Multiz Alignments of 35 Vertebrates

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 340 in window, 56737571 - 56737597, 27 bps 
B D                 Mouse  cagcttc---------ct-------cgccatcat-----acattcact
B D                   Rat  cagcgtc---------ct-------caccatcat-----acaatcact
            GCF_003668045  ctgcgtc---------ct-------cgccaccgct---gtaaatcctt
B D              Squirrel  ccgcaac---------ct-------tt---------------------
B D            Guinea pig  tcactgg---------ct------------------------------
B D                  Pika  ctgcacc---------cc-------ggtcggcgc-----acggctct-
B D                 Human  ctgcgtc---------ct-------cctcacgaagctgcgcaacttct
B D                 Chimp  ctgcgtc---------ct-------cctcaacaagctgcgcaacttct
B D                Bonobo  ctgcgtc---------ct-------cctcaacaagctgcgcaacttct
B D               Gorilla  ctgcgtc---------ct-------cctcaccaagctgcgcaacttct
B D                Rhesus  ctgcgtc---------ct-------cctcaccaagctgcgcaacttct
B D              Marmoset  ctgcgtc---------ct-------tctcacaaagctgcgcaacttct
B D               Tarsier  ctgcgtc---------ct-------cgtcac------------ctccc
B D              Bushbaby  ctgtggc---------ctgtgtccacatccccgagcagcgcaacat-t
B D  Malayan flying lemur  ctgtgtc---------ct-------cgtcaccgcgccac-caatttct
B D                   Pig  caggggt-----------------------------------------
B D               Dolphin  cagtgtcctcc----tct-------cgtcacctagctatgtgccttcc
B D                   Cow  cagtgtc---------ct-------tgtcaccgagctctgtggcttct
B D                 Sheep  cagtgtc---------ct-------tgtcacggagctctgtggcttct
B D                 Horse  cggtgtccact----cgt-------caccgctcagccgcgcggcttct
B D      Chinese pangolin  cggtgtcctcc----tct-------cgtcaccgagcagtgcggcttct
B D                   Dog  tgctg---tcc----tct-------catcatggagcggtgtggcttcc
B D    Hawaiian monk seal  cggtgtcctcc----tct-------cctcaccgagcggtgtggcttct
B D                 Shrew  cgacgtccttcccgttcc-------cgtcgcggagccgtgcagctgct
B D                Tenrec  ================================================
B D              Hedgehog  ================================================
B D             Zebrafish  ================================================
B D         X. tropicalis  ================================================
B D               Opossum  ================================================
B D               Chicken  ================================================
B D              Elephant  ================================================
B D                Rabbit  ================================================
                  Beaver  ================================================

Alignment block 2 of 340 in window, 56737598 - 56737609, 12 bps 
B D                 Mouse  actaaaattgca
B D                   Rat  actaaaattgca
            GCF_003668045  actagaagtgta
                   Beaver  actaacgctgca
B D              Squirrel  actgaaactg--
B D            Guinea pig  gtggaagctgca
B D                  Pika  gccaaagccgcg
B D                 Human  gctaatgctgca
B D                 Chimp  gctaatgctgca
B D                Bonobo  gctaatgctgca
B D               Gorilla  gctaatgctgca
B D                Rhesus  gctaatgctgcc
B D              Marmoset  gctaatgctgca
B D               Tarsier  actaatgttgca
B D              Bushbaby  acgaatgccgca
B D  Malayan flying lemur  actgatgcttca
B D                   Pig  ------gtttcg
B D               Dolphin  acaaatgcttcg
B D                   Cow  acagatgcttcg
B D                 Sheep  acagatgcttcg
B D                 Horse  acagatgcttga
B D      Chinese pangolin  acagatgcttg-
B D                   Dog  aaagatgcttag
B D    Hawaiian monk seal  acagatgcttag
B D                 Shrew  aaggaggcttca
B D                Tenrec  ============
B D              Hedgehog  ============
B D             Zebrafish  ============
B D         X. tropicalis  ============
B D               Opossum  ============
B D               Chicken  ============
B D              Elephant  ============
B D                Rabbit  ============

Alignment block 3 of 340 in window, 56737610 - 56737610, 1 bps 
B D                 Mouse  a-
B D                   Rat  a-
            GCF_003668045  a-
                   Beaver  a-
B D            Guinea pig  g-
B D                Rabbit  a-
B D                  Pika  a-
B D                 Human  a-
B D                 Chimp  a-
B D                Bonobo  a-
B D               Gorilla  a-
B D                Rhesus  a-
B D              Marmoset  a-
B D               Tarsier  g-
B D              Bushbaby  t-
B D  Malayan flying lemur  ac
B D                   Pig  a-
B D               Dolphin  a-
B D                   Cow  a-
B D                 Sheep  a-
B D                 Horse  a-
B D      Chinese pangolin  a-
B D                   Dog  a-
B D    Hawaiian monk seal  a-
B D                 Shrew  a-
B D                Tenrec  ==
B D              Hedgehog  ==
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D               Opossum  ==
B D               Chicken  ==
B D              Elephant  ==
B D              Squirrel  --

Alignment block 4 of 340 in window, 56737611 - 56737649, 39 bps 
B D                 Mouse  ccctggcaaaagcgagg-tc-tcctctggacaat--tacaggg---
B D                   Rat  ccctggcaaaagccagg-tc-ccctctctactgt--tacaggg---
            GCF_003668045  ccgtgtc-acagcgagg-tc-cccttctgacagc--tacaggg---
                   Beaver  ccctggc-----------------------------tagaagg---
B D              Squirrel  -------aaaggcgaag-tc-ttctttcgctagc--taaaggc---
B D            Guinea pig  ccctggggag------------------------------------
B D                Rabbit  cccgggcgaggccaagt-cc-tccgcccgcggactggagaggg---
B D                  Pika  ctccggcggggccgagt-cc-tcctcgggcggcc--gcgaggg---
B D                 Human  ccctggcaagacgaaat-cc-ccctccctctggc--taga------
B D                 Chimp  ccctggcaagacgaaat-cc-ccctccctctggc--taga------
B D                Bonobo  ccctggcaagacgaaat-cc-ccctccctctggc--taga------
B D               Gorilla  ccctggcaaga-gaaat-cc-ccctccctctggc--taga------
B D                Rhesus  ccctggcaagacgaaat-cc-ccctccctctggc--taga------
B D              Marmoset  ccctggcaagacgaaat-cc-tcttccttctgac--tagaagg---
B D               Tarsier  cccgggcaagacgccgt-cc-tcctcccgctggc--tagaagg---
B D              Bushbaby  ctctggcaaagctaagc-gt-cccttcttctggc--tagaggg---
B D  Malayan flying lemur  ccctggcaagatgaagtccc-ccctccctctggc--tagacag---
B D                   Pig  accaagcaggtcgaagt-ccgccctcccttctga--tggaggc---
B D               Dolphin  actgggcaggtcgaagt-cccccctccctttggc--tggacgc---
B D                   Cow  accaggcaggtcgaag------cgtcccttgggc--aggacgc---
B D                 Sheep  accaggcaggtcgaag------cgtcccttgggc--aggacgc---
B D                 Horse  cccaggcagagcgaagt-cctccctcccgcgggc--ttgaggc---
B D      Chinese pangolin  cccag-------gaagt-cc-ccgtttctctggc--tagaaac---
B D                   Dog  cccagacagggcgaagt-gcctcctccctctgac--tggaggc---
B D    Hawaiian monk seal  cccaggcaaggcgaagt-gcctcctccctctgac--tggaggc---
B D                 Shrew  tgcaggcaggccgaaat-ac-tcctcctggtggc--aggaggc---
B D                Tenrec  cccaggc-----gaaag-cc-ccctccttctggc--gacggttggg
B D              Hedgehog  ==============================================
B D             Zebrafish  ==============================================
B D         X. tropicalis  ==============================================
B D               Opossum  ==============================================
B D               Chicken  ==============================================
B D              Elephant  ==============================================

Alignment block 5 of 340 in window, 56737650 - 56737778, 129 bps 
B D                 Mouse  tcaacggggccttcc----ccgacccccaa-actcc-------------------tcc--ta------gt
B D                   Rat  tcagcctggccttcc----ctcacccccaagactcc-------------------tcc--ca------gt
            GCF_003668045  tcagcctgccct------------ctgcac-actat-------------------tcc--ca--------
                   Beaver  ccagcctggccttcc---------ctcaga-atgcc-------------------tct--ct------gc
B D              Squirrel  tcagccaggcttccc---------ctcaga-acccc-------------------ttc--ct------gt
B D            Guinea pig  ------------------------ccgggg-tctcc-------------------tcc--c-------gt
B D                Rabbit  tcagcccggcctccc---------ctcggg-gcccc-------------------gcc--ctgtcgctgc
B D                  Pika  tcagcccggactccc---------ctcgag-gcccc-------------------tcc--c-------gc
B D                 Human  tcagcccagcctccc---------ctcagg-gaccttcctgcccctccctacccctcc--ct------ac
B D                 Chimp  tcagcccagtctccc---------ctcagg-gacct---------tccctgcccctcc--ct------ac
B D                Bonobo  tcagcccagtctccc---------ctcagg-gacct---------tccctgcccctcc--ct------ac
B D               Gorilla  tcagcccagcctccc---------ctcagg-gacct---------tccctgcccctcc--ct------ac
B D                Rhesus  tcagctcagcctccc---------ctcagg-gaccc-------------------tcc--ct------gc
B D              Marmoset  tcagcctagcctccc---------ctcagg-gaccc-------------------tcc--ct------gc
B D               Tarsier  tcggcccggcctccc---------cgcagg-gcccc-------------------tcc--ct------gc
B D              Bushbaby  tcagcccagcctccc---------cacagg-gaccc-------------------ctc--ct------gc
B D  Malayan flying lemur  tcaggctggccttcc---------ctcagg-gtccc-------------------tcc--ct------gt
B D                   Pig  tcagcccagcgtccc---------tgcagg-ggtcc-------------------tca--ct------gc
B D               Dolphin  tcagcctggcgtccc---------tgcagg-gctcc-------------------tcc--ct------gc
B D                   Cow  tcagcccggcgtctc---------tgctgg-actcc-------------------gcc--ct------gc
B D                 Sheep  tcagcccggcgtctc---------tgctgg-actcc-------------------gcc--ct------gc
B D                 Horse  tcggcctggcctccc---------cgtagg-gatct-------------------tcc--cg------gc
B D      Chinese pangolin  tcagccgagccttct---------cgccgc-gatcc-------------------ttg--ct------gg
B D                   Dog  tcaggctggcctccc---------agaagg-gatct-------------------tcc--ct------gc
B D    Hawaiian monk seal  tcagcccggcctccc---------cgaagg-gatct-------------------tcc--ct------gc
B D                 Shrew  tcagccttgcctttg---------cgatag-gaccc-------------------tccctct------gc
B D              Elephant  tcaaagcgaaatccc-----ccttcttctg-gcccc-------------------tcc--ct------ac
B D                Tenrec  ----gccgacctcccggcagccgcc--ccg-gcccc-------------------tcc--c--------c
B D              Hedgehog  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  cgc---------------c-----------------ttctctca------gtagagacctgattcatgct
                      Rat  cgc---------------t-----------------atcccaca------gtagagacttgattcatgc-
            GCF_003668045  -------------------------------------tccctta------ggagagacctgattcatgat
                   Beaver  ctc---------------t----g------------tcccccca------gtcgggatctgatccttcct
                 Squirrel  ctc---------------t-----------------tatcccca------gtcgggatgtgatccttgct
               Guinea pig  ttc---------------t-----------------gtcccaca------gccagaatctgattcttgc-
                   Rabbit  ccc---------------t----c-------ccccctccccccagcccttggcggtatccgatcctcgca
                     Pika  ccc---------------t----g-------gctcctgcccccgcccgttggcagg---cgagcctggcg
                    Human  ccc---------------t----aggccgctccccccttcctct------gttgggatccgatccttgtt
                    Chimp  ccc---------------t----aggccgctccccccttcctct------gttgggatccgatccttgtt
                   Bonobo  ccc---------------t----aggccgctccccccttcctct------gttgggatccgatccttgtt
                  Gorilla  ccc---------------t----aggccgctccccgcttcctct------gttgggatccgatccttgtt
                   Rhesus  ccc---------------t----aggccgctccccccttcctct------gttgggatccgatccttgtt
                 Marmoset  ccc---------------t----gggccgctggccccttcctct------tttg------gatccttgtt
                  Tarsier  ctt---------------t----a------cccccggtgtccca------gttgggatccga-cctggcg
                 Bushbaby  c--------------------------------------cacca------gttgg-----catctttgct
     Malayan flying lemur  ccc---------------t----g-------------cccccca------atcgggatccgatcctggct
                      Pig  ccc-atcctccctgccc-c------------------ggcccca------gcaggatt--gatccttgat
                  Dolphin  ccgggtcctccctgcccct------------------gccccca------gccgggatccgatccttgat
                      Cow  tct---------------t------------------gccccta------gccgggatccgatccttgat
                    Sheep  tcg---------------t------------------gccccta------gcggggatccgatccttgat
                    Horse  ccc---------------t------------------gccccca------gcctggatccgaccctcgat
         Chinese pangolin  ccc---------------t------------------accccga------gccgagatccagtctttaat
                      Dog  ccc---------------tgccccggccccggccccggccccca------accgggatcc-atccttgat
       Hawaiian monk seal  ccc---------------t------------------gccccca------accgggaccc-gtccttgat
                    Shrew  ccc---------------t------------------gccccca------gctggcattcgaccctctat
                 Elephant  ccc---------------t------------------gctccca------gccgggatccgatccttgct
                   Tenrec  tcc---------------g------------------cccctct------gccgggatccgatcctcgct
                 Hedgehog  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  cgcaat-----------tgctgt---ccc-tcagccag------gagtattg--ct-ccttgaac-aaaa
                      Rat  ---att-----------tgctgt---cccctcagccac------gggt-tta--ct-ccttgaac-taaa
            GCF_003668045  tgcact-----------tgatgt---cac-tcagccac------gagttttg--at-ccttgaat-aaaa
                   Beaver  cgcact-----------tgctgt---tcc-gcagtcac------gagttttg--cc-ccttgcacaaaaa
                 Squirrel  ctcaca-----------tgccat---ctt-gcaagca--------agttttg--cc-ccttgcac-aaaa
               Guinea pig  ---act-----------tatcgt---ttc-gaaggcac------gagttttg--cc-cctcgcac-aaaa
                   Rabbit  cgcgct-----------tggact---cccggcagccgc------ggactgtg--cc-cctcgcgc-agta
                     Pika  cgcact-----------t---------------gccgt------ccagcgag--ct-cc-----c-agaa
                    Human  cgctct-----------tgcaat---ccc-gcagcccg------gagttttg--cc-ccgtgcat-taaa
                    Chimp  cgctct-----------tgcaat---ccc-gcagcccg------gagttttg--cc-ccgtgcat-taaa
                   Bonobo  cgctct-----------tgcaat---ccc-gcagcccg------gagttttg--cc-ccgtgcat-taaa
                  Gorilla  cgctct-----------tgcaat---ccc-gcagcccg------gagttttg--cc-ccgtgcat-taaa
                   Rhesus  cgctct-----------tgcaat---ccc-gcagccca------gagttttg--cc-ccctgcat-aaaa
                 Marmoset  tgctgt-----------tgcaat---ccc-gcagccca------gagttttg--cc-ccctccat-aaaa
                  Tarsier  tgcttt-----------tgccgccgaccc-gcagccac------gagttgtg--cc-cctcgcgc-aaaa
                 Bushbaby  tactct-----------ggccgt---gct-gctccttgccccacgactttcc--cc-ccttgcac-aaaa
     Malayan flying lemur  cacatt-----------tgccat---ccc-gcagccgt------gagtttt---cc-ccttgcac-aaaa
                      Pig  tccact-----------tg---t---tct-gaagccaa------gacttttg--cc-ccttgccctaaaa
                  Dolphin  cgcact-----------tgccgt---tct-gcagccta------gagttttg--cc-ccttgcccccaaa
                      Cow  cgcact-----------tgccac---tat-gcagccaa------gagttttg--cc-ccttgccccccaa
                    Sheep  cgcact-----------tgccac---tat-gcagccaa------gagttttg--cc-ccttgccccccaa
                    Horse  tgcact-----------tgccat---ccc-taagccac------gagtt----------ttgcac-agaa
         Chinese pangolin  catact-----------tgtcgc---acc-acagccat------aagttttt--cc-ccttgcaa-aaaa
                      Dog  cgcact-----------tgccgg---acc-gcagccac------aggttttg--cc-ctttgcat-aaaa
       Hawaiian monk seal  tgcact-----------tgccgg---gcg-gcagccac------aagttttg--ac-ccttgcacaaaaa
                    Shrew  cgtatt-----------tgctgt---ccc-gctgccta------gggtttttgccc-cctcgcac-aaaa
                 Elephant  ctcactctct-------agcagc---cag-gcagctag------gagctttg--cctccttgcac-aaaa
                   Tenrec  cgcgctagctcacagtcggccgc---ccg-ccagctag------gagctttg--ccccctcccgc-aaaa
                 Hedgehog  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  atacattctcattc
                      Rat  at------------
            GCF_003668045  atgcgttc------
                   Beaver  atatgttc------
                 Squirrel  atatgttctctttc
               Guinea pig  gtatgttttctttc
                   Rabbit  ccgcgttcgctttc
                     Pika  acgagttcacttcc
                    Human  acatgttctctttc
                    Chimp  acatgttctctttc
                   Bonobo  acatgttctctttc
                  Gorilla  acatgttctctttc
                   Rhesus  atatgttctctttc
                 Marmoset  atgtgttctctttc
                  Tarsier  atgtgttctctttc
                 Bushbaby  acgagttctctttc
     Malayan flying lemur  atgtgttctttttc
                      Pig  atatattctctttc
                  Dolphin  atgtggtcgctttc
                      Cow  atgtgttatctttc
                    Sheep  atgtgttctctttc
                    Horse  atgtgttctctttc
         Chinese pangolin  atgtgttctctttc
                      Dog  atgtgttctctttc
       Hawaiian monk seal  atgtgttctctttc
                    Shrew  atgtgttctctttc
                 Elephant  atgtgttctctttc
                   Tenrec  atgtgctctctttc
                 Hedgehog  ==============
                Zebrafish  ==============
            X. tropicalis  ==============
                  Opossum  ==============
                  Chicken  ==============

Inserts between block 5 and 6 in window
B D             Squirrel 17bp
B D                 Pika 13bp
B D             Bushbaby 12bp
B D Malayan flying lemur 12bp
B D     Chinese pangolin 12bp
B D                  Dog 12bp

Alignment block 6 of 340 in window, 56737779 - 56737839, 61 bps 
B D                 Mouse  tctctctatctctgtctctctctctgtctgtctctgtctctgtctctgtctctgtctgtct----
B D                   Rat  ----------------------------------------------------------tct----
            GCF_003668045  ----------------------------------------------------------cct----
                   Beaver  ----------------------------------------------------------cct----
B D                   Pig  ---------------------------------------------------------attt----
B D               Dolphin  ---------------------------------------------------------attt----
B D                   Cow  ---------------------------------------------------------attt----
B D                 Sheep  ---------------------------------------------------------attt----
B D                 Horse  ---------------------------------------------------------attt----
B D    Hawaiian monk seal  ---------------------------------------------------------attt----
B D                 Shrew  ---------------------------------------------------------attt----
B D              Elephant  ---------------------------------------------------------atttgcag
B D                Tenrec  ---------------------------------------------------------atttgcgg
B D            Guinea pig  -----------------------------------------------------------------
B D                Rhesus  -----------------------------------------------------------------
B D                   Dog  =================================================================
B D              Marmoset  -----------------------------------------------------------------
B D               Gorilla  -----------------------------------------------------------------
B D                Bonobo  -----------------------------------------------------------------
B D                 Chimp  -----------------------------------------------------------------
B D                 Human  -----------------------------------------------------------------
B D               Tarsier  -----------------------------------------------------------------
B D              Hedgehog  =================================================================
B D                  Pika  =================================================================
B D             Zebrafish  =================================================================
B D         X. tropicalis  =================================================================
B D               Opossum  =================================================================
B D               Chicken  =================================================================
B D              Squirrel  =================================================================
B D                Rabbit  -----------------------------------------------------------------
B D      Chinese pangolin  =================================================================
B D              Bushbaby  =================================================================
B D  Malayan flying lemur  =================================================================

Inserts between block 6 and 7 in window
B D                  Pig 10bp
B D              Dolphin 8bp
B D                  Cow 8bp
B D                Sheep 8bp
B D                Horse 8bp
B D   Hawaiian monk seal 8bp
B D                Shrew 4bp

Alignment block 7 of 340 in window, 56737840 - 56737849, 10 bps 
B D                 Mouse  ctctct------ctct
B D                   Rat  ttcttttga-ggctct
            GCF_003668045  ttcgtttga-ggcttt
                   Beaver  ttcatttgc-ggattt
B D            Guinea pig  ---atctgc-gcattt
B D                Rabbit  ---attcgcagggttt
B D                 Human  ---atttgc-agattt
B D                 Chimp  ---atttgc-agattt
B D                Bonobo  ---atttgc-agattt
B D               Gorilla  ---atttgc-agattt
B D                Rhesus  ---atttgc-ggattt
B D              Marmoset  ---atttgt-ggattt
B D               Tarsier  ---atttgc-ggattt
B D              Hedgehog  ttcatttgc-ggactt
B D                 Shrew  ------------attt
B D              Elephant  ------------attt
B D                Tenrec  ------------attt
B D                 Sheep  ================
B D    Hawaiian monk seal  ================
B D                   Dog  ================
B D                 Horse  ================
B D                  Pika  ================
B D             Zebrafish  ================
B D         X. tropicalis  ================
B D                   Cow  ================
B D               Opossum  ================
B D               Chicken  ================
B D              Squirrel  ================
B D                   Pig  ================
B D      Chinese pangolin  ================
B D               Dolphin  ================
B D              Bushbaby  ================
B D  Malayan flying lemur  ================

