Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 224 in window, 20728903 - 20728908, 6 bps 
B D                     Human  agcccc
B D                     Chimp  agcccc
B D                   Gorilla  agcccc
B D                 Orangutan  agcccc
B D                    Gibbon  agcctc
B D                    Rhesus  agcccc
B D       Crab-eating macaque  agcccc
B D                    Baboon  agcccc
B D              Green monkey  agcccc
B D                  Marmoset  agcccc
B D           Squirrel monkey  agctcc
B D                  Bushbaby  agttcc
           Chinese tree shrew  agcca-
B D                  Squirrel  agcccc
       Lesser Egyptian jerboa  agcccc
                 Prairie vole  ggtccc
B D           Chinese hamster  agtccc
               Golden hamster  agtccc
B D                     Mouse  actccc
B D                       Rat  actccg
B D            Naked mole-rat  agccca
B D                Guinea pig  agcctg
                   Chinchilla  agccca
             Brush-tailed rat  agcctg
B D                    Rabbit  ggctct
B D                      Pika  ggccct
B D                       Pig  agcccc
B D                    Alpaca  acccac
               Bactrian camel  acccac
B D                   Dolphin  agcccc
                 Killer whale  agcccc
             Tibetan antelope  agcccc
B D                       Cow  agcccc
B D                     Sheep  agcccc
B D                     Horse  cgcccc
B D          White rhinoceros  agcccc
B D                       Cat  agccgc
B D                   Ferret   -----c
B D                     Panda  -----c
               Pacific walrus  -----c
                 Weddell seal  -----c
             Black flying-fox  agcc--
B D                   Megabat  agcc--
                Big brown bat  agcccc
         David's myotis (bat)  agcccc
  D          Little brown bat  agcccc
B D                  Elephant  agctcc
          Cape elephant shrew  aacacc
B D                   Manatee  agcccc
             Cape golden mole  agtccc
B D                    Tenrec  aacccc
                     Aardvark  agtcct
B D                 Armadillo  ggtccc
B D                   Opossum  agc---
B D               Zebra finch  aacccg
B D        American alligator  aattca
B D                  Hedgehog  NNNNNN
B D                     Shrew  ======
B D                Coelacanth  ======
B D              Atlantic cod  ======
                 Spotted gar  ======
B D               Stickleback  ======
          Southern platyfish  ======
B D                      Fugu  ======
B D                 Tetraodon  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                    Medaka  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D           Green seaturtle  ======
B D                Budgerigar  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D                  Platypus  ======
             Star-nosed mole  ======
               Domestic goat  ------
B D                       Dog  ======

Alignment block 2 of 224 in window, 20728909 - 20728998, 90 bps 
B D                     Human  ttcctgaaccccccaacc----ccttg--------------------cagatcatgaaaaccagaac---
B D                     Chimp  ttcctgaaccccccaacc----ccttg--------------------cagatcatgaaaaccagaac---
B D                   Gorilla  ttcctgaaccccccaacc----ccttg--------------------cagatcatgaaaaccagaac---
B D                 Orangutan  ttcctgaaccccccaacc----ccttg--------------------cagatcatgaaaaccagaac---
B D                    Gibbon  ctcgtgaaccccccaacc----ccttg--------------------cagatcatgaaaaccagaac---
B D                    Rhesus  ttcctgaaccccccagtc----ccttg--------------------cagatcacgaaaaccagaac---
B D       Crab-eating macaque  ttcctgaaccccccagtc----ccttg--------------------cagatcacgaaaaccagaac---
B D                    Baboon  ttcctgaaccccccagtc----ccttg--------------------cagatcatgaaaaccagaac---
B D              Green monkey  ttcctgaaccccccagtc----ccttg--------------------cagatcatgaaaaccggaac---
B D                  Marmoset  ttcctgagccccccagcc----ccttg--------------------cagatcatgaaaaccagaac---
B D           Squirrel monkey  -tcctgagtctcccagcc----ccttg--------------------cagatcatgaaaaccagaac---
B D                  Bushbaby  tccacaaagaccccagct----ccttg--------------------cagatcatgaaaaccagaac---
           Chinese tree shrew  -tccaaggccct---gcc----ctttg--------------------cagagcag---------------
B D                  Squirrel  tt-------cccaaagca----cctggtca-----------c---attgagatcacaaacccagaac---
       Lesser Egyptian jerboa  ttcctaaaccccaaatcc----tgtcg--------------------cagaatctgaaaaacaacat--a
                 Prairie vole  ttcctgagtcccaaagccctttctttg--------------------cagggcaggaaaaccacgat---
B D           Chinese hamster  ttcttgaatcccaaagcc----ctttg--------------------cggggcatgaaaaccacaat---
               Golden hamster  ttcccgaatcccaaagcc----ctttg---------------------agggtatgaaaaccacaat---
B D                     Mouse  ttcctgaatcccaaagcc----ctctg--------------------cgcagtatgaaaaccacaac---
B D                       Rat  ttcctgaatcccaaagcc----cttgg--------------------cagagtatgaaacccacaac---
B D            Naked mole-rat  ttccctaagcccccaacc----ccttg--------------------tagatcatgaaaaccagaca---
B D                Guinea pig  ttccctcaacccccgacc----cctga--------------------tagctcatgaaagctggaca---
                   Chinchilla  tctcctaaagccccaacc----cct-t--------------------tagatcatgaaaaccagaca---
             Brush-tailed rat  ttccctaaatccccaatc----actgg--------------------tagcttctgaaaaccagaca---
B D                    Rabbit  ctccaga-------aacc----cacag--------------------cagaccat-aaacccagaac---
B D                      Pika  tcccag--------aact----caatg--------------------cagaccat-aaaatccgaac---
B D                       Pig  ----------------------------------------------------------------gac---
B D                    Alpaca  --------------------------------------------------tgcctgaagctcccaac---
               Bactrian camel  --------------------------------------------------tgcctgaagcccccaac---
B D                   Dolphin  --------------------------------------------------tgccagaagacccc-ac---
                 Killer whale  --------------------------------------------------tgccagaagacccc-ac---
             Tibetan antelope  --------------------------------------------------tgc-----------------
B D                       Cow  --------------------------------------------------tgcccaaagcgccc-ac---
B D                     Horse  --------------------------------------------------tgcccgaagcccccagc---
B D          White rhinoceros  --------------------------------------------------tacccgaag-ccccagc---
B D                       Cat  --------------------------------------------------tgcctgaagccccca-----
B D                   Ferret   --------------------------------------------------tgactgaa------------
B D                     Panda  --------------------------------------------------tgactgaagccccaa-----
               Pacific walrus  --------------------------------------------------tgactgaagccccca-----
                 Weddell seal  --------------------------------------------------tgactgaagccccca-----
             Black flying-fox  -------------------------------------------------------------ccag-----
B D                   Megabat  -------------------------------------------------------------ccag-----
                Big brown bat  --------------------------------------------------ttgcccgagccccca-----
         David's myotis (bat)  --------------------------------------------------ttgcccgagctccca-----
  D          Little brown bat  --------------------------------------------------ttgcccgagccccca-----
B D                  Elephant  ttttcaaagccccccaac----ccttg--------------------tgggtcttgaaaaccaaaac---
          Cape elephant shrew  tttctgaagccctcaacc----ctttt--------------------tgggtcttgaaaa----------
B D                   Manatee  tttccaaagcccccagcc----ccttg--------------------tgggtcttgaaaacaagaac---
             Cape golden mole  tttctggagcccctagta----ctgta--------------------aaggtcttgtaaaccagaaa---
B D                    Tenrec  tttcccaagcccccagt------ctcc--------------------agccctttgtcaatctggga---
                     Aardvark  ttttcaaagcccccagcc----ccttg--------------------tgggtcttgaaaatcagaac---
B D                 Armadillo  tttccccagcccacagt-------------------------------gggcgataaaacccagaac---
B D                   Opossum  ---------------------------ttt-----------ctagagcagatccttgaatgccaatc---
B D               Zebra finch  ----------------------------ctcctgtcccatcctgcaccttgcactgaggtcctccatcca
B D        American alligator  -----------------------------------------ttacagcaggcagcgaag--caccatggg
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ======================================================================
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
             Star-nosed mole  ======================================================================
               Domestic goat  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
B D                       Dog  ======================================================================

                        Human  -tcag-----------tcagacagtgcgc------tgatgc--ag-ac--aggatgtggggaagg-agg-
                        Chimp  -tcag-----------tcagacagtgcac------tgacgc--ag-ac--aggatgtggggaagg-agg-
                      Gorilla  -tcag-----------tcagacagtgcac------tgatgc--ag-ac--aggatgtgaggaagg-agg-
                    Orangutan  -tcag-----------tcagactgtgcgc------tgatgc--ag-ac--aggatgtgaggaagg-agg-
                       Gibbon  -tcag-----------tcagacagtgcgc------tgatgc--ag-ac--agggtgtggggaagg-agg-
                       Rhesus  -tcag-----------ccagacagtgcac------tgacgc--ag-ac--gggatgtggggaagg-agg-
          Crab-eating macaque  -tcag-----------ccagacagtgcac------tgacgc--ag-ac--gggatgtggggaagg-agg-
                       Baboon  -tcag-----------ccagacagtgcac------tgacgc--ag-ac--gggatgtggggaagg-agg-
                 Green monkey  -tcag-----------ccagacagtgcgc------tgacgc--ag-ac--aggatgtggggaagg-agg-
                     Marmoset  -tcag-----------ccagacagtgcac------tgatgc--ag-ac--aggatgtggggaagg-ag--
              Squirrel monkey  -tcag-----------ccagacagtgcgc------tgatgc--ag-ac--agggtgcgggtaagg-ag--
                     Bushbaby  -tcaa-----------ccacacagtgcac------ag-tgctaag-tt--gggatgtggaaaagg-tag-
           Chinese tree shrew  -----------------cggccactgtgc------tgaggc--tg-a-----------------------
                     Squirrel  -ccaa-----------tcaggccacgcac------tcaagc--tg-aatcaggacctggagaagg-tgg-
       Lesser Egyptian jerboa  cccag-----------ccacacagtgcac------ctatgt--ta-aa-------gtgaagaagg-cag-
                 Prairie vole  -ccac-----------gcaaatggggcac------cggtac--tt-att-gggatgtggagaaga-tgg-
              Chinese hamster  -ccac-----------ccaaatgatgcac------tggtac--tg-agt-gggatgcagaaaaga-tgg-
               Golden hamster  -ccac-----------ccaaatgatgtac------aggtac--ta-agt-aggatgcaaaaaaca-cag-
                        Mouse  -ccac-----------cccaaggaagagc------tggtgc--ta-agt-ggagtgcagagaaaa-tgg-
                          Rat  -cctt-----------gacaacgaagcgc------tggtgc--tg-agg-ggagtgcagagaaga-cgg-
               Naked mole-rat  -----------------------agtcac------tgatac--tg-attcaggatgtagagaagg-tag-
                   Guinea pig  -----------------------aggcac------ttatac--tg-agacaggatgtggagaact-----
                   Chinchilla  -----------------------aggcac------tggtac--tg-----aggatgtggagaagg-tag-
             Brush-tailed rat  -----------------------aggcac------tg--ag--tt-----aggatatgaagaagt-tag-
                       Rabbit  -cc-a-----------ccgaga-gtgcaa------tgacac--gg-catcggggtgtggagaagg-tgg-
                         Pika  -ccaa-----------ctgaac-ttacag------tcaccc--ag-tgtctgggtaaggagaagg-tggt
                          Pig  cccaa-----------ccagcctgcttgc------tggtgc--tg-agtccaggggc-------------
                       Alpaca  cccaa-----------ctagaccttgcac------ggatgc--tg-agtcgggaggtagggagga-tag-
               Bactrian camel  cccaa-----------ctagaccatgcac------agatgc--tg-agtcgggaggtagggagga-tag-
                      Dolphin  cccaa-----------ccagaccggacac------tgatgc--tg-aggcagggggtggggaggg-tgg-
                 Killer whale  cccaa-----------ccagaccggacac------tgatgc--tg-aggcagggggtggggaggg-tgg-
             Tibetan antelope  ----------------ccagagccggtac------tggtgc--tg-agtcagaggggagggaggg-cgg-
                          Cow  cccaa-----------ccagagccggtac------tggtgc--tg-agtcagaggggagggaggg-agg-
                        Horse  tgcaa-----------ccagac-gctcac------tgatgc--tg-agtcaggagggagggaggg-tgg-
             White rhinoceros  tccaa-----------ccagacagtgcac------tgatgc--tg-agtcaggaggaagggaagg-tgg-
                          Cat  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------ccagacagtgcac---caatgctgc--tg-agtcagcaggtaaggaagg-tgg-
                      Megabat  ----------------ccagacagtgcac---caatgctgc--tg-agtcaggaggtaaggaagg-tgg-
                Big brown bat  ----------------ccacgcagtgcac------tgatgc--tg-ggtcaggaggcaggggagg-tgg-
         David's myotis (bat)  ----------------ccata---------------gatgc--tg-agccaggaggcagggaagg-tgg-
             Little brown bat  ----------------ccacgcagtgcac------tgatgc--tg-agccaggaggcagggaagg-tgg-
                     Elephant  -caag-----------ccaggcagtgcac------tgatgc---a-agttagggtgtaaagaagg-cag-
          Cape elephant shrew  ----------------ccagacagtatgc------tgactt---g-aattagcatatagagaaag-ggg-
                      Manatee  -caag-----------ccagacagtgca--------gattc---g-agttagggtgtagagaaag-cgg-
             Cape golden mole  -caaa-----------ccagataatacac------tgatgc---a-agttagggtatagagaagg-aag-
                       Tenrec  -aaca-----------gcag-------gc------tgatat---g-agttaggataaagagaagg-tag-
                     Aardvark  -caaa-----------ccagacagcacac------tgatgt---g-agctagggtataaaga----tgg-
                    Armadillo  -caaa-----------ccagacagtgcac------tgatgc---acagtggggatgtggagaagg-tgg-
                      Opossum  -------------------caagggaagc------cagtga--tg-actccaaaggtggaggacgctgg-
                  Zebra finch  cccagggacagggggaccagagagtgcacggccacaggtgc-----------------------------
           American alligator  cccat-----------cccggaagtg--------------------------------------------
                     Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
              Green seaturtle  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
              Star-nosed mole  ======================================================================
                Domestic goat  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                          Dog  ======================================================================

                        Human  -----------ac
                        Chimp  -----------ac
                      Gorilla  -----------ac
                    Orangutan  -----------ac
                       Gibbon  -----------ac
                       Rhesus  -----------ac
          Crab-eating macaque  -----------ac
                       Baboon  -----------ac
                 Green monkey  -----------ac
                     Marmoset  -------------
              Squirrel monkey  -------------
                     Bushbaby  -----------ac
           Chinese tree shrew  -------------
                     Squirrel  -----------ac
       Lesser Egyptian jerboa  -----------ac
                 Prairie vole  -----------ac
              Chinese hamster  -----------ac
               Golden hamster  -----------ac
                        Mouse  -----------ac
                          Rat  -----------ac
               Naked mole-rat  -----------ac
                   Guinea pig  -------------
                   Chinchilla  -----------ac
             Brush-tailed rat  -----------aa
                       Rabbit  -----------ac
                         Pika  caacctcacacac
                          Pig  -----------ac
                       Alpaca  -----------ac
               Bactrian camel  -----------ac
                      Dolphin  -----------ac
                 Killer whale  -----------ac
             Tibetan antelope  -----------gc
                          Cow  -----------ac
                        Horse  -----------ac
             White rhinoceros  -----------ac
                          Cat  -------------
                      Ferret   -------------
                        Panda  -------------
               Pacific walrus  -------------
                 Weddell seal  -------------
             Black flying-fox  -----------ac
                      Megabat  -----------ac
                Big brown bat  -----------ac
         David's myotis (bat)  -----------ac
             Little brown bat  -----------ac
                     Elephant  -----------ac
          Cape elephant shrew  -----------tc
                      Manatee  -----------ac
             Cape golden mole  -----------tc
                       Tenrec  -----------ac
                     Aardvark  -----------ac
                    Armadillo  -----------ac
                      Opossum  -----------gc
                  Zebra finch  -------------
           American alligator  -------------
                     Hedgehog  NNNNNNNNNNNNN
                        Shrew  =============
                   Coelacanth  =============
                 Atlantic cod  =============
                  Spotted gar  =============
                  Stickleback  =============
           Southern platyfish  =============
                         Fugu  =============
                    Tetraodon  =============
                       Turkey  =============
                      Chicken  =============
                 Mallard duck  =============
           Tibetan ground jay  =============
       White-throated sparrow  =============
              Tasmanian devil  =============
     Mexican tetra (cavefish)  =============
                       Medaka  =============
          Pundamilia nyererei  =============
                  Zebra mbuna  =============
        Burton's mouthbreeder  =============
          Princess of Burundi  =============
                 Nile tilapia  =============
              Green seaturtle  =============
                   Budgerigar  =============
                  Rock pigeon  =============
          Collared flycatcher  =============
          Medium ground finch  =============
                       Lizard  =============
             Peregrine falcon  =============
                 Saker falcon  =============
                     Platypus  =============
              Star-nosed mole  =============
                Domestic goat  -------------
                        Sheep  -------------
                          Dog  =============

Inserts between block 2 and 3 in window
              Golden hamster 388bp
B D           Naked mole-rat 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp
B D                  Opossum 4bp

Alignment block 3 of 224 in window, 20728999 - 20729002, 4 bps 
B D                     Human  aac-t
B D                     Chimp  aac-t
B D                   Gorilla  aac-t
B D                 Orangutan  aac-t
B D                    Gibbon  aac-t
B D                    Rhesus  aac-t
B D       Crab-eating macaque  aac-t
B D                    Baboon  aac-t
B D              Green monkey  aac-t
B D                  Marmoset  aac-t
B D           Squirrel monkey  aac-t
B D                  Bushbaby  aac-t
B D                  Squirrel  aat-c
       Lesser Egyptian jerboa  agc-t
                 Prairie vole  agt-t
B D           Chinese hamster  agc-t
B D                     Mouse  aag-t
B D                       Rat  atg-g
B D                    Rabbit  -gg-c
B D                      Pika  -at-c
B D                       Pig  -aa-g
B D                    Alpaca  -aa-c
               Bactrian camel  -aa-t
B D                   Dolphin  -aa-c
                 Killer whale  -aa-c
B D                     Horse  -aa-c
B D          White rhinoceros  -aa-t
             Black flying-fox  -aa-t
B D                   Megabat  -aa-t
                Big brown bat  -ag-t
         David's myotis (bat)  -aa-t
  D          Little brown bat  -aa-t
B D                  Elephant  -aa-t
          Cape elephant shrew  -aa-t
B D                   Manatee  -aa-t
             Cape golden mole  -ag-t
B D                    Tenrec  -cg-g
                     Aardvark  -ca-t
B D                 Armadillo  -agct
B D                   Opossum  -ac-t
B D               Zebra finch  agc-t
B D        American alligator  agg-t
              Golden hamster  =====
                Weddell seal  -----
B D                  Hedgehog  NNNNN
B D                     Shrew  =====
B D                Guinea pig  -----
B D                Coelacanth  =====
B D              Atlantic cod  =====
                 Spotted gar  =====
B D               Stickleback  =====
          Southern platyfish  =====
B D                      Fugu  =====
B D                 Tetraodon  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
    Mexican tetra (cavefish)  =====
B D                    Medaka  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
  D           Green seaturtle  =====
B D                Budgerigar  =====
B D            Naked mole-rat  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
            Brush-tailed rat  =====
                  Chinchilla  =====
          Chinese tree shrew  -----
B D                  Platypus  =====
B D                       Cat  -----
B D                   Ferret   -----
             Star-nosed mole  =====
               Domestic goat  -----
B D                     Sheep  -----
            Tibetan antelope  -----
              Pacific walrus  -----
B D                     Panda  -----
B D                       Dog  =====
B D                       Cow  -----

Inserts between block 3 and 4 in window
B D                      Pig 3bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
            Black flying-fox 3bp
B D                  Megabat 3bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
  D         Little brown bat 1bp

