>Nucleic acid-b...
CCAATTGATCTTGTACCAAACCAACCATATCCAAACGCAAGCTTCGATAA
TTTTAAGTTTGTATGTGATAATATCAAATTTGCTGATGATTTAAACCAGT
TAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTC
CCTGACTTAAATGGTGATGTGGTGGCTATTGATTATAAACACTACACACC
CTCTTTTAAGAAAGGAGCTAAATTGTTACATAAACCTATTGTTTGGCATG
TTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATA
CGTTGTCTTTGGAGCACAAAACCAGTTGAAACA