Multiz Alignments of 60 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 427 in window, 56737571 - 56737588, 18 bps 
B D             Mouse  tcttaaataaaaaataat
B D               Rat  cttttaaataaaaataat
B D    Naked mole-rat  attttagcactcagtaa-
B D        Guinea pig  tttttagtactaactaa-
B D           Tarsier  ttcttaaatatgaac---
B D       Mouse lemur  tccttaaacataaccaaa
B D          Bushbaby  ttcttaaccataaacaca
B D            Alpaca  ttcttaaatataaccata
B D           Dolphin  tctttaaatatatccaag
B D               Cow  tccttagatataaccaaa
B D               Cat  ttcttaaatataaccaaa
B D               Dog  ttcgtaaatagaactaaa
B D             Panda  tccttaaatagaaccaaa
B D             Horse  ttcttaaatataactgaa
  D  Little brown bat  ttcttaaatataaccaaa
B D           Megabat  ttcttaaatgtaaccaaa
B D             Sloth  ttcttaaatataaccaaa
B D            Rabbit  ==================
B D          Elephant  ==================
B D           Manatee  ==================
B D          Squirrel  ==================
B D            Rhesus  ==================
B D         Orangutan  ==================
B D   Squirrel monkey  ==================
B D               Pig  ==================
B D          Marmoset  ==================
B D            Gibbon  ==================
B D           Gorilla  ==================
B D             Chimp  ==================
B D             Human  ==================
B D            Tenrec  ==================
B D           Wallaby  ==================
B D              Pika  ==================
B D        Tree shrew  ==================
B D             Sheep  ==================
B D       Stickleback  ==================
B D         Tetraodon  ==================
B D              Fugu  ==================
B D            Medaka  ==================
B D      Atlantic cod  ==================
B D      Nile tilapia  ==================
B D         Zebrafish  ==================
B D     X. tropicalis  ==================
B D          Platypus  ==================
B D            Turkey  ==================
B D        Coelacanth  ==================
B D   Tasmanian devil  ==================
B D           Opossum  ==================
B D            Lizard  ==================
B D        Budgerigar  ==================
B D       Zebra finch  ==================
B D           Chicken  ==================
B D    Painted turtle  ==================
B D             Shrew  ==================
B D            Baboon  ==================
B D         Armadillo  ==================
B D          Hedgehog  ==================
B D      Kangaroo rat  ==================

Alignment block 2 of 427 in window, 56737589 - 56737621, 33 bps 
B D             Mouse  ttcattttaccttaataac-tatacatta-aaata
B D               Rat  ttcattttaccttaaca---tacacatta-aaata
B D    Naked mole-rat  ttcattttattgtaaaactatatgcatta-aattt
B D        Guinea pig  ttcactttattgtaaaaccatatgcatta-aaatg
B D           Tarsier  -tcattttaatgtaatagc----------------
B D       Mouse lemur  ttcatcttattgtaataacacgtgaatta-aaata
B D          Bushbaby  tctttcttattgtattaacatgtgtatta-tcata
B D            Alpaca  ttcatattattgtaataacatatgcatta-aaata
B D           Dolphin  ttcatattattgtaataacatatgcatta-aaata
B D               Cow  ttcatattattatgataatatatgcatta-aaata
B D               Cat  ttcattttat---aatactatattaatta-aaata
B D               Dog  ttcattttac---aatactatcagaattagaaata
B D             Panda  ttcattttat---aatactataggaatta-aaata
B D             Horse  ttcattttatcaaaataacttttgaatta-aaatc
  D  Little brown bat  ttcattctat---tataccacatgcatta-atata
B D           Megabat  ttcattttat---tataacatgtgcatta-ctata
B D             Shrew  ttctttttta---aataaaacatg----a-aaata
B D             Sloth  ttcattatattgaaata------------------
B D            Rabbit  ===================================
B D          Elephant  ===================================
B D           Manatee  ===================================
B D          Squirrel  ===================================
B D            Rhesus  ===================================
B D         Orangutan  ===================================
B D   Squirrel monkey  ===================================
B D               Pig  ===================================
B D          Marmoset  ===================================
B D            Gibbon  ===================================
B D           Gorilla  ===================================
B D             Chimp  ===================================
B D             Human  ===================================
B D            Tenrec  ===================================
B D           Wallaby  ===================================
B D              Pika  ===================================
B D        Tree shrew  ===================================
B D             Sheep  ===================================
B D       Stickleback  ===================================
B D         Tetraodon  ===================================
B D              Fugu  ===================================
B D            Medaka  ===================================
B D      Atlantic cod  ===================================
B D      Nile tilapia  ===================================
B D         Zebrafish  ===================================
B D     X. tropicalis  ===================================
B D          Platypus  ===================================
B D            Turkey  ===================================
B D        Coelacanth  ===================================
B D   Tasmanian devil  ===================================
B D           Opossum  ===================================
B D            Lizard  ===================================
B D        Budgerigar  ===================================
B D       Zebra finch  ===================================
B D           Chicken  ===================================
B D    Painted turtle  ===================================
B D            Baboon  ===================================
B D         Armadillo  ===================================
B D          Hedgehog  ===================================
B D      Kangaroo rat  ===================================

Inserts between block 2 and 3 in window
B D           Alpaca 7bp
B D          Dolphin 7bp
B D              Cow 6bp
B D              Cat 7bp
B D              Dog 7bp
B D            Panda 7bp
B D            Horse 7bp
  D Little brown bat 1416bp
B D          Megabat 9bp
B D            Shrew 7bp

Alignment block 3 of 427 in window, 56737622 - 56737631, 10 bps 
B D             Mouse  aagttgga-----at----
B D               Rat  aagtcata-----at----
B D    Naked mole-rat  cattcacaaa--tat----
B D        Guinea pig  cactcacaaa--tat----
B D           Tarsier  -atgcacaaatataa----
B D       Mouse lemur  aatgtacaaatttat----
B D          Bushbaby  aatgcatgaatgtat----
B D            Alpaca  -------aaatatat----
B D           Dolphin  -------aaatatat----
B D               Cow  -------aaataaat----
B D               Cat  -------aaatatgt----
B D               Dog  -------aaatatgt----
B D             Panda  -------aaatatat----
B D             Horse  -------aaatatat----
B D           Megabat  -------aaatacat----
B D             Shrew  -------aaacatat----
B D             Sloth  ---------atgtatttgt
B D            Rabbit  ===================
B D          Elephant  ===================
B D           Manatee  ===================
B D          Squirrel  ===================
B D            Rhesus  ===================
B D         Orangutan  ===================
B D   Squirrel monkey  ===================
B D               Pig  ===================
B D          Marmoset  ===================
B D            Gibbon  ===================
B D           Gorilla  ===================
B D             Chimp  ===================
B D             Human  ===================
B D            Tenrec  ===================
B D           Wallaby  ===================
B D              Pika  ===================
B D        Tree shrew  ===================
B D             Sheep  ===================
B D       Stickleback  ===================
B D         Tetraodon  ===================
B D              Fugu  ===================
B D            Medaka  ===================
B D      Atlantic cod  ===================
B D      Nile tilapia  ===================
B D         Zebrafish  ===================
B D     X. tropicalis  ===================
B D          Platypus  ===================
B D            Turkey  ===================
B D        Coelacanth  ===================
B D   Tasmanian devil  ===================
B D           Opossum  ===================
B D            Lizard  ===================
B D        Budgerigar  ===================
B D       Zebra finch  ===================
B D           Chicken  ===================
B D    Painted turtle  ===================
  D  Little brown bat  ===================
B D            Baboon  ===================
B D         Armadillo  ===================
B D          Hedgehog  ===================
B D      Kangaroo rat  ===================

Alignment block 4 of 427 in window, 56737632 - 56737644, 13 bps 
B D             Mouse  --gtat-tatgatata
B D               Rat  --ataa-taagatata
B D    Naked mole-rat  --atataacaactata
B D        Guinea pig  --agat-gtaatgaaa
B D           Tarsier  --gtaa-taaaataga
B D       Mouse lemur  --gtaa-taagatata
B D          Bushbaby  --atga-caaaataca
B D            Alpaca  --gtaa-t-aaata--
B D           Dolphin  --ataa-taaaata--
B D               Cow  --gtaa-tgagata--
B D               Cat  --gtaa-taaaata--
B D               Dog  --gtag-caaaata--
B D             Panda  --gtta-taaaata--
B D             Horse  --ataa-taaaaca--
B D           Megabat  --ataa-caatata--
B D             Shrew  --atgg-taaaata--
B D           Manatee  gtttta-taacata--
B D             Sloth  atatta-ta----a--
B D            Rabbit  ================
B D          Elephant  ================
B D          Squirrel  ================
B D            Rhesus  ================
B D         Orangutan  ================
B D   Squirrel monkey  ================
B D               Pig  ================
B D          Marmoset  ================
B D            Gibbon  ================
B D           Gorilla  ================
B D             Chimp  ================
B D             Human  ================
B D            Tenrec  ================
B D           Wallaby  ================
B D              Pika  ================
B D        Tree shrew  ================
B D             Sheep  ================
B D       Stickleback  ================
B D         Tetraodon  ================
B D              Fugu  ================
B D            Medaka  ================
B D      Atlantic cod  ================
B D      Nile tilapia  ================
B D         Zebrafish  ================
B D     X. tropicalis  ================
B D          Platypus  ================
B D            Turkey  ================
B D        Coelacanth  ================
B D   Tasmanian devil  ================
B D           Opossum  ================
B D            Lizard  ================
B D        Budgerigar  ================
B D       Zebra finch  ================
B D           Chicken  ================
B D    Painted turtle  ================
  D  Little brown bat  ================
B D            Baboon  ================
B D         Armadillo  ================
B D          Hedgehog  ================
B D      Kangaroo rat  ================

Inserts between block 4 and 5 in window
B D           Alpaca 4bp
B D          Dolphin 4bp
B D              Cow 4bp
B D              Cat 2bp
B D              Dog 2bp
B D            Panda 2bp
B D            Horse 2bp
B D          Megabat 5bp

Alignment block 5 of 427 in window, 56737645 - 56737681, 37 bps 
B D             Mouse  tcagtatt----taatttttgtaaatca-------tttata----taatcc--------a
B D               Rat  tcaatact----taatttgtataaatca-------tttata----taaccc--------a
B D    Naked mole-rat  taaaca----------ttacataaatga-------tttata----taa-cc--------a
B D        Guinea pig  taaacac---------tcacataagt-a-------tgtata----tag-ct--------a
B D           Tarsier  aaaatatttatgtaatttataaaa----------------a----tatgtt--------a
B D       Mouse lemur  taaatatttatataatttatgtaa-taa-------tttgta----taattc--------a
B D          Bushbaby  taaatatgtatataatttatgtaa-taa-------tttata----taattc--------a
B D            Alpaca  ---ttatttatatgatat----ttataa-------attata----tactta--------a
B D           Dolphin  ---ttatttatataacat----tcgtaa-------attata----tcattc--------a
B D               Cow  ---ttatttatataatat----ttgtaa-------attata----tcattc--------a
B D               Cat  ----------------------taataa--------tcata----taattt--------a
B D               Dog  ----------------------tgatca-------tttatg----tagttt--------a
B D             Panda  ----------------------taataa-------tttata----taattt--------a
B D             Horse  ----------------------tactat--------ttata----caattttagaactca
  D  Little brown bat  ----ttattatataggatatgcaaataa-------tttata----taattc--------a
B D           Megabat  ----tatttatatcctatacataaataa-------tttatgtaactaattt--------a
B D             Shrew  --------------------tgcaata---------ttata----aaactt--------a
B D           Manatee  -------------tgaatacataaatacaataaaaaatata----caattc--------a
B D             Sloth  -------------taaatatacaaatat--------ttata----taatcc--------a
B D            Rabbit  ============================================================
B D          Elephant  ============================================================
B D          Squirrel  ============================================================
B D            Rhesus  ============================================================
B D         Orangutan  ============================================================
B D   Squirrel monkey  ============================================================
B D               Pig  ============================================================
B D          Marmoset  ============================================================
B D            Gibbon  ============================================================
B D           Gorilla  ============================================================
B D             Chimp  ============================================================
B D             Human  ============================================================
B D            Tenrec  ============================================================
B D           Wallaby  ============================================================
B D              Pika  ============================================================
B D        Tree shrew  ============================================================
B D             Sheep  ============================================================
B D       Stickleback  ============================================================
B D         Tetraodon  ============================================================
B D              Fugu  ============================================================
B D            Medaka  ============================================================
B D      Atlantic cod  ============================================================
B D      Nile tilapia  ============================================================
B D         Zebrafish  ============================================================
B D     X. tropicalis  ============================================================
B D          Platypus  ============================================================
B D            Turkey  ============================================================
B D        Coelacanth  ============================================================
B D   Tasmanian devil  ============================================================
B D           Opossum  ============================================================
B D            Lizard  ============================================================
B D        Budgerigar  ============================================================
B D       Zebra finch  ============================================================
B D           Chicken  ============================================================
B D    Painted turtle  ============================================================
B D            Baboon  ============================================================
B D         Armadillo  ============================================================
B D          Hedgehog  ============================================================
B D      Kangaroo rat  ============================================================