Alignment block 8 of 340 in window, 56737850 - 56737850, 1 bps 
B D                 Mouse  a
B D                   Rat  a
            GCF_003668045  a
                   Beaver  a
B D            Guinea pig  a
B D                Rabbit  a
B D                 Human  a
B D                 Chimp  a
B D                Bonobo  a
B D               Gorilla  a
B D                Rhesus  a
B D              Marmoset  a
B D               Tarsier  a
B D              Bushbaby  a
B D  Malayan flying lemur  a
B D                   Pig  a
B D               Dolphin  a
B D                   Cow  a
B D                 Sheep  a
B D                 Horse  a
B D      Chinese pangolin  a
B D                   Dog  a
B D    Hawaiian monk seal  a
B D              Hedgehog  a
B D                 Shrew  a
B D              Elephant  a
B D                Tenrec  c
B D                  Pika  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D               Opossum  =
B D               Chicken  =
B D              Squirrel  =

Alignment block 9 of 340 in window, 56737851 - 56737852, 2 bps 
B D                 Mouse  at
B D                   Rat  at
            GCF_003668045  at
                   Beaver  at
B D            Guinea pig  at
B D                Rabbit  at
B D                  Pika  at
B D                 Human  at
B D                 Chimp  at
B D                Bonobo  at
B D               Gorilla  at
B D                Rhesus  at
B D              Marmoset  at
B D               Tarsier  at
B D              Bushbaby  at
B D  Malayan flying lemur  at
B D                   Pig  at
B D               Dolphin  at
B D                   Cow  at
B D                 Sheep  at
B D                 Horse  at
B D      Chinese pangolin  at
B D                   Dog  at
B D    Hawaiian monk seal  at
B D              Hedgehog  gt
B D                 Shrew  at
B D              Elephant  at
B D                Tenrec  at
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D               Opossum  ==
B D               Chicken  ==
B D              Squirrel  ==

Alignment block 10 of 340 in window, 56737853 - 56737913, 61 bps 
B D                 Mouse  aaacaaacgcaatcataccata-g-gaggctcaaagccatccttctaaaagcaattccactgt
B D                   Rat  aaacaaacgcaatcgtaccaca-g-gaggctaaaagccgttcttctgaaagcgattccactgt
            GCF_003668045  aaacaaacgcaatcgtaccgca-g-gaggctcagaggcatctttctgaaagcaactccactgc
                   Beaver  aaacaaacgtaaccgtatcaca-t-gaagctcagcga-gtccttctgaaagcaattccgctgt
B D              Squirrel  aaaaaaatgtaacaatatcgca-c-gggtttcggagtcgtc---ctgaaatccatcccactgt
B D            Guinea pig  aaacaaacttagccgtatcaca-t-gaggctctgcgccgttctttctaaagcagttccactgt
B D                Rabbit  aaacaaacgtaaccgtatcaca-t-ggggctcctcgcggtccttctgaaagcgattccactgt
B D                  Pika  aaacaaacggaaccgtatcaca-t-ggggctgtgcgccgtcattctaaaagcaattccgctgt
B D                 Human  aaacaaacgtaaccatatcaca-t-ggagctccacactgtccttctgaaagcaattccgctgt
B D                 Chimp  aaacaaacgtaaccatatcaca-t-ggagctccacactgtccttctgaaagcaattccgctgt
B D                Bonobo  aaacaaacgtaaccatatcaca-t-ggagctccacactgtccttctgaaagcaattccgctgt
B D               Gorilla  aaacaaacataaccatatcaca-t-ggagctccacactgtccttctgaaagcaattccgctgt
B D                Rhesus  aaacaaacgtaatcatatcaca-t-ggagctccacactgtccttctgaaagcaattccactgt
B D              Marmoset  aaacaaaagtaagcgtatcaca-c-ggagctccacaccatccttctgaaagcaattcagc-gt
B D               Tarsier  aaacaaacgtaaccatatcaca-tgggggctccacgcaatccttctgaaagcaattccgctgt
B D              Bushbaby  aaacaaacataagcccatcaca---ggggctgtgcatcgtctttctgaaagcaattccgctgt
B D  Malayan flying lemur  aaacaaacgtaaccatatcaca-t-ggggctccgcgccgtccttctgaaagcaattccgccgt
B D                   Pig  aaacaaatataatcatatcaca-t-ggggttccgcgccgacctcctgaaagcaattccgctgt
B D               Dolphin  aaacaaatataaccatatcaca-t-ggggcaccacgccgtccttctgaaagcaattccgctgt
B D                   Cow  aaacaaatataaccatatcaca-tgggggcaacgcgccgtccttctgaaaacaattccgctgt
B D                 Sheep  aaacaaatataaccatatcaca-tgggggcaacgcgccgtccttctgaaaacaattccgctgt
B D                 Horse  aaacaaatgtaaccatatcaca-t-ggggctccgcgccgtccttctgaaagcaattccgctgt
B D      Chinese pangolin  taacaaatgtaatcatatcaca-t-ggggttccgcgccttccttctgaaagcaattccgttgt
B D                   Dog  aaacaaatgtaactatatcaca-t-ggggctctgcgccgtccttctgaaagcaattccgctgt
B D    Hawaiian monk seal  aaacaaatgtaaccatatcaca-t-ggggctccgcgccgtccttctgaaagcaattccgctgt
B D              Hedgehog  aaacaaacgtaaccatatcacagggggggctctgcgcagtccttctgaaagcaattccactgt
B D                 Shrew  aaacaaacgtaaccatatcaca-ggggggctccgcgcagtccttctgaaagcaattccgctgt
B D              Elephant  aaacaaacttaaccatatcaca-c-gaggctccgcgccgtccttctgaaagcaattccgctgt
B D                Tenrec  aaacaaacgtaaccatatcaca-c-ggggctcctcgccgtccttctgaaagcaattccgctgt
B D             Zebrafish  ===============================================================
B D         X. tropicalis  ===============================================================
B D               Opossum  ===============================================================
B D               Chicken  ===============================================================

Alignment block 11 of 340 in window, 56737914 - 56737976, 63 bps 
B D                 Mouse  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-ttagggtcacggcaatttcc
B D                   Rat  tgaaaactgaaaaacgggtgtaatctgcgttcagaaagtgatg-ttagggtcacagcaatttcc
            GCF_003668045  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-ttagggtcacagcaatttcc
                   Beaver  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-ctagggtcacagcaatttcc
B D              Squirrel  tgaaaactgaaaaatgggtgtaatttgcgctcggaaagtgatg-ttagggtcacggcaatttcc
B D            Guinea pig  tcaaaactgaaaaatgggtgtaattcgctttcagaaagtgacg-ttagggtcacggcaatttc-
B D                Rabbit  tgaaaactgaaaaatgggtgtaatttgcgatcagaaagtgatg-ttagggtcatggcaatttcc
B D                  Pika  tgaaaactgaaaaatgggtgtaatttgcgatccgaaagtgatg-ttagggtcatggcaacttcc
B D                 Human  tgaaaactgaaaaatgggtgtaatttgctttcagaaagtaatg-ttagggtcacggcaatttct
B D                 Chimp  tgaaaactgaaaaatgggtgtaatttgctttcagaaagtaatg-ttagggtcacggcaatttcc
B D                Bonobo  tgaaaactgaaaaatgggtgtaatttgctttcagaaagtaatg-ttagggtcacggcaatttcc
B D               Gorilla  tgaaaactgaaaaatgggtgtaatttgctttcagaaagtaatg-ttagggtcacggcaatttcc
B D                Rhesus  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtaatg-ttagggtcacggcaatttcc
B D              Marmoset  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtaatg-gtagggtcacagcaatttcc
B D               Tarsier  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-ctagggtcacggcaatttcc
B D              Bushbaby  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-ttagggtcacggcaatttcc
B D  Malayan flying lemur  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgacg-ttagggtcacggcaatttcc
B D                   Pig  tgaaaactgaaaaatgagtgtaatttgcattcagaaagtgacg-ttagggtcacagcaatttcc
B D               Dolphin  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-ttagggtcacagcaatttcc
B D                   Cow  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-ttggggtcacagcaatttcc
B D                 Sheep  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-ttggggtcacagcaatttcc
B D                 Horse  tgaaaactgaaaaatgggtgtaatttgctttcagaaagtgatg-ttagggtcacggcaatttcc
B D      Chinese pangolin  tgaaaactgaaaaatgggtgtaatttgcattcagaaagtgatg-ttagggtcatggcaatttcc
B D                   Dog  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-ttagggtcatggcaatttcc
B D    Hawaiian monk seal  tgaaaactgaaaaatgggtgtaatttgtgttcagaaagtgatg-ttagggtcatggcaatttcc
B D              Hedgehog  tgaaagctgaaaaatgggtgtaatttgccttcagaaagtgatg-ttagggtcatggcaatttcc
B D                 Shrew  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-tgagggtcatggcaatttcc
B D              Elephant  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-ttatggtcaccgcaatttcc
B D                Tenrec  tgaaaactgaaaaatgggtgtaatttgcgttcagaaagtgatg-tcagggtcaccgcaatttcc
B D               Opossum  tgaaaattgaactagggatgatctttagattcagaaagagatgtttaatgtaatggcattctcc
B D             Zebrafish  ================================================================
B D         X. tropicalis  ================================================================
B D               Chicken  ================================================================

Inserts between block 11 and 12 in window
B D              Opossum 37bp

Alignment block 12 of 340 in window, 56737977 - 56738006, 30 bps 
B D                 Mouse  cggg-ccgttatttatttttactttaaagtc
B D                   Rat  aggg-ccgttatttatttttattttaaagtc
            GCF_003668045  cggg-ccgttatttatttttactttaaagtc
                   Beaver  cggg-ctgttatttatttttactttaaagtc
B D              Squirrel  cggg-ccgttatttatttttactttaaagtc
B D            Guinea pig  -agg-ccattatttattttttctttaacgtc
B D                Rabbit  cggg-ccgttatttatttttactttaaagtc
B D                  Pika  cggg-ccgttatttatttttactttaaagtc
B D                 Human  cggg-ccgttatttatttttactttaaagtc
B D                 Chimp  cggg-ccgttatttatttttactttaaagtc
B D                Bonobo  cggg-ccgttatttatttttactttaaagtc
B D               Gorilla  cggg-ccgttatttatttttactttaaagtc
B D                Rhesus  cggg-ccgttatttatttttactttaaagtc
B D              Marmoset  cgggcccgttatttattttcactttaaagtc
B D               Tarsier  cggg-ccgttatttatttttactttaaagtc
B D              Bushbaby  cgag-ccgttatttatttttactttaaagtc
B D  Malayan flying lemur  cggg-ccgttatttatttttactttaaagtc
B D                   Pig  cggg-ccgttatttgtttttactttaaagtc
B D               Dolphin  cggg-ccgttatttatttttactttaaagtc
B D                   Cow  cggg-ccgttatttatttttactttaaagtc
B D                 Sheep  cggg-ccgttatttatttttactttaaagtc
B D                 Horse  cggg-ccgttatttatttttactttaaactc
B D      Chinese pangolin  cggg-ccgttatttatttttactttaaagtc
B D                   Dog  cggg-ccattatttatttttactttaaagtc
B D    Hawaiian monk seal  cggg-ccgttatttatttttactttaaagtc
B D              Hedgehog  cggg-ccattatttattttcactttaaagtc
B D                 Shrew  cggg-ccattatttatttttactttaaagtc
B D              Elephant  cggg-ccgttatttatttttactttaaagtc
B D                Tenrec  cggg-ccgttatttatttttactttaaagtc
B D             Zebrafish  ===============================
B D         X. tropicalis  ===============================
B D               Opossum  ===============================
B D               Chicken  ===============================

Alignment block 13 of 340 in window, 56738007 - 56738181, 175 bps 
B D                 Mouse  ttt-agggaagatttgcttatagactc-gga-----tac-agtatgagaaccccggcaaccccgctcgcc
B D                   Rat  ttt-agggaagatttgcttgtagactc-ggaaaccttcc-agtatgagaacactagaaacctcgctcgcc
            GCF_003668045  ttc-agggaagatttgcttatatactc-ggaaaccttcc-agtacgagaaccccagcaatctcgctcgcc
                   Beaver  ttt-agggaagatttgcttatatactc-ggaaaccttcc-agggagagaatatcagcaatcccgctcgcc
B D              Squirrel  ttt-agggaagatttgcttatgtactc-ggaaaccttcc-aatgcgaaaataccagcaatcccgctcgcc
B D            Guinea pig  ttt-aaggaagatttgcttatatactcgggaaaccttcc-aatgcgagaataccagcaatcccgctcgcc
B D                Rabbit  ttt-aggggagatttgcttatacgctc-ggaaaccttcc-agcgctccagctccggcaaccccgctcgcc
B D                  Pika  ttt-agggaagatttgcttatagactc-ggaaaccttcc-cattcgccaacaccggtcatcccgctggcc
B D                 Human  ttt-aggaaagatttgcttatatgctc-ggaaaacttccaaatgcgcgaataccagcaatcccgctcgcc
B D                 Chimp  ttt-aggaaagatttgcttatatgctc-ggaaaacttccaaatgcgcgaataccagcaatcccgctcgcc
B D                Bonobo  ttt-aggaaagatttgcttatatgctc-ggaaaacttccaaatgcgcgaataccagcaatcccgctcgcc
B D               Gorilla  ttt-aggaaagatttgcttatatgctc-ggaaaacttccaaatgcgcgaataccagcaatcccgctcgcc
B D                Rhesus  ttt-aggaaagatttgcttatatgctc-ggaaaacttccaaatgcgagaataccagcaatcccgctcgcc
B D              Marmoset  ttt-aggaaagatttgcttatatgctc-ggaaaacttccaaattctagaataccagcaatcccgctcgcc
B D               Tarsier  ttt-aggaaagatttgcttatgtactc-ggaaaccttcc-aatgcgagaataccagcaatcccgctcgcc
B D              Bushbaby  ttt-aggaaagatttgcttatatactc-ggaaaccttcc-aatgcgaggataccagccatcccgatcgcc
B D  Malayan flying lemur  tta-agggcagatttgcttatatactc-ggaaaccttcc-aatgcgagaataccagcaatcccgctcgcc
B D                   Pig  ttt-agggaagatttgcttatatactc-gggaaccttcc-aatgcgagggtaccagcaatcctgctcgcc
B D               Dolphin  ttt-agggaagatttgcttatatactc-gggaaccttcc-actgcgagggtaccaataatcccgcttgcc
B D                   Cow  ttt-agggaaggtttgcttatatactc-gggaactttcc-aatgcgagggcaccagcaatcccgcttgcc
B D                 Sheep  ttt-agggaaggtttgcttatatactc-aggaaccttcc-aatgcgagggcaccagcaatcccgcttgcc
B D                 Horse  ttt-agggaagatttgcttatgtactc-ggaaaccttcc-aatgcgagggtaccagcaatcccgctcgcc
B D      Chinese pangolin  ttt-agggaagatttgcttatatactc-ggaagacttcc-aacgccagggtaccagcaatcccgttctct
B D                   Dog  ttt-agggaagatttgcttatatactc-ggaaaccttcc-aatgcgagggtaccaggaatccagttcgcc
B D    Hawaiian monk seal  ttt-agggaagatttgcttatatactc-ggaaaccttcc-aatgcgagggtaccagcaatccagttcgcc
B D              Hedgehog  ttt-agggaagatttgcttatatactc-ggaaaccttcc-aacgcgagggtactaggaattctcttcgcc
B D                 Shrew  ttt-aggaaagctttgctgatggactc-ggaaactttcc-aaggcgagggtaccagcaatcccgcttgcc
B D              Elephant  ttt-agggaagatttgcttatgtactc-ggaaaccttcc-aatgcgagggtaccagcaatcccgctcgcc
B D                Tenrec  tttaaggggaaatttgcttatgtactc-ggaaggcttcc-aacgcgaggggaccggcaaccccgctcgcc
B D               Opossum  tgc-agggaaggcttccttagatatta-gcagatatt---agcatga-------agtgaacccgttcgcc
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  ttcaa--------------------agc--------gg-gag------------------------ggg-
                      Rat  ttcaa--------------------cgc--------gg-gag------------------------ggg-
            GCF_003668045  ttcta--------------------ctc--------gg-gag------------------------ggg-
                   Beaver  ttcaa--------------------cgc--------gg-gag------------------------ggg-
                 Squirrel  ttcaa--------------------cgc--------gg-gag------------------------ggg-
               Guinea pig  ttcag--------------------ctc--------gg-gag------------------------gggg
                   Rabbit  ctggt--------------------cgc--------tg-ggg------------------------gag-
                     Pika  ccggt--------------------cgc--------ggcggg------------------------gag-
                    Human  ttcaa--------------------cgc--------gt-gggg------------taa-------gggg-
                    Chimp  ttcaa--------------------cgc--------gt-gggg------------taa-----gggggg-
                   Bonobo  ttcaa--------------------cgc--------gt-gggg------------taa-----gggggg-
                  Gorilla  ttcaa--------------------cgc--------gt-gggg------------taa-------gggg-
                   Rhesus  ttcaa--------------------cgc--------gt-gggg------------taa--------ggg-
                 Marmoset  ttcaa--------------------cgc--------gg-gggt------------taa--------ggg-
                  Tarsier  atcaa--------------------cgc--------gg-ggg------------------------gag-
                 Bushbaby  ttccc--------------------cgc--------ga-aggg----------------------gtgg-
     Malayan flying lemur  ttcaa--------------------cgc--------gg-gggg-----------------------ggg-
                      Pig  ttcaa--------------------agc--------gg-ggg------------------------gga-
                  Dolphin  ttcaa--------------------agc--------gg-ggg------------------------ggg-
                      Cow  ttcaa--------------------agc--------tg-ggg------------------------gaa-
                    Sheep  ttcaa--------------------agc--------gg-ggg------------------------gaa-
                    Horse  ttcat--------------------cgc--------gg-ggg------------------------gga-
         Chinese pangolin  ttcaa--------------------cgc--------tg-ggg------------------------gga-
                      Dog  ttcaa--------------------cgc--------ga-ggg------------------------gga-
       Hawaiian monk seal  ttcaa--------------------cgc--------gg-ggg------------------------gtg-
                 Hedgehog  cccaatgctgggtgggggaggtgggggt--------gt-ggg------------------------gag-
                    Shrew  ttcaa--------------------ggc--------gg-agg------------------------gag-
                 Elephant  ttcaa--------------------cgc--------gg-gggg-----------------------gac-
                   Tenrec  ttcga--------------------cacgggcagaggg-ggga-----------------------ggc-
                  Opossum  tttcg--------------------cct--------ag-gaatgctgttcttttctgaaacacaaagag-
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -gcctg-----------aa---------------ggtggagaacaattactgagtgacgctaatatgggg
                      Rat  -ggctg-----------aa---------------ggtggagaacaattactgagtgacgctaatatgggg
            GCF_003668045  -gactg-----------ga---------------ggtggagaacaattactgaatgacgctaatatgggg
                   Beaver  -gga-g-----------ga---------------ggtggagaacaattaccgagtgacgctaatatgggg
                 Squirrel  -ggaag-----------ga---------------ggtggagaacaattactgagtgacgctaatatgggg
               Guinea pig  aggagg-----------ga---------------ggtggagaacaattactgagtgacgctaatatgggg
                   Rabbit  -g--------------------------------ggtagagaacaattactgagtgacgcttctacaggg
                     Pika  -g--------------------------------ggtggagaacaattactgagtgacgctcctacgggg
                    Human  -g--------------------------------ggtggggaacaattactgagtgacgctaatatgggg
                    Chimp  -g--------------------------------ggtggggaacaattactgagtgacgctaatatgggg
                   Bonobo  -g--------------------------------ggtggggaacaattactgagtgacgctaatatgggg
                  Gorilla  -g--------------------------------ggtggggaacaattactgagtgacgctaatatgggg
                   Rhesus  -g--------------------------------ggtggggaacaattactgagtgacgctaatatgggg
                 Marmoset  -g--------------------------------ggtggggaacaattactgagtgacgctaatataggg
                  Tarsier  -a--------------------------------gggggagaacaattactgagtgacgctaatacgggg
                 Bushbaby  -g--------------------------------ggtggagaacaattactgagtgacgctaatatgggg
     Malayan flying lemur  -g--------------------------------ggtggaggacaattactgagtgacgctaatacgggg
                      Pig  -g---------------gg---------------ggtggagaacaattactgagtgacgctaatatgggg
                  Dolphin  -gggggggggagggggagg---------------ggtggagaacaattactgagtgacgctaatatgggg
                      Cow  -gg--------------gg---------------ggtggagaacaattactgagtgacgctaatgtgggg
                    Sheep  -ga--------------gg---------------ggtggagaacaattactgagtgacgctaatgtgggg
                    Horse  -g---------------gg---------------gctggagaacaattactgagtgacgctaatacgggg
         Chinese pangolin  -g---------------cg---------------ggtggagaacaattaccgaatgacgctaatatgggg
                      Dog  -g---------------gg---------------ggtggagaacaattactgagtgacgctaatatgggg
       Hawaiian monk seal  -g---------------ggggtgggggtggtggtggtggagaacaattactgagtgacgctaatatgggg
                 Hedgehog  -gggagcga--------gg---------------ggtggagaacaatcactgagtgacgctaatatgggg
                    Shrew  -ggaag-----------gg---------------ggtggagaacaattactgagtgacgctaatacgggg
                 Elephant  -g---------------gg---------------ggtggagaacaattactgagtgacgctaatacgggg
                   Tenrec  -g---------------gg---------------ggtggagaacaattacggagtgacgctaatatgggg
                  Opossum  -ggtag-----------gc---------------aggggagagaaatcgc-aactgaagtagatgctggg
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================

