Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 232 in window, 20725526 - 20725548, 23 bps 
B D                     Human  gt------------cacagg----------a----------c-------------ccc--agagaga---
B D                     Chimp  gt------------cacagg----------a----------c-------------ccc--agagaga---
B D                   Gorilla  gt------------cacagg----------a----------c-------------ccc--agagaga---
B D                 Orangutan  gt------------cacagg----------g----------c-------------ccc--agagaga---
B D                    Gibbon  gt------------cacagg----------a----------c-------------ccc--agagaga---
B D                    Rhesus  gt------------cgcagg----------a----------c-------------ccc--agagaga---
B D       Crab-eating macaque  gt------------cgcagg----------a----------c-------------ccc--agagaga---
B D                    Baboon  gt------------cgcagg----------a----------c-------------ccc--agagaga---
B D              Green monkey  gt------------cgcagg----------a----------c-------------ccc--agagaga---
B D                  Marmoset  gt------------cacagg----------g----------c-------------ccc--agagaga---
B D           Squirrel monkey  gc------------cccagg----------g----------c-------------tcc--agagaga---
B D                  Bushbaby  gt-------------actgg----------a----------t-------------cct--agagaga---
           Chinese tree shrew  gt------------ggcagg----------a----------t-------------ccc--tgcgggc---
B D                  Squirrel  gc------------cacagg----------a----------c-------------tcc--acag-ga---
       Lesser Egyptian jerboa  gc------------caccgg----------c----------c-------------cct--gaag-at---
                 Prairie vole  gt------------tac-----------------------------------------------------
B D           Chinese hamster  gt------------cac-----------------------------------------------------
               Golden hamster  gt------------cac-----------------------------------------------------
B D                     Mouse  gt------------tac-----------------------------------------------------
B D                       Rat  gt------------tac-----------------------------------------------------
B D            Naked mole-rat  gt------------cac-ag----------g----------c-------------tct--gcag-ga---
B D                Guinea pig  gg------------gac-ag----------g----------c-------------tct--gcag-ga---
                   Chinchilla  gt------------tac-ag----------g----------c-------------tct--gcag-gc---
             Brush-tailed rat  gt------------caa-ag----------g----------c-------------tct--gtgg-ga---
B D                    Rabbit  gt------------cccggg----------g----------c-------------tgc--cgag-gg---
B D                      Pika  ------------------gg----------g----------a-------------tgg--ggat-gg---
B D                       Pig  gt------------gacagg----------a----------c---------------c--agaaagg---
B D                    Alpaca  gt------------cacatg----------a----------c-------------tgc--tgaaggg---
               Bactrian camel  gt------------cacagg----------a----------c-------------tgc--tgaagag---
B D                   Dolphin  gt------------cacagg----------a----------c-------------cgc--agaaagtgtg
                 Killer whale  gt------------cacagg----------a----------c-------------cgc--agaaagtgtg
             Tibetan antelope  gt------------cacagg----------a----------t-------------ggc--agaaggc---
B D                       Cow  gt------------tacagg----------a----------t-------------ggc--agaaggc---
B D                     Horse  gt------------cacagg----------a----------c-------------cgc--agaagga---
B D          White rhinoceros  gt------------cacagg----------a----------c-------------ccc--aggggga---
B D                       Cat  gt------------cacaag----------a----------c-------------ctc--agaaggg---
B D                       Dog  gt------------cacaag----------a----------c-------------ctc--agaaggg---
B D                   Ferret   gt------------tctgag----------a----------c-------------ctc--agaagga---
B D                     Panda  gt------------cccggg----------a----------c-------------ctc--agaagga---
               Pacific walrus  gt------------cccggg----------a----------c-------------ctc--agaagga---
                 Weddell seal  gt------------cccggg----------a----------c-------------ctc--agaagga---
             Black flying-fox  gt------------cacagg----------a----------c-------------ccc--ggaaggg---
B D                   Megabat  gt------------catagg----------a----------c-------------ccc--ggaaggg---
                Big brown bat  gt------------cagagg----------t------------------------ccc--agaaggg---
         David's myotis (bat)  gt------------cacagg----------t----------c-------------ccc--aggaggg---
  D          Little brown bat  gt------------cacagg----------t----------c-------------ccc--agaaggg---
B D                  Hedgehog  gt------------cacaga----------g----------c-------------tcc--agaaagg---
B D                     Shrew  at------------ctcagg----------a----------c-------------ccc--cggagga---
              Star-nosed mole  gc------------ctcagg----------a----------c-------------ccc--agaagga---
B D                  Elephant  gt------------cacagg----------g----------c----------------------------
          Cape elephant shrew  gt------------cacagg----------a----------c----------------------------
B D                   Manatee  gc------------cacagg----------g----------c----------------------------
             Cape golden mole  gt--------------caga----------g----------a----------------------------
B D                    Tenrec  gt--------------catg----------a----------c----------------------------
                     Aardvark  gt------------cacagg----------a----------c----------------------------
B D                 Armadillo  gc------------tgcaga----------a----------cttgaggaaggagg---------------
B D                   Opossum  gc------------ccaaggaggtcccccaa----------t-------------tta--atg-------
B D           Tasmanian devil  gc------------actagg----------g----------t-------------tca--gtg-------
  D       Collared flycatcher  at-------ttcccctcagg----------g----------a-------------ctg------------
B D        American alligator  atggctgcattgagctcagt----------gcagccacaaaa-------------cca------------
  D           Green seaturtle  gt----gcaaccatcgcagg----------g----------g-------------gtgtg----------
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================

                        Human  gtg
                        Chimp  gtg
                      Gorilla  gtg
                    Orangutan  gtg
                       Gibbon  gtg
                       Rhesus  ggg
          Crab-eating macaque  ggg
                       Baboon  ggg
                 Green monkey  ggg
                     Marmoset  ggg
              Squirrel monkey  ggg
                     Bushbaby  ggg
           Chinese tree shrew  aga
                     Squirrel  gga
       Lesser Egyptian jerboa  gg-
                 Prairie vole  ---
              Chinese hamster  ---
               Golden hamster  ---
                        Mouse  ---
                          Rat  ---
               Naked mole-rat  g--
                   Guinea pig  ggg
                   Chinchilla  agg
             Brush-tailed rat  gtg
                       Rabbit  agg
                         Pika  gga
                          Pig  agg
                       Alpaca  agg
               Bactrian camel  agg
                      Dolphin  ggg
                 Killer whale  ggg
             Tibetan antelope  -cg
                          Cow  -cg
                        Horse  ggg
             White rhinoceros  ggg
                          Cat  aag
                          Dog  aag
                      Ferret   aga
                        Panda  aga
               Pacific walrus  aga
                 Weddell seal  aga
             Black flying-fox  agg
                      Megabat  agg
                Big brown bat  agt
         David's myotis (bat)  agt
             Little brown bat  agt
                     Hedgehog  cg-
                        Shrew  ag-
              Star-nosed mole  ag-
                     Elephant  ---
          Cape elephant shrew  ---
                      Manatee  ---
             Cape golden mole  ---
                       Tenrec  ---
                     Aardvark  ---
                    Armadillo  ---
                      Opossum  ---
              Tasmanian devil  ---
          Collared flycatcher  ---
           American alligator  ---
              Green seaturtle  ---
                   Coelacanth  ===
                 Atlantic cod  ===
                  Spotted gar  ===
                  Stickleback  ===
           Southern platyfish  ===
                         Fugu  ===
                    Tetraodon  ===
                       Turkey  ===
                      Chicken  ===
                 Mallard duck  ===
           Tibetan ground jay  ===
                  Zebra finch  ===
       White-throated sparrow  ===
     Mexican tetra (cavefish)  ===
                    Zebrafish  ===
                       Medaka  ===
          Pundamilia nyererei  ===
                  Zebra mbuna  ===
        Burton's mouthbreeder  ===
          Princess of Burundi  ===
                 Nile tilapia  ===
               Painted turtle  ===
                   Budgerigar  ===
                  Rock pigeon  ===
          Medium ground finch  ===
                       Lizard  ===
             Peregrine falcon  ===
                 Saker falcon  ===
                       Parrot  ===
                     Platypus  ===
                      Wallaby  ===
                Domestic goat  ===
                        Sheep  ===

Inserts between block 1 and 2 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                      Cat 4bp
B D                      Dog 132bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
  D         Little brown bat 1bp
B D                  Opossum 2bp
  D      Collared flycatcher 13bp
B D       American alligator 11bp

Alignment block 2 of 232 in window, 20725549 - 20725556, 8 bps 
B D                     Human  gccatcca
B D                     Chimp  gccctcca
B D                   Gorilla  gccatcca
B D                 Orangutan  gccatcca
B D                    Gibbon  gccatcca
B D                    Rhesus  gccctcca
B D       Crab-eating macaque  gccctcca
B D                    Baboon  gccctcca
B D              Green monkey  gccatcca
B D                  Marmoset  gccatcca
B D           Squirrel monkey  gtcatcca
B D                  Bushbaby  a--atccc
           Chinese tree shrew  gtggtcta
B D                  Squirrel  gccatgca
       Lesser Egyptian jerboa  -----gca
B D                Guinea pig  gctgccta
                   Chinchilla  cccaccta
             Brush-tailed rat  gccaccta
B D                    Rabbit  ggcagtcg
B D                      Pika  gggtgcca
B D                       Pig  ttgatctg
B D                    Alpaca  gcagtcca
               Bactrian camel  gcagtcca
B D                   Dolphin  gcggtctg
                 Killer whale  gcggtctg
             Tibetan antelope  gtggtctg
B D                       Cow  gtggtctg
B D                     Horse  ggggtcta
B D          White rhinoceros  gcggtcta
B D                       Cat  ---gtcta
B D                       Dog  gtgatcta
B D                   Ferret   gtggtcca
B D                     Panda  gtggtcca
               Pacific walrus  gtggtcca
                 Weddell seal  gtggtcca
             Black flying-fox  gcagtcta
B D                   Megabat  gcagtcta
                Big brown bat  gcaggcca
         David's myotis (bat)  gcaggcta
  D          Little brown bat  gcgggcta
B D                  Hedgehog  ggggccca
B D                     Shrew  gcgtgccc
              Star-nosed mole  gggtgccc
B D                  Elephant  -----cca
          Cape elephant shrew  -----cct
B D                   Manatee  -----cca
             Cape golden mole  -----cca
B D                    Tenrec  -----cca
                     Aardvark  -----cca
B D                 Armadillo  ----tcta
B D                   Opossum  tctctcca
B D           Tasmanian devil  ----tc--
  D           Green seaturtle  g-------
B D                       Rat  --------
                Prairie vole  --------
              Golden hamster  --------
B D                     Mouse  --------
B D                Coelacanth  ========
B D              Atlantic cod  ========
                 Spotted gar  ========
B D               Stickleback  ========
          Southern platyfish  ========
B D                      Fugu  ========
B D                 Tetraodon  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
  D    White-throated sparrow  ========
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  ========
B D                    Medaka  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
  D            Painted turtle  ========
B D        American alligator  ========
B D                Budgerigar  ========
B D            Naked mole-rat  --------
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D       Medium ground finch  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D                    Parrot  ========
B D                  Platypus  ========
B D                   Wallaby  ========
B D           Chinese hamster  --------
               Domestic goat  ========
B D                     Sheep  ========

Inserts between block 2 and 3 in window
B D                  Opossum 3bp
  D          Green seaturtle 2bp

Alignment block 3 of 232 in window, 20725557 - 20725563, 7 bps 
B D                     Human  ga----gga--------------gt
B D                     Chimp  ga----gga--------------gt
B D                   Gorilla  ga----gga--------------gt
B D                 Orangutan  aa----gga--------------gt
B D                    Gibbon  ga----gga--------------gt
B D                    Rhesus  ga----gga--------------gt
B D       Crab-eating macaque  ga----gga--------------gt
B D                    Baboon  ga----gga--------------gt
B D              Green monkey  ga----gga--------------gt
B D                  Marmoset  ga----ggg--------------gc
B D           Squirrel monkey  ga----ggg--------------gc
B D                  Bushbaby  ga----gga--------------gt
           Chinese tree shrew  gg----gag----------------
B D                  Squirrel  ga----ggg--------------gt
       Lesser Egyptian jerboa  cg----agg--------------gt
B D                Guinea pig  gg----gga--------------gt
                   Chinchilla  gg----aga--------------gg
             Brush-tailed rat  ga----gga--------------gt
B D                    Rabbit  ca----gg-----------------
B D                      Pika  ca----gga--------------gc
B D                       Pig  ga----gga--------------tt
B D                    Alpaca  ga----gga--------------tt
               Bactrian camel  ga----gga--------------tt
B D                   Dolphin  ga----gga--------------tt
                 Killer whale  ga----gga--------------tt
             Tibetan antelope  ga----gga--------------tt
B D                       Cow  ga----gga--------------tt
B D                     Horse  aa----aga--------------ct
B D          White rhinoceros  ag----gga--------------ct
B D                       Cat  ga----gga--------------ct
B D                       Dog  ga----gga--------------ct
B D                   Ferret   ga----gga--------------ct
B D                     Panda  ga----gga--------------ct
               Pacific walrus  ga----gga--------------ct
                 Weddell seal  ga----gga--------------ct
             Black flying-fox  ga----aga--------------gt
B D                   Megabat  ga----aga--------------gt
                Big brown bat  ca----gga--------------gt
         David's myotis (bat)  ca----gga--------------gt
  D          Little brown bat  cg----ggt--------------gt
B D                  Hedgehog  ca----ggg--------------gt
B D                     Shrew  ca----gtatcttaaactgtgttgt
              Star-nosed mole  ta----g----------------gc
B D                  Elephant  ga----gga--------------gt
          Cape elephant shrew  ga----gaa--------------ct
B D                   Manatee  ga----gga--------------gt
             Cape golden mole  ga----taa--------------at
B D                    Tenrec  gaggagtgg--------------gt
                     Aardvark  ga----gtc--------------at
B D                 Armadillo  gg----ggc--------------gc
B D                   Opossum  aa----tg-----------------
B D           Tasmanian devil  ga----tg-----------------
  D       Collared flycatcher  aa----gat--------------ga
B D        American alligator  gg----ggg--------------gc
  D           Green seaturtle  ag----cgc--------------cg
  D            Painted turtle  gg----ggg--------------gg
B D                       Rat  -------------------------
                Prairie vole  -------------------------
              Golden hamster  -------------------------
B D                     Mouse  -------------------------
B D                Coelacanth  =========================
B D              Atlantic cod  =========================
                 Spotted gar  =========================
B D               Stickleback  =========================
          Southern platyfish  =========================
B D                      Fugu  =========================
B D                 Tetraodon  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
  D              Mallard duck  =========================
          Tibetan ground jay  =========================
B D               Zebra finch  =========================
  D    White-throated sparrow  =========================
    Mexican tetra (cavefish)  =========================
B D                 Zebrafish  =========================
B D                    Medaka  =========================
         Pundamilia nyererei  =========================
                 Zebra mbuna  =========================
       Burton's mouthbreeder  =========================
         Princess of Burundi  =========================
B D              Nile tilapia  =========================
B D                Budgerigar  =========================
B D            Naked mole-rat  -------------------------
  D               Rock pigeon  =========================
B D       Medium ground finch  =========================
B D                    Lizard  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
  D                    Parrot  =========================
B D                  Platypus  =========================
B D                   Wallaby  =========================
B D           Chinese hamster  -------------------------
               Domestic goat  =========================
B D                     Sheep  =========================

Inserts between block 3 and 4 in window
B D                    Shrew 404bp
             Star-nosed mole 3bp

Alignment block 4 of 232 in window, 20725564 - 20725587, 24 bps 
B D                     Human  caaggc--ggggtt--------------------------------cag---------ac----------
B D                     Chimp  caaggc--ggggtt--------------------------------cag---------ac----------
B D                   Gorilla  caaggc--ggggtt--------------------------------cag---------ac----------
B D                 Orangutan  caaggt--ggggtt--------------------------------cag---------ac----------
B D                    Gibbon  caaggc--gggatt--------------------------------cag---------ac----------
B D                    Rhesus  caaggc--ggggtt--------------------------------cag---------ac----------
B D       Crab-eating macaque  caaggc--ggggtt--------------------------------cag---------ac----------
B D                    Baboon  caaggc--agggtt--------------------------------cag---------ac----------
B D              Green monkey  caaggc--ggggtt--------------------------------cag---------ac----------
B D                  Marmoset  caagga--ggtgtt--------------------------------cag---------ac----------
B D           Squirrel monkey  caagga--ggggtt--------------------------------cag---------ac----------
B D                  Bushbaby  caaggt--ggggttca------------------------------cag---------gc----------
           Chinese tree shrew  caaggc--gggctttg------------------------------cac---------gc----------
B D                  Squirrel  gg--------------------------------------------------------------------
       Lesser Egyptian jerboa  agcca-----------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
B D           Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D                       Rat  ----------------------------------------------------------------------
B D                Guinea pig  c---------------------------------------------------------------------
                   Chinchilla  c---------------------------------------------------------------------
             Brush-tailed rat  caagat--agcatcac------------------------------taa---------aaaaaaaaaaaa
B D                    Rabbit  -ccggg--cag-----------------------------------------------------------
B D                      Pika  ctcggg--aac-----------------------------------------------------------
B D                       Pig  cgaggt--gggcgtca------------------------------cag---------ac----------
B D                    Alpaca  caaggt--gggcttca------------------------------cag---------ac----------
               Bactrian camel  caaggt--gggcttca------------------------------cag---------ac----------
B D                   Dolphin  caaggt--gggctcca------------------------------cag---------ac----------
                 Killer whale  caaggt--gggctcca------------------------------cag---------ac----------
             Tibetan antelope  caaggt----------------------------------------------------------------
B D                       Cow  caaggt----------------------------------------------------------------
B D                     Horse  caaggg--gggcctca------------------------------cag---------ac----------
B D          White rhinoceros  caaggt--gggcttca------------------------------cag---------ac----------
B D                       Cat  ccaggt--gggcttca------------------------------cag---------at----------
B D                       Dog  caaggc--aggcttca------------------------------cag---------ac----------
B D                   Ferret   caaggtagaggactcaa--------------------ggtaggctttag---------ac----------
B D                     Panda  caaggt--aggcttca------------------------------cag---------ac----------
               Pacific walrus  ccaggt--aggcttca------------------------------tag---------ac----------
                 Weddell seal  ccaggt--aggtttca------------------------------gag---------ac----------
             Black flying-fox  --aggt--gggcttcc------------------------------cag---------ac----------
B D                   Megabat  --aggt--gggcttca------------------------------cag---------ac----------
                Big brown bat  cacagg--gggctgca------------------------------cag---------ac----------
         David's myotis (bat)  cacagt--gggctgca------------------------------cag---------gc----------
  D          Little brown bat  cacagt--gggctgca------------------------------cag---------gc----------
B D                  Hedgehog  ----------------------------------------------------------------------
              Star-nosed mole  cgaggg--gggctgca------------------------------cag---------------------
B D                  Elephant  --------------------------------------------------------------------tg
          Cape elephant shrew  --------------------------------------------------------------------ca
B D                   Manatee  --------------------------------------------------------------------tg
             Cape golden mole  --------------------------------------------------------------------ca
B D                    Tenrec  --------------------------------------------------------------------ag
                     Aardvark  --------------------------------------------------------------------ca
B D                 Armadillo  --------------------------------------------------------------------ca
B D                   Opossum  ---------------------------------------------------------------------g
B D           Tasmanian devil  ---------------------------------------------------------------------g
  D       Collared flycatcher  ------cttggctccagccccactgctggcacccctcggtgcttttctg---------ct----------
B D        American alligator  ------ctggg----------------------cctgggcgtgggcctg---------------------
  D           Green seaturtle  ------ccggg-----------------------------------ctgtttccacgact----------
  D            Painted turtle  ------caggg-----------------------------------ctg-------ggct----------
B D                     Shrew  ======================================================================
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                Budgerigar  ======================================================================
B D            Naked mole-rat  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================

                        Human  -a----c-atggg------
                        Chimp  -a----c-atggg------
                      Gorilla  -a----c-atggg------
                    Orangutan  -a----c-gtggg------
                       Gibbon  -a----c-gtggg------
                       Rhesus  -a----t-gtggg------
          Crab-eating macaque  -a----t-gtggg------
                       Baboon  -a----t-gtggc------
                 Green monkey  -a----t-gtggg------
                     Marmoset  -a----t-gtggg------
              Squirrel monkey  -a----c-gtggg------
                     Bushbaby  -a----t-gtggc------
           Chinese tree shrew  -a----c-atgga------
                     Squirrel  -a----g-gtggg------
       Lesser Egyptian jerboa  -a----a-gtggg------
                 Prairie vole  -attccg-gtggg------
              Chinese hamster  -a----g-gtggg------
               Golden hamster  -a----g-gcggg------
                        Mouse  -a----a-gtggg------
                          Rat  -a----g-gtgga------
                   Guinea pig  -a----a-gacca------
                   Chinchilla  -a----g-aaggg------
             Brush-tailed rat  -a----a-gatgg------
                       Rabbit  -a----t-ggcgc------
                         Pika  -a----t-ggagg------
                          Pig  -a----c-atggg------
                       Alpaca  -g----c-gtggg------
               Bactrian camel  -g----c-gtggg------
                      Dolphin  -a----c-acggg------
                 Killer whale  -a----c-acggg------
             Tibetan antelope  -----------gg------
                          Cow  -----------gg------
                        Horse  -a----t-gcagg------
             White rhinoceros  -a----c-acagg------
                          Cat  -a----c-aggga------
                          Dog  -a----c-atgga------
                      Ferret   -a----c-atagg------
                        Panda  -a----c-atacg------
               Pacific walrus  -a----c-atggg------
                 Weddell seal  -a----c-atgcg------
             Black flying-fox  -a----t-agggg------
                      Megabat  -a----t-agggg------
                Big brown bat  -a----c-atggg------
         David's myotis (bat)  -a----c-atggg------
             Little brown bat  -a----c-atggg------
                     Hedgehog  -a----c-actgg------
              Star-nosed mole  -a----c-accgg------
                     Elephant  -g----gcgtggg------
          Cape elephant shrew  -g----g-gcggg------
                      Manatee  -g----g-gtggg------
             Cape golden mole  -g----g-gtggg------
                       Tenrec  -g----g-atggg------
                     Aardvark  -g----g-gtggg------
                    Armadillo  -a----g-gtggg------
                      Opossum  aa----g-agggg------
              Tasmanian devil  -a----g-agcga------
          Collared flycatcher  -g----c-ccagg-----g
           American alligator  -g----g-cctgg-----g
              Green seaturtle  -g----g-tttggaacacg
               Painted turtle  -g----g-caggg-----g
                        Shrew  ===================
                   Coelacanth  ===================
                 Atlantic cod  ===================
                  Spotted gar  ===================
                  Stickleback  ===================
           Southern platyfish  ===================
                         Fugu  ===================
                    Tetraodon  ===================
                       Turkey  ===================
                      Chicken  ===================
                 Mallard duck  ===================
           Tibetan ground jay  ===================
                  Zebra finch  ===================
       White-throated sparrow  ===================
     Mexican tetra (cavefish)  ===================
                    Zebrafish  ===================
                       Medaka  ===================
          Pundamilia nyererei  ===================
                  Zebra mbuna  ===================
        Burton's mouthbreeder  ===================
          Princess of Burundi  ===================
                 Nile tilapia  ===================
                   Budgerigar  ===================
               Naked mole-rat  -------------------
                  Rock pigeon  ===================
          Medium ground finch  ===================
                       Lizard  ===================
             Peregrine falcon  ===================
                 Saker falcon  ===================
                       Parrot  ===================
                     Platypus  ===================
                      Wallaby  ===================
                Domestic goat  ===================
                        Sheep  ===================