Alignment block 6 of 427 in window, 56737682 - 56737707, 26 bps 
B D             Mouse  atttattg--taggtagtttacagctg-g
B D               Rat  atttagtg--tatgcagttgacagctg-g
B D    Naked mole-rat  tttcattt--tgtgtaatttctttctg-t
B D        Guinea pig  tttcattg--tgtataatttctttctg-t
B D           Tarsier  tctaattg--taagttatttctacccac-
B D       Mouse lemur  tttcactg--tatgtaatttctccctg--
B D          Bushbaby  tttcattg--tatgtaatttctatctg--
B D            Alpaca  tttcattg--tgtgtaatttctatctg-c
B D           Dolphin  tttcattg--tgtgtaatttctatctg-c
B D               Cow  tttcattg--tgtgtaatttctatttg-c
B D               Cat  tttcattg--tgtgtgatttctatccg-t
B D               Dog  tttcattg--tgtgtgatttctatctg-t
B D             Panda  tttcattg--tgtgtgatttctaactg-t
B D             Horse  tttcacag--tgtgtaatttct----g-t
  D  Little brown bat  tttcattg--tgtataatttct----a-t
B D           Megabat  tttcaccg--tgtgtgatacct----g-t
B D             Shrew  tacaagtaattgcatgatt-------g-c
B D          Elephant  atctatcg--tgtgtaatttctgtctg-c
B D           Manatee  tcttactg--tgtgtaatttctgtctg-c
B D             Sloth  ------------------tttcgtctg-t
B D            Rabbit  =============================
B D          Squirrel  =============================
B D            Rhesus  =============================
B D         Orangutan  =============================
B D   Squirrel monkey  =============================
B D               Pig  =============================
B D          Marmoset  =============================
B D            Gibbon  =============================
B D           Gorilla  =============================
B D             Chimp  =============================
B D             Human  =============================
B D            Tenrec  =============================
B D           Wallaby  =============================
B D              Pika  =============================
B D        Tree shrew  =============================
B D             Sheep  =============================
B D       Stickleback  =============================
B D         Tetraodon  =============================
B D              Fugu  =============================
B D            Medaka  =============================
B D      Atlantic cod  =============================
B D      Nile tilapia  =============================
B D         Zebrafish  =============================
B D     X. tropicalis  =============================
B D          Platypus  =============================
B D            Turkey  =============================
B D        Coelacanth  =============================
B D   Tasmanian devil  =============================
B D           Opossum  =============================
B D            Lizard  =============================
B D        Budgerigar  =============================
B D       Zebra finch  =============================
B D           Chicken  =============================
B D    Painted turtle  =============================
B D            Baboon  =============================
B D         Armadillo  =============================
B D          Hedgehog  =============================
B D      Kangaroo rat  =============================

Alignment block 7 of 427 in window, 56737708 - 56737781, 74 bps 
B D             Mouse  ctgaagtctttaggtagttagagaaatgaaggaattaacca---cttctctaatgttatgtgaattgctt
B D               Rat  ctgaattcttttggtagctggagaaattaaagaattagaca---cttctctaatgttatgtgagctgctt
B D    Naked mole-rat  gtcaagcctttggagagctggagagatgaa-ggaatagaca---cttctcttatactacataaactactt
B D        Guinea pig  ctcaagcctttggagagctaaagagatgaa-gaattagaca---cttctcccatgct------actactt
B D          Squirrel  ctcaagacttcagagagttggagaatcaga-ggaatagacacttcttctctcatgctatacaaattactt
B D           Tarsier  ctccaatttttgggtagctgaagaaacgga-ggcatagaca---cttc---cgagttatttagagtactt
B D       Mouse lemur  ctcaagtctttggatagctggaggaatgga-ggcatagaca---cttcttttgtgttatatgaagtagtt
B D          Bushbaby  ctcaagcctttggatggctggagaaatgga-ggcacagata---cttcttttgtgttgtatggagtaaat
B D            Alpaca  tgcaagcctttggg-agctagagaaataga-ggcatgaacg---tttctcccatgttgtatgaattactc
B D           Dolphin  tgcaagcctttggatagctggagaaataga-ggcatggaca---tttctcccacgttgtatgaatcactc
B D               Cow  ttcaagcctttggatagctagagaa--aga-ggtatggaca---tttctcccacattgtatgaatcactc
B D               Cat  ttcaagcctttggatagctggagagat---------ggaca---tgtctcccatgttgtacggattactc
B D               Dog  ttcgagtc--taaatagctggagagatgga-ggcatggaca---cttctcccatattgtacagagtactc
B D             Panda  ctcaagac--tggatagctggagagataga-ggcagggact---cttcttccatgctgtatggagtactc
B D             Horse  ctcaagcccttggacggctggaggaatgga-ggcacggaca---c-tcccccatggtgtagggattactc
  D  Little brown bat  ctcaagcctttggataactggagaaagggc-ggcccagaca---tttgacccatgctgtatggattactc
B D           Megabat  ctcatgcctttggagaactggagataggga-ggctgggaca---ctcctcccgtgttgtttagattactc
B D             Shrew  cttctgtcttttagtagtcagagaaatgga-ggcataaaca---ctttgcctgttttgtagagatgtctc
B D          Elephant  ctgaagtctttggctagctggagaaacgga-gg--caggcc---actcacccatactacatggattacac
B D           Manatee  ctgaagtctttggctagctggaggaatgga-gg--cagact---gttctccaatgttgtgcagattacac
B D             Sloth  ttcaagcctttaaacagttgaagaaacaga-gggacagaca---cttcacccatgttatacggattacac
B D            Rabbit  ======================================================================
B D            Rhesus  ======================================================================
B D         Orangutan  ======================================================================
B D   Squirrel monkey  ======================================================================
B D               Pig  ======================================================================
B D          Marmoset  ======================================================================
B D            Gibbon  ======================================================================
B D           Gorilla  ======================================================================
B D             Chimp  ======================================================================
B D             Human  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D              Pika  ======================================================================
B D        Tree shrew  ======================================================================
B D             Sheep  ======================================================================
B D       Stickleback  ======================================================================
B D         Tetraodon  ======================================================================
B D              Fugu  ======================================================================
B D            Medaka  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D            Baboon  ======================================================================
B D         Armadillo  ======================================================================
B D          Hedgehog  ======================================================================
B D      Kangaroo rat  ======================================================================

                Mouse  ttgtca-g
                  Rat  ttgtcaag
       Naked mole-rat  gtctca-g
           Guinea pig  gtctca-g
             Squirrel  gtctca-g
              Tarsier  gtctca-g
          Mouse lemur  gtctca-g
             Bushbaby  gtctca-g
               Alpaca  atctca-g
              Dolphin  atctca-g
                  Cow  agctca-g
                  Cat  atctca-g
                  Dog  atctca-g
                Panda  atttca-g
                Horse  atctca-g
     Little brown bat  atctga-g
              Megabat  atctca-g
                Shrew  atctca-g
             Elephant  gtctga-g
              Manatee  gtctca-g
                Sloth  gtctca-g
               Rabbit  ========
               Rhesus  ========
            Orangutan  ========
      Squirrel monkey  ========
                  Pig  ========
             Marmoset  ========
               Gibbon  ========
              Gorilla  ========
                Chimp  ========
                Human  ========
               Tenrec  ========
              Wallaby  ========
                 Pika  ========
           Tree shrew  ========
                Sheep  ========
          Stickleback  ========
            Tetraodon  ========
                 Fugu  ========
               Medaka  ========
         Atlantic cod  ========
         Nile tilapia  ========
            Zebrafish  ========
        X. tropicalis  ========
             Platypus  ========
               Turkey  ========
           Coelacanth  ========
      Tasmanian devil  ========
              Opossum  ========
               Lizard  ========
           Budgerigar  ========
          Zebra finch  ========
              Chicken  ========
       Painted turtle  ========
               Baboon  ========
            Armadillo  ========
             Hedgehog  ========
         Kangaroo rat  ========

Inserts between block 7 and 8 in window
B D           Alpaca 821bp
B D            Sloth 762bp

Alignment block 8 of 427 in window, 56737782 - 56737787, 6 bps 
B D             Mouse  agtc-ta
B D               Rat  agtg-ta
B D    Naked mole-rat  agtc-ta
B D        Guinea pig  gatc-ta
B D          Squirrel  agtc-ta
B D           Tarsier  agac-ta
B D       Mouse lemur  agtc-tg
B D          Bushbaby  ggtc-tg
B D           Dolphin  agtt-ta
B D               Cow  agtt-ta
B D               Cat  agtc-ta
B D               Dog  agtctta
B D             Panda  agtc-ta
B D             Horse  agtc-ta
  D  Little brown bat  agtt-ta
B D           Megabat  agtc-tg
B D             Shrew  attt-ta
B D          Elephant  aatc-ta
B D           Manatee  aatc-ta
B D            Rabbit  =======
B D            Rhesus  =======
B D         Orangutan  =======
B D   Squirrel monkey  =======
B D               Pig  =======
B D          Marmoset  =======
B D            Gibbon  =======
B D           Gorilla  =======
B D             Chimp  =======
B D             Human  =======
B D            Tenrec  =======
B D           Wallaby  =======
B D              Pika  =======
B D            Alpaca  =======
B D        Tree shrew  =======
B D             Sheep  =======
B D       Stickleback  =======
B D         Tetraodon  =======
B D              Fugu  =======
B D            Medaka  =======
B D      Atlantic cod  =======
B D      Nile tilapia  =======
B D         Zebrafish  =======
B D     X. tropicalis  =======
B D          Platypus  =======
B D            Turkey  =======
B D        Coelacanth  =======
B D   Tasmanian devil  =======
B D           Opossum  =======
B D            Lizard  =======
B D        Budgerigar  =======
B D       Zebra finch  =======
B D           Chicken  =======
B D    Painted turtle  =======
B D            Baboon  =======
B D             Sloth  =======
B D         Armadillo  =======
B D          Hedgehog  =======
B D      Kangaroo rat  =======

Inserts between block 8 and 9 in window
B D            Shrew 1844bp

Alignment block 9 of 427 in window, 56737788 - 56737790, 3 bps 
B D             Mouse  aaa
B D               Rat  aac
B D    Naked mole-rat  aaa
B D        Guinea pig  aaa
B D          Squirrel  aaa
B D           Tarsier  aag
B D       Mouse lemur  aaa
B D          Bushbaby  aaa
B D           Dolphin  aaa
B D               Cow  aaa
B D               Cat  aaa
B D               Dog  aaa
B D             Panda  aaa
B D             Horse  caa
  D  Little brown bat  aaa
B D           Megabat  aaa
B D          Elephant  aaa
B D           Manatee  aaa
B D            Rabbit  ===
B D            Rhesus  ===
B D         Orangutan  ===
B D   Squirrel monkey  ===
B D               Pig  ===
B D          Marmoset  ===
B D            Gibbon  ===
B D           Gorilla  ===
B D             Chimp  ===
B D             Human  ===
B D            Tenrec  ===
B D           Wallaby  ===
B D              Pika  ===
B D            Alpaca  ===
B D        Tree shrew  ===
B D             Sheep  ===
B D       Stickleback  ===
B D         Tetraodon  ===
B D              Fugu  ===
B D            Medaka  ===
B D      Atlantic cod  ===
B D      Nile tilapia  ===
B D         Zebrafish  ===
B D     X. tropicalis  ===
B D          Platypus  ===
B D            Turkey  ===
B D        Coelacanth  ===
B D   Tasmanian devil  ===
B D           Opossum  ===
B D            Lizard  ===
B D        Budgerigar  ===
B D       Zebra finch  ===
B D           Chicken  ===
B D    Painted turtle  ===
B D             Shrew  ===
B D            Baboon  ===
B D             Sloth  ===
B D         Armadillo  ===
B D          Hedgehog  ===
B D      Kangaroo rat  ===

