Multiz Alignments of 60 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 702 in window, 56690786 - 56690824, 39 bps 
B D             Mouse  c------------------agct---tc-------------ctcg-------c-----ca--------tc
B D               Rat  c------------------agcg---tc-------------ctca-------c-----ca--------tc
B D    Naked mole-rat  --------------------------------------------------------------------ct
B D        Guinea pig  --------------------------------------------------------------------ct
B D          Squirrel  ---------------------------------------------------------------------c
B D              Pika  ----------------------------------------------------------------------
B D             Human  c------------------tgcg---tc-------------ctcc-------t-----cacga---agct
B D             Chimp  c------------------tgcg---tc-------------ctcc-------t-----caaca---agct
B D           Gorilla  c------------------tgcg---tc-------------ctcc-------t-----cacca---agct
B D         Orangutan  c------------------tgca---tc-------------ctcc-------t-----cacca---agct
B D            Gibbon  c------------------tgcg---tc-------------ctcc-------t-----cacta---agct
B D            Rhesus  c------------------tgcg---tc-------------ctcc-------t-----cacca---agct
B D            Baboon  c------------------tgcg---tc-------------ctcc-------t-----cacca---agct
B D          Marmoset  c------------------tgcg---tc-------------cttc-------t-----cacaa---agct
B D   Squirrel monkey  c------------------tgca---tc-------------ctcc-------t-----cacca---agct
B D           Tarsier  c------------------tgcg---tc-------------ctcg-------t-----cac---------
B D       Mouse lemur  c------------------tgag---tc-------------ctcg-------t-----ccccg---agcg
B D          Bushbaby  c------------------tgtg---tc-------------caca-------t-----ccccg---agca
B D               Pig  c------------------ag-------------------------------------------------
B D            Alpaca  a------------------agcg---tcttcctcctgtcaccgta-------t-----caccg---agct
B D           Dolphin  c------------------agtg---tcctcct--------ctcg-------t-----cacct---agct
B D             Sheep  c------------------agtg---tc-------------cttg-------t-----cacgg---agct
B D               Cow  c------------------agtg---tc-------------cttg-------t-----caccg---agct
B D               Cat  c------------------ggtgtcctcct-----------ct-------------------------tg
B D               Dog  t------------------gctg---tcct-----------ctca-------t-----catgg---agcg
B D             Panda  t------------------ggtgaactcct-----------ctcg-------t-----caccg---agcg
B D             Horse  c------------------ggtg---tcca-----------ctcg-------t-----caccgctcagcc
  D  Little brown bat  c------------------g--g---tcct-----------cccg-----ggc-----taccg---cgcg
B D           Megabat  t------------------ggtg---tcct-----------tttg----tggt-----cactg---atcg
B D             Shrew  c------------------gacg---tcct-----------tcccgttcccgt-----cgcgg---agcc
B D           Manatee  ctatagagtgaccgaggacggtg---tc-------------cttc-------tgt---cacca---agcc
B D         Armadillo  -------------------cgta---tc-------------ctcc-------tctcctcgccg---agcc
B D             Sloth  -------------------ggta---tc-------------ctcc-------tctcagcatcg---agcc
B D            Rabbit  ======================================================================
B D          Elephant  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D          Hedgehog  ======================================================================
B D      Kangaroo rat  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  a---tacattcactactaaaat----tgca
                  Rat  a---tacaatcactactaaaat----tgca
       Naked mole-rat  g---tgggcccgctttggaagc----tgca
           Guinea pig  g---ctcactggctgtggaagc----tgca
             Squirrel  c---cgcaacctttactgaaac----tga-
                 Pika  ------------ctgccaaagc----cgcg
                Human  g---cgcaacttctgctaatgc----tgca
                Chimp  g---cgcaacttctgctaatgc----tgca
              Gorilla  g---cgcaacttctgctaatgc----tgca
            Orangutan  g---cgcaacttctgctaatgccgcacgca
               Gibbon  g---cgcaacttctgctaatgc----tgca
               Rhesus  g---cgcaacttctgctaatgc----tgcc
               Baboon  g---cgcaacttctgctaatgc----tgcc
             Marmoset  g---cgcaacttctgctaatgc----tgca
      Squirrel monkey  g---ctcaacttctactaatgc----tgca
              Tarsier  ---------ctcccactaatgt----tgca
          Mouse lemur  g----gcagct-cccagaacgc----c---
             Bushbaby  g---cgcaaca-ttacgaatgc----cgca
                  Pig  ----------------gggtgt----ttcg
               Alpaca  c---tttggcttctacagacac----ttc-
              Dolphin  a---tgtgccttccacaaatgc----ttcg
                Sheep  c---tgtggcttctacagatgc----ttcg
                  Cow  c---tgtggcttctacagatgc----ttcg
                  Cat  g---tatggctcctacagatgc----ttag
                  Dog  g---tgtggcttccaaagatgc----ttag
                Panda  g---tgaggcttttacagatgc----ttag
                Horse  g---cgcggcttctacagatgc----ttga
     Little brown bat  gggtggtggcttctacagacgc----ttcg
              Megabat  g---tgtagcttctacagatgc----ttcg
                Shrew  g---tgcagctgctaaggaggc----ttca
              Manatee  g---cgcaacttctgcagttgc----ttcg
            Armadillo  g---cacgtcttctacagatgc----tgag
                Sloth  g---ccggtcttctacagatgc----tgcg
               Rabbit  ==============================
             Elephant  ==============================
               Tenrec  ==============================
              Wallaby  ==============================
                 Fugu  ==============================
         Atlantic cod  ==============================
         Nile tilapia  ==============================
            Zebrafish  ==============================
        X. tropicalis  ==============================
             Platypus  ==============================
               Turkey  ==============================
           Coelacanth  ==============================
      Tasmanian devil  ==============================
              Opossum  ==============================
               Lizard  ==============================
           Budgerigar  ==============================
          Zebra finch  ==============================
              Chicken  ==============================
       Painted turtle  ==============================
             Hedgehog  ==============================
         Kangaroo rat  ==============================
           Rock hyrax  ==============================

Alignment block 2 of 702 in window, 56690825 - 56690825, 1 bps 
B D             Mouse  a
B D               Rat  a
B D    Naked mole-rat  a
B D        Guinea pig  g
B D            Rabbit  a
B D              Pika  a
B D             Human  a
B D             Chimp  a
B D           Gorilla  a
B D         Orangutan  a
B D            Gibbon  a
B D            Rhesus  a
B D            Baboon  a
B D          Marmoset  a
B D   Squirrel monkey  a
B D           Tarsier  g
B D          Bushbaby  t
B D               Pig  a
B D            Alpaca  a
B D           Dolphin  a
B D             Sheep  a
B D               Cow  a
B D               Cat  a
B D               Dog  a
B D             Panda  a
B D             Horse  a
  D  Little brown bat  a
B D           Megabat  a
B D             Shrew  a
B D           Manatee  a
B D         Armadillo  a
B D             Sloth  a
B D          Elephant  =
B D          Squirrel  -
B D            Tenrec  =
B D           Wallaby  =
B D              Fugu  =
B D      Atlantic cod  =
B D      Nile tilapia  =
B D         Zebrafish  =
B D     X. tropicalis  =
B D          Platypus  =
B D            Turkey  =
B D        Coelacanth  =
B D   Tasmanian devil  =
B D           Opossum  =
B D            Lizard  =
B D        Budgerigar  =
B D       Zebra finch  =
B D           Chicken  =
B D    Painted turtle  =
B D       Mouse lemur  -
B D          Hedgehog  =
B D      Kangaroo rat  =
B D        Rock hyrax  =

Inserts between block 2 and 3 in window
B D          Manatee 5bp

Alignment block 3 of 702 in window, 56690826 - 56690864, 39 bps 
B D             Mouse  ccctggcaaaagcgaggt--ctcctctggacaatt---aca---gg---g---
B D               Rat  ccctggcaaaagccaggt--cccctctctactgtt---aca---gg---g---
B D    Naked mole-rat  ccttgg--agagccgagc--tggctcgg------------a---gg---g---
B D        Guinea pig  ccctgg--ggagccg--------------------------------------
B D          Squirrel  --------aaggcgaagt--cttctttcgctagct---aaa---gg---c---
B D            Rabbit  cccgggc-gaggccaagt--cctccgcccgcggactggaga---gg---g---
B D              Pika  ctccggc-ggggccgagt--cctcctcgggcggac--gcga---gg---g---
B D             Human  ccctggc-aagacgaaat--ccccctccctctggc----ta---ga-------
B D             Chimp  ccctggc-aagacgaaat--ccccctccctctggc----ta---ga-------
B D           Gorilla  ccctggc-aaga-gaaat--ccccctccctctggc----ta---ga-------
B D         Orangutan  ccctggc-aagacgaaat--ccccctccctctggc----ta---ga-------
B D            Gibbon  ccctggc-aagacgaaat--ccccctccctctggc----ta---ga-------
B D            Rhesus  ccctggc-aagacgaaat--ccccctccctctggc----ta---ga-------
B D            Baboon  ccctggc-aagacgaaat--ccccctccctctggc----ta---ga-------
B D          Marmoset  ccctggc-aagacgaaat--cctcttccttctgac----ta---gaagg----
B D   Squirrel monkey  ccctggc-aagacgaaat--cctcctccctctggc----ta---gaagg----
B D           Tarsier  cccgggc-aagacgccgt--cctcctcccgctggc----ta---gaagg----
B D       Mouse lemur  ----ggc-aaggcgaagt--agccctccttctggc----ta---gg-------
B D          Bushbaby  ctctggc-aaagctaagc--gtcccttcttctggc----tagaggg-------
B D               Pig  accaagc-aggtcgaagt-ccgccctcccttctga----tg---ga-------
B D            Alpaca  cccaggc-tgggcgaagtacccccctccctttggc----tg---ga-------
B D           Dolphin  actgggc-aggtcgaagt-cccccctccctttggc----tg---ga-------
B D             Sheep  accaggc-aggtcgaag------cgtcccttgggc----ag---ga-------
B D               Cow  accaggc-aggtcgaag------cgtcccttgggc----ag---ga-------
B D               Cat  cccaggc-gagaccaagt-gccccctccctctgac---aag---ga-------
B D               Dog  cccagac-agggcgaagt-gcctcctccctctgac----tg---ga-------
B D             Panda  cccaggc-cgggctaagt-gcctcctccctctgac----tg---ga-------
B D             Horse  cccaggc-agagcgaagt-cctccctcccgcgggc----tt---ga-------
  D  Little brown bat  ccc-ggc-agggtgaggt-ccctcctccctct------ggg---gg-------
B D           Megabat  cccagac-agggtgaagt-tccttctccctctggc---ggg---ga-------
B D             Shrew  tgcaggc-aggccgaaat-ac-tcctcctggtggc----ag---ga-------
B D            Tenrec  -----cc-caggcgaaag--ccccctccttctggc----ga---cg----gtt
B D           Manatee  -----tc-caagtgaaat--ccccctccttctggc----ta---ga----ggc
B D         Armadillo  ccctggc-aaggccgagt--ctccctccctctg-t----tg---ga----ggc
B D             Sloth  ccctgac-aaggccaagt--ctccctctctctgac----tg---aa----ggc
B D          Elephant  =====================================================
B D           Wallaby  =====================================================
B D              Fugu  =====================================================
B D      Atlantic cod  =====================================================
B D      Nile tilapia  =====================================================
B D         Zebrafish  =====================================================
B D     X. tropicalis  =====================================================
B D          Platypus  =====================================================
B D            Turkey  =====================================================
B D        Coelacanth  =====================================================
B D   Tasmanian devil  =====================================================
B D           Opossum  =====================================================
B D            Lizard  =====================================================
B D        Budgerigar  =====================================================
B D       Zebra finch  =====================================================
B D           Chicken  =====================================================
B D    Painted turtle  =====================================================
B D          Hedgehog  =====================================================
B D      Kangaroo rat  =====================================================
B D        Rock hyrax  =====================================================

Inserts between block 3 and 4 in window
B D              Pig 3bp
B D           Alpaca 3bp
B D          Dolphin 3bp
B D            Sheep 3bp
B D              Cow 3bp
B D              Cat 3bp
B D              Dog 3bp
B D            Panda 3bp
B D            Horse 3bp
  D Little brown bat 3bp
B D          Megabat 3bp
B D            Shrew 3bp
B D           Tenrec 3bp
B D          Manatee 4bp

Alignment block 4 of 702 in window, 56690865 - 56690971, 107 bps 
B D             Mouse  tcaacggggccttcc---------c--cgacccccaa-actcc---------tcc--tag----------
B D               Rat  tcagcctggccttcc---------c--tcacccccaagactcc---------tcc--cag----------
B D      Kangaroo rat  tcagcctgaccttcc---------cttctgaccccat-ctggg---------tct--cag----------
B D    Naked mole-rat  tcagctccgtctcct---------c--------gcaggacccc---------tcc--cac----------
B D        Guinea pig  -----------------------------------gggtctcc---------tcc--cgt----------
B D          Squirrel  tcagccaggcttccc---------c--------tcagaacccc---------ttc--ctg----------
B D            Rabbit  tcagcccggcctccc---------c--------tcggggcccc---------gcc--ctg----------
B D              Pika  tcagcccggactccc---------c--------tcgaggcccc---------tcc--c------------
B D             Human  tcagcccagcctccc---------c--------tcagggaccttcctgcccctcc--ctacccctcccta
B D             Chimp  tcagcccagtctccc---------c--------tcagggacct---------tcc--ctgcccctcccta
B D           Gorilla  tcagcccagcctccc---------c--------tcagggacct---------tcc--ctgcccctcccta
B D         Orangutan  tcagcccagcctccc---------c--------tcagggacct---------tcc--ctgcccctcccta
B D            Gibbon  tcagcccagcctccc---------c--------tcggggaccc---------tcc--ctgcccctcccta
B D            Rhesus  tcagctcagcctccc---------c--------tcagggaccc---------tcc--ctg----------
B D            Baboon  tcagctcagcctccc---------c--------tcagggaccc---------tcc--ctg----------
B D          Marmoset  tcagcctagcctccc---------c--------tcagggaccc---------tcc--ctg----------
B D   Squirrel monkey  tcagcccagcctccc---------c--------tcagggaccc---------tcc--ctg----------
B D           Tarsier  tcggcccggcctccc---------c--------gcagggcccc---------tcc--ctg----------
B D       Mouse lemur  tcagacaggcc-ccc---------a--------tcagggcccc---------tct--ctc----cctcta
B D          Bushbaby  tcagcccagcctccc---------c--------acagggac-----------------------------
B D               Pig  tcagcccagcgtccc---------t--------gcaggggtcc---------tca--ctg----------
B D            Alpaca  tctgcc-ggcatct---------------------gaagctcc---------aat--gtg----------
B D           Dolphin  tcagcctggcgtccc---------t--------gcagggctcc---------tcc--ctg----------
B D             Sheep  tcagcccggcgtctc---------t--------gctggactcc---------gcc--ctg----------
B D               Cow  tcagcccggcgtctc---------t--------gctggactcc---------gcc--ctg----------
B D               Cat  tcagcctggcctccc---------a--------gaagggatcc---------tcc--ctg----------
B D               Dog  tcaggctggcctccc---------a--------gaagggatct---------tcc--ctg----------
B D             Panda  tcagcctggcctccc---------g--------gaaagtatct---------tcc--ctg----------
B D             Horse  tcggcctggcctccc---------c--------gtagggatct---------tcc--cgg----------
  D  Little brown bat  tcagc-cggcctccc---------c--------gcagggatcc---------tcc--tat----------
B D           Megabat  tttgctctgcttccc---------c--------acaaggatct---------tcc--cag----------
B D             Shrew  tcagccttgcctttg---------c--------gataggaccc---------tccctctg----------
B D          Elephant  tcaaagcgaaatccc-----ccttc--------ttctggcccc---------tcc--cta----------
B D            Tenrec  ----gccgacctcccggcagccgcc----------ccggcccc---------tcc--c------------
B D           Manatee  tcagcccgacctcct---------c--------gtagggcccc---------tcc--ctt----------
B D         Armadillo  tcgccccggcctccc---------c--------gcagggcccc---------tcc--ccg----------
B D             Sloth  tcctctcggcctccc---------c--------gcagggcccc---------tcc--ctc----------
B D           Wallaby  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D          Hedgehog  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  t-cg-------------cc---------------t------------------t-ctctcagt------a
                  Rat  t-cg-------------ct---------------a------------------t-cccacagt------a
         Kangaroo rat  c-ca-------------cc---------------c------------------t-ccgcccct-------
       Naked mole-rat  t-t--------------ct---------------g------------------t-cccccagt------c
           Guinea pig  t-t--------------ct---------------g------------------t-cccacagc------c
             Squirrel  t-ct-------------ct---------------t------------------a-tccccagt------c
               Rabbit  t-cgct-gcccctcccccc---------------t------------------c-cccccagcccttggc
                 Pika  -------gcccctggctcc---------------t------------------g-cccccgcccgttggc
                Human  c-ccctaggccgctccccc---------------c------------------t-tcctctgt------t
                Chimp  c-ccctaggccgctccccc---------------c------------------t-tcctctgt------t
              Gorilla  c-ccctaggccgctccccg---------------c------------------t-tcctctgt------t
            Orangutan  c-ccctaggctgctccccc---------------c------------------t-tcctctgt------t
               Gibbon  c-ccctaggccgctccccc---------------c------------------t-tcctctgt------t
               Rhesus  c-ccctaggccgctccccc---------------c------------------t-tcctctgt------t
               Baboon  c-ccctaggccgctccccc---------------c------------------t-tcctctgt------t
             Marmoset  c-ccctgggccgctggccc---------------c------------------t-tcctcttt------t
      Squirrel monkey  c-ccctgggccgctgcccc---------------c------------------t-tcctcttt------t
              Tarsier  c-cttta------cccccg---------------g------------------t-gtcccagt------t
          Mouse lemur  c-ccct-----gccctctt---------------c------------------c-tccccagt------t
             Bushbaby  ------------ccctcct---------------g------------------c-ccaccagt------t
                  Pig  c-c--------------cc-atcctccctgccc-c------------------g-gccccagc------a
               Alpaca  g-t--------------ggaat------------t------------------c-cccccagc------c
              Dolphin  c-c--------------cgggtcctccctgcccct------------------g-cccccagc------c
                Sheep  c-t--------------cg---------------t------------------g-cccctagc------g
                  Cow  c-t--------------ct---------------t------------------g-cccctagc------c
                  Cat  t-c--------------cc---------------t------------------g-cccccaac------c
                  Dog  c-c--------------cc---------------tgccccggccccggccccgg-cccccaac------c
                Panda  c-c--------------cc---------------t------------------g-cccccaa-------c
                Horse  c-c--------------cc---------------t------------------g-cccccagc------c
     Little brown bat  t-t-------------------------------------------------------------------
              Megabat  c-c--------------cc---------------g-----------------------------------
                Shrew  c-c--------------cc---------------t------------------g-cccccagc------t
             Elephant  c-c--------------cc---------------t------------------g-ctcccagc------c
               Tenrec  c-t--------------cc---------------g------------------c-ccctctgc------c
              Manatee  cgc--------------ct---------------g------------------c-cccccagc------c
            Armadillo  c-c--------------gc---------------t------------------g-cccctctc------c
                Sloth  c-c--------------gc---------------t------------------gacccccagc------c
              Wallaby  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
             Hedgehog  ======================================================================
           Rock hyrax  ======================================================================

                Mouse  g----------------------agacc----------tgattcatgctcgcaattgct-----------
                  Rat  g----------------------agact----------tgattcatgc----atttgct-----------
         Kangaroo rat  --------------------------cc----------tgatgcttcctcacacttgcg-----------
       Naked mole-rat  g----------------------gaatc----------tgattcttgc----acttacc-----------
           Guinea pig  a----------------------gaatc----------tgattcttgc----acttatc-----------
             Squirrel  g----------------------ggatg----------tgatccttgctctcacatgcc-----------
               Rabbit  g----------------------gtatc----------cgatcctcgcacgcgcttgga-----------
                 Pika  a----------------------gg-------------cgagcctggcgcgcactt--------------
                Human  g----------------------ggatc----------cgatccttgttcgctcttgca-----------
                Chimp  g----------------------ggatc----------cgatccttgttcgctcttgca-----------
              Gorilla  g----------------------ggatc----------cgatccttgttcgctcttgca-----------
            Orangutan  g----------------------ggatc----------tgatccttgttcgctcttgca-----------
               Gibbon  g----------------------ggatc----------ctatccttgttcgctcttgca-----------
               Rhesus  g----------------------ggatc----------cgatccttgttcgctcttgca-----------
               Baboon  g----------------------ggatc----------cgatccttgttcgctcttgca-----------
             Marmoset  g----------------------g----------------atccttgtttgctgttgca-----------
      Squirrel monkey  g----------------------g----------------atccttgttcgctgttgca-----------
              Tarsier  g----------------------ggatc----------cga-cctggcgtgcttttgcc-----------
          Mouse lemur  g----------------------ggatc----------cgatccccgc-cgctcctgca-----------
             Bushbaby  g----------------------gcatctttgcttactctggccgtgc-tgctcct--------------
                  Pig  g----------------------ga--t----------tgatccttgattccacttg-------------
               Alpaca  a----------------------ggatc----------tgatccttgatccaacttgcc-----------
              Dolphin  g----------------------ggatc----------cgatccttgatcgcacttgcc-----------
                Sheep  g----------------------ggatc----------cgatccttgatcgcacttgcc-----------
                  Cow  g----------------------ggatc----------cgatccttgatcgcacttgcc-----------
                  Cat  ggannnnnnnnnnnnnnnnnnnnggatc----------cgatccttgatagcacttgcg-----------
                  Dog  g----------------------ggatc----------c-atccttgatcgcacttgcc-----------
                Panda  g----------------------ggatc----------c-atccttgatcgcacttgcg-----------
                Horse  t----------------------ggatc----------cgaccctcgattgcacttgcc-----------
     Little brown bat  ------------------------------------------ccttgaccgcacttgcg-----------
              Megabat  ----------------------------------------agccttgactgcccctgcc-----------
                Shrew  g----------------------gcatt----------cgaccctctatcgtatttgct-----------
             Elephant  g----------------------ggatc----------cgatccttgctctcactctct-------agca
               Tenrec  g----------------------ggatc----------cgatcctcgctcgcgctagctcacagtcggcc
              Manatee  g----------------------ggatc----------cgatccttgctctcactctct-------tgcc
            Armadillo  a----------------------ggctc----------ggatcctcgctcgcgctttct-------t---
                Sloth  a----------------------ggctc----------cgatcctctgtcgcagtttct-------tac-
              Wallaby  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
             Hedgehog  ======================================================================
           Rock hyrax  ======================================================================

