagttgccgtggatttttctt--catatcaaacaaag-tt---aa-
                      Cow  ctgttcttgtgaaaatataa-atgaagttgccctggatttttctt--catattaaataaag-tt----a-
                    Sheep  ctgttctt----aaatat-a-atgaagttgccctggatttttctt--cattttaaataaag-tt----a-
                    Horse  ctgttcttgtaaaaatataa-atgaagatgcactgggtttttctt--catagcaaataaa--tt---aa-
         Chinese pangolin  ctgttctcatgaaactataa-atgaaactgcactggatttttcat--catatcaaataaag-tt---aa-
                      Dog  ccgttctcatgaaaatataa-atgaagttgcactgggtttttcat--catatgaaataaaagtt---aa-
       Hawaiian monk seal  ctgttttcatgaaaatataa-atgaagttgcactggatttttcat--catatgaaataaagtta---at-
                 Hedgehog  gtactctcttgaaaatataa-ataaaattacagtggatttttaaaatcacatccaataaag-tt---aa-
                    Shrew  ttactctcatgaaaattaaa-atgaagttgtactggagttttcag--catatc----aagg-ct---aa-
                 Elephant  ttggtctcatgaaaatataa-gtgaagttgcactgaatttttctt--tatataaaataaag-ttaataa-
                   Tenrec  atggcctcttgaaaatataa-aagaaattgtac------tttttt--tgcagta--------tttgtaa-
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  cctt-tg-ataaattattttataactttatagagaatgaactttatagtcaaatgctagc---------g
                      Rat  cttt-tg-tcaaattaatttacatttttatagagaatgaaactt-taggcaaatgccaat---------g
            GCF_003668045  tttt-tg-tgaaattaatttataattttatagagaatgacattt-tagacaaattccaat---------a
                   Beaver  cttt-tc-ttaaa-taatttgcaattttaaagagagtgaaatct-taggcaaatgccatt---------a
                 Squirrel  cttt-tg-ttaaa-taatttataattttatacagaatgaaatct-tagacaaataccaat-----aaaga
               Guinea pig  cttt-tg-ctaaa-taatttatgattttatagagaatgagatct-tagacaaatgcaaat---------a
                   Rabbit  tttt-tg-ctaaa-taatttctaatttta--------aacattt-taggttaatatcaat-----agaga
                     Pika  ttct-tg-t-----taacttgtggttttatagagaataacatct-ttggtaaatatcaat-------aga
                    Human  tttt-tg-t-aaa-taagttatga-tttatagacaatgaaatct-taggcaaatgccagc-----agagt
                    Chimp  tttt-tg-t-aaa-taatttatga-tttatagacaatgaaatct-taggcaaatgccagc-----agagt
                   Bonobo  tttt-tg-t-aaa-taatttatga-tttatagacaatgaaatct-taggcaaatgccagc-----agagt
                  Gorilla  tttt-tg-t-aaa-taatttatga-tttatagacaatgaaatct-taggcaaatgccagc-----agagt
                   Rhesus  tttt-ta-t-aaa-caatttataa-tttataaacaatgaaatct-taggcaaatgccagc-----agaat
                 Marmoset  tttt-tg-t-aaa-taatttatta-gtcatagagaatgaaatct-taggcaaatgccaac-----ag--t
                  Tarsier  tttt-tg-tcaga-taatttgtaa-tttattgagaatgaaatca-taggcaaaggtcaat-----agaa-
                 Bushbaby  tttt-gt-t-aga-taaggtataattttatggggagtgaaatct-taggcaaatgccatc-----agaga
               Tree shrew  tttt-ta-a-aaa-taatttataattttatagaaaatgaagtct-taggcaaatgcctat-----agg--
     Malayan flying lemur  tttt-tgtt-aag-taatttatagttttacagagaatgaaatct-taagcaaatgccaat-----aggga
                      Pig  ttttgtg-ttaaa-taatttatagttttgtggagaacgtaattt-ttggcaaatgccaat---------a
                  Dolphin  ctttgtg-ttaaa-taatttataattttgtagagaatgcaattt-taggcaaatgccaat---------a
                      Cow  ttttgtg-cta----aatttataattttatagtgaat-caattt-cagacaaatgttaat---------a
                    Sheep  ttttgtg-ctaaa-taatttataattttatagagaat-ctattt-caggcaaatgttaat---------a
                    Horse  ttttgtg-ttaga-aattttataattttgtagagaatgcaatct-taggcaaataccaat---------a
         Chinese pangolin  ttctgtg-ttaag-taatttataattttgtagagaatgcagttg-taggcaaatactaat-----agaga
                      Dog  ttttgtc-tcaga-taatttataattttgtagagaatccaactg-taggcaaatgccaat-----ggaga
       Hawaiian monk seal  ttttgtc-ttaaa-taatttataattttatagagaatccaactg-ttggcaaatgccagt-----agaga
                 Hedgehog  ttctgtg-taaaa-taa--cataactttatagagaat-aaaatt-gtaacatatgcctatctcagagagt
                    Shrew  atttatg-tagaa-taatttgtagttttgtagaaa---aaaatt-ttagaaaatgctaat----------
                 Elephant  ttttatg-gtaag-caatttataattttacagagaagaaaatct-taagcaaacactaat-----agaga
                   Tenrec  ttttact-gagaa-tta-----aatcttacagaaaataaaata--gaagccaatactaat---------a
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gtctttgaaatttgtcatac-------ttatgaaaaagatggt-ccgatttttaattaacttt-caacca
                      Rat  gcctttgaaattcatcataa-------ttatgaaaaatatgat-ctgatttttaattaacttc-caacca
            GCF_003668045  gtctttgaaattcatcatat-------ttatga-------------------------------------
                   Beaver  gtttttgaaattcatgttat-------ctattataaaaaacat-tcttggggtcattaacttt-tagcca
                 Squirrel  gtgtttgaaattgataatatt-atctattatgaaaaatattat-ttga--cctggctaactttaaaacta
               Guinea pig  gtctttgaaattcataatac-----tattatgaaaaatacgct-ttga--actagtctacttt-aaacca
                   Rabbit  gtctttgaagttcatgttat----ctattatgaaaaacatcct-ttgg--cctggttaacttt-taagta
                     Pika  gtctttgaaaatcacat--------tattatgaaaaacattct-ttgg--tgttgttaacttt-aa---a
                    Human  gtctttgaaattcataatgtt-atctgttatgaaaaacattct-ttga--cctggttacattt-taacca
                    Chimp  gtctttgaaattcataatgtt-atctgttatgaaaaacattct-ttga--cctggttacattt-taacca
                   Bonobo  gtctttgaaattcataatgtt-atctgttatgaaaaacattct-ttga--cctggttacattt-taacca