                    Mouse  aaact-g-aaaagaaatgtcgattgtttttattgtaacagaaggag---------tgagcaaaca
                      Rat  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
            GCF_003668045  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                   Beaver  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                 Squirrel  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
               Guinea pig  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                   Rabbit  aaccg-g-cagagaaaagtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                     Pika  aaacg-g-cagagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                    Human  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                    Chimp  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                   Bonobo  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                  Gorilla  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                   Rhesus  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                 Marmoset  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                  Tarsier  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                 Bushbaby  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaata
     Malayan flying lemur  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgcgcaaaca
                      Pig  aaact-g-aaaagaaatgtcgattgtttttattgtaacagaaggag---------tgtgcaaaca
                  Dolphin  aaact-g-aaaagaaatgtggat--gttttattgtaacagaaggag---------tgtgcaaaca
                      Cow  aaact-g-aaaagaaatgtcgattgtttttattgtaacagaaggag---------tgtgcaaaca
                    Sheep  aaact-g-aaaagaaatgtcgattgtttttattgtaacagaaggag---------tgtgcaaaca
                    Horse  aaact-g-aaaagaaatgtcgattgtttttattgtaacagaaggag---------tgagcaaaca
         Chinese pangolin  aaact-g-gaaagaaatgtcgattgtttttattgtaacagaaggag---------tgagcaaaca
                      Dog  aaact-g-aaaagaaatgtcgattgtttttattgtaacagaaggag---------tgaacaaaca
       Hawaiian monk seal  aaact-g-aaaagaaatgtcgattgtttttattgtaacagaaggag---------tgaacaaaca
                 Hedgehog  aaact-gaaaaagaaatgccgattgtttttattgtaacagaaggag---------tgagcaaaca
                    Shrew  aaact-g-aaaagaaatgtcgattgtttttattgtaatagaaggag---------tgagcaaaca
                 Elephant  aaact-g-aaaagaaatgtctattgtttttattgtaacagaaggag---------tgagcaaaca
                   Tenrec  aaactgg-aaaagaaatgtctattgtttttattgtaacagaaggag---------tgagcaaaca
                  Opossum  aaacc-g-aaaagaaatgtctattgttttta----aaccggggggggggggggtctgagcaaaaa
                Zebrafish  =================================================================
            X. tropicalis  =================================================================
                  Chicken  =================================================================

Inserts between block 13 and 14 in window
B D              Opossum 62bp

Alignment block 14 of 340 in window, 56738182 - 56738209, 28 bps 
B D                 Mouse  gaaaaaccaaccccggctgatcggaaac
B D                   Rat  gaaaaaccaaccggggctgatcggaaac
            GCF_003668045  gaaaaaccaaccccggctgatcggaaac
                   Beaver  gaaaaaccaaccccgggtgatcggaaac
B D              Squirrel  gaaaaaccaaccccgggtgatcggaaac
B D            Guinea pig  gaaaaaccaacccggggtgatcggaaac
B D                Rabbit  gaaaaaccagccccgggtgatcggaaac
B D                  Pika  gaaaaaccaacctcgggtgatcggaaac
B D                 Human  gaaaaaccaaccccgggtgatcggaaac
B D                 Chimp  gaaaaaccaaccccgggtgatcggaaac
B D                Bonobo  gaaaaaccaaccccgggtgatcggaaac
B D               Gorilla  gaaaaaccaaccccggctgatcggaaac
B D                Rhesus  gaaaaaccaaccccgggtgatcggaaac
B D              Marmoset  gaaaaaccaaccccgggtgatcggaaac
B D               Tarsier  gaaaaaccaagcccgggtgatcggaaac
B D              Bushbaby  gtaaaaccaaccccgggtgatcggaaac
B D  Malayan flying lemur  ttaaaaccaaccccgggtgatcgcaaac
B D                   Pig  gaaaaaccaaccccgggtgatcggaaac
B D               Dolphin  gaaaaaccaaccctgggtgatcggaaac
B D                   Cow  gaaaaaccaaccccgggtgatcggaaac
B D                 Sheep  gaaaaaccaaccccgggtgatcggaaac
B D                 Horse  gaaaaaccaaccccgggtgatcggaaac
B D      Chinese pangolin  gaaaaaccaaccccgggtgatcggtaac
B D                   Dog  gaaaaaccaaccctgggtgatcggaaac
B D    Hawaiian monk seal  gaaaaaccaaccccgggtgatcggaaac
B D              Hedgehog  gaaaaaccaacccgggatgatcggaaac
B D                 Shrew  gaaaaaccaaccccgggtgatcggaaac
B D              Elephant  gaaaaaccaacccggggtgatcggaaac
B D                Tenrec  ggaacgccaaccccgggtgatcggaaac
B D             Zebrafish  ============================
B D         X. tropicalis  ============================
B D               Opossum  ============================
B D               Chicken  ============================

Alignment block 15 of 340 in window, 56738210 - 56738220, 11 bps 
B D                 Mouse  aggcaggcgga
B D                   Rat  aggcaggcgga
            GCF_003668045  aggcaggcgga
                   Beaver  aggcaggcgga
B D              Squirrel  aggcagacgga
B D            Guinea pig  aggcaga-gga
B D                Rabbit  aggcaggcgga
B D                  Pika  aggcaggcgga
B D                 Human  aggcaggcgga
B D                 Chimp  aggcaggcgga
B D                Bonobo  aggcaggcgga
B D               Gorilla  aggcaggcgga
B D                Rhesus  aggcaggcgga
B D              Marmoset  aggcaggcgga
B D               Tarsier  aggcaggagga
B D              Bushbaby  aggcaggcgga
B D  Malayan flying lemur  aggcaggcaga
B D                   Pig  aggcaggcgga
B D               Dolphin  aggcaggcgga
B D                   Cow  aggcaggcgga
B D                 Sheep  aggcaggcggg
B D                 Horse  aggcaggcgga
B D      Chinese pangolin  aggcaggcgaa
B D                   Dog  aggcaggcggg
B D    Hawaiian monk seal  aggcaggcggg
B D              Hedgehog  aggcaggcgga
B D                 Shrew  aggcaggcgga
B D              Elephant  aggcaggcgga
B D                Tenrec  aggcaggcgga
B D               Opossum  aagcagtagaa
B D             Zebrafish  ===========
B D         X. tropicalis  ===========
B D               Chicken  ===========

Alignment block 16 of 340 in window, 56738221 - 56738275, 55 bps 
B D                 Mouse  gaatgaaaagtgggtttcaggccgcaacaggcccctccctcccctggcctgggaa---------
B D                   Rat  gaatgaaaagtgggtttcaggccgcaacaggcccctccctcccctggcctgggac---------
            GCF_003668045  gaatgaaaagtgggtttcaggccgcaacaggcccctccctcccctggcctgggaa---------
                   Beaver  gaattaaaagcgggtttcaggccgcaacaggc----ccctcccctgccctcggaa---------
B D              Squirrel  gaattaaaagcgggtttcaggccgcaacaggc----ccctcccctgccctcggaa---------
B D            Guinea pig  aaattaaaagcgggtttcaggccgcagcaggc----ccctcccctgccctgggca---------
B D                Rabbit  gaattaaaagcgggtttcgggcggcaacaggc----ccctcctctgccctccgaa---------
B D                  Pika  gaattaaaagcggctttcgggcggccacaggc----ccctcccctgccctcggag---------
B D                 Human  gaattaaaagcgggtttcagacagcaacaggc----ccctcccctgctctcgcaa---------
B D                 Chimp  gaattaaaagcgggtttcagacagcaacaggc----ccctcccctgctctcgcaa---------
B D                Bonobo  gaattaaaagcgggtttcagacagcaacaggc----ccctcccctgctctcgcaa---------
B D               Gorilla  gaattaaaagcgggtttcagacagcaacaggc----ccctcccctgctctcgcaa---------
B D                Rhesus  gaattaaaagcggatttcagacagcaacaggc----ccctcccctgccctcgcaa---------
B D              Marmoset  gaattaaaagcgggtttcaggcagcaacaggc----ccctcccctgccctcgcaa---------
B D               Tarsier  gaattaaaagcgggtttcaggaggcagcaggc----ccctcccctgccctcggaa---------
B D              Bushbaby  gaatt-aaagccggtttcaggcggcaataggc----ccctcccctgcccttggaa---------
B D  Malayan flying lemur  gaattaaaagcgggtttcaggcggcagcagac----acctcccctgccctccgga---------
B D                   Pig  gaattaaaagcgggtttcaggcagcaacaagc----ccctcccctgccctcggaa---------
B D               Dolphin  gaattaaaagcgggtttcaggcggcaacaagc----ccctcccctgccctcggaa---------
B D                   Cow  gaattaaaagcgggtttcaggcggcaacaagc----ccctcccctgccctcggaa---------
B D                 Sheep  agaaataaagcgggtttcaggcggcaacaagc----ccctcccctgccctcggaa---------
B D                 Horse  gaattgaaagcgggtttcgagcggcaacaggc----ccctcccctgccctcggaa---------
B D      Chinese pangolin  gaattaaaagcgggtttcaggagggaacaggc----ccct-ccctgccctcgctt---------
B D                   Dog  gaattaaaagcgggtttcaggctgcaacaggc----ccctcccctgcccttggaa---------
B D    Hawaiian monk seal  gaattaaaaacgggtttcgggcggcaacaggc----ccctcccctgcccttggaa---------
B D              Hedgehog  gaattaaaagcgggtttcggaaggtcgcaggc----ccctcccctgagcagcgat---------
B D                 Shrew  gaattaaaagcgggtttcgggcggcaacaggc----ccctcccctgctctcggaa---------
B D              Elephant  gaattaaaagcgggtttcaggcggcagcaggcc---ccctcccctgccctcggaa---------
B D               Opossum  gaattaaaagcgggtttctagt--tagttggc----ccctcctct--cattgaaagaaggggaa
B D             Zebrafish  ================================================================
B D         X. tropicalis  ================================================================
B D               Chicken  ================================================================

Inserts between block 16 and 17 in window
B D              Dolphin 532bp

Alignment block 17 of 340 in window, 56738276 - 56738285, 10 bps 
B D                 Mouse  ggagcgagcc----
B D                   Rat  ggagagagcc----
            GCF_003668045  ggagagagcc----
                   Beaver  ggaga-agcc----
B D              Squirrel  gaagaacgcg----
B D            Guinea pig  ggagagcgcg----
B D                Rabbit  ggaga-agcg----
B D                  Pika  agaga-agcg----
B D                 Human  ggagaaagcg----
B D                 Chimp  ggagaaagcg----
B D                Bonobo  ggagaaagcg----
B D               Gorilla  ggagaaagcg----
B D                Rhesus  ggagaaagcg----
B D              Marmoset  ggagaaagcc----
B D               Tarsier  ggagaaagcg----
B D              Bushbaby  gaagaaagcg----
B D  Malayan flying lemur  ggagaaagcg----
B D                   Pig  ggagaaagag----
B D               Dolphin  ggagaaagag----
B D                   Cow  ggagaaagcg----
B D                 Sheep  ggagaaagcg----
B D                 Horse  ggagaaagcg----
B D      Chinese pangolin  ggaaaaagcg----
B D                   Dog  ggagaaagcg----
B D    Hawaiian monk seal  ggagaaagcg----
B D              Hedgehog  ggagagagcg----
B D                 Shrew  gggaaaagcg----
B D              Elephant  ggagaaagcg----
B D               Opossum  ----agagctatcc
B D                Tenrec  NNNNNNNNNNNNNN
B D             Zebrafish  ==============
B D         X. tropicalis  ==============
B D               Chicken  ==============

Inserts between block 17 and 18 in window
B D              Opossum 2199bp

Alignment block 18 of 340 in window, 56738286 - 56738329, 44 bps 
B D                 Mouse  gg-gctaag-cgctcgctg--------------------------------------------------g
B D                   Rat  ggctctaag-cgctcgccg--------------------------------------------------g
            GCF_003668045  ggtgctgag-cgctcgcgg--------------------------------------------------g
                   Beaver  ggcgatgag-cgttcgcagccgg--c-ggggcc----gc-tccca----------------------cag
B D              Squirrel  gacggtgag-cgctagcagtccg--c-cgcgca----ga-tcccg----------------------cag
B D            Guinea pig  ggcgcggag-cgct-gcagcccg--c-ggggca------------------------------------g
B D                Rabbit  ggcgctgag-cgctcgcagccgg--c-gggact----gaccccca----------------------cgg
B D                  Pika  ggcgaggag-cgctcgccgccgg--t-ggggcc----ga-tccca----------------------ggg
B D                 Human  ggcgacgag-cgctcgcagcccg--t-ggggct----ga-tccca----------------------cct
B D                 Chimp  ggcgacgag-cgctcgcagcccg--t-ggggct----ga-tccca----------------------cct
B D                Bonobo  ggcgacgag-cgctcgcagcccg--t-ggggct----ga-tccca----------------------cct
B D               Gorilla  ggcgacgag-cgctcgcagcccg--t-ggggct----ga-tccca----------------------cct
B D                Rhesus  ggcgacgag-ctctctcagccgg--tgggggca----ga-tccca----------------------ccg
B D              Marmoset  ggcgactag-cgttcgcagcccg--t-ggggcc----ga-tccca----------------------ccg
B D               Tarsier  ggcgacaag-cgctcgcagcccg--c-ggggca----ga-tcccg----------------------tgg
B D              Bushbaby  ggcgacgag-cgctcgcagcccg--c--gggtc----ga-tccca----------------------cgg
B D  Malayan flying lemur  ggcggtgag-cgctc-cagcccg--c-ggggca----ga-tccca----------------------cgg
B D                   Pig  agtgaggag-cgctcgcagcccc----agggcc----ga-tccca----------------------tgg
B D               Dolphin  ggtgaggag-cgctcgcaccccc----agggcg----ga-tccca----------------------cgg
B D                   Cow  ggtgaggag-cgctcgcagcccc----agggcg----ga-tccca----------------------cgg
B D                 Sheep  ggtgaggag-cgctcgcagcccc----aaggcg----ga-tcccg----------------------cgg
B D                 Horse  ggcgaggcg-cgcttgccgcc----g-cgggcc----ca-tccca----------------------cag
B D      Chinese pangolin  ggcgaggag-cgctcgcagccct--g-gggggc----ta-tccca----------------------ccg
B D                   Dog  ggtgccgag-cgctctcagcccc----ggggcg----ca-tcaca----------------------cgg
B D    Hawaiian monk seal  ggtaaggag-cgctctcggcccc--g-ggggcc----ca-tccca----------------------cgg
B D              Hedgehog  ggaggggagaccctgcacccccccgg-ggggctcatgcg-gcctaggggctctggacttggggctaccgg
B D                 Shrew  ggagccgtggctctcgaagcccc----ggggcc----ca-tcccaggg-------------------cgg
B D              Elephant  gtccaggag-cgctcgcagcccc----tgggcc----ga-tccct----------------------cgg
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  -ac-tccagcactggcatctcgcgaccg-------
                      Rat  -ac-tccagcactggctccttgcagccg-------
            GCF_003668045  -ac-ccca----cagcctccagcg-----------
                   Beaver  -cc-cgcagctctcgggactggccacag-------
                 Squirrel  -cc-tttagcgggcggagctggccgctg-------
               Guinea pig  -ac-ccca----cagcccgccgcgctcg-------
                   Rabbit  -cc-cgccgcgctccggacaggccgctg-------
                     Pika  -cc-ggctgagctcggcaca-gccgctg-------
                    Human  -cc-cgcagggctccggtcgtgtcgctg-------
                    Chimp  -cc-cgcagggctctggccgcgtcgctg-------
                   Bonobo  -cc-cgcagggctctggccgcgtcgctg-------
                  Gorilla  -cc-cgcagggctccggccgcgtcgctg-------
                   Rhesus  -cc-cgcagggctcaggtcccgtcgctg-------
                 Marmoset  -cc-agcagcactccggccgggtcgccg-------
                  Tarsier  -cc-cgcagcgctcgggcctggtcgcag-------
                 Bushbaby  -cg-tg-agcgcaccaacctggtcgctg-------
     Malayan flying lemur  -cc-cgcagctcccgggactggccgccg-------
                      Pig  -cca-------------------------------
                  Dolphin  -cca-------------------------------
                      Cow  -cca-------------------------------
                    Sheep  -cca-------------------------------
                    Horse  -cc--------------------------------
         Chinese pangolin  -cc--------------------------------
                      Dog  ccc--------------------------------
       Hawaiian monk seal  -cc--------------------------------
                 Hedgehog  -----------------------------------
                    Shrew  -----------------------------------
                 Elephant  -cc-cgc-gcgctcgcgactggcggctggcggctg
                Zebrafish  ===================================
            X. tropicalis  ===================================
                  Opossum  ===================================
                  Chicken  ===================================

Inserts between block 18 and 19 in window
B D                Sheep 350bp
B D             Hedgehog 12bp
B D                Shrew 12bp