Inserts between block 9 and 10 in window
B D              Cow 1573bp
B D          Manatee 1256bp

Alignment block 10 of 427 in window, 56737791 - 56737801, 11 bps 
B D             Mouse  tgcagaatcgt
B D               Rat  cacagaattgt
B D    Naked mole-rat  tccagggtcag
B D        Guinea pig  tccaggagcag
B D          Squirrel  aggagg-ttag
B D           Tarsier  aacagggtgga
B D       Mouse lemur  aacaggactgg
B D          Bushbaby  aatcaggttgg
B D           Dolphin  ---aacatcag
B D               Cat  agcagagtcaa
B D               Dog  gacagggtcat
B D             Panda  aacagggtcaa
B D             Horse  aacagggtcag
  D  Little brown bat  gacagggtcag
B D           Megabat  aagagggtccg
B D          Elephant  aacagggcc--
B D            Rabbit  ===========
B D               Cow  ===========
B D           Manatee  ===========
B D            Rhesus  ===========
B D         Orangutan  ===========
B D   Squirrel monkey  ===========
B D               Pig  ===========
B D          Marmoset  ===========
B D            Gibbon  ===========
B D           Gorilla  ===========
B D             Chimp  ===========
B D             Human  ===========
B D            Tenrec  ===========
B D           Wallaby  ===========
B D              Pika  ===========
B D            Alpaca  ===========
B D        Tree shrew  ===========
B D             Sheep  ===========
B D       Stickleback  ===========
B D         Tetraodon  ===========
B D              Fugu  ===========
B D            Medaka  ===========
B D      Atlantic cod  ===========
B D      Nile tilapia  ===========
B D         Zebrafish  ===========
B D     X. tropicalis  ===========
B D          Platypus  ===========
B D            Turkey  ===========
B D        Coelacanth  ===========
B D   Tasmanian devil  ===========
B D           Opossum  ===========
B D            Lizard  ===========
B D        Budgerigar  ===========
B D       Zebra finch  ===========
B D           Chicken  ===========
B D    Painted turtle  ===========
B D             Shrew  ===========
B D            Baboon  ===========
B D             Sloth  ===========
B D         Armadillo  ===========
B D          Hedgehog  ===========
B D      Kangaroo rat  ===========

Inserts between block 10 and 11 in window
B D          Dolphin 3bp
B D              Dog 750bp

Alignment block 11 of 427 in window, 56737802 - 56737804, 3 bps 
B D             Mouse  cat
B D               Rat  cac
B D    Naked mole-rat  ctt
B D        Guinea pig  ctt
B D          Squirrel  ctc
B D           Tarsier  ctt
B D       Mouse lemur  ctt
B D          Bushbaby  ttt
B D           Dolphin  cat
B D               Cat  ctt
B D             Panda  ctt
B D             Horse  ctt
  D  Little brown bat  ctt
B D           Megabat  ctt
B D            Rabbit  ===
B D               Cow  ===
B D          Elephant  ---
B D           Manatee  ===
B D            Rhesus  ===
B D         Orangutan  ===
B D   Squirrel monkey  ===
B D               Pig  ===
B D               Dog  ===
B D          Marmoset  ===
B D            Gibbon  ===
B D           Gorilla  ===
B D             Chimp  ===
B D             Human  ===
B D            Tenrec  ===
B D           Wallaby  ===
B D              Pika  ===
B D            Alpaca  ===
B D        Tree shrew  ===
B D             Sheep  ===
B D       Stickleback  ===
B D         Tetraodon  ===
B D              Fugu  ===
B D            Medaka  ===
B D      Atlantic cod  ===
B D      Nile tilapia  ===
B D         Zebrafish  ===
B D     X. tropicalis  ===
B D          Platypus  ===
B D            Turkey  ===
B D        Coelacanth  ===
B D   Tasmanian devil  ===
B D           Opossum  ===
B D            Lizard  ===
B D        Budgerigar  ===
B D       Zebra finch  ===
B D           Chicken  ===
B D    Painted turtle  ===
B D             Shrew  ===
B D            Baboon  ===
B D             Sloth  ===
B D         Armadillo  ===
B D          Hedgehog  ===
B D      Kangaroo rat  ===

Inserts between block 11 and 12 in window
B D          Dolphin 783bp

Alignment block 12 of 427 in window, 56737805 - 56737806, 2 bps 
B D             Mouse  ca
B D               Rat  ct
B D    Naked mole-rat  ca
B D        Guinea pig  aa
B D          Squirrel  ca
B D           Tarsier  ca
B D       Mouse lemur  ca
B D          Bushbaby  ca
B D               Cat  ca
B D             Panda  ca
B D             Horse  ca
  D  Little brown bat  ca
B D           Megabat  ca
B D            Rabbit  ==
B D               Cow  ==
B D          Elephant  --
B D           Manatee  ==
B D            Rhesus  ==
B D         Orangutan  ==
B D   Squirrel monkey  ==
B D               Pig  ==
B D               Dog  ==
B D          Marmoset  ==
B D            Gibbon  ==
B D           Gorilla  ==
B D             Chimp  ==
B D             Human  ==
B D            Tenrec  ==
B D           Wallaby  ==
B D              Pika  ==
B D            Alpaca  ==
B D        Tree shrew  ==
B D             Sheep  ==
B D       Stickleback  ==
B D         Tetraodon  ==
B D              Fugu  ==
B D            Medaka  ==
B D      Atlantic cod  ==
B D      Nile tilapia  ==
B D         Zebrafish  ==
B D     X. tropicalis  ==
B D          Platypus  ==
B D            Turkey  ==
B D        Coelacanth  ==
B D   Tasmanian devil  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D       Zebra finch  ==
B D           Chicken  ==
B D    Painted turtle  ==
B D             Shrew  ==
B D            Baboon  ==
B D             Sloth  ==
B D         Armadillo  ==
B D          Hedgehog  ==
B D      Kangaroo rat  ==
B D           Dolphin  ==

Inserts between block 12 and 13 in window
B D              Cat 1049bp

Alignment block 13 of 427 in window, 56737807 - 56737807, 1 bps 
B D             Mouse  t
B D               Rat  t
B D    Naked mole-rat  t
B D        Guinea pig  t
B D          Squirrel  c
B D           Tarsier  t
B D       Mouse lemur  c
B D          Bushbaby  t
B D             Panda  t
B D             Horse  t
  D  Little brown bat  t
B D           Megabat  t
B D            Rabbit  =
B D               Cow  =
B D          Elephant  -
B D           Manatee  =
B D            Rhesus  =
B D         Orangutan  =
B D   Squirrel monkey  =
B D               Pig  =
B D               Dog  =
B D          Marmoset  =
B D            Gibbon  =
B D           Gorilla  =
B D             Chimp  =
B D             Human  =
B D            Tenrec  =
B D           Wallaby  =
B D              Pika  =
B D            Alpaca  =
B D        Tree shrew  =
B D             Sheep  =
B D       Stickleback  =
B D         Tetraodon  =
B D              Fugu  =
B D            Medaka  =
B D      Atlantic cod  =
B D      Nile tilapia  =
B D         Zebrafish  =
B D     X. tropicalis  =
B D          Platypus  =
B D            Turkey  =
B D        Coelacanth  =
B D   Tasmanian devil  =
B D           Opossum  =
B D            Lizard  =
B D        Budgerigar  =
B D       Zebra finch  =
B D           Chicken  =
B D    Painted turtle  =
B D             Shrew  =
B D            Baboon  =
B D             Sloth  =
B D         Armadillo  =
B D               Cat  =
B D          Hedgehog  =
B D      Kangaroo rat  =
B D           Dolphin  =

Inserts between block 13 and 14 in window
B D            Panda 758bp

Alignment block 14 of 427 in window, 56737808 - 56737813, 6 bps 
B D             Mouse  aaatgt
B D               Rat  gaatgt
B D    Naked mole-rat  gggtgt
B D        Guinea pig  gggtgt
B D          Squirrel  ggatgt
B D           Tarsier  gtgtgt
B D       Mouse lemur  gagtgt
B D          Bushbaby  gggtgt
B D             Horse  gggtgt
  D  Little brown bat  gggtgt
B D           Megabat  gcgtgt
B D            Rabbit  ======
B D               Cow  ======
B D          Elephant  ------
B D           Manatee  ======
B D            Rhesus  ======
B D         Orangutan  ======
B D   Squirrel monkey  ======
B D               Pig  ======
B D             Panda  ======
B D               Dog  ======
B D          Marmoset  ======
B D            Gibbon  ======
B D           Gorilla  ======
B D             Chimp  ======
B D             Human  ======
B D            Tenrec  ======
B D           Wallaby  ======
B D              Pika  ======
B D            Alpaca  ======
B D        Tree shrew  ======
B D             Sheep  ======
B D       Stickleback  ======
B D         Tetraodon  ======
B D              Fugu  ======
B D            Medaka  ======
B D      Atlantic cod  ======
B D      Nile tilapia  ======
B D         Zebrafish  ======
B D     X. tropicalis  ======
B D          Platypus  ======
B D            Turkey  ======
B D        Coelacanth  ======
B D   Tasmanian devil  ======
B D           Opossum  ======
B D            Lizard  ======
B D        Budgerigar  ======
B D       Zebra finch  ======
B D           Chicken  ======
B D    Painted turtle  ======
B D             Shrew  ======
B D            Baboon  ======
B D             Sloth  ======
B D         Armadillo  ======
B D               Cat  ======
B D          Hedgehog  ======
B D      Kangaroo rat  ======
B D           Dolphin  ======

Inserts between block 14 and 15 in window
B D          Tarsier 714bp
B D          Megabat 97bp

Alignment block 15 of 427 in window, 56737814 - 56737819, 6 bps 
B D             Mouse  caaact
B D               Rat  caagct
B D    Naked mole-rat  gagact
B D        Guinea pig  gtgact
B D          Squirrel  gcgact
B D       Mouse lemur  gtgact
B D          Bushbaby  gtgact
B D             Horse  gtgact
  D  Little brown bat  gtaact
B D          Elephant  --aact
B D            Rabbit  ======
B D               Cow  ======
B D           Manatee  ======
B D            Rhesus  ======
B D         Orangutan  ======
B D   Squirrel monkey  ======
B D               Pig  ======
B D             Panda  ======
B D               Dog  ======
B D          Marmoset  ======
B D            Gibbon  ======
B D           Gorilla  ======
B D             Chimp  ======
B D             Human  ======
B D           Tarsier  ======
B D            Tenrec  ======
B D           Wallaby  ======
B D              Pika  ======
B D            Alpaca  ======
B D        Tree shrew  ======
B D             Sheep  ======
B D       Stickleback  ======
B D         Tetraodon  ======
B D              Fugu  ======
B D            Medaka  ======
B D      Atlantic cod  ======
B D      Nile tilapia  ======
B D         Zebrafish  ======
B D     X. tropicalis  ======
B D          Platypus  ======
B D            Turkey  ======
B D        Coelacanth  ======
B D   Tasmanian devil  ======
B D           Opossum  ======
B D            Lizard  ======
B D        Budgerigar  ======
B D       Zebra finch  ======
B D           Chicken  ======
B D    Painted turtle  ======
B D             Shrew  ======
B D            Baboon  ======
B D             Sloth  ======
B D         Armadillo  ======
B D               Cat  ======
B D          Hedgehog  ======
B D      Kangaroo rat  ======
B D           Megabat  ======
B D           Dolphin  ======