Alignment block 4 of 224 in window, 20729003 - 20729030, 28 bps 
B D                     Human  gccctgg----g---------------ggctgagga--c---c-a---ccccccac
B D                     Chimp  gccctgg----g---------------ggctgagga--c---c-a---ccccccac
B D                   Gorilla  gccctgg----g---------------ggctgagga--c---c-a---ccccccac
B D                 Orangutan  gccccgg----g---------------ggctgagga--c---c-a-ccccccccac
B D                    Gibbon  gccctgg----g---------------ggctgagga--c---c-a--cctccccac
B D                    Rhesus  gccctgg----g---------------ggctgagga--c---c-accccctccaac
B D       Crab-eating macaque  gccctgg----g---------------ggctgagga--c---c-accccctccaac
B D                    Baboon  gccctgg----g---------------ggctgagga--c---c-accccctccaac
B D              Green monkey  gccctgg----g---------------ggctgagga--c---c-accccctccaac
B D                  Marmoset  gctctgg----g---------------ggctgaggc--g---c-a-cccaccccac
B D           Squirrel monkey  gccctgg----g---------------gactgagga--g---c-a-cccgccccac
B D                  Bushbaby  gcccttg----gg----------aagtggctgagaa--a---c-actgcccatgtc
           Chinese tree shrew  -----gg----a---------------gggtgtgac--g---c-a-----------
B D                  Squirrel  atcc-gg----g---------------ggctgcggc--g---c-atc---------
       Lesser Egyptian jerboa  gcccagc----a---------------agctgaggc--a---a-ggc---------
                 Prairie vole  gcccagg----a---------------gactgacaa--a---c-agc---------
B D           Chinese hamster  gcccagg----a---------------gactgacaa--a---t-gga---------
B D                     Mouse  acccagg----a---------------gattgacaa--a---c-tgc---------
B D                       Rat  gcccagg----a---------------gatggacaa--a---c-agc---------
B D                    Rabbit  acctggg----g---------------ggctgaggaatg---t-ggccccca----
B D                      Pika  cgcttgt----g---------------ggcagagaa--g---c-agcctccgcaa-
B D                       Pig  cctgggg----g---------------tgctgagga--g---c-act---------
B D                    Alpaca  cccagggaggag---------------gggtgagga--a---t-cct---------
               Bactrian camel  cccagggaggag---------------gggtgagga--a---t-cct---------
B D                   Dolphin  cccgggg----g---------------tgctgagga--g---t-cct---------
                 Killer whale  cccgggg----g---------------tgctgagga--g---t-cct---------
             Tibetan antelope  --------------------------------------------cca---------
B D                     Horse  cct--gg----g---------------ggctgagga--g---t-cct---------
B D          White rhinoceros  ccctggg----g---------------ggctgagcg--g---t-cct---------
B D                       Cat  --------------------------------gggg--g---c-ccc---------
B D                       Dog  ccc-agg----g---------------ggctgagga--g---c-cct---------
B D                   Ferret   ---------------------------------gga--g---c-cct---------
B D                     Panda  -----gg----g---------------ggctgagaa--g---c-cct---------
               Pacific walrus  -----gg----c---------------ggctgggga--g---c-cct---------
                 Weddell seal  -----gg----g---------------ggctgagga--g---c-cct---------
             Black flying-fox  cccaggg----g---------------ggctgaaga--g---c-ccc---------
B D                   Megabat  cccaggg----g---------------ggctgaaga--g---c-ccc---------
                Big brown bat  -cccggg----g---------------gactgagga--g---c-ccc---------
         David's myotis (bat)  -cccagg----g---------------gactgagga--g---c-ccc---------
  D          Little brown bat  -cccggg----g---------------gactgcggg--g---c-ccc---------
B D                  Elephant  ------------gcccctgaggaggggtgctgaggg--g---c-ccc---------
          Cape elephant shrew  ------------agcccaggagagggaggctgagag--g---tgccc---------
B D                   Manatee  ------------gc------------------------------ccc---------
             Cape golden mole  ------------gtcct---agagaggagctgaagg--aaccc-ctc---------
B D                    Tenrec  ------------g--------gagggagactgagag--g---c-ccc---------
                     Aardvark  ------------g-----------------------------c-ccc---------
B D                 Armadillo  ------------gccatgggggggggatgctgagga--g---c-ccc---------
B D                   Opossum  -------------------ggagggagggttgggga--g---c-gcc---------
B D               Zebra finch  ------------------------cctggttcagca--c-----------------
B D        American alligator  ------------------------cctgccccacaa--t-----------------
              Golden hamster  ========================================================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ========================================================
B D                Guinea pig  --------------------------------------------------------
B D                Coelacanth  ========================================================
B D              Atlantic cod  ========================================================
                 Spotted gar  ========================================================
B D               Stickleback  ========================================================
          Southern platyfish  ========================================================
B D                      Fugu  ========================================================
B D                 Tetraodon  ========================================================
B D                    Turkey  ========================================================
B D                   Chicken  ========================================================
  D              Mallard duck  ========================================================
          Tibetan ground jay  ========================================================
  D    White-throated sparrow  ========================================================
B D           Tasmanian devil  ========================================================
    Mexican tetra (cavefish)  ========================================================
B D                    Medaka  ========================================================
         Pundamilia nyererei  ========================================================
                 Zebra mbuna  ========================================================
       Burton's mouthbreeder  ========================================================
         Princess of Burundi  ========================================================
B D              Nile tilapia  ========================================================
  D           Green seaturtle  ========================================================
B D                Budgerigar  ========================================================
B D            Naked mole-rat  ========================================================
  D               Rock pigeon  ========================================================
  D       Collared flycatcher  ========================================================
B D       Medium ground finch  ========================================================
B D                    Lizard  ========================================================
  D          Peregrine falcon  ========================================================
  D              Saker falcon  ========================================================
            Brush-tailed rat  ========================================================
                  Chinchilla  ========================================================
B D                  Platypus  ========================================================
             Star-nosed mole  ========================================================
               Domestic goat  --------------------------------------------------------
B D                     Sheep  --------------------------------------------------------
B D                       Cow  --------------------------------------------------------

Inserts between block 4 and 5 in window
B D                      Pig 3bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 2bp
B D                    Horse 5bp
B D         White rhinoceros 5bp
B D                      Cat 5bp
B D                      Dog 4bp
B D                  Ferret  5bp
B D                    Panda 5bp
              Pacific walrus 5bp
                Weddell seal 5bp
            Black flying-fox 4bp
B D                  Megabat 4bp
               Big brown bat 4bp
        David's myotis (bat) 4bp
  D         Little brown bat 4bp
B D                 Elephant 3bp
         Cape elephant shrew 3bp
B D                  Manatee 3bp
            Cape golden mole 3bp
B D                   Tenrec 3bp
                    Aardvark 3bp
B D                Armadillo 3bp
B D                  Opossum 5bp

Alignment block 5 of 224 in window, 20729031 - 20729033, 3 bps 
B D                     Human  cgt
B D                     Chimp  cgt
B D                   Gorilla  cgt
B D                 Orangutan  cgt
B D                    Gibbon  cgt
B D                    Rhesus  tgc
B D       Crab-eating macaque  tgc
B D                    Baboon  tgc
B D              Green monkey  tgc
B D                  Marmoset  cac
B D           Squirrel monkey  cac
B D                  Bushbaby  ccc
B D                      Pika  -gc
              Star-nosed mole  cat
B D                  Elephant  -gt
          Cape elephant shrew  -aa
B D                   Manatee  -gc
             Cape golden mole  -gc
B D                    Tenrec  -gc
                     Aardvark  -gc
B D                 Armadillo  -gc
B D                   Opossum  gg-
B D               Zebra finch  agc
B D        American alligator  ggc
B D                       Rat  ---
                Prairie vole  ---
              Golden hamster  ===
B D                     Mouse  ---
      Lesser Egyptian jerboa  ---
                Weddell seal  ===
B D                  Hedgehog  NNN
B D                     Shrew  ===
B D                Guinea pig  ---
B D                       Pig  ===
B D                    Rabbit  ---
B D                Coelacanth  ===
B D                   Megabat  ===
B D                   Dolphin  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
B D                      Fugu  ===
B D                 Tetraodon  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D           Green seaturtle  ===
B D                Budgerigar  ===
B D            Naked mole-rat  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
            Brush-tailed rat  ===
                  Chinchilla  ===
          Chinese tree shrew  ---
B D                  Platypus  ===
B D           Chinese hamster  ---
B D                       Cat  ===
B D                   Ferret   ===
               Domestic goat  ---
B D                     Sheep  ---
            Tibetan antelope  ===
              Bactrian camel  ===
B D                    Alpaca  ===
              Pacific walrus  ===
B D                     Panda  ===
                Killer whale  ===
B D                       Dog  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D                  Squirrel  ---
        David's myotis (bat)  ===
               Big brown bat  ===
  D          Little brown bat  ===
B D                       Cow  ---

Inserts between block 5 and 6 in window
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 6 of 224 in window, 20729034 - 20729044, 11 bps 
B D                     Human  ccag-ccc--agcc
B D                     Chimp  ccag-ccc--agcc
B D                   Gorilla  ccag-ccc--agcc
B D                 Orangutan  ccag-ccc--agca
B D                    Gibbon  ccag-ccc--agcc
B D                    Rhesus  tcag-ccc--agcc
B D       Crab-eating macaque  tcag-ccc--agcc
B D                    Baboon  gcag-ccc--agcc
B D              Green monkey  ccag-ccc--agtc
B D                  Marmoset  ccag-ccc--accc
B D           Squirrel monkey  gcag-ccc--accc
B D                  Bushbaby  ccag-cct--agct
B D                  Squirrel  --ac-cct--cttc
       Lesser Egyptian jerboa  --ag-cct--tgcc
                 Prairie vole  --ac-tcc--tgct
B D           Chinese hamster  --ac-tcc--tgct
B D                     Mouse  --at-tcc--gtcc
B D                       Rat  --ac-tcc--tgcc
B D                    Rabbit  --gt-ccc--agcc
B D                      Pika  atcc-tcc--agcc
B D                       Pig  ccag-ccc--aggc
B D                    Alpaca  ccag-ccc--a---
               Bactrian camel  ccag-ccc--a---
B D                   Dolphin  ccag-ccc--accc
                 Killer whale  ccag-ccc--accc
             Tibetan antelope  ccag-ccc--agcc
B D                       Cow  ccgg-ccc--aacc
                Domestic goat  ------cc--agcc
B D                     Horse  ccca-ccc--agcc
B D          White rhinoceros  ccag-ccc--agcc
B D                       Cat  ccaa-tcc--agcc
B D                       Dog  ccga-ctc--agcc
B D                   Ferret   ccaa-ccc--agcc
B D                     Panda  ccaa-cct--ggcc
               Pacific walrus  ccaa-ccc--ggcc
                 Weddell seal  ccaa-ccc--agcc
             Black flying-fox  ccaacccc--agcc
B D                   Megabat  ccaacccc--aggc
                Big brown bat  ccaa-ccc--agcc
         David's myotis (bat)  ccaa-ccc--agcc
  D          Little brown bat  ccaa-ccc--agcc
              Star-nosed mole  ctgg-ccc--agcc
B D                  Elephant  -------c--aggt
          Cape elephant shrew  -------c--aggc
B D                   Manatee  -------c--aggc
             Cape golden mole  -------a--aagc
                     Aardvark  -------c--aggc
B D                 Armadillo  -------c--acac
B D                   Opossum  ------cc--aacc
B D               Zebra finch  -----tcaggagcc
B D        American alligator  -----ctc--agcc
              Golden hamster  ==============
B D                  Hedgehog  NNNNNNNNNNNNNN
B D                     Shrew  ==============
B D                Guinea pig  --------------
B D                Coelacanth  ==============
B D              Atlantic cod  ==============
                 Spotted gar  ==============
B D               Stickleback  ==============
          Southern platyfish  ==============
B D                      Fugu  ==============
B D                 Tetraodon  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
  D              Mallard duck  ==============
          Tibetan ground jay  ==============
  D    White-throated sparrow  ==============
B D           Tasmanian devil  ==============
    Mexican tetra (cavefish)  ==============
B D                    Medaka  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
  D           Green seaturtle  ==============
B D                Budgerigar  ==============
B D            Naked mole-rat  ==============
  D               Rock pigeon  ==============
  D       Collared flycatcher  ==============
B D       Medium ground finch  ==============
B D                    Lizard  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
            Brush-tailed rat  ==============
                  Chinchilla  ==============
          Chinese tree shrew  --------------
B D                  Platypus  ==============
B D                    Tenrec  --------------
B D                     Sheep  --------------

Inserts between block 6 and 7 in window
B D                 Squirrel 7bp
      Lesser Egyptian jerboa 6bp
                Prairie vole 8bp
B D          Chinese hamster 8bp
B D                    Mouse 7bp
B D                      Rat 7bp
B D                   Rabbit 65bp
B D                     Pika 5bp
B D                      Pig 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
               Domestic goat 3bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
  D         Little brown bat 2bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 4bp
            Cape golden mole 6bp
                    Aardvark 1bp
B D                Armadillo 6bp
B D                  Opossum 5bp

Alignment block 7 of 224 in window, 20729045 - 20729045, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  g
B D                      Pika  a
B D                   Manatee  a
             Cape golden mole  g
B D                 Armadillo  a
B D                   Opossum  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
                Weddell seal  =
B D                  Hedgehog  N
B D                     Shrew  =
B D                Guinea pig  -
B D                       Pig  =
B D                    Rabbit  =
                    Aardvark  =
B D                Coelacanth  =
B D                   Megabat  =
B D                   Dolphin  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  -
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D           Green seaturtle  =
B D        American alligator  -
B D                Budgerigar  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
          Chinese tree shrew  -
B D                  Platypus  =
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  -
B D                       Cat  =
B D                   Ferret   =
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  -
            Tibetan antelope  =
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
        David's myotis (bat)  =
               Big brown bat  =
  D          Little brown bat  =
B D                       Cow  =

Alignment block 8 of 224 in window, 20729046 - 20729046, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
  D          Little brown bat  g
              Star-nosed mole  a
B D                   Manatee  t
             Cape golden mole  g
B D                 Armadillo  g
B D                   Opossum  g
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                  Hedgehog  N
B D                     Shrew  =
B D                Guinea pig  -
B D                    Rabbit  =
                    Aardvark  =
B D                Coelacanth  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  -
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D           Green seaturtle  =
B D        American alligator  -
B D                Budgerigar  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
          Chinese tree shrew  -
B D                  Platypus  =
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  -
               Domestic goat  =
B D                  Squirrel  =

Inserts between block 8 and 9 in window
B D                     Pika 416bp
B D                  Opossum 1bp

Alignment block 9 of 224 in window, 20729047 - 20729069, 23 bps 
B D                     Human  g--ttctg-gtct-----------ttc-----ctggga-cccc
B D                     Chimp  g--ttctg-gtct-----------ttc-----ctggga-cccc
B D                   Gorilla  g--ttctg-gtct-----------ttc-----ctggga-cccc
B D                 Orangutan  g--ttctg-gtct-----------ttc-----ctggga-cccc
B D                    Gibbon  g--ttctg-gtct-----------ttc-----ctggga-cccc
B D                    Rhesus  g--ctctg-gtct-----------ttc-----ctggga-cccc
B D       Crab-eating macaque  g--ctctg-gtct-----------ttc-----ctggga-cccc
B D                    Baboon  g--ctctg-gtct-----------ttc-----ctggga-cccc
B D              Green monkey  g--ctctg-gtct-----------ttc-----ctggga-cccc
B D                  Marmoset  g--ttcta-gtct-----------ttc-----ttaggg-tccc
B D           Squirrel monkey  g--ttcta-gtct-----------ttc-----ctaggg-tccc
B D                  Bushbaby  g--ttctg-gtc------------ttc-----ctggaa-ccct
           Chinese tree shrew  g--ctcc---tct-----------gtc-----ctggga--cct
B D                  Squirrel  aggttctg-gtct-----------ttc-----cttggg-ctca
       Lesser Egyptian jerboa  a--gtctg-atct-----------ttc-------tgggaactc
                 Prairie vole  g--ttgtg-tttt-----------ttc-------tggg-accc
B D           Chinese hamster  a--ttttgttttt-----------ttc-------tggg-accc
B D                     Mouse  gatttttg-tttttgttcccccccccc-------cggg-acct
B D                       Rat  g--ttttg-gttt-----------ccc-------tggg-accc
B D            Naked mole-rat  g--ccctg-ctcc-----------ctc-----ctggga-gccc
B D                Guinea pig  ---cccag-ctcc-----------ttc-----ctggga-gccc
                   Chinchilla  g--ccctg-ctcc-----------ttc-----c-ggga-gccc
             Brush-tailed rat  g--ccctg-ctcc-----------ttc-----ctggga-gtcc
B D                       Pig  g--ctctg-gtcc-----------ctc-----cgggag-cccc
B D                    Alpaca  g--ctgtg-gtct-----------ttc-----ctgtgg-cccc
               Bactrian camel  g--ctgtg-gtct-----------ttc-----ctgtgg-cccc
B D                   Dolphin  c--ctctg-gtct-----------ttc-----ctgggg-cccc
                 Killer whale  g--ctctg-gtct-----------ttc-----ctgggg-cccc
             Tibetan antelope  g--cgctg-gtct-----------ttc-----ccaga------
B D                       Cow  g--cgcta-gtct-----------ttc-----ctgga------
B D                     Sheep  g--cgctg-gtct-----------ttc-----ccaga------
                Domestic goat  g--cgctg-gtct-----------ttc-----ccaga------
B D                     Horse  g--ttctg-gtct-----------ttc-----cc-ggg-cccg
B D          White rhinoceros  g--ttctg-gtct-----------ttt-----ctgggg-cccc
B D                       Cat  g--ttttg-gtct-----------ttc-----ctgggg-cccc
B D                       Dog  g--ttttg-gtgt-----------ttc-----atgggg-cccc
B D                   Ferret   g--ttttg-gtct-----------ttc-----gtgggg-cccc
B D                     Panda  g--ttttg-gtct-----------ttc-----gtgggg-cccc
               Pacific walrus  g--ttttg-gtct-----------ttt-----gtgggg-cccc
                 Weddell seal  g--ttttg-gtct-----------ttt-----gtgggg-cccc
             Black flying-fox  g--gtctg-gtct-----------ttc-----ctgggg-tctc
B D                   Megabat  g--ttctg-gtct-----------ttc-----ctgggg-tctc
                Big brown bat  g--ttctg-gtct-----------ctc-----ctgggg-tccc
         David's myotis (bat)  g--ttctg-gtct-----------ctc-----ctgggg-tccc
  D          Little brown bat  g--ttctg-gtct-----------ctc-----ctgggg-tccc
              Star-nosed mole  g--gtcgg-gtct-----------tcc-----ctgggg-ccc-
B D                  Elephant  -----ctc-atgc-----------ttc-----ctggag-tccc
          Cape elephant shrew  ------tt-atgt-----------tgt-----ctggag-ccac
B D                   Manatee  g--ctctc-atgc-----------ttc-----ctgggg-tccc
             Cape golden mole  g--ctctc-atgt-----------ttt-----ctgggg-tccc
B D                    Tenrec  -----ctc-atgt-----------ttc-----ctggag-tcgt
                     Aardvark  -----ctc-atgt-----------ttc-----ctgggg-tcc-
B D                 Armadillo  g--ctctc-atct-----------ctc-----ctgggc-ctcc
B D                   Opossum  g--caggg-cacc-----------tgc-----caagca-cct-
B D               Zebra finch  -----------ct-----------ttc-----ctgggc-gctc
B D        American alligator  -----------ct-----------tccttcatctgtga-gctc
              Golden hamster  ===========================================
B D                      Pika  ===========================================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ===========================================
B D                    Rabbit  ===========================================
B D                Coelacanth  ===========================================
B D              Atlantic cod  ===========================================
                 Spotted gar  ===========================================
B D               Stickleback  ===========================================
          Southern platyfish  ===========================================
B D                      Fugu  ===========================================
B D                 Tetraodon  ===========================================
B D                    Turkey  ===========================================
B D                   Chicken  ===========================================
  D              Mallard duck  ===========================================
          Tibetan ground jay  ===========================================
  D    White-throated sparrow  ===========================================
B D           Tasmanian devil  ===========================================
    Mexican tetra (cavefish)  ===========================================
B D                    Medaka  ===========================================
         Pundamilia nyererei  ===========================================
                 Zebra mbuna  ===========================================
       Burton's mouthbreeder  ===========================================
         Princess of Burundi  ===========================================
B D              Nile tilapia  ===========================================
  D           Green seaturtle  ===========================================
B D                Budgerigar  ===========================================
  D               Rock pigeon  ===========================================
  D       Collared flycatcher  ===========================================
B D       Medium ground finch  ===========================================
B D                    Lizard  ===========================================
  D          Peregrine falcon  ===========================================
  D              Saker falcon  ===========================================
B D                  Platypus  ===========================================