Alignment block 19 of 340 in window, 56738330 - 56738447, 118 bps 
B D                 Mouse  tccagccc--ctgctc-t------------------ccggggacgtcttcccagctctcg----c-----
B D                   Rat  tccagccc--ctaccg-g------------------ccgtgggcatcttcccagctcttg----c-----
            GCF_003668045  -ccagccc--ctgcgc-c------------------gggggagcctcttcccagctcttg----c-----
                   Beaver  tctgacctg-caggac-g------------------cggggaggaatgtcccagctctagtcgac-----
B D              Squirrel  tcgaacccg-cagcac-t--------------------atgaagaatttcagagctcgag----t-----
B D            Guinea pig  ctcgggcgg-ccgcgc-aggga--------------ccgcgagagctccgcgcgctgctg----c-----
B D                Rabbit  cccg------cggcgc-t------------------ggtgcacggattgctcagccgccg----c-----
B D                  Pika  cccggccctccggtgc-g------------------gctgcacgactcgctcagtcccgg----c-----
B D                 Human  tcgga-ccg-cagaac-g------------------ccgggacgcatttccgagctcggg----c-----
B D                 Chimp  tcggacccg-cagaac-g------------------ccgggacgcatttccgagctcggg----c-----
B D                Bonobo  tcggacccg-cagaac-g------------------ccgggacgcatttccgagctcggg----c-----
B D               Gorilla  tcggacccg-cagaac-g------------------ccgggacgcatttccgagctcggg----c-----
B D                Rhesus  tcggaccct-cagaac-g------------------ccgggacgcatttccgagctcggg----c-----
B D              Marmoset  tcggaccag-cagaac-g------------------cggagatgcatttcggagctaggg----c-----
B D               Tarsier  tcggacccg-ccgcgctg------------------cggggcgggattttcgagctcggg----c-----
B D              Bushbaby  tccgaccca-ctgtgc-g------------------gcccaggggatttctgagctcggg----c-----
B D  Malayan flying lemur  tcggacccg-ccgcgc-g------------------ccgggagggatttccgagctcggg----c-----
B D                   Pig  -------------------------------------gcagcgggacttccgcgctctgg----c-----
B D               Dolphin  -------------------------------------gcagcgagatttccgcgctctgg----c-----
B D                   Cow  -------------------------------------gcggcgggatttccgcgctcccg----c-----
B D                 Horse  ------------------------------------cgcagcgggatctctgcgctccgg----cc----
B D      Chinese pangolin  ------------------------------------tgcagggagatttccgcactctgc----ccaccc
B D                   Dog  ------------------------------------cgcagcgggatttctgcgctctg-----------
B D    Hawaiian monk seal  ------------------------------------cgcagcgggatttccgcgctctgg----c-----
B D              Hedgehog  ------------------tggggctaccgccaagcgcggggtggggcctcccagctctgg----c-----
B D                 Shrew  ------------------cccgtccgtagcc---ctttgggggcggatttcaacgctcgg----c-----
B D              Elephant  -cggacccg-cagc---g------------------ccagaaggaatttcagcgctgggg----c-----
B D                 Sheep  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  ----------------c-----caccct---------cccgcag----cctc-------acctgccgcag
                      Rat  ----------------c-----caccct---------ccggcag----cctc-------acctgccgcag
            GCF_003668045  ----------------c-----ctccct---------cggtcag----cctt-------acctgctacag
                   Beaver  ----------------c-----cgcctg---------cctgctg----ccccccgagcaatcttaaggag
                 Squirrel  ----------------c-----caccct---------cgggctg----cagcttgagctgcctcgcggag
               Guinea pig  ----------------a-----ggcgcc---------gtggccg----cagc---agccacttcgcgcgg
                   Rabbit  ----------------cgccggagcccg---------tccgctg----ccgcccgacccgcctcgccggg
                     Pika  ----------------cgt---agcccg---------cccgcggctgcccgcccgatccacctcgtccag
                    Human  ----------------c-----cgacccaa-------cccgctg----ccattctagctacctagtggag
                    Chimp  ----------------c-----cgacccaa-------cccgctg----ccattctagctacctagtggag
                   Bonobo  ----------------c-----cgacccaa-------cccgctg----ccattctagctacctagtggag
                  Gorilla  ----------------c-----cgacccaa-------cccgctg----ccattctagctacctagtggag
                   Rhesus  ----------------c-----cgacccaa-------cccgctg----ccattctagctacctcgtggag
                 Marmoset  ----------------c-----tgacccaa-------cccactg----ccattcttgctacctcgtggag
                  Tarsier  ----------------c-----cgtccccgagccgttctagccg----ctgttctagctactaagtggaa
                 Bushbaby  ----------------g-----ggacccgg-------tccgcct----ctgcgctagctgccttgcagag
     Malayan flying lemur  ----------------t-----cgaccccg-------cgcgctg----ccgccct-gatacc--gaggag
                      Pig  ----------------c-----agaccccg-------tgggctg----ctgccct---------------
                  Dolphin  ----------------a-----ggaccccg-------cgagctt----ctgcctt---------------
                      Cow  ----------------a-----ggaccccg-------cgggctg----ctgccct---------------
                    Horse  -----------------------cgacccg-------ccggctg----ctcgcct---------------
         Chinese pangolin  tccaccttccttccacc-----actccccg-------ccgccgg----ctgccct---------------
                      Dog  ----------------g-----ggaccctg-------cacgctg----ctgtcct---------------
       Hawaiian monk seal  ----------------g-----ggaccctg-------cttgcta----cggccct---------------
                 Hedgehog  ----------------c-----agaccttg-------cgggttt----cttctcc---------------
                    Shrew  ----------------c-----cgacgcct-------cgggctg----ctgcccc---------------
                 Elephant  ----------------c-----cgaccctg-------ccagctg----ttgccctcactacccggcccag
                    Sheep  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  aggag-gaagccttctcggtatgcgaggttcctccatctggcgg-aaggct--
                      Rat  aggag-aaaagcctttcggaatgtgaggttcctccatctggtgg-aaggct--
            GCF_003668045  aggtg-gaaagggtctcggtgtgcgtggttcgtcaggccgaagc-aaggcg--
                   Beaver  tggtg-gaaaagctcttgaactgtgaagttcg-------gttgg-aaggct--
                 Squirrel  ctagg-cagagggttctgaacagggaggcttatccgt---gaaa-aaggct--
               Guinea pig  ccggg-gaaaga--ctggagtcccgaggcttgtcggt----gga-aaggct--
                   Rabbit  cc-gg-g-------ctcaggctgggggac------------cgc-aaggct--
                     Pika  ccggg-g-------cacaggc--------------------------------
                    Human  ccgcg-gagagactcttgaaccgtgaggctccttgat----gag-aaggt---
                    Chimp  ccgcg-gagagactcttgaaccgtgaggctccttgat----gag-aaggt---
                   Bonobo  ccgcg-gagagactcttgaaccgtgaggctccttgat----gag-aaggt---
                  Gorilla  ccgcg-gagagactcttgaaccgtgaggctccttgat----gag-aaggt---
                   Rhesus  tcacg-gagagactcttgaaccgtaaggctccttgat----gag-acggt---
                 Marmoset  ccg-g-gagaggctcttgaaccgtgaggctccttggt----gag-aaggt---
                  Tarsier  cccag-gcgaggctcttcaa-----aggct-----------------------
                 Bushbaby  ccggg-gaaaggctctggaaccgtgagactggttagt----gag-aaggt---
     Malayan flying lemur  tcgggagaaaggctctcgaaccgtgaggcttgttggc----gag-aaggc---
                      Pig  ctggg-gaaagggtcttgaatcgtgggcaccatcagc----cga-aggga---
                  Dolphin  ctggg-gaaagggtcttgaatcgtgagcaccaccagc----tgg-aaggc---
                      Cow  ctggg-gaaaaggtctcgaaccgtgagcaccagcagc----cag-aaggc---
                    Horse  ctggg-gaaagggtcttgagccgtgagcatcgtcggc----ggg-aaggc---
         Chinese pangolin  ctggg-gaaacggtctggaattgggagcagcgtcggc----gga-aaggc---
                      Dog  ctggg-gaaa-ggtcttgaatcgtaagcatcgtcggc----agg-aaggc---
       Hawaiian monk seal  ctggg-gaaagggtcttgaatcctaagcatcgtcggc----agg-aaggc---
                 Hedgehog  cgggg-gaaagggtcttgaatcttgaggatcatgggc----ggcggagaa---
                    Shrew  tgggg-gagagggtcttggctcgagaggatcttcagt----tgc-caggc---
                 Elephant  ctggg-gaaaatctcttgaactgtgaggctctgtagg----cgg-gaagc-ct
                    Sheep  =====================================================
                Zebrafish  =====================================================
            X. tropicalis  =====================================================
                  Opossum  =====================================================
                  Chicken  =====================================================

Inserts between block 19 and 20 in window
B D                Human 1bp
B D                Chimp 1bp
B D               Bonobo 1bp
B D              Gorilla 1bp
B D               Rhesus 1bp
B D             Marmoset 1bp
B D              Tarsier 275bp
B D             Bushbaby 1bp
B D Malayan flying lemur 1bp
B D                  Pig 1bp
B D              Dolphin 1bp
B D                  Cow 1bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp
B D             Hedgehog 1bp
B D                Shrew 1bp

Alignment block 20 of 340 in window, 56738448 - 56738480, 33 bps 
B D                 Mouse  ga-acagccagta---------agcaacgcttc---ggtagtca---gt
B D                   Rat  ga-acagccagaa---------agcgacgcttc---gggagtcc---tt
            GCF_003668045  ga-acagtcagga---------agcaacgctcc---gggagtcc---tt
                   Beaver  aaggcggtcgcgg---------ggcgactgtgc---gagcatcatcttc
B D              Squirrel  ga-gcagtcgccg---------ggcgactctcc---agcattt----tc
B D            Guinea pig  aa-gcggccgcga---------ggcgactctcc---gagcatct---tc
B D                Rabbit  ct-tctgtgagaa---------ggca----------gggaggca---gc
B D                  Pika  ---tctgtacgaa---------ggcag---------gggaggcg---gt
B D                 Human  ga-gaggctgccg---------ggctattctcc---gagcatct---tc
B D                 Chimp  ga-gaggctgccg---------ggctattctcc---aagcatct---tc
B D                Bonobo  ga-gaggctgccg---------ggctattctcc---aagcatct---tc
B D               Gorilla  ga-gagg----------------------attc---gagcatct---tc
B D                Rhesus  ga-gagaccgcgg---------ggctattctcc---aagcatct---tc
B D              Marmoset  ga-gaggccgcgg---------ggatattctcc---gagcatct---tt
B D              Bushbaby  ga-gaggcggcaa---------ggagactctta---gagcatct---tt
B D  Malayan flying lemur  ga-gcgtccgcgg---------agcgactctccgaggagaatct---tc
B D                   Pig  ga-gaggacgtgggaaggcattagcgactttcg---gagaattt-----
B D               Dolphin  ga-gaggacgcggagaggccttagaggctttcg---gagaaatt-----
B D                   Cow  gc-gagaacgcagggagaccttagggactttcg---gagcattt-----
B D                 Horse  gg-gaggc-----------cttggcgactctcg---gagaatct---tc
B D      Chinese pangolin  ga-gaggccgcggggaagtcctggcaactctgg---aagaagct---tc
B D                   Dog  ga-gaggcggcagggagtccttggagattctcc---gagaatta---tc
B D    Hawaiian monk seal  ga-gaggcgacagggaggctttggcgattctcg---gagaatct---tc
B D              Hedgehog  ca-gaggc-----------ctgggcaaagctca---gagcatct---tc
B D                 Shrew  ga-gaggc-----------ct-ggtggctcccg---gagcactt---tt
B D              Elephant  ga-gaggctggga---ggccgtggcgaccattg---gagcatct---tc
B D                 Sheep  =================================================
B D               Tarsier  =================================================
B D             Zebrafish  =================================================
B D         X. tropicalis  =================================================
B D               Opossum  =================================================
B D               Chicken  =================================================

Inserts between block 20 and 21 in window
B D                  Pig 3bp
B D              Dolphin 3bp
B D                  Cow 3bp
B D                Horse 1bp
B D     Chinese pangolin 1bp
B D                  Dog 1bp
B D   Hawaiian monk seal 1bp
B D             Hedgehog 1bp
B D                Shrew 1bp

Alignment block 21 of 340 in window, 56738481 - 56738632, 152 bps 
B D                 Mouse  ggg-----------------c----------tccaa-tt-------ga----agtcc-----------cc
B D                   Rat  ggg--------------------------------------------------gtcc-----------cc
            GCF_003668045  ggg-----------------c----------tccac-tt-------gg----ggtcc-----------ct
                   Beaver  ggg-----------------ccgtgctctgttcctc-tg-------gg----gggtc-----------cc
B D              Squirrel  gcg-----------------c----------ggcgc-tc-------ggcatcgggtt-----------cc
B D            Guinea pig  gga-----------------c----------tgcga-ct-------gt--------c-----------cc
B D                Rabbit  ggg-----------------g----------------gc-------gc----agctc-----------cg
B D                  Pika  agg-----------------gc---------gccgc-tc-------gc----agccc-----------cg
B D                 Human  cgg-----------------ccgagctctgctcctc-tc-------cg-----tgcg-----------ct
B D                 Chimp  cgg-----------------ccgagctctgctcctc-tc-------gg-----tgcg-----------ct
B D                Bonobo  cgg-----------------ccgagctctgctcctc-tc-------gg-----tgcg-----------ct
B D               Gorilla  cgg-----------------ccgagctctgctcctc-tc-------gg-----tgcg-----------ct
B D                Rhesus  cgg-----------------tcgcgctctgctcctc-tc-------gg-----tgcg-----------ct
B D              Marmoset  cgg-----------------ccgctctctactcctc-ta-------gg-----agcg-----------ct
B D              Bushbaby  cgg-----------------ctgcgctccgctcctcttc-------cg-----cgct-----------ag
B D  Malayan flying lemur  cgg-----------------ccgcactttgctcctc-tt-------cg-----ggtgtggggggc---cc
B D                   Pig  agg-----------------t----------tcctc-tt-------gg----gggcc-----------ct
B D               Dolphin  agg-----------------c----------tcctc-tt-------gg----gggcc-----------cc
B D                   Cow  agg-----------------t----------tcctc-tt-------gg----gggcc-----------cc
B D                 Sheep  agg-----------------t----------tcctc-tt-------gg----gggcc-----------cc
B D                 Horse  ggg-----------------c----------tcttt-tt-------ga----gggcc-----------cc
B D      Chinese pangolin  ggg-----------------c----------tcctc-ct-------gc----gggcc-----------cg
B D                   Dog  ggg-----------------c----------tcctt-ct-------gg----gggctgcccccccgcagg
B D    Hawaiian monk seal  ggg-----------------c----------tcctt-ct-------gg----aggccgcctcccc---ca
B D              Hedgehog  ggggaacccgtacaccccacc----------cccgc-accggaggagg----gagt------------cc
B D                 Shrew  ggg-----------------c----------tccgc-tt-------gg----gggc------------cc
B D              Elephant  cgg-----------------ctacgatcggctgctc-tc-------gg----gagcc-----------cc
B D               Tarsier  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  tg-----------aagcttctgg-ct-------gcgcg-------------ggttc-------gtccaca
                      Rat  tg-----------aagcttctgg-ct-------gcccg-------------ggtgc-------gtccgca
            GCF_003668045  tg-----------caacttctgg-ct-------acgct-------------ggtgc-------atctgcc
                   Beaver  tg-----------cggcttct-------------cctt-------------gg--------------gca
                 Squirrel  tg-----------aaacttct-------------cctt-------------gg-----------------
               Guinea pig  tg-----------tgacttct-------------cctt-------------gg--------------gcc
                   Rabbit  ag-----------catcttccgg-cttctcctcgggcg-------------ggcgc-------gtgcgct
                     Pika  cg-----------cgtccaccgg-cc--------------------------------------------
                    Human  tg-----------cggcttctcc-tt-------gggct-------------agcgc-------gtccgca
                    Chimp  tg-----------cggcttctcc-tt-------gggct-------------ggcgc-------gtccgca
                   Bonobo  tg-----------cggcttctcc-tt-------gggct-------------ggcgc-------gtccgca
                  Gorilla  tg-----------cggcttctcc-tt-------gggct-------------ggcgc-------gtccgca
                   Rhesus  tg-----------cggcttctcc-tt-------gggct-------------ggcgc-------gtccaca
                 Marmoset  tg-----------cgacttctcc-gt-------gggct-------------ggcgc-------gtccgca
                 Bushbaby  ag-----------tggcttctcc-tt-------gggct-------------ggtgc-------gtccgca
     Malayan flying lemur  tg-----------cggcttctcc-----------agct-------------ggcgc-------attagcg
                      Pig  ag-----------tggtctcttc-tt-------gggttggtgcatccc---gctgtgtccgcagtccgca
                  Dolphin  ag-----------cggcctctac-tt-------gggctggtgggtccc---gctgc-------gtctgca
                      Cow  ag-----------cggcctctac-tt-------gggctggtgcgtccg---gatgc-------gtccgca
                    Sheep  ag-----------cggcctctac-tt-------gggcgggtgcgtccg---gatgc-------gtccgca
                    Horse  tg-----------cggcctctac-gt-------gggctggttggttca---gccgc-------gtccgca
         Chinese pangolin  tgcnnnnnnnnnncagccta-------------gggctctttcctctagccgccgc-------ctccgc-
                      Dog  cccc---------ccgccttcacttt-------gggctggtgtatcct---gcggc-------gtccgcg
       Hawaiian monk seal  tccc---------ccgcctccac-tt-------gggctgattcgtccc---gcggc-------gtccgca
                 Hedgehog  tg-----------agacctctgt-tt-------gcgcgggtgcctccc---gaggt-------tttgtca
                    Shrew  ag-----------cggcctcgac-cc-------gggcgggtgcatccc---gaggc-------tccggtc
                 Elephant  tg-----------ggctctct---tt-------aggcgggtgtgtctg---gtcgc-------gttccca
                  Tarsier  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gcgtcgtcgt---cgccagcgagccaagggcaac-aggtcagtgtga---gcgcccctctcgc-----gc
                      Rat  gcctcgtcgg---cggcggcgagccaaggccaac-aggtcagtgtg-----------------------c
            GCF_003668045  gcgttgccg---------gcgagccaaggccagc-aggtcagtgtgc---gcacccctcccgc-----gc
                   Beaver  gcctcgcca------------agtcccggcccgc-aggtcagtgtgt---gggcgccttccgc-----gc
                 Squirrel  ------------------gatggtgcagaaccgc-aggtcagtgtgt---gggcgcctcccgc-------
               Guinea pig  gattcgtcggaaaccacgccgagtcctggcaggc-aggtcagtgtct---gtgcgccg--cgc-----at
                   Rabbit  gcgctgcca------------gttccag---agc-aggtcagtgtgt---gggtcctctccggcgt----
                     Pika  ---cggcca------------agtccag---agc-aggtcagtgcgtaggggggcttctccgcctccggc
                    Human  gtccctcca------------agtccaggcc-gc-aggtcagtgtgc---gggcgcctcctgt-------
                    Chimp  gtccctcca------------agtccaggcc-gc-aggttagtgtgc---gggcgcctcctgt-------
                   Bonobo  gtccctcca------------agtccaggcc-gc-aggttagtgtgc---gggcgcctcctgt-------
                  Gorilla  gtccctccg------------agtccaggcc-gc-aggtcagtgtgc---gggcgcctcctgt-------
                   Rhesus  gtccctcca------------agtccaggcc-gc-aggtcagtgtgt---gggcgcctcctgt-------
                 Marmoset  gtccctcca------------agttcaggccggc-aggtcagtgtgc---tggcgccacaagt-------
                 Bushbaby  ctcccgcca------------agtccaggccagc-aggtcagtgtgt---gggtgcctcctat-------
     Malayan flying lemur  gcccagcca------------ggtccaggccagc-aggtcagtgtat---gggcgcctcctgc-------
                      Pig  gctcggcga------------attccaggctgtcaaggtcagtgtct---ggccaccccac---------
                  Dolphin  gcccagcga------------agtacaggctggc-aggtcagtgtct---ggacactccctg--------
                      Cow  gcccggcga------------agtacaggctggc-aggtcagtgcct---ggacaccccct---------
                    Sheep  gcccggcga------------agtacaggctggc-aggtcagtgcct---ggacaccccct---------
                    Horse  tcccggcga------------cgtccagcccgga-aggtcagtgtgt---gggcatc-------------
         Chinese pangolin  ccccgcccg------------cggccccactggc-agatccgt---------------------------
                      Dog  gccgggcta------------agtccaggcctgc-aggtcagtgtgt---gggcacctcca---------
       Hawaiian monk seal  gcccggcta------------agtccaggcctgc-aggtcagtgtgt---gggcaccccca---------
                 Hedgehog  gccccacaa------------agtccaggctggc-aggtcagtgagt---gtagtcccc-----------
                    Shrew  gatccgccg------------agtgggtgctggc-aggtcagtgagc---gggcgcccccc---------
                 Elephant  gctccgcca------------agtccaggccagc-aggtcagtatgt---g-------------------
                  Tarsier  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  taccctat---------ccttc----------------------cctgt------ca-------gaaga-
                      Rat  taccctac---------ccttc----------------------cctga------ca-------gagga-
            GCF_003668045  tatccttc---------cctac----------------cccaggcctgg------tt-------gagga-
                   Beaver  ttccctta---------tctca-t--------------ccttggcctgt------ct-------aagggt
                 Squirrel  -atccttc---------cccctaa--------------ctcgggcatgg------tt-------aat---
               Guinea pig  ttccccgc---------cccac-----------------tctggcctgg------cc-------aaagcc
                   Rabbit  -------c---------ctctc--------------------ggcctgg------tt-------ggggc-
                     Pika  tatcctgc---------ctccc--------------------accccgc------ccctgcccggaggc-
                    Human  cctcctct---------cccac---------------------------------ca-------gagga-
                    Chimp  cctcctct---------cccac---------------------------------ca-------gagga-
                   Bonobo  cctcctct---------cccac---------------------------------ca-------gagga-
                  Gorilla  cctcctct---------cccac---------------------------------ca-------gagga-
                   Rhesus  cctcctct---------cccac----------------tccggatctgcctggggca-------gagga-
                 Marmoset  cctcctct---------cccac----------------cccgggtctggctgggaca-------gagga-
                 Bushbaby  ccttccca---------cccac----------------tctgggcctggctggcgcc-------cagga-
     Malayan flying lemur  acccccac---------ccccg-------------------gggcctggctgggact-------gagga-
                      Pig  ccccgcac---------ccctt-ccattaccaccaccaccctggcctggttggggct-------gaagg-
                  Dolphin  ccccccatcacc-----ccccc-ccccccccgcc----ccccggcctggctgaggct-------gaggg-
                      Cow  cccctcaccaccac---cacca-ccaccaccaccactaccctggcctggctgaggct-------gagcg-
                    Sheep  cccctcatcaccaccagcacca-ccaccaccaccactaccctggcccggctgaggct-------gagcg-
                    Horse  --ccccat---------ccc------------------tcagggcctggctggggct-------gaggg-
         Chinese pangolin  ---ccagg---------ccc------------------gcag----------------------------
                      Dog  caccccaa---------ccc------------------aggaggcctggctggggct-------g-ggg-
       Hawaiian monk seal  caccccaa---------ccc------------------agggggcctggctggggct-------gaggg-
                 Hedgehog  --tgtcct---------ccacg--------------------ggcctggcttgg------------ggg-
                    Shrew  tttctcct---------ccccg-atctggctggga---ctgaggccgggcgagg------------ctg-
                 Elephant  gcgcttct---------cgctc---------------------gcctggctggggct-------gaggc-
                  Tarsier  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ------------tc--------------------------------cct----gt---------ag-ct-
                      Rat  ------------cc--------------------------------cct----gc---------aggct-
            GCF_003668045  ------------cc--------------------------------cct----gc---------aggct-
                   Beaver  g------aggacct--------------------------------cct----gt---------gggct-
                 Squirrel  ------------ac--------------------------------cct----gc---------gggct-
               Guinea pig  actgactggagcaa--------------------------------cct----gtgtgtgtgtaggggg-
                   Rabbit  -tca----ggatcc--------------------------------cctgcgggc---------tatcc-
                     Pika  -ccagcggggactc--------------------------------ccc----gc---------tctcc-
                    Human  ------------cc--------------------------------cct----ga---------gggct-
                    Chimp  ------------cc--------------------------------cct----ga---------gggct-
                   Bonobo  ------------cc--------------------------------cct----ga---------gggct-
                  Gorilla  ------------cc--------------------------------cct----ga---------gggct-
                   Rhesus  ------------cc--------------------------------cct----ga---------aggct-
                 Marmoset  ------------cc--------------------------------act----ga---------gggct-
                 Bushbaby  ------------cc--------------------------------ccc----gc---------aggct-
     Malayan flying lemur  ------------cc--------------------------------cct----g----------------
                      Pig  ------------cc--------------------------------cgt----tc---------tggct-
                  Dolphin  ------------cc--------------------------------cgt----gc---------gggct-
                      Cow  ------------cc--------------------------------cgg----gc---------aggcg-
                    Sheep  ------------cc--------------------------------cgg----gc---------aggcg-
                    Horse  ------------cc--------------------------------cc-----gc---------gggca-
         Chinese pangolin  ----------------------------------------------ct-----cc---------gggtg-
                      Dog  ------------cc--------------------------------ctg----gc---------agtctc
       Hawaiian monk seal  ------------cc--------------------------------ctg----gc---------ggtct-
                 Hedgehog  ------------tc--------------------------------cct----gt---------gggct-
                    Shrew  ------------tcctgtctccccccacacaccccccacggctcttccc----tc---------gagcc-
                 Elephant  ------------tc--------------------------------ctc----gc---------gcgct-
                  Tarsier  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ggc----tccg
                      Rat  gac----tctg
            GCF_003668045  ggc----cctg
                   Beaver  gtc----tccc
                 Squirrel  gac----tccc
               Guinea pig  gtc----tctt
                   Rabbit  ttc----caac
                     Pika  gcc----caac
                    Human  gtc----tcca
                    Chimp  gtc----tcta
                   Bonobo  gtc----tcca
                  Gorilla  gtc----tcca
                   Rhesus  gtc----tccc
                 Marmoset  gtc----tcca
                 Bushbaby  gtc----ttc-
     Malayan flying lemur  --c----ccca
                      Pig  gtc----tct-
                  Dolphin  gtt----tct-
                      Cow  gtc----tct-
                    Sheep  gtc----tct-
                    Horse  gcc----tct-
         Chinese pangolin  gac----cct-
                      Dog  gtc----cct-
       Hawaiian monk seal  gtc----tct-
                 Hedgehog  ggcgggggct-
                    Shrew  gcc----gcc-
                 Elephant  gtc----tct-
                   Tenrec  NNNNNNNNNNN
                  Tarsier  ===========
                Zebrafish  ===========
            X. tropicalis  ===========
                  Opossum  ===========
                  Chicken  ===========