Inserts between block 15 and 16 in window
B D      Mouse lemur 1218bp
B D         Bushbaby 3065bp
B D            Horse 713bp

Alignment block 16 of 427 in window, 56737820 - 56737824, 5 bps 
B D             Mouse  ccaag
B D               Rat  ctgtg
B D    Naked mole-rat  tcatg
B D        Guinea pig  tcaaa
B D          Squirrel  tcatg
  D  Little brown bat  t----
B D          Elephant  ccg--
B D            Rabbit  =====
B D          Bushbaby  =====
B D               Cow  =====
B D           Manatee  =====
B D            Rhesus  =====
B D         Orangutan  =====
B D   Squirrel monkey  =====
B D               Pig  =====
B D             Horse  =====
B D             Panda  =====
B D               Dog  =====
B D          Marmoset  =====
B D            Gibbon  =====
B D           Gorilla  =====
B D             Chimp  =====
B D             Human  =====
B D           Tarsier  =====
B D            Tenrec  =====
B D           Wallaby  =====
B D              Pika  =====
B D            Alpaca  =====
B D        Tree shrew  =====
B D             Sheep  =====
B D       Stickleback  =====
B D         Tetraodon  =====
B D              Fugu  =====
B D            Medaka  =====
B D      Atlantic cod  =====
B D      Nile tilapia  =====
B D         Zebrafish  =====
B D     X. tropicalis  =====
B D          Platypus  =====
B D            Turkey  =====
B D        Coelacanth  =====
B D   Tasmanian devil  =====
B D           Opossum  =====
B D            Lizard  =====
B D        Budgerigar  =====
B D       Zebra finch  =====
B D           Chicken  =====
B D    Painted turtle  =====
B D             Shrew  =====
B D            Baboon  =====
B D             Sloth  =====
B D         Armadillo  =====
B D               Cat  =====
B D       Mouse lemur  =====
B D          Hedgehog  =====
B D      Kangaroo rat  =====
B D           Megabat  =====
B D           Dolphin  =====

Alignment block 17 of 427 in window, 56737825 - 56737825, 1 bps 
B D             Mouse  g
B D               Rat  g
B D    Naked mole-rat  g
B D        Guinea pig  g
B D          Squirrel  g
B D           Tarsier  g
B D             Horse  g
B D            Rabbit  =
B D          Bushbaby  =
B D               Cow  =
B D          Elephant  -
B D           Manatee  =
B D            Rhesus  =
B D         Orangutan  =
B D   Squirrel monkey  =
B D               Pig  =
B D             Panda  =
B D               Dog  =
B D          Marmoset  =
B D            Gibbon  =
B D           Gorilla  =
B D             Chimp  =
B D             Human  =
B D            Tenrec  =
B D           Wallaby  =
B D              Pika  =
B D            Alpaca  =
B D        Tree shrew  =
B D             Sheep  =
B D       Stickleback  =
B D         Tetraodon  =
B D              Fugu  =
B D            Medaka  =
B D      Atlantic cod  =
B D      Nile tilapia  =
B D         Zebrafish  =
B D     X. tropicalis  =
B D          Platypus  =
B D            Turkey  =
B D        Coelacanth  =
B D   Tasmanian devil  =
B D           Opossum  =
B D            Lizard  =
B D        Budgerigar  =
B D       Zebra finch  =
B D           Chicken  =
B D    Painted turtle  =
B D             Shrew  =
  D  Little brown bat  -
B D            Baboon  =
B D             Sloth  =
B D         Armadillo  =
B D               Cat  =
B D       Mouse lemur  =
B D          Hedgehog  =
B D      Kangaroo rat  =
B D           Megabat  =
B D           Dolphin  =

Alignment block 18 of 427 in window, 56737826 - 56737832, 7 bps 
B D             Mouse  agggaaa
B D               Rat  agggaaa
B D    Naked mole-rat  tgggagg
B D        Guinea pig  tgaggga
B D          Squirrel  gaggggg
B D           Tarsier  ggagaaa
B D           Dolphin  agggaag
B D             Horse  ggggaaa
  D  Little brown bat  ---gagc
B D            Rabbit  =======
B D          Bushbaby  =======
B D               Cow  =======
B D          Elephant  -------
B D           Manatee  =======
B D            Rhesus  =======
B D         Orangutan  =======
B D   Squirrel monkey  =======
B D               Pig  =======
B D             Panda  =======
B D               Dog  =======
B D          Marmoset  =======
B D            Gibbon  =======
B D           Gorilla  =======
B D             Chimp  =======
B D             Human  =======
B D            Tenrec  =======
B D           Wallaby  =======
B D              Pika  =======
B D            Alpaca  =======
B D        Tree shrew  =======
B D             Sheep  =======
B D       Stickleback  =======
B D         Tetraodon  =======
B D              Fugu  =======
B D            Medaka  =======
B D      Atlantic cod  =======
B D      Nile tilapia  =======
B D         Zebrafish  =======
B D     X. tropicalis  =======
B D          Platypus  =======
B D            Turkey  =======
B D        Coelacanth  =======
B D   Tasmanian devil  =======
B D           Opossum  =======
B D            Lizard  =======
B D        Budgerigar  =======
B D       Zebra finch  =======
B D           Chicken  =======
B D    Painted turtle  =======
B D             Shrew  =======
B D            Baboon  =======
B D             Sloth  =======
B D         Armadillo  =======
B D               Cat  =======
B D       Mouse lemur  =======
B D          Hedgehog  =======
B D      Kangaroo rat  =======
B D           Megabat  =======

Inserts between block 18 and 19 in window
B D       Guinea pig 50bp

Alignment block 19 of 427 in window, 56737833 - 56737843, 11 bps 
B D             Mouse  acactggggtg
B D               Rat  acactggagtg
B D    Naked mole-rat  -----aaattc
B D          Squirrel  -----ggattc
B D           Tarsier  -------attc
B D           Dolphin  ccccaaagatg
B D             Horse  attctgtgatg
  D  Little brown bat  agtcaccaggg
B D          Elephant  ----tggggtg
B D            Rabbit  ===========
B D        Guinea pig  ===========
B D          Bushbaby  ===========
B D               Cow  ===========
B D           Manatee  ===========
B D            Rhesus  ===========
B D         Orangutan  ===========
B D   Squirrel monkey  ===========
B D               Pig  ===========
B D             Panda  ===========
B D               Dog  ===========
B D          Marmoset  ===========
B D            Gibbon  ===========
B D           Gorilla  ===========
B D             Chimp  ===========
B D             Human  ===========
B D            Tenrec  ===========
B D           Wallaby  ===========
B D              Pika  ===========
B D            Alpaca  ===========
B D        Tree shrew  ===========
B D             Sheep  ===========
B D       Stickleback  ===========
B D         Tetraodon  ===========
B D              Fugu  ===========
B D            Medaka  ===========
B D      Atlantic cod  ===========
B D      Nile tilapia  ===========
B D         Zebrafish  ===========
B D     X. tropicalis  ===========
B D          Platypus  ===========
B D            Turkey  ===========
B D        Coelacanth  ===========
B D   Tasmanian devil  ===========
B D           Opossum  ===========
B D            Lizard  ===========
B D        Budgerigar  ===========
B D       Zebra finch  ===========
B D           Chicken  ===========
B D    Painted turtle  ===========
B D             Shrew  ===========
B D            Baboon  ===========
B D             Sloth  ===========
B D         Armadillo  ===========
B D               Cat  ===========
B D       Mouse lemur  ===========
B D          Hedgehog  ===========
B D      Kangaroo rat  ===========
B D           Megabat  ===========

Inserts between block 19 and 20 in window
B D          Dolphin 1bp
B D            Horse 3bp
  D Little brown bat 2bp

Alignment block 20 of 427 in window, 56737844 - 56737846, 3 bps 
B D             Mouse  tgt--
B D               Rat  tgt--
B D    Naked mole-rat  tgt--
B D          Squirrel  tgt--
B D           Tarsier  tgt--
B D           Dolphin  --t--
B D               Dog  --t--
B D             Horse  --t--
  D  Little brown bat  --t--
B D          Elephant  --tga
B D            Rabbit  =====
B D        Guinea pig  =====
B D          Bushbaby  =====
B D               Cow  =====
B D           Manatee  =====
B D            Rhesus  =====
B D         Orangutan  =====
B D   Squirrel monkey  =====
B D               Pig  =====
B D             Panda  =====
B D          Marmoset  =====
B D            Gibbon  =====
B D           Gorilla  =====
B D             Chimp  =====
B D             Human  =====
B D            Tenrec  =====
B D           Wallaby  =====
B D              Pika  =====
B D            Alpaca  =====
B D        Tree shrew  =====
B D             Sheep  =====
B D       Stickleback  =====
B D         Tetraodon  =====
B D              Fugu  =====
B D            Medaka  =====
B D      Atlantic cod  =====
B D      Nile tilapia  =====
B D         Zebrafish  =====
B D     X. tropicalis  =====
B D          Platypus  =====
B D            Turkey  =====
B D        Coelacanth  =====
B D   Tasmanian devil  =====
B D           Opossum  =====
B D            Lizard  =====
B D        Budgerigar  =====
B D       Zebra finch  =====
B D           Chicken  =====
B D    Painted turtle  =====
B D             Shrew  =====
B D            Baboon  =====
B D             Sloth  =====
B D         Armadillo  =====
B D               Cat  =====
B D       Mouse lemur  =====
B D          Hedgehog  =====
B D      Kangaroo rat  =====
B D           Megabat  =====

Alignment block 21 of 427 in window, 56737847 - 56737852, 6 bps 
B D             Mouse  g--cttac
B D               Rat  aa-cttac
B D    Naked mole-rat  gatcctac
B D          Squirrel  aactctag
B D           Tarsier  gatgttat
B D           Dolphin  catttta-
B D               Dog  gggtttaa
B D             Horse  agcttgaa
  D  Little brown bat  actcttag
B D          Elephant  -atgtgc-
B D         Armadillo  -gtttta-
B D             Sloth  -gtttta-
B D            Rabbit  ========
B D        Guinea pig  ========
B D          Bushbaby  ========
B D               Cow  ========
B D           Manatee  ========
B D            Rhesus  ========
B D         Orangutan  ========
B D   Squirrel monkey  ========
B D               Pig  ========
B D             Panda  ========
B D          Marmoset  ========
B D            Gibbon  ========
B D           Gorilla  ========
B D             Chimp  ========
B D             Human  ========
B D            Tenrec  ========
B D           Wallaby  ========
B D              Pika  ========
B D            Alpaca  ========
B D        Tree shrew  ========
B D             Sheep  ========
B D       Stickleback  ========
B D         Tetraodon  ========
B D              Fugu  ========
B D            Medaka  ========
B D      Atlantic cod  ========
B D      Nile tilapia  ========
B D         Zebrafish  ========
B D     X. tropicalis  ========
B D          Platypus  ========
B D            Turkey  ========
B D        Coelacanth  ========
B D   Tasmanian devil  ========
B D           Opossum  ========
B D            Lizard  ========
B D        Budgerigar  ========
B D       Zebra finch  ========
B D           Chicken  ========
B D    Painted turtle  ========
B D             Shrew  ========
B D            Baboon  ========
B D               Cat  ========
B D       Mouse lemur  ========
B D          Hedgehog  ========
B D      Kangaroo rat  ========
B D           Megabat  ========

Inserts between block 21 and 22 in window
B D         Squirrel 6bp
B D          Tarsier 7bp
B D            Horse 14bp