Inserts between block 4 and 5 in window
B D                  Opossum 74bp
B D          Tasmanian devil 61bp

Alignment block 5 of 232 in window, 20725588 - 20725630, 43 bps 
B D                     Human  ----------------------ct-----gagc----------cttgaagagtg-ag-t-g--------g
B D                     Chimp  ----------------------ct-----gagc----------cttgaagagtg-ag-t-g--------g
B D                   Gorilla  ----------------------ct-----gagc----------cttgaagagtg-ag-t-g--------g
B D                 Orangutan  ----------------------ct-----gagc----------cttcaagagtg-ag-t----------g
B D                    Gibbon  ----------------------ct-----gagc----------cctgaagagtg-ag-t-g--------g
B D                    Rhesus  ----------------------ct-----gagc----------cctg----gtg-ag-t-g--------g
B D       Crab-eating macaque  ----------------------ct-----gagc----------cctgaagagtg-ag-t-g--------g
B D                    Baboon  ----------------------ct-----gagc----------cctgaagagtg-ag-t-g--------g
B D              Green monkey  ----------------------ct-----gagc----------cctgaagagtg-ag-t-g--------g
B D                  Marmoset  ----------------------tt-----gagc----------cctgaagagtg-ag-t-g--------g
B D           Squirrel monkey  ----------------------tt-----gagc----------cctgaagagtg-ag-t-g--------g
B D                  Bushbaby  ----------------------ct-----gagc----------cttgaagggca-ag-tca--------g
           Chinese tree shrew  ----------------------cc-----aagc----------cttgaggggta-ag-t-----------
B D                  Squirrel  ----------------------ca-----gagc----------cctaaaggtga-gt-g-g--------g
       Lesser Egyptian jerboa  ----------------------ct-----cggt----------ctcgcagggagagt-g-g--------g
                 Prairie vole  ----------------------ct-----gggc----------tttgaagagtc-at-g-g--------g
B D           Chinese hamster  ----------------------ct-----ggac----------ttagaagggtg-gt-g-g--------g
               Golden hamster  ----------------------ct-----gggc----------ttaggagggtg-gt-g-g--------g
B D                     Mouse  ----------------------ct-----gagc----------tttgaaaggtg-gtgg-g--------g
B D                       Rat  ----------------------gt-----agac----------tttgaagggtg-ac-g-g--------g
B D            Naked mole-rat  -----------------------------gggc----------ttcacagacat-gt-g-g--------g
B D                Guinea pig  ----------------------cttc-ccaggc----------gtcacaggcac--c-a-ggcaggaaag
                   Chinchilla  ----------------------cttcacagggc----------ttcacgggcac--t-g-g--------g
             Brush-tailed rat  ----------------------cttcactgggc----------ctcacaggcac--c-g-g--------g
B D                    Rabbit  ----------------------tt-----tgcc----------cagatgagaag-gc-a-g--------g
B D                      Pika  ----------------------ct-----gagc----------ctcaagggcag-ac-a-g--------t
B D                       Pig  ----------------------ct-----gagc----------cccaaagggcaaga-t-g--------g
B D                    Alpaca  ----------------------ct-----gagt----------cttgaagggcaggt-t-g--------g
               Bactrian camel  ----------------------ct-----gagc----------cttgaagggcaggt-t-g--------g
B D                   Dolphin  ----------------------ct-----gagc----------ctcaaagggcgagt-t-g--------g
                 Killer whale  ----------------------ct-----gagc----------ctcaaagggcgagt-t-g--------g
             Tibetan antelope  ----------------------ct-----gagc----------cccaaagggcaagc-t-g--------g
B D                       Cow  ----------------------ct-----gagc----------cccaaagggcaagc-t-g--------g
B D                     Horse  ----------------------ct-----gagc----------cttgaagggcaagc-t-g--------g
B D          White rhinoceros  ----------------------ct-----gagc----------cttgaagggcaagt-t-g--------g
B D                       Cat  ----------------------ct-----g-gc----------cttgaagggcaagt-t-g--------g
B D                       Dog  ----------------------ct-----a-gc----------cttgaagagcaagc-t-g--------g
B D                   Ferret   ----------------------ct-----g-gc----------cttaaagggcaagc-t-g--------g
B D                     Panda  ----------------------ct-----g-gc----------cctgaagggcaagc-t-g--------g
               Pacific walrus  ----------------------ct-----g-gc----------cttgaagggcaaac-t-g--------g
                 Weddell seal  ----------------------ct-----g-gc----------cttgaagggcaagc-t-g--------g
             Black flying-fox  ----------------------ct-----gagc----------cttgaagggcaaat-t-a--------g
B D                   Megabat  ----------------------ct-----gagc----------cttgaagggcaaat-t-a--------g
                Big brown bat  ----------------------ct-----gagc----------cttgaagggcaagt-t-g--------g
         David's myotis (bat)  ----------------------ct-----gagc----------cttgaagggcaagt-t-g--------g
  D          Little brown bat  ----------------------ct-----gagc----------cttgaagggcaagt-t-g--------g
B D                  Hedgehog  ----------------------ca-----gagc----------cttgatggtctgac-t-g--------g
              Star-nosed mole  ----------------------tg-----gg------------cctgcagggcaagc-t-g--------g
B D                  Elephant  ----------------------cttca--gacc----------cttgaagggcacac-t-g--------g
          Cape elephant shrew  ----------------------cttca-------------------gaaaggtgggc-t-g--------g
B D                   Manatee  ----------------------cttca--gacc----------cttgaagggcacgc-t-g--------g
             Cape golden mole  ----------------------cttca--gaca----------catgga-tgtccct-t-g--------a
B D                    Tenrec  ----------------------ctttg--gaca----------cctgggctgtgcct-t-g--------a
                     Aardvark  ----------------------cttca--gaca----------catgggttgtgcct-t-g--------a
B D                 Armadillo  ----------------------cttca--cacacagccggagccttgaagggcaagt-t-g--------g
B D           Tasmanian devil  ----------------------ca-----gtgc----------cttacataggaggt-g-g--------g
  D       Collared flycatcher  cagg----------tgggaggccc-----cagc----------agcgaggtga-----------------
B D        American alligator  ctggg--------ctgggaggcct-----cagc----------caggcactgg-----------------
  D           Green seaturtle  cagcgtgtt----ctgcagcgcgc-----tgg-----------agtggggggt-----------------
  D            Painted turtle  ctgtgggttgggagtgaggggcac-----cggc----------agagctgggg-----------------
B D                     Shrew  ======================================================================
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================

                        Human  a--------------atgtgct--------------a--------------------gga-tg---aga-
                        Chimp  a--------------atgtgct--------------a--------------------gga-tg---aga-
                      Gorilla  a--------------atgtgct--------------a--------------------gga-tg---aga-
                    Orangutan  a--------------atgtgcc--------------a--------------------gga-tg---aga-
                       Gibbon  a--------------atgtgcc--------------a--------------------gga-tg---aga-
                       Rhesus  a--------------atgtgcc--------------a--------------------gga-tg---aga-
          Crab-eating macaque  a--------------atgtgcc--------------a--------------------gga-tg---aga-
                       Baboon  a--------------atgtgcc--------------a--------------------gga-tg---aga-
                 Green monkey  a--------------atgtgcc--------------a--------------------aga-tg---aga-
                     Marmoset  a--------------atgcacc--------------a--------------------gga-tg---aaa-
              Squirrel monkey  a--------------atgcacc--------------a--------------------gga-tg---aga-
                     Bushbaby  a--------------atctgcc--------------a--------------------aga-cg---aga-
           Chinese tree shrew  -----------------gtgcg--------------t--------------------gtg-tg---agat
                     Squirrel  g-----------------------------------t--------------------gag-aa---agg-
       Lesser Egyptian jerboa  g--------------actagct--------------g--------------------gaa-ggctcagc-
                 Prairie vole  a--------------actagcc--------------a--------------------gga-tg---agg-
              Chinese hamster  a--------------attagcc--------------a--------------------gga-tg---agg-
               Golden hamster  g--------------actaggc--------------a--------------------gga-tg---agg-
                        Mouse  a--------------atgagcc--------------g--------------------ggg-tg---agg-
                          Rat  a--------------aggagca--------------a--------------------gga-gg---aag-
               Naked mole-rat  g--------------ctgagccctgagggtaaggagg--------------------tga-gg---agg-
                   Guinea pig  g--------------gggagtcctgagggtaaagagg--------------------gga-gg---agg-
                   Chinchilla  g--------------ctgagccctg-aggcatggagg--------------------tga-gg---agg-
             Brush-tailed rat  g--------------ccaagctctgaaggcaaagagg--------------------tga-gg---agg-
                       Rabbit  g--------------ggagacc--------------a--------------------cgc-cg---aga-
                         Pika  g--tagagacaggacagaggcc--------------a--------------------tgcacg---agc-
                          Pig  a--------------attttcc--------------a--------------------gga-gg---aga-
                       Alpaca  a--------------atttgcc--------------a--------------------gga-tg---aga-
               Bactrian camel  a--------------atttgcc--------------a--------------------gga-tg---aga-
                      Dolphin  a--------------atttgcc--------------a--------------------gga-tg---aga-
                 Killer whale  a--------------atttgcc--------------a--------------------gga-tg---aga-
             Tibetan antelope  a--------------atttgcc--------------a--------------------ggg-tg---at--
                          Cow  a--------------atttgcc--------------a--------------------ggg-gg---ag--
                        Horse  g--------------atctgtc--------------a--------------------aga-tg---aga-
             White rhinoceros  a--------------acctgcc--------------a--------------------gga-tg---aga-
                          Cat  a--------------atttgcc--------------a--------------------g----------a-
                          Dog  a--------------ctttgcc--------------a--------------------g------------
                      Ferret   a--------------atttgcc--------------a--------------------g----------a-
                        Panda  a--------------acttgcc--------------a--------------------g----------a-
               Pacific walrus  a--------------acttgcc--------------a--------------------g----------a-
                 Weddell seal  a--------------acttgcc--------------a--------------------g----------a-
             Black flying-fox  a--------------atttgcc--------------a--------------------gga-tg---aga-
                      Megabat  a--------------atttgcc--------------a--------------------gga-tg---aga-
                Big brown bat  a--------------atttgcc--------------a--------------------gga-tg---aga-
         David's myotis (bat)  a--------------attttcc--------------a--------------------gga-tg---aga-
             Little brown bat  a--------------atttgcc--------------a--------------------gga-tg---aga-
                     Hedgehog  a--------------gtctgcc------------------------------------------------
              Star-nosed mole  g------------tcgccagct--------------g-------------------------------a-
                     Elephant  a--------------gtttg-c--------------a--------------------atg-tg---aga-
          Cape elephant shrew  c--------------gtatg-t--------------a--------------------ggg-ag---aga-
                      Manatee  a--------------gtttg-c--------------a--------------------aga-tg---aga-
             Cape golden mole  ---------------------------------------------------------ggg-tg---agg-
                       Tenrec  a--------------ggata-t--------------gcccagctggcaccccatggggga-ta---agg-
                     Aardvark  aggtaagcctggggtgtttt-c--------------a--------------------ggg-tg---aga-
                    Armadillo  a--------------gtctgcc--------------a--------------------gga-cg---aga-
              Tasmanian devil  c--------------acaa---------------------------------------------------
          Collared flycatcher  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------
              Green seaturtle  ----------------------------------------------------------------------
               Painted turtle  ----------------------------------------------------------------------
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================

                        Human  -aggg
                        Chimp  -aggg
                      Gorilla  -aggg
                    Orangutan  -aggg
                       Gibbon  -aggg
                       Rhesus  -aggg
          Crab-eating macaque  -aggg
                       Baboon  -aggg
                 Green monkey  -aggg
                     Marmoset  -aggg
              Squirrel monkey  -aggg
                     Bushbaby  -aggg
           Chinese tree shrew  gaggg
                     Squirrel  -a-gg
       Lesser Egyptian jerboa  -g-ag
                 Prairie vole  -g-aa
              Chinese hamster  -g-ag
               Golden hamster  -g-ag
                        Mouse  -g-ag
                          Rat  -g-ag
               Naked mole-rat  -gcag
                   Guinea pig  -gcag
                   Chinchilla  -gcag
             Brush-tailed rat  -gctg
                       Rabbit  -gaag
                         Pika  -agag
                          Pig  -aggg
                       Alpaca  -a-gg
               Bactrian camel  -aggg
                      Dolphin  -aggg
                 Killer whale  -aggg
             Tibetan antelope  --ggg
                          Cow  --ggg
                        Horse  -aaag
             White rhinoceros  -aagg
                          Cat  -aggg
                          Dog  -aggg
                      Ferret   -aggg
                        Panda  -agag
               Pacific walrus  -aggg
                 Weddell seal  -agcg
             Black flying-fox  -aagg
                      Megabat  -aagg
                Big brown bat  -aggt
         David's myotis (bat)  -aggt
             Little brown bat  -aggt
                     Hedgehog  -----
              Star-nosed mole  -cggc
                     Elephant  -aggg
          Cape elephant shrew  -gggg
                      Manatee  -aggg
             Cape golden mole  -aggg
                       Tenrec  -aaga
                     Aardvark  -aggg
                    Armadillo  -ggcg
              Tasmanian devil  -----
          Collared flycatcher  -----
           American alligator  -----
              Green seaturtle  -----
               Painted turtle  -----
                        Shrew  =====
                   Coelacanth  =====
                 Atlantic cod  =====
                  Spotted gar  =====
                  Stickleback  =====
           Southern platyfish  =====
                         Fugu  =====
                    Tetraodon  =====
                       Turkey  =====
                      Chicken  =====
                 Mallard duck  =====
           Tibetan ground jay  =====
                  Zebra finch  =====
       White-throated sparrow  =====
     Mexican tetra (cavefish)  =====
                    Zebrafish  =====
                       Medaka  =====
          Pundamilia nyererei  =====
                  Zebra mbuna  =====
        Burton's mouthbreeder  =====
          Princess of Burundi  =====
                 Nile tilapia  =====
                   Budgerigar  =====
                      Opossum  =====
                  Rock pigeon  =====
          Medium ground finch  =====
                       Lizard  =====
             Peregrine falcon  =====
                 Saker falcon  =====
                       Parrot  =====
                     Platypus  =====
                      Wallaby  =====
                Domestic goat  =====
                        Sheep  =====

Alignment block 6 of 232 in window, 20725631 - 20725712, 82 bps 
B D                     Human  ga-gg-----ggatgcc------------a--g------------a--------------ca-gaa----
B D                     Chimp  ga-gg-----ggatgcc------------a--g------------a--------------ca-gaa----
B D                   Gorilla  ga-gg-----ggatgcc------------a--g------------a--------------ca-gaa----
B D                 Orangutan  gg-gg-----ggatgcc------------a--g------------a--------------ca-gaa----
B D                    Gibbon  gaggg-----ggatgcc------------a--g------------a--------------ca-gaa----
B D                    Rhesus  gaggg-----gggtgcc------------a--g------------a--------------ca-gaa----
B D       Crab-eating macaque  gaggg-----gggtgcc------------a--g------------a--------------ca-gaa----
B D                    Baboon  gaggg-----gggtgcc------------a--g------------a--------------ca-gaa----
B D              Green monkey  gaggg-----gggtgcc------------a--g------------a--------------ca-gaa----
B D                  Marmoset  gaggg-----ggatgta------------a--g------------g--------------ta-gaa----
B D           Squirrel monkey  gaggg-----ggatgta------------a--g------------g--------------ca-gaa----
B D                  Bushbaby  gaggg-----gcatt-------------------------------------------------------
           Chinese tree shrew  gaggg-----gcgctcc------------a--g------------g--------------ca-gagctcc
B D                  Squirrel  ggcaa-----gccctccaggcaaggagggc--g------------g--------------catgag----
       Lesser Egyptian jerboa  gctggacactgcactctg-----------c--g------------a--------------ca-tat----
                 Prairie vole  ggtgg-----gcacccta-----------c--a------------g--------------ca-gag----
B D           Chinese hamster  ggtgg-----gcac-cca-----------t--a------------g--------------ca-gag----
               Golden hamster  ggcgg-----gcactcca-----------c--g------------g--------------ca-gag----
B D                     Mouse  gttgg-----gccgtcc------------c--a------------g--------------ga-gag----
B D                       Rat  ggcgg-----gctctc-----------------------------------------------gac----
B D            Naked mole-rat  ggcag-----gcattc-------------a--g------------g--------------ca-gag----
B D                Guinea pig  ggcag-----gcattc-------------a--g------------g--------------ta-gag----
                   Chinchilla  ggcag-----gcattc-------------a--g------------g--------------ta-gag----
             Brush-tailed rat  ggcag-----tcattc-------------a--g------------g--------------ta-gag----
B D                    Rabbit  agcag-----gagc---------------a--a--------tctcg--------------ag-gcg----
B D                      Pika  gcctg-----gtac---------------t--ggctgcactcctcg--------------aa-gct----
B D                       Pig  gaagg-----ggg-ttc------------a--g------------g--------------ca-gag----
B D                    Alpaca  gaagg-----aaa-ttc------------a---------------g--------------ca-gaa----
               Bactrian camel  gaagg-----aga-ttc------------a---------------g--------------ca-gaa----
B D                   Dolphin  gaagg-----ggt-tgc------------a--g------------g--------------ca-gag----
                 Killer whale  gaagg-----ggt-tgc------------a--g------------g--------------ca-gag----
             Tibetan antelope  gaggg-----gcg-tgg------------a--g------------g--------------ca-gac----
B D                       Cow  gaggg-----gca-tgg------------a--g------------g--------------ca-gac----
B D                     Horse  gaagg-----ggattc--------------------------------------------ca-ggt----
B D          White rhinoceros  gaagg-----gaattct------------c--g------------g--------------ca-gac----
B D                       Cat  gaagg-----gaattcc------------a--g------------g--------------ca-gag----
B D                       Dog  gaagt-----gaatttc------------a--g------------g--------------ca-gag----
B D                   Ferret   gaagg-----gaattcc------------a--g------------g--------------ct-aag----
B D                     Panda  gaagg-----gaattcc------------a--g------------g--------------cc-cag----
               Pacific walrus  gaagg-----gaattcc------------a--g------------g--------------cc-aag----
                 Weddell seal  gaagg-----gaattcc------------a--g------------g--------------cc-aag----
             Black flying-fox  gaagg-----gcattcc------------a--g------------g--------------ca-gag----
B D                   Megabat  gaagg-----gcattcc------------c--g------------g--------------tg-gag----
                Big brown bat  gaagg-----gca-ccc------------a--g------------g--------------ga-gag----
         David's myotis (bat)  gaagg-----gca-ccc------------a--g------------g--------------ta-gag----
  D          Little brown bat  gaagg-----gca-ccc------------a--g------------g--------------ta-gag----
B D                  Hedgehog  --agg-----acactcc------------a--g------------a--------------ca-gtg----
              Star-nosed mole  gaagg-----gtgtccc------------g--g----------------------------a-gcg----
B D                  Elephant  gatgg-----gcactct------------a--g------------g--------------ca-gag----
          Cape elephant shrew  gac-a-----gtggtcc------------a--a------------a--------------ca-gag----
B D                   Manatee  aca-g-----gcactcc------------a--g------------a--------------ca-gag----
             Cape golden mole  gctgg-----gtactcc------------a--g------------t--------------cg-gga----
B D                    Tenrec  ggcag-----gcactca------------g--g------------g--------------ca-g------
                     Aardvark  gaggg-----gaactcc------------a--g------------g--------------aa-gag----
B D                 Armadillo  ggagg-----gcactcc------------a--g------------g--------------ca-gag----
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
  D       Collared flycatcher  ----------------------------gagcg------------gccagtgatttcctgca-gag----
B D        American alligator  ----------------------------ga--g------------gcc------------ca-ggt----
  D           Green seaturtle  ----------------------------gg--g------------gct------------ca-ggg----
  D            Painted turtle  ----------------------------gg--g------------g--------------ca-ggg----
B D                     Shrew  ======================================================================
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================