Inserts between block 21 and 22 in window
B D Malayan flying lemur 7bp

Alignment block 22 of 340 in window, 56738633 - 56738737, 105 bps 
B D                 Mouse  tcctcagcccccagtgcttgtttct-tcta---gctg---cagcc----acc-----------cgccgc-
B D                   Rat  tcctcagtccccagtggctatttctatcca---gctg---ctgcc----acc-----------cgcgtc-
            GCF_003668045  tccccatacctcagtggttgcttcc-tcta---gctgctactgcc----acc-----------cgggat-
                   Beaver  ttcccagtcccccaaagtcatttgc-ttta---gacg---ccgtcct-tgcc-----------cgcggca
B D              Squirrel  ttcttagcacctaatgtttgttccc-tttg---gtggtcccagctttggacc-----------cgcagc-
B D            Guinea pig  tcttcagctccccgcgttggttcgc-ttta---gcct---tggcccct-gcc-----------tgaggc-
B D                Rabbit  ctccccg-gccccgcgatcgtgccc-cttaggtgccg---ccgtc----tct-----------tgcggc-
B D                  Pika  ctccctgcgctgggcgattgaaccc-ttta---gccg---ctgtg----tcc-----------gccggc-
B D                 Human  tccccaat-ccccgcgactgctcct-ttta---gccg---ccatc----ccc-----------tcccgc-
B D                 Chimp  tccccaat-ccccgcgactgctcct-ttta---gccg---ccatc----ccc-----------tcccgc-
B D                Bonobo  tccccaat-ccccgcgactgctcct-ttta---gccg---ccatc----ccc-----------tcccgc-
B D               Gorilla  tctccaat-ccccgcgactgctcct-ttta---gccg---ccatc----ccc-----------acccgc-
B D                Rhesus  tccccaat-ccccgagactgctcct-ttta---gcgg---ccgcc----ccc-----------tcccgc-
B D              Marmoset  ttcccaatcccccgctactgcacca-ttta---gcca---ccgcc----ccc-----------ttccgc-
B D               Tarsier  tcccccttcccctgaggttgtttcc-ttca---gccc---ccgcc----cgc-----------agctcc-
B D              Bushbaby  tcctctatcccgggccattcttccc-ttta---gccg---ctgtt----ccc-----------gcccgc-
B D  Malayan flying lemur  -----agt-ctccgcggttgttccc-ttta---gctg---ccgcc----ccc-----------accc---
B D                   Pig  -----------------ttcttctc-tcta---gcag---ct-------tct--gaccccagtcgcggc-
B D               Dolphin  cccaca---ccgcctggctcttccc-tgta---gccg---ccgcc----tcc--gacctcgcccgcggc-
B D                   Cow  cccaca---ccccctggctcttctc-tcta---gccg---ctgcc----tcc--gaccccgcccgcggt-
B D                 Sheep  cccaca---ccccctggctcttccc-tcta---gccg---ccgcc----tcc--gcccccgcccgcggt-
B D                 Horse  ccccca---tcccagggctctttcc-t-tg---gccg---ccgcc----ccc--gtccccgcccgtggc-
B D      Chinese pangolin  ccttcg-----------------cc-t-tg---ggca---cgggg----tgc--gcttccggctgccac-
B D                   Dog  ccctca---ccccaaagcttttccc-tcta---gccg---ccgcc----ccc---actccacccgcggc-
B D    Hawaiian monk seal  ccctcg---ccccaaagcttttccc-tcta---gccg---ccgct----ccc--gactccgcccgcggc-
B D              Hedgehog  ccccca---cccc-----------c-tccc---agct---cttct----ctctggcctccgcctgtggc-
B D                 Shrew  ccccca---cccccgg--------c-tccg---cccg---cggct----cccagcgctccgcagatcgc-
B D              Elephant  tccccagccccttgctacgctgttc-cttt---gccg---ctgcc----ccg---------cccgcggc-
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  -ttggg-a----c-----------atagagttgc--t--gggc--gagccttctt-gggt-gaacctggc
                      Rat  -ttggg-c----c-----------atagatttgc--t--aggc--gagccttcttagggt-gaacctggc
            GCF_003668045  -tcggg-a----c-----------acaaatttgt--t--gggc--aagcctcctc-gggt-ggaccgggc
                   Beaver  tcttgg-g----c-----------atatccttgc--g--gcg---aagcagtcca-aggc-ggacccttt
                 Squirrel  -tccaa-g----c-----------acggatctgc--c--tgg---------acta-gggt-ggacccctt
               Guinea pig  -ttcag-g----a-----------gctgatcggcttt--gggc--gagcagccca-gggg-ggacccatt
                   Rabbit  -gtcac-c----c-----------gcagatctgg--c--aggtc-cagcagccct-gggt-ggacgctcc
                     Pika  -tccac-g----c-----------gcagatctgg--c--ggctcaaagcagcctt-gagt-ggactctcc
                    Human  -----a-g----c-----------gcagatcctg--caggggc--cagcggtcca-gggc-ggaccctcc
                    Chimp  -----a-g----c-----------gcagatcctg--caggggc--cagcggtcca-gggc-ggaccctcc
                   Bonobo  -----a-g----c-----------gcagatcctg--caggggc--cagcggtcca-gggc-ggaccctcc
                  Gorilla  -----a-g----c-----------gcagatcctg--caggggc--cagcggtcca-gggc-ggaccctcc
                   Rhesus  -----a-g----c-----------gaagatcctg--ca-gggc--cagcggtcct-gggc-ggaccctcc
                 Marmoset  -----a-g----c-----------gcagatgctg--ca-gggc--cagcggtcca-ggga-ggacccacc
                  Tarsier  -----acg----c-----------gcagatccgg--cg-gggc--cagcagtcca-gggt-gaaccctcc
                 Bushbaby  -----g---------------------------------cggc--ccgcagtcta-gggg-ggaccctcc
     Malayan flying lemur  -------g----c-----------gttgatccgg--cg-gggc--cagcagtcca-ggtt-gaaccctcc
                      Pig  -tccac-g----c-----------ataggttggg--tc-catc--cctcagctca-tggt-ggacc----
                  Dolphin  -tccac-g----c-----------gcagatagag--tc-cagc--ccgcagctca-gggt-ggaccttcc
                      Cow  -ccccg-g----c-----------gcagataggg--tc-cagc--ccgcggccct-gggt-ggaccctcc
                    Sheep  -cccgg-g----c-----------tcagataggg--tc-cagc--ccgcggccca-gggtgggaccctcc
                    Horse  -tcccc-g----c-----------gcaggtccgg--cc--ggc--ccgcagctca-gggt-ggaccctcc
         Chinese pangolin  -gtgcc-g----cagcagtcgcaggaaggtcgag--tg--ggcg-tgggagctgc-ggct-g--------
                      Dog  -tctacgg----c-----------gcagatcccg--cc-tggc--ccgcagctca-gggt-g-gacctcc
       Hawaiian monk seal  -tccac-g----c-----------gcagatccct--cc-tggc--ccgcagctcc-gggt-g-gacctcg
                 Hedgehog  -ttcat-gcgccc-----------acggggcatg--ac-ccccg-cagcggcccg-ggtg-g-gtcactt
                    Shrew  -cgcag------c-----------tctgggcggt--ac-cctc--cggggtctcg-gaat-c-gtcgggg
                 Elephant  -tccac-g----c-----------gccagtcgcg--cc-gggc--ggccggccgg-tgga-ggatcctcc
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  c-t-ggc-tgtggttg
                      Rat  c-t-ggc-cgtgagtg
            GCF_003668045  t-t-agc-cgttggag
                   Beaver  a-t-gat-cttgggca
                 Squirrel  c-taggc-cttgggca
               Guinea pig  c-t-ggc-cttgagca
                   Rabbit  c-g-tgc-cttgggct
                     Pika  c-a-ggc-ctcgggct
                    Human  c-t-cgc-cctgggcg
                    Chimp  c-t-cgc-cctgggcg
                   Bonobo  c-t-cgc-cctgggcg
                  Gorilla  c-t-cgc-cctgggcg
                   Rhesus  c-t-ctc-cccgggcg
                 Marmoset  c-t-agc-cccgggcg
                  Tarsier  c-t-cgc-cttgggcg
                 Bushbaby  c-t-tgc-ctttggct
     Malayan flying lemur  t-t-cgc-ct------
                      Pig  --t-ctc-cttagaca
                  Dolphin  c-t-ctc-tttaggca
                      Cow  c-t-ctc-cttaggca
                    Sheep  ctt-ttc-cttaagca
                    Horse  c-t-ggc-ctagggca
         Chinese pangolin  ----------------
                      Dog  c-t-ggc-ctcgggca
       Hawaiian monk seal  c-t-cgc-cttggcca
                 Hedgehog  c-t-cgc-ctggggca
                    Shrew  a-a-cgctccgggacg
                 Elephant  c-t-ggc-cttgggcg
                   Tenrec  NNNNNNNNNNNNNNNN
                Zebrafish  ================
            X. tropicalis  ================
                  Opossum  ================
                  Chicken  ================

Inserts between block 22 and 23 in window
B D     Chinese pangolin 91bp

Alignment block 23 of 340 in window, 56738738 - 56738833, 96 bps 
B D                 Mouse  cggg-gcgc----------gccggttgc-cc------tgacactttctg-----gggagcttagt-----
B D                   Rat  acag-acgc----------gccggttgc-cc------tgacacttactg-----gggagcttagc-----
            GCF_003668045  cggg-gcgc----------gtcgcttgc-cc------cgacatttgctg-----ggaaactcagg-----
                   Beaver  ccagcgcgc--ttccggctgccacttgc-tc------tggcacttgctg-----gag-gcgcagt-----
B D              Squirrel  cggg-gcac-------gcttctggctgc-ccctgttgcagcagttgcta-----cgaggtgcagt-----
B D            Guinea pig  cggg-gcacacttctggctgccacttgc-ca------cgcgactgacct-----ga--gcacctt-----
B D                Rabbit  cggg-gcgcgcttccggttgccacttgc-gg------cgacagtcgctg-----ggaggaacagc-----
B D                  Pika  ccgg-ccgctcttccgactgccactcgc-gg------ggacagtcgcgg-----gaaggagcagc-----
B D                 Human  cggg-gcgagcttctggctgtcacttgc-cg------ctgcagtttcag-----ggaaactcagc-----
B D                 Chimp  cggg-gcgagcttctggctgtcacttgc-cg------ctgcagtttcag-----ggaaactcagc-----
B D                Bonobo  cggg-gcgagcttctggctgtcacttgc-cg------ctgcagtttcag-----ggaaactcagc-----
B D               Gorilla  cggg-gcgagcttctggctgtcacttgc-cg------ctgcagtttcag-----ggaaactcagc-----
B D                Rhesus  cggg-gcgagcttctggctgtcacttgc-cg------ctgcagtttctg-----ggaaactcagt-----
B D              Marmoset  ccgg-gcagtcttccggttgtcacttgc-ag------ctgcagtttctg-----ggaaactcagt-----
B D               Tarsier  cggg-gcgcccttccggctaccacttgc-cg------ccgcagtcgctg-----gggagcccagt-----
B D              Bushbaby  cagg-gtgcactta-ggatgccacttgc-gg------c-gccgttgcggggggtgggggggcact-----
B D  Malayan flying lemur  -----------gtccggctgccacttgc-ag------cggcagttgctg-----ggaggcccagtgggca
B D                   Pig  cct--gtacacttcaggctgccgcgtgc-gg------cagaagaagctg-----ggaggacgagt-----
B D               Dolphin  ccgg-gtgcgcctccggctgccacgtgc-ta------cagcagacgctg-----ggaggtccagt-----
B D                   Cow  ccgg-gtgcgcttccggctgccacgtgc-gg------cagcagacactg-----ggaggtccagt-----
B D                 Sheep  cccg-gtgcgcttcaggctgccacgtgcagg------cagcagacactg-----gga-gtccagt-----
B D                 Horse  cggg-gtgcgcttcaggctgccacgtgc-gg------ccgcggtcgcca-----agaggtcgagt-----
B D                   Dog  cagg-gcgcgcttccggctgccacgtgc-cg------cagcaggcgctg-----ggaggtcgagt-----
B D    Hawaiian monk seal  cagg-gtgcgcttccggctgccacgtgc-cg------cagcgggcgctg-----ggaggttgagt-----
B D              Hedgehog  cggg-gcgcgctgcctgctgccacgtgc-gg------ccgcgctggccg-----ggaggccgagt-----
B D                 Shrew  c-ga-gtgcgccg---------aggagc-gg------ccgccgagcctt-----cgaggccgag------
B D              Elephant  cggg-atgcgcttccggctgccacgtgc-gg------cggtagtcgctg-----ggagaccgagt-----
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D      Chinese pangolin  ======================================================================

                    Mouse  -----tgggtgc-----gctgaac----actgaccctgcaagg---------------------------
                      Rat  ------gggtgt-----gctgagc-----caggccctgcaagg---------------------------
            GCF_003668045  ------gggtg------aaggaac----gcagactctgcaagg---------------------------
                   Beaver  ------gggcg------gaggagtcgccgttgacgctgtgaga---------------------------
                 Squirrel  ------gggca------gaggaaccgatgctgaccgtgtgaag---------------------------
               Guinea pig  ------gggcg------gaggagccaccgttgactccgagagg---------------------------
                   Rabbit  ------gggcg------ggggagcggtctccgaccgtggcagg---------------------------
                     Pika  ------gggcg------gagaagcggcctctgaccccggcagg---------------------------
                    Human  ------tggcc-----------------gcttaccctgcaaga---------------------------
                    Chimp  ------tggcc-----------------gcttaccctgcaaga---------------------------
                   Bonobo  ------tggcc-----------------gcttaccctgcaaga---------------------------
                  Gorilla  ------tggcc-----------------gcttaccctgcaaga---------------------------
                   Rhesus  ------tggcc-----------------ccttaccctgcaaga---------------------------
                 Marmoset  ------tggct-----------------gctgaccctgcaaga---------------------------
                  Tarsier  ------gggct-----------------gctgaccctgcgaca---------------------------
                 Bushbaby  ------gggcc-----------------gctga-cttgcaggg---------------------------
     Malayan flying lemur  gaggagtggcc-----------------gctgaccctgcgagg---------------------------
                      Pig  -------ggtg------gaggggtagtcgctgaccctaccaag---------------------------
                  Dolphin  ------gggca------g-ggggctgacgctgaccctaccggg---------------------------
                      Cow  ------gggcg------gaggggcggccgctgaccccaccagg---------------------------
                    Sheep  ------gggcg------ggggggcggccgctgaccctacc-gg---------------------------
                    Horse  ------gggcg------gaggagcggccgctca-cctgcgagg---------------------------
                      Dog  ------aggcg------gaggagcggccgctgaccccgagtgg---------------------------
       Hawaiian monk seal  ------aggcg------gaggagcggccgctgaccccgagggg---------------------------
                 Hedgehog  ------gggcggaggacgcgggagcggcgctgaccctgcagggccgggcaaaaagcgcggcggatcccag
                    Shrew  -----------------acagcaccggggcagatcgcgctggg------------------ggtccgcgg
                 Elephant  ------gggcg------gaggagcggccggtggccctgcgaag---------------------------
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  ctg-------------ggccctaa-ctggg------aggc------------------------------
                      Rat  ttg-------------ggccctaa-ttggg------cggc------------------------------
            GCF_003668045  ctg-------------ggccctga-ttgag------cgcc------------------------------
                   Beaver  cca-------------ggcctcaa-tagtg------ggcc------------------------------
                 Squirrel  cag-------------ggccttcg-ctgtg------ggcc------------------------------
               Guinea pig  -------------------------------------gcc------------------------------
                   Rabbit  ccg-------------agtcctag-cagtg------ggca------------------------------
                     Pika  ccg-------------ggtcacag-cggtg------ggtg------------------------------
                    Human  cgg-------------ggacatag-cagag------ggcc------------------------------
                    Chimp  cgg-------------ggacatag-cagag------ggcc------------------------------
                   Bonobo  cgg-------------ggacatag-cagag------ggcc------------------------------
                  Gorilla  cgg-------------ggacatag-cagag------ggcc------------------------------
                   Rhesus  cgg-------------ggacatag-cagcg------ggcc------------------------------
                 Marmoset  ccg-------------ggacagag-cagcg------ggcc------------------------------
                  Tarsier  ctg-------------ggacaccg-tactg------ggcc------------------------------
                 Bushbaby  ----------------------ag-cggtg------ggac------------------------------
     Malayan flying lemur  ccg-------------ggacatag-cagtg------ggcc------------------------------
                      Pig  cca-------------gaatgtag-tattg------ggcc------------------------------
                  Dolphin  ccg-------------ggacttag-cattg------ggcc------------------------------
                      Cow  ccg-------------aaacgtag-catgg------ggcc------------------------------
                    Sheep  ccg-------------gaacgtag-catct------ggcc------------------------------
                    Horse  ccg-------------ggacacag-cagcg------ggcc------------------------------
                      Dog  ccg-------------ggacggag-cagtg------ggca------------------------------
       Hawaiian monk seal  ccg-------------ggaccgag-cagtg------ggca------------------------------
                 Hedgehog  ccggagccccaaacctgggcgtggacagcgcagtttggcc------------------------------
                    Shrew  ccg-------------cggcgtgg-ctgcgcgcttgggcg------------------------------
                 Elephant  cca-------------gagcccgg-ctgtg------ggcctctgggcttggaacccgcgccctgggcgtt
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================
         Chinese pangolin  ======================================================================

                    Mouse  ----------------cagat
                      Rat  ----------------cagat
            GCF_003668045  ----------------cagat
                   Beaver  ----------------caggt
                 Squirrel  ----------------caggt
               Guinea pig  ----------------cagtt
                   Rabbit  ----------------gaggt
                     Pika  ----------------gaggg
                    Human  ----------------gagtt
                    Chimp  ----------------gagtt
                   Bonobo  ----------------gagtt
                  Gorilla  ----------------gagtt
                   Rhesus  ---------------agagtt
                 Marmoset  ----------------gagtt
                  Tarsier  ----------------gaggt
                 Bushbaby  ----------------caggg
     Malayan flying lemur  ----------------gaggt
                      Pig  ----------------gat--
                  Dolphin  ----------------gat--
                      Cow  ----------------gat--
                    Sheep  ----------------gat--
                    Horse  ----------------gat--
                      Dog  ----------------ggt--
       Hawaiian monk seal  ----------------gat--
                 Hedgehog  ----------------aga--
                    Shrew  ----------------gcg--
                 Elephant  ggcagcgtggtttcctgaggt
                   Tenrec  NNNNNNNNNNNNNNNNNNNNN
                Zebrafish  =====================
            X. tropicalis  =====================
                  Opossum  =====================
                  Chicken  =====================
         Chinese pangolin  =====================

Inserts between block 23 and 24 in window
B D                  Pig 37bp
B D              Dolphin 49bp
B D                  Cow 49bp
B D                Sheep 49bp
B D                Horse 47bp
B D                  Dog 36bp
B D   Hawaiian monk seal 39bp
B D             Hedgehog 1bp
B D                Shrew 1bp