                Mouse  gt---ccc-tcagccaggag-tattgctcctt-
                  Rat  gt---cccctcagccacggg-t-ttactcctt-
         Kangaroo rat  -------c-ccagccaagag-cgttgcccttt-
       Naked mole-rat  gt---gtc-gccgccacgag-ttttgcccctc-
           Guinea pig  gt---ttc-gaaggcacgag-ttttgcccctc-
             Squirrel  at---ctt-gcaagca--ag-ttttgcccctt-
               Rabbit  ct---cccggcagccgcgga-ctgtgcccctc-
                 Pika  ------------gccgtcca-gcgagctcc---
                Human  at---ccc-gcagcccggag-ttttgccccgt-
                Chimp  at---ccc-gcagcccggag-ttttgccccgt-
              Gorilla  at---ccc-gcagcccggag-ttttgccccgt-
            Orangutan  at---ccc-gcagcccggag-ttttgccccct-
               Gibbon  at---ccc-gcagcccggag-ttttgccccct-
               Rhesus  at---ccc-gcagcccagag-ttttgccccct-
               Baboon  at---ccc-gcagcccagag-ttttgccccct-
             Marmoset  at---ccc-gcagcccagag-ttttgccccct-
      Squirrel monkey  at---ccc-gcagcccagag-ttttgcctcct-
              Tarsier  gccgaccc-gcagccacgag-ttgtgcccctc-
          Mouse lemur  gt---ccc-gcaaccacgag-tttcccccctt-
             Bushbaby  -t---gcc-----ccacgac-tttcccccctt-
                  Pig  -t---tct-gaagccaagac-ttttgcccctt-
               Alpaca  gt---tct-gcagcctcggg-ttttgcccctt-
              Dolphin  gt---tct-gcagcctagag-ttttgcccctt-
                Sheep  ac---tat-gcagccaagag-ttttgcccctt-
                  Cow  ac---tat-gcagccaagag-ttttgcccctt-
                  Cat  gg---atc-gcagccacaag-ttttgtctctt-
                  Dog  gg---acc-gcagccacagg-ttttgcccttt-
                Panda  gg---acc-gcagccacaag-ttttgcccctt-
                Horse  at---ccc-taagccacgag-ttttgc------
     Little brown bat  gt---ccc-gcagccacagt--tttgcccctc-
              Megabat  gc---ccc-gcagccatgag--tttgcccctt-
                Shrew  gt---ccc-gctgcctagggtttttgccccct-
             Elephant  gc---cag-gcagctaggag-ctttgcctcctt
               Tenrec  gc---ccg-ccagctaggag-ctttgccccctc
              Manatee  gc---ccg-gcagctatgag-ctttgccccctt
            Armadillo  gt---ccc-gcagccacaag-ttttacccgctt
                Sloth  ga---ccc-gcagccacgag-ttttgccccctt
              Wallaby  =================================
                 Fugu  =================================
         Atlantic cod  =================================
         Nile tilapia  =================================
            Zebrafish  =================================
        X. tropicalis  =================================
             Platypus  =================================
               Turkey  =================================
           Coelacanth  =================================
      Tasmanian devil  =================================
              Opossum  =================================
               Lizard  =================================
           Budgerigar  =================================
          Zebra finch  =================================
              Chicken  =================================
       Painted turtle  =================================
             Hedgehog  =================================
           Rock hyrax  =================================

Inserts between block 4 and 5 in window
B D              Pig 1bp
B D           Alpaca 1bp
B D          Dolphin 1bp
B D            Sheep 1bp
B D              Cow 1bp
B D              Cat 76bp
B D              Dog 2bp
B D            Panda 2bp
B D            Shrew 1bp

Alignment block 5 of 702 in window, 56690972 - 56690993, 22 bps 
B D             Mouse  gaac-aaaaatacattctcattc
B D               Rat  gaac-taaaattctttct-----
B D      Kangaroo rat  gcac-aaaaacaggctctccttc
B D    Naked mole-rat  gcac-aaaaatatgttctctttc
B D        Guinea pig  gcac-aaaagtatgttttctttc
B D          Squirrel  gcac-aaaaatatgttctctttc
B D            Rabbit  gcgc-agtaccgcgttcgctttc
B D              Pika  ---c-agaaacgagttcacttcc
B D             Human  gcat-taaaacatgttctctttc
B D             Chimp  gcat-taaaacatgttctctttc
B D           Gorilla  gcat-taaaacatgttctctttc
B D         Orangutan  acat-taaaacatgttctctttc
B D            Gibbon  gcat-taaaatatgttctctttc
B D            Rhesus  gcat-aaaaatatgttctctttc
B D            Baboon  gcat-aaaaatatgttctctttc
B D          Marmoset  ccat-aaaaatgtgttctctttc
B D   Squirrel monkey  gcat-aaaaatgtgttctctttc
B D           Tarsier  gcgc-aaaaatgtgttctctttc
B D       Mouse lemur  gcac-aaaactgcgttcgc----
B D          Bushbaby  gcac-aaaaacgagttctctttc
B D               Pig  ccct-aaaaatatattctctttc
B D            Alpaca  cccc-caaaatgtgttctcttcc
B D           Dolphin  cccc-caaaatgtggtcgctttc
B D             Sheep  cccc-ccaaatgtgttctctttc
B D               Cow  cccc-ccaaatgtgttatctttc
B D               Dog  --at-aaaaatgtgttctctttc
B D             Panda  atat-aaaaatgtgttc------
B D             Horse  --ac-agaaatgtgttctctttc
  D  Little brown bat  gcac-agaaatgcgttctctttc
B D           Megabat  gtgc-aaaaatgtgttctcattc
B D             Shrew  gcac-aaaaatgtgttctctttc
B D          Elephant  gcac-aaaaatgtgttctctttc
B D            Tenrec  ccgc-aaaaatgtgctctctttc
B D           Manatee  gcacaaaaaatgtgttctctttc
B D         Armadillo  aaac-acaaatgtgt--tctttc
B D             Sloth  gaac-aaaaacgtgt--tctttc
B D           Wallaby  =======================
B D              Fugu  =======================
B D      Atlantic cod  =======================
B D      Nile tilapia  =======================
B D         Zebrafish  =======================
B D     X. tropicalis  =======================
B D          Platypus  =======================
B D            Turkey  =======================
B D        Coelacanth  =======================
B D   Tasmanian devil  =======================
B D           Opossum  =======================
B D            Lizard  =======================
B D        Budgerigar  =======================
B D       Zebra finch  =======================
B D           Chicken  =======================
B D    Painted turtle  =======================
B D               Cat  =======================
B D          Hedgehog  =======================
B D        Rock hyrax  =======================

Inserts between block 5 and 6 in window
B D     Kangaroo rat 12bp
B D         Squirrel 17bp
B D             Pika 13bp
B D         Bushbaby 12bp
B D              Pig 1bp
B D           Alpaca 1bp
B D          Dolphin 1bp
B D            Sheep 1bp
B D              Cow 1bp
B D              Dog 12bp
B D            Panda 7bp
B D            Horse 1bp
  D Little brown bat 1bp
B D          Megabat 1bp
B D            Shrew 1bp
B D         Elephant 1bp
B D           Tenrec 1bp
B D          Manatee 1bp
B D        Armadillo 1bp
B D            Sloth 1bp

Alignment block 6 of 702 in window, 56690994 - 56690999, 6 bps 
B D             Mouse  tctctc
B D               Pig  tttgtg
B D            Alpaca  tttgtg
B D           Dolphin  tttgtg
B D             Sheep  tttgtg
B D               Cow  tttgtg
B D             Panda  tttgcg
B D             Horse  tttgcg
  D  Little brown bat  tttgcg
B D           Megabat  tttgaa
B D             Shrew  tttgcg
B D          Elephant  tttgca
B D            Tenrec  tttgcg
B D           Manatee  tttgcg
B D         Armadillo  tttgcg
B D             Sloth  tttgcg
B D   Tasmanian devil  tttctc
B D            Rabbit  ------
B D        Guinea pig  ------
B D          Bushbaby  ======
B D          Squirrel  ======
B D            Rhesus  ------
B D         Orangutan  ------
B D   Squirrel monkey  ------
B D               Dog  ======
B D          Marmoset  ------
B D            Gibbon  ------
B D           Gorilla  ------
B D             Chimp  ------
B D    Naked mole-rat  ------
B D             Human  ------
B D           Tarsier  ------
B D           Wallaby  ======
B D              Pika  ======
B D              Fugu  ======
B D      Atlantic cod  ======
B D      Nile tilapia  ======
B D         Zebrafish  ======
B D     X. tropicalis  ======
B D          Platypus  ======
B D            Turkey  ======
B D        Coelacanth  ======
B D           Opossum  ======
B D            Lizard  ======
B D        Budgerigar  ======
B D       Zebra finch  ======
B D           Chicken  ======
B D    Painted turtle  ======
B D            Baboon  ------
B D               Cat  ======
B D       Mouse lemur  ------
B D          Hedgehog  ======
B D      Kangaroo rat  ======
B D        Rock hyrax  ======
B D               Rat  ------

Inserts between block 6 and 7 in window
B D              Pig 3bp
B D           Alpaca 2bp
B D          Dolphin 2bp
B D            Sheep 2bp
B D              Cow 2bp
B D            Panda 1bp
B D            Horse 1bp
  D Little brown bat 4bp
B D          Megabat 4bp
B D            Shrew 1bp
B D         Elephant 1bp
B D           Tenrec 1bp
B D          Manatee 1bp
B D        Armadillo 1bp
B D            Sloth 1bp

Alignment block 7 of 702 in window, 56691000 - 56691047, 48 bps 
B D             Mouse  tatctctgtctctctctctgt---------ctgtctctgtctctgtct----ctgtctctg
B D           Opossum  tctctctatcagcctctcaaatggaaattcctcttcttgtattaatcgtaaactaac----
B D   Tasmanian devil  tatgtctatcagtctctcaaa------------ttctcgtgttaatcttacgctaac----
B D            Rabbit  -------------------------------------------------------------
B D        Guinea pig  -------------------------------------------------------------
B D          Bushbaby  =============================================================
B D               Cow  =============================================================
B D          Elephant  =============================================================
B D           Manatee  =============================================================
B D          Squirrel  =============================================================
B D            Rhesus  -------------------------------------------------------------
B D         Orangutan  -------------------------------------------------------------
B D   Squirrel monkey  -------------------------------------------------------------
B D               Pig  =============================================================
B D             Horse  =============================================================
B D             Panda  =============================================================
B D               Dog  =============================================================
B D          Marmoset  -------------------------------------------------------------
B D            Gibbon  -------------------------------------------------------------
B D           Gorilla  -------------------------------------------------------------
B D             Chimp  -------------------------------------------------------------
B D    Naked mole-rat  -------------------------------------------------------------
B D             Human  -------------------------------------------------------------
B D           Tarsier  -------------------------------------------------------------
B D            Tenrec  =============================================================
B D           Wallaby  =============================================================
B D              Pika  =============================================================
B D            Alpaca  =============================================================
B D             Sheep  =============================================================
B D              Fugu  =============================================================
B D      Atlantic cod  =============================================================
B D      Nile tilapia  =============================================================
B D         Zebrafish  =============================================================
B D     X. tropicalis  =============================================================
B D          Platypus  =============================================================
B D            Turkey  =============================================================
B D        Coelacanth  =============================================================
B D            Lizard  =============================================================
B D        Budgerigar  =============================================================
B D       Zebra finch  =============================================================
B D           Chicken  =============================================================
B D    Painted turtle  =============================================================
B D             Shrew  =============================================================
  D  Little brown bat  =============================================================
B D            Baboon  -------------------------------------------------------------
B D             Sloth  =============================================================
B D         Armadillo  =============================================================
B D               Cat  =============================================================
B D       Mouse lemur  -------------------------------------------------------------
B D          Hedgehog  =============================================================
B D      Kangaroo rat  =============================================================
B D        Rock hyrax  =============================================================
B D           Megabat  =============================================================
B D           Dolphin  =============================================================
B D               Rat  -------------------------------------------------------------

Alignment block 8 of 702 in window, 56691048 - 56691060, 13 bps 
B D             Mouse  ----------tctgtctctctct
B D               Rat  ----------------tttgagg
B D    Naked mole-rat  ---------------atttgcgc
B D        Guinea pig  ---------------atctgcgc
B D            Rabbit  ---------------attcgcag
B D             Human  ---------------atttgcag
B D             Chimp  ---------------atttgcag
B D           Gorilla  ---------------atttgcag
B D         Orangutan  ---------------atttgcag
B D            Gibbon  ---------------atttgcag
B D            Rhesus  ---------------atttgcgg
B D            Baboon  ---------------atttgcgg
B D          Marmoset  ---------------atttgtgg
B D   Squirrel monkey  ---------------atttgcgg
B D           Tarsier  ---------------atttgcgg
B D       Mouse lemur  ----------tttttatttgcgg
B D          Hedgehog  -----------------tccctc
B D           Opossum  ctgatc--agt----cttt----
B D   Tasmanian devil  acgatcagagc----cttt----
B D          Bushbaby  =======================
B D               Cow  =======================
B D          Elephant  =======================
B D           Manatee  =======================
B D          Squirrel  =======================
B D               Pig  =======================
B D             Horse  =======================
B D             Panda  =======================
B D               Dog  =======================
B D            Tenrec  =======================
B D           Wallaby  =======================
B D              Pika  =======================
B D            Alpaca  =======================
B D             Sheep  =======================
B D              Fugu  =======================
B D      Atlantic cod  =======================
B D      Nile tilapia  =======================
B D         Zebrafish  =======================
B D     X. tropicalis  =======================
B D          Platypus  =======================
B D            Turkey  =======================
B D        Coelacanth  =======================
B D            Lizard  =======================
B D        Budgerigar  =======================
B D       Zebra finch  =======================
B D           Chicken  =======================
B D    Painted turtle  =======================
B D             Shrew  =======================
  D  Little brown bat  =======================
B D             Sloth  =======================
B D         Armadillo  =======================
B D               Cat  =======================
B D      Kangaroo rat  =======================
B D        Rock hyrax  =======================
B D           Megabat  =======================
B D           Dolphin  =======================

Inserts between block 8 and 9 in window
B D         Hedgehog 15bp

Alignment block 9 of 702 in window, 56691061 - 56691064, 4 bps 
B D             Mouse  -ctct
B D               Rat  -ctct
B D    Naked mole-rat  -attt
B D        Guinea pig  -attt
B D            Rabbit  -ggtt
B D             Human  -attt
B D             Chimp  -attt
B D           Gorilla  -attt
B D         Orangutan  -attt
B D            Gibbon  -attt
B D            Rhesus  -attt
B D            Baboon  -attt
B D          Marmoset  -attt
B D   Squirrel monkey  -attt
B D           Tarsier  -attt
B D       Mouse lemur  -attt
B D               Pig  -tttt
B D            Alpaca  --ttt
B D           Dolphin  --ttt
B D             Sheep  --ttt
B D               Cow  --ttt
B D               Cat  -attt
B D             Panda  -attt
B D             Horse  -attt
  D  Little brown bat  ----t
B D           Megabat  ----t
B D          Hedgehog  -actt
B D             Shrew  -attt
B D          Elephant  -attt
B D            Tenrec  -attt
B D           Manatee  -attt
B D         Armadillo  -attt
B D             Sloth  -attt
B D           Opossum  taca-
B D   Tasmanian devil  ccct-
B D          Bushbaby  =====
B D          Squirrel  =====
B D               Dog  =====
B D           Wallaby  =====
B D              Pika  =====
B D              Fugu  =====
B D      Atlantic cod  =====
B D      Nile tilapia  =====
B D         Zebrafish  =====
B D     X. tropicalis  =====
B D          Platypus  =====
B D            Turkey  =====
B D        Coelacanth  =====
B D            Lizard  =====
B D        Budgerigar  =====
B D       Zebra finch  =====
B D           Chicken  =====
B D    Painted turtle  =====
B D      Kangaroo rat  =====
B D        Rock hyrax  =====

Inserts between block 9 and 10 in window
B D           Rabbit 1bp

Alignment block 10 of 702 in window, 56691065 - 56691065, 1 bps 
B D             Mouse  -a
B D               Rat  -a
B D      Kangaroo rat  -a
B D    Naked mole-rat  -a
B D        Guinea pig  -a
B D            Rabbit  -a
B D             Human  -a
B D             Chimp  -a
B D           Gorilla  -a
B D         Orangutan  -a
B D            Gibbon  -a
B D            Rhesus  -a
B D            Baboon  -a
B D          Marmoset  -a
B D   Squirrel monkey  -a
B D           Tarsier  -a
B D       Mouse lemur  -a
B D          Bushbaby  -a
B D               Pig  -a
B D            Alpaca  -a
B D           Dolphin  -a
B D             Sheep  -a
B D               Cow  -a
B D               Cat  -a
B D               Dog  -a
B D             Panda  -a
B D             Horse  -a
  D  Little brown bat  -a
B D           Megabat  -a
B D          Hedgehog  -a
B D             Shrew  -a
B D          Elephant  -a
B D            Tenrec  -c
B D           Manatee  -a
B D         Armadillo  -a
B D             Sloth  -a
B D           Opossum  c-
B D   Tasmanian devil  t-
B D          Squirrel  ==
B D           Wallaby  ==
B D              Pika  ==
B D              Fugu  ==
B D      Atlantic cod  ==
B D      Nile tilapia  ==
B D         Zebrafish  ==
B D     X. tropicalis  ==
B D          Platypus  ==
B D            Turkey  ==
B D        Coelacanth  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D       Zebra finch  ==
B D           Chicken  ==
B D    Painted turtle  ==
B D        Rock hyrax  ==

Alignment block 11 of 702 in window, 56691066 - 56691067, 2 bps 
B D             Mouse  -at
B D               Rat  -at
B D      Kangaroo rat  -at
B D    Naked mole-rat  -at
B D        Guinea pig  -at
B D            Rabbit  -at
B D              Pika  -at
B D             Human  -at
B D             Chimp  -at
B D           Gorilla  -at
B D         Orangutan  -at
B D            Gibbon  -at
B D            Rhesus  -at
B D            Baboon  -at
B D          Marmoset  -at
B D   Squirrel monkey  -at
B D           Tarsier  -at
B D       Mouse lemur  -at
B D          Bushbaby  -at
B D               Pig  -at
B D            Alpaca  -at
B D           Dolphin  -at
B D             Sheep  -at
B D               Cow  -at
B D               Cat  -at
B D               Dog  -at
B D             Panda  -at
B D             Horse  -at
  D  Little brown bat  -at
B D           Megabat  -at
B D          Hedgehog  -gt
B D             Shrew  -at
B D          Elephant  -at
B D            Tenrec  -at
B D           Manatee  -at
B D         Armadillo  -at
B D             Sloth  -at
B D           Opossum  ag-
B D   Tasmanian devil  aa-
B D          Squirrel  ===
B D           Wallaby  ===
B D              Fugu  ===
B D      Atlantic cod  ===
B D      Nile tilapia  ===
B D         Zebrafish  ===
B D     X. tropicalis  ===
B D          Platypus  ===
B D            Turkey  ===
B D        Coelacanth  ===
B D            Lizard  ===
B D        Budgerigar  ===
B D       Zebra finch  ===
B D           Chicken  ===
B D    Painted turtle  ===
B D        Rock hyrax  ===