                  Gorilla  gtctttgaaattcataatgtt-atgtgttatgaaaaacattct-ttgc--cctggttacattt-taacca
                   Rhesus  gtctttgaaattcataatgtt-atctgttatgaaaaacattat-ttga--cctggttatattt-taacca
                 Marmoset  gtctttgacatttataatgtt-atcttttatgaaaaacattct-ttga--cctggttatattt-taacaa
                  Tarsier  -tctttgaaattcataatatt-atttattacaaaaaacattct-ttga--tctggttatattt-taacca
                 Bushbaby  gtctctgaaattcgtgatgtt-atctgttatgaaaaacattct-ttgt--cttggtt--cttt-tgagca
               Tree shrew  gtctttacaattc---atatt-atgtattatgaaagtcattct-ttga--cctcattaagttt-cagcca
     Malayan flying lemur  gtatttgaaatttgtaatgtt-atctactatgaaaaacattct-ttga--tctggttaactat-taacca
                      Pig  gtctttgaaactc---ctgtt-at----tatgaaaaatattct-ttga--cctggttagcttt-taacca
                  Dolphin  gtctttgaaattc---atgtt-atttattatgaaaaatattct-ttga--cctgattaacttt-taacta
                      Cow  gtctttgaaattc---atatt-atctactatgaaaaatattct-ttga--tctggctagtttt-taactg
                    Sheep  gtctttgaaattc---atatt-atctactatgaaaaatattct-ttga--tctggctagcttt-taacta
                    Horse  gtctttgaaattcataatgtt-atctattattaaaaacattct-ttga--tctggttagattt-taacta
         Chinese pangolin  gttcttgaaattcatcatgtt-atttattatgaaaaacattct-ttga--cctggtcgacatt-taatta
                      Dog  cactttgaaattcatgatgtt-atctattatgaaaaacattcc-ttga--cctgggttgcttt-tattta
       Hawaiian monk seal  gac-ttgaaattcatgatgtt-atctattatgaaaaacattcc-ttga--cctgggttgcttt-taacta
                 Hedgehog  cttattgaagtttataatgtttttctgccatgaagaacattttggggg--cctgattagcttt-acacta
                    Shrew  --------agcctctgatatt---------caaagaaaattct-ttga--cctggttagcttt-aaacta
                 Elephant  gcctttaaaaatcataatgtt-atccattctgcaaaacaccct-ttga--cctggttaacttt-taacca
                   Tenrec  gtctttaaaagccataatgtt-atccagcctgaaatacatcct-ttaa--cctgattgacttt-taacca
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gtagtacttttaaacaa---acttgataataattatatatcaac--aaagtgtg-tcatgtgagata
                      Rat  atagtatttttaagcaa---acttattaataattatatatcaac--aaaatatg-tcatgtgagaga
            GCF_003668045  --------------caa---act---aaataattgtatgtcagt--aaaatgtg-tcatgtgaaata
                   Beaver  ttggtattttaaaacaa---actt-------attatataatagt--aaaatctg-tcatataaaatt
                 Squirrel  gtattagttttaatcaa---a----------aggata-attaag--aaatttt--------------
               Guinea pig  gtcgtattttaatataa---aatta------attatctatcagt--aaaatgt---catataaaata
                   Rabbit  gtagtatcttttaagaa---gatgg------attacatatcaat--aaaatgtg-tcatataaaata
                     Pika  ctagtatcttttaaaaa---gctgg------atcacatgtcaat--aaagcatgtttctataaagtg
                    Human  gtagtatttcaaaataa---aattaatg---atcatgtatcagt--aaaatgta-ttgtataaaata
                    Chimp  gtagtatttcaaaataa---aattaatg---atcatgtatcagt--aaaatgta-ttgtataaaata
                   Bonobo  gtagtatttcaaaataa---aattaatg---atcatgtatcagt--aaaatgta-ttgtataaaata
                  Gorilla  gtagtatttcaaaataa---aattaatg---atcatatatcagt--aaaatgta-ttgtataaaata
                   Rhesus  ctagtatttcaaaataa---aattaatg---attatatatcagt--aaaatgtg-ttgtataaaata
                 Marmoset  gaagtatttcaaaataa---aattaatg---attatgtatctgt--aaaatgta-ttgtataaaatg
                  Tarsier  gtagt--------atga---aattaatg---atcatatgtcagc--aaagtgtg-ccatataaaata
                 Bushbaby  gtagtgttttaaaacaa---aattaatg---attctgtatcagt--aaaatgtg-tcacataaaata
               Tree shrew  ttagtattttaaagaaa---aa--aatg---attatgtatcagt--aacatgtg-tcatatgacata
     Malayan flying lemur  gttgtattttaaaacaa---aattaatg---attatgtatcagt--aaaatgta-tcagataaaata
                      Pig  ttagtgttt-----taaaacaattaatg---attatgtatcagt--aaaatgtg-tcatataaaatg
                  Dolphin  ----tgttttaaaacaa---aattaatg---attatgtatcgct--aaaatgtg-tcatataaaata
                      Cow  ----tgttt-----taa---aattagta---attatgtattggt--aaaacatg-tcatatgaaata
                    Sheep  ----tgttt-----caa---aattagta---attatgtattggt--aaaacatg-tcatatgaaata
                    Horse  ttagtattttaaaacaa---aatttatg---attatgtatcagt--aaaatgtg-tcatataaaata
         Chinese pangolin  ttagtgtcttaaagcaa---aattaatg---attataaat-------aattatg-tttttggaa---
                      Dog  ttagtgtcttaaaataa---gattaatg---attatgtagtagt--aaaatgtg-tcatataaaata
       Hawaiian monk seal  tttgtgtcttaaaacaa---gattaatg---attatgtagtagt--aaaatgtg-tcatataaaata
                 Hedgehog  tcagtgtt--aaaacaa---aattagta---actatgtatcagt--aaaatttg-tcatgtaaaata
                    Shrew  tcag-gtc-------------atgcatg---atgacgaatcagt--aaaccctt-ttatataaaatg
                 Elephant  gtagtgtgttaaggcaa---aattaatg---attatgtatcagt--aaaatgtg-tgagtagatata
                   Tenrec  ggagtgttttaagtcaa---aattattg---ataatgtataaataaaaaatgtg-tcagtaaaaata
                Zebrafish  ===================================================================
            X. tropicalis  ===================================================================
                  Opossum  ===================================================================
                  Chicken  ===================================================================