Alignment block 24 of 340 in window, 56738834 - 56738953, 120 bps 
B D                 Mouse  ccgaa-----------------tgagtctagttgctt-ttt-tt--ttaaagtcaag------tgcaat-
B D                   Rat  ccgaa-----------------ggagcctagttgctt-ttt---------aggcaag------tgcaga-
            GCF_003668045  ccgaa-----------------ggagcctaattgtct-ttt------ctaagtcaag------cgcaat-
                   Beaver  ctgca-----------------gaagccgggcctctt-ttt-ct-gtctacacagcg------cgcaaa-
B D              Squirrel  ctaga-----------------aaagccggaactctc-ccc-cccccccgccccgcgcctcaccgcaat-
B D            Guinea pig  ctgga-----------------gaggcccggtctcc--------------------a------agcagt-
B D                Rabbit  ctgca-----------------gcagcagagcctttt-ttc-tc--tctgcgccgct------ggcaat-
B D                  Pika  ctgcc-----------------gaagccgagcctctt-ttc-ca--tttgcgccgat-----gggcaat-
B D                 Human  ctgga-----------------gaagctgggcttgtt-ttt-ct-ctctgcaccgcg------cgcaatg
B D                 Chimp  ctgaa-----------------gaagctgggcttgtt-ttt-ct-ctctgcaccgcg------cgcaatg
B D                Bonobo  ctgaa-----------------gaagctgggcttgtt-ttt-ct-ctctgcaccgcg------cgcaatg
B D               Gorilla  ctgga-----------------gaagctgggcctgtt-ttt-ct-ctctgcaccgcg------cgcgatg
B D                Rhesus  ctgga-----------------gaagctgggcctgtt-ttt-ct-ctctgcacagcg------cgcaata
B D              Marmoset  ctgga-----------------gaagttgggcctgtt-ttt-ct-ctctgcgccgcg------cgcaatg
B D               Tarsier  ctgga-----------------gaagctgggc----------ct-ctctacgccgcg------cgaaac-
B D              Bushbaby  cggaa-----------------caagctgggtctctt-ttt-tt-ctccatgcctac------agtaat-
B D  Malayan flying lemur  ctgga-----------------gaagcagggcctctt-ttt-cc-ctctaagccgca------cgcagt-
B D                   Pig  atg--------------------aagtccggcccctt-att-ct-ctccacgccgcg------cgcaat-
B D               Dolphin  ctgga-----------------gaagcctggcctctt-tttcct-ctctacgcggcg------cgcaat-
B D                   Cow  ccgca-----------------caagtccggcctcct-ttt-ct-ctctacgaggcg------tgcaat-
B D                 Sheep  ccg--------------------aagtccggcctctt-ttt-ct-ctctacgaggcg------tgcaat-
B D                 Horse  ctgga-----------------gaagcccggcctc---ttt-ct-ctccacgccgcg------cgcaat-
B D      Chinese pangolin  ctgga-----------------gatgtccggcccctt-ttt-ct-ctctacgccgcg------cgccat-
B D                   Dog  ctgcagaggact----------gaagtccggcctc---ctt-ta-ctctacgccgcg------ctcaat-
B D    Hawaiian monk seal  gtggcgaggact----------gaagtccggcctc---ttt-tt-ctctacgccgcg------ctcaat-
B D              Hedgehog  ctggaaaaaaaaaaaaaaaaaaaaaaaccagccgggcctct-ct-ccctcaggcgcg------cgcagt-
B D                 Shrew  ctgg------------------agaacccagccacttcctc-gt-ctctgcgccccg------cgcctc-
B D              Elephant  ctgga-----------------gtagccaggcctt---ttg-ct-gtctacgacgcg------cgcaag-
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  gccacactca-cc-taacaca--gg------cgtgctgtaga----ggaactcaactcg-aggtccagcc
                      Rat  tccacattta-tt-taacacacagg------cgtgctgtaga----ggaactcgacgcg-aggtccagcc
            GCF_003668045  gccacacacg-----gatact--gg------cttgcg----------------cactcg-aggaccagcc
                   Beaver  ctc-cactcaccc-tggtagt--gg------ctttctggtgc----gggaatcgactcc-acgtcta---
                 Squirrel  cccgggttcacct-tagcaat--gg------ctttcctgtga----gggaacc-----------------
               Guinea pig  ctc-cactca-ac-cggcaga--gt------catttctgtgg----gggaaaagagtc---cgttttgcc
                   Rabbit  cccccactcaccctctgaaga--a-----------------------------gactc--aggtcaggcc
                     Pika  gccccgcacgctc-caggaga--g-----------------------------ggctc--gggtcaggcc
                    Human  ccccaactgaccc-tgaa------------------------------------------gggtcttgcc
                    Chimp  ccccaactgaccc-tgaa------------------------------------------aggtcttgcc
                   Bonobo  ccccaactgaccc-tgaa------------------------------------------aggtcttgcc
                  Gorilla  ccccaactgaccc-tgaa------------------------------------------aggtcttgcc
                   Rhesus  ccccaaatcatcc-tgaa------------------------------------------aggtcttgcc
                 Marmoset  ccccaactcaccg-tgaa------------------------------------------agggcttgac
                  Tarsier  cccccactcaccc-tggaagg--gg------cgctcccgtgc----ggcaacccaactcgaggtctttcc
                 Bushbaby  -ccccactcaccc-tggaaga--ga------cgctcacgtgg----ggaaaa--------tgatcttgtc
     Malayan flying lemur  cccccactcacca-tggaagg--gg------ctctccggtgg----gggagc--------ccgacttgt-
                      Pig  ctttcgcctaccc-tggaaga--gg------cgctcccgtgg----gagaaccggatcggaaggcttgcc
                  Dolphin  ccttcacttaccc-tggaaga--gg------cactcccgtgg----gggaacaggatcggaggtcttgcc
                      Cow  ccttcacttacca--gcaaga--gg------agcttccgtgg----gggaaccggatcggagatcttgcc
                    Sheep  ccttcacttacca--ggaaga--gg------agctcccgtgg----ggaaacaggatcggagatcttgcc
                    Horse  ccttcacttactc-tggaaga--gg------agctcccgccg----gggagccggatccgagaccttgcc
         Chinese pangolin  ccttcgcttgccc-cgaaaga--gg------tgctccggtgg----ggaaaccgaatacgagatcctgcc
                      Dog  ctttcacttaccc-tgaaaga--gg------cgctccctggg----gaggaccggattcgagatcttgtt
       Hawaiian monk seal  ctttcacttaccc-tgaaaca-----------gctcccttgg----gagaaccggactcgagatcttgtt
                 Hedgehog  ctttgacttaccc-aggaaga--ga------cgctcccgcggg---gggaacagaattccagagatcgtc
                    Shrew  ccttcacttaccc-agagaga--g-------cagtagctcgggtgcgggaacgg---tgcggaggacg--
                 Elephant  cccgcactcaccc-tcgaaga--gactcccccactcccgtgg----gggaactggccctgaggtcttgcc
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tttgcctgaaaacttc-cccc---ag-a
                      Rat  tttgccggaaagtttc-cccc---ag-a
            GCF_003668045  actgcctgaaagtttc-ccct-------
                   Beaver  tttgcctagcattttc-cctt---ag-a
                 Squirrel  ----------agagtc-cctc---agaa
               Guinea pig  tgtgcccaccattttc-actt---ga-t
                   Rabbit  tttagcaagtattttt-ctttcccgg--
                     Pika  tgtagcaagcatttgc-cttt---gga-
                    Human  tttact--gcatttgc-cccc---ag-a
                    Chimp  tttact--gcatttgc-cccc---ag-a
                   Bonobo  tttact--gcatttgc-cccc---ag-a
                  Gorilla  tttagt--gcatttgc-cccc---ag-a
                   Rhesus  tttact--gcgttttc-tccc---ag-a
                 Marmoset  tttact--gcatgttc-ccca---gg--
                  Tarsier  tttacc--gcatttcc-cctc---ag-a
                 Bushbaby  attatc--acatttcc-cctt---tg-g
     Malayan flying lemur  tttacc--gcatttcc-cctc---ag-a
                      Pig  tctatc--gcgttttc-cctc---ag-a
                  Dolphin  tctact--atattctc-cctc---ag-a
                      Cow  tttacc--gtattctc-cctc---ag-a
                    Sheep  tctacc--gtattctc-cctc---ag-a
                    Horse  tctacg--gcattccc-cctc---gg-a
         Chinese pangolin  cctatc--attttacc-cctc---ag-a
                      Dog  tctacc--tcattccctccac---tc-g
       Hawaiian monk seal  tctatc--tcattccctcctc---ac-a
                 Hedgehog  tccacc--tctctccc-tctc---gg-a
                    Shrew  ----------------------------
                 Elephant  tgtactgactgctttt-ccc--------
                Zebrafish  ============================
            X. tropicalis  ============================
                  Opossum  ============================
                  Chicken  ============================

Inserts between block 24 and 25 in window
B D                 Pika 59bp

Alignment block 25 of 340 in window, 56738954 - 56738965, 12 bps 
B D                 Mouse  cagctg------------------------caagaa
B D                   Rat  tagctg------------------------caaaaa
            GCF_003668045  ---------------------------------gaa
                   Beaver  ctgctg------------------------ggagaa
B D              Squirrel  tggttg------------------------gaagaa
B D            Guinea pig  tggctg------------------------gaagaa
B D                Rabbit  -ggctg------------------------gaagaa
B D                 Human  ---cgg------------------------ctagaa
B D                 Chimp  ---cgg------------------------ctagaa
B D                Bonobo  ---cgg------------------------ctagaa
B D               Gorilla  ---cgg------------------------ctagaa
B D                Rhesus  ---cgg------------------------ctagaa
B D              Marmoset  -------------------------------cagaa
B D               Tarsier  ---tgg------------------------ctggaa
B D              Bushbaby  -------------------------------gagaa
B D  Malayan flying lemur  ---cgg------------------------ctggaa
B D                   Pig  tgactg------------------------gaaaaa
B D               Dolphin  cgactg------------------------gaagaa
B D                   Cow  cgactg------------------------gaagaa
B D                 Sheep  cgactg------------------------gaagaa
B D                 Horse  cggctg------------------------gaagaa
B D      Chinese pangolin  tggctg------------------------gaagaa
B D                   Dog  aggctg------------------------gaagaa
B D    Hawaiian monk seal  aggctg------------------------gaagaa
B D              Hedgehog  aggctgtgctttgcaaaccagctctggatccttgca
B D                 Shrew  aggtctagttcgccgcacccgctctcagctgaagca
B D                  Pika  ====================================
B D             Zebrafish  ====================================
B D         X. tropicalis  ====================================
B D               Opossum  ====================================
B D               Chicken  ====================================
B D              Elephant  ------------------------------------

Inserts between block 25 and 26 in window
B D              Tarsier 46bp
B D Malayan flying lemur 1bp

Alignment block 26 of 340 in window, 56738966 - 56738970, 5 bps 
B D                 Mouse  ctcac
B D                   Rat  ctcac
            GCF_003668045  ctcac
                   Beaver  ctaac
B D              Squirrel  atcac
B D            Guinea pig  gtcgc
B D                Rabbit  gtcgc
B D                 Human  gtcaa
B D                 Chimp  gtcaa
B D                Bonobo  gtcaa
B D               Gorilla  gtcaa
B D                Rhesus  gtcaa
B D              Marmoset  gtcaa
B D              Bushbaby  gtcat
B D  Malayan flying lemur  -tcac
B D                   Pig  gtaac
B D               Dolphin  ggaa-
B D                   Cow  gtaac
B D                 Sheep  gtaac
B D                 Horse  gtcac
B D      Chinese pangolin  gtcac
B D                   Dog  gtcac
B D    Hawaiian monk seal  gtcac
B D              Hedgehog  actgc
B D                 Shrew  gtcgc
B D              Elephant  ctca-
B D                Tenrec  NNNNN
B D               Tarsier  =====
B D                  Pika  =====
B D             Zebrafish  =====
B D         X. tropicalis  =====
B D               Opossum  =====
B D               Chicken  =====

Inserts between block 26 and 27 in window
B D                  Dog 78bp
B D             Hedgehog 4bp
B D                Shrew 3bp

Alignment block 27 of 340 in window, 56738971 - 56738974, 4 bps 
B D                 Mouse  agta
B D                   Rat  agtg
            GCF_003668045  tg-a
                   Beaver  tgta
B D              Squirrel  tgta
B D            Guinea pig  tata
B D                 Human  tgca
B D                 Chimp  tgca
B D                Bonobo  tgca
B D               Gorilla  tgca
B D                Rhesus  tgca
B D              Marmoset  tgca
B D              Bushbaby  tgta
B D  Malayan flying lemur  tgta
B D                   Pig  tgtc
B D                   Cow  tgtg
B D                 Sheep  tgtg
B D                 Horse  tgtg
B D      Chinese pangolin  tgtg
B D    Hawaiian monk seal  tgtg
B D              Hedgehog  -act
B D                 Shrew  -gct
B D                   Dog  ====
B D                Tenrec  NNNN
B D               Tarsier  ====
B D                  Pika  ====
B D             Zebrafish  ====
B D         X. tropicalis  ====
B D               Opossum  ====
B D               Chicken  ====
B D              Elephant  ----
B D                Rabbit  ----
B D               Dolphin  ----

Inserts between block 27 and 28 in window
B D             Hedgehog 1bp
B D                Shrew 4bp

Alignment block 28 of 340 in window, 56738975 - 56738976, 2 bps 
B D                 Mouse  ct
B D                   Rat  ct
            GCF_003668045  ct
                   Beaver  ct
B D              Squirrel  ct
B D            Guinea pig  cg
B D                 Human  ct
B D                 Chimp  ct
B D                Bonobo  ct
B D               Gorilla  ct
B D                Rhesus  ct
B D              Marmoset  ct
B D              Bushbaby  ct
B D  Malayan flying lemur  ct
B D                   Pig  ct
B D               Dolphin  ct
B D                 Horse  ct
B D      Chinese pangolin  ct
B D    Hawaiian monk seal  ct
B D              Hedgehog  ct
B D                 Sheep  --
B D                   Dog  ==
B D                Tenrec  NN
B D               Tarsier  ==
B D                  Pika  ==
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D                   Cow  --
B D               Opossum  ==
B D               Chicken  ==
B D                 Shrew  ==
B D              Elephant  --
B D                Rabbit  --

Inserts between block 28 and 29 in window
                  Beaver 1bp
B D             Squirrel 67bp
B D           Guinea pig 67bp
B D             Bushbaby 74bp
B D                  Pig 152bp
B D                Horse 3bp
B D     Chinese pangolin 3bp
B D   Hawaiian monk seal 26bp
B D             Hedgehog 431bp

Alignment block 29 of 340 in window, 56738977 - 56738977, 1 bps 
B D                 Mouse  g
B D                 Human  a
B D                 Chimp  a
B D                Bonobo  a
B D               Gorilla  a
B D                Rhesus  g
B D              Marmoset  g
B D               Dolphin  g
B D            Guinea pig  =
B D                 Sheep  -
B D    Hawaiian monk seal  =
B D                   Dog  =
B D                 Horse  =
B D                Tenrec  N
B D               Tarsier  =
B D              Hedgehog  =
B D                  Pika  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  -
B D               Opossum  =
B D               Chicken  =
B D                 Shrew  =
B D              Elephant  -
B D              Squirrel  =
B D                   Pig  =
B D                Rabbit  -
B D      Chinese pangolin  =
B D              Bushbaby  =
                  Beaver  =
B D  Malayan flying lemur  -
           GCF_003668045  -
B D                   Rat  -

Inserts between block 29 and 30 in window
B D                Human 1bp
B D                Chimp 1bp
B D               Bonobo 1bp
B D              Gorilla 1bp
B D               Rhesus 35bp
B D             Marmoset 1bp

Alignment block 30 of 340 in window, 56738978 - 56739054, 77 bps 
B D                 Mouse  gtttttgtgtgtctttctttcttttctttctttctttctttctttctttctttctttctttctttctttc
B D               Dolphin  ----------------------------------------------------------------------
B D              Elephant  ------gagtgcatttcgttc-------------------------------------------------
B D            Guinea pig  ======================================================================
B D                 Sheep  ----------------------------------------------------------------------
B D                Rhesus  ======================================================================
B D    Hawaiian monk seal  ======================================================================
B D                   Dog  ======================================================================
B D                 Horse  ======================================================================
B D              Marmoset  ======================================================================
B D               Gorilla  ======================================================================
B D                Bonobo  ======================================================================
B D                 Chimp  ======================================================================
B D                 Human  ======================================================================
B D               Tarsier  ======================================================================
B D              Hedgehog  ======================================================================
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D                   Cow  ----------------------------------------------------------------------
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D                 Shrew  ======================================================================
B D              Squirrel  ======================================================================
B D                   Pig  ======================================================================
B D                Rabbit  ----------------------------------------------------------------------
B D      Chinese pangolin  ======================================================================
B D              Bushbaby  ======================================================================
                  Beaver  ======================================================================
B D  Malayan flying lemur  ----------------------------------------------------------------------
           GCF_003668045  ----------------------------------------------------------------------
B D                   Rat  ----------------------------------------------------------------------

                    Mouse  tttcttt-------
                  Dolphin  -tgctct-------
                 Elephant  -tgctctgaaaacc
               Guinea pig  ==============
                    Sheep  --------------
                   Rhesus  ==============
       Hawaiian monk seal  ==============
                      Dog  ==============
                    Horse  ==============
                 Marmoset  ==============
                  Gorilla  ==============
                   Bonobo  ==============
                    Chimp  ==============
                    Human  ==============
                   Tenrec  NNNNNNNNNNNNNN
                  Tarsier  ==============
                 Hedgehog  ==============
                     Pika  ==============
                Zebrafish  ==============
            X. tropicalis  ==============
                      Cow  --------------
                  Opossum  ==============
                  Chicken  ==============
                    Shrew  ==============
                 Squirrel  ==============
                      Pig  ==============
                   Rabbit  --------------
         Chinese pangolin  ==============
                 Bushbaby  ==============
                   Beaver  ==============
     Malayan flying lemur  --------------
            GCF_003668045  --------------
                      Rat  --------------

Inserts between block 30 and 31 in window
B D              Dolphin 8bp

Alignment block 31 of 340 in window, 56739055 - 56739072, 18 bps 
B D                 Mouse  ctttctttctttccttct
B D    Hawaiian monk seal  cctgcctcctcaccttc-
B D            Guinea pig  ==================
B D                 Sheep  ------------------
B D                Rhesus  ==================
B D                   Dog  ==================
B D                 Horse  ==================
B D              Marmoset  ==================
B D               Gorilla  ==================
B D                Bonobo  ==================
B D                 Chimp  ==================
B D                 Human  ==================
B D                Tenrec  NNNNNNNNNNNNNNNNNN
B D               Tarsier  ==================
B D              Hedgehog  ==================
B D                  Pika  ==================
B D             Zebrafish  ==================
B D         X. tropicalis  ==================
B D                   Cow  ------------------
B D               Opossum  ==================
B D               Chicken  ==================
B D                 Shrew  ==================
B D              Elephant  ------------------
B D              Squirrel  ==================
B D                   Pig  ==================
B D                Rabbit  ------------------
B D      Chinese pangolin  ==================
B D               Dolphin  ==================
B D              Bushbaby  ==================
                  Beaver  ==================
B D  Malayan flying lemur  ------------------
           GCF_003668045  ------------------
B D                   Rat  ------------------

Alignment block 32 of 340 in window, 56739073 - 56739075, 3 bps 
B D                 Mouse  ttc
B D                Rabbit  -tc
B D            Guinea pig  ===
B D                 Sheep  ---
B D                Rhesus  ===
B D    Hawaiian monk seal  ---
B D                   Dog  ===
B D                 Horse  ===
B D              Marmoset  ===
B D               Gorilla  ===
B D                Bonobo  ===
B D                 Chimp  ===
B D                 Human  ===
B D                Tenrec  NNN
B D               Tarsier  ===
B D              Hedgehog  ===
B D                  Pika  ===
B D             Zebrafish  ===
B D         X. tropicalis  ===
B D                   Cow  ---
B D               Opossum  ===
B D               Chicken  ===
B D                 Shrew  ===
B D              Elephant  ---
B D              Squirrel  ===
B D                   Pig  ===
B D      Chinese pangolin  ===
B D               Dolphin  ===
B D              Bushbaby  ===
                  Beaver  ===
B D  Malayan flying lemur  ---
           GCF_003668045  ---
B D                   Rat  ---

Alignment block 33 of 340 in window, 56739076 - 56739077, 2 bps 
B D                 Mouse  tt
B D                   Rat  -c
            GCF_003668045  -c
B D                Rabbit  ac
B D            Guinea pig  ==
B D                 Sheep  --
B D                Rhesus  ==
B D    Hawaiian monk seal  --
B D                   Dog  ==
B D                 Horse  ==
B D              Marmoset  ==
B D               Gorilla  ==
B D                Bonobo  ==
B D                 Chimp  ==
B D                 Human  ==
B D                Tenrec  NN
B D               Tarsier  ==
B D              Hedgehog  ==
B D                  Pika  ==
B D             Zebrafish  ==
B D         X. tropicalis  ==
B D                   Cow  --
B D               Opossum  ==
B D               Chicken  ==
B D                 Shrew  ==
B D              Elephant  --
B D              Squirrel  ==
B D                   Pig  ==
B D      Chinese pangolin  ==
B D               Dolphin  ==
B D              Bushbaby  ==
                  Beaver  ==
B D  Malayan flying lemur  --

Inserts between block 33 and 34 in window
B D               Rabbit 2bp

Alignment block 34 of 340 in window, 56739078 - 56739078, 1 bps 
B D                 Mouse  t
B D                   Rat  t
            GCF_003668045  t
                   Beaver  t
B D                Rabbit  t
B D  Malayan flying lemur  c
B D                   Cow  t
B D                 Sheep  t
B D            Guinea pig  =
B D                Rhesus  =
B D    Hawaiian monk seal  -
B D                   Dog  =
B D                 Horse  =
B D              Marmoset  =
B D               Gorilla  =
B D                Bonobo  =
B D                 Chimp  =
B D                 Human  =
B D                Tenrec  N
B D               Tarsier  =
B D              Hedgehog  =
B D                  Pika  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D               Opossum  =
B D               Chicken  =
B D                 Shrew  =
B D              Elephant  -
B D              Squirrel  =
B D                   Pig  =
B D      Chinese pangolin  =
B D               Dolphin  =
B D              Bushbaby  =