Alignment block 22 of 427 in window, 56737853 - 56737854, 2 bps 
B D             Mouse  ag
B D               Rat  ag
B D    Naked mole-rat  ca
B D            Rabbit  aa
B D           Tarsier  ag
B D           Dolphin  aa
B D               Cat  aa
B D               Dog  -a
B D             Panda  aa
B D             Horse  aa
  D  Little brown bat  aa
B D          Elephant  ag
B D         Armadillo  aa
B D             Sloth  aa
B D        Guinea pig  ==
B D          Bushbaby  ==
B D               Cow  ==
B D           Manatee  ==
B D          Squirrel  ==
B D            Rhesus  ==
B D         Orangutan  ==
B D   Squirrel monkey  ==
B D               Pig  ==
B D          Marmoset  ==
B D            Gibbon  ==
B D           Gorilla  ==
B D             Chimp  ==
B D             Human  ==
B D            Tenrec  ==
B D           Wallaby  ==
B D              Pika  ==
B D            Alpaca  ==
B D        Tree shrew  ==
B D             Sheep  ==
B D       Stickleback  ==
B D         Tetraodon  ==
B D              Fugu  ==
B D            Medaka  ==
B D      Atlantic cod  ==
B D      Nile tilapia  ==
B D         Zebrafish  ==
B D     X. tropicalis  ==
B D          Platypus  ==
B D            Turkey  ==
B D        Coelacanth  ==
B D   Tasmanian devil  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D       Zebra finch  ==
B D           Chicken  ==
B D    Painted turtle  ==
B D             Shrew  ==
B D            Baboon  ==
B D       Mouse lemur  ==
B D          Hedgehog  ==
B D      Kangaroo rat  ==
B D           Megabat  ==

Inserts between block 22 and 23 in window
B D   Naked mole-rat 7bp

Alignment block 23 of 427 in window, 56737855 - 56737860, 6 bps 
B D             Mouse  gtacac
B D               Rat  gtatac
B D      Kangaroo rat  gtatat
B D    Naked mole-rat  gcataa
B D          Squirrel  acacat
B D            Rabbit  gtacat
B D           Tarsier  gtacat
B D           Dolphin  acacat
B D               Cat  gcacat
B D               Dog  ggacat
B D             Panda  gcacat
B D             Horse  gcatat
  D  Little brown bat  gagcct
B D          Elephant  tcacac
B D         Armadillo  gcacat
B D             Sloth  gcacat
B D        Guinea pig  ======
B D          Bushbaby  ======
B D               Cow  ======
B D           Manatee  ======
B D            Rhesus  ======
B D         Orangutan  ======
B D   Squirrel monkey  ======
B D               Pig  ======
B D          Marmoset  ======
B D            Gibbon  ======
B D           Gorilla  ======
B D             Chimp  ======
B D             Human  ======
B D            Tenrec  ======
B D           Wallaby  ======
B D              Pika  ======
B D            Alpaca  ======
B D        Tree shrew  ======
B D             Sheep  ======
B D       Stickleback  ======
B D         Tetraodon  ======
B D              Fugu  ======
B D            Medaka  ======
B D      Atlantic cod  ======
B D      Nile tilapia  ======
B D         Zebrafish  ======
B D     X. tropicalis  ======
B D          Platypus  ======
B D            Turkey  ======
B D        Coelacanth  ======
B D   Tasmanian devil  ======
B D           Opossum  ======
B D            Lizard  ======
B D        Budgerigar  ======
B D       Zebra finch  ======
B D           Chicken  ======
B D    Painted turtle  ======
B D             Shrew  ======
B D            Baboon  ======
B D       Mouse lemur  ======
B D          Hedgehog  ======
B D           Megabat  ======

Inserts between block 23 and 24 in window
B D         Elephant 1199bp

Alignment block 24 of 427 in window, 56737861 - 56737869, 9 bps 
B D             Mouse  catagg--cag
B D               Rat  catagg--cag
B D      Kangaroo rat  cattgtgctac
B D    Naked mole-rat  cctgtg-ctat
B D          Squirrel  tctttg-ctaa
B D            Rabbit  cctgta--cta
B D           Tarsier  cccgtg-ctag
B D               Pig  cacagg-cta-
B D           Dolphin  catgtg-tta-
B D               Cat  catgtg-cta-
B D               Dog  catgtg-cta-
B D             Panda  catgtg-ctg-
B D             Horse  catgtg-cta-
  D  Little brown bat  catgct-tgg-
B D         Armadillo  catgtg-cta-
B D             Sloth  catgtg-ctg-
B D        Guinea pig  ===========
B D          Bushbaby  ===========
B D               Cow  ===========
B D          Elephant  ===========
B D           Manatee  ===========
B D            Rhesus  ===========
B D         Orangutan  ===========
B D   Squirrel monkey  ===========
B D          Marmoset  ===========
B D            Gibbon  ===========
B D           Gorilla  ===========
B D             Chimp  ===========
B D             Human  ===========
B D            Tenrec  ===========
B D           Wallaby  ===========
B D              Pika  ===========
B D            Alpaca  ===========
B D        Tree shrew  ===========
B D             Sheep  ===========
B D       Stickleback  ===========
B D         Tetraodon  ===========
B D              Fugu  ===========
B D            Medaka  ===========
B D      Atlantic cod  ===========
B D      Nile tilapia  ===========
B D         Zebrafish  ===========
B D     X. tropicalis  ===========
B D          Platypus  ===========
B D            Turkey  ===========
B D        Coelacanth  ===========
B D   Tasmanian devil  ===========
B D           Opossum  ===========
B D            Lizard  ===========
B D        Budgerigar  ===========
B D       Zebra finch  ===========
B D           Chicken  ===========
B D    Painted turtle  ===========
B D             Shrew  ===========
B D            Baboon  ===========
B D       Mouse lemur  ===========
B D          Hedgehog  ===========
B D           Megabat  ===========

Inserts between block 24 and 25 in window
B D              Pig 1bp
B D          Dolphin 1bp

Alignment block 25 of 427 in window, 56737870 - 56737872, 3 bps 
B D             Mouse  ttt
B D               Rat  ttt
B D      Kangaroo rat  ttt
B D    Naked mole-rat  ctt
B D          Squirrel  ctt
B D            Rabbit  ctt
B D           Tarsier  tat
B D               Pig  ttt
B D            Alpaca  ttt
B D           Dolphin  ttt
B D             Sheep  ttt
B D               Cow  ttt
B D               Cat  ctt
B D               Dog  ctt
B D             Panda  cct
B D             Horse  ctt
  D  Little brown bat  ttt
B D         Armadillo  ctt
B D             Sloth  ctt
B D        Guinea pig  ===
B D          Bushbaby  ===
B D          Elephant  ===
B D           Manatee  ===
B D            Rhesus  ===
B D         Orangutan  ===
B D   Squirrel monkey  ===
B D          Marmoset  ===
B D            Gibbon  ===
B D           Gorilla  ===
B D             Chimp  ===
B D             Human  ===
B D            Tenrec  ===
B D           Wallaby  ===
B D              Pika  ===
B D        Tree shrew  ===
B D       Stickleback  ===
B D         Tetraodon  ===
B D              Fugu  ===
B D            Medaka  ===
B D      Atlantic cod  ===
B D      Nile tilapia  ===
B D         Zebrafish  ===
B D     X. tropicalis  ===
B D          Platypus  ===
B D            Turkey  ===
B D        Coelacanth  ===
B D   Tasmanian devil  ===
B D           Opossum  ===
B D            Lizard  ===
B D        Budgerigar  ===
B D       Zebra finch  ===
B D           Chicken  ===
B D    Painted turtle  ===
B D             Shrew  ===
B D            Baboon  ===
B D       Mouse lemur  ===
B D          Hedgehog  ===
B D           Megabat  ===

Inserts between block 25 and 26 in window
B D              Cat 1bp
B D              Dog 1bp
B D            Panda 1bp
B D            Horse 1bp
  D Little brown bat 1091bp

Alignment block 26 of 427 in window, 56737873 - 56737905, 33 bps 
B D             Mouse  -taatatgtag---gagttggacgacttttagctacg
B D               Rat  -tatattgtag---gagttgaa-gacttttgtcttct
B D      Kangaroo rat  -tatattgtag---atgtttgaagacatttagcatct
B D    Naked mole-rat  -tatattgtag---aagttagaagtccacaggtattg
B D          Squirrel  -tatatggtag---aaatca---ggcagttggcat--
B D            Rabbit  -tttattatag---atgttgaaaggctgctggcatct
B D           Tarsier  -tatatggtag---agtttgaaagactgctgtcatct
B D               Pig  -tatctgatta---aagttgaaagggtgctgacatct
B D            Alpaca  -taccttgtca---aagttgaaaggctgctgccattt
B D           Dolphin  -tatcttgtca---aagttgaaaggctgctgacatct
B D             Sheep  -tatcttatca---aagtggaaaggctgctgacatat
B D               Cow  -tattttatca---aagtggaaaggctgctgacatac
B D               Cat  -catcttgtag---aagttaaaaggctgctagcatct
B D               Dog  -tatcttgtag---aagttga-aggctgctagcattt
B D             Panda  -tatcttgtag---aagttgagaggctgctagcatcg
B D             Horse  -tatcttgtag---aagttgaaaggctgctaatatct
B D         Armadillo  taatcttgtagaaaaagttgaagggctgctggtgtca
B D             Sloth  ttatcttgtagaataagttgaagggctactggtgctt
B D        Guinea pig  =====================================
B D          Bushbaby  =====================================
B D          Elephant  =====================================
B D           Manatee  =====================================
B D            Rhesus  =====================================
B D         Orangutan  =====================================
B D   Squirrel monkey  =====================================
B D          Marmoset  =====================================
B D            Gibbon  =====================================
B D           Gorilla  =====================================
B D             Chimp  =====================================
B D             Human  =====================================
B D            Tenrec  =====================================
B D           Wallaby  =====================================
B D              Pika  =====================================
B D        Tree shrew  =====================================
B D       Stickleback  =====================================
B D         Tetraodon  =====================================
B D              Fugu  =====================================
B D            Medaka  =====================================
B D      Atlantic cod  =====================================
B D      Nile tilapia  =====================================
B D         Zebrafish  =====================================
B D     X. tropicalis  =====================================
B D          Platypus  =====================================
B D            Turkey  =====================================
B D        Coelacanth  =====================================
B D   Tasmanian devil  =====================================
B D           Opossum  =====================================
B D            Lizard  =====================================
B D        Budgerigar  =====================================
B D       Zebra finch  =====================================
B D           Chicken  =====================================
B D    Painted turtle  =====================================
B D             Shrew  =====================================
  D  Little brown bat  =====================================
B D            Baboon  =====================================
B D       Mouse lemur  =====================================
B D          Hedgehog  =====================================
B D           Megabat  =====================================

Alignment block 27 of 427 in window, 56737906 - 56737906, 1 bps 
B D             Mouse  g
B D               Rat  g
B D      Kangaroo rat  g
B D    Naked mole-rat  g
B D        Guinea pig  g
B D          Squirrel  g
B D            Rabbit  c
B D           Tarsier  g
B D               Pig  a
B D            Alpaca  g
B D           Dolphin  g
B D             Sheep  g
B D               Cow  g
B D               Cat  g
B D               Dog  g
B D             Panda  g
B D             Horse  g
B D         Armadillo  g
B D             Sloth  a
B D          Bushbaby  =
B D          Elephant  =
B D           Manatee  =
B D            Rhesus  =
B D         Orangutan  =
B D   Squirrel monkey  =
B D          Marmoset  =
B D            Gibbon  =
B D           Gorilla  =
B D             Chimp  =
B D             Human  =
B D            Tenrec  =
B D           Wallaby  =
B D              Pika  =
B D        Tree shrew  =
B D       Stickleback  =
B D         Tetraodon  =
B D              Fugu  =
B D            Medaka  =
B D      Atlantic cod  =
B D      Nile tilapia  =
B D         Zebrafish  =
B D     X. tropicalis  =
B D          Platypus  =
B D            Turkey  =
B D        Coelacanth  =
B D   Tasmanian devil  =
B D           Opossum  =
B D            Lizard  =
B D        Budgerigar  =
B D       Zebra finch  =
B D           Chicken  =
B D    Painted turtle  =
B D             Shrew  =
  D  Little brown bat  =
B D            Baboon  =
B D       Mouse lemur  =
B D          Hedgehog  =
B D           Megabat  =