                        Human  c---------------ggcatga------gcga------aggcctg-------------------gagg-
                        Chimp  c---------------ggcatga------gcga------aggcctg-------------------gagg-
                      Gorilla  c---------------ggcatga------gcga------aggcctg-------------------gagg-
                    Orangutan  c---------------ggcatga------gcga------aggcctg-------------------gtgg-
                       Gibbon  c---------------ggcatga------gcga------aggcctg-------------------gtgg-
                       Rhesus  t---------------ggcatga------gcga------agcccta-------------------gtgg-
          Crab-eating macaque  t---------------ggcatga------gcga------agcccta-------------------gtgg-
                       Baboon  t---------------ggcatga------gcga------agcccta-------------------gtgg-
                 Green monkey  t---------------ggcatga------ccga------agcccta-------------------gtgg-
                     Marmoset  c---------------agcatga------gcaa------aagcctg-------------------gctg-
              Squirrel monkey  c---------------ggcatga------gcaa------aggcctg-------------------gctg-
                     Bushbaby  -----------------------------gcag------aggccag-------------------gcag-
           Chinese tree shrew  c---------------agcctga------gc-a------aggcctg-------------------gtgg-
                     Squirrel  c------------------------------aa------aggcctg-------------------gcca-
       Lesser Egyptian jerboa  ag-----------------------------aa------aggtctg-------------------gccg-
                 Prairie vole  a------------------------------aa------agtaccg-------------------gcta-
              Chinese hamster  a------------------------------aa------agtccca-------------------gcta-
               Golden hamster  a------------------------------aa------agtccta-------------------gcta-
                        Mouse  a------------------------------aa------agtcctg-------------------tcta-
                          Rat  a------------------------------gg------agtcctg-------------------gcta-
               Naked mole-rat  ---------------tggcacca------gcaa------caacctg-------------------acag-
                   Guinea pig  aa-------------cgg------------------------------------------------cag-
                   Chinchilla  aa-------------tggcatca------gcaa------aggcctg-------------------acag-
             Brush-tailed rat  aa-------------tggcacca------gcaa------aagcctg-------------------acag-
                       Rabbit  ag-------------aggc------------ca------ggtctcc-------------------gcct-
                         Pika  a--------------agca------------ca------ggctctg-------------------gcct-
                          Pig  agaa-----------cagcaggg------gcaa------aggccag-------------------gcag-
                       Alpaca  agaa-----------taacaggg------gcaa------aggcctg-------------------gcag-
               Bactrian camel  agaa-----------taacaggg------gcaa------aggcctg-------------------gcag-
                      Dolphin  agaa-----------cagcaagg------gcaa------aggcctg-------------------gcag-
                 Killer whale  agaa-----------cagcaagg------gcaa------aggcctg-------------------gcag-
             Tibetan antelope  agaa-----------cagcaagg------gcaa------aggcctg-------------------gcag-
                          Cow  agaa-----------cagcaaga------gcaa------aggcctg-------------------gcag-
                        Horse  agaa-----------cagtgtga------gcag------aggcctg-------------------gcag-
             White rhinoceros  agaa-----------cagtatga------gcag------agacctg-------------------gcag-
                          Cat  agaa-----------cagcacga------gcaa------aggcctg-------------------gcag-
                          Dog  agaa-----------cagcatga------gcaa------aggccta-------------------gtag-
                      Ferret   ----------------agcatga------gcaa------aagcctg-------------------gcag-
                        Panda  ag-a-----------cagcatga------gcaa------aggcctg-------------------acag-
               Pacific walrus  ag-a-----------cagcatga------gcaa------aggcctg-------------------gcag-
                 Weddell seal  ag-a-----------cagcatga------gcaa------aggcctg-------------------gcag-
             Black flying-fox  agag-----------cagcagga------gcag------aggcctg-------------------gcag-
                      Megabat  agag-----------cagcagga------gcag------aggcctg-------------------gcag-
                Big brown bat  agaa-----------cagcagga------gcaa------aggtgtg-------------------gcag-
         David's myotis (bat)  agaa-----------cagcagga------gcca------aggtgtg-------------------gcag-
             Little brown bat  ggaa-----------cagcagga------gcaa------aggtgtg-------------------gcag-
                     Hedgehog  ggaa-----------cagcatga------gcaaagggccagggctg-------------------gcaa-
              Star-nosed mole  gggg-----------cggcacaa------gca-------aggcctg-------------------gctg-
                     Elephant  agaa-----------cagcatgc------acaa------aggcttg-------------------gagg-
          Cape elephant shrew  agaa-----------ca------------acaa------aggcctg-------------------gaga-
                      Manatee  agaa-----------caacacac------gcaa------aggcctg-------------------gaag-
             Cape golden mole  agaa-----------cagcataa------gcca------aggcctg-------------------gatg-
                       Tenrec  agaa-----------cagcatgg------gcag------aggcctg-------------------ga-g-
                     Aardvark  agga-----------cacaatgt------gcaa------aggcctg-------------------gagg-
                    Armadillo  ggga-----------cagcaggg------gcaa------aggccta-------------------gagg-
                      Opossum  ------------------taggggatgtgtggg------agctcca-------------------gaggt
              Tasmanian devil  -----------------------------gggg------ggaccca-------------------ctgg-
          Collared flycatcher  cctgcagggagggtgccacggcc------accg------gaggctgtgtgccccaaccatctcactgagt
           American alligator  tctg------ggctgccgcag-c------accc------gggcttgccaggctctgcc--cgcatggag-
              Green seaturtle  tcgg----------------gct------gggg------gggtctgttggtggc-----------gcag-
               Painted turtle  ccgg----------------gct------agca------ggggctgcgggtcg------------ggag-
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================

                        Human  -tgtga-ctctccactctcta--------agcgcgtggccag-attcccgc
                        Chimp  -tgtga-ctctccactctcta--------agcgcgtggccag-attcccgc
                      Gorilla  -tgtga-ctctccactctcta--------agcgcgtggccag-attcccgc
                    Orangutan  -tgtga-ctctccactctcta--------agcgtgtggccag-gttcccgc
                       Gibbon  -tgtga-ctctccactctcta--------agcgcatggccag-gttcccgc
                       Rhesus  -tgtga-ctctccattctcca--------agcgcgtggccag-gttcccgc
          Crab-eating macaque  -tgtga-ctctccattctcca--------agcgcgtggccag-gttcccgc
                       Baboon  -tgtga-ctctccattctcca--------agcgcgtggccag-gttcccgc
                 Green monkey  -tgtga-ctctccattctcca--------agcgcgtggccag-gttcccgc
                     Marmoset  -tgtga-atttctactctcca--------ggcatgtggccag-attcccac
              Squirrel monkey  -tgtga-atttccactctcca--------ggcgtgtggccaa-gttcccac
                     Bushbaby  -ggtgacccccccagtctcta--------agtgcagggccag-gttcctgc
           Chinese tree shrew  -tgtgc-acctgccct------------------ggggccag-gttcccac
                     Squirrel  ----ga------------------------------c--------------
       Lesser Egyptian jerboa  ----gc---------------------------tctg--------------
                 Prairie vole  ----gt---------------------------------------------
              Chinese hamster  ----gt---------------------------------------------
               Golden hamster  ----gc---------------------------------------------
                        Mouse  ----gt---------------------------tttg--------------
                          Rat  ----gt---------------------------tttg--------------
               Naked mole-rat  ----gt-------gacctgca--------cattcgta--------------
                   Guinea pig  ----gt-------gccatgaa--------agtctgtg--------------
                   Chinchilla  ----gt-------gccctgca--------agtttgtg--------------
             Brush-tailed rat  ----------------------------------gtg--------------
                       Rabbit  ----gc---------------------------------------------
                         Pika  ----gc---------------------------------------------
                          Pig  -tgtga-ccttctgatctcta--------aggacacagcctg-gtccccac
                       Alpaca  -tgtga-ctctctgatctcta--------agggcacagccta-gtcctcac
               Bactrian camel  -tgtga-ctctctgatctcta--------agggcacagccta-gtcctcac
                      Dolphin  -tgtga-ccctccgatctcta--------agggcacagcctg-gtccccac
                 Killer whale  -tgtga-ccctccgatctcta--------agggcacagcctg-gtccccac
             Tibetan antelope  -tgtga-gcctcc----------------------tggcctg-gtgcccat
                          Cow  -tgtga-gcctcc----------------------cggcctg-gtgcccat
                        Horse  -gatga-gcctccaatttcta--------aacgcatggcctg-gtccctac
             White rhinoceros  -tgtgg-ccctccaatttcta--------aatgcatggcctg-gtccctac
                          Cat  -tgtga-ccatccaatttcta--------agcacatgtcctg-acacccac
                          Dog  -tgtga-ccatccaatttcta--------agcacctggcctg-atccccac
                      Ferret   -agtga-ctatccaatttcta--------agcacatggcctg-atccccat
                        Panda  -tgtga-ccacccaatttcta--------agcatgtggcctg-atccccac
               Pacific walrus  -tgtga-ccacccaatttcta--------agcacatggcctg-atccccat
                 Weddell seal  -tgtga-ccacccaatttcta--------agcacatggcctg-atccccat
             Black flying-fox  -ggtga-ccctccaatctcca--------agcacatggcctg-gt------
                      Megabat  -ggtga-ccctccaatctcca--------agcacatggcctg-gt------
                Big brown bat  -gggga-ccttccaatcccca--------agtacatggccta-gt------
         David's myotis (bat)  -ggtga-ccttccaacaccca--------agtgcatggccta-gt------
             Little brown bat  -ggtga-ccttccaacaccca--------agtgcatggccta-gt------
                     Hedgehog  -cgtgc-tcctcctgtctcca--------cgcacgcgacctg-ctccccac
              Star-nosed mole  -tgtga-gcctgagggct--a--------cgcgcgtggcctgtctccccac
                     Elephant  -ggtga-ccccgcaatttcca--------agtgcagggccag-ggccccac
          Cape elephant shrew  -tgtga-cccttcaattgcca--------aatgtaaatccag-gcccccac
                      Manatee  -gttga-ccctacaatttcca--------agtgcagggccag-ggtcccac
             Cape golden mole  -ggtga-ccctccaatttcta--------aatgcagggccag-gtctccac
                       Tenrec  -ggtga-cactccaatgtcca--------catgcagggccgg-g-ccctgc
                     Aardvark  -ggtca-ccctccagttttga--------gctgcagaatcag-gtccccct
                    Armadillo  -tgtgg-ccttccagtctctg------------------------ccacac
                      Opossum  -cacgg-ccctcctccccctcccccctggagtgcaggtcctgggtgccccc
              Tasmanian devil  ----ag-ccctccactacctc------ggggggagcctcct--ctcccccc
          Collared flycatcher  ccccgt-ggtgc---------------------------------------
           American alligator  -catgc-gctgc---------------------------------------
              Green seaturtle  -tctgt-gacgc---------------------------------------
               Painted turtle  -tgagg-ggcac---------------------------------------
                        Shrew  ===================================================
                   Coelacanth  ===================================================
                 Atlantic cod  ===================================================
                  Spotted gar  ===================================================
                  Stickleback  ===================================================
           Southern platyfish  ===================================================
                         Fugu  ===================================================
                    Tetraodon  ===================================================
                       Turkey  ===================================================
                      Chicken  ===================================================
                 Mallard duck  ===================================================
           Tibetan ground jay  ===================================================
                  Zebra finch  ===================================================
       White-throated sparrow  ===================================================
     Mexican tetra (cavefish)  ===================================================
                    Zebrafish  ===================================================
                       Medaka  ===================================================
          Pundamilia nyererei  ===================================================
                  Zebra mbuna  ===================================================
        Burton's mouthbreeder  ===================================================
          Princess of Burundi  ===================================================
                 Nile tilapia  ===================================================
                   Budgerigar  ===================================================
                  Rock pigeon  ===================================================
          Medium ground finch  ===================================================
                       Lizard  ===================================================
             Peregrine falcon  ===================================================
                 Saker falcon  ===================================================
                       Parrot  ===================================================
                     Platypus  ===================================================
                      Wallaby  ===================================================
                Domestic goat  ===================================================
                        Sheep  ===================================================

Inserts between block 6 and 7 in window
B D                  Opossum 6bp
B D          Tasmanian devil 6bp
  D      Collared flycatcher 10bp
B D       American alligator 7bp
  D          Green seaturtle 1bp

Alignment block 7 of 232 in window, 20725713 - 20725727, 15 bps 
B D                     Human  ccctgggccct-----ag--------gg
B D                     Chimp  ccctgggccct-----ag--------gg
B D                   Gorilla  ccctgggccct-----ag--------gg
B D                 Orangutan  ccctgggccct-----ag--------gg
B D                    Gibbon  ccctgggccct-----ag--------gg
B D                    Rhesus  ccctgggccct-----ag--------gg
B D       Crab-eating macaque  ccctgggccct-----ag--------gg
B D                    Baboon  ccctgggccct-----ag--------gg
B D              Green monkey  ccctggaccct-----ag--------gg
B D                  Marmoset  ccctgggccct-----gg--------ga
B D           Squirrel monkey  cccccggcccc-----gg--------ga
B D                  Bushbaby  ctctcggcacc-----ag--------gg
           Chinese tree shrew  ctccgaac-ct-----gg--------gc
B D                  Squirrel  cgcccatctcc-----aa--------ga
       Lesser Egyptian jerboa  cttccagctcc-----tg--------gg
                 Prairie vole  ---------ct-----ag--------gg
B D           Chinese hamster  ---------gc-----ag--------gg
               Golden hamster  ---------gc-----ag--------gg
B D                     Mouse  ctcccagcccc-----ag--------ag
B D                       Rat  ctcctggcccc-----ag--------gg
B D            Naked mole-rat  ctctggccccc-----ag--------gg
B D                Guinea pig  ctctggcttcc-----ag--------ga
                   Chinchilla  ctctggccccc-----ag--------ga
             Brush-tailed rat  ctctggccccc-----ag--------ga
B D                    Rabbit  ---aggccccc-----cg--------gg
B D                      Pika  ---aggccgcc-----ag--------gg
B D                       Pig  ttccaagcct------gg--------gg
B D                    Alpaca  cttcgaatcc------ag--------gg
               Bactrian camel  cttcgaatcc------ag--------gg
B D                   Dolphin  ctccaagctc------gg--------gg
                 Killer whale  ctccaagctc------gg--------gg
             Tibetan antelope  ctcccagccc------ag--------gg
B D                       Cow  ctcccagcct------gg--------gg
B D                     Horse  cttccagccct-----gg--------gg
B D          White rhinoceros  gtccaggccct-----gg--------gg
B D                       Cat  ttccaggcccc-----gg---------g
B D                       Dog  ttccaggcccc-----gg--------gg
B D                   Ferret   gtccaggccct-----gg--------gg
B D                     Panda  ttccagacccc-----ag--------gg
               Pacific walrus  ttccaggcccc-----gg--------ag
                 Weddell seal  ttccaggcccc-----gg--------ag
             Black flying-fox  -------ccct-----gt--------gg
B D                   Megabat  -------ccct-----gt--------gg
                Big brown bat  -------cttc-----aa--------gg
         David's myotis (bat)  -------cttc-----aa--------gg
  D          Little brown bat  -------ctcc-----aa--------gg
B D                  Hedgehog  c---------------------------
              Star-nosed mole  cctggg----------------------
B D                  Elephant  -ctcaggcccc-----ag--------gg
          Cape elephant shrew  -cttgggcccc---ttag--------gg
B D                   Manatee  -ctcaggccct-----ag--------gg
             Cape golden mole  -ctccggtccc-----ag--------gg
B D                    Tenrec  -cctgggtcct-----ag--------gg
                     Aardvark  -cttaggcccc-----ag--------gg
B D                 Armadillo  ggctgggccct-----gg--------gg
B D                   Opossum  ttctgggcctc-----------------
B D           Tasmanian devil  tcctggccctcccgacag--------gg
  D       Collared flycatcher  gtctgtacctt-----ag--------t-
B D               Zebra finch  ccctgaaaccc-----agggcaagctt-
B D        American alligator  -ccgtgaccac-----ag--------c-
  D           Green seaturtle  -----tgggtc-----gg--------a-
  D            Painted turtle  ----------c-----gg--------c-
B D                     Shrew  ============================
B D                Coelacanth  ============================
B D              Atlantic cod  ============================
                 Spotted gar  ============================
B D               Stickleback  ============================
          Southern platyfish  ============================
B D                      Fugu  ============================
B D                 Tetraodon  ============================
B D                    Turkey  ============================
B D                   Chicken  ============================
  D              Mallard duck  ============================
          Tibetan ground jay  ============================
  D    White-throated sparrow  ============================
    Mexican tetra (cavefish)  ============================
B D                 Zebrafish  ============================
B D                    Medaka  ============================
         Pundamilia nyererei  ============================
                 Zebra mbuna  ============================
       Burton's mouthbreeder  ============================
         Princess of Burundi  ============================
B D              Nile tilapia  ============================
B D                Budgerigar  ============================
  D               Rock pigeon  ============================
B D       Medium ground finch  ============================
B D                    Lizard  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
  D                    Parrot  ============================
B D                  Platypus  ============================
B D                   Wallaby  ============================
               Domestic goat  ============================
B D                     Sheep  ============================

Alignment block 8 of 232 in window, 20725728 - 20725778, 51 bps 
B D                     Human  aa-tg----ctga-----------ggccactgactt-gctt--tgt-----gg-----t--gtcctcagt
B D                     Chimp  aa-tg----ctga-----------ggccactgactt-gctt--tgt-----gg-----t--gtcctcagt
B D                   Gorilla  aa-tg----ctga-----------ggccactgactt-gctt--tgt-----gg-----t--gtcctcagt
B D                 Orangutan  aa-tg----ctga-----------ggccactgactt-gctt--tgt-----gg-----t--gtcctcagt
B D                    Gibbon  aa---------------------------------t-gctt--tgt-----gg-----t--gtcctcagt
B D                    Rhesus  aa-tg----ctga-----------ggccactgactt-gctt--tgt-----gg-----t--gtcctcagt
B D       Crab-eating macaque  aa-tg----ctga-----------ggccactgactt-gctt--tgt-----gg-----t--gtcctcagt
B D                    Baboon  aa-tg----ctga-----------ggccactgactt-gctt--tgt-----gg-----t--gtcctcagt
B D              Green monkey  aa-tg----ctga-----------ggccactgactt-gctt--tgt-----gg-----t--gtcctcagt
B D                  Marmoset  aa-tg----ctga-----------agccactgactt-gctt--tgt-----gg-----t--gtccttggt
B D           Squirrel monkey  aa-tg----ctga-----------ggccactgactt-gctt--tgt-----gg-----t--gttctcagt
B D                  Bushbaby  aacca----ttga-----------ggccactgactt-gctt--tgt-----ag--------------agt
           Chinese tree shrew  ag-tg----ctga-----------ggccactgacct-gctc--tac-ag--gg-----t--gtgtgtgtg
B D                  Squirrel  g---------caa-----------ggcccctgactg-gcct--gag-----ag-----g--gtcttcagt
       Lesser Egyptian jerboa  ga-cg----ccaa-----------gtctactgaccg-gttc--cac-gggagc-----a--ggcccaaga
                 Prairie vole  aa-tg----t----------------------------tac--tac-----ac-----agggtcctagga
B D           Chinese hamster  ag-tg----tcaa-----------gggtgctga-----cac--aac-----ac-----a--gtcctagga
               Golden hamster  ag-cg----tcaa-----------gggcgctga-----cac--aac-----gc-----a--gtcttggga
B D                     Mouse  aa-tg----tcag-----------gggtgctgatgt-gctc--cac-----ac-----a--gccct----
B D                       Rat  aa-tg----tcaa-----------gggtgctgacag-gcta--cac-----ac-----a--gtcct----
B D            Naked mole-rat  aa-tg----ccaa-----------ggccaccaactt-gcat--gga-----gtagagga--gtccttagt
B D                Guinea pig  aa-tg----gcaa-----------gaccaccagttt-gcat--ggg-----gc--agga--gtccttagt
                   Chinchilla  aa-tg----ccaa-----------ggccaccaacct-gtat--ggg-----gcggagga--gtccttagt
             Brush-tailed rat  aa-tg----ccaa-----------ggccaccaactt-gcaa--ggg-----gtagagga--atccatagt
B D                    Rabbit  gg-ca----ct--------------------ggctt-gctc--tct-----gg-----g--gtcctctgt
B D                      Pika  ac-ca----ctga-----------ggccacggacct-gctc--tcc-----ag-----a--gcctc----
B D                       Pig  aa-tg----ttga-----------ggccacggactt-gcttctggg-----gg-----a--gtcctcaga
B D                    Alpaca  aa-ta----ctga-----------ggccactgactt-gctc-tggg-----gg-----a--gtc------
               Bactrian camel  aa-ta----ctga-----------ggccactgactt-gctc-tggg-----gg-----a--gtc------
B D                   Dolphin  aa-cg----ctga-----------ggccactgactc-gctt-tgag-----gg-----c--gtcctcaga
                 Killer whale  aa-cg----ctga-----------ggccactgactc-gctt-tgag-----gg-----a--gtcctcaga
             Tibetan antelope  ca-tg----ctga-----------atccactgactc-actt-tagg-----gg-----g--ttcctccaa
B D                       Cow  ca-tg----ctga-----------gtccactgactc-actt-tggg-----gg-----g--ttcctccaa
B D                     Horse  aa-tg----ctga-----------gcccactgattt-gctg-tggt-----gg-----a--gtgctcagt
B D          White rhinoceros  aa-tg----ctga-----------ggccactgactg-gctt-tggt-----gg-----a--gtcctcagt
B D                       Cat  aa-tg----ctga-----------ggccgctaactt-gctt-ttgt-----gg-----c--gtccccggt
B D                       Dog  aa-tg----ctga-----------ggccactaacgt-gctt-ctgt-----gg-----a--accctccgt
B D                   Ferret   aa-tg----ctga-----------ggccactaacct-gctt-ttgt-----gg-----g--gtcctcagt
B D                     Panda  aa-tg----ccta-----------ggtcactaactt-gcgt-ttgt-----gg-----a--gtcctcagt
               Pacific walrus  aa-tg----ctga-----------ggccactaacct-gctt-ttgt-----gg-----a--gtcctcagt
                 Weddell seal  aa-cg----ctga-----------ggccactaacct-gctt-ttgt-----gg-----a--gtcctcagt
             Black flying-fox  ca-tg----ctga-----------ggcccctgactt-actt-ttgt-----gg-----g--attctcagt
B D                   Megabat  ca-tg----ctga-----------ggcccctgactt-aatt-ttgt-----tg-----g--attctcagt
                Big brown bat  ca-ta----ctga-----------ggccactgactt-gctt--tgt-----gg-----a--gtcctcagt
         David's myotis (bat)  ca-ta----ctga-----------ggccattgacgt-gctt-ctgc-----gg-----a--gtcctcagt
  D          Little brown bat  ca-ca----ctga-----------ggccactgactt-gctt-ctgt-----gg-----a--gtcctcagt
B D                  Hedgehog  ----------tga-----------gggcactgactc-gcct-gggt-----gg-----a--cccctcagt
B D                     Shrew  ac-tg----caaa-----------ggccactgactc-gctt-ctgt-----gg-----a--gacctcagt
              Star-nosed mole  ----g----atga-----------ggccacggact----tc-tcgt-----gg-----c--gcccgcggt
B D                  Elephant  ga-tg----ctga-----------ggccactagctt-actt-cttg-----ga-----a--gttctcagt
          Cape elephant shrew  aa-tgctaactaa-----------ggtcactgggtg-cctt-ctgg-----gg-----a--gttctc--t
B D                   Manatee  ga-tg----ctga-----------ggccactggctc-actt-ctgg-----gg-----a--gccctcaat
             Cape golden mole  g-----------------------------------------------------------------taga
B D                    Tenrec  ga-ca----ctga-----------agatgctagctc-tctt-ctgg-----gg-----a--gcacttagt
                     Aardvark  ga-ca----ctga-----------ggccacctgttt-gcac-ctga-----gg-----a--gtcctccat
B D                 Armadillo  aa-cg----ctga-----------ggccgctggctc-gctt-tggt------------------------
B D                   Opossum  ------------------------agtttc-----c-cctt-ctgt-----gc-----t--tgccccgtc
B D           Tasmanian devil  ------------------------agttcc---atc-actt-cttt-----tc-----c--ctcccc-cc
  D       Collared flycatcher  ga-tg----ctga-----------tctcctccaggctgatc--acctcggggg-----c--agggctcgc
B D               Zebra finch  gg-tg----ctaaatcgggctctggcccctcagcgctgttg--att-----ga-----t--aagggacgt
B D        American alligator  at-ag----caaa-------------cccacgagg--gctc--agt-----gc-----t--accctccgt
  D           Green seaturtle  gg-ca----ttat-----------ttcccatcacct-ggta--gtg-----cc-----c--actctgcat
  D            Painted turtle  ag-gg----ccgt-----------taccaatgacgc-gctc--ttt-----tg-----c--tctctcctc
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================