Inserts between block 34 and 35 in window
B D Malayan flying lemur 1bp
B D                  Cow 4bp
B D                Sheep 4bp

Alignment block 35 of 340 in window, 56739079 - 56739079, 1 bps 
B D                 Mouse  t
B D                   Rat  g
            GCF_003668045  g
                   Beaver  g
B D                Rabbit  g
B D                 Human  g
B D                 Chimp  g
B D                Bonobo  g
B D               Gorilla  g
B D              Marmoset  g
B D  Malayan flying lemur  g
B D            Guinea pig  =
B D                 Sheep  =
B D                Rhesus  =
B D    Hawaiian monk seal  -
B D                   Dog  =
B D                 Horse  =
B D                Tenrec  N
B D               Tarsier  =
B D              Hedgehog  =
B D                  Pika  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  =
B D               Opossum  =
B D               Chicken  =
B D                 Shrew  =
B D              Elephant  -
B D              Squirrel  =
B D                   Pig  =
B D      Chinese pangolin  =
B D               Dolphin  =
B D              Bushbaby  =

Alignment block 36 of 340 in window, 56739080 - 56739096, 17 bps 
B D                 Mouse  tcttatccatgtccagg
B D                   Rat  acaaatccacatgcggg
            GCF_003668045  aaat-ttcatgtccagg
                   Beaver  aaaa-tccctatccggg
B D                Rabbit  aaaa-cccctgtccggg
B D                 Human  aaaa-tcccagtcccgg
B D                 Chimp  aaaa-tcccagtcccgg
B D                Bonobo  aaaa-tcccagtcccgg
B D               Gorilla  aaaa-tcccagtcccgg
B D              Marmoset  aaaa-tcccagtcccgg
B D  Malayan flying lemur  aaaa-cccctgtcctgg
B D               Dolphin  ----------gtccggg
B D                   Cow  aaaa---cccatccccg
B D                 Sheep  aaaa---cccatccccg
B D                 Horse  aaaa---ctcggcccgg
B D      Chinese pangolin  gaaa---cccgttccgg
B D                 Shrew  caaa---ccggtcccgg
B D              Elephant  ------ccttgtcctgg
B D            Guinea pig  =================
B D                Rhesus  =================
B D    Hawaiian monk seal  -----------------
B D                   Dog  =================
B D                Tenrec  NNNNNNNNNNNNNNNNN
B D               Tarsier  =================
B D              Hedgehog  =================
B D                  Pika  =================
B D             Zebrafish  =================
B D         X. tropicalis  =================
B D               Opossum  =================
B D               Chicken  =================
B D              Squirrel  =================
B D                   Pig  =================
B D              Bushbaby  =================

Inserts between block 36 and 37 in window
B D               Rabbit 4bp

Alignment block 37 of 340 in window, 56739097 - 56739097, 1 bps 
B D                 Mouse  a
B D                   Rat  a
            GCF_003668045  a
                   Beaver  a
B D                 Human  a
B D                 Chimp  a
B D                Bonobo  a
B D               Gorilla  a
B D              Marmoset  a
B D               Tarsier  g
B D  Malayan flying lemur  a
B D               Dolphin  a
B D                   Cow  a
B D                 Sheep  a
B D                 Horse  a
B D      Chinese pangolin  a
B D                 Shrew  a
B D              Elephant  a
B D            Guinea pig  =
B D                Rhesus  =
B D    Hawaiian monk seal  -
B D                   Dog  =
B D                Tenrec  N
B D              Hedgehog  =
B D                  Pika  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D               Opossum  =
B D               Chicken  =
B D              Squirrel  =
B D                   Pig  =
B D                Rabbit  =
B D              Bushbaby  =

Alignment block 38 of 340 in window, 56739098 - 56739137, 40 bps 
B D                 Mouse  gctgtcctggaca-ctggctgc-----------ttcccaaggagcttcg-----------gta
B D                   Rat  gctgtcctggaca-ctggctgc-----------atcccaaggagcttca-----------gca
            GCF_003668045  g-----ctcgatt-ctggttgc-ctc-tctgtactcccaatgttcctca-----------gcg
                   Beaver  g----ctctgact-caggcggc-ccc-ttgt--gcttcgaaactcttca-----------g--
B D                Rabbit  -------agcact-ctggcttg-ccc-gtaa--ttcccgcaactcccctacggtccagaggcg
B D                  Pika  -------agccct-ccgggttgcccc-ctga--ttccccaaagtccccc-----------tcg
B D                 Human  ----cctcggact-ctggctgt-ctt-acaa--tccctgcaactcctcc-----------gag
B D                 Chimp  ----cctcggact-ctggctgt-ctt-acaa--tccctgcaactcctcc-----------gag
B D                Bonobo  ----cctcggact-ctggctgt-ctt-acaa--tccctgcaactcctcc-----------gag
B D               Gorilla  ----cctcggact-ctggctgt-ctt-acaa--tccctgcaactcctcc-----------gag
B D                Rhesus  ---------------------------gcaa--tccctgaaactcctcc-----------gag
B D              Marmoset  -----ctcggact-ctggctgt-ctt-gcaa--tccccgcaactcctct-----------gag
B D               Tarsier  -----------------gctgc-ctt-gcaa--tccctgcaactcccca-----------gag
B D  Malayan flying lemur  ----gctcggact-ctggctgc-cctagcga--tctccgcaactcccac-----------gag
B D               Dolphin  ----gctcagact-ctggctgc--tt-tcga--tccccggaa---------------------
B D                   Cow  ----gctcagact-ctggctgc--tt-tcga--tccccgaaa---------------------
B D                 Sheep  ----gctcagact-ctggctgc--tt-tcga--cccccgaaa---------------------
B D                 Horse  ----gctcaggct-cgggctgc---t-ccga--tcctcggaa---------------------
B D      Chinese pangolin  ----gctcaggctcctagctgc---t-ctcc--attcctgga---------------------
B D    Hawaiian monk seal  -----------------------------------cctggag---------------------
B D                 Shrew  ----gctccgact-cggcct-----c-caga--tccccggag---------------------
B D              Elephant  ----tctcggact-ctggctgc-ctc-cgga--gcccagaaactcct----------------
B D            Guinea pig  ===============================================================
B D                   Dog  ===============================================================
B D              Hedgehog  ===============================================================
B D             Zebrafish  ===============================================================
B D         X. tropicalis  ===============================================================
B D               Opossum  ===============================================================
B D               Chicken  ===============================================================
B D              Squirrel  ===============================================================
B D                   Pig  ===============================================================
B D              Bushbaby  ===============================================================

Inserts between block 38 and 39 in window
B D                Human 12bp
B D                Chimp 12bp
B D               Bonobo 12bp
B D              Gorilla 12bp
B D               Rhesus 12bp
B D             Marmoset 12bp
B D              Tarsier 12bp
B D Malayan flying lemur 12bp
B D              Dolphin 22bp
B D                  Cow 23bp
B D                Sheep 23bp
B D                Horse 22bp
B D     Chinese pangolin 22bp
B D   Hawaiian monk seal 22bp
B D                Shrew 19bp

Alignment block 39 of 340 in window, 56739138 - 56739138, 1 bps 
B D                 Mouse  g
B D                   Rat  a
            GCF_003668045  g
                   Beaver  g
B D            Guinea pig  a
B D                Rabbit  g
B D                  Pika  g
B D                 Human  g
B D                 Chimp  g
B D                Bonobo  g
B D               Gorilla  g
B D                Rhesus  g
B D              Marmoset  g
B D               Tarsier  g
B D              Bushbaby  g
B D  Malayan flying lemur  t
B D               Dolphin  g
B D                   Cow  g
B D                 Sheep  g
B D                 Horse  g
B D      Chinese pangolin  g
B D                   Dog  g
B D    Hawaiian monk seal  g
B D                 Shrew  g
B D                Tenrec  N
B D              Hedgehog  =
B D             Zebrafish  =
B D         X. tropicalis  =
B D               Opossum  =
B D               Chicken  =
B D              Elephant  -
B D              Squirrel  =
B D                   Pig  =

Alignment block 40 of 340 in window, 56739139 - 56739189, 51 bps 
B D                 Mouse  ------ggcatagtgac-----------ct------ggaccttgctt----------gacccagtatgct
B D                   Rat  ------ggtgtagtggc-----------ct------gggccttactt----------gaccctgtatact
            GCF_003668045  ------ggcatagtgg-------------------------------------------cccagtctgct
                   Beaver  ------ggtctaggggcgggcacatcatca------gggcctcactg--------gagatccagtctgtt
B D              Squirrel  ------ggcgccgtcc------------tc------tggctttgctg--------ggaatccagtctctt
B D            Guinea pig  ------gacacagtcac-----------ct------gggtcttatgt--------agggtccggtgcatc
B D                Rabbit  ------gccaccgtctc-----------ct------gggcctcgctc---------cggtgcaatctgtt
B D                  Pika  ------gacctcgttag-----------ct------aga------------------ggcccaaaccgat
B D                 Human  ------ggcaccgtcgc-----------ct------gggcctcgcttggggggg-gggggtc---ctgtc
B D                 Chimp  ------ggcaccgtcgc-----------ct------gggcctcgcttgggggggtgggggtc---ctgtc
B D                Bonobo  ------ggcaccgtcgc-----------ct------gggcctcgcttgggggggtgggggtc---ctgtc
B D               Gorilla  ------ggcaccgtcgc-----------ct------gggcctcgcttgggggg--gggggtc---ctgtc
B D                Rhesus  ------ggcaccatcgc-----------ct------ggacctcccttg-------ggggatc---gtgtc
B D              Marmoset  ------ggcaccatcgc-----------ct------gggcctcgcct--------gggggtc---ctgtc
B D               Tarsier  ------agcaccgtcgc-----------ct------gggtctcgctc--------gaggtcccatctgtt
B D              Bushbaby  ------ggcattgtctc-----------tt------gggt-------------------------ctgtt
B D  Malayan flying lemur  ------ggcacagtcgc-----------ct------gggcctcgctc--------ggggtccggtctgtt
B D               Dolphin  ------gccgccgtcgc-----------ct------gggcctcaccc--------tgggtcctgtctttt
B D                   Cow  ------gcagtcgttgc-----------ct------gggcctcactc--------tcggtcctgtctttt
B D                 Sheep  ------gcagtagttgc-----------ct------gggcctcactc--------ttggtcctgtctttt
B D                 Horse  ------gggaccgcagc-----------ct------gggcctctccc--------ggggtcccg--tgtt
B D      Chinese pangolin  ------gccatcgtcgc-----------ct------gggcctcacca--------gagatgctgtctgtt
B D                   Dog  ------ggcaccgtcgc-----------ct------gcgcct-gccc--------ggggtcc----tgtc
B D    Hawaiian monk seal  ------ggcaccgtcgc-----------ct------gtgcct-gccc--------ggggtcc----tgtc
B D                 Shrew  ------agccccgcacc-----------tttgccgagagcctcgcca--------ggggtcctcggggtt
B D              Elephant  cagggtggtccagaggc-----------tg------acaggtcacct--------agggtgt----tgta
B D              Hedgehog  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D                   Pig  ======================================================================

                    Mouse  cctagcag----------g-g------------------------g--------------aca
                      Rat  cctagccg----------g-g------------------------g--------------aca
            GCF_003668045  tctagcgg----------g-g------------------------gtg-ggggtgggggaaca
                   Beaver  cctagcag----------g-g------------------------g--------------gca
                 Squirrel  cccagcag----------gag------------------------g--------------gca
               Guinea pig  ctcagcag----------g-g------------------------gtgcaaagtgaagcaaca
                   Rabbit  cccaacgg----------g-g------------------------a--------------gcg
                     Pika  tccaacag----------g-g------------------------a--------------gca
                    Human  cccagcag----------g-g------------------------g--------------gca
                    Chimp  cccagcag----------g-g------------------------g--------------gca
                   Bonobo  cccagcag----------g-g------------------------g--------------gca
                  Gorilla  cccagcag----------g-g------------------------g--------------gca
                   Rhesus  cccagcag----------g-g------------------------g--------------gca
                 Marmoset  cctagcag----------g-g------------------------t--------------gca
                  Tarsier  cccagcaaggaatcagttg-g------------------------g--------------aat
                 Bushbaby  cccggctg----------g-g------------------------g--------------tca
     Malayan flying lemur  cccaacag----------g-g------------------------gc-------------gca
                  Dolphin  tccgacag----------a-g----------------------gag--------------gca
                      Cow  cccgacag----------a-g----------------------g-g--------------gca
                    Sheep  cccgacag----------a-g----------------------g-g--------------gca
                    Horse  gctggcag----------g-g----------------------g-g--------------gcg
         Chinese pangolin  ctcggcag----------g-g----------------------g-g--------------gca
                      Dog  cccaggag----------g-a-----------ggggaggaggag-g--------------gca
       Hawaiian monk seal  cccaggag----------g-a------------------------g--------------gca
                    Shrew  tccggcag----------g-ggcggggggggtggggaggaggga-g--------------aca
                 Elephant  cccagcag----------g-t------------------------------------------
                 Hedgehog  ===============================================================
                Zebrafish  ===============================================================
            X. tropicalis  ===============================================================
                  Opossum  ===============================================================
                  Chicken  ===============================================================
                      Pig  ===============================================================

Alignment block 41 of 340 in window, 56739190 - 56739316, 127 bps 
B D                 Mouse  agttgcagagttcggtgcctacatact---ct-gctctaactcccgtgttca----cctcaaccgcgagt
B D                   Rat  agttgcagagttcggtgcctaagtatt---tt-gctctaactcctatgttca----ctgcaaccgcgggt
            GCF_003668045  agtt---gagttcggatcctaagtact---ctccccctaccgcctgtgttca----ctataactgcga-t
                   Beaver  a----------tcaactcc----catt---ct-ccactaccagctctgctca----ttgtaagtgcgact
B D              Squirrel  a-------------------------t---ct-tctataccagctctgctca----tcctaactgccact
B D            Guinea pig  a--------------------------------cctctaa---atctgctca----tcataactgcaaca
B D                Rabbit  agttggaggcat------------------ct-cctcctccagttccgctgg----tcttaaggacaact
B D                  Pika  agttggaggcatccactccttaatatttccct-ccttcttcagctctgcttg----tc-----accgaac
B D                 Human  agttggaggaatcagctccttaatatt---tt----ctgctagctctgcttg----tcataactgcaact
B D                 Chimp  agttggaggaatcagctccttaatatt---tt----ctgctagctctgcttg----tcataactgcaact
B D                Bonobo  agttggaggaatcagctccttaatatt---tt----ctgctagctctgcttg----tcataactgcaact
B D               Gorilla  agttggaggaatcagctccttaatatt---tt----ctgctagctctgcttg----tcataactgcaact
B D                Rhesus  agttgcaggaatcagctccttaatatt---tt----ctgctagctctgcctg----tcataactgcaact
B D              Marmoset  agttggaggaatcagctccttaatatt---tt----ctgctagctccgctagtcattcattactgcaact
B D               Tarsier  agttggaggaatcagctctttctttcc---ct----ctgccccctccgcttg----tcataacggcaact
B D              Bushbaby  atttggagaaatcagctccttaatatt---ct----ctgcccgctctgcttg----tcataactataatt
B D  Malayan flying lemur  agttggaagaatcaactccttaatatt---ct----ctgccagttctgcccg----tcgtaactgcaact
B D                   Pig  atttggaggaatctg---cttaatatt---ct-cctcggccacctctagtca----ttctaaatgcgtct
B D               Dolphin  agctggaggaatctgccccttaatatt---ct-cctcggccaactctagtct----tcctaaaagcgact
B D                   Cow  agttggaggaatctgctccttaacatt---ct-cgtcgg-caactctagtct----ccctaaaagcgcct
B D                 Sheep  agttggaggaatct-cttcttaacatt---ct-tgtcgg-caactctagtct----ccctgaaagcgcct
B D                 Horse  agttggaggaatctgcttcttaatagt---ct-cctttgccaactctgctct----tcaaaaccgccatt
B D      Chinese pangolin  agctggaagaatctgctccttactagt---ct-cctctgcaaactatgctct----tcacaaaagcaaat
B D                   Dog  agttggaagaaactgccccttaa---t---ct-tctccgccaactctgccct----tcataaatgcaact
B D    Hawaiian monk seal  agttgttagaatctgccccttaatgtt---ct-tctctgccaactctgctct----ccataaatgcaacc
B D                 Shrew  cattcgaagcctctgcgccttaaaaag---cc-cctctgccaactctgctct----tcctcagtgcaacc
B D              Elephant  ---tggaagaatcggatcaatactatt---ct-cctctgccagctctgctcg----tcagaactggtact
B D              Hedgehog  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  agaa--------------------------------------aaa---gagacccttc---------cat
                      Rat  agaa--------------------------------------aaaa-agagacccttc---------cat
            GCF_003668045  aggg--------------------------------------aaa---gactccctcc---------cat
                   Beaver  gaaaactctcccgcgcgcgcgcgcacacacacacacacacacaca---cacacacaca---------cac
                 Squirrel  gaga--------------------------------------acag-gaggactcttc------------
               Guinea pig  gaga--------------------------------------aca----ggacacaca---------cac
                   Rabbit  ggga--------------------------------------atag-gaggacccctctccca--cgcat
                     Pika  ttgt--------------------------------------ccag-gaggactcccgtacca--cgtac
                    Human  cgga--------------------------------------atag-aacaacctctctcccg--tgcat
                    Chimp  cgga--------------------------------------atag-aacaacctctctcccg--tgcat
                   Bonobo  cgga--------------------------------------atag-aacaacctctctcccg--tgcat
                  Gorilla  cgga--------------------------------------atag-aacaac--ctctccca--tgcat
                   Rhesus  cgga--------------------------------------atag-aacaacctctctcccg--cgcat
                 Marmoset  cgga--------------------------------------atag-aacagcctctctccaggacacac
                  Tarsier  ggga--------------------------------------acag-aatgacccctctctga--tacaa
                 Bushbaby  ggga--------------------------------------acagcaagaccccctctttggggggggt
     Malayan flying lemur  ggga--------------------------------------acag-aaggacccctctcggg--cgcat
                      Pig  ggga--------------------------------------acag-caagacccctcgcgcg--cgcat
                  Dolphin  ggaa--------------------------------------acag-caggacccctctcccg--cgcat
                      Cow  gaga--------------------------------------gtag-caggacccctctcccg--cgcat
                    Sheep  gaga--------------------------------------atag-caggacccctctcccg--cacat
                    Horse  ggga--------------------------------------acag-cagga-ccctctcccg--tgcat
         Chinese pangolin  gaga--------------------------------------acag-cagaacccctctccca--cgctt
                      Dog  gcga--------------------------------------acgg-caggacctctcgcgcg--cg---
       Hawaiian monk seal  ggga--------------------------------------gcaa-caggacccttctcacg--cgcac
                    Shrew  gaag--------------------------------------agaa-caaga-ccctctcccg--cgcgc
                 Elephant  gaga--------------------------------------acag-caggacccc-ctcccg--cgcac
                 Hedgehog  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tct----cgcg-cctccc------------------cctact--ttc-----------tcttccacggtc
                      Rat  tcc----cgct-cctctctct------------cgccctacc--ttc-----------ttttccgctggc
            GCF_003668045  cca----cgca-cctctgtct------------caccctacc--ttc-----------ccttctgcggcc
                   Beaver  aca----cacg-cctccccct------------cgccccact--ctg-----------gcatccgcaatc
                 Squirrel  tcc----cgcc-acatgcata------------cactttact--ctt-----------ccactcgcagta
               Guinea pig  ctt----cgc----------------------------------ctt-----------ccatctgctgtc
                   Rabbit  aca----cacg-cccccctct------------agcctttcc--ctc-----------ccctgtacagtc
                     Pika  acc----cacg--ccccctct------------tgccttgcc--ctc-----------tgctg--cagtc
                    Human  acg----cacc-cccaactct------------cgccctatc--ctc-----------ccatccacagtc
                    Chimp  acg----cacc-cccaactct------------cgccctatc--ctc-----------ccatccacagtc
                   Bonobo  acg----cacc-cccaactct------------cgccctatc--ctc-----------ccatccacagtc
                  Gorilla  acg----cacc-cccaactct------------cgccctatc--ctc-----------ccatccacagtc
                   Rhesus  acg----cacc-ccctactct------------cgccctgtc--ctc-----------ccatccgcagtc
                 Marmoset  aca----caca-cctcactct------------cgccctatc--ctc-----------ccgtccgcagtc
                  Tarsier  gcgagcacccc-tctcgctct------------cgcctctcc--ctc-----------ccatccgcagtc
                 Bushbaby  ctg---------------tct------------cgccttccc--ctc-----------ccatccacagtc
     Malayan flying lemur  gca----cacg-cccccctcg------------cgccttaccctctc-----------tcagccgcagtc
                      Pig  aca----caag---cccctctctggccatacaatagcacttc--ccc-----------------------
                  Dolphin  aca----cacg---cccctctctcgctataccaccccccgcc--ccccgccccccgtcccgtctgcagtc
                      Cow  aca----caca---cccctct------------caacccacc--ttcgcgctcccgtcccatctgcggtc
                    Sheep  aca----cacg---cccctct------------caacccacc--ctcgcgctcccgtcccatctgcggtc
                    Horse  cca----cacg--ccccccct------------cgctgtacc--ctc-----------at-----ccgcc
         Chinese pangolin  gca----catgctccctctct------------cgctttatc--ccc-----------gtatctgcagtc
                      Dog  -----------------------------------------------------------gggacgtagtc
       Hawaiian monk seal  acg----cacg--ccctctct------------cattctcgc--ccc------------cagccgcagtc
                    Shrew  acg----ccct---gctctaa------------cgctgcccc--ctc-----------gcgtgagcaatc
                 Elephant  aca----cacg-cctcccttc------------tgccatacc--ctc----------cccatccttagtg
                 Hedgehog  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -gcagtcgacct---------------------
                      Rat  -gccatcgacct---------------------
            GCF_003668045  -accatggatct---------------------
                   Beaver  -accacggacct---------------------
                 Squirrel  -atccctggcct---------------------
               Guinea pig  tttcaccagcct---------------------
                   Rabbit  -atcactgacct---------------------
                     Pika  -agcgctgacct---------------------
                    Human  -atcactgacct---------------------
                    Chimp  -atcactgacct---------------------
                   Bonobo  -atcactgacct---------------------
                  Gorilla  -atcactgacct---------------------
                   Rhesus  -atcactgacct---------------------
                 Marmoset  -atcacagacct---------------------
                  Tarsier  -atcgccgacag---------------------
                 Bushbaby  -atcattgacca---------------------
     Malayan flying lemur  -ataactgacct---------------------
                      Pig  -----ctgacct---------------------
                  Dolphin  -gtagctgacct---------------------
                      Cow  -gtcgctgacct---------------------
                    Sheep  -gtcgctgacct---------------------
                    Horse  -gtcgctgacct---------------------
         Chinese pangolin  -gccgccgatct---------------------
                      Dog  -gtagctgacct---------------------
       Hawaiian monk seal  -gtagctgacct---------------------
                    Shrew  -gttgctgacct---------------------
                 Elephant  -gtcgcagacctgcagaccccgcgaagggaacg
                 Hedgehog  =================================
                Zebrafish  =================================
            X. tropicalis  =================================
                  Opossum  =================================
                  Chicken  =================================