Alignment block 36 of 407 in window, 56750537 - 56750543, 7 bps 
B D                 Mouse  gccaaaa
B D                   Rat  gcaaaga
            GCF_003668045  gcaacaa
                   Beaver  acaagga
B D            Guinea pig  ataagaa
B D                Rabbit  gcaggaa
B D                  Pika  gcagaaa
B D                 Human  gcaggga
B D                 Chimp  gcaggga
B D                Bonobo  gcaggga
B D               Gorilla  gcaggga
B D                Rhesus  gcaggga
B D              Marmoset  gcaggga
B D               Tarsier  gtggaaa
B D              Bushbaby  gcaggaa
B D  Malayan flying lemur  gcagaaa
B D                   Pig  -ccaaaa
B D               Dolphin  -caaaaa
B D                   Cow  -cc-aaa
B D                 Sheep  -ccaaaa
B D                 Horse  -ccaaa-
B D                   Dog  -caaaa-
B D    Hawaiian monk seal  -caaaa-
B D              Hedgehog  -c-----
B D                 Shrew  -cc----
B D              Elephant  -ccagta
B D                Tenrec  -ctagta
B D            Tree shrew  -------
B D             Zebrafish  =======
B D         X. tropicalis  =======
B D               Opossum  =======
B D               Chicken  =======
B D              Squirrel  -------
B D      Chinese pangolin  -------