Alignment block 28 of 427 in window, 56737907 - 56737918, 12 bps 
B D             Mouse  taggttatca---tt
B D               Rat  caggttatca---tt
B D      Kangaroo rat  taagttacca---t-
B D    Naked mole-rat  taagttaaca---t-
B D        Guinea pig  tatggtaaca---t-
B D          Squirrel  tcagttaccc---tt
B D            Rabbit  taagttacca---tt
B D          Marmoset  tatgctatca---tt
B D           Tarsier  tatgttacaatattt
B D               Pig  taagttacca---tt
B D            Alpaca  gaagttacca---gt
B D           Dolphin  taagttacca---tt
B D             Sheep  tgagttactg---tt
B D               Cow  tgagttacta---tt
B D               Cat  taaattatca---tt
B D               Dog  taaattacca---tt
B D             Panda  taagttacca---tt
B D             Horse  taagttacca---tt
B D         Armadillo  taagtgatca---tt
B D             Sloth  t-agctacca---tt
B D          Bushbaby  ===============
B D          Elephant  ===============
B D           Manatee  ===============
B D            Rhesus  ===============
B D         Orangutan  ===============
B D   Squirrel monkey  ===============
B D            Gibbon  ===============
B D           Gorilla  ===============
B D             Chimp  ===============
B D             Human  ===============
B D            Tenrec  ===============
B D           Wallaby  ===============
B D              Pika  ===============
B D        Tree shrew  ===============
B D       Stickleback  ===============
B D         Tetraodon  ===============
B D              Fugu  ===============
B D            Medaka  ===============
B D      Atlantic cod  ===============
B D      Nile tilapia  ===============
B D         Zebrafish  ===============
B D     X. tropicalis  ===============
B D          Platypus  ===============
B D            Turkey  ===============
B D        Coelacanth  ===============
B D   Tasmanian devil  ===============
B D           Opossum  ===============
B D            Lizard  ===============
B D        Budgerigar  ===============
B D       Zebra finch  ===============
B D           Chicken  ===============
B D    Painted turtle  ===============
B D             Shrew  ===============
  D  Little brown bat  ===============
B D            Baboon  ===============
B D       Mouse lemur  ===============
B D          Hedgehog  ===============
B D           Megabat  ===============

Inserts between block 28 and 29 in window
B D         Marmoset 2bp
B D          Tarsier 2bp

Alignment block 29 of 427 in window, 56737919 - 56737922, 4 bps 
B D             Mouse  aaga
B D               Rat  aaaa
B D      Kangaroo rat  --aa
B D    Naked mole-rat  -aaa
B D        Guinea pig  -taa
B D          Squirrel  -aaa
B D            Rabbit  gaag
B D          Marmoset  --aa
B D           Tarsier  --aa
B D        Tree shrew  --aa
B D               Pig  -aaa
B D            Alpaca  -aaa
B D           Dolphin  -aaa
B D             Sheep  -aaa
B D               Cow  -aaa
B D               Cat  -aaa
B D               Dog  -aaa
B D             Panda  -aaa
B D             Horse  -aaa
B D         Armadillo  aaaa
B D             Sloth  taaa
B D          Bushbaby  ====
B D          Elephant  ====
B D           Manatee  ====
B D            Rhesus  ====
B D         Orangutan  ====
B D   Squirrel monkey  ====
B D            Gibbon  ====
B D           Gorilla  ====
B D             Chimp  ====
B D             Human  ====
B D            Tenrec  ====
B D           Wallaby  ====
B D              Pika  ====
B D       Stickleback  ====
B D         Tetraodon  ====
B D              Fugu  ====
B D            Medaka  ====
B D      Atlantic cod  ====
B D      Nile tilapia  ====
B D         Zebrafish  ====
B D     X. tropicalis  ====
B D          Platypus  ====
B D            Turkey  ====
B D        Coelacanth  ====
B D   Tasmanian devil  ====
B D           Opossum  ====
B D            Lizard  ====
B D        Budgerigar  ====
B D       Zebra finch  ====
B D           Chicken  ====
B D    Painted turtle  ====
B D             Shrew  ====
  D  Little brown bat  ====
B D            Baboon  ====
B D       Mouse lemur  ====
B D          Hedgehog  ====
B D           Megabat  ====

Inserts between block 29 and 30 in window
B D         Marmoset 18bp
B D          Tarsier 2bp
B D       Tree shrew 5bp
B D              Pig 1bp
B D           Alpaca 1bp
B D          Dolphin 1bp
B D            Sheep 1bp
B D              Cow 1bp
B D              Cat 1bp
B D              Dog 1bp
B D            Panda 1bp
B D            Horse 1bp

Alignment block 30 of 427 in window, 56737923 - 56737924, 2 bps 
B D             Mouse  ga
B D               Rat  ga
B D      Kangaroo rat  aa
B D    Naked mole-rat  aa
B D        Guinea pig  aa
B D          Squirrel  ag
B D            Rabbit  aa
B D         Armadillo  aa
B D             Sloth  aa
B D          Bushbaby  ==
B D               Cow  ==
B D          Elephant  ==
B D           Manatee  ==
B D            Rhesus  ==
B D         Orangutan  ==
B D   Squirrel monkey  ==
B D               Pig  ==
B D             Horse  ==
B D             Panda  ==
B D               Dog  ==
B D          Marmoset  ==
B D            Gibbon  ==
B D           Gorilla  ==
B D             Chimp  ==
B D             Human  ==
B D           Tarsier  ==
B D            Tenrec  ==
B D           Wallaby  ==
B D              Pika  ==
B D            Alpaca  ==
B D        Tree shrew  ==
B D             Sheep  ==
B D       Stickleback  ==
B D         Tetraodon  ==
B D              Fugu  ==
B D            Medaka  ==
B D      Atlantic cod  ==
B D      Nile tilapia  ==
B D         Zebrafish  ==
B D     X. tropicalis  ==
B D          Platypus  ==
B D            Turkey  ==
B D        Coelacanth  ==
B D   Tasmanian devil  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D       Zebra finch  ==
B D           Chicken  ==
B D    Painted turtle  ==
B D             Shrew  ==
  D  Little brown bat  ==
B D            Baboon  ==
B D               Cat  ==
B D       Mouse lemur  ==
B D          Hedgehog  ==
B D           Megabat  ==
B D           Dolphin  ==

Inserts between block 30 and 31 in window
B D        Armadillo 4bp
B D            Sloth 1bp

Alignment block 31 of 427 in window, 56737925 - 56737948, 24 bps 
B D             Mouse  taatg-------g---------------------------------------------------------
B D               Rat  taatg-------c---------------------------------------------------------
B D      Kangaroo rat  taatg------tt---------------------------------------------------------
B D    Naked mole-rat  taatg------gt---------------------------------------------------------
B D        Guinea pig  t-ata------at---------------------------------------------------------
B D          Squirrel  taatgaaaataat---------------------------------------------------------
B D            Rabbit  taata------at---------------------------------------------------------
B D             Human  -gata------at---------------------------------------------------------
B D             Chimp  -gata------at---------------------------------------------------------
B D           Gorilla  -gata------at---------------------------------------------------------
B D         Orangutan  -gata------at---------------------------------------------------------
B D            Gibbon  -gata------at---------------------------------------------------------
B D            Rhesus  -gata------at---------------------------------------------------------
B D            Baboon  -gata------at---------------------------------------------------------
B D          Marmoset  -gatg------at---------------------------------------------------------
B D           Tarsier  -gatg------at---------------------------------------------------------
B D        Tree shrew  -aata------gt---------------------------------------------------------
B D               Pig  ---------at-t---------------------------------------------------------
B D            Alpaca  ----------------------------------------------------------------------
B D           Dolphin  ---------at-t---------------------------------------------------------
B D             Sheep  ----------------------------------------------------------------------
B D               Cow  ---------at-t---------------------------------------------------------
B D               Cat  ---------atatatatattaaatatatatatattacatatatatttactaaatatatatatattaaata
B D               Dog  ---------gtat---------------------------------------------------------
B D             Panda  ---------atat---------------------------------------------------------
B D             Horse  ---------atat---------------------------------------------------------
B D          Elephant  ----------------------------------------------------------------------
B D         Armadillo  ----------------------------------------------------------------------
B D             Sloth  ----------------------------------------------------------------------
B D          Bushbaby  ======================================================================
B D           Manatee  ======================================================================
B D   Squirrel monkey  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D              Pika  ======================================================================
B D       Stickleback  ======================================================================
B D         Tetraodon  ======================================================================
B D              Fugu  ======================================================================
B D            Medaka  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
  D  Little brown bat  ======================================================================
B D       Mouse lemur  ======================================================================
B D          Hedgehog  ======================================================================
B D           Megabat  ======================================================================

                Mouse  -----------aataaccaccatttttat---
                  Rat  -----------aattatccccattgttat---
         Kangaroo rat  -----------aatagtttatatcattag---
       Naked mole-rat  -----------aatatctattatcattat---
           Guinea pig  -----------aataactattatcatttt---
             Squirrel  -----------aataattattattattat---
               Rabbit  -----------ggtaacaattatcattat---
                Human  -----------aattatcatcattgttat---
                Chimp  -----------aattatcatcattgttat---
              Gorilla  -----------aattatcatcattgttat---
            Orangutan  -----------aattatcatcattgttat---
               Gibbon  -----------aattatcatcattgttat---
               Rhesus  -----------aattatcatcattgttat---
               Baboon  -----------aattatcataattgttat---
             Marmoset  -----------aataattatcattattat---
              Tarsier  -----------gatgataatgaccattat---
           Tree shrew  -----------aattatcataattactat---
                  Pig  ------------------attattattat---
               Alpaca  ---------------------attattat---
              Dolphin  ------------------attattattat---
                Sheep  ------------------attattgttat---
                  Cow  ------------------attattgttat---
                  Cat  tatatatatacatatataatcattattat---
                  Dog  -----------acttataattattattac---
                Panda  -----------atttataattattacttc---
                Horse  -----------acatgtaattattat------
             Elephant  --------tagggagataaacacactcttaaa
            Armadillo  --------aataataatagctactattttagc
                Sloth  --------------------tactacttttgc
             Bushbaby  ================================
              Manatee  ================================
      Squirrel monkey  ================================
               Tenrec  ================================
              Wallaby  ================================
                 Pika  ================================
          Stickleback  ================================
            Tetraodon  ================================
                 Fugu  ================================
               Medaka  ================================
         Atlantic cod  ================================
         Nile tilapia  ================================
            Zebrafish  ================================
        X. tropicalis  ================================
             Platypus  ================================
               Turkey  ================================
           Coelacanth  ================================
      Tasmanian devil  ================================
              Opossum  ================================
               Lizard  ================================
           Budgerigar  ================================
          Zebra finch  ================================
              Chicken  ================================
       Painted turtle  ================================
                Shrew  ================================
     Little brown bat  ================================
          Mouse lemur  ================================
             Hedgehog  ================================
              Megabat  ================================

Alignment block 32 of 427 in window, 56737949 - 56737953, 5 bps 
B D             Mouse  attat
B D               Rat  attat
B D      Kangaroo rat  attgc
B D    Naked mole-rat  attac
B D        Guinea pig  atttc
B D          Squirrel  attgc
B D            Rabbit  attat
B D             Human  tttgc
B D             Chimp  tttgc
B D           Gorilla  tttgc
B D         Orangutan  tttgc
B D            Gibbon  tttgc
B D            Rhesus  tttgc
B D            Baboon  tttgc
B D          Marmoset  tttgc
B D           Tarsier  tttgc
B D       Mouse lemur  -ataa
B D        Tree shrew  tttgc
B D               Pig  tttac
B D            Alpaca  cttac
B D           Dolphin  tttat
B D             Sheep  ttcat
B D               Cow  ttcat
B D               Cat  tttgc
B D               Dog  tttgc
B D             Panda  tctgc
B D             Horse  tttgc
B D          Elephant  ---aa
B D         Armadillo  ---ac
B D             Sloth  ---at
B D          Bushbaby  =====
B D           Manatee  =====
B D   Squirrel monkey  =====
B D            Tenrec  =====
B D           Wallaby  =====
B D              Pika  =====
B D       Stickleback  =====
B D         Tetraodon  =====
B D              Fugu  =====
B D            Medaka  =====
B D      Atlantic cod  =====
B D      Nile tilapia  =====
B D         Zebrafish  =====
B D     X. tropicalis  =====
B D          Platypus  =====
B D            Turkey  =====
B D        Coelacanth  =====
B D   Tasmanian devil  =====
B D           Opossum  =====
B D            Lizard  =====
B D        Budgerigar  =====
B D       Zebra finch  =====
B D           Chicken  =====
B D    Painted turtle  =====
B D             Shrew  =====
  D  Little brown bat  =====
B D          Hedgehog  =====
B D           Megabat  =====