Alignment block 12 of 702 in window, 56691068 - 56691099, 32 bps 
B D             Mouse  aaacaa----------acgcaatcataccat-a--g-gagg-ctcaa-----------
B D               Rat  aaacaa----------acgcaatcgtaccac-a--g-gagg-ctaaa-----------
B D      Kangaroo rat  aaacac----------acgtaaccataccactc--g-gaga-ctcaa-----------
B D    Naked mole-rat  aaacaa----------ac--agccatatcac-a--t-gagg-ttccg-----------
B D        Guinea pig  aaacaa----------acttagccgtatcac-a--t-gagg-ctctg-----------
B D          Squirrel  aaaaaa----------atgtaacaatatcgc-a--c-gggt-ttcgg-----------
B D            Rabbit  aaacaa----------acgtaaccgtatcac-a--t-gggg-ctcct-----------
B D              Pika  aaacaa----------acggaaccgtatcac-a--t-gggg-ctgtg-----------
B D             Human  aaacaa----------acgtaaccatatcac-a--t-ggag-ctcca-----------
B D             Chimp  aaacaa----------acgtaaccatatcac-a--t-ggag-ctcca-----------
B D           Gorilla  aaacaa----------acataaccatatcac-a--t-ggag-ctcca-----------
B D         Orangutan  aaacaa----------acgtaaccatatcac-a--t-ggag-ctcca-----------
B D            Gibbon  aaacaa----------acgtaaccatatcac-a--t-ggag-ctcca-----------
B D            Rhesus  aaacaa----------acgtaatcatatcac-a--t-ggag-ctcca-----------
B D            Baboon  aaacaa----------acataatcatatcac-a--t-ggag-ctcca-----------
B D          Marmoset  aaacaa----------aagtaagcgtatcac-a--c-ggag-ctcca-----------
B D   Squirrel monkey  aaacaa----------acgtaaccgtatcac-a--t-gaag-ctcca-----------
B D           Tarsier  aaacaa----------acgtaaccatatcac-a--tggggg-ctcca-----------
B D       Mouse lemur  aaacaa----------gc--aatcctatcac-a--g-gggg-ctccg-----------
B D          Bushbaby  aaacaa----------acataagcccatcac-a----gggg-ctgtg-----------
B D               Pig  aaacaa----------atataatcatatcac-a--t-gggg-ttccg-----------
B D            Alpaca  aaacaa----------atataaccatatcac-a--t-gggg-ctccg-----------
B D           Dolphin  aaacaa----------atataaccatatcac-a--t-gggg-cacca-----------
B D             Sheep  aaacaa----------atataaccatatcac-a--tggggg-caacg-----------
B D               Cow  aaacaa----------atataaccatatcac-a--tggggg-caacg-----------
B D               Cat  aaacaa----------atgtaaccatatcac-a--c-gggg-ctccg-----------
B D               Dog  aaacaa----------atgtaactatatcac-a--t-gggg-ctctg-----------
B D             Panda  aaacaa----------atgtaaccatatcac-a--t-gggg-ctccg-----------
B D             Horse  aaacaa----------atgtaaccatatcac-a--t-gggg-ctccg-----------
  D  Little brown bat  aaac-a----------atgtaaccatatcac-a--t-agggcccgcg-----------
B D           Megabat  aaacaa----------atgtaaccatatcac-a--c-ggg--ctccg-----------
B D          Hedgehog  taacca----------acgtaaccatatcac-aggg-gggg-ttctg-----------
B D             Shrew  aaacaa----------acgtaaccatatcac-a-gg-gggg-ctccg-----------
B D          Elephant  aaacaa----------acttaaccatatcac-a--c-gagg-ctccg-----------
B D            Tenrec  aaacaa----------acgtaaccatatcac-a--c-gggg-ctcct-----------
B D           Manatee  aaacaa----------acgtaaccatatcac-a--c-gagg-ctccg-----------
B D         Armadillo  aaacaa----------acgtaaccaaatcac-a--t-gggg-ctctg-----------
B D             Sloth  aaacaa----------acgtaaccatatcac-a--t-gggg-ccctg-----------
B D           Opossum  aagcaacctctctgttatttaactatttcat-a--a-gaaa-aaattg-----aacaa
B D   Tasmanian devil  aaacaagttcgcaattatttaaatatttcat-t--a-aaga-aaaatgaccacaacaa
B D           Wallaby  ==========================================================
B D              Fugu  ==========================================================
B D      Atlantic cod  ==========================================================
B D      Nile tilapia  ==========================================================
B D         Zebrafish  ==========================================================
B D     X. tropicalis  ==========================================================
B D          Platypus  ==========================================================
B D            Turkey  ==========================================================
B D        Coelacanth  ==========================================================
B D            Lizard  ==========================================================
B D        Budgerigar  ==========================================================
B D       Zebra finch  ==========================================================
B D           Chicken  ==========================================================
B D    Painted turtle  ==========================================================
B D        Rock hyrax  ==========================================================

Inserts between block 12 and 13 in window
B D          Opossum 1bp
B D  Tasmanian devil 11bp

Alignment block 13 of 702 in window, 56691100 - 56691191, 92 bps 
B D             Mouse  agccatccttctaaaagcaattccactg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D               Rat  agccgttcttctgaaagcgattccactg-------ttgaaaactgaaaaacgggtgtaatctgcgttcag
B D      Kangaroo rat  cg-cgtccttccgaaagcaagcccgccg-------ttgaaaactgaaaaatgggtgtaatttgctttcag
B D    Naked mole-rat  cgccgttcttctgaaagcaattccactg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D        Guinea pig  cgccgttctttctaaagcagttccactg-------ttcaaaactgaaaaatgggtgtaattcgctttcag
B D          Squirrel  agtcgtcct---gaaatccatcccactg-------ttgaaaactgaaaaatgggtgtaatttgcgctcgg
B D            Rabbit  cgcggtccttctgaaagcgattccactg-------ttgaaaactgaaaaatgggtgtaatttgcgatcag
B D              Pika  cgccgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgatccg
B D             Human  cactgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgctttcag
B D             Chimp  cactgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgctttcag
B D           Gorilla  cactgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgctttcag
B D         Orangutan  cactgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D            Gibbon  cactgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D            Rhesus  cactgtccttctgaaagcaattccactg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D            Baboon  cactgtccttctgaaagcaattccactg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D          Marmoset  caccatccttctgaaagcaattcagc-g-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D   Squirrel monkey  caccatccttctgaaagcaattccgc-g-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D           Tarsier  cgcaatccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D       Mouse lemur  cgacgtccttctgaaagcaattccgctg-------ctgaaaactgaaaaatgggtgtaatttgcattgag
B D          Bushbaby  catcgtctttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D               Pig  cgccgacctcctgaaagcaattccgctg-------ttgaaaactgaaaaatgagtgtaatttgcattcag
B D            Alpaca  cgtcgtccttctgagagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgagttcag
B D           Dolphin  cgccgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D             Sheep  cgccgtccttctgaaaacaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D               Cow  cgccgtccttctgaaaacaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D               Cat  agccgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D               Dog  cgccgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D             Panda  cgccgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttgag
B D             Horse  cgccgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgctttcag
  D  Little brown bat  cgcagtccctctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgtccag
B D           Megabat  cgccgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcattcag
B D          Hedgehog  cccagtccttctgaaagcaattccactg-------tggaaagctgaaaaatgggtgtaatttgcctacag
B D             Shrew  cgcagtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D          Elephant  cgccgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D            Tenrec  cgccgtccttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D           Manatee  cgccgtccttctgaaagcaattctgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D         Armadillo  cgccgttcttctgaaagcaattccgctg-------ttgaaaactgaaaaatgggtgtaatttgcgttcag
B D             Sloth  cgccgtccttctgaaagcaattccgccg-------ttgaaaactgcaaaatgggtgtaatttgcgttcag
B D           Opossum  ---------------atctattcagacttctggaagtgaaaattgaactagggatgatctttagattcag
B D   Tasmanian devil  tacaaactttttaaaaact----------------ttgaaaagtgaaatggggataaagcttaggtttta
B D           Wallaby  agcaatccttttaaaaactattcggccttcaaccagtgaaaactgaaatggggatgaaatttaggttcag
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  aaagtgatgttaggg--tcacggcaatttcc
                  Rat  aaagtgatgttaggg--tcacagcaatttcc
         Kangaroo rat  aaagtgatcttaggg--tcacggcaattttc
       Naked mole-rat  aaagtgatgttaggg--tcacggcaatttct
           Guinea pig  aaagtgacgttaggg--tcacggcaatt--t
             Squirrel  aaagtgatgttaggg--tcacggcaatttcc
               Rabbit  aaagtgatgttaggg--tcatggcaatttcc
                 Pika  aaagtgatgttaggg--tcatggcaacttcc
                Human  aaagtaatgttaggg--tcacggcaatttct
                Chimp  aaagtaatgttaggg--tcacggcaatttcc
              Gorilla  aaagtaatgttaggg--tcacggcaatttcc
            Orangutan  aaagtaatgttaggg--tcagggcaatttcc
               Gibbon  aaagtaatgttaggg--tcacggcaatttct
               Rhesus  aaagtaatgttaggg--tcacggcaatttcc
               Baboon  aaagtaatgttaggg--tcacggcaatttcc
             Marmoset  aaagtaatggtaggg--tcacagcaatttcc
      Squirrel monkey  aaagtaatgttaggg--tcacagcaatttcc
              Tarsier  aaagtgatgctaggg--tcacggcaatttcc
          Mouse lemur  aaagtgatgttaggg--tcacagcaatttcc
             Bushbaby  aaagtgatgttaggg--tcacggcaatttcc
                  Pig  aaagtgacgttaggg--tcacagcaatttcc
               Alpaca  aaagtgatgttaggg--tcacagcaatttct
              Dolphin  aaagtgatgttaggg--tcacagcaatttcc
                Sheep  aaagtgatgttgggg--tcacagcaatttcc
                  Cow  aaagtgatgttgggg--tcacagcaatttcc
                  Cat  aaagtgatgttaggg--tcatggcaatttcc
                  Dog  aaagtgatgttaggg--tcatggcaatttcc
                Panda  aaagtgatgttaggg--tcatggcaatttcc
                Horse  aaagtgatgttaggg--tcacggcaatttcc
     Little brown bat  aaagtgaggctaggg--tcacggcaatttcg
              Megabat  aaagtgatgttaggg--tcatggcaatttcc
             Hedgehog  aaagtgatgttaggg--tcatggcaatttcc
                Shrew  aaagtgatgtgaggg--tcatggcaatttcc
             Elephant  aaagtgatgttatgg--tcaccgcaatttcc
               Tenrec  aaagtgatgtcaggg--tcaccgcaatttcc
              Manatee  aaagtgatgttaggg--tcaccgcaatttcc
            Armadillo  aaagtgatgtttggg--tcacggcaatttcc
                Sloth  aaagtgatgttaggg--tcacggcaattttc
              Opossum  aaagagatgtttaat-gtaatggcattctcc
      Tasmanian devil  aaagacacgactggt--ttaatgcattccct
              Wallaby  aaaagagttcttaggcataaaggcattttcc
                 Fugu  ===============================
         Atlantic cod  ===============================
         Nile tilapia  ===============================
            Zebrafish  ===============================
        X. tropicalis  ===============================
             Platypus  ===============================
               Turkey  ===============================
           Coelacanth  ===============================
               Lizard  ===============================
           Budgerigar  ===============================
          Zebra finch  ===============================
              Chicken  ===============================
       Painted turtle  ===============================
           Rock hyrax  ===============================

Inserts between block 13 and 14 in window
B D          Opossum 37bp

Alignment block 14 of 702 in window, 56691192 - 56691221, 30 bps 
B D             Mouse  cggg-cc-----------gttatttatttttactttaaagtc
B D               Rat  aggg-cc-----------gttatttatttttattttaaagtc
B D      Kangaroo rat  cggg-ct-----------gctatttatttttactttaaagtc
B D    Naked mole-rat  cggg-cg-----------attatttatttttactttacagtc
B D        Guinea pig  cagg-cc-----------attatttattttttctttaacgtc
B D          Squirrel  cggg-cc-----------gttatttatttttactttaaagtc
B D            Rabbit  cggg-cc-----------gttatttatttttactttaaagtc
B D              Pika  cggg-cc-----------gttatttatttttactttaaagtc
B D             Human  cggg-cc-----------gttatttatttttactttaaagtc
B D             Chimp  cggg-cc-----------gttatttatttttactttaaagtc
B D           Gorilla  cggg-cc-----------gttatttatttttactttaaagtc
B D         Orangutan  cggg-cc-----------gttatttgtttttactttaaagtc
B D            Gibbon  cggg-cc-----------gttatttatttttactttaaagtc
B D            Rhesus  cggg-cc-----------gttatttatttttactttaaagtc
B D            Baboon  cggg-cc-----------gttatttatttttactttaaagtc
B D          Marmoset  cgggccc-----------gttatttattttcactttaaagtc
B D   Squirrel monkey  cggg-cc-----------gttatttattttcac-ttaaagtc
B D           Tarsier  cggg-cc-----------gttatttatttttactttaaagtc
B D       Mouse lemur  cggg-cc-----------gttatttatttttactttaaggtc
B D          Bushbaby  cgag-cc-----------gttatttatttttactttaaagtc
B D               Pig  cggg-cc-----------gttatttgtttttactttaaagtc
B D            Alpaca  cggg-cc-----------gttatttatttttactttaaagtc
B D           Dolphin  cggg-cc-----------gttatttatttttactttaaagtc
B D             Sheep  cggg-cc-----------gttatttatttttactttaaagtc
B D               Cow  cggg-cc-----------gttatttatttttactttaaagtc
B D               Cat  cggg-cc-----------gttatttatttttactttaaagtc
B D               Dog  cggg-cc-----------attatttatttttactttaaagtc
B D             Panda  ctgg-cc-----------gttatttatttttactttaaagtc
B D             Horse  cggg-cc-----------gttatttatttttactttaaactc
  D  Little brown bat  cggg-cc-----------gttatttatttttactttaaagtc
B D           Megabat  cggg-cc-----------gttatttatttttatttgaaagtc
B D          Hedgehog  cggg-cc-----------attatttattttcactttaaagtc
B D             Shrew  cggg-cc-----------attatttatttttactttaaagtc
B D          Elephant  cggg-cc-----------gttatttatttttactttaaagtc
B D            Tenrec  cggg-cc-----------gttatttatttttactttaaagtc
B D           Manatee  cggg-cc-----------gttatttatttttactttaaagtc
B D         Armadillo  c-gg-cc-----------gttatttatttttactttgaagtc
B D             Sloth  c-gg-cc-----------gttatttatttttactttgaagtc
B D   Tasmanian devil  -----cccccctaccctttttaattttttttttttt------
B D           Wallaby  -----cc----------------------ttatgtt------
B D              Fugu  ==========================================
B D      Atlantic cod  ==========================================
B D      Nile tilapia  ==========================================
B D         Zebrafish  ==========================================
B D     X. tropicalis  ==========================================
B D          Platypus  ==========================================
B D            Turkey  ==========================================
B D        Coelacanth  ==========================================
B D           Opossum  ==========================================
B D            Lizard  ==========================================
B D        Budgerigar  ==========================================
B D       Zebra finch  ==========================================
B D           Chicken  ==========================================
B D    Painted turtle  ==========================================
B D        Rock hyrax  ==========================================

Alignment block 15 of 702 in window, 56691222 - 56691369, 148 bps 
B D             Mouse  ttt-agggaaga-tttgcttatagactc-gga-----tac-agtat-gagaaccccggc-----------
B D               Rat  ttt-agggaaga-tttgcttgtagactc-ggaaaccttcc-agtat-gagaacactaga-----------
B D      Kangaroo rat  ttt-agggaaggctttgcttatatactc-ggaaagcttcc-aatgc-gcgaagatccgc-----------
B D    Naked mole-rat  ttt-agggaaga-tttgcttatatactc-ggaaaccttcc-aatgcagagaataccagc-----------
B D        Guinea pig  ttt-aaggaaga-tttgcttatatactcgggaaaccttcc-aatgc-gagaataccagc-----------
B D          Squirrel  ttt-agggaaga-tttgcttatgtactc-ggaaaccttcc-aatgc-gaaaataccagc-----------
B D            Rabbit  ttt-aggggaga-tttgcttatacgctc-ggaaaccttcc-agcgc-tccagctccggc-----------
B D              Pika  ttt-agggaaga-tttgcttatagactc-ggaaaccttcc-cattc-gccaacaccggt-----------
B D             Human  ttt-aggaaaga-tttgcttatatgctc-ggaaaacttccaaatgc-gcgaataccagc-----------
B D             Chimp  ttt-aggaaaga-tttgcttatatgctc-ggaaaacttccaaatgc-gcgaataccagc-----------
B D           Gorilla  ttt-aggaaaga-tttgcttatatgctc-ggaaaacttccaaatgc-gcgaataccagc-----------
B D         Orangutan  ttt-aggaaaga-tttgcttatatgctc-ggaaaacttccaaatgc-gagaataccagc-----------
B D            Gibbon  ttt-aggaagga-tttgcttatatgctc-ggaaaacttccaaatgc-gagaataccagc-----------
B D            Rhesus  ttt-aggaaaga-tttgcttatatgctc-ggaaaacttccaaatgc-gagaataccagc-----------
B D            Baboon  ttt-aggaaaga-tttgcttatatgctc-ggaaagcttccaaatgc-gagaataccagc-----------
B D          Marmoset  ttt-aggaaaga-tttgcttatatgctc-ggaaaacttccaaattc-tagaataccagc-----------
B D   Squirrel monkey  ttt-aggaaaga-tttgcttatatgctc-ggaaaacttccaaattt-gagaataccagc-----------
B D           Tarsier  ttt-aggaaaga-tttgcttatgtactc-ggaaaccttcc-aatgc-gagaataccagc-----------
B D       Mouse lemur  ttt-aggaaaga-tttgcttatatactc-ggaaaccttcc-aatgc-gaggatagcagc-----------
B D          Bushbaby  ttt-aggaaaga-tttgcttatatactc-ggaaaccttcc-aatgc-gaggataccagc-----------
B D               Pig  ttt-agggaaga-tttgcttatatactc-gggaaccttcc-aatgc-gagggtaccagc-----------
B D            Alpaca  ttt-aggaaaga-tttgcttatatactc-ggaaaccttcc-aatgc-gagggtacgagc-----------
B D           Dolphin  ttt-agggaaga-tttgcttatatactc-gggaaccttcc-actgc-gagggtaccaat-----------
B D             Sheep  ttt-agggaagg-tttgcttatatactc-aggaaccttcc-aatgc-gagggcaccagc-----------
B D               Cow  ttt-agggaagg-tttgcttatatactc-gggaactttcc-aatgc-gagggcaccagc-----------
B D               Cat  ttt-agggaaga-tttgcttatatactc-ggaaaccttcc-aatgc-gagagtaccagc-----------
B D               Dog  ttt-agggaaga-tttgcttatatactc-ggaaaccttcc-aatgc-gagggtaccagg-----------
B D             Panda  ttt-agggaaga-tttgcttatatactc-ggaaaccttcc-aatgc-gagggtaccagc-----------
B D             Horse  ttt-agggaaga-tttgcttatgtactc-ggaaaccttcc-aatgc-gagggtaccagc-----------
  D  Little brown bat  ttt-agggaaga-tttgcttatatattc-ggaaaccttcc-aatgc-gagggtaccagc-----------
B D           Megabat  ttt-agggaaga-tttgcttatatactc-ggaaaccttcc-aatgc-gagggtaccagc-----------
B D          Hedgehog  ttt-agggaaga--ttgcttatatactc-ggaaaccttcc-aacgc-gagggtactagg-----------
B D             Shrew  ttt-aggaaagc-tttgctgatggactc-ggaaactttcc-aaggc-gagggtaccagc-----------
B D          Elephant  ttt-agggaaga-tttgcttatgtactc-ggaaaccttcc-aatgc-gagggtaccagc-----------
B D            Tenrec  tttaaggggaaa-tttgcttatgtactc-ggaaggcttcc-aacgc-gaggggaccggc-----------
B D           Manatee  ttt-agggaaga-tttgcttatatactc-ggaaactttcc-aatgc-gagggtacaagc-----------
B D         Armadillo  ttt-aggaaaga-tttgcttatagactc-ggaaactttcc-aacgt-gagggtactaac-----------
B D             Sloth  ttt-agggaaga-tttgcttatataacc-ggaaactttcc-aatgt-gagggcactagc-----------
B D           Opossum  tgc-agggaagg-cttccttagatatta-gcagatattag-catga-agtgaacccgttcgcctttcgcc
B D   Tasmanian devil  ttc-agggaaag-gttagctaaatattt-gcagtctttag-aatga-accaaatcgcgtagtttctcacc
B D           Wallaby  ttt-aggaaaag-gtttactagatattt-gcaatcttcag-agtaa-accgaactcagttccctctcacc
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  ----aaccccgctcgccttc--aaagcg-------g-g---agg---g--------------gg----c-
                  Rat  ----aacctcgctcgccttc--aacgcg-------g-g---agg---g--------------gg----g-
         Kangaroo rat  -----gctgcgctcgccttc--cacgcg-------g-g---agg---g--------------gg----a-
       Naked mole-rat  ----a---tcgctcgccttc--aactcg-------g-g---cgg---g--------------gg----a-
           Guinea pig  ----aatcccgctcgccttc--agctcg-------g-g---agg---g--------------gg----a-
             Squirrel  ----aatcccgctcgccttc--aacgcg-------g-g---agg---g--------------gg----g-
               Rabbit  ----aaccccgctcgccctg--gtcgct-------g-g---ggg---a--------------gg----g-
                 Pika  ----catcccgctggccccg--gtcgcg-------gcg---ggg---a--------------gg----g-
                Human  ----aatcccgctcgccttc--aacgcg-------t-g---ggg---t--------------aa---gg-
                Chimp  ----aatcccgctcgccttc--aacgcg-------t-g---ggg---t--------------aaggggg-
              Gorilla  ----aatcccgctcgccttc--aacgcg-------t-g---ggg---t--------------aa---gg-
            Orangutan  ----aatcccgctcgccttc--aacgcg-------t-g---ggg---t--------------aa----g-
               Gibbon  ----aatcccgctcgccttc--aacgcg-------t-g---ggg---t--------------aa----g-
               Rhesus  ----aatcccgctcgccttc--aacgcg-------t-g---ggg---t--------------aa----g-
               Baboon  ----aatcccgctcgccttc--aacgcg-------t-g---ggg---t--------------aa----g-
             Marmoset  ----aatcccgctcgccttc--aacgcg-------g-g---ggt---t--------------aa----g-
      Squirrel monkey  ----aatcccgcttgccttc--aaagcg-------g-g---ggg---t--------------aa----g-
              Tarsier  ----aatcccgctcgccatc--aacgcg-------g-g---ggg---a--------------ga----g-
          Mouse lemur  ----aatcccgctcgccttc--agcgcg-------a-g---ggg-------------------g----t-
             Bushbaby  ----catcccgatcgccttc--cccgcg-------a-a---ggg-------------------g----t-
                  Pig  ----aatcctgctcgccttc--aaagcg-------g-g---ggg---g--------------ag----g-
               Alpaca  ----aatcccgttcgccttc--aacgcg-------g-g---gga---g--------------gg----a-
              Dolphin  ----aatcccgcttgccttc--aaagcg-------g-g---ggg---g--------------gg----gg
                Sheep  ----aatcccgcttgccttc--aaagcg-------g-g---ggg---a--------------ag----a-
                  Cow  ----aatcccgcttgccttc--aaagct-------g-g---ggg---a--------------ag----g-
                  Cat  ----aatccggttcgccttc--aacgcg-------gcg---gggggtg--------------gg----g-
                  Dog  ----aatccagttcgccttc--aacgcg-------a-g---ggg---g--------------ag----g-
                Panda  ----aatctagttcgccttc--aacgcg-------gcg---ggg---g--------------gt----g-
                Horse  ----aatcccgctcgccttc--atcgcg-------g-g---ggg---g--------------ag----g-
     Little brown bat  ----caccccgctctccttc--aacgcg-------t-g---ggg---g--------------ga----g-
              Megabat  ----aatctcactcgccttc--aacgcg---------g---cgg---g--------------ga----g-
             Hedgehog  ----aattctcttcgccccc--aatgct-------g-g---gtg---gggagttggggttgtgg----g-
                Shrew  ----aatcccgcttgccttc--aaggcg-------g-a---ggg---a--------------gg----g-
             Elephant  ----aatcccgctcgccttc--aacgc--------g-g---ggg---g--------------ga----c-
               Tenrec  ----aaccccgctcgccttc--gacacgggcagagg-g---ggg---a--------------gg----c-
              Manatee  ----aatcccgctcgccttc--aacgc--------g-g---ggg---g--------------ga----c-
            Armadillo  ----aatcctgctcggcttc--agcgcgggggtggg-g---tgg---a--------------cg----c-
                Sloth  ----aatccctctcgccttc--aacacggggggtgg-g---ggg---a--------------cg----t-
              Opossum  taggaatgctgttcttttctgaaacaca-------a-a---gag---g--------------gt----a-
      Tasmanian devil  tcggaattctggtctcttctgaaacaca-------a-a--gcgg---a--------------gg----a-
              Wallaby  tcggaatcctgttctcttgtgaaacaca-------a-atgacgg---g--------------ga----a-
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
           Rock hyrax  ======================================================================