Inserts between block 36 and 37 in window
B D                  Pig 1bp
B D              Dolphin 1bp
B D                  Cow 1bp
B D                Sheep 1bp
B D                Horse 1bp
B D             Hedgehog 17bp
B D                Shrew 11bp

Alignment block 37 of 407 in window, 56750544 - 56750545, 2 bps 
B D                 Mouse  aa
B D                   Rat  aa
            GCF_003668045  aa
                   Beaver  aa
B D              Squirrel  aa
B D            Guinea pig  aa
B D                Rabbit  aa
B D                  Pika  ca
B D                 Human  aa
B D                 Chimp  aa
B D                Bonobo  aa
B D               Gorilla  aa
B D                Rhesus  aa
B D              Marmoset  aa
B D               Tarsier  a-
B D              Bushbaby  ga
B D  Malayan flying lemur  aa
B D                   Pig  ag
B D               Dolphin  aa
B D                   Cow  aa
B D                 Sheep  aa
B D      Chinese pangolin  aa
B D                   Dog  aa
B D    Hawaiian monk seal  aa
B D              Elephant  aa
B D                Tenrec  aa
B D                 Horse  ==
B D            Tree shrew  --
B D              Hedgehog  ==
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D               Opossum  ==
B D               Chicken  ==
B D                 Shrew  ==

Inserts between block 37 and 38 in window
B D                  Pig 1bp
B D                  Cow 1bp
B D                Sheep 1bp

Alignment block 38 of 407 in window, 56750546 - 56750546, 1 bps 
B D                 Mouse  a
B D                   Rat  a
B D  Malayan flying lemur  g
B D              Elephant  a
B D                Tenrec  a
B D            Guinea pig  -
B D                 Sheep  =
B D                Rhesus  -
B D    Hawaiian monk seal  -
B D                   Dog  -
B D                 Horse  =
B D              Marmoset  -
B D               Gorilla  -
B D                Bonobo  -
B D                 Chimp  -
B D                 Human  -
B D               Tarsier  -
B D            Tree shrew  -
B D              Hedgehog  =
B D                  Pika  -
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  =
B D               Opossum  =
B D               Chicken  =
B D                 Shrew  =
B D              Squirrel  -
B D                   Pig  =
B D                Rabbit  -
B D      Chinese pangolin  -
B D               Dolphin  -
B D              Bushbaby  -
                  Beaver  -
           GCF_003668045  -