                        Human  ------------gg-----gaagagcc-ac
                        Chimp  ------------gg-----gaagagcc-ac
                      Gorilla  ------------gg-----gaagagcc-ac
                    Orangutan  ------------gg-----gaagagcc-ac
                       Gibbon  ------------gg-----gaagagcc-ac
                       Rhesus  ------------gg-----gaagagcc-ac
          Crab-eating macaque  ------------gg-----gaagagcc-ac
                       Baboon  ------------gg-----gaagagcc-ac
                 Green monkey  ------------gg-----gaagagcc-ac
                     Marmoset  ------------gg-----gcagagcc-ac
              Squirrel monkey  ------------gg-----gcagagcc-ac
                     Bushbaby  ------------gg-----acagagca-gc
           Chinese tree shrew  ------------gg-----gcagacct-gc
                     Squirrel  ------------gg-----gcagagcc-aa
       Lesser Egyptian jerboa  ------------ag----------------
                 Prairie vole  ------------gg-----gaagagc----
              Chinese hamster  ------------gg-----aaagagc----
               Golden hamster  ------------gg-----aagg-------
                        Mouse  ------------------------------
                          Rat  ------------------------------
               Naked mole-rat  ------------gg-----gcagggcc-aa
                   Guinea pig  ------------gg-----gcaaggtc-aa
                   Chinchilla  ------------gg-----gcaaggtc-aa
             Brush-tailed rat  ------------gg-----gaaaggtc-aa
                       Rabbit  ------------gg-----gcagagcg---
                         Pika  --------------------caaggtg-a-
                          Pig  ------------gg-----gaagagcc-ag
                       Alpaca  -----------------------------c
               Bactrian camel  -----------------------------c
                      Dolphin  ------------gg-----gcagcgcc-ac
                 Killer whale  ------------gg-----gcagtgcc-ac
             Tibetan antelope  ------------gg-----gcagagcc-ac
                          Cow  ------------gg-----gcagagcc-ac
                        Horse  ------------gg-----gcagagcc-ac
             White rhinoceros  ------------gg-----gcagaccc-ac
                          Cat  -------g----gg-----gcagagcc-ac
                          Dog  ------------gg-----acagagcc-at
                      Ferret   ------------gg-----gcagagac-ac
                        Panda  ------------gg-----gcagggct-ac
               Pacific walrus  ------------gg-----gcagagcc-ac
                 Weddell seal  ------------gg-----gcagagcc-ac
             Black flying-fox  ------------gg-----gcggagcc-ac
                      Megabat  ------------gg-----gcggagcc-ac
                Big brown bat  ------------gg-----gcagagcc-at
         David's myotis (bat)  ------------gg-----gcagaggc-at
             Little brown bat  ------------gg-----gcagaggc-at
                     Hedgehog  ------------gg-----acagagcc-gc
                        Shrew  ------------gg-----gcaaagcc-at
              Star-nosed mole  ------------gg-----gcagcggc-cc
                     Elephant  ------------gg-----gcagagct-gc
          Cape elephant shrew  ------------gg-----gcagagca-gc
                      Manatee  ------------gg-----gcagagct-gc
             Cape golden mole  ------------gg-----ctagtg-----
                       Tenrec  ------------gg-----gtagagct-gc
                     Aardvark  ------------gg-----gcagagct-gc
                    Armadillo  -------------g-----gcagag---ac
                      Opossum  ------------ca-----gcttctcc---
              Tasmanian devil  ------------ca-----gcagggca---
          Collared flycatcher  cccgccggcca-gg-----gccacctt---
                  Zebra finch  -------gcca-gg-----gcagccct---
           American alligator  -------cccaggg-----ggcgactt---
              Green seaturtle  ------------tgggggcgctgcccatgc
               Painted turtle  ------------tg-----gcagaccctgg
                   Coelacanth  ==============================
                 Atlantic cod  ==============================
                  Spotted gar  ==============================
                  Stickleback  ==============================
           Southern platyfish  ==============================
                         Fugu  ==============================
                    Tetraodon  ==============================
                       Turkey  ==============================
                      Chicken  ==============================
                 Mallard duck  ==============================
           Tibetan ground jay  ==============================
       White-throated sparrow  ==============================
     Mexican tetra (cavefish)  ==============================
                    Zebrafish  ==============================
                       Medaka  ==============================
          Pundamilia nyererei  ==============================
                  Zebra mbuna  ==============================
        Burton's mouthbreeder  ==============================
          Princess of Burundi  ==============================
                 Nile tilapia  ==============================
                   Budgerigar  ==============================
                  Rock pigeon  ==============================
          Medium ground finch  ==============================
                       Lizard  ==============================
             Peregrine falcon  ==============================
                 Saker falcon  ==============================
                       Parrot  ==============================
                     Platypus  ==============================
                      Wallaby  ==============================
                Domestic goat  ==============================
                        Sheep  ==============================

Inserts between block 8 and 9 in window
B D              Zebra finch 3bp

Alignment block 9 of 232 in window, 20725779 - 20725797, 19 bps 
B D                     Human  agaaagagcc----------aatgtggtg
B D                     Chimp  agaaagagcc----------aatgtggtg
B D                   Gorilla  agaaagagcc----------aatgtggtg
B D                 Orangutan  agaaagagcc----------aatgtggcg
B D                    Gibbon  agaaagagcc----------aatgtggcg
B D                    Rhesus  ggaaaga------------------ggcg
B D       Crab-eating macaque  ggaaaga------------------ggcg
B D                    Baboon  ggaaaga------------------ggcg
B D              Green monkey  ggaaaga------------------ggcg
B D                  Marmoset  agaaagagcc----------aatgtagtg
B D           Squirrel monkey  actgaggggc----------tct------
B D                  Bushbaby  agaaagggcc----------agtgtggcc
           Chinese tree shrew  ggcaggagca----------atg--ggta
B D                  Squirrel  agcaggggcc----------agtgtggta
       Lesser Egyptian jerboa  -----ccgcc----------agtgggaga
                 Prairie vole  --caaaagcc----------ggggtgatg
B D           Chinese hamster  --caaaagcc----------agagtggga
               Golden hamster  ---aaaagcc----------agtgtggtg
B D                     Mouse  -----aagcc----------agtgtgggg
B D                       Rat  -----aagcc----------c-tgtggtg
B D            Naked mole-rat  agaaggattc----------agtacgata
B D                Guinea pig  agaaggactc----------agt------
                   Chinchilla  agaaggactc----------agtatggta
             Brush-tailed rat  aggaggcttt----------catatcgta
B D                    Rabbit  --------------------agtggggcg
B D                      Pika  ---------c----------aatgtggac
B D                       Pig  agaaggagcc----------agggtggcg
B D                    Alpaca  agaaggagcc----------agggtggtg
               Bactrian camel  agaaggagcc----------agggtggtg
B D                   Dolphin  agcaggagcc----------ggggtggca
                 Killer whale  agcaggagcc----------ggggtggca
             Tibetan antelope  agaaggagcc----------agggtggtg
B D                       Cow  agaaggagcc----------agggtggcg
B D                     Horse  agaaggagcc----------cgtgtggtg
B D          White rhinoceros  agaaggagcc----------agtgtggtg
B D                       Cat  aggaggagca----------ggtgtgaca
B D                       Dog  agaaggagcc----------ggcgtagca
B D                   Ferret   agaaggagcc----------agtgcggga
B D                     Panda  agaaggagcc----------ggtgtggca
               Pacific walrus  agaaggagcc----------agtggggca
                 Weddell seal  agaaggagcc----------ggtggggca
             Black flying-fox  agaaggagcc----------agagtggcg
B D                   Megabat  agaaggagcc----------agagtggca
                Big brown bat  agaaggagcc----------tgtgtggcc
         David's myotis (bat)  agaaggagcc----------tgtatggca
  D          Little brown bat  agaaggagcc----------cgtgtggca
B D                  Hedgehog  agaaggagcc-------------------
B D                     Shrew  agaaggtgccacaggtggtg---------
              Star-nosed mole  agaagatgcc-------------------
B D                  Elephant  agaaggagca----------ggtgtggag
          Cape elephant shrew  agaaggagcc----------agtgcgagg
B D                   Manatee  agaaggagca----------ggtgtgggg
B D                    Tenrec  caggagagcc----------tatgtgggg
                     Aardvark  agaaggagcc----------agtgtgggg
B D                 Armadillo  ataaggggcc----------aatgtggtg
  D       Collared flycatcher  -caggacttt----------gccgtcatc
B D        American alligator  -cctgacttt----------cctgc----
  D           Green seaturtle  acacagccct----------gccgtggcg
  D            Painted turtle  ccaaag---t----------ggtggaggg
B D               Stickleback  agaaggag------------ggtg-----
            Cape golden mole  -----------------------------
B D                Coelacanth  =============================
B D              Atlantic cod  =============================
                 Spotted gar  =============================
          Southern platyfish  =============================
B D                      Fugu  =============================
B D                 Tetraodon  =============================
B D                    Turkey  =============================
B D                   Chicken  =============================
  D              Mallard duck  =============================
          Tibetan ground jay  =============================
B D               Zebra finch  =============================
  D    White-throated sparrow  =============================
B D           Tasmanian devil  -----------------------------
    Mexican tetra (cavefish)  =============================
B D                 Zebrafish  =============================
B D                    Medaka  =============================
         Pundamilia nyererei  =============================
                 Zebra mbuna  =============================
       Burton's mouthbreeder  =============================
         Princess of Burundi  =============================
B D              Nile tilapia  =============================
B D                Budgerigar  =============================
B D                   Opossum  -----------------------------
  D               Rock pigeon  =============================
B D       Medium ground finch  =============================
B D                    Lizard  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
  D                    Parrot  =============================
B D                  Platypus  =============================
B D                   Wallaby  =============================
               Domestic goat  =============================
B D                     Sheep  =============================

Inserts between block 9 and 10 in window
B D                   Alpaca 466bp
              Bactrian camel 478bp
B D       American alligator 1bp

Alignment block 10 of 232 in window, 20725798 - 20725809, 12 bps 
B D                     Human  a---gg--gg-------tgc-atgc
B D                     Chimp  a---gg--gg-------tgc-atgc
B D                   Gorilla  a---gg--gg-------tgc-atgc
B D                 Orangutan  a---gg--gg-------tgc-atgc
B D                    Gibbon  a---gg--gg-------tgc-atga
B D                    Rhesus  a---gg--tg-------tgc-atgc
B D       Crab-eating macaque  a---gg--tg-------tgc-atgc
B D                    Baboon  a---gg--tg-------tgc-atgc
B D              Green monkey  a---gg--tg-------tgc-atgc
B D                  Marmoset  a---gg--gg-------tgt-gtgc
B D           Squirrel monkey  ---------g-------tgt-atgc
B D                  Bushbaby  g---gt--gg-------cac-atgc
           Chinese tree shrew  a---gg--gg-------gga-atgc
B D                  Squirrel  a---gg--tt-------gga-aggc
       Lesser Egyptian jerboa  a---gg--ca-------tg------
                 Prairie vole  a---gg--ca-------cgg-attc
B D           Chinese hamster  a---gg--ca-------cat-attc
               Golden hamster  a---aa-------------------
B D                     Mouse  a---gg--ca-------tgg-attc
B D                       Rat  g---gg--ca-------tgg-attc
B D            Naked mole-rat  a---gg--gg-------tcg-gttc
B D                Guinea pig  --------ta-------tgg-gagc
                   Chinchilla  c---gg--gg-------tag-gtgc
             Brush-tailed rat  a---ga--gg-------tag-ggtc
B D                    Rabbit  a---gg--ag-------cgc-gagc
B D                      Pika  a---gg--gg-------cactgtgc
B D                       Pig  a---gg--gg-------tgc-acgc
B D                    Alpaca  a---gg--ga-------tcc-atgc
               Bactrian camel  a---gg--ga-------tcc-atgc
B D                   Dolphin  a---gg--gg-------tgc-atgc
                 Killer whale  a---gg--gg-------tgc-atgc
             Tibetan antelope  agctgg--gg-------ggc-----
B D                       Cow  agccgg--gg-------ggc-a---
B D                     Horse  a---gg--gg-------tgc-atgg
B D          White rhinoceros  a---gg--gg-------tgc-atgc
B D                       Cat  a---gg--ag-------tgc-ctgc
B D                       Dog  a---gg--ag-------tgc-ccac
B D                   Ferret   a---gg--ag-------tgg-ctgc
B D                     Panda  a---gg--ag-------tgc-ccgc
               Pacific walrus  a---gg--ag-------tgc-ctgt
                 Weddell seal  a---gg--ag-------tgc-ctgt
             Black flying-fox  a---tg--gg-------tgc-acat
B D                   Megabat  a---cg--gg-------tac-acat
                Big brown bat  a---tg--gg-------tcc-aggt
         David's myotis (bat)  a---tg--gg-------tcc-aggt
  D          Little brown bat  a---tg--gg-------tgc-aggt
B D                  Hedgehog  --------gc-------ggt-agcc
B D                     Shrew  ----aggggg-------tgc-aggc
              Star-nosed mole  --------gg-------cgc-aggc
B D                  Elephant  ----ag--gg---------c-gcac
          Cape elephant shrew  ----at--gg-------atc-gtgt
B D                   Manatee  ----ag--gg-------cac-acac
B D                    Tenrec  ----ag--gg-------cac-gtgc
                     Aardvark  ----at--gg-------caa-atgc
B D                 Armadillo  ----ag--tg-------cat-gttc
B D                   Opossum  a---gg--ggcccaccc--------
B D           Tasmanian devil  g---gg--gg---------------
  D       Collared flycatcher  ----------------------tgt
  D           Green seaturtle  ----------------------ctc
  D            Painted turtle  ----------------------ctg
B D               Stickleback  -ggggg--gg-------cgc-aa--
            Cape golden mole  -------------------------
B D                Coelacanth  =========================
B D              Atlantic cod  =========================
                 Spotted gar  =========================
          Southern platyfish  =========================
B D                      Fugu  =========================
B D                 Tetraodon  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
  D              Mallard duck  =========================
          Tibetan ground jay  =========================
B D               Zebra finch  =========================
  D    White-throated sparrow  =========================
    Mexican tetra (cavefish)  =========================
B D                 Zebrafish  =========================
B D                    Medaka  =========================
         Pundamilia nyererei  =========================
                 Zebra mbuna  =========================
       Burton's mouthbreeder  =========================
         Princess of Burundi  =========================
B D              Nile tilapia  =========================
B D        American alligator  =========================
B D                Budgerigar  =========================
  D               Rock pigeon  =========================
B D       Medium ground finch  =========================
B D                    Lizard  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
  D                    Parrot  =========================
B D                  Platypus  =========================
B D                   Wallaby  =========================
               Domestic goat  =========================
B D                     Sheep  =========================

Inserts between block 10 and 11 in window
B D                 Squirrel 3bp
B D          Chinese hamster 20bp
  D      Collared flycatcher 4bp
  D          Green seaturtle 7bp
  D           Painted turtle 7bp

Alignment block 11 of 232 in window, 20725810 - 20725812, 3 bps 
B D                     Human  ctg-
B D                     Chimp  ctg-
B D                   Gorilla  ctg-
B D                 Orangutan  ctg-
B D                    Gibbon  ctg-
B D                    Rhesus  ctg-
B D       Crab-eating macaque  ctg-
B D                    Baboon  ctg-
B D              Green monkey  ctg-
B D                  Marmoset  ctg-
B D           Squirrel monkey  ctg-
B D                  Bushbaby  ctg-
           Chinese tree shrew  ctc-
B D                  Squirrel  ctg-
B D            Naked mole-rat  cta-
B D                Guinea pig  cta-
                   Chinchilla  cca-
             Brush-tailed rat  cta-
B D                    Rabbit  ccg-
B D                      Pika  ctg-
B D                       Pig  ctg-
B D                    Alpaca  ccg-
               Bactrian camel  tcg-
B D                   Dolphin  ctg-
                 Killer whale  ctg-
B D                     Horse  ttg-
B D          White rhinoceros  ctg-
B D                       Cat  ctg-
B D                       Dog  c---
B D                   Ferret   ctg-
B D                     Panda  ctg-
               Pacific walrus  ctg-
                 Weddell seal  ctg-
             Black flying-fox  ctg-
B D                   Megabat  ctg-
                Big brown bat  ctg-
         David's myotis (bat)  ctg-
  D          Little brown bat  ctg-
B D                     Shrew  ctt-
              Star-nosed mole  cct-
B D                  Elephant  act-
          Cape elephant shrew  cca-
B D                   Manatee  cca-
B D                    Tenrec  cca-
                     Aardvark  cca-
B D                 Armadillo  cca-
B D                   Opossum  --g-
  D       Collared flycatcher  cag-
B D        American alligator  cag-
  D           Green seaturtle  aag-
  D            Painted turtle  cag-
B D               Stickleback  -cgt
B D                       Rat  ----
                Prairie vole  ----
              Golden hamster  ----
B D                     Mouse  ----
      Lesser Egyptian jerboa  ----
B D                  Hedgehog  ----
            Cape golden mole  ----
B D                Coelacanth  ====
B D              Atlantic cod  ====
                 Spotted gar  ====
          Southern platyfish  ====
B D                      Fugu  ====
B D                 Tetraodon  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ----
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D                Budgerigar  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
B D                  Platypus  ====
B D                   Wallaby  ====
B D           Chinese hamster  ====
               Domestic goat  ====
B D                     Sheep  ====
            Tibetan antelope  ----
B D                       Cow  ----

Inserts between block 11 and 12 in window
B D                  Opossum 2bp
  D      Collared flycatcher 4bp
B D       American alligator 4bp
  D          Green seaturtle 4bp
  D           Painted turtle 4bp