                Mouse  ----------ctga-------ag---g-tggagaacaatt----actgagtgacgctaatatggggaaac
                  Rat  ----------ctga-------ag---g-tggagaacaatt----actgagtgacgctaatatggggaaac
         Kangaroo rat  ------------gg-------ag---g-tggagaacaatt----accgagtgacgctaatatggggaaac
       Naked mole-rat  --------gggagg-------ag---g-tggagaacaatt----actgagtgacgctaatatggggaaac
           Guinea pig  --------ggaggg-------ag---g-tggagaacaatt----actgagtgacgctaatatggggaaac
             Squirrel  ----------aagg-------ag---g-tggagaacaatt----actgagtgacgctaatatggggaaac
               Rabbit  --------------------------g-tagagaacaatt----actgagtgacgcttctacagggaacc
                 Pika  --------------------------g-tggagaacaatt----actgagtgacgctcctacggggaaac
                Human  ------------gg-------gg---g-tggggaacaatt----actgagtgacgctaatatggggaaac
                Chimp  ------------gg-------gg---g-tggggaacaatt----actgagtgacgctaatatggggaaac
              Gorilla  ------------gg-------gg---g-tggggaacaatt----actgagtgacgctaatatggggaaac
            Orangutan  ------------gg-------gg---g-tggggaacaatt----actgagtgacgctaatatggggaaac
               Gibbon  ------------gg-------gg---g-tggggaactatt----actgagtgacgctaatatggggaaac
               Rhesus  ------------gg-------gg---g-tggggaacaatt----actgagcgacgctaatatggggaaac
               Baboon  ------------gg-------gg---g-tggggaacaatt----actgagtgacgctaatatggggaaac
             Marmoset  ------------gg-------gg---g-tggggaacaatt----actgagtgacgctaatatagggaaac
      Squirrel monkey  ------------gg-------gg---g-tggggaacaatt----actgtgtgacgctaatatggggaaac
              Tarsier  ------------gg---------------ggagaacaatt----actgagtgacgctaatacggggaaac
          Mouse lemur  ------------gg-------tg---g-tggagaacaatt----actgagtgacgctaatatggggaaac
             Bushbaby  ------------gg-------gg---g-tggagaacaatt----actgagtgacgctaatatggggaaac
                  Pig  ---------------------gg---g-tggagaacaatt----actgagtgacgctaatatggggaaac
               Alpaca  ------------ag-------gg---g-tggagaacaattactgactgagtgacgctaatatggggaaac
              Dolphin  ggggggagggggag-------gg---g-tggagaacaatt----actgagtgacgctaatatggggaaac
                Sheep  -------------g-------gg---g-tggagaacaatt----actgagtgacgctaatgtggggaaac
                  Cow  -------------g-------gg---g-tggagaacaatt----actgagtgacgctaatgtggggaaac
                  Cat  ---------------------gg---g-tggagaacaatt----actgagtgacgctaatatggggaaac
                  Dog  ---------------------gg---g-tggagaacaatt----actgagtgacgctaatatggggaaac
                Panda  ---------------------gg---g-tggagaacaatt----actgagtgacgctaatatggggaaac
                Horse  ---------------------gg---c-tggagaacaatt----actgagtgacgctaatacggggaaac
     Little brown bat  ---------------------ggggtg-tggagaacaatt----accgagtgacgctaatatggggaaac
              Megabat  ---------------------gg---g-tggagaacaatt----actgagtgacgctaatatggggaaac
             Hedgehog  ----------aagggatcgatgg---g-ttgagaacaatc----actgagtgacgctaatatggggaaac
                Shrew  ----------aagg-------gg---g-tggagaacaatt----actgagtgacgctaatacggggaaac
             Elephant  ------------gg-------gg---g-tggagaacaatt----actgagtgacgctaatacggggaaac
               Tenrec  ------------gg-------gg---g-tggagaacaatt----acggagtgacgctaatatggggaaac
              Manatee  ------------gg-------gg---g-tggagaacaatt----actgagtgacgctaatatggggaaac
            Armadillo  ------------gg-------gg---g-tggagaacaatt----actgagtgacgctaatatggggaaac
                Sloth  ------------gg-------gg---gatggagaacaatt----actgtgtgacgctaatat-gggaaac
              Opossum  ------------gg-------ca---g-gggagagaaatc----gc-aactgaagtagatgctgggaaac
      Tasmanian devil  ------------gg-------cg---g-gggagagaaatc----cc-atctgatgtagatactaggaaac
              Wallaby  ------------gg-------cg---g-ggaagagaaatc----gc-aacacaagtagatgatgaaaact
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
           Rock hyrax  ======================================================================

                Mouse  t-g-aaaagaaatgtcgattgtttt
                  Rat  t-g-aaaagaaatgtcgattgtttt
         Kangaroo rat  t-g-aaaagaaaagtcgattgtttt
       Naked mole-rat  t-g-aaaagaaatgtcgattgtttt
           Guinea pig  t-g-aaaagaaatgtcgattgtttt
             Squirrel  t-g-aaaagaaatgtcgattgtttt
               Rabbit  g-g-cagagaaaagtcgattgtttt
                 Pika  g-g-cagagaaatgtcgattgtttt
                Human  t-g-aaaagaaatgtcgattgtttt
                Chimp  t-g-aaaagaaatgtcgattgtttt
              Gorilla  t-g-aaaagaaatgtcgattgtttt
            Orangutan  t-g-aaaagaaatgtcgattgtttt
               Gibbon  t-g-aaaagaaatgtcgattgtttt
               Rhesus  t-g-aaaagaaatgtcgattgtttt
               Baboon  t-g-aaaagaaatgtcgattgtttt
             Marmoset  t-g-aaaagaaatgtcgattgtttt
      Squirrel monkey  t-g-aaaagaaatgtcgattgtttt
              Tarsier  t-g-aaaagaaatgtcgattgtttt
          Mouse lemur  t-g-aaaagaaatgtcgattgtttt
             Bushbaby  t-g-aaaagaaatgtcgattgtttt
                  Pig  t-g-aaaagaaatgtcgattgtttt
               Alpaca  t-g-aaaagaaatgtcgattgtttt
              Dolphin  t-g-aaaagaaatgtggat--gttt
                Sheep  t-g-aaaagaaatgtcgattgtttt
                  Cow  t-g-aaaagaaatgtcgattgtttt
                  Cat  t-g-aaaagaaatgtcgattgtttt
                  Dog  t-g-aaaagaaatgtcgattgtttt
                Panda  t-g-aaaagaaatgtcgattgtttt
                Horse  t-g-aaaagaaatgtcgattgtttt
     Little brown bat  t-g-aaaagaaatgtcgattgtttt
              Megabat  t-gaaaaagaaatgtcgattgtttt
             Hedgehog  t-gaaaaagaaatgccgattgtttt
                Shrew  t-g-aaaagaaatgtcgattgtttt
             Elephant  t-g-aaaagaaatgtctattgtttt
               Tenrec  tgg-aaaagaaatgtctattgtttt
              Manatee  t-g-aaaagaaatgtctattgtttt
            Armadillo  t-g-aaaagaaatgtcgattgtttt
                Sloth  t-g-aaaagaaatgcggattgtttt
              Opossum  c-g-aaaagaaatgtctattgtttt
      Tasmanian devil  c-g-aaaagaaatgtccatcgtttt
              Wallaby  c-a-aaatgaaatgtccattatttt
                 Fugu  =========================
         Atlantic cod  =========================
         Nile tilapia  =========================
            Zebrafish  =========================
        X. tropicalis  =========================
             Platypus  =========================
               Turkey  =========================
           Coelacanth  =========================
               Lizard  =========================
           Budgerigar  =========================
          Zebra finch  =========================
              Chicken  =========================
       Painted turtle  =========================
           Rock hyrax  =========================

Alignment block 16 of 702 in window, 56691370 - 56691422, 53 bps 
B D             Mouse  -tattgt----aacagaaggagtgagca-aacag-aaaaacca---------------------------
B D               Rat  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D      Kangaroo rat  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D    Naked mole-rat  -tattgt----aatagaaggagtgagca-aatag-aaaaacca---------------------------
B D        Guinea pig  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D          Squirrel  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D            Rabbit  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D              Pika  -tattgt----aatagaaggagtgagca-aacag-aaaaacta---------------------------
B D             Human  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D             Chimp  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D           Gorilla  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D         Orangutan  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D            Gibbon  -tattgt----aatagaaggagggagca-aacag-aaaaacca---------------------------
B D            Rhesus  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D            Baboon  -tactgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D          Marmoset  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D   Squirrel monkey  -tattgt----aatagaaggagtgagca-agcag-aaaaacca---------------------------
B D           Tarsier  -tattgt----aatagaaggagtgagca-aacag-aaaaacca---------------------------
B D       Mouse lemur  -tattgt----aacagaaggagtgagca-aacag-aaaaacca---------------------------
B D          Bushbaby  -tattgt----aatagaaggagtgagca-aatag-taaaacca---------------------------
B D               Pig  -tattgt----aacagaaggagtgtgca-aacag-aaaaacca---------------------------
B D            Alpaca  -tattgt----aacagaaggagtgtgca-aacagaaaaaacca---------------------------
B D           Dolphin  -tattgt----aacagaaggagtgtgca-aacag-aaaaacca---------------------------
B D             Sheep  -tattgt----aacagaaggagtgtgca-aacag-aaaaacca---------------------------
B D               Cow  -tattgt----aacagaaggagtgtgca-aacag-aaaaacca---------------------------
B D               Cat  -tattgt----aacagaaggagtgaaca-aacag-aaaaacca---------------------------
B D               Dog  -tattgt----aacagaaggagtgaaca-aacag-aaaaacca---------------------------
B D             Panda  -tattgt----aacagaaggagtgaaca-aacag-aaaaacca---------------------------
B D             Horse  -tattgt----aacagaaggagtgagca-aacag-aaaaacca---------------------------
  D  Little brown bat  -tattgt----aacagaaggagtgagca-aacag-aaaaacca---------------------------
B D           Megabat  -tattgt----aacggaaggagtgagca-aacag-aaaaacca---------------------------
B D          Hedgehog  -tattgt----aacagaaggagtgagca-aacag-aaaaacca---------------------------
B D          Elephant  -tattgt----aacagaaggagtgagca-aacag-aaaaacca---------------------------
B D            Tenrec  -tattgt----aacagaaggagtgagca-aacag-gaacgcta---------------------------
B D           Manatee  -tattgt----aacagaaggagtgcgca-aacag-aaaaacca---------------------------
B D         Armadillo  -tattgt----aacagaaggagtgagca-aacag-aaaaatca---------------------------
B D             Sloth  -tattgt----aacagaaggagtgagcatagcag-aaaaacca---------------------------
B D           Opossum  ta---------aaccggggggggggggg-gtctg-agcaaaaacggaggggggggggagtgtcggcggct
B D   Tasmanian devil  taattggggaaaacaaagggaaagaaga-aactg-agtaacaactggggcgaggg-----tttggc----
B D           Wallaby  tcattgg----aaaaaggggacag-------ctg-aggaaaaaatgggacgaagg-----tttgg-----
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  --------------------accccggctgatcggaa
                  Rat  --------------------accggggctgatcggaa
         Kangaroo rat  --------------------accccggctgatcggaa
       Naked mole-rat  --------------------acccagggtgatcagaa
           Guinea pig  --------------------acccggggtgatcggaa
             Squirrel  --------------------accccgggtgatcggaa
               Rabbit  --------------------gccccgggtgatcggaa
                 Pika  --------------------acctcgggtgatcggaa
                Human  --------------------accccgggtgatcggaa
                Chimp  --------------------accccgggtgatcggaa
              Gorilla  --------------------accccggctgatcggaa
            Orangutan  --------------------accccgggtgatcggaa
               Gibbon  --------------------accccgggtgatcggaa
               Rhesus  --------------------accccgggtgatcggaa
               Baboon  --------------------accccgggtgatcggaa
             Marmoset  --------------------accccgggtgatcggaa
      Squirrel monkey  --------------------accccgggtgatcggaa
              Tarsier  --------------------agcccgggtgatcggaa
          Mouse lemur  --------------------accccgggtgatcggaa
             Bushbaby  --------------------accccgggtgatcggaa
                  Pig  --------------------accccgggtgatcggaa
               Alpaca  --------------------acccggggtgatcggaa
              Dolphin  --------------------accctgggtgatcggaa
                Sheep  --------------------accccgggtgatcggaa
                  Cow  --------------------accccgggtgatcggaa
                  Cat  --------------------accccgggtgatcggaa
                  Dog  --------------------accctgggtgatcggaa
                Panda  --------------------accccgggtgatcggaa
                Horse  --------------------accccgggtgatcggaa
     Little brown bat  --------------------accccgagtgatccgaa
              Megabat  --------------------accccgggtgatcggaa
             Hedgehog  --------------------acccgggatgatcggaa
             Elephant  --------------------acccggggtgatcggaa
               Tenrec  --------------------actctgggtgatcggaa
              Manatee  --------------------accccgggtgatcggaa
            Armadillo  --------------------accccgggtgatcggaa
                Sloth  --------------------atctcgtgtgatcagat
              Opossum  cacagggggtcaggggggacgcacctagtgaaccgaa
      Tasmanian devil  ----tagagttggggagga-gcacttagtaataggaa
              Wallaby  -----ggagatggg------gcacgtaatgaccggaa
                 Fugu  =====================================
         Atlantic cod  =====================================
         Nile tilapia  =====================================
            Zebrafish  =====================================
        X. tropicalis  =====================================
             Platypus  =====================================
               Turkey  =====================================
           Coelacanth  =====================================
               Lizard  =====================================
           Budgerigar  =====================================
          Zebra finch  =====================================
              Chicken  =====================================
       Painted turtle  =====================================
                Shrew  =====================================
           Rock hyrax  =====================================

Inserts between block 16 and 17 in window
B D           Alpaca 385bp

Alignment block 17 of 702 in window, 56691423 - 56691453, 31 bps 
B D             Mouse  acaggcaggcggagaatgaaaagtgggtttc
B D               Rat  acaggcaggcggagaatgaaaagtgggtttc
B D      Kangaroo rat  acaggcaggcggagaatttaaagcgggtttc
B D    Naked mole-rat  acaggcagacggagaattcaaagcgggtttc
B D        Guinea pig  acaggcaga-ggaaaattaaaagcgggtttc
B D          Squirrel  acaggcagacggagaattaaaagcgggtttc
B D            Rabbit  acaggcaggcggagaattaaaagcgggtttc
B D              Pika  acaggcaggcggagaattaaaagcggctttc
B D             Human  acaggcaggcggagaattaaaagcgggtttc
B D             Chimp  acaggcaggcggagaattaaaagcgggtttc
B D           Gorilla  acaggcaggcggagaattaaaagcgggtttc
B D         Orangutan  acaggcaggcggagaattaaaagtgggtttc
B D            Gibbon  acaggcaggcggagaattaaaagcgggtttc
B D            Rhesus  acaggcaggcggagaattaaaagcggatttc
B D            Baboon  acaggcaggcggagaattaaaagcggatttc
B D          Marmoset  acaggcaggcggagaattaaaagcgggtttc
B D   Squirrel monkey  acaggcaggcggagaattaaatgcggatttc
B D           Tarsier  acaggcagg-agagaattaaaagcgggtttc
B D       Mouse lemur  acaggcaggcggagaattaaaagccggtttc
B D          Bushbaby  acaggcaggcggagaatt-aaagccggtttc
B D               Pig  acaggcaggcggagaattaaaagcgggtttc
B D           Dolphin  acaggcaggcggagaattaaaagcgggtttc
B D             Sheep  acaggcaggcggagaattaaaagcgggtttc
B D               Cow  acaggcaggcggagaattaaaagcgggtttc
B D               Cat  acaggcaggcggggaattaaaagcgggtctc
B D               Dog  acaggcaggcggggaattaaaagcgggtttc
B D             Panda  acaggcaggcggggaattaaaagcgggtttc
B D             Horse  acaggcaggcggagaattgaaagcgggtttc
  D  Little brown bat  acaggcaggcggagaattaaaagcgggtttc
B D           Megabat  acaggcaggcggagaattaaaagcgggtttt
B D          Hedgehog  acaggcaggcggagaattaaaagcgggtttc
B D          Elephant  acaggcaggcggagaattaaaagcgggtttc
B D            Tenrec  acaggcaggcggagaatgagaagcgggtttc
B D           Manatee  acaggcaggcggagaattaaaagcgggtttc
B D         Armadillo  acaggcaggcgcagaattaaaagcgggtttc
B D             Sloth  acagacaggcggagaattaaaagcgggtttc
B D           Opossum  ----gcagtagaagaattaaaagcgggtttc
B D   Tasmanian devil  ----acagaagaagaattgaaagcgggtttc
B D           Wallaby  ----agagaagaagaactgaaagcgagtttc
B D            Alpaca  ===============================
B D              Fugu  ===============================
B D      Atlantic cod  ===============================
B D      Nile tilapia  ===============================
B D         Zebrafish  ===============================
B D     X. tropicalis  ===============================
B D          Platypus  ===============================
B D            Turkey  ===============================
B D        Coelacanth  ===============================
B D            Lizard  ===============================
B D        Budgerigar  ===============================
B D       Zebra finch  ===============================
B D           Chicken  ===============================
B D    Painted turtle  ===============================
B D             Shrew  ===============================
B D        Rock hyrax  ===============================

Inserts between block 17 and 18 in window
B D          Tarsier 367bp

Alignment block 18 of 702 in window, 56691454 - 56691477, 24 bps 
B D             Mouse  aggccgcaac--agg-cccctccctcc----
B D               Rat  aggccgcaac--agg-cccctccctcc----
B D      Kangaroo rat  aggccgccac--agg-c----ccctcc----
B D    Naked mole-rat  aggccaccac--agg-c----ccctcc----
B D        Guinea pig  aggccgcagc--agg-c----ccctcc----
B D          Squirrel  aggccgcaac--agg-c----ccctcc----
B D            Rabbit  gggcggcaac--agg-c----ccctcc----
B D              Pika  tggcggccac--agg-c----ccctcc----
B D             Human  agacagcaac--agg-c----ccctcc----
B D             Chimp  agacagcaac--agg-c----ccctcc----
B D           Gorilla  agacagcaac--agg-c----ccctcc----
B D         Orangutan  agacagcaac--agg-c----ccctcc----
B D            Gibbon  agacagcaac--agg-c----ccctcc----
B D            Rhesus  agacagcaac--agg-c----ccctcc----
B D            Baboon  agacagcaac--agg-c----ccctcc----
B D          Marmoset  aggcagcaac--agg-c----ccctcc----
B D   Squirrel monkey  aggcagcaac--agg-c----ccctcc----
B D       Mouse lemur  aggcggcaac--aag-c----ccctcc----
B D          Bushbaby  aggcggcaat--agg-c----ccctcc----
B D               Pig  aggcagcaac--aag-c----ccctcc----
B D           Dolphin  aggcggcaac--aag-c----ccctcc----
B D             Sheep  aggcggcaac--aag-c----ccctcc----
B D               Cow  aggcggcaac--aag-c----ccctcc----
B D               Cat  aggcggcaac--agg-c----ccctcc----
B D               Dog  aggctgcaac--agg-c----ccctcc----
B D             Panda  aggcggcaac--agg-c----ccctcc----
B D             Horse  gagcggcaac--agg-c----ccctcc----
  D  Little brown bat  aggcggcagc--agg-c----ccctcc----
B D           Megabat  aggcggcagc--agg-c----ccctcc----
B D          Hedgehog  ggaaggtcgc--agg-c----ccctcc----
B D          Elephant  aggcggcagc--aggcc----ccctcc----
B D            Tenrec  aggcggctgc--agg-c----ctctcc----
B D           Manatee  aggcggcaac--agg-c----ccctcc----
B D         Armadillo  atgaggcaac--agg-c----ccctcc----
B D             Sloth  tggaggcaac--a-g-c----ccctcc----
B D           Opossum  tag--ttagt--tgg-c----ccctcctctc
B D   Tasmanian devil  cagaaccagtaaagg-t----ccttcccccc
B D           Wallaby  tagaattagt--agg-c----cccacccctc
B D           Tarsier  ===============================
B D            Alpaca  ===============================
B D              Fugu  ===============================
B D      Atlantic cod  ===============================
B D      Nile tilapia  ===============================
B D         Zebrafish  ===============================
B D     X. tropicalis  ===============================
B D          Platypus  ===============================
B D            Turkey  ===============================
B D        Coelacanth  ===============================
B D            Lizard  ===============================
B D        Budgerigar  ===============================
B D       Zebra finch  ===============================
B D           Chicken  ===============================
B D    Painted turtle  ===============================
B D             Shrew  ===============================
B D        Rock hyrax  ===============================