Alignment block 39 of 407 in window, 56750547 - 56750547, 1 bps 
B D                 Mouse  a
B D              Elephant  a
B D                Tenrec  a
B D            Guinea pig  -
B D                 Sheep  =
B D                Rhesus  -
B D    Hawaiian monk seal  -
B D                   Dog  -
B D                 Horse  =
B D              Marmoset  -
B D               Gorilla  -
B D                Bonobo  -
B D                 Chimp  -
B D                 Human  -
B D               Tarsier  -
B D            Tree shrew  -
B D              Hedgehog  =
B D                  Pika  -
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  =
B D               Opossum  =
B D               Chicken  =
B D                 Shrew  =
B D              Squirrel  -
B D                   Pig  =
B D                Rabbit  -
B D      Chinese pangolin  -
B D               Dolphin  -
B D              Bushbaby  -
                  Beaver  -
B D  Malayan flying lemur  -
           GCF_003668045  -
B D                   Rat  -

Alignment block 40 of 407 in window, 56750548 - 56750582, 35 bps 
B D                 Mouse  aaaaaaaaaaaaaaaaaaccctgagagttcaaaag
B D                   Rat  ----------------------ggtagtttaaaag
            GCF_003668045  ----------------------gatagttt-aaag
                   Beaver  ----------------------gataattt-aaaa
B D              Squirrel  ----------------------gcttattcaaaa-
B D            Guinea pig  ----------------------gataattttaaa-
B D                Rabbit  ----------------------cgtagca--aaaa
B D                  Pika  ----------------------tgcaac----aaa
B D               Tarsier  ----------------------ggtaatttaaaaa
B D              Bushbaby  ----------------------ggtaa--taaaaa
B D      Chinese pangolin  ----------------------------------a
B D                   Dog  ----------------------------------a
B D              Elephant  -------------------------gg--------
B D                Tenrec  -------------------------ag--------
B D                 Sheep  ===================================
B D                Rhesus  -----------------------------------
B D    Hawaiian monk seal  -----------------------------------
B D                 Horse  ===================================
B D              Marmoset  -----------------------------------
B D               Gorilla  -----------------------------------
B D                Bonobo  -----------------------------------
B D                 Chimp  -----------------------------------
B D                 Human  -----------------------------------
B D            Tree shrew  -----------------------------------
B D              Hedgehog  ===================================
B D             Zebrafish  ===================================
B D         X. tropicalis  ===================================
B D                   Cow  ===================================
B D               Opossum  ===================================
B D               Chicken  ===================================
B D                 Shrew  ===================================
B D                   Pig  ===================================
B D               Dolphin  -----------------------------------
B D  Malayan flying lemur  -----------------------------------

Inserts between block 40 and 41 in window
B D              Tarsier 5bp
B D     Chinese pangolin 17bp
B D                  Dog 9bp

Alignment block 41 of 407 in window, 56750583 - 56750599, 17 bps 
B D                 Mouse  acctgaagctcaatg-----tc
B D                   Rat  actgtaaactcaagg-----ta
            GCF_003668045  actgtaaaatccaga-----tc
                   Beaver  attct-agttcaaaa-----ta
B D              Squirrel  ------tattcaaaa-----ta
B D                Rabbit  aattttaggtccaaaataacta
B D                  Pika  acttttagattaaaa-----ta
B D              Bushbaby  -----aatgtc-----------
B D              Hedgehog  -----actttcaaag-----tt
B D              Elephant  ----------caatt-------
B D                Tenrec  ---------tcaatt-------
B D            Guinea pig  ----------------------
B D                 Sheep  ======================
B D                Rhesus  ----------------------
B D    Hawaiian monk seal  ----------------------
B D                   Dog  ======================
B D                 Horse  ======================
B D              Marmoset  ----------------------
B D               Gorilla  ----------------------
B D                Bonobo  ----------------------
B D                 Chimp  ----------------------
B D                 Human  ----------------------
B D               Tarsier  ======================
B D            Tree shrew  ----------------------
B D             Zebrafish  ======================
B D         X. tropicalis  ======================
B D                   Cow  ======================
B D               Opossum  ======================
B D               Chicken  ======================
B D                 Shrew  ======================
B D                   Pig  ======================
B D      Chinese pangolin  ======================
B D               Dolphin  ----------------------
B D  Malayan flying lemur  ----------------------