Alignment block 12 of 232 in window, 20725813 - 20725850, 38 bps 
B D                     Human  -----------gagg--gggatcaggcc-----------------gccc-------tggcaaagc-----
B D                     Chimp  -----------gagg--gggatcaggcc-----------------gccc-------tggcaaag------
B D                   Gorilla  -----------gagg--gggatcaggcc-----------------gccc-------tggcagagc-----
B D                 Orangutan  -----------gagg--gggatcaggcc-----------------gccc-------tggcaaagc-----
B D                    Gibbon  -----------gagg--gggatcaggcc-----------------gccc-------tggcaaagc-----
B D                    Rhesus  -----------gagg--gggatcaggct-----------------gccc-------tgacaaaac-----
B D       Crab-eating macaque  -----------gagg--gggatcaggct-----------------gccc-------tgacaaagc-----
B D                    Baboon  -----------gagg--gggatcaggct-----------------gccc-------tgacaaagc-----
B D              Green monkey  -----------gagg--gggatcaggct-----------------gccc-------tgacaaagc-----
B D                  Marmoset  -----------gagg--gggatcagttc-----------------gccc-------tggcaaagc-----
B D           Squirrel monkey  -----------gagg--gggatcaggct-----------------gccc-------tggcaaagc-----
B D                  Bushbaby  -----------gagg--gggcttgggct-----------------gcct-------tggctcaaccctt-
           Chinese tree shrew  -----------ctgg--gggctcaagtc----------------------------------agc-----
B D                  Squirrel  -----------gagg--gg-----agcc-----------------aatc---------------------
       Lesser Egyptian jerboa  -----------------gg---------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
B D            Naked mole-rat  -----------gagg--gc-ctcaggcc-----------------agct-------ctgccaag------
B D                Guinea pig  -----------gagg--gg-ctcagggc-----------------agct-------ctgccagg------
                   Chinchilla  -----------gagg--gg-ctcaggcc-----------------agct-------ctgccaag------
             Brush-tailed rat  -----------gagg--gg-ctcaggcc-----------------agct-------ctatgaag------
B D                    Rabbit  -----------gagggggg-tgcaggcc-----------------agcc-------cggccaagc-----
B D                      Pika  -----------cagg-----------------------------------------cagccatgc-----
B D                       Pig  -----------gaga--gggtgcaggcc-----------------ggct-------tggctaagc-----
B D                    Alpaca  -----------gagg--gggctcaggcc-----------------agct-------tggctaagc-----
               Bactrian camel  -----------gagg--gggctcaggcc-----------------agct-------tggctaagc-----
B D                   Dolphin  ------------gag--gggcgcaggcc-----------------agcg-------tggctgagc-----
                 Killer whale  ------------gag--gggcgcaggcc-----------------agcg-------tggctgagc-----
             Tibetan antelope  -----------gggg--gtgctcaggcc-----------------agc--------ttgctgagc-----
B D                       Cow  ------------ggg--gtgctcaggcc-----------------agc--------tcgctgagc-----
                Domestic goat  -----------gggg--gtgctcaggcc-----------------agc--------ttgctgagc-----
B D                     Horse  -----------gagg--cggctctggcc-----------------gatg-------tggctgagc-----
B D          White rhinoceros  -----------aagg--gggctc-ggcc-----------------agcc-------tggctaagc-----
B D                       Cat  -----------gagg--gggctcgggcc-----------------agct-------tgactaagc-----
B D                   Ferret   -----------gagg--ggactctggcc-----------------agct-------tagctgagc-----
B D                     Panda  -----------gagg--ggactccggcc-----------------agct-------tagcggagc-----
               Pacific walrus  -----------gagg--ggactccggcc-----------------agct-------tagctgagc-----
                 Weddell seal  -----------gagg--gggctccggcc-----------------agct-------tagctgagc-----
             Black flying-fox  -----------gagc--aggcccaagcc-----------------agca-------tagctaagc-----
B D                   Megabat  -----------gagc--aggcccaagcc-----------------agca-------tagctaagc-----
                Big brown bat  -----------gagg--gggctcaggac-----------------agca-------tggccaagc-----
         David's myotis (bat)  -----------gagg--gggctcaggac-----------------agct-------tggccaagc-----
  D          Little brown bat  -----------gagg--gggctcaggac-----------------agcc-------tggccaagc-----
B D                  Hedgehog  --------------------------------------------------------------agc-----
B D                     Shrew  --------------------------------------------------------------agc-----
              Star-nosed mole  ------------------------------------------------c-------tcgctaagc-----
B D                  Elephant  -----------g---------------------------------agca-------tggctgag------
          Cape elephant shrew  -----------gagt--cgccttggggc-----------------agcc-------tggctgag------
B D                   Manatee  -----------gagg--ggactcagggc-----------------agct-------tgactgag------
             Cape golden mole  --------------t--gggctcaaggc-----------------agc----------------------
B D                    Tenrec  -----------ggat--aggctcagggc-----------------a------------------------
                     Aardvark  -----------gagg--gagttcaagac-----------------agtt-------tggctgag------
B D                 Armadillo  -----------gagg--gggctcaggcc-----------------agcc-------tgactaagcctcag
B D                   Opossum  -----------------gagcagagtcc-----------------agctgcaggggctggtggcc-----
B D           Tasmanian devil  ---------------------------------------------agctccggggtggggggagc-----
  D       Collared flycatcher  -----------agga--gctgtcagggctgggagcccccgggctg-------------------------
B D               Zebra finch  -----------agtg--acaaccagggc----agccctgggagtg-------------------------
B D        American alligator  -----------gaca--gcaccca--gctgagggtcaaggacctg-------------------------
  D           Green seaturtle  -----------gggt--gggggcgatac------------------------------------------
  D            Painted turtle  -----------cgga--gcggacggagc------------------------------------------
B D               Stickleback  gcggagaaaaaaaaa--gcccgtgagcc-----------------ggtt-------ttaaaaag------
B D                       Rat  ----------------------------------------------------------------------
                Prairie vole  ----------------------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D           Chinese hamster  ======================================================================
B D                     Sheep  ======================================================================
B D                       Dog  ----------------------------------------------------------------------

                        Human  ---cctcaa--------------ggaa
                        Chimp  ---------------------------
                      Gorilla  ---cctcaa--------------ggaa
                    Orangutan  ---cctcaa--------------ggaa
                       Gibbon  ---cctcaa--------------ggaa
                       Rhesus  ---cctcaa--------------ggaa
          Crab-eating macaque  ---cctcaa--------------ggaa
                       Baboon  ---cctcaa--------------ggaa
                 Green monkey  ---cctcaa--------------ggaa
                     Marmoset  ---cctcaa--------------ggaa
              Squirrel monkey  ---cttcaa--------------ggaa
                     Bushbaby  ---cctcaaaggcctgtgtctccagaa
           Chinese tree shrew  ---cctcga--------------gggc
                     Squirrel  ---cccaaa--------------ggcc
       Lesser Egyptian jerboa  ---ccc---------------------
               Golden hamster  ---cacgga------------------
               Naked mole-rat  ---cccaga--------------g---
                   Guinea pig  ---cccaga--------------c---
                   Chinchilla  ---cagaga--------------g---
             Brush-tailed rat  ---cccaga--------------t---
                       Rabbit  ---cccaga--------------g---
                         Pika  ---ctgaaa--------------g---
                          Pig  ---cgtcca--------------gg--
                       Alpaca  ---catcta--------------ag--
               Bactrian camel  ---catcta--------------ag--
                      Dolphin  ---cgtcca--------------gg--
                 Killer whale  ---cgtcca--------------gg--
             Tibetan antelope  ---cagcca--------------cg--
                          Cow  ---cagcca--------------cg--
                Domestic goat  ---cagcca--------------cg--
                        Horse  ---cctccc--------------ag--
             White rhinoceros  ---cctcca--------------ag--
                          Cat  ---cctccg--------------ag--
                      Ferret   ---cccccg--------------ag--
                        Panda  ---ccttca--------------gg--
               Pacific walrus  ---cctcta--------------ag--
                 Weddell seal  ---cctcca--------------ag--
             Black flying-fox  ---cctcca--------------ag--
                      Megabat  ---cctcca--------------ag--
                Big brown bat  ---cctcca--------------tg--
         David's myotis (bat)  ---cctcca--------------tg--
             Little brown bat  ---cctcca--------------tg--
                     Hedgehog  ---ggggca--------------c---
                        Shrew  ---ccagca--------------c---
              Star-nosed mole  ---cctgca--------------ag--
                     Elephant  ---ct------------------gaaa
          Cape elephant shrew  ---ct------------------ggaa
                      Manatee  ---ct------------------ggaa
             Cape golden mole  ---------------------------
                       Tenrec  ---------------------------
                     Aardvark  ---ct------------------ggaa
                    Armadillo  tccct------------------ggaa
                      Opossum  ---tgcggg--------------ga--
              Tasmanian devil  ---tctgga--------------ga--
          Collared flycatcher  ---------------------------
                  Zebra finch  ---------------------------
           American alligator  ---------------------------
              Green seaturtle  ---------------------------
               Painted turtle  ---------------------------
                  Stickleback  ---------------------------
                          Rat  ---------------------------
                 Prairie vole  ---------------------------
                        Mouse  ---------------------------
                   Coelacanth  ===========================
                 Atlantic cod  ===========================
                  Spotted gar  ===========================
           Southern platyfish  ===========================
                         Fugu  ===========================
                    Tetraodon  ===========================
                       Turkey  ===========================
                      Chicken  ===========================
                 Mallard duck  ===========================
           Tibetan ground jay  ===========================
       White-throated sparrow  ===========================
     Mexican tetra (cavefish)  ===========================
                    Zebrafish  ===========================
                       Medaka  ===========================
          Pundamilia nyererei  ===========================
                  Zebra mbuna  ===========================
        Burton's mouthbreeder  ===========================
          Princess of Burundi  ===========================
                 Nile tilapia  ===========================
                   Budgerigar  ===========================
                  Rock pigeon  ===========================
          Medium ground finch  ===========================
                       Lizard  ===========================
             Peregrine falcon  ===========================
                 Saker falcon  ===========================
                       Parrot  ===========================
                     Platypus  ===========================
                      Wallaby  ===========================
              Chinese hamster  ===========================
                        Sheep  ===========================
                          Dog  ---------------------------

Inserts between block 12 and 13 in window
  D      Collared flycatcher 1401bp
B D              Zebra finch 11bp
B D       American alligator 15bp

Alignment block 13 of 232 in window, 20725851 - 20725863, 13 bps 
B D                     Human  ccc--a--------c--cctgatgc------
B D                     Chimp  -cc--a--------c--cctgatgc------
B D                   Gorilla  ccc--a--------c--cctgatgc------
B D                 Orangutan  ccc--a--------c--cctgatgc------
B D                    Gibbon  ccc--a--------c--cctgatgc------
B D                    Rhesus  ccc--g--------c--cctgatgc------
B D       Crab-eating macaque  ccc--g--------c--cctgatgc------
B D                    Baboon  ccc--g--------c--cctgatgc------
B D              Green monkey  gcc--g--------c--cctgatgc------
B D                  Marmoset  ccc--g--------c--tctgatgc------
B D           Squirrel monkey  cct--g--------c--tctgatgc------
B D                  Bushbaby  ctt--g--------t--cctgatgt------
           Chinese tree shrew  ccccat--------c--cctggaac------
B D                  Squirrel  ttt--g--------t--ccctgaaa------
       Lesser Egyptian jerboa  -----g--------c--tgctgcac------
                 Prairie vole  -----a--------c--cgctgcca------
               Golden hamster  ttc--g--------c--cactgcca------
B D                     Mouse  -----a--------c--ccctgcac------
B D                       Rat  -----actccccacc--tcctgcaa------
B D            Naked mole-rat  -----g--------c--ctccatcc------
B D                Guinea pig  -----a--------c--ctctgacc------
                   Chinchilla  -----g--------c--ctctgacc------
             Brush-tailed rat  -----g--------t--cgctgacc------
B D                    Rabbit  -----g--------c--ctctgtcc------
B D                      Pika  -----g--------c--c-----ac------
B D                       Pig  -----g--------c--ctccgtcc------
B D                    Alpaca  -----g--------t--ctctgtcc------
               Bactrian camel  -----g--------t--ctctgtcc------
B D                   Dolphin  -----g--------c--ctcggtcc------
                 Killer whale  -----g--------c--ctcggtcc------
             Tibetan antelope  -----g--------c--ctcggtcc------
B D                       Cow  -----g--------c--ctcggtcc------
                Domestic goat  -----g--------c--ctcggtcc------
B D                     Horse  -----g--------c--ctcgggcc------
B D          White rhinoceros  -----g--------c--ctcggtcc------
B D                       Cat  -----g--------c--ctcggtcc------
B D                       Dog  --------------c--cttggtcc------
B D                   Ferret   -----g--------c--ctagatgc------
B D                     Panda  -----g--------c--ctcggtcc------
               Pacific walrus  -----g--------t--cttggtcc------
                 Weddell seal  -----g--------t--cttggtcc------
             Black flying-fox  -----g--------c--ctcggtcc------
B D                   Megabat  -----g--------c--ctcggtcc------
                Big brown bat  -----g--------cctctcggtcc------
         David's myotis (bat)  -----a--------c--------ct------
  D          Little brown bat  -----a--------ccgctcgatcc------
B D                     Shrew  ----------------------tgc------
              Star-nosed mole  -----g--------t--cacagtgc------
B D                  Elephant  cct--g--------c--cctgatgc------
          Cape elephant shrew  cct--g--------c--attcaggt------
B D                   Manatee  cct--g--------c--cttcattc------
             Cape golden mole  -------------------tgatgc------
B D                    Tenrec  --------------------gatac------
                     Aardvark  cct--g--------c--cctgacgc------
B D                 Armadillo  cct--g--------t--cctggtgc------
B D                   Opossum  -----t--------c--cctaaccc------
B D           Tasmanian devil  --------------c--tccaggct------
  D       Collared flycatcher  -----------------cccccccc------
B D               Stickleback  ------------------cggaggcggagct
B D                  Hedgehog  -------------------------------
B D                Coelacanth  ===============================
B D              Atlantic cod  ===============================
                 Spotted gar  ===============================
          Southern platyfish  ===============================
B D                      Fugu  ===============================
B D                 Tetraodon  ===============================
B D                    Turkey  ===============================
B D                   Chicken  ===============================
  D              Mallard duck  ===============================
          Tibetan ground jay  ===============================
B D               Zebra finch  ===============================
  D    White-throated sparrow  ===============================
    Mexican tetra (cavefish)  ===============================
B D                 Zebrafish  ===============================
B D                    Medaka  ===============================
         Pundamilia nyererei  ===============================
                 Zebra mbuna  ===============================
       Burton's mouthbreeder  ===============================
         Princess of Burundi  ===============================
B D              Nile tilapia  ===============================
  D            Painted turtle  -------------------------------
  D           Green seaturtle  -------------------------------
B D        American alligator  ===============================
B D                Budgerigar  ===============================
  D               Rock pigeon  ===============================
B D       Medium ground finch  ===============================
B D                    Lizard  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
  D                    Parrot  ===============================
B D                  Platypus  ===============================
B D                   Wallaby  ===============================
B D           Chinese hamster  ===============================
B D                     Sheep  ===============================

Inserts between block 13 and 14 in window
            Black flying-fox 5bp
B D                  Megabat 5bp
B D              Stickleback 1bp

Alignment block 14 of 232 in window, 20725864 - 20725868, 5 bps 
B D                     Human  ct-------gg-------c
B D                     Chimp  ct-------gg-------c
B D                   Gorilla  ct-------gg-------c
B D                 Orangutan  ct-------gg-------c
B D                    Gibbon  cc-------gg-------c
B D                    Rhesus  cc-------gg-------c
B D       Crab-eating macaque  cc-------gg-------c
B D                    Baboon  cc-------gg-------c
B D              Green monkey  ct-------gg-------c
B D                  Marmoset  cc-------ag-------c
B D           Squirrel monkey  cc-------ag-------c
B D                  Bushbaby  cc-------ag-------t
           Chinese tree shrew  ct-------gg-------c
B D                  Squirrel  cc-------tg-------c
       Lesser Egyptian jerboa  cc-------gt-------c
                 Prairie vole  cc-------tg-------a
               Golden hamster  cc-------tg-------a
B D                     Mouse  cc-------ga-------a
B D                       Rat  cc-------tg-------a
B D            Naked mole-rat  t------------------
B D                Guinea pig  ct-------a---------
                   Chinchilla  ct-------g---------
             Brush-tailed rat  ct-------a---------
B D                    Rabbit  ct-------gc-------a
B D                      Pika  ct-------g--------a
B D                       Pig  ct-------gg-------a
B D                    Alpaca  ct-------gg-------a
               Bactrian camel  ct-------gg-------a
B D                   Dolphin  ct-------gg-------a
                 Killer whale  ct-------gg-------a
             Tibetan antelope  cc-------ag-------g
B D                       Cow  ct-------gg-------g
                Domestic goat  cc-------ag-------g
B D                     Horse  ct-------gg-------a
B D          White rhinoceros  ct-------gg-------a
B D                       Cat  cc------tgg-------a
B D                       Dog  cc-------aa-------a
B D                   Ferret   ct-------gg-------a
B D                     Panda  ct-------gg-------a
               Pacific walrus  cc-------ag-------a
                 Weddell seal  cc-------gg-------a
                Big brown bat  ct------gga-------a
         David's myotis (bat)  ct------gga-------a
  D          Little brown bat  ct------gga-------a
B D                  Hedgehog  cc-------tg-------g
B D                     Shrew  cc-----------------
              Star-nosed mole  cc-------ag-------g
B D                  Elephant  cc-------ag--------
          Cape elephant shrew  ca-------a---------
B D                   Manatee  cc-------ag--------
             Cape golden mole  cc-------ag--------
B D                    Tenrec  ct-------ag--------
                     Aardvark  cc-------ag--------
B D                 Armadillo  cc-------agcacctcc-
B D                   Opossum  cc-------gg-------g
B D           Tasmanian devil  ct-------gc-------c
  D       Collared flycatcher  cccccccc-----------
B D               Stickleback  ctcga--------------
                  Spotted gar  ct-----------------
B D                Coelacanth  ===================
B D                   Megabat  ===================
B D              Atlantic cod  ===================
          Southern platyfish  ===================
B D                      Fugu  ===================
B D                 Tetraodon  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
  D              Mallard duck  ===================
          Tibetan ground jay  ===================
B D               Zebra finch  ===================
  D    White-throated sparrow  ===================
    Mexican tetra (cavefish)  ===================
B D                 Zebrafish  ===================
B D                    Medaka  ===================
         Pundamilia nyererei  ===================
                 Zebra mbuna  ===================
       Burton's mouthbreeder  ===================
         Princess of Burundi  ===================
B D              Nile tilapia  ===================
  D            Painted turtle  -------------------
  D           Green seaturtle  -------------------
B D        American alligator  ===================
B D                Budgerigar  ===================
  D               Rock pigeon  ===================
B D       Medium ground finch  ===================
B D                    Lizard  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
  D                    Parrot  ===================
B D                  Platypus  ===================
B D                   Wallaby  ===================
B D           Chinese hamster  ===================
B D                     Sheep  ===================
            Black flying-fox  ===================

Inserts between block 14 and 15 in window
B D                 Squirrel 13bp
      Lesser Egyptian jerboa 17bp
                Prairie vole 5bp
              Golden hamster 4bp
B D                    Mouse 5bp
B D                      Rat 5bp
B D                   Rabbit 8bp
B D                     Pika 8bp
B D                      Pig 12bp
B D                   Alpaca 12bp
              Bactrian camel 12bp
B D                  Dolphin 12bp
                Killer whale 12bp
            Tibetan antelope 12bp
B D                      Cow 12bp
               Domestic goat 12bp
B D                    Horse 12bp
B D         White rhinoceros 12bp
B D                      Cat 12bp
B D                      Dog 12bp
B D                  Ferret  12bp
B D                    Panda 12bp
              Pacific walrus 12bp
                Weddell seal 12bp
               Big brown bat 12bp
        David's myotis (bat) 12bp
  D         Little brown bat 12bp
B D                 Hedgehog 8bp
B D                    Shrew 1bp
             Star-nosed mole 8bp
B D                  Opossum 7bp
B D          Tasmanian devil 7bp

Alignment block 15 of 232 in window, 20725869 - 20725874, 6 bps 
B D                     Human  gcacag--
B D                     Chimp  acacag--
B D                   Gorilla  acacag--
B D                 Orangutan  acacag--
B D                    Gibbon  acacag--
B D                    Rhesus  acacag--
B D       Crab-eating macaque  acacag--
B D                    Baboon  acacag--
B D              Green monkey  acacag--
B D                  Marmoset  acacgg--
B D           Squirrel monkey  acgcga--
B D                  Bushbaby  acacc---
           Chinese tree shrew  -cagat--
B D                  Squirrel  --acaa--
       Lesser Egyptian jerboa  ctacag--
                 Prairie vole  gcacag--
B D           Chinese hamster  acacag--
               Golden hamster  acacaa--
B D                     Mouse  gtacag--
B D                       Rat  gtgcag--
B D            Naked mole-rat  -gacca--
B D                Guinea pig  -cacca--
                   Chinchilla  -ggcca--
             Brush-tailed rat  -gaaaa--
B D                    Rabbit  --acat--
B D                      Pika  --ccat--
B D                       Pig  gcacag--
B D                    Alpaca  acacag--
               Bactrian camel  acacag--
B D                   Dolphin  gcacag--
                 Killer whale  gcacag--
             Tibetan antelope  ccacag--
B D                       Cow  ccacag--
                Domestic goat  ccacag--
B D                     Horse  gcacag--
B D          White rhinoceros  gcacag--
B D                       Cat  gcacag--
B D                       Dog  gcctgg--
B D                   Ferret   gcacgg--
B D                     Panda  gcacat--
               Pacific walrus  gcacgg--
                 Weddell seal  gcacgg--
             Black flying-fox  gcacag--
B D                   Megabat  gcacag--
                Big brown bat  gcacag--
         David's myotis (bat)  gcacag--
  D          Little brown bat  gcacag--
B D                 Armadillo  --cctg--
B D                   Opossum  --actc--
B D           Tasmanian devil  --actc--
  D       Collared flycatcher  -ccccc--
B D               Zebra finch  --cccg--
B D        American alligator  --accg--
B D               Stickleback  --gcggcg
                  Spotted gar  --gccatg
B D                  Hedgehog  ========
B D                     Shrew  ========
            Cape golden mole  --------
                    Aardvark  --------
B D                Coelacanth  ========
B D              Atlantic cod  ========
          Southern platyfish  ========
B D                      Fugu  ========
B D                 Tetraodon  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
  D    White-throated sparrow  ========
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  ========
B D                    Medaka  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
  D            Painted turtle  --------
  D           Green seaturtle  --------
B D                Budgerigar  ========
  D               Rock pigeon  ========
B D       Medium ground finch  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D                    Parrot  ========
         Cape elephant shrew  --------
B D                  Platypus  ========
B D                   Wallaby  ========
B D                   Manatee  --------
B D                  Elephant  --------
B D                    Tenrec  --------
             Star-nosed mole  ========
B D                     Sheep  ========

Inserts between block 15 and 16 in window
B D                 Squirrel 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                      Pig 7bp
B D                   Alpaca 14bp
              Bactrian camel 14bp
B D                  Dolphin 5bp
                Killer whale 4bp
            Tibetan antelope 8bp
B D                      Cow 7bp
               Domestic goat 10bp
B D                    Horse 8bp
B D         White rhinoceros 8bp
B D                      Cat 8bp
B D                      Dog 8bp
B D                  Ferret  8bp
B D                    Panda 15bp
              Pacific walrus 8bp
                Weddell seal 8bp
            Black flying-fox 8bp
B D                  Megabat 8bp
               Big brown bat 7bp
        David's myotis (bat) 7bp
  D         Little brown bat 7bp
B D                Armadillo 2bp
B D                  Opossum 5bp
B D          Tasmanian devil 2bp
  D      Collared flycatcher 1bp
B D              Zebra finch 1bp
B D       American alligator 1bp