Inserts between block 18 and 19 in window
B D  Tasmanian devil 7bp
B D          Wallaby 4822bp

Alignment block 19 of 702 in window, 56691478 - 56691490, 13 bps 
B D             Mouse  cctggcctgggaa
B D               Rat  cctggcctgggac
B D      Kangaroo rat  cctgccctcggaa
B D    Naked mole-rat  cctgccctgggca
B D        Guinea pig  cctgccctgggca
B D          Squirrel  cctgccctcggaa
B D            Rabbit  tctgccctccgaa
B D              Pika  cctgccctcggag
B D             Human  cctgctctcgcaa
B D             Chimp  cctgctctcgcaa
B D           Gorilla  cctgctctcgcaa
B D         Orangutan  cctgccctcgcaa
B D            Gibbon  cctgccctcgcaa
B D            Rhesus  cctgccctcgcaa
B D            Baboon  cctgccctcgcaa
B D          Marmoset  cctgccctcgcaa
B D   Squirrel monkey  cctgccctcgcaa
B D       Mouse lemur  cctgcccttggaa
B D          Bushbaby  cctgcccttggaa
B D               Pig  cctgccctcggaa
B D           Dolphin  cctgccctcggaa
B D             Sheep  cctgccctcggaa
B D               Cow  cctgccctcggaa
B D               Cat  cctgcccttggaa
B D               Dog  cctgcccttggaa
B D             Panda  cctgcctttggaa
B D             Horse  cctgccctcggaa
  D  Little brown bat  cctgccctcggaa
B D           Megabat  cctgccctcggaa
B D          Hedgehog  cctgagcagcgat
B D          Elephant  cctgccctcggaa
B D            Tenrec  tctgccctccgca
B D           Manatee  cctgccctaggaa
B D         Armadillo  cctgccctcggaa
B D             Sloth  cgtgccctcgaaa
B D           Opossum  -------attgaa
B D   Tasmanian devil  tctcctcagaaaa
B D           Tarsier  =============
B D           Wallaby  =============
B D            Alpaca  =============
B D              Fugu  =============
B D      Atlantic cod  =============
B D      Nile tilapia  =============
B D         Zebrafish  =============
B D     X. tropicalis  =============
B D          Platypus  =============
B D            Turkey  =============
B D        Coelacanth  =============
B D            Lizard  =============
B D        Budgerigar  =============
B D       Zebra finch  =============
B D           Chicken  =============
B D    Painted turtle  =============
B D             Shrew  =============
B D        Rock hyrax  =============

Inserts between block 19 and 20 in window
B D          Dolphin 528bp

Alignment block 20 of 702 in window, 56691491 - 56691515, 25 bps 
B D             Mouse  ggagcgagccggg-ctaagcgctcgc
B D               Rat  ggagagagccggctctaagcgctcgc
B D      Kangaroo rat  ggagaaagcgggcgatgcgcgctggc
B D    Naked mole-rat  ggagaaagcgggcgatgagcgctcgc
B D        Guinea pig  ggagagcgcgggcgcggagcgct-gc
B D          Squirrel  gaagaacgcggacggtgagcgctagc
B D            Rabbit  ggagaa-gcgggcgctgagcgctcgc
B D              Pika  agagaa-gcgggagaggagcgctcgc
B D             Human  ggagaaagcgggcgacgagcgctcgc
B D             Chimp  ggagaaagcgggcgacgagcgctcgc
B D           Gorilla  ggagaaagcgggcgacgagcgctcgc
B D         Orangutan  ggagaaagcgggcgacgagcgctcgc
B D            Gibbon  ggagaaagcgggcgatgagcactcgc
B D            Rhesus  ggagaaagcgggcgacgagctctctc
B D            Baboon  ggagaaagcgggcgacgagctctctc
B D          Marmoset  ggagaaagccggcgactagcgttcgc
B D   Squirrel monkey  ggagaaagccggcgatcagcgttcgc
B D       Mouse lemur  ggagacagcgggcggcgggcgctcgc
B D          Bushbaby  gaagaaagcgggcgacgagcgctcgc
B D               Pig  ggagaaagagagtgaggagcgctcgc
B D           Dolphin  ggagaaagagggtgaggagcgctcgc
B D             Sheep  ggagaaagcgggtgaggagcgctcgc
B D               Cow  ggagaaagcgggtgaggagcgctcgc
B D               Cat  ggagaaagcgggtgaggagcgctcgc
B D               Dog  ggagaaagcgggtgccgagcgctctc
B D             Panda  ggagaaagcgggtgaggagcgctctc
B D             Horse  ggagaaagcgggcgaggcgcgcttgc
  D  Little brown bat  ggagagagcgggtga-gagagctcgc
B D           Megabat  ggagaaagcgggtgaggagcgcttgc
B D          Hedgehog  ggagagagcgggaggggagaccctgc
B D          Elephant  ggagaaagcggtccaggagcgctcgc
B D            Tenrec  -gagaaagccggccccgagcgcacgc
B D           Manatee  ggagaaagcgggccaggagcgctagc
B D         Armadillo  ggagaaagcgggcgaggagcgttcgc
B D             Sloth  ggagaaagccggcgagaagcgctcgc
B D           Opossum  --agaa---ggggaaagagctatcc-
B D   Tasmanian devil  --agaa---ggagcaagagtgatcc-
B D           Tarsier  ==========================
B D           Wallaby  ==========================
B D            Alpaca  ==========================
B D              Fugu  ==========================
B D      Atlantic cod  ==========================
B D      Nile tilapia  ==========================
B D         Zebrafish  ==========================
B D     X. tropicalis  ==========================
B D          Platypus  ==========================
B D            Turkey  ==========================
B D        Coelacanth  ==========================
B D            Lizard  ==========================
B D        Budgerigar  ==========================
B D       Zebra finch  ==========================
B D           Chicken  ==========================
B D    Painted turtle  ==========================
B D             Shrew  ==========================
B D        Rock hyrax  ==========================

Inserts between block 20 and 21 in window
B D         Elephant 5bp
B D           Tenrec 1bp
B D          Manatee 5bp
B D        Armadillo 6bp
B D            Sloth 2596bp

Alignment block 21 of 702 in window, 56691516 - 56691525, 10 bps 
B D             Mouse  tg--------------------------------------------------------------------
B D               Rat  cg--------------------------------------------------------------------
B D      Kangaroo rat  gg--------------------------------------------------------------------
B D    Naked mole-rat  ggtccgc---------------------------------------------------------ggggca
B D        Guinea pig  agcccgc---------------------------------------------------------ggggca
B D          Squirrel  agtccgc---------------------------------------------------------cgcgca
B D            Rabbit  agccggc---------------------------------------------------------gggact
B D              Pika  cgccggt---------------------------------------------------------ggggcc
B D             Human  agcccgt---------------------------------------------------------ggggct
B D             Chimp  agcccgt---------------------------------------------------------ggggct
B D           Gorilla  agcccgt---------------------------------------------------------ggggct
B D         Orangutan  agcccgt---------------------------------------------------------ggggct
B D            Gibbon  agcccgt---------------------------------------------------------ggggct
B D            Rhesus  agccggtg--------------------------------------------------------ggggca
B D            Baboon  agccggt---------------------------------------------------------ggggcc
B D          Marmoset  agcccgt---------------------------------------------------------ggggcc
B D   Squirrel monkey  aacccgt---------------------------------------------------------ggggcg
B D       Mouse lemur  agccggc----------------------------------------------------------gggtg
B D          Bushbaby  agcccgc----------------------------------------------------------gggtc
B D               Pig  agcccc----------------------------------------------------------agggcc
B D           Dolphin  accccc----------------------------------------------------------agggcg
B D             Sheep  agcccc----------------------------------------------------------aaggcg
B D               Cow  agcccc----------------------------------------------------------agggcg
B D               Cat  agcccc----------------------------------------------------------gggggc
B D               Dog  agcccc----------------------------------------------------------ggggcg
B D             Panda  ggcccg----------------------------------------------------------ggggcc
B D             Horse  cgccgc-----------------------------------------------------------gggcc
  D  Little brown bat  tgcccc----------------------------------------------------------ggggcc
B D           Megabat  agcccc-----------------------------------------------------------cggcc
B D          Hedgehog  acccccccggggggctcatgcggcctaggggctctggacttggggctaccgggggctctggacctggggc
B D          Elephant  ---------------------------------------------------------------ctgggcc
B D            Tenrec  ------------------------------------------------------------------ggcc
B D           Manatee  ---------------------------------------------------------------cggggcc
B D         Armadillo  ---------------------------------------------------------------cggggcc
B D           Opossum  --------------------------------------------------------------------ta
B D   Tasmanian devil  --------------------------------------------------------------------ta
B D           Tarsier  ======================================================================
B D           Wallaby  ======================================================================
B D            Alpaca  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  ga-ctccag
                  Rat  ga-ctccag
         Kangaroo rat  a--------
       Naked mole-rat  ga-tcccaa
           Guinea pig  ga-ccccac
             Squirrel  ga-tcccgc
               Rabbit  gacccccac
                 Pika  ga-tcccag
                Human  ga-tcccac
                Chimp  ga-tcccac
              Gorilla  ga-tcccac
            Orangutan  ga-tcccac
               Gibbon  ga-tcccac
               Rhesus  ga-tcccac
               Baboon  ga-tcccac
             Marmoset  ga-tcccac
      Squirrel monkey  ga-tcccac
          Mouse lemur  ga-tcccag
             Bushbaby  ga-tcccac
                  Pig  ga-tcccat
              Dolphin  ga-tcccac
                Sheep  ga-tcccgc
                  Cow  ga-tcccac
                  Cat  cagtcgcgc
                  Dog  ca-tcacac
                Panda  ca-tcccac
                Horse  ca-tcccac
     Little brown bat  tc-tcccac
              Megabat  ga-gcccac
             Hedgehog  ta-ccgcca
             Elephant  ga-tccctc
               Tenrec  gc-tccctg
              Manatee  ga-tccctc
            Armadillo  ga-tcccac
              Opossum  aa-ttgcag
      Tasmanian devil  aa-t--cag
              Tarsier  =========
              Wallaby  =========
               Alpaca  =========
                 Fugu  =========
         Atlantic cod  =========
         Nile tilapia  =========
            Zebrafish  =========
        X. tropicalis  =========
             Platypus  =========
               Turkey  =========
           Coelacanth  =========
               Lizard  =========
           Budgerigar  =========
          Zebra finch  =========
              Chicken  =========
       Painted turtle  =========
                Shrew  =========
                Sloth  =========
           Rock hyrax  =========

Inserts between block 21 and 22 in window
B D          Opossum 2189bp
B D  Tasmanian devil 7bp

Alignment block 22 of 702 in window, 56691526 - 56691535, 10 bps 
B D             Mouse  ca-ctggc--atc
B D               Rat  ca-ctggc--tcc
B D      Kangaroo rat  ----tggc-----
B D    Naked mole-rat  ag-cccgccgcgc
B D        Guinea pig  ag-cccgccgcgc
B D          Squirrel  ag-cctttagcgg
B D            Rabbit  gg-cccgccgcgc
B D              Pika  gg-ccggctgagc
B D             Human  ct-cccgcagggc
B D             Chimp  ct-cccgcagggc
B D           Gorilla  ct-cccgcagggc
B D         Orangutan  ct-cccgcagggc
B D            Gibbon  ct-cccgcagggc
B D            Rhesus  cg-cccgcagggc
B D            Baboon  cg-cccgcagggc
B D          Marmoset  cg-ccagcagcac
B D   Squirrel monkey  cg-cccgcagcac
B D       Mouse lemur  gg-cgcg--gcgc
B D          Bushbaby  gg-cgtg-agcgc
B D               Pig  gg-ccagcag---
B D           Dolphin  gg-ccagcag---
B D             Sheep  gg-ccagtgg---
B D               Cow  gg-ccagcgg---
B D               Cat  gg-cccgcag---
B D               Dog  ggccccgcag---
B D             Panda  cg-cccgcag---
B D             Horse  ag-cccgcag---
  D  Little brown bat  gg-cccgcag---
B D           Megabat  tg-ccggcag---
B D          Hedgehog  ag-cgcgggg---
B D          Elephant  gg-cccgc-gcgc
B D            Tenrec  gg-tccgc-gcgc
B D           Manatee  gg-cccgc-gcgc
B D         Armadillo  gg-cccgcagcgc
B D   Tasmanian devil  ag-ccgacatc--
B D           Tarsier  =============
B D           Wallaby  =============
B D            Alpaca  =============
B D              Fugu  =============
B D      Atlantic cod  =============
B D      Nile tilapia  =============
B D         Zebrafish  =============
B D     X. tropicalis  =============
B D          Platypus  =============
B D            Turkey  =============
B D        Coelacanth  =============
B D           Opossum  =============
B D            Lizard  =============
B D        Budgerigar  =============
B D       Zebra finch  =============
B D           Chicken  =============
B D    Painted turtle  =============
B D             Shrew  =============
B D             Sloth  =============
B D        Rock hyrax  =============

Inserts between block 22 and 23 in window
B D  Tasmanian devil 4753bp

Alignment block 23 of 702 in window, 56691536 - 56691544, 9 bps 
B D             Mouse  tcg--cgaccg
B D               Rat  ttg--cagccg
B D      Kangaroo rat  --g--ggggcc
B D    Naked mole-rat  tcg--ggactg
B D        Guinea pig  tcgctcgggcg
B D          Squirrel  gcg--gagctg
B D            Rabbit  tcc--ggacag
B D              Pika  tcg--gcaca-
B D             Human  tcc--ggtcgt
B D             Chimp  tct--ggccgc
B D           Gorilla  tcc--ggccgc
B D         Orangutan  tct--ggccgc
B D            Gibbon  tcc--ggccgc
B D            Rhesus  tca--ggtccc
B D            Baboon  tca--ggtccc
B D          Marmoset  tcc--ggccgg
B D   Squirrel monkey  tcc--ggcccg
B D       Mouse lemur  tcg--ggcc-g
B D          Bushbaby  acc--aacctg
B D               Pig  -cg--gg----
B D           Dolphin  -cg--ag----
B D             Sheep  -cg--gg----
B D               Cow  -cg--gg----
B D               Cat  -cg--gg----
B D               Dog  -cg--gg----
B D             Panda  -cg--gg----
B D             Horse  -cg--gg----
  D  Little brown bat  -ca--gg----
B D           Megabat  -ca--gg----
B D          Hedgehog  -tg--gg----
B D          Elephant  tcg--------
B D            Tenrec  tcg--------
B D           Manatee  tcg--------
B D         Armadillo  tca--------
B D           Tarsier  ===========
B D           Wallaby  ===========
B D            Alpaca  ===========
B D              Fugu  ===========
B D      Atlantic cod  ===========
B D      Nile tilapia  ===========
B D         Zebrafish  ===========
B D     X. tropicalis  ===========
B D          Platypus  ===========
B D            Turkey  ===========
B D        Coelacanth  ===========
B D   Tasmanian devil  ===========
B D           Opossum  ===========
B D            Lizard  ===========
B D        Budgerigar  ===========
B D       Zebra finch  ===========
B D           Chicken  ===========
B D    Painted turtle  ===========
B D             Shrew  ===========
B D             Sloth  ===========
B D        Rock hyrax  ===========

Inserts between block 23 and 24 in window
B D         Elephant 44bp
B D           Tenrec 1018bp
B D          Manatee 40bp
B D        Armadillo 34bp

Alignment block 24 of 702 in window, 56691545 - 56691670, 126 bps 
B D             Mouse  tcc------agcccctgctctccggggacg---tcttcccagctctcgcc-----ca------ccctccc
B D               Rat  tcc------agcccctaccggccgtgggca---tcttcccagctcttgcc-----ca------ccctccg
B D      Kangaroo rat  ccc------cgatcccacagcccg---------------cagccctcg-------gg------tctgccc
B D    Naked mole-rat  gcagctctgggcccccgcgagccgggagga---atttccgcgctctgatc-----cacgggtctgctgcc
B D        Guinea pig  gccgcgcagggaccgcgagagc--------------tccgcgcgctgctg-----ca-ggcgccgtggcc
B D          Squirrel  gccgctgtcgaacccgcagcactatgaaga---atttcagagctcgagtc-----ca------ccctcgg
B D            Rabbit  gccgctgcccg------cggcgctggtgcacggattgctcagccgccgccgccggag------cccgtcc
B D              Pika  gccgctgcccggccctccggtgcggctgcacgactcgctcagtcccggccgt---ag------cccgccc
B D             Human  gtcgctgtcgga-ccg-cagaacgccgggacgcatttccgagctcgggcc-----cg----acccaaccc
B D             Chimp  gtcgctgtcggacccg-cagaacgccgggacgcatttccgagctcgggcc-----cg----acccaaccc
B D           Gorilla  gtcgctgtcggacccg-cagaacgccgggacgcatttccgagctcgggcc-----cg----acccaaccc
B D         Orangutan  gtcgctgtcggacccg-cagaacgccgggacgcatttccgagctccggcc-----ag----acccaaccc
B D            Gibbon  gtcgctgtcggacccg-cagaacgccgggtagcatttccgagctcgggcc-----cg----acccaaccc
B D            Rhesus  gtcgctgtcggaccct-cagaacgccgggacgcatttccgagctcgggcc-----cg----acccaaccc
B D            Baboon  gtcgctgtcggaccct-cagaacgccgggacgcatttccgagctcgggcc-----cg----acccaaccc
B D          Marmoset  gtcgccgtcggaccag-cagaacgcggagatgcatttcggagctagggcc-----tg----acccaaccc
B D   Squirrel monkey  gtcgctgtcggacccg-cagaacgcggagacgcatttccgagctcgggcc-----cg----acccaaccc
B D       Mouse lemur  gccgctgtcggacccg-ctgtgcgcccggaggtgtttccaggctc-ggcc-----cg----accccgtcc
B D          Bushbaby  gtcgctgtccgaccca-ctgtgcggcccaggggatttctgagctcgggcg-----gg----acccggtcc
B D               Pig  ---------------------------------acttccgcgctctggcc-----ag----accccgtgg
B D           Dolphin  ---------------------------------atttccgcgctctggca-----gg----accccgcga
B D             Sheep  ---------------------------------atttccgcgctcccgca-----gg----accccgcgg
B D               Cow  ---------------------------------atttccgcgctcccgca-----gg----accccgcgg
B D               Cat  ---------------------------------atttccgcgctctggcc-----gg----accccgcac
B D               Dog  ---------------------------------atttctgcgctctg--g-----gg----accctgcac
B D             Panda  ---------------------------------atttccgcgctctggcg-----gt----accctgcat
B D             Horse  ---------------------------------atctctgcgctccggcc-----cg----accc-gccg
  D  Little brown bat  ---------------------------------atttctgcgcgctggga-----cg----gcttggtgg
B D           Megabat  ---------------------------------atttccactctctagac-----gg----acctggcgg
B D          Hedgehog  ---------------------------------gcctcccagctctggcc-----ag----accttgcgg
B D          Elephant  -----------------------------------ttcagcgctggggcc-----cg----accctgcca
B D           Manatee  -----------------------------------tttagctctcgggcc-----tg----accctgccg
B D         Armadillo  -----------------------------------ttcggcgcccgggtc------g----actccgcgg
B D           Tarsier  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D            Alpaca  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  gcag------------cctcacctgccgcagagg------a--ggaagccttctcggtatgcg-------
                  Rat  gcag------------cctcacctgccgcagagg------a--gaaaagcctttcggaatgtg-------
         Kangaroo rat  gccg------------tctgacccgcagtgccgg------a--ggaa----tttcagaattct-------
       Naked mole-rat  accg------------agctacttcgcgggcccg------g--ggaaaggctctagaatcgcg-------
           Guinea pig  gcag----c-------agccacttcgcgcggccg------g--ggaaaga--ctggagtcccg-------
             Squirrel  gctg----cagc-ttgagctgcctcgcggagcta------g--gcagagggttctgaacaggg-------
               Rabbit  gctg----ccgc-ccgacccgcctcgccgggcc-------g--gg-------ctcaggctgggggaccgc
                 Pika  gcggctgcccgc-ccgatccacctcgtccagccg------g--gg-------cacaggc-----------
                Human  gctg----ccat-tctagctacctagtggagccg------c--ggagagactcttgaaccgtg-------
                Chimp  gctg----ccat-tctagctacctagtggagccg------c--ggagagactcttgaaccgtg-------
              Gorilla  gctg----ccat-tctagctacctagtggagccg------c--ggagagactcttgaaccgtg-------
            Orangutan  gctg----ccat-tctagctacctagtggagccg------c--ggagagactcttgaaccgcg-------
               Gibbon  gctg----ccat-tctagctacctcgtggagccg------ccggaagagactcttgaaccgtg-------
               Rhesus  gctg----ccat-tctagctacctcgtggagtca------c--ggagagactcttgaaccgta-------
               Baboon  gctg----ccat-tctagctacctcgtggagtca------c--ggagagactcttgaaccgta-------
             Marmoset  actg----ccat-tcttgctacctcgtggagccg---------ggagaggctcttgaaccgtg-------
      Squirrel monkey  actg----ccgt-tctagctacctcgtggagccc---------ggagaggctcttgaacagtg-------
          Mouse lemur  gctg----ccgt-ggcagctacctcgcggagccg------g--ggaaaggctcttgaaccgtg-------
             Bushbaby  gcct----ctgc-gctagctgccttgcagagccg------g--ggaaaggctctggaaccgtg-------
                  Pig  gctg----ctgc-cct---------------ctg------g--ggaaagggtcttgaatcgtg-------
              Dolphin  gctt----ctgc-ctt---------------ctg------g--ggaaagggtcttgaatcgtg-------
                Sheep  g------------------------------ctg------g--gaaaagggtctcgaaccgtg-------
                  Cow  gctg----ctgc-cct---------------ctg------g--ggaaaaggtctcgaaccgtg-------
                  Cat  gctg----ctac-cct---------------ccg------g--ggaaagggtcttgaatcgta-------
                  Dog  gctg----ctgt-cct---------------ctg------g--gg-aaaggtcttgaatcgta-------
                Panda  gctg----ccgt-ctt---------------ctg------g--ggaaaaggtcttgaatcgta-------
                Horse  gctg----ctcg-cct---------------ctg------g--ggaaagggtcttgagccgtg-------
     Little brown bat  g------------cgg---------------ctgccttggg--ggaaagggtcttttaccgtg-------
              Megabat  gctg----cttgccct---------------ctg------g--ggaaacggtcttgaatcgtg-------
             Hedgehog  gttt----cttc-tcc---------------cgg------g--ggaaagggtcttgaatcttg-------
             Elephant  gctg----ttgc-cctcactacccggcccagctg------g--ggaaaatctcttgaactgtg-------
              Manatee  gctg----ttgc-cctcgctacctggcggagctg------g--ggaaaagctcttgaaccgtg-------
            Armadillo  actg----gcgc-cctcactacctcgcggagc-a------a--agaaaggctctggaaccgcg-------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
               Alpaca  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
           Rock hyrax  ======================================================================