Inserts between block 9 and 10 in window
B D                 Elephant 10bp
         Cape elephant shrew 10bp
B D                  Manatee 10bp
            Cape golden mole 10bp
B D                   Tenrec 6bp
                    Aardvark 1bp
B D                Armadillo 11bp

Alignment block 10 of 224 in window, 20729070 - 20729173, 104 bps 
B D                     Human  tctccc----------acatcca-g----------tcgtg----gaaga-ga--ggag---tgg----ac
B D                     Chimp  tctccc----------acatcca-g----------tcgtg----gaaga-ga--ggag---tgg----ac
B D                   Gorilla  tctccc----------acatcca-g----------tcgtg----gaaga-ga--ggag---tgg----ac
B D                 Orangutan  tctccc----------acatcca-g----------tcgtg----gaagg-ga--ggag---tgg----ac
B D                    Gibbon  tctccc----------acatcca-g----------tagtg----gaaga-ga--ggag---tgg----ac
B D                    Rhesus  tctccc----------acatcca-g----------tcgtg----gaa---ga--ggag---tgg----ac
B D       Crab-eating macaque  tctccc----------acatcca-g----------tcgtg----gaa---ga--ggag---tgg----ac
B D                    Baboon  tctccc----------acatcca-g----------tcgtg----gaa---ga--ggag---tgg----ac
B D              Green monkey  tctccc----------acatcca-g----------tcgtg----gaa---ga--ggag---tgg----ac
B D                  Marmoset  tctctc----------atatcca-g----------tcgtg----gaaga-ga--ggag---tgg----ac
B D           Squirrel monkey  tctccc----------atatcca-g----------tcatg----aaaga-ga--ggtg---tgg----ac
B D                  Bushbaby  tctccc----------agatcca-c----------tagta----gagga-gt--ggga---tgggggaag
           Chinese tree shrew  gcttcc----------gggccca-c----------gggtg----------gt--ggac---agg----ag
B D                  Squirrel  cggccc----------agatcca-c----------tagtg----ggca--gcaaagta----------ac
       Lesser Egyptian jerboa  ttgctc----------agaccca-ctgggtgtatgggggg----gggt--ac--tgtg----------cc
                 Prairie vole  ctggcc----------agaccca-t----------ggggg----gggg--ga--ggtg------------
B D           Chinese hamster  ttggcc----------agatcca-t----------ggggg----tggg------ggtg------------
B D                     Mouse  ttagcc----------agatcca-g----------aggtg----gagg--ac------------------
B D                       Rat  ttagcc----------agatgca-c----------aggtg----gaag--ac------------------
B D            Naked mole-rat  ctgccc----------ggattca-c----------tagtg----ctga--ca--gggg---gag----ac
B D                Guinea pig  ctgggc--------------cat-c----------cagc-----agga--ta--ggag---gcg----ac
                   Chinchilla  ctgccc----------------a-c----------tagtg----agga--ta--ggaa---gac----ac
             Brush-tailed rat  ctgtatgctccttcctgg--aag-c----------tagtg----agga--ca--ggag----------at
B D                       Pig  tctccc----------agatcca-t----------cggtg----gagga-ga--ggaa---gaa----ac
B D                   Dolphin  tctccc----------agatcca-c----------cagag----ggggaaga--ggag---gaa----ag
                 Killer whale  tctccc----------agatcca-c----------cagag----ggggaaga--ggag---gaa----ag
             Tibetan antelope  tctccc----------ggacctc-t----------cagca----gagga------gag---aga----cg
B D                       Cow  tctccc----------ggacctc-c----------cagcg----gagga-ga--ggag---gga----cg
B D                     Sheep  tctccc----------ggacctc-t----------cagcg----gagaa-ga--ggag---gga----cg
                Domestic goat  tctccc----------ggacctc-t----------cagcg----gagga-ga--ggag---gga----cg
B D                     Horse  tctccc----------agttcca-c----------tggtg----gagga-ga--ggag---gaa----g-
B D          White rhinoceros  tctccc----------agaccca-c----------tact-----gagga-ga--ggag---aaa----ac
B D                       Cat  tctccc----------agagcca-c----------cagtg----gag----a--aaag---gaa----ac
B D                       Dog  tctctc----------agatcca-t----------tcctg----gag-------agaa---gaa----ac
B D                   Ferret   tttccc----------aaatcca-c----------tagtg----gagga-ga--gaag---gaa----ac
B D                     Panda  cttccc----------agatcca-c----------tagta----gaaga-ga--ggag---gaa----ac
               Pacific walrus  tttccc----------agatcca-c----------tagtg----gaaga-ga--gaag---gaa----ac
                 Weddell seal  tttccc----------agatcca-c----------taggg----gagga-ga--gaag---gaa----ac
             Black flying-fox  tgtccc----------agatcta-c----------taatg----gagga-ga--gaag---gaa----cc
B D                   Megabat  tgtccc----------agatcta-c----------taatg----gagga-ga--gaag---gaa----cc
                Big brown bat  tctccc----------agatcca-c----------ccgtg----gagga-ga--ggag---gaa----ac
         David's myotis (bat)  tctccc----------agatcca-c----------caggg----gagga-ga--ggag---gaa------
  D          Little brown bat  tctccc----------agatcca-c----------cagtg----gagga-ga--ggag---gaa----ac
              Star-nosed mole  tctccc----------aggtcca-c----------tagag----aaggg-aa--aggg---gaa----gg
B D                  Elephant  ccttcc----------aca-cca-c--------tacagtg----gatga-ga--ggag---caa----ac
          Cape elephant shrew  cctcac----------aaacccg-t--------tacagtg----aagga-ga--gaaa---caa----ac
B D                   Manatee  cctccc----------acaccca-c--------tatagtggacagacaa-gt--ggag---caa----ac
             Cape golden mole  cctcct----------agaccca-c--------tacagtg----cagga-ga--ggag---caa----ac
B D                    Tenrec  accccc----------agccccagc--------ctcgacc----cagga-ga--agagacacaa----at
                     Aardvark  cctcct----------agacaca-c--------tacagtg----gagga-ga--ggag---caa----ac
B D                 Armadillo  ggtccc----------agatcca-c------------------------------------gga----ac
B D                   Opossum  ----cc----------tagcttg-t----------tggca----ggcca-ga--gcag----------gt
B D               Zebra finch  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
              Golden hamster  ======================================================================
B D                      Pika  ======================================================================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ======================================================================
B D                    Rabbit  ======================================================================
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------

                        Human  c-----cc-ccttag-gtga--------ctgtcctcaagggcaggg--aacacac-tattt---ccca-t
                        Chimp  c-----cc-ccttag-gtga--------ctgtcctcaagggcaggg--aacacac-tattt---ccca-t
                      Gorilla  c-----cc-ccttag-gtga--------ctgtcctcaagggcaggg--aacacac-tattt---ccca-t
                    Orangutan  c-----cc-ccttag-gtga--------ctgtcctcaagggcaggg--aacacac-tattt---ccca-t
                       Gibbon  c-----cc-ccttag-gtga--------ctgtcctcaaggacaggg--aacacac-tattt---ccca-t
                       Rhesus  c-----cc-ccttag-gcga--------ttgtcctcaagggcaggg--agcacac-tattt---ccca-t
          Crab-eating macaque  c-----cc-ccttag-gcga--------ttgtcctcaagggcaggg--agcacac-tattt---ccca-t
                       Baboon  c-----cc-ccttag-gcga--------ttgtcctcaagggcaggg--agcacac-tattt---ccca-t
                 Green monkey  c-----cc-ccttag-gcga--------ttgtcctcaagggcaggg--agcacac-tattt---ccca-t
                     Marmoset  c-----cctccttag-gtga--------ctgtcctcaagggcaggg--aacacac-cattt---ccca-t
              Squirrel monkey  c-----c--ccttag-gtga--------ctgtcctcaagggcaggg--aacacac-cattt---ccca-t
                     Bushbaby  g-----tc-tttcaa---ga--------ttgtcct---------------------tatta---ccca-t
           Chinese tree shrew  c-----cc-ccttcc-caga--------ctgtcttcacatgcagggacagagctc-tgcct---caca-c
                     Squirrel  t-----tc-ccttac-caga--------ctgctc------aaggga--cagtacc-tgttt---ccca-t
       Lesser Egyptian jerboa  c-----tc-ctcaa---ggg--------c------------aagca--gaatgtt-tatcc---ccca-c
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  t-----tc-ccttgt-tgga--------tagtcctcaagggcaagg--a-gcatt-tactc---cccc-t
                   Guinea pig  t-----tc-ccttct-gagc--------cagttttcagggacaggg--g--------actc---ccct-t
                   Chinchilla  t-----tc-ccttct-gaaa--------tggtcctcaagggcgggg--gagcatt-tactc---ccgt-t
             Brush-tailed rat  t-----tc-ccttcc-gaga--------cagccctcaagggcaggg--gagcact-tactc---tcct-t
                          Pig  c-----tg-ccctct--aga--------ctgcgctcaggggcagga--agagcactcacgc---tcca-t
                      Dolphin  c-----tg-ccttct--aga--------ccgtcctcaagagcaggg--agagcacttactc---cccg-t
                 Killer whale  c-----tg-ccttct--aga--------ccgtcctcaagggcaggg--agagcacttactc---cccg-t
             Tibetan antelope  c-----tg-ccttcc--aga--------ctgtcctcaggggcaggg--agggtgcgtccttc--cccc-t
                          Cow  c-----tg-ccttcc--aga--------ctgttctcaggggcaggg--agggggcgtcctgc--cccc-t
                        Sheep  c-----tg-ccttcc--aga--------ctgtcctc-ggggcaggg--agggcgcgtcctt---cccc-t
                Domestic goat  c-----tg-ccttcc--aga--------ctgtcctcaggggcaggg--agggcgcgtccttc--cccc-t
                        Horse  c-----tc-cctcac--aga--------ctgtcctcaagggcaggg--agagcccttcctc---cc----
             White rhinoceros  c-----tc-ccttat--agg--------ctgtcctcaagggcaggg---gagcgctttctc---ccca-t
                          Cat  c-----tc-tcttacttaga--------ctgtcctcaaggaccagg--agagtgctcactc---ccc--c
                          Dog  c-----tc-cccgac-taga--------ccatcctcaag-----gg--agagcgctcagtt---cccc-t
                      Ferret   c-----tc-ccttac-taga--------ccaccctcaagtacaggg--agagcgctcactc---cccatt
                        Panda  c-----tc-ccttac-taga--------ctgtcctcaaggacaggg--ataacgctcattc---ccca-t
               Pacific walrus  c-----tc-tcttac-taga-------------ctcaaggacaagg--atagcgctcactc---ccca-t
                 Weddell seal  c-----tc-tcttac-tgga--------ctgtcctcaaggacaggg--atagcgctcactc---ccca-t
             Black flying-fox  cctctacc-ccttac-taga--------ctgtcctcaatggcaggg--agaaggtttactc---ccca-t
                      Megabat  cctctacc-ccttac-taga--------ctgtcctcaatggcaggg--agaaggtttactc---ccca-t
                Big brown bat  c-----cc-cgggag-ggga------------cccccggggggagg--agagcgctcactc---ccca-c
         David's myotis (bat)  c-----cc-ccggag-ggga--------ctgtcctcccgggc--ag--agagcactcactc---ccca-c
             Little brown bat  c-----cc-ccggag-ggga--------ctgtcctccccagcagag--agagcgctcact----ccca-c
              Star-nosed mole  c---------cttgc-tacg--------ctgtccgt--gggcaggg-----gcacacatcc---ctcc-t
                     Elephant  c-----tc-tcttac-taga---------tgtcctcaagggcaagg--agaacacatcctc---ccca-g
          Cape elephant shrew  c-----tc-tctcac-tagc---------cattcttaagggctgcg--agctcactgcctc---ccca-c
                      Manatee  c-----tc-tttcac-taga---------tgtcctcaagggc-ggg--agaacgcttcctc---ctca-g
             Cape golden mole  c-----tc---tcag-taga---------ggtcctcaaggacagag--agaacaatccccc---tgtt-t
                       Tenrec  c-----ct---tcgc-caga---------tgtccccaagggca-cg--gggacaattccct---ccca-t
                     Aardvark  c-----tc-tctcac-tggg---------catcttcaagggcaggg--agaacacttcttc---ccta-t
                    Armadillo  c-----tc------------------------cctcaaggacaggg--agagtgcttactc---ccca-t
                      Opossum  c-----ct-ctgggg-aggggctgcgatctgccctcggggagggtg--tgtgctctttcccaggcccc-t
                  Zebra finch  ---------------------------------ccaaggtggtgaa--ggagcccccactt---ctcc-t
           American alligator  ---------------------------------cc----tggtacc--aggctgcttgact---ctcc--
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                     Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Shrew  ======================================================================
                       Rabbit  ======================================================================
                   Coelacanth  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
              Green seaturtle  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
               Bactrian camel  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------

                        Human  ga-ga-gcc--------c-a-------------------ggacac------agctgg
                        Chimp  ga-ga-gcc--------c-a-------------------ggacac------agctgg
                      Gorilla  ga-ga-gcc--------c-a-------------------ggacac------agctgg
                    Orangutan  ga-ga-gcc--------c-a-------------------ggacac------agctgg
                       Gibbon  ga-ga-gcc--------c-a-------------------ggacac------agctgg
                       Rhesus  gg-ga-gcc--------c-a-------------------ggacac------agctgg
          Crab-eating macaque  gg-ga-gcc--------c-a-------------------ggacac------agctgg
                       Baboon  gg-ga-gcc--------c-a-------------------ggacac------agctag
                 Green monkey  gg-ga-gcc--------c-a-------------------ggacac------agctgg
                     Marmoset  ga-ga-gcc--------c-a-------------------ggacgc------agctgg
              Squirrel monkey  ga-ga-gcc--------c-a-------------------ggaggc------agctgg
                     Bushbaby  ga-ga-atc--------c-a-------------------ggac--------------
           Chinese tree shrew  ag------c--------g-g-------------------ggccgc------ag-tgg
                     Squirrel  ta-ga-gct--------cag-------------------aatctc------agctgg
       Lesser Egyptian jerboa  ta-ga-gtt--------c---------------------------------------
                 Prairie vole  -g-gagagt--------c---------------------------------------
              Chinese hamster  -a-ga-agt--------c---------------------------------------
                        Mouse  ------tgt--------c---------------------------------------
                          Rat  -a-ga-agt--------c---------------------------------------
               Naked mole-rat  ta-ca-gcc--------cag-------------------tacccc------agctgg
                   Guinea pig  ta-ga-gcc--------cag-------------------gacccc------agctgg
                   Chinchilla  ta-ga-gct--------ctg-------------------aacccc------agctgg
             Brush-tailed rat  ta-ga-gcc--------caa-------------------gacccc------agctgg
                          Pig  ca-ga-gct--------c-a-------------------gaccac------agctgc
                      Dolphin  ca-ga-gct--------c-a-------------------gaccac------agctgg
                 Killer whale  ca-ga-gct--------c-a-------------------gaccac------agctgg
             Tibetan antelope  ca-ga-gct--------c-a-------------------gggcac------agctga
                          Cow  ca-ga-gct--------c-a-------------------gggcac------agctgg
                        Sheep  ca-ga-gct--------c-a-------------------gggcac------agctta
                Domestic goat  ca-ga-gct--------c-a-------------------gggcac------agctga
                        Horse  -a-ga-gct--------c-cg------------------gaccac------agctgg
             White rhinoceros  tg-ga-gct--------c-ag------------------gaccac------agctgg
                          Cat  ga-ga-gct--------c-at------------------gaccat------tgctgg
                          Dog  tc--a-gct--------c-at------------------gaccc---------ctgg
                      Ferret   ta-ga-gct--------c-at------------------gaccgc------agctag
                        Panda  ca-ga-gct--------c-at------------------gaccac------agctgg
               Pacific walrus  ta-ga-gct--------c-at------------------gaccac------agctgt
                 Weddell seal  ta-ga-gct--------c-at------------------gaccac------agctgg
             Black flying-fox  ta-ga-gct--------c-ag------------------gaccgc------agctgg
                      Megabat  ta-ga-gct--------c-ag------------------gaccgc------agctgg
                Big brown bat  ca-ga-gcg--------c-cg------------------gaccgc------agctgg
         David's myotis (bat)  ca-ga-gcg--------c-ag------------------ggccac------agctgg
             Little brown bat  ca-ga-gcg--------c-ag------------------gaccac------agctgg
              Star-nosed mole  cg-aa-gcc--------c-ag------------------gaccac------agctgg
                     Elephant  gc-ac-gtt--------c-ag------------------ggccac------agctgg
          Cape elephant shrew  gtgat-gct--------c-ag------------------ggccac------agc-ag
                      Manatee  gc-ac-gtt--------c-ag------------------ggccac------agctgg
             Cape golden mole  ga-gc-atc--------c-aa------------------ggctat------ggctgg
                       Tenrec  gt-gt-gct--------c-ag------------------ggacac------agctgg
                     Aardvark  cc-ac-att--------c-ag------------------ggccac------aattgg
                    Armadillo  cc-ct-gct--------c-ag------------------gaacac------agcagg
                      Opossum  tt-gg-gctgcctttggc-ag------------------ggcccccaaacaagctgg
                  Zebra finch  ca-gc-ccc-------cc-agtcctgcaaagggaacctccagcac------agcc--
           American alligator  ca-gc-act-----gagc-agcatcccggggtggcccctaggcac------aacca-
               Golden hamster  =========================================================
                         Pika  =========================================================
                     Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Shrew  =========================================================
                       Rabbit  =========================================================
                   Coelacanth  =========================================================
                 Atlantic cod  =========================================================
                  Spotted gar  =========================================================
                  Stickleback  =========================================================
           Southern platyfish  =========================================================
                         Fugu  =========================================================
                    Tetraodon  =========================================================
                       Turkey  =========================================================
                      Chicken  =========================================================
                 Mallard duck  =========================================================
           Tibetan ground jay  =========================================================
       White-throated sparrow  =========================================================
              Tasmanian devil  =========================================================
     Mexican tetra (cavefish)  =========================================================
                       Medaka  =========================================================
          Pundamilia nyererei  =========================================================
                  Zebra mbuna  =========================================================
        Burton's mouthbreeder  =========================================================
          Princess of Burundi  =========================================================
                 Nile tilapia  =========================================================
              Green seaturtle  =========================================================
                   Budgerigar  =========================================================
                  Rock pigeon  =========================================================
          Collared flycatcher  =========================================================
          Medium ground finch  =========================================================
                       Lizard  =========================================================
             Peregrine falcon  =========================================================
                 Saker falcon  =========================================================
                     Platypus  =========================================================
               Bactrian camel  ---------------------------------------------------------
                       Alpaca  ---------------------------------------------------------