Alignment block 16 of 232 in window, 20725875 - 20725881, 7 bps 
B D                     Human  ccc---c-tc--c---
B D                     Chimp  ccc---c-tc--c---
B D                   Gorilla  ccc---c-tc--c---
B D                 Orangutan  ccc---c-tc--c---
B D                    Gibbon  ccc---c-tc--c---
B D                    Rhesus  tcc---c-tc--c---
B D       Crab-eating macaque  tcc---c-tc--c---
B D                    Baboon  tcc---c-tc--c---
B D              Green monkey  tcc---c-tc--c---
B D                  Marmoset  ctc---c-tc--c---
B D           Squirrel monkey  ctc---c-tc--t---
B D                  Bushbaby  ccc---a-cc--c---
           Chinese tree shrew  tcc---a-gc-ac---
B D                  Squirrel  cca---c-tc--a---
       Lesser Egyptian jerboa  -tc---c-tt--g---
                 Prairie vole  ccc---c-tc--a---
B D           Chinese hamster  ccc---c-tc--a---
               Golden hamster  ccc---c-tc--a---
B D            Naked mole-rat  ------t-cc--c---
B D                Guinea pig  ------c-cc--c---
                   Chinchilla  --------ct--c---
             Brush-tailed rat  ------c-cc--c---
B D                    Rabbit  ccc--ac-tc--c---
B D                      Pika  ccc-ttc-tc--c---
B D                       Pig  ccg---c-cc--c---
B D                    Alpaca  ccctgac-cc--c---
               Bactrian camel  ccctgac-cc--c---
B D                   Dolphin  ccc---c-cc--c---
                 Killer whale  ccc---c-cc--c---
             Tibetan antelope  tcc---c-cc--c---
B D                       Cow  ccc---c-cc--c---
B D                     Sheep  ccc---c-ca--c---
                Domestic goat  ccc---c-caccc---
B D                     Horse  cca---c-tc--c---
B D          White rhinoceros  tca---c-cc--g---
B D                       Cat  cca---accc--c---
B D                       Dog  caa---a-cc--c---
B D                   Ferret   caa---a-cc--c---
B D                     Panda  cac-------------
               Pacific walrus  caa-------------
                 Weddell seal  caa-------------
             Black flying-fox  caa---c-cc--c---
B D                   Megabat  caa---c-cc--c---
                Big brown bat  cca---c-cc--c---
         David's myotis (bat)  cca---c-cc--c---
  D          Little brown bat  cca---c-cc--c---
B D                  Hedgehog  ccc---c-tc--t---
B D                     Shrew  ccc---t-ct--c---
              Star-nosed mole  tct---g-gc--c---
B D                 Armadillo  ------------c---
B D                   Opossum  --------cc--c---
B D           Tasmanian devil  --------cc--c---
  D       Collared flycatcher  ------------c---
B D               Zebra finch  ------------g---
B D        American alligator  ------------g---
B D               Stickleback  ------c-tc--cttc
                  Spotted gar  ------c-ac--cttt
B D                       Rat  ----------------
B D                     Mouse  ----------------
            Cape golden mole  ----------------
                    Aardvark  ----------------
B D                Coelacanth  ================
B D              Atlantic cod  ================
          Southern platyfish  ================
B D                      Fugu  ================
B D                 Tetraodon  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D              Mallard duck  ================
          Tibetan ground jay  ================
  D    White-throated sparrow  ================
    Mexican tetra (cavefish)  ================
B D                 Zebrafish  ================
B D                    Medaka  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
  D            Painted turtle  ----------------
  D           Green seaturtle  ----------------
B D                Budgerigar  ================
  D               Rock pigeon  ================
B D       Medium ground finch  ================
B D                    Lizard  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D                    Parrot  ================
         Cape elephant shrew  ----------------
B D                  Platypus  ================
B D                   Wallaby  ================
B D                   Manatee  ----------------
B D                  Elephant  ----------------
B D                    Tenrec  ----------------

Inserts between block 16 and 17 in window
B D                  Opossum 41bp
B D          Tasmanian devil 13bp
  D      Collared flycatcher 6bp
B D              Zebra finch 6bp
B D       American alligator 6bp
B D              Stickleback 15bp
                 Spotted gar 3bp

Alignment block 17 of 232 in window, 20725882 - 20725911, 30 bps 
B D                     Human  gg------cctccgtggcg--------gtc---------------------------------cc-----
B D                     Chimp  gg------cctccatggcg--------gtc---------------------------------cc-----
B D                   Gorilla  gg------cctccatggcg--------gtc---------------------------------cc-----
B D                 Orangutan  gg------cctccatggca--------gtc---------------------------------cc-----
B D                    Gibbon  cg------cctccatggcg--------gtc---------------------------------cc-----
B D                    Rhesus  gg------cctccatggtg--------gtc---------------------------------cc-----
B D       Crab-eating macaque  gg------cctccatggtg--------gtc---------------------------------cc-----
B D                    Baboon  gg------cctccatggtg--------gtc---------------------------------cc-----
B D              Green monkey  gg------cctccatggtg--------gtc---------------------------------cc-----
B D                  Marmoset  gg------cctccataaca--------gtc---------------------------------cc-----
B D           Squirrel monkey  gg------cctccatggca--------gtc---------------------------------cc-----
B D                  Bushbaby  ag------cctcggttgtg--------gcc--------------------------------acc-----
           Chinese tree shrew  gg------ctcccat------------------------------------------------tc-----
B D                  Squirrel  ag------cctcagtgg----------tgt---------------------------------cc-----
       Lesser Egyptian jerboa  ag------ccctg---------------------------------------------------------
                 Prairie vole  ag------acaca---------------------------------------------------------
B D           Chinese hamster  ag------gcaca---------------------------------------------------------
               Golden hamster  gg------gcaca---------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D                       Rat  ----------------------------------------------------------------------
B D            Naked mole-rat  ag------cctgggtgt----------att---------------------------------cc-----
B D                Guinea pig  ag------cctcggtgc----------atc---------------------------------cc-----
                   Chinchilla  ag------cctcgctgt----------gtc---------------------------------cc-----
             Brush-tailed rat  ag------cctccgtgt----------gtc---------------------------------cc-----
B D                    Rabbit  gt------cctcagcgg----------gac---------------------------------cc-----
B D                      Pika  at------ccttagcag----------gac---------------------------------ctcctca
B D                       Pig  ag------cctcagtgctg--------gg---------------------------------ccc-----
B D                    Alpaca  ag------cctcagtgctg--------agt--------------------------------cct-----
               Bactrian camel  ag------cctcagtgctg--------agt--------------------------------cct-----
B D                   Dolphin  cc------cccgagtgctg--------tgc--------------------------------ccc-----
                 Killer whale  cc------cccgagtgctg--------cgc--------------------------------ccc-----
             Tibetan antelope  ag------ccccagtgctg--------ggc--------------------------------ccc-----
B D                       Cow  ag------ccccaggcctg--------gg---------------------------------ccc-----
B D                     Sheep  ag------ccccagtgctg--------ggc--------------------------------ccc-----
                Domestic goat  ag------ccccagtgctg--------ggc--------------------------------ccc-----
B D                     Horse  ag------ccaacgtggca--------gtc--------------------------------ccc-----
B D          White rhinoceros  ag------tctccacagtc--------gtc--------------------------------ccc-----
B D                       Cat  ac------cctcagtgatg--------gtt--------------------------------cgc-----
B D                       Dog  ag------cctcagcagtg--------ctc--------------------------------gcc-----
B D                   Ferret   ag------ccttggtggtg--------gct--------------------------------ccc-----
B D                     Panda  gg------ccttggtggag--------gtt--------------------------------ccc-----
               Pacific walrus  --------------------------------------------------------------gcc-----
                 Weddell seal  --------------------------------------------------------------ccc-----
             Black flying-fox  ag------cctccgtggca--------ccc--------------------------------ccc-----
B D                   Megabat  ag------cctccgtggca--------gcc--------------------------------ccc-----
                Big brown bat  gg------cctcagtggtg--------gtt--------------------------------ccc-----
         David's myotis (bat)  ag------cctcagtggtg--------gtc--------------------------------tcc-----
  D          Little brown bat  ag------cctcagtggtg--------gtc--------------------------------ccc-----
B D                  Hedgehog  ag------cctc----------------------------------------------------------
B D                     Shrew  at------cttcaggggcg--------gtc--------------------------------ccc-----
              Star-nosed mole  ag------cctcagggtgg--------gcc--------------------------------cgc-----
B D                  Elephant  --------cctccacggtg--------gcc---------------------------------cc-----
          Cape elephant shrew  -----------ccgctgag--------gc-----------------------------------------
B D                   Manatee  --------cctccacggtg--------gtc---------------------------------cc-----
             Cape golden mole  --------cctccaagagc--------gtc---------------------------------ta-----
B D                    Tenrec  ----tcttcctcctgggg---------gtc---------------------------------cc-----
                     Aardvark  --------cttccatggca--------gtt---------------------------------cc-----
B D                 Armadillo  ctcccctgcctcagtggtg--------gtc---------------------------------cc-----
B D                   Opossum  ---------------agcctgccctgatgc--------------------------------tcc-----
B D           Tasmanian devil  ---------------------------tcc--------------------------------ccc-----
B D                   Wallaby  ---------------ggcc--------ccc--------------------------------tcc-----
  D       Collared flycatcher  ---------------------------ccc--------------------ccccccccccccccc-----
B D               Zebra finch  ---------------------------cgc--------------------gctcaggagcgctcg-----
B D        American alligator  ---------------------------ggcatggcatacctggagagcaagcactgcatccaccg-----
  D           Green seaturtle  -----------------------------------------------------------accacg-----
  D            Painted turtle  ---------------------------------------------------------------tg-----
B D                      Fugu  ----------------------------------------------------------------------
B D               Stickleback  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
          Southern platyfish  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================

                        Human  ----------ctg------c------ctc--aagcc---------------
                        Chimp  ----------ctg------c------ctc--aagcc---------------
                      Gorilla  ----------ctg------c------ctc--aagcc---------------
                    Orangutan  ----------ctg------c------ctc--gagcc---------------
                       Gibbon  ----------ctg------c------ctc--aagcc---------------
                       Rhesus  ----------ctg------c------ctc--gagcc---------------
          Crab-eating macaque  ----------ctg------c------ctc--gagcc---------------
                       Baboon  ----------ctg------c------ctc--gagcc---------------
                 Green monkey  ----------ctg------c------ctc--gagcc---------------
                     Marmoset  ----------ctg------c------ctt--gggcc---------------
              Squirrel monkey  ----------ctg------c------ctc--gggtc---------------
                     Bushbaby  ----------ctg------c------ctt--gggcc---------------
           Chinese tree shrew  ----------cgg------c------ctg--gggcc---------------
                     Squirrel  ----------ctgccccagc------ccg--gg------------------
       Lesser Egyptian jerboa  -------------------c------cct--gg------------------
                 Prairie vole  ----------ctacc----c------cct--gggtc---------------
              Chinese hamster  ----------ctacc----c------tct--gggtg---------------
               Golden hamster  ----------ctgcc----c------tct--gggtg---------------
                        Mouse  -------------------c------cct--aggtc---------------
                          Rat  -------------------c------ccc--cagtc---------------
               Naked mole-rat  ----------ctg------c------ttt--gggat---------------
                   Guinea pig  ----------ctg------c------ctt--gggcc---------------
                   Chinchilla  ----------ctg------c------ctt--gggcc---------------
             Brush-tailed rat  ----------ctg------c------ttt--gggcc---------------
                       Rabbit  ----------cca------c------cct--ggggc---------------
                         Pika  cccccacccaccg------c------ctt--atggc---------------
                          Pig  ----------ctg------c------cct--gggcc---------------
                       Alpaca  ----------ctg------c------cct--gggcc---------------
               Bactrian camel  ----------ctg------c------cct--gggcc---------------
                      Dolphin  ----------ctg------c------cct--gggcc---------------
                 Killer whale  ----------ctg------c------cct--ggg-c---------------
             Tibetan antelope  ----------ctg------c------cct--gggcc---------------
                          Cow  ----------ctg------c------cct--gggcc---------------
                        Sheep  ----------ctg------c------cct--gggcc---------------
                Domestic goat  ----------ctg------c------cct--gggcc---------------
                        Horse  ----------ctg------c------cct--gggtc---------------
             White rhinoceros  ---------------------------------------------------
                          Cat  ----------ctg------c------ccc--aggcc---------------
                          Dog  ----------ccg------c------cct--gggcc---------------
                      Ferret   ----------ctg------c------cct--gggcc---------------
                        Panda  ----------ctg------c------cct--gggcc---------------
               Pacific walrus  ----------cgg------c------cct--gtgcc---------------
                 Weddell seal  ----------cag------c------cct--gtgcc---------------
             Black flying-fox  ----------t-----------------------tg---------------
                      Megabat  ----------c-----------------------tg---------------
                Big brown bat  ----------tg--------------cct--gggcc---------------
         David's myotis (bat)  ----------tg--------------cct--gggcc---------------
             Little brown bat  ----------tg--------------gct--gggcc---------------
                     Hedgehog  ----------------------------g--ggatc---------------
                        Shrew  ----------tg--------------aag--aggcc---------------
              Star-nosed mole  ----------t-----------------t--aggcc---------------
                     Elephant  ----------ttg------c------ctt--gggcc---------------
          Cape elephant shrew  --------------------------------agtc---------------
                      Manatee  ----------ctg------c------ctt--gggcc---------------
             Cape golden mole  ----------ctg------c------ccc--aagcc---------------
                       Tenrec  ----------atg------t------ctc--agacc---------------
                     Aardvark  ----------ctg------c------ctt--gggcc---------------
                    Armadillo  ----------at--------------ctt--gggcc---------------
                      Opossum  ----------cat------t------ttt----------------------
              Tasmanian devil  ----------agg------t------ctt----tcc---------------
                      Wallaby  ----------cat------t------ctcaggggcc---------------
          Collared flycatcher  ----------ccc------ccccc--ccc--ccccc---------------
                  Zebra finch  ----------ctg------tgtgg--tgg--cagcc---------------
           American alligator  ----------gtg------cgtgg--gcc--aggcc---------------
              Green seaturtle  ----------ctg------cacg---tct--cggcg---------------
               Painted turtle  ----------ctg------cgcgggctcc--aggcg---------------
                         Fugu  -------------------------------ggcctccatcacaccaagac
                  Stickleback  -------------------------------ggtttacgctactc------
                  Spotted gar  --------------------------------agtcaaagcacgccgagac
                   Coelacanth  ===================================================
                 Atlantic cod  ===================================================
           Southern platyfish  ===================================================
                    Tetraodon  ===================================================
                       Turkey  ===================================================
                      Chicken  ===================================================
                 Mallard duck  ===================================================
           Tibetan ground jay  ===================================================
       White-throated sparrow  ===================================================
     Mexican tetra (cavefish)  ===================================================
                    Zebrafish  ===================================================
                       Medaka  ===================================================
          Pundamilia nyererei  ===================================================
                  Zebra mbuna  ===================================================
        Burton's mouthbreeder  ===================================================
          Princess of Burundi  ===================================================
                 Nile tilapia  ===================================================
                   Budgerigar  ===================================================
                  Rock pigeon  ===================================================
          Medium ground finch  ===================================================
                       Lizard  ===================================================
             Peregrine falcon  ===================================================
                 Saker falcon  ===================================================
                       Parrot  ===================================================
                     Platypus  ===================================================

Inserts between block 17 and 18 in window
B D       American alligator 6bp
  D          Green seaturtle 20bp
  D           Painted turtle 7bp

Alignment block 18 of 232 in window, 20725912 - 20725912, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  c
B D                       Rat  t
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
  D          Little brown bat  c
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                 Armadillo  t
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
  D       Collared flycatcher  c
B D               Zebra finch  c
  D                    Parrot  c
  D             Scarlet macaw  c
B D                   Chicken  c
B D        American alligator  c
  D           Green seaturtle  c
B D                      Fugu  a
                  Spotted gar  c
            Cape golden mole  -
                    Aardvark  -
B D                Coelacanth  =
B D              Atlantic cod  =
B D               Stickleback  -
          Southern platyfish  =
B D                 Tetraodon  =
B D                    Turkey  =
  D              Mallard duck  =
          Tibetan ground jay  =
  D    White-throated sparrow  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                Budgerigar  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
         Cape elephant shrew  -
B D                  Platypus  =
B D                   Manatee  -
B D                  Elephant  -
B D                    Tenrec  -
B D          White rhinoceros  -

Inserts between block 18 and 19 in window
  D                   Parrot 3bp
  D            Scarlet macaw 3bp
B D                  Chicken 2bp
B D       American alligator 1bp

Alignment block 19 of 232 in window, 20725913 - 20725914, 2 bps 
B D                     Human  -ca
B D                     Chimp  -ca
B D                   Gorilla  -ca
B D                 Orangutan  -ca
B D                    Gibbon  -ca
B D                    Rhesus  -ca
B D       Crab-eating macaque  -ca
B D                    Baboon  -ca
B D              Green monkey  -ca
B D                  Marmoset  -cg
B D           Squirrel monkey  -ca
B D                  Bushbaby  -ta
           Chinese tree shrew  -ca
B D                  Squirrel  -cc
       Lesser Egyptian jerboa  -ct
                 Prairie vole  -ca
B D           Chinese hamster  -ca
               Golden hamster  -cg
B D                     Mouse  -c-
B D                       Rat  -cc
B D            Naked mole-rat  -ca
B D                Guinea pig  -ca
                   Chinchilla  -tg
             Brush-tailed rat  -ca
B D                    Rabbit  -ca
B D                      Pika  -ca
B D                       Pig  -cg
B D                    Alpaca  -ct
               Bactrian camel  -ct
B D                   Dolphin  -ca
                 Killer whale  -ca
             Tibetan antelope  -cg
B D                       Cow  -cg
B D                     Sheep  -cg
                Domestic goat  -cg
B D                     Horse  -ca
B D                       Cat  -ca
B D                       Dog  -ca
B D                   Ferret   -ca
B D                     Panda  -ca
               Pacific walrus  -ca
                 Weddell seal  -ca
             Black flying-fox  -ca
B D                   Megabat  -ca
                Big brown bat  -ca
         David's myotis (bat)  -ca
  D          Little brown bat  -aa
B D                  Hedgehog  -ca
B D                     Shrew  -ca
              Star-nosed mole  -ca
B D                  Elephant  -ca
          Cape elephant shrew  -ag
B D                   Manatee  -ca
             Cape golden mole  -ca
B D                    Tenrec  -ca
                     Aardvark  -ca
B D                 Armadillo  -ca
B D                   Opossum  -tt
B D           Tasmanian devil  -tt
B D                   Wallaby  -cc
  D       Collared flycatcher  -cc
B D               Zebra finch  -ct
B D                Budgerigar  -cg
  D                    Parrot  -cg
  D             Scarlet macaw  -cg
B D                   Chicken  -cg
B D                    Turkey  -cg
B D        American alligator  -c-
  D           Green seaturtle  -ca
  D            Painted turtle  --a
B D                      Fugu  cc-
                  Spotted gar  tt-
B D                Coelacanth  ===
B D              Atlantic cod  ===
B D               Stickleback  ---
          Southern platyfish  ===
B D                 Tetraodon  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
  D    White-throated sparrow  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                  Platypus  ===
B D          White rhinoceros  ---

Inserts between block 19 and 20 in window
  D      Collared flycatcher 1bp
B D              Zebra finch 296bp
B D       American alligator 458bp

Alignment block 20 of 232 in window, 20725915 - 20725916, 2 bps 
B D                     Human  ga-
B D                     Chimp  ga-
B D                   Gorilla  ga-
B D                 Orangutan  ga-
B D                    Gibbon  ga-
B D                    Rhesus  ga-
B D       Crab-eating macaque  ga-
B D                    Baboon  ga-
B D              Green monkey  ga-
B D                  Marmoset  ga-
B D           Squirrel monkey  ga-
B D                  Bushbaby  ga-
           Chinese tree shrew  ga-
B D                  Squirrel  ga-
       Lesser Egyptian jerboa  ag-
                 Prairie vole  gg-
B D           Chinese hamster  gg-
               Golden hamster  ag-
B D                     Mouse  -g-
B D                       Rat  ag-
B D            Naked mole-rat  ga-
B D                Guinea pig  gg-
                   Chinchilla  gg-
             Brush-tailed rat  ag-
B D                    Rabbit  gg-
B D                      Pika  gg-
B D                       Pig  gg-
B D                    Alpaca  gg-
               Bactrian camel  gg-
B D                   Dolphin  gg-
                 Killer whale  gg-
             Tibetan antelope  gg-
B D                       Cow  gg-
B D                     Sheep  gg-
                Domestic goat  gg-
B D                     Horse  ga-
B D          White rhinoceros  ga-
B D                       Cat  ga-
B D                       Dog  ga-
B D                   Ferret   gg-
B D                     Panda  ag-
               Pacific walrus  ga-
                 Weddell seal  ga-
             Black flying-fox  ga-
B D                   Megabat  ga-
                Big brown bat  gg-
         David's myotis (bat)  gg-
  D          Little brown bat  gg-
B D                  Hedgehog  ag-
B D                     Shrew  ca-
              Star-nosed mole  gg-
B D                  Elephant  ga-
          Cape elephant shrew  ga-
B D                   Manatee  ga-
             Cape golden mole  gg-
B D                    Tenrec  ga-
                     Aardvark  ga-
B D                 Armadillo  ga-
B D                   Opossum  gc-
B D           Tasmanian devil  tg-
B D                   Wallaby  at-
B D        American alligator  gg-
  D           Green seaturtle  gc-
  D            Painted turtle  gg-
B D                      Fugu  -ac
                  Spotted gar  -gc
B D                Coelacanth  ===
B D              Atlantic cod  ===
B D               Stickleback  ---
          Southern platyfish  ===
B D                 Tetraodon  ===
B D                    Turkey  ---
B D                   Chicken  ---
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D             Scarlet macaw  ---
B D                Budgerigar  ---
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ---
B D                  Platypus  ===

Inserts between block 20 and 21 in window
B D                     Fugu 7bp
                 Spotted gar 14bp