Inserts between block 32 and 33 in window
B D      Mouse lemur 1bp

Alignment block 33 of 427 in window, 56737954 - 56737980, 27 bps 
B D             Mouse  aataagagcaaatga-ctcc-agaggag-t
B D               Rat  aatatgagcaaatga-ctag-agaggag-t
B D      Kangaroo rat  atcaaaagaaagtga-tttt-agaaaagct
B D    Naked mole-rat  atcaaaagcaaatga-tcct-agaagagtt
B D        Guinea pig  atcaaaagcaaataa-tccc-agaagagtt
B D          Squirrel  accagatgcaaatga-ttct-agaagagtt
B D            Rabbit  atcagaagcaaatga-ccac-ggaagaggt
B D             Human  ctcaaaagcaaatga-ttct-agaagaatt
B D             Chimp  ctcaaaagcaaatga-ttct-agaagaatt
B D           Gorilla  cttaaaagcaaatga-ttct-agaagaatt
B D         Orangutan  ctcaaaagcaaatga-ttct-agaagaatt
B D            Gibbon  ctcaaaagcaaatga-ttct-agaagaatt
B D            Rhesus  atcaaaagcaaatga-ttct-agaagaatc
B D            Baboon  atcaaaat---atga-ttct-agaagaatc
B D          Marmoset  atcaaaagcaaataa-tctt-agaaaaatt
B D           Tarsier  atcaaaaacaaatga-ttct-agaataact
B D       Mouse lemur  aaaaaaagcaaatta-tcct-agaagagtt
B D          Bushbaby  aaaaaaagcaaatga-ttac-agaaaagtt
B D        Tree shrew  atcaaaggcaaatgattttt-ataggagtt
B D               Pig  atcaaaagtgtaaga-tcct-agaagggt-
B D            Alpaca  atcaaaggtgaatga-tcct-agaagagc-
B D           Dolphin  atcaaaagtgcatga-tcct-agaagagt-
B D             Sheep  gtcaaaagtgaatga-tcct-agaagagt-
B D               Cow  gtcaaaagtgaatga-tcct-agaagagt-
B D               Cat  atg-aaagtgaatga-tcct-taaagagt-
B D               Dog  atgaaaagtgtatga-tcct-catagagt-
B D             Panda  ctgaaaagtgaatga-tcct-tgaagagt-
B D             Horse  actaaaagcaaatga-tcct-agaagagt-
B D          Elephant  aaaaaaagctaatga-tcctaaaaaaagtt
B D           Manatee  aaaaaaagcaaatga-tcct-aaaaaagtt
B D         Armadillo  --caaaattaaatga-tcct-agaaaagtt
B D             Sloth  --caaaagcaaatga-tcct-agaaaagtt
B D   Squirrel monkey  ==============================
B D            Tenrec  ==============================
B D           Wallaby  ==============================
B D              Pika  ==============================
B D       Stickleback  ==============================
B D         Tetraodon  ==============================
B D              Fugu  ==============================
B D            Medaka  ==============================
B D      Atlantic cod  ==============================
B D      Nile tilapia  ==============================
B D         Zebrafish  ==============================
B D     X. tropicalis  ==============================
B D          Platypus  ==============================
B D            Turkey  ==============================
B D        Coelacanth  ==============================
B D   Tasmanian devil  ==============================
B D           Opossum  ==============================
B D            Lizard  ==============================
B D        Budgerigar  ==============================
B D       Zebra finch  ==============================
B D           Chicken  ==============================
B D    Painted turtle  ==============================
B D             Shrew  ==============================
  D  Little brown bat  ==============================
B D          Hedgehog  ==============================
B D           Megabat  ==============================

Inserts between block 33 and 34 in window
B D              Pig 1bp
B D           Alpaca 1bp
B D          Dolphin 1bp
B D              Cow 1bp
B D              Cat 1bp
B D              Dog 1bp
B D            Panda 1bp
B D            Horse 1bp

Alignment block 34 of 427 in window, 56737981 - 56737988, 8 bps 
B D             Mouse  gg-tttacc
B D               Rat  gg-cttacc
B D      Kangaroo rat  ga-ttcac-
B D    Naked mole-rat  ga-tttat-
B D        Guinea pig  ca-tttac-
B D          Squirrel  ta-tttatt
B D            Rabbit  ga-tttact
B D             Human  ga-tta---
B D             Chimp  ga-ttg---
B D           Gorilla  ga-ttgact
B D         Orangutan  ga-ttgact
B D            Gibbon  ga-ttgact
B D            Rhesus  ga-ttgatt
B D            Baboon  ga-ttcatt
B D          Marmoset  gt-ttgact
B D           Tarsier  ga-ttta-t
B D       Mouse lemur  gg-tttacg
B D          Bushbaby  gg-tttac-
B D        Tree shrew  ga-cttact
B D               Pig  gc-tttatt
B D            Alpaca  ga-tttact
B D           Dolphin  ga-tttact
B D               Cow  aa-tttaat
B D               Cat  gg-tttact
B D               Dog  ggttttaca
B D             Panda  gg-tttact
B D             Horse  ga-tttact
B D          Elephant  ga-tatact
B D           Manatee  ga-tttact
B D         Armadillo  ca-tgtatt
B D             Sloth  ca-tttact
B D   Squirrel monkey  =========
B D            Tenrec  =========
B D           Wallaby  =========
B D              Pika  =========
B D             Sheep  NNNNNNNNN
B D       Stickleback  =========
B D         Tetraodon  =========
B D              Fugu  =========
B D            Medaka  =========
B D      Atlantic cod  =========
B D      Nile tilapia  =========
B D         Zebrafish  =========
B D     X. tropicalis  =========
B D          Platypus  =========
B D            Turkey  =========
B D        Coelacanth  =========
B D   Tasmanian devil  =========
B D           Opossum  =========
B D            Lizard  =========
B D        Budgerigar  =========
B D       Zebra finch  =========
B D           Chicken  =========
B D    Painted turtle  =========
B D             Shrew  =========
  D  Little brown bat  =========
B D          Hedgehog  =========
B D           Megabat  =========

Alignment block 35 of 427 in window, 56737989 - 56737992, 4 bps 
B D             Mouse  tctc
B D               Rat  cctc
B D      Kangaroo rat  ---t
B D    Naked mole-rat  ---c
B D        Guinea pig  ---t
B D          Squirrel  gtta
B D            Rabbit  actt
B D             Human  -act
B D             Chimp  -act
B D           Gorilla  aact
B D         Orangutan  aact
B D            Gibbon  aact
B D            Rhesus  acct
B D            Baboon  acct
B D          Marmoset  acct
B D           Tarsier  gttt
B D       Mouse lemur  actc
B D          Bushbaby  -ctc
B D        Tree shrew  acct
B D               Pig  tctt
B D            Alpaca  actt
B D           Dolphin  actt
B D               Cow  actt
B D               Cat  gttt
B D               Dog  gctt
B D             Panda  gctt
B D             Horse  actt
B D          Elephant  acct
B D        Rock hyrax  acct
B D           Manatee  acct
B D         Armadillo  actt
B D             Sloth  actt
B D   Squirrel monkey  ====
B D            Tenrec  ====
B D           Wallaby  ====
B D              Pika  ====
B D             Sheep  NNNN
B D       Stickleback  ====
B D         Tetraodon  ====
B D              Fugu  ====
B D            Medaka  ====
B D      Atlantic cod  ====
B D      Nile tilapia  ====
B D         Zebrafish  ====
B D     X. tropicalis  ====
B D          Platypus  ====
B D            Turkey  ====
B D        Coelacanth  ====
B D   Tasmanian devil  ====
B D           Opossum  ====
B D            Lizard  ====
B D        Budgerigar  ====
B D       Zebra finch  ====
B D           Chicken  ====
B D    Painted turtle  ====
B D             Shrew  ====
  D  Little brown bat  ====
B D          Hedgehog  ====
B D           Megabat  ====

Alignment block 36 of 427 in window, 56737993 - 56738025, 33 bps 
B D             Mouse  acctaaattaactgaagt-aattttacagtgagt
B D               Rat  acctaaattaacccaagt-aattttacagtgagc
B D      Kangaroo rat  acttagattaagctatgtgaattttaatattaat
B D    Naked mole-rat  actta-atttacctacatggatttaaaaattatg
B D        Guinea pig  attta-atttacctacat-aatttaaaaattatg
B D          Squirrel  accttaattaacctatgt-aaattaaaaat----
B D            Rabbit  actttaactaatgtaaat-aaatttaaaatgtag
B D             Human  accctaattaacctaga-----ttaaaaattaat
B D             Chimp  accctaattaacctaga-----ttaaaaattaat
B D           Gorilla  accctaattaacctaga-----ttaaaaattaat
B D         Orangutan  accctaattaacctaga-----ttaaaaattaat
B D            Gibbon  accctaattaacctaga-----ttaaaaattaat
B D            Rhesus  accctaattaacctaga-----ttaaaaattaat
B D            Baboon  accctaattaacctaga-----ttaaaaattaat
B D          Marmoset  accctaattaacctaga-----taaaaaattaat
B D           Tarsier  gtcctaattaacctaggtgaatttaaacattgac
B D       Mouse lemur  atcctaatgaacctacgtgaatttaaaaattaat
B D          Bushbaby  a---------------gcgattgtgaacattaat
B D        Tree shrew  aaaccaatgaacctaaatgaatttaaaagttaat
B D               Pig  accctaactgacttaggtgaatttagaaattagt
B D            Alpaca  accctaattaacttaggtgaatttaaaaattaaa
B D           Dolphin  atcctaattaacttaggtgaatttaaaaattacc
B D             Sheep  accctaattaacttgggtaaattttaaaattact
B D               Cow  accctaattaacttaggtaaattttaaaattact
B D               Cat  accctaattaatgtaggtgaatttaaaaatgaat
B D               Dog  accctaattaacttctgtgaatttaaaaattgct
B D             Panda  accctagttaacttaggtgaatttaaaaattaat
B D             Horse  accgtaattaacataggtaaattaaaaaattaat
B D          Elephant  accctaattaactcaagtgaatttaaaaattaat
B D        Rock hyrax  actctaattaacct-----aatttaaaaattcat
B D           Manatee  accctaattaacctaagtgaatttaaaaattcat
B D         Armadillo  accctaattaaactaaatgaatttaaaaattaat
B D             Sloth  accctaattaaactaaatgaatttaaaaattaat
B D   Squirrel monkey  ==================================
B D            Tenrec  ==================================
B D           Wallaby  ==================================
B D              Pika  ==================================
B D       Stickleback  ==================================
B D         Tetraodon  ==================================
B D              Fugu  ==================================
B D            Medaka  ==================================
B D      Atlantic cod  ==================================
B D      Nile tilapia  ==================================
B D         Zebrafish  ==================================
B D     X. tropicalis  ==================================
B D          Platypus  ==================================
B D            Turkey  ==================================
B D        Coelacanth  ==================================
B D   Tasmanian devil  ==================================
B D           Opossum  ==================================
B D            Lizard  ==================================
B D        Budgerigar  ==================================
B D       Zebra finch  ==================================
B D           Chicken  ==================================
B D    Painted turtle  ==================================
B D             Shrew  ==================================
  D  Little brown bat  ==================================
B D          Hedgehog  ==================================
B D           Megabat  ==================================