Inserts between block 10 and 11 in window
             Star-nosed mole 47bp

Alignment block 11 of 224 in window, 20729174 - 20729188, 15 bps 
B D                     Human  tgttcaattaatgtg
B D                     Chimp  tgttcaattaatgtg
B D                   Gorilla  tgttcaattaatgtg
B D                 Orangutan  tgttcaattaatgtg
B D                    Gibbon  tgttcaattaatgtg
B D                    Rhesus  tgctcatttaatgtg
B D       Crab-eating macaque  tgctcaattaatgtg
B D                    Baboon  tgctcaattaatgtg
B D              Green monkey  tgctcaattaatgtg
B D                  Marmoset  tgttcaattaatatg
B D           Squirrel monkey  tattcaattaatatg
           Chinese tree shrew  cactccacccacgtg
B D                  Squirrel  tgctcaacaactgtg
       Lesser Egyptian jerboa  ----------aagtg
                 Prairie vole  ----------atgtg
B D           Chinese hamster  ----------ctgtg
B D                     Mouse  ----------ctatg
B D                       Rat  ----------ctgtg
B D            Naked mole-rat  tgctcaataaatgtg
B D                Guinea pig  tgcccagtagatgtg
                   Chinchilla  tgctcaataaatatg
             Brush-tailed rat  tgctcaataaatgtg
B D                       Pig  agctccatgaatgtg
B D                   Dolphin  tgctcagtgaacgtg
                 Killer whale  tgctcagtgaacgtg
             Tibetan antelope  tgttcagtgaacgcg
B D                       Cow  tgttcggtgaatgtg
B D                     Sheep  tgttcagtgaacgcg
                Domestic goat  tgttcagtgaacgcg
B D                     Horse  tgctcagtggatgtg
B D          White rhinoceros  tgctcaatgaatgtg
B D                       Cat  tacacagtgaatgag
B D                       Dog  tgcacagtgaccgcg
B D                   Ferret   tgcacaatgaacacg
B D                     Panda  tgcacagtgaactcg
               Pacific walrus  tgcacagtgaacgc-
                 Weddell seal  tgcacagtgaacgtg
             Black flying-fox  tcctcaatgaatatg
B D                   Megabat  tcctcaatgaatatg
                Big brown bat  tgctgggtgagcacg
         David's myotis (bat)  tgct-ggtgagcagg
  D          Little brown bat  tgct-ggtgagcacg
B D                  Elephant  tgc-caatggaggag
          Cape elephant shrew  cac-caacaaaggag
B D                   Manatee  tgc-cgatgaaggag
             Cape golden mole  tac-caatagaggag
B D                    Tenrec  -gc-caat---ggag
                     Aardvark  tgc-caatgaaggag
B D                 Armadillo  agctcaatgactgtg
B D                   Opossum  tgcccagctcag---
B D               Zebra finch  --ctcagtgct----
B D        American alligator  cacctaatgag----
              Golden hamster  ===============
B D                      Pika  ===============
B D                  Hedgehog  NNNNNNNNNNNNNNN
B D                     Shrew  ===============
B D                    Rabbit  ===============
B D                Coelacanth  ===============
B D              Atlantic cod  ===============
                 Spotted gar  ===============
B D               Stickleback  ===============
          Southern platyfish  ===============
B D                      Fugu  ===============
B D                 Tetraodon  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
          Tibetan ground jay  ===============
  D    White-throated sparrow  ===============
B D           Tasmanian devil  ===============
    Mexican tetra (cavefish)  ===============
B D                    Medaka  ===============
         Pundamilia nyererei  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D              Nile tilapia  ===============
  D           Green seaturtle  ===============
B D                Budgerigar  ===============
  D               Rock pigeon  ===============
  D       Collared flycatcher  ===============
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
B D                  Platypus  ===============
B D                  Bushbaby  ---------------
             Star-nosed mole  ===============
              Bactrian camel  ---------------
B D                    Alpaca  ---------------

Inserts between block 11 and 12 in window
      Lesser Egyptian jerboa 1104bp
B D                  Opossum 1bp

Alignment block 12 of 224 in window, 20729189 - 20729197, 9 bps 
B D                     Human  ------------gaattaaca
B D                     Chimp  ------------gaattaaca
B D                   Gorilla  ------------gaattaaca
B D                 Orangutan  ------------gaattaaca
B D                    Gibbon  ------------gaattaaca
B D                    Rhesus  ------------gaattaaca
B D       Crab-eating macaque  ------------gaattaaca
B D                    Baboon  ------------gaattaaca
B D              Green monkey  ------------gaattaaca
B D                  Marmoset  ------------gaattaatg
B D           Squirrel monkey  ------------gaattaatg
           Chinese tree shrew  ------------gactaaaag
B D                  Squirrel  ------------gcatcaatg
                 Prairie vole  ------------ggacagatg
B D           Chinese hamster  ------------ggaaagata
B D                     Mouse  ------------ggacagatg
B D                       Rat  ------------tgacagatg
B D            Naked mole-rat  ------------caatgaatg
B D                Guinea pig  ------------gaatgactg
                   Chinchilla  ------------aaacgaatg
             Brush-tailed rat  ------------aaatgaacg
B D                       Pig  ------------gaa--aagg
B D                   Dolphin  ------------gaataaact
                 Killer whale  ------------gaataaact
             Tibetan antelope  ------------gtatgaacg
B D                       Cow  ------------gtatgaacg
B D                     Sheep  ------------gcatgaacg
                Domestic goat  ------------gcatgaaca
B D                     Horse  ------------gagtggatg
B D          White rhinoceros  ------------gaataaatg
B D                       Cat  ------------gagtcaagg
B D                       Dog  ------------gcacctagg
B D                   Ferret   ------------gaatcaagg
B D                     Panda  ------------gaatcaagg
               Pacific walrus  ------------gaagtaagg
                 Weddell seal  ------------gaagcaagg
             Black flying-fox  ------------gaataaagg
B D                   Megabat  ------------gaataaagg
                Big brown bat  ------------gaataaagg
         David's myotis (bat)  ------------gaataaagg
  D          Little brown bat  ------------gaataaagg
B D                  Elephant  ------------aaataaatt
          Cape elephant shrew  ------------gaataaatg
B D                   Manatee  ------------gaataaatg
             Cape golden mole  ------------aaataaacg
B D                    Tenrec  ------------gaatgggtg
                     Aardvark  ------------gaatgaatg
B D                 Armadillo  ------------gagtaagtg
B D                   Opossum  ------------gagcacct-
B D               Zebra finch  cggatggatgatggatg----
B D        American alligator  aagcta------ggaag----
              Golden hamster  =====================
      Lesser Egyptian jerboa  =====================
B D                      Pika  =====================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  =====================
B D                    Rabbit  =====================
B D                Coelacanth  =====================
B D              Atlantic cod  =====================
                 Spotted gar  =====================
B D               Stickleback  =====================
          Southern platyfish  =====================
B D                      Fugu  =====================
B D                 Tetraodon  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
          Tibetan ground jay  =====================
  D    White-throated sparrow  =====================
B D           Tasmanian devil  =====================
    Mexican tetra (cavefish)  =====================
B D                    Medaka  =====================
         Pundamilia nyererei  =====================
                 Zebra mbuna  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D              Nile tilapia  =====================
  D           Green seaturtle  =====================
B D                Budgerigar  =====================
  D               Rock pigeon  =====================
  D       Collared flycatcher  =====================
B D       Medium ground finch  =====================
B D                    Lizard  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
B D                  Platypus  =====================
B D                  Bushbaby  ---------------------
             Star-nosed mole  =====================
              Bactrian camel  ---------------------
B D                    Alpaca  ---------------------

Alignment block 13 of 224 in window, 20729198 - 20729198, 1 bps 
B D                     Human  -t
B D                     Chimp  -a
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -c
B D       Crab-eating macaque  -c
B D                    Baboon  -c
B D              Green monkey  -c
B D                  Marmoset  -t
           Chinese tree shrew  -c
B D                  Squirrel  -c
                 Prairie vole  -a
B D           Chinese hamster  -t
B D                     Mouse  -c
B D                       Rat  -c
B D            Naked mole-rat  -c
B D                Guinea pig  -c
                   Chinchilla  -c
             Brush-tailed rat  -c
B D                       Pig  -c
B D                   Dolphin  -c
                 Killer whale  -c
             Tibetan antelope  -c
B D                       Cow  -c
B D                     Sheep  -c
                Domestic goat  -c
B D                     Horse  -c
B D          White rhinoceros  -c
B D                       Cat  -c
B D                       Dog  -c
B D                   Ferret   -c
B D                     Panda  -c
               Pacific walrus  -c
                 Weddell seal  -c
             Black flying-fox  -c
B D                   Megabat  -c
                Big brown bat  -c
         David's myotis (bat)  -c
  D          Little brown bat  -c
B D                  Elephant  -c
          Cape elephant shrew  -a
B D                   Manatee  -a
             Cape golden mole  -a
B D                    Tenrec  -g
                     Aardvark  -a
B D                 Armadillo  -c
B D                   Opossum  -c
B D               Zebra finch  g-
B D        American alligator  g-
              Golden hamster  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                  Hedgehog  NN
B D                     Shrew  ==
B D                    Rabbit  ==
B D                Coelacanth  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
B D                      Fugu  ==
B D                 Tetraodon  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D           Green seaturtle  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D                  Platypus  ==
B D                  Bushbaby  --
             Star-nosed mole  ==
              Bactrian camel  --
B D                    Alpaca  --
B D           Squirrel monkey  --

Inserts between block 13 and 14 in window
B D                  Opossum 6bp

Alignment block 14 of 224 in window, 20729199 - 20729209, 11 bps 
B D                     Human  -------atcatg--------gcccc
B D                     Chimp  -------atcatg--------gcccc
B D                   Gorilla  -------atcatg--------gcccc
B D                 Orangutan  -------atcacg--------gcccc
B D                    Gibbon  -------atcatg--------gcccc
B D                    Rhesus  -------atcata--------gcccc
B D       Crab-eating macaque  -------atcata--------gcccc
B D                    Baboon  -------atcata--------gcccc
B D              Green monkey  -------atcata--------gcccc
           Chinese tree shrew  -------accggt--------ggacc
B D                  Squirrel  -------ctccgc--------gtccc
                 Prairie vole  -------at-aac--------ggacc
B D           Chinese hamster  -------gt-aat--------gggct
B D                     Mouse  -------atcaat--------ggacc
B D                       Rat  -------gtcaat--------ggacc
B D            Naked mole-rat  -------atccag--------ggcca
B D                Guinea pig  -------acttag--------gacca
                   Chinchilla  -------atctgg--------gacca
             Brush-tailed rat  -------atccag--------gacca
B D                       Pig  -------atcatg-------------
B D                   Dolphin  -------gtcac--------------
                 Killer whale  -------gtcac--------------
             Tibetan antelope  -------atcccgccaccgcg-----
B D                       Cow  -------atcctgccaccgcg-----
B D                     Sheep  -------atcccgccaccatg-----
                Domestic goat  -------atcccgccaccatg-----
B D                     Horse  -------atcaca-------------
B D          White rhinoceros  -------atcaca-------------
B D                       Cat  -------ttctcg-------------
B D                       Dog  -------atctgg-------------
B D                   Ferret   -------atcttg-------------
B D                     Panda  -------atcttg-------------
               Pacific walrus  -------atcttg-------------
                 Weddell seal  -------atcttg-------------
             Black flying-fox  -------atcatg-------------
B D                   Megabat  -------atcatg-------------
                Big brown bat  -------accccg-------------
         David's myotis (bat)  -------accgca-------------
  D          Little brown bat  -------accgca-------------
B D                  Elephant  -------atcaat-------------
          Cape elephant shrew  -------atcagt-------------
B D                   Manatee  -------atcatt-------------
             Cape golden mole  -------atcaat-------------
B D                    Tenrec  -------ctcggt-------------
                     Aardvark  -------atccgt-------------
B D                 Armadillo  -------gtcaga-------------
B D                   Opossum  -------gcc----------------
B D               Zebra finch  atgggggatgg---------------
B D        American alligator  atccaggatcc---------------
              Golden hamster  ==========================
      Lesser Egyptian jerboa  ==========================
B D                      Pika  ==========================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ==========================
B D                    Rabbit  ==========================
B D                Coelacanth  ==========================
B D              Atlantic cod  ==========================
                 Spotted gar  ==========================
B D               Stickleback  ==========================
          Southern platyfish  ==========================
B D                      Fugu  ==========================
B D                 Tetraodon  ==========================
B D                    Turkey  ==========================
B D                   Chicken  ==========================
  D              Mallard duck  ==========================
          Tibetan ground jay  ==========================
  D    White-throated sparrow  ==========================
B D           Tasmanian devil  ==========================
    Mexican tetra (cavefish)  ==========================
B D                    Medaka  ==========================
         Pundamilia nyererei  ==========================
                 Zebra mbuna  ==========================
       Burton's mouthbreeder  ==========================
         Princess of Burundi  ==========================
B D              Nile tilapia  ==========================
  D           Green seaturtle  ==========================
B D                Budgerigar  ==========================
  D               Rock pigeon  ==========================
  D       Collared flycatcher  ==========================
B D       Medium ground finch  ==========================
B D                    Lizard  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
B D                  Platypus  ==========================
B D                  Bushbaby  --------------------------
             Star-nosed mole  ==========================
              Bactrian camel  --------------------------
B D                    Alpaca  --------------------------
B D           Squirrel monkey  --------------------------
B D                  Marmoset  --------------------------

Inserts between block 14 and 15 in window
B D                 Squirrel 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
            Tibetan antelope 119bp
B D                      Cow 124bp
B D                    Sheep 108bp
               Domestic goat 128bp
B D                 Elephant 6bp
         Cape elephant shrew 5bp
B D                  Manatee 6bp
            Cape golden mole 6bp
B D                   Tenrec 6bp
                    Aardvark 6bp
B D                Armadillo 6bp

Alignment block 15 of 224 in window, 20729210 - 20729212, 3 bps 
B D                     Human  atg
B D                     Chimp  atg
B D                   Gorilla  atg
B D                 Orangutan  atg
B D                    Gibbon  atg
B D                    Rhesus  atg
B D       Crab-eating macaque  atg
B D                    Baboon  atg
B D              Green monkey  atg
           Chinese tree shrew  atg
B D                  Squirrel  gtg
       Lesser Egyptian jerboa  atg
B D                     Mouse  gtt
B D                       Rat  gtc
B D            Naked mole-rat  gtg
B D                Guinea pig  gcg
                   Chinchilla  gcg
             Brush-tailed rat  gcg
B D                  Elephant  atg
          Cape elephant shrew  atg
B D                   Manatee  atg
             Cape golden mole  atg
B D                    Tenrec  acg
                     Aardvark  atg
B D                 Armadillo  atg
B D               Zebra finch  atg
B D        American alligator  cag
                Prairie vole  ---
              Golden hamster  ===
B D                      Pika  ===
                Weddell seal  ---
B D                  Hedgehog  NNN
B D                     Shrew  ===
B D                       Pig  ---
B D                    Rabbit  ===
B D                Coelacanth  ===
B D                   Megabat  ---
B D                   Dolphin  ---
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
B D                      Fugu  ===
B D                 Tetraodon  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D           Green seaturtle  ===
B D                Budgerigar  ===
B D                   Opossum  ---
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                  Platypus  ===
B D           Chinese hamster  ---
B D                       Cat  ---
B D                  Bushbaby  ---
B D                   Ferret   ---
             Star-nosed mole  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
              Bactrian camel  ---
B D                    Alpaca  ---
              Pacific walrus  ---
B D                     Panda  ---
                Killer whale  ---
B D                       Dog  ---
            Black flying-fox  ---
B D          White rhinoceros  ---
B D                     Horse  ---
        David's myotis (bat)  ---
               Big brown bat  ---
  D          Little brown bat  ---
B D           Squirrel monkey  ---
B D                  Marmoset  ---
B D                       Cow  ===

Alignment block 16 of 224 in window, 20729213 - 20729216, 4 bps 
B D                     Human  ---at--tc
B D                     Chimp  ---at--tc
B D                   Gorilla  ---at--tc
B D                 Orangutan  ---at--tc
B D                    Gibbon  ---at--tc
B D                    Rhesus  ---gt--tc
B D       Crab-eating macaque  ---gt--tc
B D                    Baboon  ---at--tc
B D              Green monkey  ---at--tc
B D                  Bushbaby  --------c
           Chinese tree shrew  ---g-----
B D                  Squirrel  ---gt--tg
       Lesser Egyptian jerboa  ---ac--ta
                 Prairie vole  ---gctatg
B D           Chinese hamster  ---ac--tg
B D                     Mouse  ---ac--tg
B D                       Rat  ---gt----
B D            Naked mole-rat  ---at--aa
B D                Guinea pig  ---at--aa
                   Chinchilla  ---at--aa
             Brush-tailed rat  ---at--aa
             Tibetan antelope  ---at--ca
B D                       Cow  ---at--ca
B D                     Sheep  ---at--ca
B D                  Elephant  ---at--ta
          Cape elephant shrew  ---at--aa
B D                   Manatee  ---at--ta
             Cape golden mole  ---tt--ta
B D                    Tenrec  ---gt--tc
                     Aardvark  ---at--ca
B D                 Armadillo  ---ac--tg
B D                   Opossum  ----t--tc
B D               Zebra finch  gatg-----
B D        American alligator  ctgg-----
              Golden hamster  =========
B D                      Pika  =========
                Weddell seal  ---------
B D                  Hedgehog  NNNNNNNNN
B D                     Shrew  =========
B D                       Pig  ---------
B D                    Rabbit  =========
B D                Coelacanth  =========
B D                   Megabat  ---------
B D                   Dolphin  ---------
B D              Atlantic cod  =========
                 Spotted gar  =========
B D               Stickleback  =========
          Southern platyfish  =========
B D                      Fugu  =========
B D                 Tetraodon  =========
B D                    Turkey  =========
B D                   Chicken  =========
  D              Mallard duck  =========
          Tibetan ground jay  =========
  D    White-throated sparrow  =========
B D           Tasmanian devil  =========
    Mexican tetra (cavefish)  =========
B D                    Medaka  =========
         Pundamilia nyererei  =========
                 Zebra mbuna  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D              Nile tilapia  =========
  D           Green seaturtle  =========
B D                Budgerigar  =========
  D               Rock pigeon  =========
  D       Collared flycatcher  =========
B D       Medium ground finch  =========
B D                    Lizard  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
B D                  Platypus  =========
B D                       Cat  ---------
B D                   Ferret   ---------
             Star-nosed mole  =========
               Domestic goat  =========
              Bactrian camel  ---------
B D                    Alpaca  ---------
              Pacific walrus  ---------
B D                     Panda  ---------
                Killer whale  ---------
B D                       Dog  ---------
            Black flying-fox  ---------
B D          White rhinoceros  ---------
B D                     Horse  ---------
        David's myotis (bat)  ---------
               Big brown bat  ---------
  D          Little brown bat  ---------
B D           Squirrel monkey  ---------
B D                  Marmoset  ---------