Alignment block 42 of 407 in window, 56750600 - 56750600, 1 bps 
B D                 Mouse  a
B D                   Rat  a
            GCF_003668045  a
                   Beaver  g
B D              Squirrel  a
B D                Rabbit  a
B D                  Pika  a
B D            Guinea pig  -
B D                 Sheep  =
B D                Rhesus  -
B D    Hawaiian monk seal  -
B D                   Dog  =
B D                 Horse  =
B D              Marmoset  -
B D               Gorilla  -
B D                Bonobo  -
B D                 Chimp  -
B D                 Human  -
B D                Tenrec  -
B D               Tarsier  =
B D            Tree shrew  -
B D              Hedgehog  -
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  =
B D               Opossum  =
B D               Chicken  =
B D                 Shrew  =
B D              Elephant  -
B D                   Pig  =
B D      Chinese pangolin  =
B D               Dolphin  -
B D              Bushbaby  -
B D  Malayan flying lemur  -

Alignment block 43 of 407 in window, 56750601 - 56750625, 25 bps 
B D                 Mouse  ctagatgaaaggattgt--aaatgttc
B D                   Rat  ct-------aggattct--aaat-ttt
            GCF_003668045  ctagatgaaagggttct--gaatgttt
                   Beaver  ctagaagagaggatcct--gaatgttc
B D              Squirrel  ctcaaagaaaaggttct--taatgttc
B D            Guinea pig  -------------ttct--gaatgttc
B D                Rabbit  ctagaagagagtattct--gaatgttc
B D                  Pika  ttagaaggcagcaatctgggaatgttc
B D                 Human  --------ggtaattgc--aaattttt
B D                 Chimp  --------ggtaattgc--aaattttt
B D                Bonobo  --------ggtaattgc--aaattttt
B D              Marmoset  --------ggtaagtga--aaa-----
B D                   Cow  -----------ctattt--aaattt--
B D                 Sheep  -----------ctattt--gaattt--
B D              Elephant  -----------------aaaaattttc
B D                Tenrec  -----------------aagaatt---
B D                Rhesus  ---------------------------
B D    Hawaiian monk seal  ---------------------------
B D                   Dog  ===========================
B D                 Horse  ===========================
B D               Gorilla  ---------------------------
B D               Tarsier  ===========================
B D            Tree shrew  ---------------------------
B D              Hedgehog  ---------------------------
B D             Zebrafish  ===========================
B D         X. tropicalis  ===========================
B D               Opossum  ===========================
B D               Chicken  ===========================
B D                 Shrew  ===========================
B D                   Pig  ===========================
B D      Chinese pangolin  ===========================
B D               Dolphin  ---------------------------
B D              Bushbaby  ---------------------------
B D  Malayan flying lemur  ---------------------------

Inserts between block 43 and 44 in window
B D             Marmoset 3bp

Alignment block 44 of 407 in window, 56750626 - 56750627, 2 bps 
B D                 Mouse  tt
B D                   Rat  tt
            GCF_003668045  tt
                   Beaver  tc
B D              Squirrel  tt
B D            Guinea pig  tt
B D                Rabbit  tc
B D                  Pika  tc
B D              Marmoset  tt
B D                   Cow  tt
B D                 Sheep  tt
B D                Rhesus  --
B D    Hawaiian monk seal  --
B D                   Dog  ==
B D                 Horse  ==
B D               Gorilla  --
B D                Bonobo  --
B D                 Chimp  --
B D                 Human  --
B D                Tenrec  --
B D               Tarsier  ==
B D            Tree shrew  --
B D              Hedgehog  --
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D               Opossum  ==
B D               Chicken  ==
B D                 Shrew  ==
B D              Elephant  --
B D                   Pig  ==
B D      Chinese pangolin  ==
B D               Dolphin  --
B D              Bushbaby  --
B D  Malayan flying lemur  --

Inserts between block 44 and 45 in window
B D                  Cow 2bp

Alignment block 45 of 407 in window, 56750628 - 56750629, 2 bps 
B D                 Mouse  t--t
B D                   Rat  a--a
                   Beaver  a--t
B D              Squirrel  a-cc
B D            Guinea pig  acct
B D                Rabbit  a--c
B D                  Pika  a--t
B D                 Sheep  --tt
B D                Rhesus  ----
B D    Hawaiian monk seal  ----
B D                   Dog  ====
B D                 Horse  ====
B D              Marmoset  ----
B D               Gorilla  ----
B D                Bonobo  ----
B D                 Chimp  ----
B D                 Human  ----
B D                Tenrec  ----
B D               Tarsier  ====
B D            Tree shrew  ----
B D              Hedgehog  ----
B D             Zebrafish  ====
B D         X. tropicalis  ====
B D                   Cow  ====
B D               Opossum  ====
B D               Chicken  ====
B D                 Shrew  ====
B D              Elephant  ----
B D                   Pig  ====
B D      Chinese pangolin  ====
B D               Dolphin  ----
B D              Bushbaby  ----
B D  Malayan flying lemur  ----
           GCF_003668045  ----