                Mouse  -aggt-tc---ctccatctg-gcgg--aaggct-gaa---------cag-cc
                  Rat  -aggt-tc---ctccatctg-gtgg--aaggct-gaa---------cag-cc
         Kangaroo rat  -ctgc-ac---ccc--gcca-gctg--cggcct-gag---------caa-c-
       Naked mole-rat  -aggc-tt---gtt-----g-gtga-aaagact-ga-----------gg-ct
           Guinea pig  -aggc-tt---gtc-----g-gtgg-aaaggct-aag---------cgg-cc
             Squirrel  -aggc-tt---atc-----c-gtgaaaaaggct-gag---------cag-tc
               Rabbit  aaggc-tc---ttc-----t-gtga-gaaggca-ggg---------agg-ca
                 Pika  ------------tc-----t-gtac-gaaggcagggg---------agg-cg
                Human  -aggc-tc---ctt-----g-atga-gaaggtg-gag---------agg-ct
                Chimp  -aggc-tc---ctt-----g-atga-gaaggtg-gag---------agg-ct
              Gorilla  -aggc-tc---ctt-----g-atga-gaaggtg-gag---------agg-ct
            Orangutan  -aggc-tc---ctt-----g-atga-gaaggtg-gag---------agg-ct
               Gibbon  -aggc-tc---ctt-----g-atga-gaaggtg-gag---------agg-ct
               Rhesus  -aggc-tc---ctt-----g-atga-gacggtg-gag---------aga-cc
               Baboon  -aggc-tc---ctt-----g-atga-gatggtg-gag---------aga-cc
             Marmoset  -aggc-tc---ctt-----g-gtga-gaaagtg-gag---------agg-cc
      Squirrel monkey  -aggc-tc---ctt-----g-gtca-gaaggtg-gca---------agg-cc
          Mouse lemur  -agac-tt---gtt-----a-gtga-gaaggtg-aag---------agg-cc
             Bushbaby  -agac-tg---gtt-----a-gtga-gaaggtg-gag---------agg-cg
                  Pig  -ggca-cc---atc-----a-gccg-aagggaa-gag---------aggac-
              Dolphin  -agca-cc---acc-----a-gctg-gaaggca-gag---------aggac-
                Sheep  -agca-cc---agc-----a-gccg-gaaggca-gcg---------agaac-
                  Cow  -agca-cc---agc-----a-gcca-gaaggca-gcg---------agaac-
                  Cat  -agca-------ac-----g-acag-gaaggcg-gag---------agg-c-
                  Dog  -agca-tc---gtc-----g-gcag-gaaggca-gag---------agg-c-
                Panda  -agca-tc---gtc-----g-gcag-gaaggcg-gag---------agg-c-
                Horse  -agca-tc---gtc-----g-gcgg-gaaggcg-------------------
     Little brown bat  -agca-tc---gcc-----g-gctg-gaaggcg-gag---------agg-c-
              Megabat  -agca-tc---gcc-----a-gtag-gaaagtg-gag---------aag-c-
             Hedgehog  -agga-tcatgggc-----g-gcgg-agaagca-gaggcctgggcaaag-c-
             Elephant  -aggctct---gta-----g-gcgg-gaagcct-gag---------agg-ct
              Manatee  -agg--ct---gtc-----g-gcgg-gaaggct-gag---------agg-ct
            Armadillo  -acgctcc---gtc-----gcaccg-gaaggcg-gag---------agg-tc
              Tarsier  ====================================================
               Tenrec  ====================================================
              Wallaby  ====================================================
               Alpaca  ====================================================
                 Fugu  ====================================================
         Atlantic cod  ====================================================
         Nile tilapia  ====================================================
            Zebrafish  ====================================================
        X. tropicalis  ====================================================
             Platypus  ====================================================
               Turkey  ====================================================
           Coelacanth  ====================================================
      Tasmanian devil  ====================================================
              Opossum  ====================================================
               Lizard  ====================================================
           Budgerigar  ====================================================
          Zebra finch  ====================================================
              Chicken  ====================================================
       Painted turtle  ====================================================
                Shrew  ====================================================
                Sloth  ====================================================
           Rock hyrax  ====================================================

Inserts between block 24 and 25 in window
B D              Pig 9bp
B D          Dolphin 9bp
B D            Sheep 9bp
B D              Cow 9bp
B D              Cat 10bp
B D              Dog 10bp
B D            Panda 10bp
B D            Horse 6bp
  D Little brown bat 36bp
B D          Megabat 20bp
B D         Hedgehog 2bp

Alignment block 25 of 702 in window, 56691671 - 56691695, 25 bps 
B D             Mouse  ---------agtaag-------caacgcttcggtagtcagt
B D               Rat  ---------agaaag-------cgacgcttcgggagtcctt
B D      Kangaroo rat  -----------atcg-------cggtgcggtggaaaggcgc
B D    Naked mole-rat  ---------gcgagg-------tgactct--gagcatcttt
B D        Guinea pig  ---------gcgagg-------cgactctccgagcatcttc
B D          Squirrel  ---------gccggg-------cgactctcc-agcattttc
B D            Rabbit  ---------gcgggg------gcgcagctccgagcatcttc
B D              Pika  ---------gtagggcgccgctcgcagccccgcgcgtccac
B D             Human  ---------gccggg-------ctattctccgagcatcttc
B D             Chimp  ---------gccggg-------ctattctccaagcatcttc
B D           Gorilla  ---------gccggg-------ctatt---cgagcatcttc
B D         Orangutan  ---------gcgggg-------ctattctccgagcatcttc
B D            Gibbon  ---------gcgggg-------ctattctccgagcatcttc
B D            Rhesus  ---------gcgggg-------ctattctccaagcatcttc
B D            Baboon  ---------gcgggg-------ctattctccaagcatcttc
B D          Marmoset  ---------gcggag-------atattctccgagcatcttt
B D   Squirrel monkey  ---------gcgggg-------ctattctccgagcatcttc
B D       Mouse lemur  ---------gcgggc-------cgactcttagagcatcttt
B D          Bushbaby  ---------gcaagg-------agactcttagagcatcttt
B D               Pig  ---------cattag-------cgactttcggagaattttc
B D           Dolphin  ---------ccttag-------aggctttcggagaaatttc
B D             Sheep  ---------ccttag-------agactttcggagaactttc
B D               Cow  ---------ccttag-------ggactttcggagcattttc
B D               Cat  ---------ctttgg-------cgattctcggagaatcttc
B D               Dog  ---------ccttgg-------agattctccgagaattatc
B D             Panda  ---------ctctgg-------cgattctcggagaatcttc
B D             Horse  ---------ccttgg-------cgactctcggagaatcttc
B D           Megabat  --------------------------tctaggagaatcttc
B D          Hedgehog  -----------agag-------catcttctggggaacccgt
B D          Elephant  g---ggaggccgtgg-------cgaccattggagcatcttc
B D           Manatee  g---ggaggccgtgg-------cgactcttggagcatcttc
B D         Armadillo  gcctggaggctgtga-------cgactctcggagcatcttc
B D           Tarsier  =========================================
B D            Tenrec  =========================================
B D           Wallaby  =========================================
B D            Alpaca  =========================================
B D              Fugu  =========================================
B D      Atlantic cod  =========================================
B D      Nile tilapia  =========================================
B D         Zebrafish  =========================================
B D     X. tropicalis  =========================================
B D          Platypus  =========================================
B D            Turkey  =========================================
B D        Coelacanth  =========================================
B D   Tasmanian devil  =========================================
B D           Opossum  =========================================
B D            Lizard  =========================================
B D        Budgerigar  =========================================
B D       Zebra finch  =========================================
B D           Chicken  =========================================
B D    Painted turtle  =========================================
B D             Shrew  =========================================
  D  Little brown bat  =========================================
B D             Sloth  =========================================
B D        Rock hyrax  =========================================

Inserts between block 25 and 26 in window
B D              Pig 1bp
B D          Dolphin 1bp
B D            Sheep 1bp
B D              Cow 1bp
B D              Cat 1bp
B D              Dog 1bp
B D            Panda 1bp
B D            Horse 1bp
B D          Megabat 1bp

Alignment block 26 of 702 in window, 56691696 - 56691763, 68 bps 
B D             Mouse  gggctccaattg-----------------------aag----------tcc--cct---------gaagc
B D               Rat  ggg----------------------------------g----------tcc--cct---------gaagc
B D      Kangaroo rat  agc----------------------------------g----------tccggcct---------ggctc
B D    Naked mole-rat  cggctgcgcctg-------------------------g----------tc---cct---------gtgcc
B D        Guinea pig  ggactgcgact--------------------------g----------tc---cct---------gtgac
B D          Squirrel  gcgcggcgctcggca------------------tcggg----------tt---cct---------gaaac
B D            Rabbit  cgg--------------------------------------------------ctt--------------
B D              Pika  cgg--------------------------------------------------cc---------------
B D             Human  cggccgagctctgctcctct-------------ccgtg----------cg---ctt---------gcggc
B D             Chimp  cggccgagctctgctcctct-------------cggtg----------cg---ctt---------gcggc
B D           Gorilla  cggccgagctctgctcctct-------------cggtg----------cg---ctt---------gcggc
B D         Orangutan  cggccgcgctctgctcctct-------------cggtg----------cg---ctt---------gcggt
B D            Gibbon  cggccgcgctctgctcctct-------------cggtg----------cg---ctt---------gcggc
B D            Rhesus  cggtcgcgctctgctcctct-------------cggtg----------cg---ctt---------gcggc
B D            Baboon  cggtcgcgctctgctcctct-------------ccgtg----------cg---ctt---------gcggc
B D          Marmoset  cggccgctctctactcctct-------------aggag----------cg---ctt---------gcgac
B D   Squirrel monkey  tggccgcgctctgctcctct-------------aggag----------cg---ctt---------gcgac
B D       Mouse lemur  cggccgcgctcggctcccctc------------cccgg----------cc---agt---------gcggc
B D          Bushbaby  cggctgcgctccgctcctctt------------ccgcg----------ct---aga---------gtggc
B D               Pig  ----------aggttcctctt------------ggggg----------cc---cta---------gtggt
B D           Dolphin  ----------aggctcctctt------------ggggg----------cc---cca---------gcggc
B D             Sheep  ----------aggttcctctt------------ggggg----------cc---cca---------gcggc
B D               Cow  ----------aggttcctctt------------ggggg----------cc---cca---------gcggc
B D               Cat  ----------gggctccttct------------gggggccgcacacctcc---cccccccgtcgccccac
B D               Dog  ----------gggctccttct------------gggggctgc------cc---ccccgcaggccccccgc
B D             Panda  ----------gggctccttct------------ggggg--gc------ct---cctccctcatcccccgc
B D             Horse  ----------gggctcttttt------------gaggg----------cc---cct---------gcggc
  D  Little brown bat  ----------gggctcctctt-----------ggggga----------cc---cct---------gcggc
B D           Megabat  ----------gggctcctctt------------agggc----------ct---cct---------ttggc
B D          Hedgehog  ----------acaccccacccccgcaccggaggaggga----------gt---cct---------gagac
B D          Elephant  cggctacgatcggctgctctc------------gggag----------cc---cct---------g--gg
B D           Manatee  tggctacg----------ctc------------ggccg----------ct---ct---------------
B D         Armadillo  cggcagcgcccggttcctctc------------ccgcg----------cc---ccg---------gccgt
B D           Tarsier  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D            Alpaca  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  ttctgg-ctg-cgcgggt----------tc-------gtccacagc------------------------
                  Rat  ttctgg-ctg-cccgggt----------gc-------gtccgcagc------------------------
         Kangaroo rat  agctgg-t---ctggggc----------gc-------tacagcggc------------------------
       Naked mole-rat  ttctcc-ttg-ggccggt----------gc-------gtctgcaac------------------------
           Guinea pig  ttctcc-ttg-ggccgat----------tc-------gtcggaaac------------------------
             Squirrel  ttctcc-ttg-ggatggt----------gc----------------------------------------
               Rabbit  --ctcc-tcg-ggcgggc----------gc-------gtgcgctgc------------------------
                 Pika  ----------------------------------------------------------------------
                Human  ttctcc-ttg-ggctagc----------gc-------gtccgcagt------------------------
                Chimp  ttctcc-ttg-ggctggc----------gc-------gtccgcagt------------------------
              Gorilla  ttctcc-ttg-ggctggc----------gc-------gtccgcagt------------------------
            Orangutan  ttctcc-ttg-ggctggc----------gc-------gtccgccgt------------------------
               Gibbon  ttctcc-ttg-ggctggc----------gc-------gtccgcagt------------------------
               Rhesus  ttctcc-ttg-ggctggc----------gc-------gtccacagt------------------------
               Baboon  ttctcc-ttg-ggctgat----------gc-------gtccacagt------------------------
             Marmoset  ttctcc-gtgaggctggc----------gc-------gtccgcagt------------------------
      Squirrel monkey  ttctcc-ttg-ggctgac----------gc-------gtccgcagt------------------------
          Mouse lemur  ttctcc-ttg-agctggt----------gc-------gtccgcagt------------------------
             Bushbaby  ttctcc-ttg-ggctggt----------gc-------gtccgcact------------------------
                  Pig  ctcttc-ttg-ggttggtgcatcccgctgtgtccgcagtccgcagc------------------------
              Dolphin  ctctac-ttg-ggctggtgggtcccgctgc-------gtctgcagc------------------------
                Sheep  ctctac-ttg-ggcgggtgcgtccggatgc-------gtccgcagc------------------------
                  Cow  ctctac-ttg-ggctggtgcgtccggatgc-------gtccgcagc------------------------
                  Cat  ctccac-ttg-ggctggtacgtcccgccgc-------gtccgcagc------------------------
                  Dog  ctttactttg-ggctggtgtatcctgcggc-------gtccgcggc------------------------
                Panda  ctccac-tgg-ggctggtacgtcctgcggc-------gtccgcagc------------------------
                Horse  ctctac-gtg-ggctggttggttcagccgc-------gtccgcatc------------------------
     Little brown bat  ctttac-ctg-ggcaggcgcgtccggtccc-------gtccgcaac------------------------
              Megabat  ctctac-ttg-gcctggtgcgtcccatcgc-------gtccatagc------------------------
             Hedgehog  ctctgt-ttg-cgcgggtgcctcccgaggt-------tttgtcagc------------------------
             Elephant  ctctct-tta-ggcgggtgtgtctggtcgc-------gttcccagc------------------------
              Manatee  -------------cgggagtgtctagtcgc-------atttccagc------------------------
            Armadillo  ctcccc-ttt-gccaggcgcttcccgccgc-------cttctcagcccggctcggcagtcgccggagagg
              Tarsier  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
               Alpaca  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
           Rock hyrax  ======================================================================

                Mouse  ------gtcgt-cgtcgccagc
                  Rat  ------ctcgt-cggcggcggc
         Kangaroo rat  ------ctcttgcagcctatcc
       Naked mole-rat  ------cacac----------c
           Guinea pig  ------cacgc----------c
             Squirrel  ---------------------a
               Rabbit  ------gctgc----------c
                 Pika  -------cggc----------c
                Human  ------ccctc----------c
                Chimp  ------ccctc----------c
              Gorilla  ------ccctc----------c
            Orangutan  ------ccctc----------c
               Gibbon  ------ccctc----------c
               Rhesus  ------ccctc----------c
               Baboon  ------ccctc----------c
             Marmoset  ------ccctc----------c
      Squirrel monkey  ------ccctc----------c
          Mouse lemur  ------cccgc----------c
             Bushbaby  ------cccgc----------c
                  Pig  ------tcggc----------g
              Dolphin  ------ccagc----------g
                Sheep  ------ccggc----------g
                  Cow  ------ccggc----------g
                  Cat  ------ccggt----------t
                  Dog  ------cgggc----------t
                Panda  ------cgggc----------t
                Horse  ------ccggc----------g
     Little brown bat  ------ccggc----------g
              Megabat  ------cccgc----------g
             Hedgehog  ------cccac----------a
             Elephant  ------tccgc----------c
              Manatee  ------tccgc----------g
            Armadillo  gtcagtcccgc----------g
              Tarsier  ======================
               Tenrec  ======================
              Wallaby  ======================
               Alpaca  ======================
                 Fugu  ======================
         Atlantic cod  ======================
         Nile tilapia  ======================
            Zebrafish  ======================
        X. tropicalis  ======================
             Platypus  ======================
               Turkey  ======================
           Coelacanth  ======================
      Tasmanian devil  ======================
              Opossum  ======================
               Lizard  ======================
           Budgerigar  ======================
          Zebra finch  ======================
              Chicken  ======================
       Painted turtle  ======================
                Shrew  ======================
                Sloth  ======================
           Rock hyrax  ======================

Alignment block 27 of 702 in window, 56691764 - 56691847, 84 bps 
B D             Mouse  gagccaagg-gcaac-aggtcagtgtga---gcgcc------------cctctcgcgc-----------t
B D               Rat  gagccaagg-ccaac-aggtcagtgt------------------------------gc-----------t
B D      Kangaroo rat  aagtccagg-tcagc-aggtcagtatgt---gggcg------------cctcccgcgc-----------t
B D    Naked mole-rat  gagtgcctg-caggc-aggtcagtgtat---gcgcg-----------tccccgcg-at-----------t
B D        Guinea pig  gagtcctgg-caggc-aggtcagtgtct---gtgcg--------------ccgcgcat-----------t
B D          Squirrel  gaacc--------gc-aggtcagtgtgt---gggcg------------cctcccgcat-----------c
B D            Rabbit  agttccaga----gc-aggtcagtgtgt---gggtc-----------ctctccggcgt-----------c
B D              Pika  aagtccaga----gc-aggtcagtgcgtaggggggc-----------ttctccgcctccggctatcctgc
B D             Human  aagtccagg-cc-gc-aggtcagtgtgc---gggcg------------cctcctgtcc-----------t
B D             Chimp  aagtccagg-cc-gc-aggttagtgtgc---gggcg------------cctcctgtcc-----------t
B D           Gorilla  aagtccagg-cc-gc-aggtcagtgtgc---gggcg------------cctcctgtcc-----------t
B D         Orangutan  aagtccagg-cc-gc-aggtcagtgtgc---gggcg------------cctcctgtcc-----------t
B D            Gibbon  aagtccagg-cc-gc-aggtcagtgtgc---gggcg------------cctccggtcc-----------t
B D            Rhesus  aagtccagg-cc-gc-aggtcagtgtgt---gggcg------------cctcctgtcc-----------t
B D            Baboon  aagtccagg-cc-gc-aggtcagtgtgt---gggcg------------cctcctgtcc-----------t
B D          Marmoset  tagttcaaacccggc-aagtcagtgtgc---tggcg------------ccacaagtcc-----------t
B D   Squirrel monkey  aagtccggg-ccggc-aggtcagtgtgc---ggacg------------ccacctgtct-----------t
B D       Mouse lemur  aagcccagg-ccagc-aggtcagtgtgt---gggcg------------cctcctgtcc-----------t
B D          Bushbaby  aagtccagg-ccagc-aggtcagtgtgt---gggtg------------cctcctatcc-----------t
B D               Pig  aattccagg-ctgtcaaggtcagtgtct---ggcca------------ccccac---------------c
B D           Dolphin  aagtacagg-ctggc-aggtcagtgtct---ggaca------------ctccctg--------------c
B D             Sheep  aagtacagg-ctggc-aggtcagtgcct---ggaca------------ccccct---------------c
B D               Cow  aagtacagg-ctggc-aggtcagtgcct---ggaca------------ccccct---------------c
B D               Cat  aagtccagg-cctgc-aggtcagtgtgt---gggca------------cctcca---------------c
B D               Dog  aagtccagg-cctgc-aggtcagtgtgt---gggca------------cctcca---------------c
B D             Panda  aagtccagg-cctgc-aggtcagtgtgt---gggca------------ccccca---------------c
B D             Horse  acgtccagc-ccgga-aggtcagtgtgt---gggca------------tc--------------------
  D  Little brown bat  aagtccagg-cccgc-aggtcagtgtgc---cgccaccccctccccctccctct---------------c
B D           Megabat  aagtccagg-ccggc-aggtcagtgtgc---gggca------------ccgtcc---------------c
B D          Hedgehog  aagtccagg-ctggc-aggtcagtgagt---gtagt------------cccctg---------------t
B D          Elephant  aagtccagg-ccagc-aggtcagtatgt---gg-cg------------ct-------------------t
B D           Manatee  aagtccagg-ccggc-aggtcagtgtgt---gg-cg------------ct-------------------g
B D         Armadillo  aagtccagg-cccgc-aggtcagtgagc---ggaca------------ct-------------------c
B D          Platypus  --gaacaaa-agaca-aggtcgatttca---attct------------cctctcccgc-----------t
B D           Tarsier  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D            Alpaca  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  accctat---------cct-----------------t-------------ccctgtcagaa-----gatc
                  Rat  accctac---------cct-----------------t-------------ccctgacagag-----gacc
         Kangaroo rat  cccccct---------ccc-----------------t----------aagccaggctaggg-----atcc
       Naked mole-rat  cccgcgc---------ccc-----------------ttgc-------cggcctggccagggccgaggact
           Guinea pig  tccccgc---------ccc-----------------actc-------tggcctggccaaagccactgact
             Squirrel  cttcccc---------cta-----------------actc-------gggcatggttaata--------c
               Rabbit  ctctcgg---------cct-----------------ggtt-------ggggctca----gg-----atcc
                 Pika  ctcccac---------ccc-----------------gcccctgcccggaggcccagcgggg-----actc
                Human  cctctcc---------cac-------------------------------------cagag-----gacc
                Chimp  cctctcc---------cac-------------------------------------cagag-----gacc
              Gorilla  cctctcc---------cac-------------------------------------cagag-----gacc
            Orangutan  cttctcc---------cac-------------------------------------cagag-----gacc
               Gibbon  cctctcc---------cac-----------------cccggatc---tgccttgggcagag-----gacc
               Rhesus  cctctcc---------cac-----------------tccggatc---tgcctggggcagag-----gacc
               Baboon  cctctcc---------cac-----------------tccggatc---tgcctggggcagag-----gacc
             Marmoset  cctctcc---------cac-----------------cccgagtc---tggctgggacagag-----gacc
      Squirrel monkey  cctctcc---------cac-----------------cccgggtc---tggctggggtagag-----gacc
          Mouse lemur  ccccacc---------ccc---------------------ggcc---tggctggggccgag-----gacc
             Bushbaby  tcccacc---------cac-----------------tctgggcc---tggctggcgcccag-----gacc
                  Pig  cccgcac---------cccttccattaccaccaccaccctggcc---tggttggggctgaa-----ggcc
              Dolphin  cccccatcacc-----cccccccccccccgcc----ccccggcc---tggctgaggctgag-----ggcc
                Sheep  ccctcatcaccaccagcaccaccaccaccaccactaccctggcc---cggctgaggctgag-----cgcc
                  Cow  ccctcaccaccac---caccaccaccaccaccactaccctggcc---tggctgaggctgag-----cgcc
                  Cat  accccaa---------ccc------------------gggtccc---cggctggggctgag-----ggcc
                  Dog  accccaa---------ccc-----------------aggaggcc---tggctggggctg-g-----ggcc
                Panda  accccaa---------ccc-----------------aggggccc---tggctggggctgag-----ggcc
                Horse  -ccccat---------ccc-----------------tcagggcc---tggctggggctgag-----ggcc
     Little brown bat  cccctcc---------ccc-----------------ctccggcc---tggctgggggtgag-----ggcc
              Megabat  ctcccct---------acc-----------------ccccagac----ggccagtgttcag-----gatc
             Hedgehog  cctcca--------------------------------cgggcc---tggct-----tggg-----ggtc
             Elephant  ctcgctc---------gcc----------------------------tggctggggctgag-----gctc
              Manatee  cccgcgc---------gcc----------------------------tggct-ggtctgag-----ggtc
            Armadillo  tccgcgg---------acc----------------------------cgcct-gcggtagg-----ggtt
             Platypus  ccccatc---------cct-----------------ccc-----------------ccgga-----ggca
              Tarsier  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
               Alpaca  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
           Rock hyrax  ======================================================================