Alignment block 17 of 224 in window, 20729217 - 20729236, 20 bps 
B D                     Human  caa-gaaa--gaatggct------------aaat-----g---
B D                     Chimp  caa-gaaa--gaatggct------------aaat-----g---
B D                   Gorilla  caa-gaaa--gaatggct------------aaat-----g---
B D                 Orangutan  c-----aa--gaatggct------------aaat-----g---
B D                    Gibbon  caa-gaaa--gaatggct------------aaat-----g---
B D                    Rhesus  caa-gaaa--gaacggct------------gaat-----g---
B D       Crab-eating macaque  caa-gaaa--gaacggct------------gaat-----g---
B D                    Baboon  caa-gaaa--gaacggct------------gaat-----g---
B D              Green monkey  caa-gaag--gaacggct------------gaat-----g---
B D                  Bushbaby  aca-agaa--gaatggct------------gatg-----g---
           Chinese tree shrew  ------------aaggct-------------------------
B D                  Squirrel  caa-gaaa--gtgcggcc------------gaat-----g---
       Lesser Egyptian jerboa  taa-gaca--gaggaact------------taat-----g---
                 Prairie vole  cag-ggca--gaa------------------------------
B D           Chinese hamster  caa-ggaa--gcacagac------------aaaa-----g---
B D                     Mouse  caa-agca--gagtggag------------gaaa-----g---
B D                       Rat  -------------tgggg------------gaaa-----g---
B D            Naked mole-rat  caa-gaaa--gaatggct------------gaat-----g---
B D                Guinea pig  tga-caaa--gcacggccgaatgcctcggtgaat-----g---
                   Chinchilla  tga-gaaa--gaacggcc------------gaat-----g---
             Brush-tailed rat  c-a-gaaa--gaacgggg------------gaac-----g---
B D                       Pig  --a-aata--gaatggct------------gaat-----g---
B D                   Dolphin  --a-gaca--gaatggct------------gaat-----g---
                 Killer whale  --a-gaca--gaatggct------------gaat-----g---
             Tibetan antelope  caa-aaca--gaacgacc------------gagt-----g---
B D                       Cow  cga-aacg--gaaggact------------gagt-----g---
B D                     Sheep  caa-aaca--gaacgaca------------gagt-----g---
                Domestic goat  caa-aaca--gaacgacc------------gagt-----g---
B D                     Horse  --a-agag--gactggct------------gact-----g---
B D          White rhinoceros  --a-aaag--gaacggct------------gaat-----g---
B D                       Cat  --a-gaaa--gaatggct------------gact-----g---
B D                       Dog  --a-gaaa--gaagggct------------gact-----g---
B D                   Ferret   --a-gaaa--gagtggct------------gatg-----g---
B D                     Panda  --a-gaaa--gaatggct------------gact-----g---
               Pacific walrus  --a-gaaa--gaatggct------------gatt-----g---
                 Weddell seal  --a-gaaa--gaatggct------------gatt-----g---
             Black flying-fox  --a-gaaa--caatggct------------gact-----g---
B D                   Megabat  --a-gaaa--caatggct------------gact-----g---
                Big brown bat  --g-gaa------tggct------------gcct-----g---
         David's myotis (bat)  --g-gaaa--gaatggct------------gact-----g---
  D          Little brown bat  --g-gaaa--gagtggct------------gacc-----g---
B D                  Elephant  cca-gaaa--gaacagct------------gaat-----g---
          Cape elephant shrew  ccaggaaa--aaagggct------------aagt-----c---
B D                   Manatee  cca-gaaa--gaatggct------------gaat-----a---
             Cape golden mole  cca-gaaa--gaacggcg------------gaat-----c---
B D                    Tenrec  cca-gagagtggccagcc------------ggag-----g---
                     Aardvark  cca-gaaa--gtatgggc------------ggat---------
B D                 Armadillo  caa-gatg-------gct------------agat-----g---
B D               Zebra finch  -----------gatggat------------ggatggatggatg
B D        American alligator  -----------gacagac------------gcat-----gctg
              Golden hamster  ===========================================
B D                      Pika  ===========================================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ===========================================
B D                    Rabbit  ===========================================
B D                Coelacanth  ===========================================
B D              Atlantic cod  ===========================================
                 Spotted gar  ===========================================
B D               Stickleback  ===========================================
          Southern platyfish  ===========================================
B D                      Fugu  ===========================================
B D                 Tetraodon  ===========================================
B D                    Turkey  ===========================================
B D                   Chicken  ===========================================
  D              Mallard duck  ===========================================
          Tibetan ground jay  ===========================================
  D    White-throated sparrow  ===========================================
B D           Tasmanian devil  ===========================================
    Mexican tetra (cavefish)  ===========================================
B D                    Medaka  ===========================================
         Pundamilia nyererei  ===========================================
                 Zebra mbuna  ===========================================
       Burton's mouthbreeder  ===========================================
         Princess of Burundi  ===========================================
B D              Nile tilapia  ===========================================
  D           Green seaturtle  ===========================================
B D                Budgerigar  ===========================================
B D                   Opossum  -------------------------------------------
  D               Rock pigeon  ===========================================
  D       Collared flycatcher  ===========================================
B D       Medium ground finch  ===========================================
B D                    Lizard  ===========================================
  D          Peregrine falcon  ===========================================
  D              Saker falcon  ===========================================
B D                  Platypus  ===========================================
             Star-nosed mole  ===========================================
              Bactrian camel  -------------------------------------------
B D                    Alpaca  -------------------------------------------
B D           Squirrel monkey  -------------------------------------------
B D                  Marmoset  -------------------------------------------

Inserts between block 17 and 18 in window
B D                      Dog 1bp
B D       American alligator 27bp

Alignment block 18 of 224 in window, 20729237 - 20729263, 27 bps 
B D                     Human  cctctggcgagg-t-cccccagg-actcag
B D                     Chimp  cctctggcgagg-t-cccccagg-actcag
B D                   Gorilla  cctctggcgagg-t-cccccagg-actccg
B D                 Orangutan  cctctggcgagg-t-cccccagg-actcag
B D                    Gibbon  cctctggcgagg-t-cccccagg-actcag
B D                    Rhesus  cctctggcgagg-t-cccccagg-actcag
B D       Crab-eating macaque  cctctggcgagg-t-cccccagg-actcag
B D                    Baboon  cctctggcgagg-t-cccccagg-actcag
B D              Green monkey  cctctggcaagg-t-cccccagg-actcag
B D                  Bushbaby  cctctcctgagg-t-ccccaagt-actcag
           Chinese tree shrew  --------gagc-c-ccccaggg-acccag
B D                  Squirrel  cctctgccaaggcc-tcccaagg-cctcag
       Lesser Egyptian jerboa  cctctaccatgg-a-acccccct-ccccag
                 Prairie vole  ---------------tcccacat-actcag
B D           Chinese hamster  cctctg-caaga-t-tccctcag-actcag
B D                     Mouse  cct----tgggg-t-ccctgcag-actcag
B D                       Rat  tctatgcttggg-t-ccctgcaa-actcag
B D            Naked mole-rat  tttctgccatgg-t-ccccaagg-actcag
B D                Guinea pig  cctctgccacgg-t-ccccaagg-actcgg
                   Chinchilla  cctctgccatgg-t-ccccaggg-actcag
             Brush-tailed rat  cctccaccatgg-t-cccggagg-actcag
B D                       Pig  cctccgcctggg-t-ccca---------ag
B D                   Dolphin  cctctgcctagg-t-cccag-gg-actcag
                 Killer whale  cctctgcctagg-t-cccag-gg-actcag
             Tibetan antelope  cctctgcccccg-a-ccca--gg-actcgg
B D                       Cow  cctctgcctcgg-c-ctca--gg-actcgg
B D                     Sheep  cctctgcctccg-a-ccca--gg-actcgg
                Domestic goat  cctctgcctctg-a-ccca--gg-actcgg
B D                     Horse  cctctgcccaag-t-ccccaagg-acgcag
B D          White rhinoceros  cctctgcctagg-t-ccccaagg-actcag
B D                       Cat  cctctgcctggg-t-ccccaatg-actc-t
B D                       Dog  cctctgcctggg-t-ccccc-cg-actcag
B D                   Ferret   cctctgtctggg-tggcctcatg-actcag
B D                     Panda  cctctgcccggg-t-cccccatg-actcag
               Pacific walrus  cctctacctggg-t-cccccatg-actcag
                 Weddell seal  cctctgcctggg-t-cccccatg-actcag
             Black flying-fox  cctctgctcggg-g-gcccgagg-actcgg
B D                   Megabat  cctctgctcggg-g-ccccgagg-actcgg
                Big brown bat  cctctgcctggg-t-ccctgagg-cctcag
         David's myotis (bat)  tctctgcctggg-t-ccctgagg-cctccg
  D          Little brown bat  cctccgcccggg-t-ccctgagg-cctcag
B D                  Elephant  -ctctgcctgcg-t-ctctaagg-ac----
          Cape elephant shrew  -ttctgccttat-t-ctctaaag-agtctg
B D                   Manatee  -ctctgcctgca-t-cttcaaga-actctg
             Cape golden mole  -ctgggcctagg-t-ccccaaag-accctg
B D                    Tenrec  -ctcagcctggg-t-ctctcagg-actccc
                     Aardvark  -----gcttgct-t-ctccaa---------
B D                 Armadillo  cctctgcctagg-g-ctcccaagtgctcag
B D                   Opossum  --cctacatacc-a-ccctggga-gatggg
B D        American alligator  -------ccagg-g-tgtccagc-actggg
              Golden hamster  ==============================
B D                      Pika  ==============================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ==============================
B D                    Rabbit  ==============================
B D                Coelacanth  ==============================
B D              Atlantic cod  ==============================
                 Spotted gar  ==============================
B D               Stickleback  ==============================
          Southern platyfish  ==============================
B D                      Fugu  ==============================
B D                 Tetraodon  ==============================
B D                    Turkey  ==============================
B D                   Chicken  ==============================
  D              Mallard duck  ==============================
          Tibetan ground jay  ==============================
B D               Zebra finch  ==============================
  D    White-throated sparrow  ==============================
B D           Tasmanian devil  ==============================
    Mexican tetra (cavefish)  ==============================
B D                    Medaka  ==============================
         Pundamilia nyererei  ==============================
                 Zebra mbuna  ==============================
       Burton's mouthbreeder  ==============================
         Princess of Burundi  ==============================
B D              Nile tilapia  ==============================
  D           Green seaturtle  ==============================
B D                Budgerigar  ==============================
  D               Rock pigeon  ==============================
  D       Collared flycatcher  ==============================
B D       Medium ground finch  ==============================
B D                    Lizard  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================
B D                  Platypus  ==============================
             Star-nosed mole  ==============================
              Bactrian camel  ------------------------------
B D                    Alpaca  ------------------------------
B D           Squirrel monkey  ------------------------------
B D                  Marmoset  ------------------------------

Inserts between block 18 and 19 in window
B D       American alligator 14bp

Alignment block 19 of 224 in window, 20729264 - 20729291, 28 bps 
B D                     Human  ctccc----tc-----------------ggt--ctc-----tcctgggacca---g----t-g-a
B D                     Chimp  ctccc----tc-----------------ggt--ctc-----tcctgggacca---g----t-g-a
B D                   Gorilla  ctccc----tc-----------------ggt--ctc-----tcctgggagca---g----t-g-a
B D                 Orangutan  ctccc----tt-----------------ggt--ctc-----tcctgggacca---a----t-g-a
B D                    Gibbon  ctccc----tc-----------------gat--ctc-----tcctgggacca---a----t-g-a
B D                    Rhesus  gtccc----tc-----------------agt--ctc-----tgctgggacca---a----t-g-g
B D       Crab-eating macaque  gtccc----tc-----------------agt--ctc-----tgctgggacca---a----t-g-g
B D                    Baboon  ctccc----tc-----------------agt--ctc-----tgctgggacca---a----t-g-g
B D              Green monkey  ctccc----tc-----------------ggt--ctc-----tgctgggacca---a----t-g-a
B D                  Bushbaby  cttac----tc-----------------agc--ctt-----t-ctggggcct---a----t-t-a
           Chinese tree shrew  ctccc----tc-----------------gtc--ttt-----tggtggggctg---a---cc-c-a
B D                  Squirrel  ctctg----tc-----------------cag-agtt-----tcctgaggcca---a----ctt-a
       Lesser Egyptian jerboa  gcttc----tc-----------------agg-----------------gcca---a----c-t-c
                 Prairie vole  ctccc----cc-----------------ccccccgt-----gcccccggaca---g----cat-a
B D           Chinese hamster  ctccc----cc-----------------agt-----------------gaca---a----c-c-a
B D                     Mouse  catcc----cc-----------------ag-----------------------------------
B D                       Rat  catcc----tc-----------------agg-----------------gaca---c----tgt-a
B D            Naked mole-rat  ctcct----cc-----------------aac--ctc-----taccaggccca---a----c-t-t
B D                Guinea pig  ttccc----cc-----------------tca--ctt-----taccagggcca---a----t-t-t
                   Chinchilla  ctccc----cc-----------------agc--ctt-----taccagggcca---a----t-t-t
             Brush-tailed rat  ttccc----tc-----------------agc--ctt-----taccacagtca---a----t-t-t
B D                       Pig  ctccc----tc-----------------agg--ctt-----tcctggggcca---a----c-t-t
B D                   Dolphin  ctccc----tc-----------------agg--ctt-----ccctggggcca---a----c-t-t
                 Killer whale  ctccc----tc-----------------agg--ctt-----ccctgggg-ca---a----c-t-t
             Tibetan antelope  ctccc----tc-----------------agg--ctt-----cctcggggtca---a----c-tgt
B D                       Cow  ctccc----tc-----------------agg--ctt-----ccctcgggcca---a----t-ttt
B D                     Sheep  ctccc----tc-----------------agg--ctt-----cctcggagtca---a----t-tgt
                Domestic goat  ctccc----tc-----------------agg--ctt-----cctcggagtca---a----t-tgt
B D                     Horse  atccc----tc-----------------agt--ctt-----ccctggggcca---a----c-t-t
B D          White rhinoceros  ctccc----tc-----------------agt--ctt-----gcctggggcca---a----c-t-t
B D                       Cat  ctccc----tt-----------------agt--ttt-----tgctggggcca---a----c-t-c
B D                       Dog  ctcct----cc-----------------agt--ctt-----tcctggg--tg---g----c-t-t
B D                   Ferret   ttccc----tc-----------------agt--cct-----tgctggggcca---a----c-t-c
B D                     Panda  caacc----tc-----------------agt--ctt-----tcctggggcca---a----t-t-t
               Pacific walrus  ctccc----tc-----------------agt--ccc-----tcctggggcca---a----t-t-t
                 Weddell seal  ctccc----tc-----------------agt--ccc-----tcctggggcca---a----c-t-t
             Black flying-fox  ccccc----tc-----------------agt--ctt-----tcctggggtcc---a----c-t-t
B D                   Megabat  ccccc----tc-----------------agt--ctt-----tcctggggtct---a----c-t-t
                Big brown bat  cccca-----c-----------------cgt--ttt-----ccctggg-----------------
         David's myotis (bat)  c---------c-----------------cgt--tct-----tcctggg-----------------
  D          Little brown bat  c---------c-----------------cgt--tct-----tcctggg-----------------
          Cape elephant shrew  ctccc----tctgca-------------gat--gca-----tcctggcagtg---a---------
B D                   Manatee  ctctc----tc-----------------aat--ctt-----tcctggagtca---a---------
             Cape golden mole  ccccc----tc-----------------agc--ttt-----tcccaaggcca---atgt------
B D                    Tenrec  ctccc----cc------------------------------tcctag------------------
                     Aardvark  -ctcc----tc-----------------------tt-----tcctggggctg---acgt------
B D                 Armadillo  ctccc----cc-----------------aga--ctt-----aactggggcct---actc------
B D                   Opossum  cccat----ttcacagatggagagtgggagg--ctg-----gact--------------------
B D               Zebra finch  ctcccttgtcc-----------------agt--cctggggatgctggggacagtga---------
B D        American alligator  caccc---acc-----------------aat--cagcagcaagc-agcttcaagga---------
              Golden hamster  =================================================================
B D                      Pika  =================================================================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  =================================================================
B D                    Rabbit  =================================================================
B D                Coelacanth  =================================================================
B D              Atlantic cod  =================================================================
                 Spotted gar  =================================================================
B D               Stickleback  =================================================================
          Southern platyfish  =================================================================
B D                      Fugu  =================================================================
B D                 Tetraodon  =================================================================
B D                    Turkey  =================================================================
B D                   Chicken  =================================================================
  D              Mallard duck  =================================================================
          Tibetan ground jay  =================================================================
  D    White-throated sparrow  =================================================================
B D           Tasmanian devil  =================================================================
    Mexican tetra (cavefish)  =================================================================
B D                    Medaka  =================================================================
         Pundamilia nyererei  =================================================================
                 Zebra mbuna  =================================================================
       Burton's mouthbreeder  =================================================================
         Princess of Burundi  =================================================================
B D              Nile tilapia  =================================================================
  D           Green seaturtle  =================================================================
B D                Budgerigar  =================================================================
  D               Rock pigeon  =================================================================
  D       Collared flycatcher  =================================================================
B D       Medium ground finch  =================================================================
B D                    Lizard  =================================================================
  D          Peregrine falcon  =================================================================
  D              Saker falcon  =================================================================
B D                  Platypus  =================================================================
B D                  Elephant  -----------------------------------------------------------------
             Star-nosed mole  =================================================================
              Bactrian camel  -----------------------------------------------------------------
B D                    Alpaca  -----------------------------------------------------------------
B D           Squirrel monkey  -----------------------------------------------------------------
B D                  Marmoset  -----------------------------------------------------------------

Inserts between block 19 and 20 in window
         Cape elephant shrew 1209bp
B D                  Manatee 4bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 20 of 224 in window, 20729292 - 20729344, 53 bps 
B D                     Human  gaaag---cca-c---------ctctgtgtcct-------accctggctgg-----ct-tcac-------
B D                     Chimp  gaaag---cca-c---------ctctgtgtccc-------accctggctgg-----ct-tcac-------
B D                   Gorilla  gaaag---cca-c-----------ctgtgtccc-------accctggctgg-----ct-tctc-------
B D                 Orangutan  gaaag---cca-c---------ctctgtgtccc-------accctggctgg-----ct-tctc-------
B D                    Gibbon  gaaag---tca-c---------ctctgtgtccc-------accctggctgg-----ct-tctc-------
B D                    Rhesus  gaaag---cca-c---------ctctgtgttcc-------atcctggctgg-----ct-tctc-------
B D       Crab-eating macaque  gaaag---cca-c---------ctctgtgtccc-------atcctggctgg-----ct-tctc-------
B D                    Baboon  gaaag---cca-c---------ctctgtgtctc-------atcctggctgg-----ct-tctc-------
B D              Green monkey  gaaag---cca-c---------ctctgtgtccc-------atcctgattgg-----ct-tctc-------
B D                  Bushbaby  gaaac---ttg-c---------ctc-atccctc-------accctggcc-a-----cc-cctc-------
           Chinese tree shrew  ggaac---ccg-c---------ctctgt-ccct-------gtccaggctgg-----c--actc-------
B D                  Squirrel  gaacc---tcc-a---------tctgc--cccc-------attctggccag-----t--tctc-------
       Lesser Egyptian jerboa  agaca----cc-t---------ccctc--ccctgtctcctattgaggacag-----t--tctg-------
                 Prairie vole  agaca----ct-c---------ctctc--tcac--------------------------actc-------
B D           Chinese hamster  agaca---ccc-c---------ctctt--tcct--------------------------atta-------
B D                     Mouse  agaca---cct-g---------ccctc--tcccagct-------------g-----c--cttc-------
B D                       Rat  agaca---cct-g---------ccctc--tcccgg------------------------attc-------
B D            Naked mole-rat  agacg---ttc-c---------ctctgt-accc-------attctgtccga-----c--tctc-------
B D                Guinea pig  agatg---ctc-c---------ctctgt-cccc-------atcctggctgg-----c--tctc-------
                   Chinchilla  ataag---ctc-c---------ctctg--ccct-------attctggccgg-----c--tctc-------
             Brush-tailed rat  ggatg---ctc-c---------ctctg--cccc-------ctcctggccgg---------ctc-------
B D                       Pig  gagcc--ccca-c---------ctccatccccc-------atcctggctgg-----ctctgtc-------
B D                   Dolphin  agacc--ccca-c---------ctccatccccc-------atcctggcggg-----ctccgtc-------
                 Killer whale  agacc--ccca-c---------ctccatccccc-------atcctggcggg-----ctccgtc-------
             Tibetan antelope  agaca--tccg-c---------gccagtccccc-------atcctggagggc-tccctccgtc-------
B D                       Cow  agaca--tccg-c---------gtccgtccccc-------atcctggaggg-----ctgcgtc-------
B D                     Sheep  agaca--tctgcc---------gtcagtccccc-------atcctggagggc-tccctccgtc-------
                Domestic goat  agaca--tccg-c---------atcagtcccct-------atcctggagggc-tccctccgtc-------
B D                     Horse  agacc--ccca-c---------ccccgtcccgc-------atcctggcggg-----ttctgtc-------
B D          White rhinoceros  agacc--ccca-c---------ctctgtccacc-------atcctggctgg-----ctctgtc-------
B D                       Cat  agaccctccca-c---------ctccctccccc-------atcctgcctgg-----ctctgtc-------
B D                       Dog  agacc-----------------ccctgcccccc-------atcctgcctgg-----ctctagc-------
B D                   Ferret   agacc---cca-c---------ctccgtctccc-------atcctgcctgg-----ct---gc-------
B D                     Panda  agacc---cca-cc-------tctccatccccc-------atcctgcctgg-----ct---ac-------
               Pacific walrus  agacc---cca-c---------ctccatgcccc-------gtcctgcctgg-----ct---ac-------
                 Weddell seal  agacc---cca-c---------ctccatccccc-------atcctgcctgg-----ct---ac-------
             Black flying-fox  agacc--ccca-c---------cgccatccccc-------aacctagctag-----ctctgtc-------
B D                   Megabat  agacc--ccca-c---------cgccatccccc-------aacctagctag-----ctctgtc-------
                Big brown bat  ------------------------------acg-------atcccagctgg-----c----cg-------
         David's myotis (bat)  ------------------------------acg-------accccagctgg-----c--ggtg-------
  D          Little brown bat  -----------------------------cccg-------acccccgctgg-----c--ggtg-------
B D                  Elephant  ---------------------------tcc----------------------------------------
B D                   Manatee  -------------gaccctcacctccgtccctc-------atcttggtggt-----c--tgtc-------
             Cape golden mole  -------------------gacctccatccctg-------gaacttgcagc-----c--tatc-------
B D                    Tenrec  ------------------------------ctg-------gggcgt---------------cc-------
                     Aardvark  -------------gacccccacctccatccctc-------attctggtggt-----c--tgtc-------
B D                 Armadillo  -------------gcccccgaccactgtccc-c-------atcctggctga-----c--tgtc-------
B D                   Opossum  -----------------------gcaggacccc-------tctctgcccgctgtacctccttc-------
B D               Zebra finch  -------------------------------------------------gg-----ctgggtccctggag
B D        American alligator  -------------------------------------------------gc-----ccaggtc-------
              Golden hamster  ======================================================================
B D                      Pika  ======================================================================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ======================================================================
B D                    Rabbit  ======================================================================
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
             Star-nosed mole  ======================================================================
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
B D           Squirrel monkey  ----------------------------------------------------------------------
B D                  Marmoset  ----------------------------------------------------------------------