Alignment block 46 of 407 in window, 56750630 - 56750649, 20 bps 
B D                 Mouse  tattatcttaca----atgtctgc
B D                   Rat  aattatcttgtg----ctacctga
            GCF_003668045  tatgatcttatg----ttatctga
                   Beaver  cacaagaaaatgatgaatgtttga
B D              Squirrel  caggaaatgataataaatgcttga
B D            Guinea pig  caggaaatgata---aatgtttaa
B D                Rabbit  cacaaagcaatgattaatgtttga
B D                  Pika  cacaaacgaacg---aatgttcga
B D                 Sheep  ------------------------
B D                Rhesus  ------------------------
B D    Hawaiian monk seal  ------------------------
B D                   Dog  ========================
B D                 Horse  ========================
B D              Marmoset  ------------------------
B D               Gorilla  ------------------------
B D                Bonobo  ------------------------
B D                 Chimp  ------------------------
B D                 Human  ------------------------
B D                Tenrec  ------------------------
B D               Tarsier  ========================
B D            Tree shrew  ------------------------
B D              Hedgehog  ------------------------
B D             Zebrafish  ========================
B D         X. tropicalis  ========================
B D                   Cow  ========================
B D               Opossum  ========================
B D               Chicken  ========================
B D                 Shrew  ========================
B D              Elephant  ------------------------
B D                   Pig  ========================
B D      Chinese pangolin  ========================
B D               Dolphin  ------------------------
B D              Bushbaby  ------------------------
B D  Malayan flying lemur  ------------------------

Alignment block 47 of 407 in window, 56750650 - 56750650, 1 bps 
B D                 Mouse  g
B D                   Rat  g
            GCF_003668045  g
                   Beaver  g
B D              Squirrel  g
B D            Guinea pig  a
B D                Rabbit  g
B D                  Pika  g
B D               Gorilla  g
B D                Rhesus  g
B D                 Sheep  -
B D    Hawaiian monk seal  -
B D                   Dog  =
B D                 Horse  =
B D              Marmoset  -
B D                Bonobo  -
B D                 Chimp  -
B D                 Human  -
B D                Tenrec  -
B D               Tarsier  =
B D            Tree shrew  -
B D              Hedgehog  -
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  =
B D               Opossum  =
B D               Chicken  =
B D                 Shrew  =
B D              Elephant  -
B D                   Pig  =
B D      Chinese pangolin  =
B D               Dolphin  -
B D              Bushbaby  -
B D  Malayan flying lemur  -

Alignment block 48 of 407 in window, 56750651 - 56750664, 14 bps 
B D                 Mouse  gtgactgacatttt
B D                   Rat  gtgattg-cactta
            GCF_003668045  atgactgacatgct
                   Beaver  gtgattgctgtgct
B D              Squirrel  gcagtggatattct
B D            Guinea pig  gtgatggatgtgca
B D                Rabbit  gtactggatctgct
B D                  Pika  gcgctggatatatt
B D               Gorilla  gtaattgca-----
B D                Rhesus  gtaactgaa-----
B D                   Pig  gtgatttaaatttt
B D      Chinese pangolin  -----------ttt
B D                Tenrec  ----------tttt
B D                 Sheep  --------------
B D    Hawaiian monk seal  --------------
B D                   Dog  ==============
B D                 Horse  ==============
B D              Marmoset  --------------
B D                Bonobo  --------------
B D                 Chimp  --------------
B D                 Human  --------------
B D               Tarsier  ==============
B D            Tree shrew  --------------
B D              Hedgehog  --------------
B D             Zebrafish  ==============
B D         X. tropicalis  ==============
B D                   Cow  ==============
B D               Opossum  ==============
B D               Chicken  ==============
B D                 Shrew  ==============
B D              Elephant  --------------
B D               Dolphin  --------------
B D              Bushbaby  --------------
B D  Malayan flying lemur  --------------

Inserts between block 48 and 49 in window
B