                Mouse  cct----g-t----------------a------gct-------ggctccg
                  Rat  cct----g-c----------------ag-----gct-------gactctg
         Kangaroo rat  cct----g-c----------------ctaggtcttc-------tactcca
       Naked mole-rat  cag----g-t----------------gg-----gct-------gtctcct
           Guinea pig  gga----g-caacctgtgtgtgtgtagg-----ggg-------gtctctt
             Squirrel  cct----g-c----------------gg-----gct-------gactccc
               Rabbit  cctgcggg-c----------------ta-----tcc-------ttccaac
                 Pika  ccc----g-c----------------tc-----tcc-------gcccaac
                Human  cct----g-a----------------gg-----gct-------gtctcca
                Chimp  cct----g-a----------------gg-----gct-------gtctcta
              Gorilla  cct----g-a----------------gg-----gct-------gtctcca
            Orangutan  cct----g-a----------------gg-----gct-------gtctcca
               Gibbon  cct----g-a----------------gg-----gct-------gtctcca
               Rhesus  cct----g-a----------------ag-----gct-------gtctccc
               Baboon  cct----g-a----------------ag-----gct-------gtctccc
             Marmoset  act----gaa----------------gg-----gct-------gtctcca
      Squirrel monkey  tct----g-a----------------gg-----gct-------gtctcca
          Mouse lemur  ccc----g-c----------------gg-----gct-------gtctcc-
             Bushbaby  ccc----g-c----------------ag-----gct-------gtcttc-
                  Pig  cgt----t-c----------------tg-----gct-------gtctct-
              Dolphin  cgt----g-c----------------gg-----gct-------gtttct-
                Sheep  cgg----g-c----------------ag-----gcg-------gtctct-
                  Cow  cgg----g-c----------------ag-----gcg-------gtctct-
                  Cat  ctg----g-c----------------gg-----tct-------gtctct-
                  Dog  ctg----g-c----------------ag-----tct------cgtccct-
                Panda  ctg----g-t----------------gg-----tct-------gtctct-
                Horse  cc-----g-c----------------gg-----gca-------gcctct-
     Little brown bat  cca----g-a----------------gg-----gct-------gtctct-
              Megabat  ccc----g-a----------------ga-----gc---------tctct-
             Hedgehog  cct----g-t----------------gg-----gctggcgggggctccc-
             Elephant  ctc----g-c----------------gc-----gct-------gtctct-
              Manatee  ct-------c----------------gc-----gct-------gtctct-
            Armadillo  tcc----g-c----------------gg-----gct-------gga-ca-
             Platypus  ccg----g-t----------------gg-----at---------------
              Tarsier  ==================================================
               Tenrec  ==================================================
              Wallaby  ==================================================
               Alpaca  ==================================================
                 Fugu  ==================================================
         Atlantic cod  ==================================================
         Nile tilapia  ==================================================
            Zebrafish  ==================================================
        X. tropicalis  ==================================================
               Turkey  ==================================================
           Coelacanth  ==================================================
      Tasmanian devil  ==================================================
              Opossum  ==================================================
               Lizard  ==================================================
           Budgerigar  ==================================================
          Zebra finch  ==================================================
              Chicken  ==================================================
       Painted turtle  ==================================================
                Shrew  ==================================================
                Sloth  ==================================================
           Rock hyrax  ==================================================

Alignment block 28 of 702 in window, 56691848 - 56691868, 21 bps 
B D             Mouse  tcctcagccccca-------gt---------gcttgt-
B D               Rat  tcctcagtcccca-------gt---------ggctat-
B D      Kangaroo rat  gcccccccccccattttgcttt---------agctgc-
B D    Naked mole-rat  tccccagctcccc-------gt---------ggtggt-
B D        Guinea pig  tcttcagctcccc-------gc---------gttggt-
B D          Squirrel  ttcttagcaccta-------at---------gtttgt-
B D            Rabbit  ctccccg-gcccc-------gc---------gatcgt-
B D              Pika  ctccctgcgctgg-------gc---------aattga-
B D             Human  tccccaat-cccc-------gc---------gactgc-
B D             Chimp  tccccaat-cccc-------gc---------gactgc-
B D           Gorilla  tctccaat-cccc-------gc---------gactgc-
B D         Orangutan  tccccaat-cccc-------gc---------gactgc-
B D            Gibbon  tccccaat-cccc-------gc---------gactgc-
B D            Rhesus  tccccaat-cccc-------ga---------gactgc-
B D            Baboon  tccccaat-cccc-------ga---------gactgc-
B D          Marmoset  ttcccaatccccc-------gc---------tactgc-
B D   Squirrel monkey  tccctgatccccc-------gc---------tactgc-
B D           Tarsier  tcccccttcccct-------ga---------ggttgt-
B D       Mouse lemur  ttctcaatacccc-------ga---------ggttgt-
B D          Bushbaby  tcctctatcccgg-------gc---------cattct-
B D               Pig  ---------------------------------ttct-
B D           Dolphin  ---cccacaccgc-------ct---------ggctct-
B D             Sheep  ---cccacacccc-------ct---------ggctct-
B D               Cow  ---cccacacccc-------ct---------ggctct-
B D               Cat  ---ccttcacccc-------ag---------aaattt-
B D               Dog  ---ccctcacccc-------aa---------agcttt-
B D             Panda  ---ctctccccca-------aa---------agcgtt-
B D             Horse  ---cccctatccc-------ag---------ggctct-
  D  Little brown bat  ---ttctcacc-c-------tt---------ggccct-
B D           Megabat  ---tcctcaccgc-------at---------ggcttt-
B D          Hedgehog  ---ccaccccctc-------cc---------agctct-
B D          Elephant  tccccagcccctt-------gcta-------cgctgt-
B D           Manatee  tccccagccgggt-------gcta-------ggctgt-
B D         Armadillo  ccaccagcccact-------cccagcgccgcggcggc-
B D          Platypus  -tccggaggcccc-------gg---------gacgagt
B D            Tenrec  ======================================
B D           Wallaby  ======================================
B D            Alpaca  ======================================
B D              Fugu  ======================================
B D      Atlantic cod  ======================================
B D      Nile tilapia  ======================================
B D         Zebrafish  ======================================
B D     X. tropicalis  ======================================
B D            Turkey  ======================================
B D        Coelacanth  ======================================
B D   Tasmanian devil  ======================================
B D           Opossum  ======================================
B D            Lizard  ======================================
B D        Budgerigar  ======================================
B D       Zebra finch  ======================================
B D           Chicken  ======================================
B D    Painted turtle  ======================================
B D             Shrew  ======================================
B D             Sloth  ======================================
B D        Rock hyrax  ======================================

Inserts between block 28 and 29 in window
B D         Platypus 23bp

Alignment block 29 of 702 in window, 56691869 - 56691885, 17 bps 
B D             Mouse  ttct-tcta---gctg---cag-cc--
B D               Rat  ttctatcca---gctg---ctg-cc--
B D      Kangaroo rat  tgcc-ttta---gcgg---cgg-ct--
B D    Naked mole-rat  ttgc-ttta---gcct---ctg-tc--
B D        Guinea pig  tcgc-ttta---gcct---tgg-cc--
B D          Squirrel  tccc-tttg---gtggtcccag-ct--
B D            Rabbit  gccc-cttaggtgccg---ccg-tc--
B D              Pika  atcc-ttcg---gccg---ctg-tg--
B D             Human  tcct-ttta---gccg---cca-tc--
B D             Chimp  tcct-ttta---gccg---cca-tc--
B D           Gorilla  tcct-ttta---gccg---cca-tc--
B D         Orangutan  tcct-ttta---gccg---cca-tc--
B D            Gibbon  tcct-tttg---gccg---ccg-cc--
B D            Rhesus  tcct-ttta---gcgg---ccg-cc--
B D            Baboon  tcct-ttta---gcgg---ccg-cc--
B D          Marmoset  acca-ttta---gcca---cgc-cc--
B D   Squirrel monkey  accc-ttta---gccc---ccg-ac--
B D           Tarsier  ttcc-ttca---gccc---cc------
B D       Mouse lemur  tccc-cgta---gccg---ccg-cc--
B D          Bushbaby  tccc-ttta---gccg---ctg-tt--
B D               Pig  tctc-tcta---gcag---ct------
B D           Dolphin  tccc-tgta---gccg---ccg-cc--
B D             Sheep  tccc-tcta---gccg---ccg-cc--
B D               Cow  tctc-tcta---gccg---ctg-cc--
B D               Cat  ccgc-tgtg---gcca---cct-ct--
B D               Dog  tccc-tcta---gccg---ccg-cc--
B D             Panda  tccc-tcta---gccg---ccg-cc--
B D             Horse  ttcc-t-tg---gccg---ccg-cc--
  D  Little brown bat  tccc-tcta---ccca---ccg-cc--
B D           Megabat  tccc-tcta---gctg---cct-cc--
B D          Hedgehog  tctc-tctg------------------
B D          Elephant  tcct-tt-----gccg---ctg-cccc
B D           Manatee  tcct-tt-----gccg---ctg-cccc
B D         Armadillo  tccg-ttta---gcca---cagccccc
B D            Tenrec  ===========================
B D           Wallaby  ===========================
B D            Alpaca  ===========================
B D              Fugu  ===========================
B D      Atlantic cod  ===========================
B D      Nile tilapia  ===========================
B D         Zebrafish  ===========================
B D     X. tropicalis  ===========================
B D          Platypus  ===========================
B D            Turkey  ===========================
B D        Coelacanth  ===========================
B D   Tasmanian devil  ===========================
B D           Opossum  ===========================
B D            Lizard  ===========================
B D        Budgerigar  ===========================
B D       Zebra finch  ===========================
B D           Chicken  ===========================
B D    Painted turtle  ===========================
B D             Shrew  ===========================
B D             Sloth  ===========================
B D        Rock hyrax  ===========================

Inserts between block 29 and 30 in window
B D            Human 3bp
B D            Chimp 3bp
B D          Gorilla 3bp
B D        Orangutan 3bp
B D           Gibbon 3bp
B D           Rhesus 3bp
B D           Baboon 3bp
B D         Marmoset 407bp
B D  Squirrel monkey 2bp
B D              Pig 9bp
B D          Dolphin 9bp
B D            Sheep 9bp
B D              Cow 9bp
B D              Cat 9bp
B D              Dog 8bp
B D            Panda 8bp
B D            Horse 9bp
  D Little brown bat 27bp
B D          Megabat 9bp
B D         Hedgehog 6bp

Alignment block 30 of 702 in window, 56691886 - 56691902, 17 bps 
B D             Mouse  a----cccgcc----------------gct-tgggaca
B D               Rat  a----cccgcg----------------tct-tgggcca
B D      Kangaroo rat  c----cccgcg----------------tcgatggggca
B D    Naked mole-rat  cttg-cctggg----------------gct-tccggag
B D        Guinea pig  cctg-cctgag----------------gct-tcaggag
B D          Squirrel  ttggacccgca----------------gct-ccaagca
B D            Rabbit  t----cttgcg----------------gcg-tcacccg
B D              Pika  t----ccgccg----------------gct-ccacgcg
B D             Human  ----tcccgca----------------gcg-cagatc-
B D             Chimp  ----tcccgca----------------gcg-cagatc-
B D           Gorilla  ----acccgca----------------gcg-cagatc-
B D         Orangutan  ----tcccgca----------------gcg-cagatc-
B D            Gibbon  ----tcccgca----------------gcg-cagatc-
B D            Rhesus  ----tcccgca----------------gcg-aagatc-
B D            Baboon  ----tcccgca----------------gcg-aagatc-
B D   Squirrel monkey  ----ttccgcg----------------gcg-cagatt-
B D           Tarsier  ----gcccgcag--------ctccac-gcg-cagatc-
B D       Mouse lemur  -----cccgccctcccgcagctccac-gcg-aagatc-
B D          Bushbaby  -----cccgccc--------------------------
B D               Pig  ----agtcgcg--------gctccac-gca-taggtt-
B D           Dolphin  ----gcccgcg--------gctccac-gcg-cagata-
B D             Sheep  ----gcccgcg--------gtcccgg-gct-cagata-
B D               Cow  ----gcccgcg--------gtccccg-gcg-cagata-
B D               Cat  ----gcccgct--------gcttcac-gcg-cagatc-
B D               Dog  ----acccgcg--------gctctacggcg-cagatc-
B D             Panda  ----gcccgcg--------gctccac-gcg-cagatc-
B D             Horse  ----gcccgtg--------gctcccc-gcg-caggtc-
  D  Little brown bat  ----gcccgcg--------gctccaa-gtg-cagatc-
B D           Megabat  ----gcccgcc--------tttctaa-gcg-cagatc-
B D          Hedgehog  ----gcctgtg--------gcttcat-gcg-cccacg-
B D          Elephant  ----gcccgcg--------gctccac-gcg-ccagtc-
B D           Manatee  ----gcccgca--------gttccac-gcg-ctggtc-
B D         Armadillo  ----gcccgcg--------gctcc-c-gca-gcagat-
B D          Marmoset  ======================================
B D            Tenrec  ======================================
B D           Wallaby  ======================================
B D            Alpaca  ======================================
B D              Fugu  ======================================
B D      Atlantic cod  ======================================
B D      Nile tilapia  ======================================
B D         Zebrafish  ======================================
B D     X. tropicalis  ======================================
B D          Platypus  ======================================
B D            Turkey  ======================================
B D        Coelacanth  ======================================
B D   Tasmanian devil  ======================================
B D           Opossum  ======================================
B D            Lizard  ======================================
B D        Budgerigar  ======================================
B D       Zebra finch  ======================================
B D           Chicken  ======================================
B D    Painted turtle  ======================================
B D             Shrew  ======================================
B D             Sloth  ======================================
B D        Rock hyrax  ======================================

Alignment block 31 of 702 in window, 56691903 - 56692029, 127 bps 
B D             Mouse  tagagttgc--tgggc--ga--gcctt--ctt-gggtgaacctggc---ct-ggct-------------g
B D               Rat  tagatttgc--taggc--ga--gcctt--cttagggtgaacctggc---ct-ggcc-------------g
B D      Kangaroo rat  ggggaggg----aggg--ca--gccgt--cca-gagtggaccctcc---ct-ggccttgaactcaagcag
B D    Naked mole-rat  ctgctcagc--tgggc--aa--gcagt--cca-gggtagacacgtc---ct-ggcc-------------t
B D        Guinea pig  ctgatcggctttgggc--ga--gcagc--cca-ggggggacccatt---ct-ggcc-------------t
B D          Squirrel  cggatctgc--ctgga-------------cta-gggtggacccctt---ctaggcc-------------t
B D            Rabbit  cagatctgg--caggtc-ca--gcagc--cct-gggtggacgctcc---cg-tgcc-------------t
B D              Pika  cagatctgg--cggctcaaa--gcagc--ctt-gagtggactctcc---ca-ggcc-------------t
B D             Human  -----ctgc-aggggc--ca--gcggt--cca-gggcggaccctcc---ct-cgcc-------------c
B D             Chimp  -----ctgc-aggggc--ca--gcggt--cca-gggcggaccctcc---ct-cgcc-------------c
B D           Gorilla  -----ctgc-aggggc--ca--gcggt--cca-gggcggaccctcc---ct-cgcc-------------c
B D         Orangutan  -----ctgc--tgggc--ca--gcggt--cca-gggcggaccctcc---ct-cgcc-------------c
B D            Gibbon  -----ctgc--aaggc--ca--gcggt--cca-gggcggaccctcc---ca-ctcc-------------c
B D            Rhesus  -----ctgc--agggc--ca--gcggt--cct-gggcggaccctcc---ct-ctcc-------------c
B D            Baboon  -----ctgc--agggc--ca--gcggt--cct-gggcggaccctcc---ct-ctcc-------------c
B D   Squirrel monkey  -----ctgc--agggc--ca--gcggt--cca-gggaggacccacc---ct-cgcc-------------c
B D           Tarsier  -----cggc--ggggc--ca--gcagt--cca-gggtgaaccctcc---ct-cgcc-------------t
B D       Mouse lemur  -----cggc--ctggc--ca--gcagt--cga-ggggggacccttc---ct-cgtc-------------g
B D          Bushbaby  -------gc--gcggc--cc--gcagt--cta-ggggggaccctcc---ct-tgcc-------------t
B D               Pig  -----gggt--ccatc--cc--tcagc--tca-tggtgga-----c---ct-ctcc-------------t
B D           Dolphin  -----gagt--ccagc--cc--gcagc--tca-gggtggaccttcc---ct-ctct-------------t
B D             Sheep  -----gggt--ccagc--cc--gcggc--cca-gggtggaccctcc---ct-ctcc-------------t
B D               Cow  -----gggt--ccagc--cc--gcggc--cct-gggtggaccctcc---ct-ctcc-------------t
B D               Cat  -----ccgc--ctggc--cc--acagc--tca-gcgtggaccctcc---ct-cgcc-------------t
B D               Dog  -----ccgc--ctggc--cc--gcagc--tca-gggtgga-cctcc---ct-ggcc-------------t
B D             Panda  -----ccgc--ctggc--cc--gcaac--tca-gggtgga-cctcc---ct-cgcc-------------t
B D             Horse  -----cggc--c-ggc--cc--gcagc--tca-gggtggaccctcc---ct-ggcc-------------t
  D  Little brown bat  -----c-gc--ccggc--tt---cagc--tca-ggatggatcct-c---gt-cgcc-------------t
B D           Megabat  -----c-gc--ccggc--tt---caac--tca-gagtggaccctcc---ct-cgcc-------------t
B D          Hedgehog  -----gggc--atgac--ccccgcagcggccc-gggtgggtcactt---ct-cgcc-------------t
B D          Elephant  -----gcgc--cgggc--gg--ccggc--cgg-tggaggatcctcc---ct-ggcc-------------t
B D           Manatee  -----gcgc--ggggc--tg--gcagc--cca-tggagtaccctcc---ct-ggcc-------------t
B D         Armadillo  -----ccgc--ccggc--gc--accgc--ctc-gggcggaccctcc---ct-cgcc-------------c
B D          Platypus  -----taga--attgc--tc--cctgc--ctg-gggt-----ctccaagct-aagc-------------g
B D          Marmoset  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D            Alpaca  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  ----tggttgcggggcgc----------gccggttgcc-ctgacactttc------tggggagcttagtt
                  Rat  ----tgagtgacagacgc----------gccggttgcc-ctgacacttac------tggggagcttag-c
         Kangaroo rat  ----ggggggaggggtgc--ttctagctgccacttgac-ccggcactcgc------tgggaggcgcag-a
       Naked mole-rat  ----tggacgtggggtgcgcttctggctgccacttgcctccacgattgac------cggag-gcaccg-t
           Guinea pig  ----tgagcacggggcacacttctggctgccacttgcc-acgcgactgac------ctga--gcacct-t
             Squirrel  ----tgggcacggggcacgcttctggctgcc-cctgtt-gcagcagttgc------tacgaggtgcag-t
               Rabbit  ----tgggctcggggcgcgcttccggttgccacttgcg-gcgacagtcgc------tgggaggaacag-c
                 Pika  ----cgggctccggccgctcttccgactgccactcgcg-gggacagtcgc------gggaaggagcag-c
                Human  ----tgggcgcggggcgagcttctggctgtcacttgcc-gctgcagtttc------agggaaactcag-c
                Chimp  ----tgggcgcggggcgagcttctggctgtcacttgcc-gctgcagtttc------agggaaactcag-c
              Gorilla  ----tgggcgcggggcgagcttctggctgtcacttgcc-gctgcagtttc------agggaaactcag-c
            Orangutan  ----tgggcgcggggcgagcttctggctgtcacttgcc-gctgcagtttc------tgggaaactcag-c
               Gibbon  ----tgggagccgggcgagcttctggctgtcacttgcc-gctgcagtttc------tgggaaactcag-c
               Rhesus  ----cgggcgcgggaagagcttctggctgtcacttgcc-gctgcagtttc------tgggaaactcag-t
               Baboon  cgggcgggcgcggggcgagcttctggctgtcacttgcc-gctgcagtttc------tgggaaactcag-t
      Squirrel monkey  ----cgggcgccgggcactcttccggctgtcacttgca-gctgtagtttc------tgggaaactcag-t
              Tarsier  ----tgggcgcggggcgcccttccggctaccacttgcc-gccgcagtcgc------tggggagcccag-t
          Mouse lemur  ----tggacgcgggtctcgcttccggctgccacttgcg-gc-gcagttgc------tgggg-tcccag-t
             Bushbaby  ----ttggctcagggtgcactt-aggatgccacttgcg-gc-gccgttgcggggggtgggg-gggcac-t
                  Pig  ----tagacacct-gtacacttcaggctgccgcgtgcg-gcagaagaagc------tgggaggacgag-t
              Dolphin  ----taggcaccgggtgcgcctccggctgccacgtgct-acagcagacgc------tgggaggtccag-t
                Sheep  ----taagcacccggtgcgcttccggctgccacgtgcg-gcagcagacac------tgggaggtccag-t
                  Cow  ----taggcaccgggtgcgcttccggctgccacgtgcg-gcagcagacac------tgggaggtccag-t
                  Cat  ----taggcacggggtgcgcttccggctgccacgtgcc-gcagcaggcgc------ggggaggtcgag-g
                  Dog  ----cgggcacagggcgcgcttccggctgccacgtgcc-gcagcaggcgc------tgggaggtcgag-t
                Panda  ----tgggcgcagggtgcgcttccggctgccacgtgcc-gcagcaggccc------tgggaggtcgag-t
                Horse  ----agggcacggggtgcgcttcaggctgccacgtgcg-gccgcggtcgc------caagaggtcgag-t
     Little brown bat  ----tggggacccggtgcgctgcgggctgccac-tgcg-gcagcagtcgc------tagaaggtcaag-a
              Megabat  ----tgggcaccgggtgcactgttagctgccacgtgcg-gcagcagacgc------tgggaggtccag-a
             Hedgehog  ----ggggcacggggcgcgctgcctgctgccacgtgcg-gccgcgctggc------cgggaggccgag-t
             Elephant  ----tgggcgcgggatgcgcttccggctgccacgtgcg-gcggtagtcgc------tgggagaccgag-t
              Manatee  ----tgggcgcggggcgcgcttccggctgccacgtgcg-gccgtggtagc------tgggaggccgag-t
            Armadillo  ----tgggcta-----gcgcttctggctgccgagtgcg-gcggcagtt-c------tgggagaccccg-a
             Platypus  ----tggccgggacccacgcttct-gctatcaccttgc-tctgca-----------gaggaggttcgt-t
             Marmoset  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
               Alpaca  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
           Rock hyrax  ======================================================================