                        Human  -----------tcaccagcctgcttgt----------------
                        Chimp  -----------tcaccagcctgcttgt----------------
                      Gorilla  -----------tcaccagcctgcttgt----------------
                    Orangutan  -----------tcaccagcctgcttgt----------------
                       Gibbon  -----------tcaccagcctgcttgt----------------
                       Rhesus  -----------tcaccagcctgcttgt----------------
          Crab-eating macaque  -----------tcaccagcctgcttgt----------------
                       Baboon  -----------tcaccagcctgcttgt----------------
                 Green monkey  -----------tcaccagcctgcctgt----------------
                     Bushbaby  -----------tcaccagcctacttag----------------
           Chinese tree shrew  -----------tcaccagccttctcgg----------------
                     Squirrel  -----------tcactagccgacttgt----------------
       Lesser Egyptian jerboa  -----------tcactagcctactat-----------------
                 Prairie vole  -----------acacca--------------------------
              Chinese hamster  -----------gcgccagatttcttgc----------------
                        Mouse  -----------tcaccagccttcttgc----------------
                          Rat  -----------tctccaaccttcttgc----------------
               Naked mole-rat  -----------tcaccagctgacttgt----------------
                   Guinea pig  -----------tcac--gtggacttgt----------------
                   Chinchilla  -----------tcaccagccgacttgt----------------
             Brush-tailed rat  -----------gcagcagccgatctgt----------------
                          Pig  -----------tcatcaggcttcttgg----------------
                      Dolphin  -----------ccaccaggctacttgt----------------
                 Killer whale  -----------tcaccaggctacttgt----------------
             Tibetan antelope  -----------ttaccaggctcctcag----------------
                          Cow  -----------ttaccaggctactcag----------------
                        Sheep  -----------ttaccaggctactcgg----------------
                Domestic goat  -----------ttaccaggctactcgg----------------
                        Horse  -----------tcccctggctacttgt----------------
             White rhinoceros  -----------tccccgggctacttat----------------
                          Cat  -----------tccccagactacttct----------------
                          Dog  -----------tcaccagactccttcc----------------
                      Ferret   -----------tcaccagactgcttcc----------------
                        Panda  -----------tcaccagactatttac----------------
               Pacific walrus  -----------tcaccagactactaac----------------
                 Weddell seal  -----------tcaccagactacttac----------------
             Black flying-fox  -----------tcaccaacctagttat----------------
                      Megabat  -----------tcaccaacctagttat----------------
                Big brown bat  -----------tcaccggcctacttgt----------------
         David's myotis (bat)  -----------tcaccggcctacttgc----------------
             Little brown bat  -----------tcaccagcctacgtgc----------------
                     Elephant  -------------------------------------------
                      Manatee  -----------tcactaggctacctgt----------------
             Cape golden mole  -----------taagtaagctgcttgc----------------
                       Tenrec  -----------tgatggcgctactgac----------------
                     Aardvark  -----------tcactaggctacttgt----------------
                    Armadillo  -----------attccaggctgcttgg----------------
                      Opossum  -----------ccaccttgctgatcga----------------
                  Zebra finch  ggctggacagacaggcagtgccctggtctggggccagtagttg
           American alligator  -----------catccagcttccttcgctcaccccgg--gtct
               Golden hamster  ===========================================
                         Pika  ===========================================
                     Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Shrew  ===========================================
                       Rabbit  ===========================================
                   Coelacanth  ===========================================
                 Atlantic cod  ===========================================
                  Spotted gar  ===========================================
                  Stickleback  ===========================================
           Southern platyfish  ===========================================
                         Fugu  ===========================================
                    Tetraodon  ===========================================
                       Turkey  ===========================================
                      Chicken  ===========================================
                 Mallard duck  ===========================================
           Tibetan ground jay  ===========================================
       White-throated sparrow  ===========================================
              Tasmanian devil  ===========================================
     Mexican tetra (cavefish)  ===========================================
                       Medaka  ===========================================
          Pundamilia nyererei  ===========================================
                  Zebra mbuna  ===========================================
        Burton's mouthbreeder  ===========================================
          Princess of Burundi  ===========================================
                 Nile tilapia  ===========================================
              Green seaturtle  ===========================================
                   Budgerigar  ===========================================
                  Rock pigeon  ===========================================
          Collared flycatcher  ===========================================
          Medium ground finch  ===========================================
                       Lizard  ===========================================
             Peregrine falcon  ===========================================
                 Saker falcon  ===========================================
          Cape elephant shrew  ===========================================
                     Platypus  ===========================================
              Star-nosed mole  ===========================================
               Bactrian camel  -------------------------------------------
                       Alpaca  -------------------------------------------
              Squirrel monkey  -------------------------------------------
                     Marmoset  -------------------------------------------

Inserts between block 20 and 21 in window
B D                 Bushbaby 1bp
          Chinese tree shrew 1bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
B D          Chinese hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                      Pig 3bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
  D         Little brown bat 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                  Opossum 5bp

Alignment block 21 of 224 in window, 20729345 - 20729345, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D           Squirrel monkey  c
B D                   Opossum  c
B D               Zebra finch  c
B D        American alligator  c
B D                       Rat  =
                Prairie vole  -
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
                Weddell seal  =
B D                  Hedgehog  N
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
B D                Coelacanth  =
B D                   Megabat  =
B D                   Dolphin  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D           Green seaturtle  =
B D                Budgerigar  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Manatee  =
B D                  Elephant  -
B D           Chinese hamster  =
B D                    Tenrec  -
B D                       Cat  =
B D                  Bushbaby  =
B D                   Ferret   =
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                 Armadillo  =
        David's myotis (bat)  =
               Big brown bat  =
  D          Little brown bat  =
B D                  Marmoset  -
B D                       Cow  =

Inserts between block 21 and 22 in window
B D                  Opossum 2bp

Alignment block 22 of 224 in window, 20729346 - 20729360, 15 bps 
B D                     Human  atcactg-ac-----ttggga
B D                     Chimp  atcactg-ac-----ttggga
B D                   Gorilla  atcactg-ac-----ttggga
B D                 Orangutan  atcactg-ac-----ttggga
B D                    Gibbon  atcactg-ac-----ttgggg
B D                    Rhesus  atcactg-ac-----ttggga
B D       Crab-eating macaque  atcactg-ac-----ttggga
B D                    Baboon  atcactg-ac-----ttggga
B D              Green monkey  atcactg-ac-----ttggga
B D                  Marmoset  atcactg-ac-----ttgggg
B D           Squirrel monkey  atcactg-ac-----ttggga
B D                  Bushbaby  atcacta-ac-----atggga
           Chinese tree shrew  aacact---c-----tcagga
B D                  Squirrel  accactg-ac-----tt-gg-
       Lesser Egyptian jerboa  atcactg-ac-----acagg-
                 Prairie vole  attactg-ac-----ttgag-
B D           Chinese hamster  attactg-ac-----ttggg-
               Golden hamster  atgactg-ac-----ttggg-
B D                     Mouse  atgactg-gc-----tcagg-
B D                       Rat  atcattg-gc-----tcggg-
B D            Naked mole-rat  atcatgg-ac-----tcagg-
B D                Guinea pig  atcactg-actagggtcagg-
                   Chinchilla  atcactg-ac-----tcaga-
             Brush-tailed rat  atcactg-g------------
B D                       Pig  atcactgcac-----ttggga
B D                   Dolphin  atcactgcac-----ttggga
                 Killer whale  atcactgcac-----ttggga
             Tibetan antelope  atcactgcat-----ttggga
B D                       Cow  atccgtgcat-----ttggga
B D                     Sheep  atcactgcat-----ttggga
                Domestic goat  atcactgcat-----ttggga
B D                     Horse  atcattgcac-----ttggga
B D          White rhinoceros  atcactgccc-----ttggga
B D                       Cat  atcactgcac-----ttagga
B D                       Dog  atccctgcac-----ttagga
B D                   Ferret   atcactgcac-----ttagga
B D                     Panda  atcacggcac-----ttagga
               Pacific walrus  atcaccgcac-----tttgga
                 Weddell seal  atcactgcac-----tttgga
             Black flying-fox  atcactgcac-----ttggga
B D                   Megabat  atcactgcac-----ttggga
                Big brown bat  atcactgcgc-----ttgggg
         David's myotis (bat)  atcactggga-----------
  D          Little brown bat  atccctgcga-----------
B D                  Elephant  -tcactgcac-----atggga
B D                   Manatee  accactgcac-----ttggga
             Cape golden mole  agcattgca-----------c
B D                    Tenrec  --------------------t
                     Aardvark  accactgcac-----ttggga
B D                 Armadillo  at------------------c
B D                   Opossum  aactcga-ac-----acggga
B D               Zebra finch  tgcgctg-cc-----cattgc
B D        American alligator  cctgctg-gc-----taggga
B D                      Pika  =====================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  =====================
B D                    Rabbit  =====================
B D                Coelacanth  =====================
B D              Atlantic cod  =====================
                 Spotted gar  =====================
B D               Stickleback  =====================
          Southern platyfish  =====================
B D                      Fugu  =====================
B D                 Tetraodon  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
          Tibetan ground jay  =====================
  D    White-throated sparrow  =====================
B D           Tasmanian devil  =====================
    Mexican tetra (cavefish)  =====================
B D                    Medaka  =====================
         Pundamilia nyererei  =====================
                 Zebra mbuna  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D              Nile tilapia  =====================
  D           Green seaturtle  =====================
B D                Budgerigar  =====================
  D               Rock pigeon  =====================
  D       Collared flycatcher  =====================
B D       Medium ground finch  =====================
B D                    Lizard  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
         Cape elephant shrew  =====================
B D                  Platypus  =====================
             Star-nosed mole  =====================
              Bactrian camel  ---------------------
B D                    Alpaca  ---------------------

Alignment block 23 of 224 in window, 20729361 - 20729517, 157 bps 
B D                     Human  tcagagagtcctgggtccaaatcctgtgtgact-ttggaccagctgcc---tcaaccct---ctg-----
B D                     Chimp  tcagagagtcctgggtccaaatcctgtgtgact-ttgggccagctgcc---tcaacccc---ctg-----
B D                   Gorilla  tcagagagtcctgggtccaaatcctgtgtgact-ttgggccagctgcc---tcaaccct---ctg-----
B D                 Orangutan  tcagagattcctgggtccaaatcctgtgtgact-ttgggccagctgcc---tcaaccct---ctg-----
B D                    Gibbon  tcacagagtcctgggtccaaatcctgtgtgact-ttgggccagctgcc---tcaaccct---ctg-----
B D                    Rhesus  tc--agagtcctgggtccaaatcctgtgtgact-ttgggccagctgcc---tcaaccct---ctg-----
B D       Crab-eating macaque  tc--agagtcctgggtccaaatcctgtgtgact-ttgggccagctgcc---tcaaccct---ctg-----
B D                    Baboon  tc--agagtcctgggtccaaatcctgtgtgact-ttgggccagctgcc---tcaaccct---ctg-----
B D              Green monkey  tc--agagtcctgggtccaaatcctgtgtgact-ttgggccagctgcc---tcaaccct---ctg-----
B D                  Marmoset  tc--agagtaccgggtccaaatcctatgggact-ttgggcaagctgcc---tcaaccct---ctg-----
B D           Squirrel monkey  tcagagagtcctgggtccaaattctgtgggact-ttgggcaagctgcc---ccaaccct---ctg-----
B D                  Bushbaby  tc--acagtccttggttcaaatcctgtgtgact-ctgagcaagctgct---caaactct---ctg-----
           Chinese tree shrew  cc--acagagctgtgttcaaatcctgtgtgact-c-aggcaagctgcc---tcatctct---ctg-----
B D                  Squirrel  tcagacagctcctgatccaaatctagcgtgact-tcgggaaagctgcc---tcacctc----ctg-----
       Lesser Egyptian jerboa  gcagaaagacctgagtgcaagtcctgtg--act-ctgg-ccagttgct---tcaccttg---ctg-----
                 Prairie vole  tcagagaagtctgggtgcaaggtctgcgtggct-ttgggccacctgcc---ctacctct---ctg-----
B D           Chinese hamster  tcatagaggcccggaaacaagttctgtgtggct-ttgggccagctgcc---ctacctct---ctg-----
               Golden hamster  tcggagaggcctgggcacaggttctgtgtagct-ttgggccagctgcc---ctacctct---ctg-----
B D                     Mouse  tcagagaggcctgggcacaagatctgtgtggct-ttggtgcagccgcc---ccacctct---cta-----
B D                       Rat  tcagaga------ggcacaagttctgtgtggct-ttgggccagctgcc---ctacctct---cta-----
B D            Naked mole-rat  tcaggagg-cctaggtccaaaccccgtgtgatt-ctgggccagccgcc---ttgcctct---tc------
B D                Guinea pig  tcaggggg--ttgggtgcaaaccctgtgtgact-ttgggccacctgct---tcatctct---cc------
                   Chinchilla  tcaggggg--ttgggtccaaacccc-tgcgact-tcgggccagctgcc---ttgccgct---cc------
             Brush-tailed rat  --------------------------ggcgatt-ctggcccagctgcc---tggcctct---cc------
B D                       Pig  taggagagacctggggccaaatcctgtgtgact-ttgggcaagctgcc---tcacctct---ctg-----
B D                    Alpaca  tcagagagacctgggtccaaatgctgtgtgact-ttgggcaagctgtc---tcacctct---ctg-----
               Bactrian camel  tcagagagacctgggtccaaatgctgtgtgact-ttgggcaagctgtc---tcacctca---ctg-----
B D                   Dolphin  tcagagagacctgggtccaaatcctgtgcgacc-ttgggcaagctgcc---tcacctct---ctg-----
                 Killer whale  tcagagagacctgggtccaaatcctgtgcgacc-ttgggcaagctgcc---tcacctct---ctg-----
             Tibetan antelope  tcagagagacccaggtccaaatcctgtgtgatg-ctgcataagctgct---tcacctct---ctg-----
B D                       Cow  tcagagaaacccgggtccaaatcctgtgtgatg-ttgcataagctgct---tcacctca---ctg-----
B D                     Sheep  tcagagagacccaggtccaaatcctgtgtgatg-ctgcataagctgct---tcacctct---ctg-----
                Domestic goat  tcagagagacccaggtccaaatcctgtgtgatg-ctgcataagctgct---tcacctct---ctg-----
B D                     Horse  tcagagagatctgggtccaaatcctgtgtgact-ttgggcgagccact---tcacttct---ctg-----
B D          White rhinoceros  tcagagagatctgggcctaaatcctgtgtgact-ttgggcaagccacc---tcacctct---ctg-----
B D                       Cat  tcagagagacctgtgtccagatgctgtgtgagt-ctgggcaagctgcc---ccacctct---ctg-----
B D                       Dog  tcagggagtcctgggtccaaatgctgcgtaact-tcaggcaaatggcc---ccacatct---cag-----
B D                   Ferret   tcagagaaatctgggtccaaatgctgtgtgact-tcaggcaaacagcc---ctacctct---ctg-----
B D                     Panda  tcagagaaatctgggtccaaatgctgtgtgact-ttgggcacatagcc---ccacctct---ctg-----
               Pacific walrus  tcagagagacctgggtccaaatgctgtgtgact-ttgggcaaacggcc---ccacctct---ctg-----
                 Weddell seal  tcagagagatctgggtccaaatgctgtgtgact-ttgggcaaacggcc---ccacctct---ctg-----
             Black flying-fox  tcagagagacctgggtccaaatcctatgtgact-ttgggtaagccatc---tcacctct---ctg-----
B D                   Megabat  tcagagagacctgggtccaaatcctatgtgact-ttgggtaagccatc---tcacctct---ctg-----
                Big brown bat  tc--agagtgatgggaccaaatcctgggtgact-ttggacaagccccc---tcacctct---ctg-----
         David's myotis (bat)  ---------ggtgggtccaaatcctgtgtgact-ttggacaagcctcc---tcacctct---ctg-----
  D          Little brown bat  ---------cgtgggtccgaatcctgtgtgact-ttggacaggcctcc---tcacctct---ctg-----
B D                  Elephant  --tcagagacctgggtccgagtcctgcgtgacg-ctgggcgagccacc---tcacctct---gtg-----
B D                   Manatee  --tcagagacctgggtccgagtcct--gtgaca-ctgggtgagccgcc---tcacctct---cta-----
             Cape golden mole  --ttggaaatctgagtcccaatcctgtgtgctaactgggggagctgcc---ccacctct---ctg-----
B D                    Tenrec  --tctgagcactgggtctgaatgctgtgtgctg--tgggcaacctgcc---tcacctct---ctg-----
                     Aardvark  --tcagagacctgggtcc-aatcctctgtgact-ctgggtgagctgcc---tcacttcc---ccg-----
B D                 Armadillo  --tgagagacatgggtccgagtcc---gcagct----------------------cccc---ctg-----
B D                   Opossum  ---------ttaggcagcaagccctgc----cc-ttgg--catctgcc---tcagctcttccccg-----
B D               Zebra finch  ---------------tctgaacaccctgtcggt-c--tgtttgctcagggttcagccat---cagaaacc
B D        American alligator  ---------------acc-aattcctagtaggt-caaagctcactccg---ccagcccc---cag----c
B D                      Pika  ======================================================================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ======================================================================
B D                    Rabbit  ======================================================================
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
             Star-nosed mole  ======================================================================