Alignment block 21 of 232 in window, 20725917 - 20725917, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  c
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
  D          Little brown bat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  c
B D           Tasmanian devil  t
B D                   Wallaby  t
  D       Collared flycatcher  c
B D               Zebra finch  c
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
B D                   Chicken  c
B D                    Turkey  c
B D        American alligator  t
  D           Green seaturtle  c
  D            Painted turtle  c
B D                Coelacanth  t
B D                      Fugu  t
          Princess of Burundi  t
        Burton's mouthbreeder  t
                  Zebra mbuna  t
          Pundamilia nyererei  t
B D                    Medaka  t
           Southern platyfish  t
                  Spotted gar  t
B D              Atlantic cod  =
B D               Stickleback  -
B D                 Tetraodon  =
  D              Mallard duck  =
          Tibetan ground jay  =
  D    White-throated sparrow  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D              Nile tilapia  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                  Platypus  =

Inserts between block 21 and 22 in window
         Cape elephant shrew 4bp
  D          Green seaturtle 14bp
  D           Painted turtle 10bp

Alignment block 22 of 232 in window, 20725918 - 20725929, 12 bps 
B D                     Human  acctctcctg---gc
B D                     Chimp  acctctcctg---gc
B D                   Gorilla  acctctcctg---gc
B D                 Orangutan  acctctcctg---gc
B D                    Gibbon  acctctcctg---gc
B D                    Rhesus  acctctcctg---gc
B D       Crab-eating macaque  acctctcctg---gc
B D                    Baboon  acctctcctg---gc
B D              Green monkey  acctctcctg---gc
B D                  Marmoset  acctctcctg---gc
B D           Squirrel monkey  acctctcctg---gc
B D                  Bushbaby  acctctccag---gc
           Chinese tree shrew  acctccccgg---gc
B D                  Squirrel  acctctccag---gc
       Lesser Egyptian jerboa  acctctccag---gc
                 Prairie vole  acctctccag---gc
B D           Chinese hamster  acctctccag---gc
               Golden hamster  acctctccag---gc
B D                     Mouse  acctctccag---gc
B D                       Rat  acctctccag---gc
B D            Naked mole-rat  acctctccag---gc
B D                Guinea pig  acctctccag---gc
                   Chinchilla  acctctccag---gc
             Brush-tailed rat  acctctccag---gc
B D                    Rabbit  acctctccgg---gc
B D                      Pika  acctctcctg---gc
B D                       Pig  acctctccag---gc
B D                    Alpaca  acctctccag---gc
               Bactrian camel  acctctccag---gc
B D                   Dolphin  acctctccag---gc
                 Killer whale  acctctccag---gc
             Tibetan antelope  acctctccag---gc
B D                       Cow  acctctccag---gc
B D                     Sheep  acctctccag---gc
                Domestic goat  acctctccag---gc
B D                     Horse  acctctccag---gc
B D          White rhinoceros  acctctccag---gc
B D                       Cat  acctctccgg---gc
B D                       Dog  acctctccag---gc
B D                   Ferret   acctctccag---gc
B D                     Panda  acctctccag---gc
               Pacific walrus  acctctccag---gc
                 Weddell seal  acctctccag---gc
             Black flying-fox  acctctccag---gc
B D                   Megabat  acctctccag---gc
                Big brown bat  acctctccag---gc
         David's myotis (bat)  acctctccag---gc
  D          Little brown bat  acctctccag---gc
B D                  Hedgehog  acctcgccag---gt
B D                     Shrew  acctctccag---gc
              Star-nosed mole  acctctccag---gc
B D                  Elephant  acctctccag---gt
          Cape elephant shrew  acctctccag---gc
B D                   Manatee  acctctccag---gt
             Cape golden mole  acctctccag---gt
B D                    Tenrec  acctctccag---gc
                     Aardvark  acctctccag---gt
B D                 Armadillo  acctctccag---gc
B D                   Opossum  acctccccc-----c
B D           Tasmanian devil  acatacccc-----t
B D                   Wallaby  acctccccag---gc
  D       Collared flycatcher  cccccccccc-----
B D               Zebra finch  acctctcccg-----
           Tibetan ground jay  acctctcccg-----
B D                Budgerigar  acctcgccgg-----
  D                    Parrot  acctctcccg-----
  D             Scarlet macaw  acctcgcccg-----
B D                   Chicken  acctcaccca-----
B D                    Turkey  acctcgcctg-----
B D        American alligator  acctctccaggtt--
  D           Green seaturtle  gcgtt----------
  D            Painted turtle  gcgct----------
B D                Coelacanth  acctcgctgg---gc
B D                 Tetraodon  acctctgggg---c-
B D                      Fugu  actgctctgg---c-
          Princess of Burundi  actgctctgg---c-
        Burton's mouthbreeder  actgctctgg---c-
                  Zebra mbuna  actgctctgg---c-
          Pundamilia nyererei  actgctctgg---c-
B D                    Medaka  actgctcggg---c-
           Southern platyfish  accgctcggg---c-
B D               Stickleback  gccgctctgg---a-
B D              Atlantic cod  accgctctgg---c-
                  Spotted gar  accgccctgg---c-
  D              Mallard duck  ===============
  D    White-throated sparrow  ===============
    Mexican tetra (cavefish)  ===============
B D                 Zebrafish  ===============
B D              Nile tilapia  ===============
  D               Rock pigeon  ===============
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
B D                  Platypus  ===============

Inserts between block 22 and 23 in window
  D      Collared flycatcher 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 2bp
B D               Budgerigar 2bp
  D                   Parrot 2bp
  D            Scarlet macaw 2bp
B D                  Chicken 3bp
B D                   Turkey 3bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
B D                Tetraodon 1bp
B D                     Fugu 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
B D                   Medaka 1bp
          Southern platyfish 1bp
B D              Stickleback 1bp
B D             Atlantic cod 1bp
                 Spotted gar 1bp

Alignment block 23 of 232 in window, 20725930 - 20725930, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
  D          Little brown bat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  a
B D           Tasmanian devil  t
B D                   Wallaby  t
B D                Coelacanth  t
B D                 Tetraodon  t
B D                      Fugu  t
          Princess of Burundi  t
        Burton's mouthbreeder  t
                  Zebra mbuna  t
          Pundamilia nyererei  t
B D                    Medaka  t
           Southern platyfish  t
B D               Stickleback  t
B D              Atlantic cod  t
B D                 Zebrafish  t
                  Spotted gar  t
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
    Mexican tetra (cavefish)  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  -
  D             Scarlet macaw  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                  Platypus  =

Inserts between block 23 and 24 in window
B D               Coelacanth 1bp

Alignment block 24 of 232 in window, 20725931 - 20725935, 5 bps 
B D                     Human  ggctg
B D                     Chimp  ggctg
B D                   Gorilla  ggctg
B D                 Orangutan  ggctg
B D                    Gibbon  ggctg
B D                    Rhesus  ggctg
B D       Crab-eating macaque  ggctg
B D                    Baboon  ggctg
B D              Green monkey  ggctg
B D                  Marmoset  ggctg
B D           Squirrel monkey  ggctg
B D                  Bushbaby  ggctg
           Chinese tree shrew  ggctg
B D                  Squirrel  ggctg
       Lesser Egyptian jerboa  ggctg
                 Prairie vole  ggctc
B D           Chinese hamster  ggctc
               Golden hamster  ggctc
B D                     Mouse  ggctc
B D                       Rat  ggctc
B D            Naked mole-rat  ggctg
B D                Guinea pig  ggctg
                   Chinchilla  ggctg
             Brush-tailed rat  ggcta
B D                    Rabbit  ggctg
B D                      Pika  gcctg
B D                       Pig  ggctg
B D                    Alpaca  ggctg
               Bactrian camel  ggctg
B D                   Dolphin  ggctg
                 Killer whale  ggctg
             Tibetan antelope  ggctg
B D                       Cow  ggctg
B D                     Sheep  ggctg
                Domestic goat  ggctg
B D                     Horse  ggctg
B D          White rhinoceros  ggctg
B D                       Cat  ggttg
B D                       Dog  ggctg
B D                   Ferret   ggttg
B D                     Panda  ggctg
               Pacific walrus  ggcta
                 Weddell seal  ggctg
             Black flying-fox  ggctg
B D                   Megabat  ggctg
                Big brown bat  gtctg
         David's myotis (bat)  gtctg
  D          Little brown bat  gtctg
B D                  Hedgehog  ggctg
B D                     Shrew  ggttg
              Star-nosed mole  ggctc
B D                  Elephant  ggctg
          Cape elephant shrew  ggcta
B D                   Manatee  ggctg
             Cape golden mole  ggcta
B D                    Tenrec  ggctg
                     Aardvark  ggcta
B D                 Armadillo  ggttg
B D                   Opossum  agtct
B D           Tasmanian devil  tgttg
B D                   Wallaby  ggctt
  D       Collared flycatcher  cc---
B D               Zebra finch  ag---
           Tibetan ground jay  ag---
B D                Budgerigar  ag---
  D                    Parrot  ag---
  D             Scarlet macaw  ag---
  D              Mallard duck  gg---
B D                   Chicken  gg---
B D                    Turkey  gg---
B D        American alligator  gg---
  D           Green seaturtle  tg---
  D            Painted turtle  ag---
B D                Coelacanth  ggcg-
B D                 Tetraodon  ggcga
B D                      Fugu  gtcga
          Princess of Burundi  gcctt
        Burton's mouthbreeder  gcctt
                  Zebra mbuna  gcctt
          Pundamilia nyererei  gcctt
B D                    Medaka  gcctt
           Southern platyfish  gtctt
B D               Stickleback  gcctg
B D              Atlantic cod  ggcgg
B D                 Zebrafish  gtctg
                  Spotted gar  gcctg
  D    White-throated sparrow  =====
    Mexican tetra (cavefish)  =====
B D              Nile tilapia  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                  Platypus  =====

Inserts between block 24 and 25 in window
  D      Collared flycatcher 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
B D       American alligator 3bp
  D          Green seaturtle 3bp
  D           Painted turtle 3bp

Alignment block 25 of 232 in window, 20725936 - 20725962, 27 bps 
B D                     Human  cccacaaagaggtg--------gcagaagagcttg
B D                     Chimp  cccacaaagaggtg--------gcagaagagcttg
B D                   Gorilla  cccacaaagaggtg--------gcagaagagcttg
B D                 Orangutan  cccacaaagaggtg--------gcagaagaacttg
B D                    Gibbon  cccacaaagaggtg--------gcagaagagcttg
B D                    Rhesus  cccacaaagaggtg--------gcagaagagtttg
B D       Crab-eating macaque  cccacaaagaggtg--------gcagaagagtttg
B D                    Baboon  cccacaaagaggtg--------gcagaagagtttg
B D              Green monkey  cccacaaagaggtg--------acagaagagcttg
B D                  Marmoset  cccacgaagaggtg--------gcagaagagcttg
B D           Squirrel monkey  cccacgaagaggtg--------gcagaagagcttg
B D                  Bushbaby  ctcacaaacaggtg--------gcagaagagcttg
           Chinese tree shrew  cccacaaagaggtg--------gcagaagagcctg
B D                  Squirrel  cccacaaaaaggtg--------gcagaagagcttg
       Lesser Egyptian jerboa  cccacaaaaaggtg--------gcagaagagtttg
                 Prairie vole  cccacaaagaggtg--------gcagaaaagcttg
B D           Chinese hamster  cccacaaagaggtg--------gcaataaagcttg
               Golden hamster  cccacaaagaggtg--------gcagtaaagcttg
B D                     Mouse  cccacaaagagatg--------acaaaagagcttg
B D                       Rat  cccacaaagagatg--------acagaaaagcttg
B D            Naked mole-rat  cccacaaagaggtg--------gcagaagagtctg
B D                Guinea pig  cccacaaagaggtg--------gcagaagagtctg
                   Chinchilla  cccacaaagaggtg--------gcagaagagtctg
             Brush-tailed rat  cccgcaaagaggtg--------gcagaagagtctg
B D                    Rabbit  cccacgaagaggtg--------gcagaagagcttg
B D                      Pika  cccacgaagaggtg--------gcagaacagcttg
B D                       Pig  cccacaaagaggtg--------gcagaagagcttg
B D                    Alpaca  cccacaaagaggtg--------gcagaagagcttg
               Bactrian camel  cccacaaagaggtg--------gcagaagagcttg
B D                   Dolphin  cccacaaagaggtg--------gcagaagagcttg
                 Killer whale  cccacaaagaggtg--------gcagaagagcttg
             Tibetan antelope  cccacaaagaggtg--------gcagaagagcttg
B D                       Cow  cccacaaagaggtg--------gcagaagagcttg
B D                     Sheep  cccacaaagaggtg--------gcagaagagcttg
                Domestic goat  cccacaaagaggtg--------gcagaagagcttg
B D                     Horse  cccacaaagaggtg--------gcagaagagcttg
B D          White rhinoceros  cccacaaagaggtg--------gcagaagagcttg
B D                       Cat  cctacaaagaggtg--------gcagaagagcttg
B D                       Dog  cccacgaagagatg--------gcaaaagagcttg
B D                   Ferret   cccacgaagaggtg--------gcagaagagcttg
B D                     Panda  cccacaaagaggtg--------gcagaagagcttg
               Pacific walrus  cccacaaagaggtg--------gcagaagagcttg
                 Weddell seal  cccacaaagaggtg--------gcagaagagcttg
             Black flying-fox  cccacaaagaggtg--------acagaagagcttg
B D                   Megabat  cccacaaagaggtg--------acagaagagcttg
                Big brown bat  cccacaaagaggtg--------acagaagagcttg
         David's myotis (bat)  cccacaaaaaggtg--------acagaagagcttg
  D          Little brown bat  cccacaaaaaggtg--------acagaagagcttg
B D                  Hedgehog  cccacaaacaggtg--------gcagaagagcttg
B D                     Shrew  cccacgaagaggtg--------gcagaagagtctg
              Star-nosed mole  cccacaaagaggtg--------gcagaagagcttg
B D                  Elephant  cccacaaagaggtg--------gcagaagagcttg
          Cape elephant shrew  cccacaaagaggtg--------gcagaagagcttg
B D                   Manatee  cccacaaagaggtg--------gcagaagagcttg
             Cape golden mole  cccacaaagaggtg--------gcagaagagcttg
B D                    Tenrec  cccacaaagaggtg--------gcagaagagcttg
                     Aardvark  cccacaaaaaggtg--------gcagaagagcttg
B D                 Armadillo  cccacaaagaggtg--------gcagtagagattg
B D                   Opossum  cagagagg--------------gcaggggttctcc
B D           Tasmanian devil  acaataaattattattttttatgaagtaaactttg
B D                   Wallaby  ccaacaaacaagtg--------acagaagagtttg
  D              Saker falcon  cccacgaagaggtg--------gcagaagagggtg
  D       Collared flycatcher  ccccc------------------cccaagagggtg
B D               Zebra finch  cccacgaagaggtg--------gcagaagagggtg
           Tibetan ground jay  cccacgaagaggtg--------acagaagagggtg
B D                Budgerigar  cccacgaagaggtg--------gcagaagaggggg
  D                    Parrot  cccacgaagaggtg--------gcagaagaggggg
  D             Scarlet macaw  cccacgaagaggtg--------gcagaagaggggg
  D              Mallard duck  cccatgaagaggtg--------gcagaagagggcg
B D                   Chicken  ctcacaaagaggtg--------gcagaacagtgtg
B D                    Turkey  cccacaaagaggtg--------gcagaacagtgag
B D        American alligator  cccacaaagaggtg--------gcagaagagcttg
  D           Green seaturtle  ggctcggggcgggg--------ggggatgtgaagg
  D            Painted turtle  gcagcagga-ggtg--------agtggtgggccgg
B D                Coelacanth  cccacaaacagatg--------gcagtacagctca
B D                 Tetraodon  gcctggaagacgtg--------gcagtagagctgg
B D                      Fugu  gctctaaagacatg--------gcagtagagttgg
          Princess of Burundi  gctttaaagacatg--------gcagtagagctgg
        Burton's mouthbreeder  gctttaaagacatg--------gcagtagagctgg
                  Zebra mbuna  gctttaaagacatg--------gcagtagagctgg
          Pundamilia nyererei  gctttaaagacatg--------gcagtagagctgg
B D                    Medaka  gctctgaaaacgtg--------gcagtagagctgg
           Southern platyfish  gccttaaagacatg--------gcagtaaagttgg
B D               Stickleback  gcccggtagaggtc--------gcagtacagctgg
B D              Atlantic cod  gccttgaacaggtg--------gcagtagagttga
B D                 Zebrafish  gctctgaagaggtg--------gcaatagagctgg
                  Spotted gar  cccttgaaaaggtg--------acagtacagctgg
  D    White-throated sparrow  ===================================
    Mexican tetra (cavefish)  ===================================
B D              Nile tilapia  ===================================
  D               Rock pigeon  ===================================
B D       Medium ground finch  ===================================
B D                    Lizard  ===================================
  D          Peregrine falcon  ===================================
B D                  Platypus  ===================================

Inserts between block 25 and 26 in window
B D               Coelacanth 2bp

Alignment block 26 of 232 in window, 20725963 - 20726014, 52 bps 
B D                     Human  ctg-gctgggctccgt-------------gggtttc-------------gagccatgaaggca-------
B D                     Chimp  ctg-gctgggctctgt-------------gggtttc-------------gagccatgaaggca-------
B D                   Gorilla  ctg-gctgggctccgt-------------gggtttc-------------gagccatgaaggca-------
B D                 Orangutan  ctg-gctgggctccgt-------------gggtttc-------------tagccacgaaggca-------
B D                    Gibbon  ccg-gctgggctccgt-------------gggtttc-------------gagccatgaaggca-------
B D                    Rhesus  ctg-gctgggctccgt-------------gggtttc-------------gagccacgaaggca-------
B D       Crab-eating macaque  ctg-gctgggctccgt-------------gggtttc-------------gagccacaaaggca-------
B D                    Baboon  ctg-gctgggctccgt-------------gggtttc-------------gagccacgaaggca-------
B D              Green monkey  ctg-gctgggctgcgt-------------gggtttc-------------gagccacgaaggca-------
B D                  Marmoset  ctg-gctgggctccgt-------------gggtttc-------------gggccatgaaggca-------
B D           Squirrel monkey  ctg-gctgggcttcgt-------------gggtttc-------------gggccatgaaggca-------
B D                  Bushbaby  ctg-ggtgggctccgc-------------gggtttc-------------gggcgatgaaggca-------
           Chinese tree shrew  ctg-gctgggctccgt-------------gggttcc-------------gggcgacaaaggcg-------
B D                  Squirrel  ctg-gcggggctgcgt-------------gggttcc-------------gggcgatgaaggaa-------
       Lesser Egyptian jerboa  ctg-gctgggctacgt-------------gggttcc-------------gggcgataagggca-------
                 Prairie vole  ctg-gctgggctgcgt-------------gggttcc-------------gggaaacaaaagca-------
B D           Chinese hamster  ctg-gctgggcttctc-------------gggttcc-------------gggcaacaaaagca-------
               Golden hamster  ctg-gctgggctgcgc-------------gggttcc-------------gggcaacaaaagca-------
B D                     Mouse  ctg-gatgggctgcgt-------------gggttcc-------------gggcaataaaagca-------
B D                       Rat  ctg-gctgggctgcgt-------------gggttcc-------------gggcaacaaaagca-------
B D            Naked mole-rat  ctg-gctgggtttcgt-------------gggttcc-------------gagcgacgaaggca-------
B D                Guinea pig  ctg-ggtgggcttcgt-------------gggttcc-------------gggcaataaaggca-------
                   Chinchilla  ctg-ggtgggcttcgt-------------gggttcc-------------gggcaacaaaggca-------
             Brush-tailed rat  ctg-gctgggcttcgt-------------gggttcc-------------gggcaacaaaggca-------
B D                    Rabbit  ctg-gccgggctccgt-------------gggttcc-------------gcgcgacgaaggca-------
B D                      Pika  ctg-gccgggctccgt-------------gggttcc-------------gggcaatgaaggca-------
B D                       Pig  ctg-gccgggctccgg-------------gggtttc-------------gggccatgaaggca-------
B D                    Alpaca  ctg-gctgggctccgg-------------gggtttc-------------gggccatgaaggca-------
               Bactrian camel  ctg-gccgggctccgg-------------gggtttc-------------gggccatgaaggca-------
B D                   Dolphin  ctg-gccgggctccgg-------------ggatttc-------------gggccatgaaggca-------
                 Killer whale  ctg-gccgggctccgg-------------ggatttc-------------gggccatgaaggca-------
             Tibetan antelope  ctg-gctgggctcctg-------------gggtttc-------------gggccatgaaggca-------
B D                       Cow  ctg-gctgggctcctg-------------gggtttc-------------gggccatgaaggca-------
B D                     Sheep  ctg-gctgggctcctg-------------gggtttc-------------gggccatgaaggca-------
                Domestic goat  ctg-gctgggctcctg-------------gggtttc-------------gggccatgaaggca-------
B D                     Horse  ctg-gccgggctccgg-------------gggtttc-------------gggccatgaaggca-------
B D          White rhinoceros  ctg-gctgggctccgc-------------gggtttc-------------gggccatgaaggca-------
B D                       Cat  ctg-gctgggctctgg-------------gggtttc-------------gggccacgaaggca-------
B D                       Dog  ctg-gctgggctctgg-------------ggatttc-------------gggccatgaaggca-------
B D                   Ferret   ttg-gccgggctctgg-------------gggtttc-------------gggccatgaaggcg-------
B D                     Panda  ctg-gccgggctctgg-------------gggtttc-------------gggccatgaaggca-------
               Pacific walrus  ctg-gccgggctctgg-------------gggtttc-------------gggccatgaaggca-------
                 Weddell seal  ctg-gccgggctctgg-------------gggtttc-------------gggccatgaaggca-------
             Black flying-fox  ctg-gccgggctccgt-------------gggtttc-------------gggccacaaaggca-------
B D                   Megabat  ctg-gccgggctccgt-------------gggtttc-------------gggccacaaaggca-------
                Big brown bat  ctg-gccggactccgt-------------gggtttc-------------gggccacaaaggca-------
         David's myotis (bat)  ctg-gccgggctccgt-------------gggtttc-------------gggccacaaaggca-------
  D          Little brown bat  ctg-gccgggctccgt-------------gggtttc-------------gggccacaaaggca-------
B D                  Hedgehog  ctg-gctgggctctga-------------gggttcc-------------gggccatgaaggca-------
B D                     Shrew  ctg-ggtgggctccga-------------gggttcc-------------gggccaggaaggca-------
              Star-nosed mole  ctg-gccgggctccgg-------------ggatttc-------------gggccatgaaggca-------
B D                  Elephant  ctg-gccgggctccgg-------------gggtttc-------------gggccataaaggca-------
          Cape elephant shrew  ctg-gctgggctccgt-------------gggtttc-------------gggcaatgaaggca-------
B D                   Manatee  ctg-gccgggctccgc-------------gggtttc-------------gggcaatgaaggca-------
             Cape golden mole  ctg-gctgggctccgt-------------gggttcc-------------gggcaatgaaggca-------
B D                    Tenrec  gtg-gccgggctccgt-------------gggtttc-------------gggcagtgaaggca-------
                     Aardvark  ttg-gctgggctctgt-------------gggtttc-------------gggcaatgaaggca-------
B D                 Armadillo  ctg-gccgggctccgt-------------gggtttc-------------gggcaatgaaggca-------
B D                   Opossum  ccg-gcggggccccgg-------------tggctcccagggtgggaggaggccggggggtgga-------
B D           Tasmanian devil  tggaggtgatcgttgg-------------gaat----------------gggcgggcagggca-------
B D                   Wallaby  ctg-gctgggctccga-------------gggttcc-------------gggagatgaaggca-------
  D              Saker falcon  cga-gcagggctgcag-------------ggattgc-------------gggccacgaaggcg-------
  D       Collared flycatcher  ctg-ggggggctgtgg-------------gggttgc-------------gggccacgaaggcg-------
B D               Zebra finch  ctg-ggggggctgtgg-------------gggttgc-------------gggccacgaaggcg-------
           Tibetan ground jay  ctg-ggggggctgtgg-------------gggttgc-------------gggccacgaaggcg-------
B D                Budgerigar  ctg-cgggggctgtgg-------------gggttgc-------------gggccacgaaggcg-------
  D                    Parrot  ctg-ccggggctgtgg-------------ggattgc-------------gggccacgaaggcg-------
  D             Scarlet macaw  ctg-ccggggctgtgg-------------ggattgc-------------gggccacgaaggca-------
  D              Mallard duck  ctg-ggggggctgtag-------------gggttgc-------------gggccacgaaggcg-------
B D                   Chicken  ctg-ggggggctgtgg-------------gggttgc-------------gggccacaaaggcg-------
B D                    Turkey  ctg-ggggggctgcgg-------------gggttgc-------------gggccacgaaggcg-------
B D        American alligator  ctg-gctgggctgcgt-------------ggatttc-------------gtgacacaaaggca-------
  D           Green seaturtle  cag-ggcgggctgtggccctccggatcagggcgggg-------------agggcactgtggcagggggca
  D            Painted turtle  cgg-gggtgctggtggccgagctgccc--gcctggc-------------gcagccctgagccctgatgtg
B D                Coelacanth  ctg-gttg---------------------gggttgc-------------gtgctacaaaggca-------
B D                 Tetraodon  gcg-tccaccctgccg-------------gggttgt-------------gggagacgaaggcg-------
B D                      Fugu  gcg-tccacgctgccg-------------ggattgt-------------gggagacaaaggca-------
          Princess of Burundi  gtg-tctgggcagcct-------------gggttat-------------gagcgacaaaggca-------
        Burton's mouthbreeder  gtg-tctgggcagcct-------------gggttat-------------gcgcgacaaaggca-------
                  Zebra mbuna  gtg-tctgggcagcct-------------gggttat-------------gcgcgacaaaggca-------
          Pundamilia nyererei  gtg-tctgggcagcct-------------gggttat-------------gcgcgacaaaggca-------
B D                    Medaka  gcg-tcggtgctgccc-------------gggttat-------------gggagacgaaggca-------
           Southern platyfish  ccg-taggtgctgcct-------------gggttat-------------gggagacgaaggca-------
B D               Stickleback  ccg-tcggcgcggccc-------------gggttgt-------------gggagatgaaggcg-------
B D              Atlantic cod  gcg-ttggcgcttccc-------------gggttgt-------------gggagacgaaggcg-------
B D                 Zebrafish  gca-tcagaatttcca-------------ggattat-------------gagaggcaaaggca-------
                  Spotted gar  cta-tccggacaccca-------------gggttgt-------------gcgagacaaaggca-------
  D    White-throated sparrow  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D              Nile tilapia  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                  Platypus  ======================================================================