                Mouse  gggtgcgctga-------aca-------ctgaccctgcaaggctgggc
                  Rat  gggtgtgctga-------gc--------caggccctgcaaggttgggc
         Kangaroo rat  ggg------ga-------gga-------ctgatctgggggggcttggc
       Naked mole-rat  gggcg----ga-------ggagccaccgttgaccccgctaga------
           Guinea pig  gggcg----ga-------ggagccaccgttgactccgagagg------
             Squirrel  gggca----ga-------ggaaccgatgctgaccgtgtgaagcagggc
               Rabbit  gggcg----gg-------ggagcggtctccgaccgtggcaggccgagt
                 Pika  gggcg----ga-------gaagcggcctctgaccccggcaggccgggt
                Human  tggcc----g------------------cttaccctgcaagacgggga
                Chimp  tggcc----g------------------cttaccctgcaagacgggga
              Gorilla  tggcc----g------------------cttaccctgcaagacgggga
            Orangutan  tggcc----g------------------cttaccctgcaagacgggga
               Gibbon  tggcc----g------------------cttactctgcaagacgggga
               Rhesus  tggcc----c------------------cttaccctgcaagacgggga
               Baboon  tggcc----g------------------cttaccctgcaagacgggga
      Squirrel monkey  tggcc----g------------------cttactctgcaagaacagga
              Tarsier  gggct----g------------------ctgaccctgcgacactggga
          Mouse lemur  gggcc----g------------------ctgaccctgcgagacctggg
             Bushbaby  gggcc----g------------------ctga-cttgcaggg------
                  Pig  -ggtg----ga-------ggggtagtcgctgaccctaccaagccagaa
              Dolphin  gggca----g--------ggggctgacgctgaccctaccgggccggga
                Sheep  gggcg----ga-------ggggcggccgctgaccctacc-ggccggaa
                  Cow  gggcg----ga-------ggggcggccgctgaccccaccaggccgaaa
                  Cat  gggcg----ga-------ggagctgccgctgaccccgtgtggccggga
                  Dog  aggcg----ga-------ggagcggccgctgaccccgagtggccggga
                Panda  aggcg----ga-------ggagcggccgctgaccccgagtggcccgga
                Horse  gggcg----ga-------ggagcggccgctca-cctgcgaggccggga
     Little brown bat  tgggg----ga-------ggaggggccgctgaccgtgcgaggcccaga
              Megabat  gggcg----ga-------agagcggccgctgaccctgcgaggccggga
             Hedgehog  gggcg----gaggacgcgggagcgg-cgctgaccctgcagggccgggc
             Elephant  gggcg----ga-------ggagcggccggtggccctgcgaagccagag
              Manatee  gggcg----ga-------ggagcggccgctgaccctgcgaagccaggg
            Armadillo  gggcg----aa-------ggagcggccgcggaccctgcgaggctgggg
             Platypus  gcgca----tg-------gaatcagatcgcgcctctgccatgttctgt
             Marmoset  ================================================
               Tenrec  ================================================
              Wallaby  ================================================
               Alpaca  ================================================
                 Fugu  ================================================
         Atlantic cod  ================================================
         Nile tilapia  ================================================
            Zebrafish  ================================================
        X. tropicalis  ================================================
               Turkey  ================================================
           Coelacanth  ================================================
      Tasmanian devil  ================================================
              Opossum  ================================================
               Lizard  ================================================
           Budgerigar  ================================================
          Zebra finch  ================================================
              Chicken  ================================================
       Painted turtle  ================================================
                Shrew  ================================================
                Sloth  ================================================
           Rock hyrax  ================================================

Inserts between block 31 and 32 in window
B D         Hedgehog 2410bp

Alignment block 32 of 702 in window, 56692030 - 56692035, 6 bps 
B D             Mouse  cctaac
B D               Rat  cctaat
B D      Kangaroo rat  ctcggc
B D          Squirrel  cttcgc
B D            Rabbit  cctagc
B D              Pika  cacagc
B D             Human  catagc
B D             Chimp  catagc
B D           Gorilla  catagc
B D         Orangutan  catagc
B D            Gibbon  catagc
B D            Rhesus  catagc
B D            Baboon  catagc
B D   Squirrel monkey  cacagc
B D           Tarsier  caccgt
B D       Mouse lemur  catagc
B D          Bushbaby  ---agc
B D               Pig  tgtagt
B D           Dolphin  cttagc
B D             Sheep  cgtagc
B D               Cow  cgtagc
B D               Cat  cagagc
B D               Dog  cggagc
B D             Panda  cagagc
B D             Horse  cacagc
  D  Little brown bat  cctagc
B D           Megabat  catagc
B D          Elephant  cccggc
B D           Manatee  cctggc
B D         Armadillo  cgcggc
B D          Platypus  ccc---
B D        Guinea pig  ------
B D          Marmoset  ======
B D    Naked mole-rat  ------
B D            Tenrec  ======
B D           Wallaby  ======
B D            Alpaca  ======
B D              Fugu  ======
B D      Atlantic cod  ======
B D      Nile tilapia  ======
B D         Zebrafish  ======
B D     X. tropicalis  ======
B D            Turkey  ======
B D        Coelacanth  ======
B D   Tasmanian devil  ======
B D           Opossum  ======
B D            Lizard  ======
B D        Budgerigar  ======
B D       Zebra finch  ======
B D           Chicken  ======
B D    Painted turtle  ======
B D             Shrew  ======
B D             Sloth  ======
B D          Hedgehog  ======
B D        Rock hyrax  ======

Inserts between block 32 and 33 in window
B D              Pig 27bp
B D          Dolphin 39bp
B D            Sheep 39bp
B D              Cow 39bp
B D              Cat 4bp
B D              Dog 4bp
B D            Panda 4bp
B D            Horse 4bp
  D Little brown bat 4bp
B D          Megabat 1252bp
B D         Elephant 46bp
B D          Manatee 47bp
B D        Armadillo 47bp

Alignment block 33 of 702 in window, 56692036 - 56692101, 66 bps 
B D             Mouse  ------tgggaggc-ca------------gatccgaa---t---gagtctagttgct-------------
B D               Rat  ------tgggcggc-ca------------gatccgaa---g---gagcctagttgct-------------
B D      Kangaroo rat  ------cgtgagcc-ct------------ggtctgga---g---atgtctggttctc-------------
B D    Naked mole-rat  -----------gcc-ca------------ggtctgga---g---acgccgggcctcc-------------
B D        Guinea pig  -----------gcc-ca------------gttctgga---g---aggcccggtctcc-------------
B D          Squirrel  ------tgtgggcc-ca------------ggtctaga---a---aagccggaactct-------------
B D            Rabbit  ------agtgggca-ga------------ggtctgca---g---cagcagagccttt-------------
B D              Pika  ------ggtgggtg-ga------------gggctgcc---g---aagccgagcctct-------------
B D             Human  ------agagggcc-ga------------gttctgga---g---aagctgggcttgt-------------
B D             Chimp  ------agagggcc-ga------------gttctgaa---g---aagctgggcttgt-------------
B D           Gorilla  ------agagggcc-ga------------gttctgga---g---aagctgggcctgt-------------
B D         Orangutan  ------agagggcc-ga------------gttctgga---g---gagctgggcctgt-------------
B D            Gibbon  ------agagggcc-ga------------gttctgga---g---aagctgggct----------------
B D            Rhesus  ------agcgggccaga------------gttctgga---g---aagctgggcctgt-------------
B D            Baboon  ------agcgggccaga------------gttctgga---g---aagctgggcctgt-------------
B D   Squirrel monkey  ------agcggccc-ga------------gttctgga---g---aaggtgggcctgt-------------
B D           Tarsier  ------actgggcc-ga------------ggtctgga---g---aagctgggcc----------------
B D       Mouse lemur  ------agtgggcc-ga------------gttctgga---g---aagct-ggcctcc-------------
B D          Bushbaby  ------ggtgggac-ca------------gggcggaa---c---aagctgggtctct-------------
B D               Pig  ------ggcagcgt-agt---------ttagagaggaat-g---aagtccggcccct-------------
B D           Dolphin  ------ggcagcgc-ggt---------ttggcgaggact-ggagaagcctggcctct-------------
B D             Sheep  ------ggcagcgc-agt---------ttggtgaggacc-g---aagtccggcctct-------------
B D               Cow  ------ggcagcgc-agt---------ttggcgaggacc-gcacaagtccggcctcc-------------
B D               Cat  ------ggcaggtc-gg------------ggttggaacccg---tggcccaggcgtt-------------
B D               Dog  ------ggcaggtc-gg------------ggctggaacccg---tggcccgggcg---------------
B D             Panda  ------ggcagatc-gg------------ggttggaacctg---tggcccgggcgtt-------------
B D             Horse  ------ggccgatc-cg------------gattggcacc-g---cggcccgagcttcgg-agcgc-----
  D  Little brown bat  ------ggcggatc-gg------------gattgaaaccca---tggctcaggcgttggcaacacagttt
B D          Elephant  ------ggtttcct-ga------------ggtctgga---g---tagccaggcc--t-------------
B D           Manatee  ------ggtttggt-ga------------gatctgga---g---aagccgggcc--t-------------
B D         Armadillo  ------tgttccgc-gg------------cgtctaga---g---aagcctg-----t-------------
B D          Platypus  tgccctgtcggacc-cgtccacccctctgaccctgcc---a---ttgctcagtc----------------
B D          Marmoset  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D            Alpaca  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D          Hedgehog  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Megabat  ======================================================================

                Mouse  ---------------------------------------------------tttt--ttttaaagtcaag
                  Rat  ---------------------------------------------------tttt--------aggcaag
         Kangaroo rat  ---------------------------------------------------ttct---------------
       Naked mole-rat  ---------------------------------------------------acac--------ag-----
           Guinea pig  ---------------------------------------------------aagc--------ag-----
             Squirrel  ---------------------------------------------------cccc--cccccccgccccg
               Rabbit  ---------------------------------------------------tttc--tctctgcgccgct
                 Pika  ---------------------------------------------------tttc--catttgcgccgat
                Human  ---------------------------------------------------tttt-ctctctgcaccgcg
                Chimp  ---------------------------------------------------tttt-ctctctgcaccgcg
              Gorilla  ---------------------------------------------------tttt-ctctctgcaccgcg
            Orangutan  ---------------------------------------------------tttt-ctctctgcaccgcg
               Gibbon  ----------------------------------------------------------------------
               Rhesus  ---------------------------------------------------tttt-ctctctgcacagcg
               Baboon  ---------------------------------------------------tttt-ctctctgcaccgcg
      Squirrel monkey  ---------------------------------------------------tttt-ctctctgcgccgca
              Tarsier  ---------------------------------------------------------tctctacgccgcg
          Mouse lemur  ---------------------------------------------------tttc-ctctctatggcgag
             Bushbaby  ---------------------------------------------------tttt-ttctccatgcctac
                  Pig  ---------------------------------------------------tatt-ctctccacgccgcg
              Dolphin  ---------------------------------------------------ttttcctctctacgcggcg
                Sheep  ---------------------------------------------------tttt-ctctctacgaggcg
                  Cow  ---------------------------------------------------tttt-ctctctacgaggcg
                  Cat  ---------------------------------------------------------------agcagcg
                  Dog  ----------------------------------------------------------------gtagcg
                Panda  ---------------------------------------------------------------cgccgct
                Horse  --------------gctttggctcggactggaga-------agcccggcctcttt-ctctccacgccgcg
     Little brown bat  ggagaggaatggagacatcggcgctctctctctctctctctctctccctccctcc-ctccctacgccgcg
             Elephant  ---------------------------------------------------tttg-ctgtctacgacgcg
              Manatee  ---------------------------------------------------cttg-ctgtctatgccacg
            Armadillo  ---------------------------------------------------tttc-ctctcaacaccgcg
             Platypus  ---------------------------------------------------ctgt-cccgccctgcccag
             Marmoset  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
               Alpaca  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
             Hedgehog  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================

                Mouse  --------tg-------------------------------------------------------caat-
                  Rat  --------tg-------------------------------------------------------caga-
         Kangaroo rat  ----------------------------------------------------------------------
       Naked mole-rat  ----------------------------------------------------------------------
           Guinea pig  ----------------------------------------------------------------------
             Squirrel  cgcctcaccg-------------------------------------------------------caat-
               Rabbit  --------gg-------------------------------------------------------caat-
                 Pika  -------ggg-------------------------------------------------------caat-
                Human  --------cg-------------------------------------------------------caat-
                Chimp  --------cg-------------------------------------------------------caat-
              Gorilla  --------cg-------------------------------------------------------cgat-
            Orangutan  --------cg-------------------------------------------------------caac-
               Gibbon  ----------------------------------------------------------------------
               Rhesus  --------cg-------------------------------------------------------caat-
               Baboon  --------cg-------------------------------------------------------caat-
      Squirrel monkey  --------cg-------------------------------------------------------caat-
              Tarsier  --------cg-------------------------------------------------------aaac-
          Mouse lemur  --------cg-------------------------------------------------------caat-
             Bushbaby  --------ag-------------------------------------------------------taat-
                  Pig  --------cg-------------------------------------------------------caat-
              Dolphin  --------cg-------------------------------------------------------caat-
                Sheep  --------tg-------------------------------------------------------caat-
                  Cow  --------tg-------------------------------------------------------caat-
                  Cat  --------ca------------------------------------------------------------
                  Dog  --------ca---------gtctgcagaggactgaagtccggcctcctttactctacgccgcgctcaat-
                Panda  --------ca---------gtctggtgaggactgaagtccggcctctttttctctacgccgcgctccat-
                Horse  --------cgcaatccttcacttact--------------------------------------------
     Little brown bat  --------cg-------------------------------------------------------caat-
             Elephant  --------cg-------------------------------------------------------caag-
              Manatee  --------cg-------------------------------------------------------caag-
            Armadillo  --------cg-------------------------------------------------------aaac-
             Platypus  --------tc-------------------------------------------------------caatc
             Marmoset  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
               Alpaca  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
             Hedgehog  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================

                Mouse  -------gccacactcac
                  Rat  -------tccacatttat
         Kangaroo rat  -------------ctctg
       Naked mole-rat  ---------cccactcac
           Guinea pig  -------tctccactcaa
             Squirrel  -------cccgggttcac
               Rabbit  -------cccccactcac
                 Pika  -------gccccgcacgc
                Human  ------gccccaactgac
                Chimp  ------gccccaactgac
              Gorilla  ------gccccaactgac
            Orangutan  ------gccccaactgac
               Gibbon  ---------ccaactgac
               Rhesus  ------accccaaatcat
               Baboon  ------accccaactcat
      Squirrel monkey  ------gccccaactcac
              Tarsier  -------cccccactcac
          Mouse lemur  --------ccccactcac
             Bushbaby  --------ccccactcac
                  Pig  -------ctttcgcctac
              Dolphin  -------ccttcacttac
                Sheep  -------ccttcacttac
                  Cow  -------ccttcacttac
                  Cat  ------------------
                  Dog  -------ctttcacttac
                Panda  -------ctttcacttac
                Horse  ------------------
     Little brown bat  -------ccttgacctac
             Elephant  -------cccgcactcac
              Manatee  -------tcagcactcgc
            Armadillo  -------ctgacactctc
             Platypus  caagtccccgacgctggc
             Marmoset  ==================
               Tenrec  ==================
              Wallaby  ==================
               Alpaca  ==================
                 Fugu  ==================
         Atlantic cod  ==================
         Nile tilapia  ==================
            Zebrafish  ==================
        X. tropicalis  ==================
               Turkey  ==================
           Coelacanth  ==================
      Tasmanian devil  ==================
              Opossum  ==================
               Lizard  ==================
           Budgerigar  ==================
          Zebra finch  ==================
              Chicken  ==================
       Painted turtle  ==================
                Shrew  ==================
                Sloth  ==================
             Hedgehog  ==================
           Rock hyrax  ==================
              Megabat  ==================

Inserts between block 33 and 34 in window
B D             Pika 594bp
B D         Elephant 1bp
B D          Manatee 1bp
B D        Armadillo 1bp

Alignment block 34 of 702 in window, 56692102 - 56692180, 79 bps 
B D             Mouse  cta--acacaggcgtg-ctgt-a------------------------------ga---------------
B D               Rat  ttaacacacaggcgtg-ctgt-a------------------------------ga---------------
B D      Kangaroo rat  ctg---------cgtg-caat-------------------------------------------------
B D    Naked mole-rat  cct--acagaggcattcctccgg------------------------------gg---------------
B D        Guinea pig  ccg--gcagagtcatttctgt-g------------------------------gg---------------
B D          Squirrel  ctt-agcaatggctttcctgt-g------------------------------ag---------------
B D            Rabbit  ----------------cctct-g------------------------------aa---------------
B D             Human  ----------------cctga-a------------------------------gg---------------
B D             Chimp  ----------------cctga-a------------------------------ag---------------
B D           Gorilla  ----------------cctga-a------------------------------ag---------------
B D         Orangutan  ----------------cctga-a------------------------------ag---------------
B D            Gibbon  ----------------cctga-a------------------------------ag---------------
B D            Rhesus  ----------------cctga-a------------------------------ag---------------
B D            Baboon  ----------------cctga-a------------------------------ag---------------
B D   Squirrel monkey  ----------------cctga-a------------------------------ag---------------
B D           Tarsier  ----------------cctgg-aaggggcgctcccgtgcggcaacccaactcgag---------------
B D       Mouse lemur  ----------------cctgg-a------------------------------agaggcg------gtcc
B D          Bushbaby  ----------------cctgg-a------------------------------agagacg------ctca
B D               Pig  ----------------cctgg-a------------------------------agaggcg------ctcc
B D           Dolphin  ----------------cctgg-a------------------------------agaggca------ctcc
B D             Sheep  ----------------ca-gg-a------------------------------agaggag------ctcc
B D               Cow  ----------------ca-gc-a------------------------------agaggag------cttc
B D               Cat  ----------------------------------------------------------------------
B D               Dog  ----------------cctga-a------------------------------agaggcg------ctcc
B D             Panda  ----------------ccaga-a------------------------------agaggcg------ctcc
B D             Horse  -----------------ctgg-a------------------------------agaggag------ctcc
  D  Little brown bat  ----------------cctag-a------------------------------agacgcg------ctcc
B D          Elephant  -----------------ctcg-a------------------------------agagactcccccactcc
B D           Manatee  -----------------ctcg-a------------------------------agaaact-ccccactcc
B D         Armadillo  -----------------ctcg-a------------------------------agacacttccccattcg
B D          Platypus  ----------------------------------------------------------------------
B D          Marmoset  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B