                        Human  ---agcctccccttcc------------tcatctgc-aaacctgggatcat--gtgaggagtagatgggg
                        Chimp  ---agcctccccttcc------------tcatctgc-aaacctgggatcat--gtgaggagtagatgggg
                      Gorilla  ---agcctccccttcc------------tcatctgc-aaacctgggatcat--gtgaggagtagatgggg
                    Orangutan  ---agcctccccttcc------------tcatctgc-aaacctgggatcat--gtgaggagtagatgggg
                       Gibbon  ---agcctccccttcc------------tcatctgc-aaacctgggatcat--gtgaggagtagatgggg
                       Rhesus  ---agcatccccttcc------------tcatttgc-aaacctgggatcat--gtgagaagtagatgggg
          Crab-eating macaque  ---agcatccccttcc------------tcatttgc-aaacctgggatcat--gtgagaagtagatgggg
                       Baboon  ---agcatccccttcc------------tcatttgc-aaacctaggatcat--gtgagaagtagatgggg
                 Green monkey  ---agcctccccctcc------------tcatctgc-aaacctgggatcat--gtgagaagtagatgggg
                     Marmoset  ---agcctccctttcc------------tcatctgc-aaacctcag-tcac--gtgaggggtagatgagg
              Squirrel monkey  ---agcctccctttcc------------tcatctgc-aaacctggg-tcac--atgatgggtagatgagg
                     Bushbaby  ---ag---ccactgct------------gagtctac-aaacccagggtaat--gtgagcag----tttgg
           Chinese tree shrew  ---ggcctc--------------------------c-gagcctggg------------gagtggatgggg
                     Squirrel  ---aacctccattttc------------tcatccgc-aaacctgggataat--gagaggtacccatgaga
       Lesser Egyptian jerboa  ---ggcctccatttcc------------tcacctgc-aaaacttggataat--atgaagtgtcagcaaga
                 Prairie vole  ---tgccctcacttcc------------tcacctgc-aagccttgtggaattagtgaggcacctg-----
              Chinese hamster  ---tgtcctcactctt------------ttgcctgc-aa---------aac--ctgaggtgcctg-----
               Golden hamster  ---tgtcctcactccc------------tcgcctgc-aaaccttgggtaac--gtgaggtgcctg-----
                        Mouse  ---tgcactcatttcc------------tttcctga-aaactctgggtaat--atgaggt----------
                          Rat  ---tgcactcacttcc------------tttcctga-aaaccttgggtaac--gtgaggtgcctg-----
               Naked mole-rat  ---tgccccaatttcc------------tcatctac-aaacctgggataat--gtgaggagcagg-----
                   Guinea pig  ---tgcccccatttta------------tca---gc-aaacctgggagaat--gtggggagcagg-----
                   Chinchilla  ---tg---ccatttca------------tca---gc-aaacctggaggaat--gtgaggagcagg-----
             Brush-tailed rat  ---tgcccccatttca------------tca---gc-aaccctgggacaat--gtgaagagcagg-----
                          Pig  ---agcctccatttcc------------tcttcccc-aaacctggggtaat--gtgaggagtcgatgaga
                       Alpaca  ---agcctctatttcc------------tcctcccc-aaacctgggataac--gtgaggagtcaatgaga
               Bactrian camel  ---agcctccatttcc------------tcctcccc-aaacctgggataac--atgaggagtcaatgaga
                      Dolphin  ---agcctccatttcc------------ttgtcccc-aaacctggggtaac--atgaggagtcaatgaga
                 Killer whale  ---agcctccatttcc------------ttgtcccc-aaacctgggataac--atgaggagtcaatgaga
             Tibetan antelope  ---agcccccatttcc------------tcaacccc-aaatgtggggtaac--atgcggcactggtgaga
                          Cow  ---agcccccatttcc------------tcaacccc-aaatgtggggtaac--gtgcggcactggtgaga
                        Sheep  ---agcccccatttcc------------tcaacccc-aaaggtggggtaac--ttgcggcactggtgaga
                Domestic goat  ---agcccccatttcc------------tcaacccc-aaaggtggggtaac--gtgcggcactggtgaga
                        Horse  ---agcctccacttcc------------tgatccc--aaacctgggataat--gtgaggatttggtgaga
             White rhinoceros  ---agcctccatttcc------------tgatccc--aaccatgggataat--gtgaggactcgatgaga
                          Cat  ---aggctccatttcc------------tcatcccc-aaacctgggataat--gtgaggaggc---aaga
                          Dog  ---agctgccatctcc------------tcatcccc-aaacctggggtaat--gggaggagac---taga
                      Ferret   ---agcctccatgtct------------gcatccccaaaacctggaatcga--gtcaggactc---caga
                        Panda  ---agcctccatgtcc------------tcaacccc-aagcctgggatcat--gtgaggagtc---caga
               Pacific walrus  ---agcctccatgtcc------------tcatcccc-aaacgtgggatcat--gtgagggctc---caaa
                 Weddell seal  ---agcctccatgtcc------------tcatcccc-aaacctgggatcat--gtgagggctc---taga
             Black flying-fox  ---agccttcatttcc------------tcatcccc-aaacctggaataac--gcgaggagtcaatgaga
                      Megabat  ---agccttcagttcc------------tcatcccc-aaacctagaataac--gcgaggagtcaatgaga
                Big brown bat  ---agcctct-gttcc------------tcatcccc-acacctggaatgaa--gtgaggcgtcaatgagg
         David's myotis (bat)  ---agctgt---ttcc------------tcgtcccc-aagcctgg-ataat--gtgaggagtcactgagg
             Little brown bat  ---agctgt---ttcc------------tcgtcccc-aaacctggaataat--gtgaggagtcactgagg
                     Elephant  ---agcccccctttcc------------tcatctgc-aaacctaggctcac--ctgaagagctga-ggaa
                      Manatee  ---agcctccctttcc------------tcatctga-aaacctgggctcat--gt---gagttga-tgaa
             Cape golden mole  ---aacctcccttttc------------tcatctg----aggagg-------------agttgat-gaga
                       Tenrec  ---agccgccctttcc------------tcgtc------atgtgg-------------gggctgg-ggga
                     Aardvark  ---aacctctctttcc------------tcatctgc-aaacttgggatcat--gt---------a-agga
                    Armadillo  ---aacctccatgtcc------------tcacctgc-agacgtgggataac--gt---ggagtgg-gtga
                      Opossum  ---ggccgacggctc-------------tctccttg-tagccagagaacac--cttcgatttcctt----
                  Zebra finch  tgcggtcc---cttccgggggctggaaaccatctac-aagtcagggaagag--gtgggtgcta-------
           American alligator  tgcagcccagacctccgaaag-----gacccgcttc-----tgggtgcaac--gcagctgctgt------
                         Pika  ======================================================================
                     Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Shrew  ======================================================================
                       Rabbit  ======================================================================
                   Coelacanth  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
              Green seaturtle  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
              Star-nosed mole  ======================================================================

                        Human  ac-agaatggaggagg-cagcgcccagcccgac---gccag-----cc-a--g-gcttgg----------
                        Chimp  ac-agaatggaggagg-cagcgcccagcccgac---gccag-----cc-a--g-gcttgg----------
                      Gorilla  ac-agaatggaggagg-cagcgcccagcccgac---gccag-----cc-a--g-gcttgg----------
                    Orangutan  ac-agaatggaggagg-cggcgcccagcccgac---gccag-----cc-a--g-gcttgg----------
                       Gibbon  ac-agaatggaggagg-cggcgcccagccggac---gccaa-----cc-a--g-gcttgg----------
                       Rhesus  acaagaatggaggagc-aggcgcccagcccgac---atcag-----cc-a--g-gcttgg----------
          Crab-eating macaque  acaagaatggaggagc-aggcgcccagcccgac---atcag-----cc-a--g-gcttgg----------
                       Baboon  acaagaatggaggagc-aggcgcccagcccgac---atcag-----cc-a--g-gcttgg----------
                 Green monkey  acaagaatggaggagc-aggcgcccagcccgcc---atcag-----cc-a--g-gctcgg----------
                     Marmoset  ac-tgaatggaggagc-tgaagcccagcccgac---gccag-----cc-a--g-gcttgg----------
              Squirrel monkey  ac-tgaatgcaggagc-cgaagcccagcccgac---gccag-----cc-a--g-gcttgg----------
                     Bushbaby  at-ggagcagaggagc-ctatgct----------------------------g-gctgga----------
           Chinese tree shrew  ac---aatggaggagc-agggacccagcataac---accag-----cc-a--g-gcctgc----------
                     Squirrel  gc-tcagtgc-tgggc-aggtaccaagcacagt---gccag-----cc-a--g-gcttggagctgatgct
       Lesser Egyptian jerboa  -------------agc-aggtagccagaatgat---gccag-----cc-a--a-gcacct----------
                 Prairie vole  --------------------------gcatgat---gccaa-----cc-t--g-acatgg----------
              Chinese hamster  --------------------------gcacgac---accaa-----tc-t--g-acacgg----------
               Golden hamster  --------------------------gcacgac---gccaa-----cc-t--g-acatgg----------
                        Mouse  --------------------------acaagcc---gcccc-----cc-t--------------------
                          Rat  --------------------------gcgagat---gccag-----cc-t--g-acatgg----------
               Naked mole-rat  --------------------tgctcagcacaat---gccag-----cc-a--g-gcttgg----------
                   Guinea pig  --------------------tacccagcatgat---gccag-----cc-a--g-actcgg----------
                   Chinchilla  --------------------tactcagcacaat---gccag-----cc-a--g-gctcgg----------
             Brush-tailed rat  --------------------gactcaacacaat---gctag-----cc-a--g-gctccg----------
                          Pig  at-tgaatggagacgc-a-gaacccagcatgac---gttgg-----cc-a--g-gctctg----------
                       Alpaca  ac-tgaatggaggtgc-a-gaacccagcatgat---gccgg-----cc-a--g-acttgg----------
               Bactrian camel  ac-tgaatggaggtgc-a-gaacccagcatgat---gccgg-----cc-a--g-acttgg----------
                      Dolphin  at-tgaatgcaggcac-a-gaacccagcacgat---gcctg-----cc-a--g-gctggg----------
                 Killer whale  at-tgaatgcaggcac-a-gaacccagcacgat---gcctg-----cc-a--g-gctcgg----------
             Tibetan antelope  gc-t---tgcaggcac-g-gagccgtgcacgat---gcccg-----cc-a--g-gctcag----------
                          Cow  gc-tgaatgggggcac-a-gagccgcgcacgat---gcccg-----cc-a--g-gctcag----------
                        Sheep  gc-t---tgcaggcac-g-gagccgcgcacgat---gcccg-----cc-a--g-gctcag----------
                Domestic goat  gc-t---tgcaggcac-g-gagccgcgcacgat---gcccg-----cc-a--g-gctcag----------
                        Horse  ac-ggaatggaggag---------cagcacgat---gtcag-----ct-a--g-gctccc----------
             White rhinoceros  ac-tgaatggaggagc-aggtacccagcacgat---gccgg-----cc-a--g-gctctg----------
                          Cat  cc-tgaatggaggagc-aggcacccagcatgat---gccat-----ct-g--g-gcgggg----------
                          Dog  ac-tgagcagaggagc-gggtacct-gcatgat---gccag-----tg-g--g-gtg-gg----------
                      Ferret   ac-tgaatggaggagc-aggcacccagcatgac---cccag-----cg-t--g-gcctgg----------
                        Panda  ac-tgaatggaggagc-aggcacccaacatgat---gccag-----ct-g--g-gcttgg----------
               Pacific walrus  ac-agaatggaggagc-a----------------------------------------gg----------
                 Weddell seal  ac-agaatggaggagc-a----------------------------------------gg----------
             Black flying-fox  at-tgaagggagtagc-aggcacctagcatgat---gctgg-----gg-atgg-gctcag----------
                      Megabat  at-tgaagggagtagc-aggcacctagcatgat---gctgg-----gg-atgg-gctcag----------
                Big brown bat  ac-tgaagggaggagc-aggcacgcggc-tgat---gccag-----cc-a--g-gctcgg----------
         David's myotis (bat)  aa-tgagtgggggagc-agggacccagtgcgat---gccag-----cc-a--g-gctcgg----------
             Little brown bat  aa-tgaacggaggagc-aggcacccagtgtgat---gccag-----cc-a--g-gctcgg----------
                     Elephant  ac-tgaatggaggagc-a-ggcaccggcctgat---gccag-----cc-a--g-gctcga----------
                      Manatee  ac-tgaacagaggagc-a-ggcgctggcctgat---gccag-----cc-a--g-gctcgc----------
             Cape golden mole  ac-tgaatggaggagt-a-ggcagcagccag--------ag-----cc-a--atgctcaa----------
                       Tenrec  cc-tgagagcagcagc-a-gggacgggcctggt---accag-----cc-a--g-gcctga----------
                     Aardvark  gt-tgacagtgatacc-a-aggcttgg------------ag-----cc-a--atgctcaa----------
                    Armadillo  ga-acaaggcaggagcaa-gggcccagcacaat---gccag-----tc-a--g-gctcgg----------
                      Opossum  ---agcccggagcagg-ccgtgcac----tttt---gccagaaaatcc-a--g-gc--------------
                  Zebra finch  ---gtgctggagaagt-ccaaccccaacatcacctggtttg-----cctg--g-g---------------
           American alligator  ---gaactgagccacc-gctactacgaacgcacctgaccag-----cc-a--g-g---------------
                         Pika  ======================================================================
                     Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Shrew  ======================================================================
                       Rabbit  ======================================================================
                   Coelacanth  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
              Green seaturtle  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
              Star-nosed mole  ======================================================================

                        Human  ------------a
                        Chimp  ------------a
                      Gorilla  ------------a
                    Orangutan  ------------a
                       Gibbon  ------------a
                       Rhesus  ------------a
          Crab-eating macaque  ------------a
                       Baboon  ------------a
                 Green monkey  ------------a
                     Marmoset  ------------a
              Squirrel monkey  ------------a
                     Bushbaby  ------------g
           Chinese tree shrew  ------------a
                     Squirrel  caacaacgtggtc
       Lesser Egyptian jerboa  ------------c
                 Prairie vole  ------------c
              Chinese hamster  ------------c
               Golden hamster  ------------c
                        Mouse  -------------
                          Rat  ------------a
               Naked mole-rat  -------------
                   Guinea pig  -------------
                   Chinchilla  -------------
             Brush-tailed rat  -------------
                          Pig  ------------a
                       Alpaca  ------------a
               Bactrian camel  ------------a
                      Dolphin  ------------a
                 Killer whale  ------------a
             Tibetan antelope  ------------a
                          Cow  ------------a
                        Sheep  ------------a
                Domestic goat  ------------a
                        Horse  ------------a
             White rhinoceros  ------------a
                          Cat  ------------a
                          Dog  ------------a
                      Ferret   ------------a
                        Panda  ------------a
               Pacific walrus  ------------a
                 Weddell seal  ------------a
             Black flying-fox  ------------a
                      Megabat  ------------a
                Big brown bat  ------------a
         David's myotis (bat)  ------------a
             Little brown bat  ------------a
                     Elephant  ------------a
                      Manatee  ------------a
             Cape golden mole  ------------c
                       Tenrec  ------------c
                     Aardvark  ------------c
                    Armadillo  ------------a
                      Opossum  -------------
                  Zebra finch  -------------
           American alligator  -------------
                         Pika  =============
                     Hedgehog  NNNNNNNNNNNNN
                        Shrew  =============
                       Rabbit  =============
                   Coelacanth  =============
                 Atlantic cod  =============
                  Spotted gar  =============
                  Stickleback  =============
           Southern platyfish  =============
                         Fugu  =============
                    Tetraodon  =============
                       Turkey  =============
                      Chicken  =============
                 Mallard duck  =============
           Tibetan ground jay  =============
       White-throated sparrow  =============
              Tasmanian devil  =============
     Mexican tetra (cavefish)  =============
                       Medaka  =============
          Pundamilia nyererei  =============
                  Zebra mbuna  =============
        Burton's mouthbreeder  =============
          Princess of Burundi  =============
                 Nile tilapia  =============
              Green seaturtle  =============
                   Budgerigar  =============
                  Rock pigeon  =============
          Collared flycatcher  =============
          Medium ground finch  =============
                       Lizard  =============
             Peregrine falcon  =============
                 Saker falcon  =============
          Cape elephant shrew  =============
                     Platypus  =============
              Star-nosed mole  =============

Inserts between block 23 and 24 in window
B D                    Mouse 2bp
B D                      Cow 287bp

Alignment block 24 of 224 in window, 20729518 - 20729529, 12 bps 
B D                     Human  tccaa--------a-gctca--a-----
B D                     Chimp  tccaa--------a-gctca--a-----
B D                   Gorilla  tccaa--------a-gctca--a-----
B D                 Orangutan  tccaa--------a-gctca--a-----
B D                    Gibbon  tccaa--------a-gctca--a-----
B D                    Rhesus  tccaa--------a-gctca--a-----
B D       Crab-eating macaque  tccaa--------a-gctca--a-----
B D                    Baboon  tccaa--------a-gctca--a-----
B D              Green monkey  tccaa--------a-gctca--a-----
B D                  Marmoset  cctga--------a--ctca--a-----
B D           Squirrel monkey  cctga--------a--ctca--a-----
B D                  Bushbaby  tatga--------g-ggacc--c-----
           Chinese tree shrew  gctggtacaggaca-gctcc--a-----
B D                  Squirrel  acagg--------g-aatag--g-----
       Lesser Egyptian jerboa  acagg--------g-gatcgatg-----
                 Prairie vole  acagg--------a-gatt---g-----
B D           Chinese hamster  acagg--------g-gatga--g-----
               Golden hamster  acagg--------g-gatga--g-----
B D                       Rat  gcagg--------g-gatca--g-----
B D            Naked mole-rat  gcagg--------t-gctcc--g-----
B D                Guinea pig  gcaaa--------g-gctca--a-----
                   Chinchilla  gcaag--------g-gctca--g-----
             Brush-tailed rat  gcaag--------g-gctca--g-----
B D                       Pig  gc-cg--------t-gatca--g-----
B D                    Alpaca  ---ga--------t-gatgc--t-----
               Bactrian camel  ---ga--------t-gatgc--t-----
B D                   Dolphin  gc-tg--------t-gatca--a-----
                 Killer whale  gc-tg--------t-gatca--a-----
             Tibetan antelope  gc-tg--------t-gacca--g-----
B D                     Sheep  gc-tg--------t-gacca--g-----
                Domestic goat  gc-tg--------t-gacca--g-----
B D                     Horse  gctga--------t-gctca--a-----
B D          White rhinoceros  gccta--------t-gctca--a-----
B D                       Cat  gc-ga--------c-actga--a-----
B D                       Dog  gg-ga--------caattta--a-----
B D                   Ferret   gg-aa--------c-gctta--a-----
B D                     Panda  gg-ga--------c-gctta--a-----
               Pacific walrus  gg-ga--------c-gcttc--a-----
                 Weddell seal  gg-ga--------t-gcttc--a-----
             Black flying-fox  actga--------t-gctcg--a-----
B D                   Megabat  actga--------t-gctcg--a-----
                Big brown bat  gctga--------t-gctca--a-----
         David's myotis (bat)  gcaga--------t-actca--a-----
  D          Little brown bat  gctga--------t-gccca--a-----
B D                  Elephant  gccaa--------t-gctca--a-----
B D                   Manatee  gacaa--------t-gctcg--a-----
             Cape golden mole  aaaca--------t-ggtct--c-----
B D                    Tenrec  aagca--------t-ggtct--c-----
                     Aardvark  aagca--------t-ggttt--c-----
B D                 Armadillo  gccac--------c-accca--a-----
B D                   Opossum  ccaga--------t-gctca--t-----
B D               Zebra finch  -----------------tct--------
B D        American alligator  -----------------tct--gatgag
B D                     Mouse  ============================
B D                      Pika  ============================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ============================
B D                    Rabbit  ============================
B D                Coelacanth  ============================
B D              Atlantic cod  ============================
                 Spotted gar  ============================
B D               Stickleback  ============================
          Southern platyfish  ============================
B D                      Fugu  ============================
B D                 Tetraodon  ============================
B D                    Turkey  ============================
B D                   Chicken  ============================
  D              Mallard duck  ============================
          Tibetan ground jay  ============================
  D    White-throated sparrow  ============================
B D           Tasmanian devil  ============================
    Mexican tetra (cavefish)  ============================
B D                    Medaka  ============================
         Pundamilia nyererei  ============================
                 Zebra mbuna  ============================
       Burton's mouthbreeder  ============================
         Princess of Burundi  ============================
B D              Nile tilapia  ============================
  D           Green seaturtle  ============================
B D                Budgerigar  ============================
  D               Rock pigeon  ============================
  D       Collared flycatcher  ============================
B D       Medium ground finch  ============================
B D                    Lizard  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
         Cape elephant shrew  ============================
B D                  Platypus  ============================
             Star-nosed mole  ============================
B D                       Cow  ============================

Inserts between block 24 and 25 in window
          Chinese tree shrew 22bp
B D                 Squirrel 4bp
      Lesser Egyptian jerboa 4bp
                Prairie vole 12bp
B D          Chinese hamster 4bp
              Golden hamster 4bp
B D                      Rat 4bp
B D           Naked mole-rat 11bp
B D               Guinea pig 9bp
                  Chinchilla 11bp
            Brush-tailed rat 11bp
B D                 Elephant 216bp
B D                  Manatee 223bp
            Cape golden mole 17bp
B D                   Tenrec 17bp
                    Aardvark 14bp
B D                Armadillo 28bp

Alignment block 25 of 224 in window, 20729530 - 20729530, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  c
B D                  Elephant  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D        American alligator  c
B D                      Pika  =
                Weddell seal  -
B D                  Hedgehog  N
B D                     Shrew  =
B D                       Pig  -
B D                Coelacanth  =
B D                   Megabat  -
B D                   Dolphin  -
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  -
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D           Green seaturtle  =
B D                Budgerigar  =
B D                   Opossum  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
         Cape elephant shrew  =
B D                  Platypus  =
B D                       Cat  -
B D                   Ferret   -
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  -
B D                     Panda  -
                Killer whale  -
B D                       Dog  -
            Black flying-fox  -
B D          White rhinoceros  -
B D                     Horse  -
        David's myotis (bat)  -
               Big brown bat  -
  D          Little brown bat  -
B D                       Cow  =