Alignment block 37 of 427 in window, 56738026 - 56738090, 65 bps 
B D             Mouse  atcaacctaccatttgaactataac-cttatttttt---ccttgtg-agctcaa--ctgatttgt-----
B D               Rat  atcaatgtaccatttgaaatatagc-ctgacatttc---ccttgtg-agctcaa--ctgatttgg-----
B D      Kangaroo rat  gcttatgtaaaacttg----cttac-cttatcttcc-------atg-agctcaa----------------
B D    Naked mole-rat  atctaggcaaaacttaaaattcagc-ctcatatttt--tcttcttg-agctcaaaatttatttag-----
B D        Guinea pig  atcaaggcaaaacttaaaatttagg-ctaatatttt--tccttatg-agctcaaaatgtatttag-----
B D          Squirrel  atctaggcaaaaatgaaaatttaga-ctgacatttttttctctatg-agctcaaaatttccttag-----
B D            Rabbit  cactaggtaaaattta-attttagg-gtaacagttt--tccccagg-agctcacaatttatttag-----
B D             Human  atccaggtgaaatttaaattttagg-ccaacaattt-ttccttgtg-agttcaaaagttttttaa-----
B D             Chimp  atccaggtgaaatttaaattttagg-ccaacaattt-ttccttgtg-agttcaaaagttttttaa-----
B D           Gorilla  atccaggtgaaatttaaattttagg-ccaacgattt-ttccttgtg-agttcaacagttttttaa-----
B D         Orangutan  atccaggtgaaatttaaattttagg-ccaacaattt-ttccttgtg-agttcaaaagttttttaa-----
B D            Gibbon  atccaggtgaaatttaaattttagg-ccaacaattt-ttccttgtg-agttcaaaagttttttaa-----
B D            Rhesus  acccaggtgaaatttaaattttagg-ccgacaattt-ttccttgtg-agttcaaaacttatttaa-----
B D            Baboon  acccaggtgaaatttaaattttagg-ccgacaattt-ctccttgtg-agtttaaaacttatttaa-----
B D          Marmoset  atccaggtgaaatttaaattttagg-ctgaaaattt-ttccttgtg-agttcaaaacttatttaaaatat
B D           Tarsier  atatatgtgaaatttaaattttagg-ctaaaaattt-ttccctgtgtagttcaagttttatttag-----
B D       Mouse lemur  ttctaggtgacatttaaattttagg-ctgacaattt-ttccccctg-agtgcaaagtttgtttag-----
B D          Bushbaby  ttctagctgaaatttaaattttagg-ccagtag-tt-ttccccatg-agtacaacatttgtttag-----
B D        Tree shrew  --ctaggcaaaatttaaatttcaag-atgacaaatt-tcccctgtg-agtttgcaatttatttag-----
B D               Pig  atctaggtaaaatttaaattttagg-ctgattaatt-tccctcatg-aattcaaaatttatttag-----
B D            Alpaca  acctcagtaagatttaaattttaggtttgttaattt-ttccccatg-aattcagaatttatttag-----
B D           Dolphin  atctaggtaaaatttaaattttagg-ctgataattt-cccctcatg-aactcaaaatttatttac-----
B D             Sheep  atctatgtaagatttaaattttagg-ctgataactt-tcttttata-aactcaaaatgtatttag-----
B D               Cow  atctatataagatttaaattttagg-ctgataactt-tctttcata-aactcaaaacgtatttag-----
B D               Cat  atctacgtaaaatttaaattttagg-ctgataattt-ttcccca-g-agctcaaaatttatgtag-----
B D               Dog  atctaggtaaaatttaaattttagg-ctgacaattt--ccccca-g-agatcaaaatttatttag-----
B D             Panda  atccaggtaaaatttaaattttagg-ctgacaattt-cccccca-g-agctcaaaatttatttag-----
B D             Horse  atctaggtaaaatttaagttttagg-ctgacaattt-ttccccatg-agctcaaaatttattcag-----
  D  Little brown bat  atctaggtaatatttcaattttagg-ctgacgattt-tcctcat-g-agctcagaatttatttac-----
B D          Elephant  atctaggtaaaatttaaatattaag-ttgacatttt-t-ccccatg-agctaaaattttatttgg-----
B D        Rock hyrax  aactacctaaaatttaaactttaaa-atgacattat-t--tccaca-aactgacattttatttga-----
B D           Manatee  atctatgtaaaatttaaatgctaag-ttgacatttt-t-ccctatg-agctaaaattttatttgg-----
B D         Armadillo  gcctaagtaatatt-------tagg-ctgacacttt-t--------------------------------
B D             Sloth  gtctaggtaatatt-------tagg-ctgacaattt-t--------------------------------
B D   Squirrel monkey  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D              Pika  ======================================================================
B D       Stickleback  ======================================================================
B D         Tetraodon  ======================================================================
B D              Fugu  ======================================================================
B D            Medaka  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D          Hedgehog  ======================================================================
B D           Megabat  ======================================================================

                Mouse  --------------------------------aata-tga
                  Rat  --------------------------------agta-cga
         Kangaroo rat  ----------------------------------ta-tgg
       Naked mole-rat  --------------------------------aata-tga
           Guinea pig  --------------------------------aata-tga
             Squirrel  --------------------------------aata-tga
               Rabbit  --------------------------------aaaa-tga
                Human  ----------------------------------------
                Chimp  ----------------------------------------
              Gorilla  ----------------------------------------
            Orangutan  ----------------------------------------
               Gibbon  ----------------------------------------
               Rhesus  ----------------------------------------
               Baboon  ----------------------------------------
             Marmoset  aaaac-----------------------------------
              Tarsier  -----aatatgaag--------------------------
          Mouse lemur  --------------aatttgaaaa----------------
             Bushbaby  --------------aatatgaaac----------------
           Tree shrew  ------------------------aatatgaa--------
                  Pig  --------------------------------acta-tg-
               Alpaca  --------------------------------acta-tga
              Dolphin  --------------------------------acta-tga
                Sheep  --------------------------------acta-tga
                  Cow  --------------------------------ac---tga
                  Cat  --------------------------------aata-tga
                  Dog  --------------------------------aata-tga
                Panda  --------------------------------aaca-tga
                Horse  --------------------------------aata----
     Little brown bat  --------------------------------aaca-caa
             Elephant  --------------------------------gata-tta
           Rock hyrax  --------------------------------aata-tta
              Manatee  --------------------------------gcta-tta
            Armadillo  -----------------------------------a-tga
                Sloth  -----------------------------------attga
      Squirrel monkey  ========================================
               Tenrec  ========================================
              Wallaby  ========================================
                 Pika  ========================================
          Stickleback  ========================================
            Tetraodon  ========================================
                 Fugu  ========================================
               Medaka  ========================================
         Atlantic cod  ========================================
         Nile tilapia  ========================================
            Zebrafish  ========================================
        X. tropicalis  ========================================
             Platypus  ========================================
               Turkey  ========================================
           Coelacanth  ========================================
      Tasmanian devil  ========================================
              Opossum  ========================================
               Lizard  ========================================
           Budgerigar  ========================================
          Zebra finch  ========================================
              Chicken  ========================================
       Painted turtle  ========================================
                Shrew  ========================================
             Hedgehog  ========================================
              Megabat  ========================================

Inserts between block 37 and 38 in window
B D         Marmoset 1091bp

Alignment block 38 of 427 in window, 56738091 - 56738093, 3 bps 
B D             Mouse  aac--
B D               Rat  ga---
B D      Kangaroo rat  aa---
B D    Naked mole-rat  aa---
B D        Guinea pig  aa---
B D          Squirrel  aa---
B D            Rabbit  aa---
B D               Pig  -g---
B D            Alpaca  aa---
B D           Dolphin  aa---
B D             Sheep  aa---
B D               Cow  aa---
B D               Cat  aa---
B D               Dog  aa---
B D             Panda  ag---
  D  Little brown bat  at---
B D          Elephant  aa---
B D        Rock hyrax  aa---
B D           Manatee  aa---
B D         Armadillo  ac---
B D             Sloth  aa---
B D           Chicken  -a-cc
B D          Bushbaby  -----
B D            Rhesus  -----
B D         Orangutan  -----
B D   Squirrel monkey  =====
B D             Horse  -----
B D          Marmoset  =====
B D            Gibbon  -----
B D           Gorilla  -----
B D             Chimp  -----
B D             Human  -----
B D           Tarsier  -----
B D            Tenrec  =====
B D           Wallaby  =====
B D              Pika  =====
B D        Tree shrew  -----
B D       Stickleback  =====
B D         Tetraodon  =====
B D              Fugu  =====
B D            Medaka  =====
B D      Atlantic cod  =====
B D      Nile tilapia  =====
B D         Zebrafish  =====
B D     X. tropicalis  =====
B D          Platypus  =====
B D            Turkey  =====
B D        Coelacanth  =====
B D   Tasmanian devil  =====
B D           Opossum  =====
B D            Lizard  =====
B D        Budgerigar  =====
B D       Zebra finch  =====
B D    Painted turtle  =====
B D             Shrew  =====
B D            Baboon  -----
B D       Mouse lemur  -----
B D          Hedgehog  =====
B D           Megabat  =====

Alignment block 39 of 427 in window, 56738094 - 56738140, 47 bps 
B D             Mouse  ------aaaacaaaacaaagacaaacaaaacaacccaactccatgg------tt-ttggg-
B D               Rat  -------aaacgaaacaaaaacaaacaaacaaacccaactccatgg------tt-ttgag-
B D      Kangaroo rat  -------------------------------------atttcatct------tt-gttga-
B D    Naked mole-rat  -------------------------------------atttcaact------ttcccaag-
B D        Guinea pig  -------------------------------------atttcaact------t--ctaag-
B D          Squirrel  -------------------------------------acttctaat------tc-ttaat-
B D            Rabbit  -------------------------------------ttttcaa--------tt-ttatg-
B D             Human  -----------aatacaaag-----------------ctttcaact------ttcttgag-
B D             Chimp  -----------aatacaaag-----------------ctttcaact------ttcttgag-
B D           Gorilla  -----------aacacaaag-----------------ctttcaact------ttcttgag-
B D         Orangutan  -----------aatacaaag-----------------ctttcaact------ttcttgag-
B D            Gibbon  -----------aatacaaag-----------------ctttcaact------ttcttgag-
B D            Rhesus  -----------aatataaaa-----------------ctttcaact------ttctagag-
B D            Baboon  -----------aatataaaa-----------------ctttcaact------ttcttgag-
B D          Marmoset  -----------aagaaaaaa-----------------tcttacactagagtatcctaaag-
B D           Tarsier  -------------------------------------attccaact------ttcttgag-
B D       Mouse lemur  --------------------------------------ttttcact------ttcttgag-
B D          Bushbaby  --------------------------------------cttccact------ttcttgag-
B D        Tree shrew  -------------------c-----------------atttcaaat------ttctttaa-
B D               Pig  -------------------------------------atttcaact------ttcttgag-
B D            Alpaca  -------------------------------------acttcaact------ttcttaag-
B D           Dolphin  -------------------------------------atttcaact------tccttgag-
B D             Sheep  -------------------------------------atttcaact---------ttaag-
B D               Cow  -------------------------------------atttcaact---------ttgaa-
B D               Cat  -------------------------------------atttcaact------ttcttgag-
B D               Dog  -------------------------------------atttcaact------ttcttgag-
B D             Panda  -------------------------------------atttcaact------ttcttggg-
B D             Horse  -----------------------------------------caact------ttttggag-
  D  Little brown bat  -------------------------------------atttaaact------ttct-gag-
B D          Elephant  -------------------------------------atttcaact------gttatgag-
B D        Rock hyrax  -------------------------------------atttcaact------tttctgag-
B D           Manatee  -------------------------------------atttcaatt------tttatgag-
B D         Armadillo  -------------------------------------ctttcaact------tccctgag-
B D             Sloth  -------------------------------------ctttcagct------tccctgag-
B D           Chicken  acaaacaaacaaacaaaagc-----------------ataacaatg------cacttacat