                        Human  -------aactggcagt-cggcag
                        Chimp  -------aactggcagt-cggcag
                      Gorilla  -------aactggcagt-cggcag
                    Orangutan  -------aactggcagt-cggcag
                       Gibbon  -------aactggcagt-cggcgg
                       Rhesus  -------aactggcagt-cggcag
          Crab-eating macaque  -------aactggcagt-cggcag
                       Baboon  -------aactggcagt-cggcag
                 Green monkey  -------aactggcagt-cggcag
                     Marmoset  -------aactggcagt-cggcag
              Squirrel monkey  -------aactggcagt-cggcgg
                     Bushbaby  -------aactggcagt-cggcag
           Chinese tree shrew  -------aactggcagt-cggcgg
                     Squirrel  -------aactggcaat-tggcag
       Lesser Egyptian jerboa  -------aactggcagg-cagctg
                 Prairie vole  -------aactgacagg-cggctg
              Chinese hamster  -------aactgacagg-cagctg
               Golden hamster  -------aactgacagg-cggctg
                        Mouse  -------aactggcagg-cagctg
                          Rat  -------aactggcagg-cggctg
               Naked mole-rat  -------aactggcagc-gggctg
                   Guinea pig  -------aactggcagc-gggccg
                   Chinchilla  -------aactggcagc-gggctg
             Brush-tailed rat  -------aactggcagc-gggctg
                       Rabbit  -------aactggcagt-cagcag
                         Pika  -------aactggcagt-cagctg
                          Pig  -------aactggcagt-cagctg
                       Alpaca  -------aactggcagt-cagctg
               Bactrian camel  -------aactggcagt-cagctg
                      Dolphin  -------aactggcagt-cggctg
                 Killer whale  -------aactggcagt-cggctg
             Tibetan antelope  -------aactggcagt-cggccg
                          Cow  -------aactggcagt-cggccg
                        Sheep  -------aactggcagt-cggctg
                Domestic goat  -------aactggcagt-cggctg
                        Horse  -------aactggcagt-cagctg
             White rhinoceros  -------aactggcagt-cagctg
                          Cat  -------aactggcggt-cagctg
                          Dog  -------aactggcagt-cagctg
                      Ferret   -------aactggcagt-cagccg
                        Panda  -------aactggcagt-gggcgg
               Pacific walrus  -------aactggcagt-cagctg
                 Weddell seal  -------aactgacagt-cagctg
             Black flying-fox  -------aactggcagt-cggctg
                      Megabat  -------aactggcagt-cggctg
                Big brown bat  -------aactggcagt-cggctg
         David's myotis (bat)  -------aactggcagt-cgtctg
             Little brown bat  -------aactggcagt-cgtctg
                     Hedgehog  -------aactggcact-gggcag
                        Shrew  -------aactggcaat-ctgccg
              Star-nosed mole  -------aactggcagt-ggctgg
                     Elephant  -------aactggcagt-cggctg
          Cape elephant shrew  -------aactggcagt-cggcgg
                      Manatee  -------aactggcagt-cagccg
             Cape golden mole  -------aactggcagt-ctgctg
                       Tenrec  -------aactggcagt-cagccg
                     Aardvark  -------aactggcagt-cggccg
                    Armadillo  -------aactggcagt-cggccg
                      Opossum  -------ggggagcgtcgctgcgg
              Tasmanian devil  -------ccggggcgt--------
                      Wallaby  -------aactggcatt-cagctg
                 Saker falcon  -------aactggcggt-cggcgt
          Collared flycatcher  -------aactggcggt-cgggga
                  Zebra finch  -------aactggcggt-cagggg
           Tibetan ground jay  -------aactggcggt-cgggga
                   Budgerigar  -------aactggcggt-cggcgc
                       Parrot  -------aactggcggt-cggcgc
                Scarlet macaw  -------aactggcggt-cggcgc
                 Mallard duck  -------aactggtgct-cagcgt
                      Chicken  -------aactggcgct-cggcat
                       Turkey  -------aactgacgct-cagtgt
           American alligator  -------aactgacagt-ctgtgg
              Green seaturtle  cccaagatgcctgtggg-aga---
               Painted turtle  tct----cccccgcaga-cgg---
                   Coelacanth  -------aactggcaat-ctgccg
                    Tetraodon  -------aactgggcat-cggccg
                         Fugu  -------aactgggcat-caacgg
          Princess of Burundi  -------aactgtgaat-cgacgg
        Burton's mouthbreeder  -------aactgtgaat-cgacgg
                  Zebra mbuna  -------aactgtgaat-cgacgg
          Pundamilia nyererei  -------aactgtgaat-cgacgg
                       Medaka  -------aactgggcgt-cggcgg
           Southern platyfish  -------aactggccat-caattg
                  Stickleback  -------aactgggcgt-cgacgg
                 Atlantic cod  -------aactgtgagt-ccgagg
                    Zebrafish  -------aactgggcat-cagagg
                  Spotted gar  -------aactgggctt-ctgaag
       White-throated sparrow  ========================
     Mexican tetra (cavefish)  ========================
                 Nile tilapia  ========================
                  Rock pigeon  ========================
          Medium ground finch  ========================
                       Lizard  ========================
             Peregrine falcon  ========================
                     Platypus  ========================

Inserts between block 26 and 27 in window
  D          Green seaturtle 4bp
  D           Painted turtle 4bp

Alignment block 27 of 232 in window, 20726015 - 20726068, 54 bps 
B D                     Human  ggcaccaggtgga--------gtagagtatgcgcctc---ag-----------ggcatgagccatcag--
B D                     Chimp  ggcaccaggtgga--------gtagagtatgcgcctc---ag-----------ggcgtgagccatcag--
B D                   Gorilla  ggcaccaggtgga--------gtagagtatgcgcctc---ag-----------ggcgtgagccatcag--
B D                 Orangutan  ggcaccaggtgga--------gtacagtatgcgcctc---ag-----------ggcgtgagccatcag--
B D                    Gibbon  ggcaccaggtgga--------gtagagtatgcgcctc---ag-----------ggcgtgagccatcag--
B D                    Rhesus  ggcaccaggtgga--------gtagaggatgcgcctc---ag-----------ggcatgcgccatcag--
B D       Crab-eating macaque  ggcaccaggtgga--------gtagaggatgcgcctc---ag-----------ggcatgcgccatcag--
B D                    Baboon  ggcaccaggtgga--------gtagaggatgcgcctc---ag-----------ggcatgcgccatcag--
B D              Green monkey  ggcaccaggtgga--------gtagaggatgcgcctc---ag-----------ggcatgcgccatcag--
B D                  Marmoset  ggcaccaggtaga--------gtagaggatgcgcctc---ag-----------ggcatgtgccatcag--
B D           Squirrel monkey  ggcaccaggtgga--------gtagaggatgcgcctt---ag-----------ggcatgtgccatcag--
B D                  Bushbaby  ggcaccaggtgga--------gtagagcatgcgcctc---ag-----------ggcatgtgccatcag--
           Chinese tree shrew  ggcaccaggtgga--------gtagagtatgcgcctc---ag-----------ggcgtgggccatcag--
B D                  Squirrel  gacaccaggtgga--------atagaggatgcgtctc---ag-----------ggcatgggccatcag--
       Lesser Egyptian jerboa  ggcaccaagtggc--------atagaagatgcgtctc---ag-----------agcatgggccatcag--
                 Prairie vole  ggcaccaggtggc--------atagaggatgcgcttc---ag-----------ggcatgggccatcag--
B D           Chinese hamster  ggcaccaggtggc--------atagaggatccgcttc---ag-----------ggcatgggccatcag--
               Golden hamster  ggcaccaggtggc--------atagaggacgcgcttc---ag-----------ggcgtgggccatcag--
B D                     Mouse  ggtaccaggtggc--------atagaggatgcgcttc---ag-----------cgcatgggccattag--
B D                       Rat  ggttccaggtggc--------atagaggatgcgcttc---ag-----------agcatgggccatgag--
B D            Naked mole-rat  ggctccaggtaga--------gtagaggatgcgccgc---ag-----------ggcgtgggccatcag--
B D                Guinea pig  ggctccaggtaga--------gtagaggatgcgccgg---ag-----------gccatgggccatcag--
                   Chinchilla  ggctccaggtaga--------gtagaggatgcgccgc---ag-----------gccatgggccatcag--
             Brush-tailed rat  ggctccaggtaga--------gtagaggatgcgtcgc---ag-----------gccatgagccatcag--
B D                    Rabbit  ggcaccaggtgga--------gtagaggatgcgcctc---ag-----------ggcgtgggccatcag--
B D                      Pika  ggcaccaggtgga--------gtagaggatgcgcctc---ag-----------ggcgtgcgccatcag--
B D                       Pig  ggcaccaggtagt--------gtagaggatgcgccgc---ag-----------ggcgtgggccatcag--
B D                    Alpaca  ggcaccaggtgga--------gtagaggatgcgccgc---ag-----------ggcgtgagccatcag--
               Bactrian camel  ggcaccaagtgga--------gtagaggatgcgccgc---ag-----------ggcgtgagccatcag--
B D                   Dolphin  ggcaccaggtgga--------gtagagtatgcgcctc---ag-----------ggcgtgagccatcag--
                 Killer whale  ggcaccaggtgga--------gtagagtatgcgcctc---ag-----------ggcgtgagccatcag--
             Tibetan antelope  ggcaccaggtggc--------atagaggatgcgcctc---ag-----------ggcgtgcgccatcag--
B D                       Cow  ggcaccaggtggc--------atagaggatgcgcctc---ag-----------ggcgtgcgccatcag--
B D                     Sheep  ggcaccaggtggc--------atagaggatgcgcctc---ag-----------ggcgtgcgccatcag--
                Domestic goat  ggcaccaggtggc--------atagaggatgcgcctt---ag-----------ggcgtgtgccatcag--
B D                     Horse  ggcaccaggtgga--------gtagagtatgcgcctc---ag-----------ggcgtgcgccatcag--
B D          White rhinoceros  ggcaccaggtgga--------gtagaggacgcgcctc---ag-----------ggcgtgagccatcag--
B D                       Cat  ggcaccaggtaga--------gtagagcacgcgcctc---ag-----------agcatgagccatcag--
B D                       Dog  ggcaccaggtgga--------gtagaggatgcgcctc---ag-----------agcatgagccatcag--
B D                   Ferret   ggcaccaggtgga--------gtagaggatgcgccgc---ag-----------ggcgtgagccatcag--
B D                     Panda  ggcaccaggtaga--------gtagaggatacgcttc---ag-----------agcgtgagccatgag--
               Pacific walrus  ggcaccaggtaga--------gtagaggatgcgcctc---ag-----------agcatgagccatcag--
                 Weddell seal  ggcaccaggtaga--------gtagaggatgcgcctc---ag-----------agcatgagccatcag--
             Black flying-fox  ggcaccaggtgga--------gtagagtattcgcttc---ag-----------ggcatgtgccatcag--
B D                   Megabat  ggcaccaggtgga--------gtagagtattcgcttc---ag-----------ggcatgtgccatcag--
                Big brown bat  ggcaccaggtgga--------gtagagtattcgcctc---ag-----------ggcgtgtgccatcag--
         David's myotis (bat)  ggcaccaggtgga--------gtagagtattcgcctc---ag-----------ggcgtgtgccatcag--
  D          Little brown bat  ggcaccaggtgga--------gtagagtattcgcctc---ag-----------ggcgtgtgccatcag--
B D                  Hedgehog  ggcaccaggtgga--------gtacaggatacgcctc---ag-----------ggcgtgtgccatcag--
B D                     Shrew  ggcaccaggtgga--------gaagaggatgcgccgt---ag-----------ggcgtgggccatcag--
              Star-nosed mole  ggcaccaggtgca--------gtagagaatgcgcctc---ag-----------ggcgtgggccatcag--
B D                  Elephant  ggcaccaggtgga--------atggagtatgcgcctc---ag-----------ggcatgagccatcag--
          Cape elephant shrew  ggcaccaggtgga--------gtggagtatgcgtcgc---ag-----------ggcatgagccatcag--
B D                   Manatee  ggcaccaggtgga--------gtggagtatgcgtctc---ag-----------ggcatgagccatcag--
             Cape golden mole  ggcaccaggtaga--------gtggaatattcgcctc---ag-----------ggcatgagccatcag--
B D                    Tenrec  ggcaccaggtaga--------gtggaatatgcgtctc---aa-----------ggcatgtgccatcag--
                     Aardvark  ggcaccaggtgga--------gtggagtatacgcctc---ag-----------ggcatgagccatcag--
B D                 Armadillo  ggcaccaggtgca--------gtagagaatgcgcctc---ag-----------ggcatgcgccatcag--
B D                   Opossum  gagacgaggggggccgctccggggggggctcctcctc---gggcctcctggccggca-------------
B D           Tasmanian devil  ----ccaggtgga----------agagcttcc----c---ag-----------ggca-------------
B D                   Wallaby  ggcaccaggtgga--------gtagaggatccgcttc---ag-----------ggcatgagccatcag--
  D              Saker falcon  ggtgccacgtgct--------gtacaggatgcggcag---ag-----------agcgtgcgccatcag--
  D          Peregrine falcon  ggtaccacgtgct--------gtacaggatgcggcag---ag-----------agcgtgcgccatcag--
  D       Collared flycatcher  ggctccaggtgct--------gtacaggatgcggcgc---ag-----------tgcgtgtgccatcag--
B D               Zebra finch  gcctccaggtgct--------gtacaggatccggcgc---ag-----------cgcgtgtgccatcag--
           Tibetan ground jay  gcctccaggtgct--------gtacaggatccggcgc---ac-----------cgcgtgtgccatgag--
B D                Budgerigar  gtcgccatgtgct--------gtacaggatccggcgc---ag-----------ggcatgtgccatcag--
  D                    Parrot  gtcgccacgtgct--------gtacaggatgcggcgc---ag-----------ggcatgcgccatcag--
  D             Scarlet macaw  gtcgccacgtgct--------gtacaggatccggcgc---ag-----------ggcatgtgccatcag--
  D              Mallard duck  gcctccaggtgct--------gtacaggatccggcgc---ag-----------agcgtgcgccatcag--
B D                   Chicken  gcaggcaggtgct--------gtacaggatgcggcgc---ag-----------cgcgtgcgccatcag--
B D                    Turkey  gcaggcaggtgct--------gtacaggatgcggcgc---ag-----------cgcgtgcgccatcag--
B D        American alligator  gcctccacgtgga--------gtacaggatccgtctc---ag-----------ggcatgagccatcag--
  D           Green seaturtle  gcagcc---------------cagtgggagcagggccaagag-----------cagatgagccggggggt
  D            Painted turtle  gcagctggaggtg--------cggctggagcaggcgctggag-----------gccctgagccgggag--
B D                Coelacanth  agcaacacgtact--------ataaaagattcttcgg---ag-----------ggcatgagccatgag--
B D                 Tetraodon  ggcgggccgtgga--------cagggagacccggcgc---ag-----------ggcgtgggccatgag--
B D                      Fugu  gccgggcagtgga--------gagggagacccggcgc---ag-----------ggcgtgggccatcag--
          Princess of Burundi  gtcgggccgtgga--------aagagagattctccgc---ag-----------agcgtgggccatcag--
        Burton's mouthbreeder  gtcgggccgtgga--------aagagagattctccgc---ag-----------agcgtgggccatcag--
                  Zebra mbuna  gtcgggccgtgga--------aagagagattctccgc---ag-----------agcgtgggccatcag--
          Pundamilia nyererei  gtcgggccgtgga--------aagagagattctccgc---ag-----------agcgtgggccatcag--
B D                    Medaka  gccgggcggtgga--------cagggacactcggtgc---ag-----------agcgtgggccatcag--
           Southern platyfish  ggcgggcggtaga--------cagagagactcttcgc---aa-----------agcatgagccattag--
B D               Stickleback  gccgggcggtgga--------cagggagacccgacgc---ag-----------cgcgtgagccatcag--
B D              Atlantic cod  ggcgtgcggtgga--------gaaggagactctgcgt---ag-----------ggcatgagccatcag--
B D                 Zebrafish  gacgggcggtgga--------cagggagactcgacac---at-----------cgcatgagccatgag--
                  Spotted gar  gggagcaggtgga--------gaaggacaccctccgc---ag-----------ggcgtgagccatcag--
  D    White-throated sparrow  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D              Nile tilapia  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
B D                  Platypus  ======================================================================

                        Human  cagc-acct
                        Chimp  cagc-acct
                      Gorilla  cagc-acct
                    Orangutan  cagc-acct
                       Gibbon  cagc-acct
                       Rhesus  aagc-acct
          Crab-eating macaque  aagc-acct
                       Baboon  aagc-acct
                 Green monkey  aagc-acct
                     Marmoset  tagc-acct
              Squirrel monkey  cagc-acct
                     Bushbaby  gagc-acct
           Chinese tree shrew  cagt-acct
                     Squirrel  gagc-acct
       Lesser Egyptian jerboa  gagc-acct
                 Prairie vole  gagc-acct
              Chinese hamster  gagc-acct
               Golden hamster  gagc-acct
                        Mouse  gagc-acct
                          Rat  gagc-acct
               Naked mole-rat  gagc-acct
                   Guinea pig  gagc-gtct
                   Chinchilla  gagt-gcct
             Brush-tailed rat  gagt-gcct
                       Rabbit  gagc-acct
                         Pika  aagc-acct
                          Pig  aagc-acct
                       Alpaca  gagc-acct
               Bactrian camel  gagc-acct
                      Dolphin  gagc-acct
                 Killer whale  gagc-acct
             Tibetan antelope  gagc-acct
                          Cow  gagc-acct
                        Sheep  gagc-acct