Alignment block 26 of 224 in window, 20729531 - 20729537, 7 bps 
B D                     Human  a-aagcct
B D                     Chimp  a-aagcct
B D                   Gorilla  a-aagcct
B D                 Orangutan  a-aagcct
B D                    Gibbon  a-aagcct
B D                    Rhesus  a-aagcct
B D       Crab-eating macaque  a-aagcct
B D                    Baboon  a-aagcct
B D              Green monkey  a-aagcct
B D                  Marmoset  a-gagcct
B D           Squirrel monkey  a-gagcct
B D                  Bushbaby  a-aagtcc
           Chinese tree shrew  a-acgcct
B D                  Squirrel  caaaaact
       Lesser Egyptian jerboa  c-aaggct
                 Prairie vole  c-gaggtt
B D           Chinese hamster  c-acgcct
               Golden hamster  c-aagcct
B D                     Mouse  c-ccatct
B D                       Rat  c-aagcct
B D            Naked mole-rat  c-acaggg
B D                Guinea pig  c-tcaggg
                   Chinchilla  c-acaggg
             Brush-tailed rat  c-aatggg
B D                    Rabbit  a-gagcct
B D                       Pig  c-aagtcc
B D                    Alpaca  c-aagtcc
               Bactrian camel  c-aagtcc
B D                   Dolphin  c-aagtac
                 Killer whale  c-aagtac
             Tibetan antelope  c-aagtac
B D                     Sheep  c-aagtat
                Domestic goat  c-aagtac
B D                     Horse  c-aaatac
B D          White rhinoceros  c-aaataa
B D                       Cat  c-aggtat
B D                       Dog  c-aggtct
B D                   Ferret   c-aggtac
B D                     Panda  c-aggtac
               Pacific walrus  c-aggcac
                 Weddell seal  c-aggcac
             Black flying-fox  c-aa----
B D                   Megabat  c-aa----
                Big brown bat  c-aagcgc
         David's myotis (bat)  c-aaacac
  D          Little brown bat  c-aaacac
B D                  Elephant  a-aagcct
B D                   Manatee  a-aagcct
             Cape golden mole  a-aagcct
B D                    Tenrec  a-gagcct
                     Aardvark  a-aagcct
B D                 Armadillo  a-gagcct
B D                   Opossum  c-a-----
B D                  Platypus  a-aagccg
B D        American alligator  --aaa---
B D                      Pika  ========
B D                  Hedgehog  NNNNNNNN
B D                     Shrew  ========
B D                Coelacanth  ========
B D              Atlantic cod  ========
                 Spotted gar  ========
B D               Stickleback  ========
          Southern platyfish  ========
B D                      Fugu  ========
B D                 Tetraodon  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  --------
  D    White-throated sparrow  ========
B D           Tasmanian devil  ========
    Mexican tetra (cavefish)  ========
B D                    Medaka  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
  D           Green seaturtle  ========
B D                Budgerigar  ========
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D       Medium ground finch  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
         Cape elephant shrew  ========
             Star-nosed mole  ========
B D                       Cow  ========

Inserts between block 26 and 27 in window
B D                      Pig 41bp
B D                   Alpaca 30bp
              Bactrian camel 30bp
B D                  Dolphin 32bp
                Killer whale 32bp
            Tibetan antelope 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 32bp
B D         White rhinoceros 32bp
B D                      Cat 26bp
B D                      Dog 29bp
B D                  Ferret  27bp
B D                    Panda 27bp
              Pacific walrus 28bp
                Weddell seal 29bp
            Black flying-fox 30bp
B D                  Megabat 30bp
               Big brown bat 29bp
        David's myotis (bat) 30bp
  D         Little brown bat 30bp

Alignment block 27 of 224 in window, 20729538 - 20729541, 4 bps 
B D                     Human  gctg
B D                     Chimp  gctg
B D                   Gorilla  gctg
B D                 Orangutan  gctg
B D                    Gibbon  gctg
B D                    Rhesus  gctg
B D       Crab-eating macaque  gctg
B D                    Baboon  gctg
B D              Green monkey  gccg
B D                  Marmoset  gctc
B D           Squirrel monkey  gctg
           Chinese tree shrew  gccc
B D                  Squirrel  gctg
       Lesser Egyptian jerboa  gttg
                 Prairie vole  g---
B D           Chinese hamster  g---
               Golden hamster  g---
B D                     Mouse  gctg
B D                       Rat  gctg
B D            Naked mole-rat  gaca
B D                Guinea pig  aaca
                   Chinchilla  gaca
             Brush-tailed rat  gact
B D                    Rabbit  gctg
B D                       Pig  gatg
B D                    Alpaca  actg
               Bactrian camel  actg
B D                   Dolphin  gat-
                 Killer whale  gatg
B D                     Horse  gctg
B D          White rhinoceros  gctg
B D                       Cat  gctg
B D                       Dog  gcta
B D                   Ferret   gctg
B D                     Panda  gctg
               Pacific walrus  gctg
                 Weddell seal  gctg
             Black flying-fox  gctg
B D                   Megabat  gctg
                Big brown bat  gagg
         David's myotis (bat)  ggtg
  D          Little brown bat  ggtg
B D                  Elephant  gctg
B D                   Manatee  gctg
             Cape golden mole  gctg
B D                    Tenrec  cctg
                     Aardvark  gctg
B D                 Armadillo  gctg
B D                  Platypus  gctc
B D                      Pika  ====
B D                  Hedgehog  NNNN
B D                     Shrew  ====
B D                Coelacanth  ====
B D              Atlantic cod  ====
                 Spotted gar  ====
B D               Stickleback  ====
          Southern platyfish  ====
B D                      Fugu  ====
B D                 Tetraodon  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ----
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
B D                    Medaka  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
  D           Green seaturtle  ====
B D        American alligator  ----
B D                Budgerigar  ====
B D                   Opossum  ----
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
         Cape elephant shrew  ====
B D                  Bushbaby  ----
             Star-nosed mole  ====
               Domestic goat  ====
B D                     Sheep  ====
            Tibetan antelope  ====
B D                       Cow  ====

Alignment block 28 of 224 in window, 20729542 - 20729572, 31 bps 
B D                     Human  -----------ctcagg--a----gggag---------------cttg--ggagga---c---agcgggg
B D                     Chimp  -----------ctcagg--a----gggag---------------cttg--ggagga---c---agcgggg
B D                   Gorilla  -----------ctcagg--a----gggag---------------cttg--ggagga---c---agcgggg
B D                 Orangutan  -----------ctcagg--a----gggag---------------cttg--ggagga---c---agcaggg
B D                    Gibbon  -----------ctcagg--a----gggag---------------cttg--ggagga---c---agcgggg
B D                    Rhesus  -----------ctcagg--a----gggag---------------cttg--ggagga---c---agcgggg
B D       Crab-eating macaque  -----------ctcagg--a----gggag---------------cttg--ggagga---c---agcgggg
B D                    Baboon  -----------ctcagg--a----gggag---------------cttg--ggagga---c---agcgggg
B D              Green monkey  -----------ctcagg--a----gggag---------------cttg--ggagga---c---agcgggg
B D                  Marmoset  -----------ctcagg--a----gggag---------------cctg--gaagga---c---accaggg
B D           Squirrel monkey  -----------ctcagg--a----gggag---------------cctg--ggagga---c---accaggg
B D                  Bushbaby  --------------------------------------------------agaggt---g---aacaagg
           Chinese tree shrew  -----------ttcaga--a----gggac---------------ctgg--ggaggg-------agcaggg
B D                  Squirrel  -----------ttcggg--a----ggaag---------------ctta--agaaga---c---cacaggg
       Lesser Egyptian jerboa  -----------ctcagg--a----gggag---------------ccag--gaaaga---a---agcagag
                 Prairie vole  --------------gga--a----gggag---------------cttg--ggaaga---c---agcaaac
B D           Chinese hamster  ------------caggc--a----gggag---------------cttg--agaaga---c---agcagag
               Golden hamster  ------------caggt--a----gggag---------------ctcg--ggaaga---c---agtagag
B D                     Mouse  -----------gccaga--a----gggag---------------cttg--ggaaga---c---agcagag
B D                       Rat  -----------accgga--a----gggag---------------cttg--ggaagatggc---agcagag
B D            Naked mole-rat  -----------catagg--a----gggaa---------------cttg--ggaaga---c---agcaggc
B D                Guinea pig  -----------ctcaag--a----gggaa---------------ctcg--ggaaga---c---agcaggc
                   Chinchilla  -----------ctcggg--a----gggaa---------------ctca--ggaaga---c---agcaggc
             Brush-tailed rat  -----------ctcagg--a----agcaa---------------ctgg--gggaga---c---agcaggg
B D                    Rabbit  -----------tccagg--a----ggg-g---------------ctcggcgggggg---g---agcag-t
B D                       Pig  -----------ttcagg--a----gggag---------------cttg--ggaggc---c---atcgagg
B D                    Alpaca  -----------ttcagg--a----gggag---------------cttg--aaagga---c---agcgagg
               Bactrian camel  -----------ttcaag--a----gggag---------------cttg--aaagga---c---agcgagg
B D                   Dolphin  ----------------g--c----aggag---------------cttg--ggagga---c---agcgagg
                 Killer whale  -----------gtcggg--c----aggag---------------cttg--ggagga---c---agcgagg
             Tibetan antelope  -----------gtctcg--t----cgggaatgtggtcgttgctgttca--ggtgct---c---agtcgtg
B D                       Cow  -----------gcccct--cagaaggggaa--------------ctca--gggga----c---agtgagg
B D                     Sheep  -----------gtctcg--t----ggggaatgtggtcgttgctgttca--ggcgct---c---agtcgtg
                Domestic goat  -----------gtctcg--t----ggggaatgtggtcgttgctgttca--ggcgct---c---agtcgtg
B D                     Horse  -----------ttcagg--a----gggag---------------ct-g--ggggga---c---ggcgagg
B D          White rhinoceros  -----------ttcagg--a----tggag---------------ctcg--ggagga---t---agcgaga
B D                       Cat  -----------ttcggg--a----gggag---------------cttg--ggagga---c---agagagg
B D                       Dog  -----------tccagg--a----gggag---------------cctg--ggagga---c---agcgagg
B D                   Ferret   -----------ttcagg--a----gggag---------------cttg--ggaggg---c---agcgagg
B D                     Panda  -----------ttcagg--a----gggag---------------cttg--ggtgga---c---agcgagg
               Pacific walrus  -----------ttcaga--a----gggag---------------cttg--ggagga---c---agcgagg
                 Weddell seal  -----------ttcagg--a----gggag---------------cttg--ggagga---c---agcgcgg
             Black flying-fox  -----------ttcagg--a----gggag---------------catg--gaa-ga---c---agcgagg
B D                   Megabat  -----------ttcagg--a----gggag---------------catg--gaa-ga---c---agcgagg
                Big brown bat  -----------ctcagg--a----gggag---------------ct-g--gga-ga---c---agtgagg
         David's myotis (bat)  -----------ctcagg--a----gggag---------------ctag--gga-ga---c---agtgagg
  D          Little brown bat  -----------ttcagg--a----gggag---------------cttg--gga-gg---c---agtgagg
B D                     Shrew  -----------cccagg--a----gggtg---------------ctgg--ggaaaa---c---cactagg
B D                  Elephant  -----------ttctgg--a----agaag---------------cctg--gatggg---c---agtgagg
B D                   Manatee  -----------ttctgg--g----aggag---------------cttg--ggaggg---c---agtgagg
             Cape golden mole  -----------ttctgg--a----aggtg---------------tttg--ggaggt---c---agtgagg
B D                    Tenrec  -----------tgctgg--a----gggag---------------atta--gggggg---c---agtgagg
                     Aardvark  -----------ttctgg--a----gggag---------------cttg--ggaaga---c---agtgaga
B D                 Armadillo  -----------gtccag--a----gggag---------------caag--gcagga---c---agggagg
B D                   Opossum  ------------tcaagtaa----gtggg---------------accg--gccggc---c---ggcccag
B D                  Platypus  --------------cgc--g----ggagg---------------accg--ggcaga---cgcggtcgggg
B D               Zebra finch  accag----cacctgtt--g----gagaa---------------caca--ag------------------
B D        American alligator  atcaggagccaccaggc--aat--gagaa---------------gtgc--ag------------------
B D                      Pika  ======================================================================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
         Cape elephant shrew  ======================================================================
             Star-nosed mole  ======================================================================

                        Human  t
                        Chimp  t
                      Gorilla  t
                    Orangutan  t
                       Gibbon  t
                       Rhesus  t
          Crab-eating macaque  t
                       Baboon  t
                 Green monkey  t
                     Marmoset  t
              Squirrel monkey  t
                     Bushbaby  t
           Chinese tree shrew  c
                     Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
              Chinese hamster  t
               Golden hamster  t
                        Mouse  t
                          Rat  t
               Naked mole-rat  t
                   Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
                       Rabbit  t
                          Pig  a
                       Alpaca  t
               Bactrian camel  t
                      Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
                          Cow  t
                        Sheep  t
                Domestic goat  t
                        Horse  t
             White rhinoceros  c
                          Cat  t
                          Dog  c
                      Ferret   t
                        Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
                      Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
             Little brown bat  g
                        Shrew  g
                     Elephant  t
                      Manatee  t
             Cape golden mole  t
                       Tenrec  t
                     Aardvark  t
                    Armadillo  c
                      Opossum  g
                     Platypus  c
                  Zebra finch  -
           American alligator  -
                         Pika  =
                     Hedgehog  N
                   Coelacanth  =
                 Atlantic cod  =
                  Spotted gar  =
                  Stickleback  =
           Southern platyfish  =
                         Fugu  =
                    Tetraodon  =
                       Turkey  =
                      Chicken  =
                 Mallard duck  =
           Tibetan ground jay  =
       White-throated sparrow  =
              Tasmanian devil  =
     Mexican tetra (cavefish)  =
                       Medaka  =
          Pundamilia nyererei  =
                  Zebra mbuna  =
        Burton's mouthbreeder  =
          Princess of Burundi  =
                 Nile tilapia  =
              Green seaturtle  =
                   Budgerigar  =
                  Rock pigeon  =
          Collared flycatcher  =
          Medium ground finch  =
                       Lizard  =
             Peregrine falcon  =
                 Saker falcon  =
          Cape elephant shrew  =
              Star-nosed mole  =

Inserts between block 28 and 29 in window
B D                      Dog 22bp

Alignment block 29 of 224 in window, 20729573 - 20729597, 25 bps 
B D                     Human  ctgacca----cttctgctcccc-------t-c-----------------------cttg-------
B D                     Chimp  ctgacca----cttctgctcccg-------t-c-----------------------tttg-------
B D                   Gorilla  ctgacca----cttctgctcccc-------t-c-----------------------cttg-------
B D                 Orangutan  cggacca----ctttcgctcccc-------t-c-----------------------cttg-------
B D                    Gibbon  ctgacca----cttccgctcccc-------t-c-----------------------cttg-------
B D                    Rhesus  ctgacca----cttccgcttccc-------t-c-----------------------cttg-------
B D       Crab-eating macaque  ctgacca----cttccgcttccc-------t-c-----------------------cttg-------
B D                    Baboon  ctgacca----cttccgcttccc-------t-c-----------------------cttg-------
B D              Green monkey  ctgacca----cttccgcttccc-------t-c-----------------------cttg-------
B D                  Marmoset  ctgacca----cttctgctcccc-------t-c-----------------------cttg-------
B D           Squirrel monkey  ctgacca----cttctgttcccc-------t-c-----------------------cttg-------
B D                  Bushbaby  cagacca----ccttcac-cttc-------t-c-----------------------actg-------
           Chinese tree shrew  ctggccc----ctttcag-ctcc-------t-c-----------------------cttg-------
B D                  Squirrel  ctggtaa----cttttagttgcc-------t-c-----------------------cttg-------
       Lesser Egyptian jerboa  ctggcta----ctttcagctccc-------t-g-----------------------ctta-------
                 Prairie vole  ctagc-g----ctttcaagactt-------t-t-----------------------g----------
B D           Chinese hamster  ctagc-a----cttccaagactc-------t-t-----------------------tctg-------
               Golden hamster  ctagc-g----ctttcaagattc-------t-t-----------------------tctg-------
B D                     Mouse  ctagcca----ctttcaaga--c-------t-t-----------------------cctg-------
B D                       Rat  ctagctt----ctttcaaga--c-------t-t-----------------------cctg-------
B D            Naked mole-rat  ctgtcca----ctttcagtcccc-------t-c-----------------------ctag-------
B D                Guinea pig  ctggcca----cctttaggccct-------t-c-----------------------cttg-------
                   Chinchilla  ctggtca----ctttcagtcccc-------t-c-----------------------cttg-------
             Brush-tailed rat  ctggcca----ctttcagtgccc-------t-c-----------------------cttg-------
B D                    Rabbit  ccaaccg----cgtc--agtccc-------c-c-----------------------cttg-------
B D                       Pig  ctgacca----ct-acagttctc-------t-c-----------------------cctg-------
B D                    Alpaca  ctgacca----ctttcagcacct-------t-c-----------------------cttg-------
               Bactrian camel  ctgacca----ctttcagcacct-------t-c-----------------------cttg-------
B D                   Dolphin  ctgacca----ctttcagtgccc-------t-c-----------------------cttg-------
                 Killer whale  ctgacca----ctttcagtgccc-------t-c-----------------------cttg-------
             Tibetan antelope  ccgactc----tttgcgacccca-------tgg-----------------------actg-------
B D                       Cow  ctgatta----ctgtcagtaccc-------t-c-----------------------cttg-------
B D                     Sheep  ctgactt----tttgcgatccca-------tgg-----------------------actg-------
                Domestic goat  ccgactt----tttgcgacccca-------tgg-----------------------actg-------
B D                     Horse  cgggaca----ctttcagtgccc-------t-c-----------------------cttg-------
B D          White rhinoceros  ctgacca----cgttcagtcccc-------t-c-----------------------cttg-------
B D                       Cat  ctgacca----cttccagcaccc-------t-c-----------------------ctta-------
B D                   Ferret   ctgacca----ctttcagggccc-------t-c-----------------------cttg-------
B D                     Panda  ctgacca----cttgcagggccc-------t-c-----------------------ctta-------
               Pacific walrus  cagacca----ctttcagggccc-------t-c-----------------------ctta-------
                 Weddell seal  cagacga----ctttcagggccc-------t-c-----------------------ctta-------
             Black flying-fox  ctgacct----tggtcagtgccc-------t-c-----------------------cttg-------
B D                   Megabat  ctgacct----cggtcagtgccc-------t-c-----------------------cttg-------
                Big brown bat  gggacca----ctggcagtgccg-------t-c-----------------------ctcg-------
         David's myotis (bat)  gggacca----cttgcagggcct-------c-ctagcactgggcccacttgacaaccttg-------
  D          Little brown bat  gggacca----cttgcagtgcct-------c-c-------------------------tt-------
B D                     Shrew  cagacca----atttcagggtcc-------t-c-----------------------cta--------
B D                  Elephant  ----ctg----ttttcagtccc----------c-----------------------cttg-------
B D                   Manatee  ----ctg----ttttcagttcc----------c-----------------------cttg-------
             Cape golden mole  ----tta----ttttcagtgct----------c-----------------------tttg-------
B D                    Tenrec  ----ttc----tttccaggccc----------c-----------------------cttg-------
                     Aardvark  ----ctg----ttttcagtccc----------c-----------------------ctta-------
B D                 Armadillo  ----ctgaccactttcaggccc----------c---------------------ctcttg-------
B D                   Opossum  -gagccc----ctcatcccctcc-------c-c-----------------------ctt--------
B D                  Platypus  -----cg----cgtccccgggcg-------t-c-----------------------cccg-------
B D               Zebra finch  ----cct----cctgttcttcatgtctgtgg-c-----------------------cctgatgtgag
B D        American alligator  ----cca----actgcacctcct-------c-c-----------------------cctaccatcca
B D                      Pika  ===================================================================
B D                  Hedgehog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Coelacanth  ===================================================================
B D              Atlantic cod  ===================================================================
                 Spotted gar  ===================================================================
B D               Stickleback  ===================================================================
          Southern platyfish  ===================================================================
B D                      Fugu  ===================================================================
B D                 Tetraodon  ===================================================================
B D                    Turkey  ===================================================================