Inserts between block 41 and 42 in window
B D                  Pig 6bp
B D              Dolphin 6bp
B D                  Cow 6bp
B D                Sheep 6bp
B D                Horse 6bp
B D     Chinese pangolin 6bp
B D                  Dog 112bp
B D   Hawaiian monk seal 6bp
B D                Shrew 6bp

Alignment block 42 of 340 in window, 56739317 - 56739393, 77 bps 
B D                 Mouse  ccagggacac-----agacgctg------agta-ctca-------------------------------c
B D                   Rat  acacagacgc-----agacgccg------gttc-ttaa----------------------------gaat
            GCF_003668045  gcacgcgcat-----agaagctgtccttaagtg-ctgg-------------------------------c
                   Beaver  gcacataagg-----agcagctg------gcct-ccaga-------------------------cagatt
B D              Squirrel  gcgtccgc---------aagctg------acat-ccggg-------------------------caggtt
B D            Guinea pig  gcatgccctg-----ggaatctg------gtgt-cagaa-------------------------caggtt
B D                Rabbit  gcagaccccg-----agcaacaa------gcac-tcagaggagccgcagagccggacggcggtccgggtt
B D                  Pika  gcagacccgtgcagcagcagcgg------gcgc-tcgcagggaccgccgagccggccgctggccggggct
B D                 Human  gtagacccgg-----aggagcag------gctt-c-----------------cgggggtcggtccaggtt
B D                 Chimp  gtagacccgg-----aggagcag------gctt-c-----------------cgggcgtcggtccaggtt
B D                Bonobo  gtagacccgg-----aggagcag------gctt-c-----------------cgggcgtcggtccaggtt
B D               Gorilla  gtagacccgg-----aggagcag------gctt-c-----------------cgggcgtcggtccaggtt
B D                Rhesus  gtacacccgc-----aggagcag------gctt-c-----------------ctggagtcggtccaggtt
B D              Marmoset  gtagacccgg-----aggagcag------cctt-cccgcggagcagcttag-ccggcgtcggtctgggtt
B D               Tarsier  acagaccccg-----agaagcag------gctt-cccgcagagttgcccagtcgggcgttggtccaggtt
B D              Bushbaby  gcagaccctg-----ag-agcaa------gctc-cctaagaaacaactcatccgggctgacatccaggtt
B D  Malayan flying lemur  gtggaccc-g-----agaagctg------gcac-ccggcggagcagctcagctcggcgtcggtccaggtt
B D                   Pig  ------cgag-----ggaagcag------acac-ccagcgcagcggtcc---aaggcgcgagtccggttt
B D               Dolphin  ------cgcg-----ggaagcag------gcgc-ccggcggagcagccc---aggacatcgctcagcgct
B D                   Cow  ------c-cg-----ggaagcag------gcgc-gaggcggagcctccc---gggacgtcggtccgtgtt
B D                 Sheep  ------c-tg-----ggaagcgg------gggc-gaggcggagccgccc---gggacgtcggtccgggtt
B D                 Horse  ------ccc------ggaagcag------gcgc-ccggcggagggaccc---ggggcgtcggccaggacc
B D      Chinese pangolin  ------cccg-----ggaagcag------gcgt-cccacggagcagcta---ggggcgtcggtcagggtt
B D    Hawaiian monk seal  ------cccg-----ggtagcag-----------------------ccc---agggcgtcggtcagggtc
B D                 Shrew  ------cccg-----gggaggag------gggtggtcccagagtcctgc---ggagcggcgtgcagaacg
B D              Elephant  -----ccggg-----tggagcag---------c-c-----------------cagctggggatccaggtt
B D                   Dog  ======================================================================
B D              Hedgehog  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  cgagatcaagt--------ga-g-------------tgctcacacacagcctagagtgctgccttccgat
                      Rat  tgagatcaaat--------ga-ggcctctcca-ag-tgctcacactcaccctagagtgctgccttccgat
            GCF_003668045  tgaggtcaaat--------gatggcttctgga-gt-cgctca----cagcctggactgctgccttgcgat
                   Beaver  gggaatcaagg--------ga-gatttccccgtgc-ccctca----caatctgtagtgcttccttccaac
                 Squirrel  ggggatcggga--------ca-ggtctccccgagt-cccgca----caatctacagcaccccttcatgat
               Guinea pig  agggacccggc---------a-gaccttcctgtgt-cccaca----gggtctgcagc-ccgggttcctac
                   Rabbit  gggggtcgagg--------gc-ccgctcccagcct-cccgca----cagcccccagcgcccgggtccgac
                     Pika  gggggccgagggagagagtga-acgctcactgcctgagcaca----cagcctgcagcgccccagttaggc
                    Human  ggggatacagg--------ga-ggggtcctcgcgt-tccgca----caacctgtagtgcttgggtctgac
                    Chimp  ggggatacagg--------ga-ggggtcctcgcgt-tccaca----caacctgtagtgcttgggtctgac
                   Bonobo  ggggatacagg--------ga-ggggtcctcgcgt-tccaca----caacctgtagtgcttgggtctgac
                  Gorilla  ggggatacagg--------ga-ggggtccttgcgt-tccgta----caacctgtagtgcttgggtctgac
                   Rhesus  ggggatacagg--------ga-ggagtccccgcgt-tccgca----caacctgcagtgcttgggtct---
                 Marmoset  ggggattcagg--------ga-ggggtcctcgcgt-tccgca----caacctgcagtgcttgggtctgac
                  Tarsier  gaggatcgaag--------ga-gggctccccgcgt-tccgca----cagacagcagcgcctgggtctgaa
                 Bushbaby  ggggatccaga--------ga-gagctccccgcgt-cccgcc----cagcctgtggcgcttgggtctgac
     Malayan flying lemur  gggggtcgagg--------ac-cgactcccctcat-cccgta----cagcgtgcagtgcccggttctgac
                      Pig  agagagct-----------gc-gggcttcccactt-tctgta----cagcctgttgcgcccagatccgac
                  Dolphin  ggagggc------------gg-aggctccccactc-cctgca----cagcctgttgctcccgggtccgac
                      Cow  ggagagccg----------gg-ggggtccccactc-cccgca----cagcctgtggcgcctgggtc----
                    Sheep  ggagagcc-----------gg-ggggtccgcactc-cccgca----cagcctgtggcgcctgggtc----
                    Horse  gcagatccagg-------cta-gggctccccgct--cctgcg----ccgccggtagcgcccg-gtgcgac
         Chinese pangolin  ggagagctggg--------gg-cggctcatcgctc-cctgcg----tggcctgtagcactggagtccaac
       Hawaiian monk seal  acagagctggg--------ga-agagttcccctg--cctcaa----cagcctgtagcgccggggtctcac
                    Shrew  aacgcgc------------gg-------ccagctc-cttgca----cagccttgagcgcccggggccacc
                 Elephant  ggagagcgagc--------ag-agg------gcgc-cccgca----cagcctgcagcacgg---------
                      Dog  ======================================================================
                 Hedgehog  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gg
                      Rat  gg
            GCF_003668045  g-
                   Beaver  ct
                 Squirrel  ct
               Guinea pig  ct
                   Rabbit  tt
                     Pika  at
                    Human  tt
                    Chimp  tt
                   Bonobo  tt
                  Gorilla  tt
                   Rhesus  --
                 Marmoset  tt
                  Tarsier  ct
                 Bushbaby  ct
     Malayan flying lemur  ct
                      Pig  ct
                  Dolphin  ct
                      Cow  --
                    Sheep  --
                    Horse  at
         Chinese pangolin  ct
       Hawaiian monk seal  ct
                    Shrew  cg
                 Elephant  --
                      Dog  ==
                   Tenrec  NN
                 Hedgehog  ==
                Zebrafish  ==
            X. tropicalis  ==
                  Opossum  ==
                  Chicken  ==

Inserts between block 42 and 43 in window
B D                Sheep 2bp
B D                Shrew 3bp

Alignment block 43 of 340 in window, 56739394 - 56739394, 1 bps 
B D                 Mouse  c
B D                   Rat  c
                   Beaver  t
B D              Squirrel  c
B D            Guinea pig  g
B D                Rabbit  c
B D                  Pika  c
B D                 Human  c
B D                 Chimp  c
B D                Bonobo  c
B D               Gorilla  c
B D              Marmoset  c
B D               Tarsier  g
B D              Bushbaby  t
B D  Malayan flying lemur  c
B D                   Pig  t
B D               Dolphin  c
B D                 Horse  t
B D      Chinese pangolin  c
B D    Hawaiian monk seal  t
B D              Hedgehog  a
B D                 Shrew  c
B D                 Sheep  =
B D                Rhesus  -
B D                   Dog  =
B D                Tenrec  N
B D             Zebrafish  =
B D         X. tropicalis  =
B D                   Cow  -
B D               Opossum  =
B D               Chicken  =
B D              Elephant  -
           GCF_003668045  -

Inserts between block 43 and 44 in window
B D                  Pig 11bp
B D              Dolphin 11bp
B D                Horse 11bp
B D     Chinese pangolin 10bp
B D   Hawaiian monk seal 15bp
B D             Hedgehog 10bp
B D                Shrew 7bp

Alignment block 44 of 340 in window, 56739395 - 56739417, 23 bps 
B D                 Mouse  ggcggc-------gactgcccg---g-atactct
B D                   Rat  ggcagc----------tgcccg---g-atgcttc
            GCF_003668045  ------------------------------ctta
                   Beaver  ggcagc------------------------cctc
B D              Squirrel  agtagctcttgggtgctgtctgcc-a-gtctctt
B D            Guinea pig  ggtagtcctcgggtgccctcag---acatccact
B D                Rabbit  tgcagacctggattgctgtctgcc-g-gccgttc
B D                  Pika  tgcagacccgggtagcgttcttcc-a-gcccttc
B D                 Human  ggcagccctcgggtacagtctgcc-gggcta---
B D                 Chimp  ggcagccctcgggtacagtctgcc-gggcta---
B D                Bonobo  ggcagccctcgggtacagtctgcc-gggcta---
B D               Gorilla  ggcagccctcgggtacagtcagcc-gggcta---
B D                Rhesus  ----------gggtacagtctgcc-cggcta---
B D              Marmoset  agcagccctcgggtacagtctacc-gggcta---
B D               Tarsier  ggcaactctggggtgctgtctgct-gggccactt
B D              Bushbaby  ggcagccctctggtgtcttctgcc-tagccactc
B D  Malayan flying lemur  ggcagccctcgggtgcagtctgcc-gggccactc
B D                   Pig  -----------ggagccgtctgcc-aggccacac
B D               Dolphin  -----------ggcgccgtctgcc-gggtcgcgc
B D                   Cow  ---------------------------------c
B D                 Sheep  -----------ggcgcggtctgccagggccacgc
B D                 Horse  -----------ggcgccgtgtgcc-aggccgcgc
B D      Chinese pangolin  -----------ggcacggtct-cc-aggccgctc
B D                   Dog  -----------ggcgccgtccgcc-cggttgcgc
B D    Hawaiian monk seal  -----------ggcgccgtctgcc-gggctgcgc
B D              Hedgehog  -----------gaggact-------gggcaggcc
B D                 Shrew  -----------gacgccttctgta-ggtccgccc
B D              Elephant  --------------------ggtc-aggtcacgc
B D             Zebrafish  ==================================
B D         X. tropicalis  ==================================
B D               Opossum  ==================================
B D               Chicken  ==================================

Inserts between block 44 and 45 in window
B D                  Rat 4bp

Alignment block 45 of 340 in window, 56739418 - 56739533, 116 bps 
B D                 Mouse  gtgagccgccgtg-ggaagagctagattccacttcctgc---gcatct--ctcc-tcagacctcgctcgt
B D                   Rat  gtgagcaacggta-ggaagagctagattccacttcctgc---gcatct--ctcc-tcagacctcgctggt
            GCF_003668045  gcgcgaggccttg-ggaagagctagattccacttcctgc---gcgtct-----c-ccagccctcgctggt
                   Beaver  gagtg---tcatt-tgcagggcca---------ttctcc---gtatct--gtcc-tcagatcccgtt-at
B D              Squirrel  gagggcgaccttg-gaaggagctagattccccgt-ctcc---atacct--ctcc-tcagatcccgctaga
B D            Guinea pig  gagggcggccttg-gaaggcgcctgattccagcacct----------t--ctcc-gcagaccctgctagt
B D                Rabbit  gaaggcggcctcg-gaggatgatggtttcttgtccctttcctgcattt--ctcc-tcagatcccactggt
B D                  Pika  caagttggccttgttaaaataccagtttctcgtcccttctcggtatctcactcc-tcagaccccaccggt
B D                 Human  ------------------------gattcccgttgcttctccgcgtct--ctcc-gcgggccgctctagc
B D                 Chimp  ------------------------gattcccgttgcttctccgcgtct--ctcc-gccggccgctctagc
B D                Bonobo  ------------------------gattcccgttgcttctccgcgtct--ctcc-gccggccgctctagc
B D               Gorilla  ------------------------gattcccgttgcttctccgcgtct--ctcc-gccggccgctgtagc
B D                Rhesus  ------------------------gattcctgttgcttctccgcgtct--ctct-gccggccgctctagt
B D              Marmoset  ------------------------gattcctgttgcttctccgcgtct--ctcc-gccagccgctctagt
B D               Tarsier  gagggcggcttcg-gaaacagctcgattcccgttccttcttcgcgttt--ctccttccgactgctctagt
B D              Bushbaby  gagggcagcctca-aaagaagctagattcctgtttcttctccgtgtct--ctcc-tcagaccctgctaat
B D  Malayan flying lemur  gaaggcggcctcg-gaaggagctagattcctgttccat---cgcatct--ctcc-tcagacccagctagt
B D                   Pig  gagggcggcctcg-caaggagctaga----------tcctccgcatct--ctcc-tcagaccccgcgggt
B D               Dolphin  tggggcggcctca-gaaggagctagactcctgttccttctccgaacct--ctcc-tcagaccccgctgct
B D                   Cow  gggggcggcctct-gaaggagccagattccagttccttccccgcatct--cttc-ccagaccccgctggt
B D                 Sheep  gggggcggcctcg-gaaggatccagattccagttccttccccgcatct--cttc-ccagacccggctggt
B D                 Horse  gaggg-ggcctcg-gaaggagccggattcctgttctttctcggctcct--ctcc-ttggac---------
B D      Chinese pangolin  gaaggcggcctcg-gaaagcgctggactgcagttcctcctcggcctct--ctcc-tcagatcgcactaca
B D                   Dog  gagggcggcctcg-gaaagagctgga-tcctgttcctccgcgccgtct--ctcc-ttggatcccgctagc
B D    Hawaiian monk seal  gagggcggcctcg-gaaagagctagattcctgttccttctggttgtct--ctcc-tcagatcccgctagt
B D              Hedgehog  g---------------------tcgatcccagagtcttcccggtttct--ctcc-gcagacccggctagt
B D                 Shrew  g-----------------gagctcgattacggatcctgttccacgtct--ctcc-ttagaacacgccggt
B D              Elephant  gcaggaggcctcg-gaaggggctagattcttattccttcccggcatcg--cctc-tcagtccgcgctggg
B D                Tenrec  gtgcgaggcctcg-gaaggggctggattttgaacctttctccgtagct--tgcc-tctgaccgcccgggg
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  g--cccaaaggga----cttggtgcac-----t-gcaagtggcgggcccgtggcatt--gggaccac
                      Rat  g--cccaaaggga----cccggtgcac-----c-gcaagtggcaggcccgtggcact--gggaccac
            GCF_003668045  g--ccgaaaggga----cgcgatgcac-----c-acaggtggtgagcccatgacact--gggactac
                   Beaver  a--ccgggagggg----c-----gcgc-----c-acaggtgac-ggcccatgactgt--gggaccac
                 Squirrel  g--ccaggagggg----c-----gcgc-----c-acaggtgat-ggcccgtgacact--gggaccgc
               Guinea pig  g--ctgggagggg----t-----gcac-----c-acagatcacagccccctgacact---ggaccac
                   Rabbit  ---ccgggagggt----c-----gcac-----t-gcaggtgacggc----tcgcgcccctggagcac
                     Pika  ---ctgggaagaa----g-----gcgc-----c-acaggggaccacgtcgtagcactcgcaacacac
                    Human  g--ccgggaaggg----g-----gcgc-----c-gcaggtgac-tgcccgcggcact--gggacggc
                    Chimp  g--ccgggaaggg----g-----gcgc-----c-gcaggtgac-tgcccgcggcact--gggacggc
                   Bonobo  g--ccgggaaggg----g-----gcgc-----c-gcaggtgac-tgcccgcggcact--gggacggc
                  Gorilla  g--ccgggaaggg----g-----gcac-----c-gcaggtgac-tgcccgcggcact--gggacggc
                   Rhesus  g--ccgggaaggg----g-----gcgc-----c-gcaggtgac-tgcccgcggcact--gggacggc
                 Marmoset  g--cctggaaggg----g-----gcgc-----a-gcaggtgac-tgcccgcggcact--gggagggc
                  Tarsier  g--tcgggacggg----g-----acgc-----c-gcaggtgac-cgcccgcggcact--gagaccgc
                 Bushbaby  a--ttgaaggggg----g-----gagc-------gcaggtgag-cgcccgcagcact--aggaccgc
     Malayan flying lemur  g--cgggggtggggggag-----ggac-----t-gcaggtgac-cgtccgcagcact--gggaccgc
                      Pig  g--cccggagtgg----a-----gcgc-----c-gcaggtgac-tgccagtggcacc--aggaccgc
                  Dolphin  g--ccgggagggg----a-----gggcgggggc-gcaggtgac-cgcccgcagcact--gggaccgc
                      Cow  g--ccaggagggg----c-----acgc-----c-gcaggtgat-cacccgaagcact--gggaccgc
                    Sheep  g--ccaggagagg----c-----acgc-----c-gcaggtgat-cgcccgaagcact--gggaccgc
                    Horse  ---ccgggagggg----g-----gcgc-----c-gcaggtgac-cgcccgcggccct--gggaccgc
         Chinese pangolin  gagccgggaggag----g-----gcgc-----c-acaggtgat-cgccagcggcgct--gggaccgc
                      Dog  g--ccgagagggg----g-----gc-c-----c-acaggttac-tgtccgcggcacc--gcgaccgc
       Hawaiian monk seal  g--ccgagagggg----g-----gcgc-----c-acaggttac-cgtccgcggcact--gcgaccgc
                 Hedgehog  g--ccgggagggg----g-----tgcc-----tagcagatgtt-cgcctgctacact--ggggccgc
                    Shrew  g--tcagaagggg----a-----acgc-----t-gcaggtgac-ggtccgcggcaat--gggaccgc
                 Elephant  g--ccagaagggg----g-----acgc-----c-gcaggtgat-tgcccgaggcact--gggaccgc
                   Tenrec  g--ccaggagggg----a-----ccgc-----c-gcaggtgac-cgccctcggccct--gagaccgc
                Zebrafish  ===================================================================
            X. tropicalis  ===================================================================
                  Opossum  ===================================================================
                  Chicken  ===================================================================

Alignment block 46 of 340 in window, 56739534 - 56739680, 147 bps 
B D                 Mouse  tgac-agatttatgaagacttta---caagcatcgagcctgggtcgttggaggcag-ggt-tgagttcaa
B D                   Rat  tgac-agatttatgaagacttta---caagcatctagcctgggccgttggaggcag-cgt-tgagttcaa
            GCF_003668045  tgac-agatttatgaagacttta---caagcttctagcctcggtcgttgtgggcag-cgt-tgcgtg-ag
                   Beaver  tgac-ggatttatggagacttc----ccagcttttggcctgagtcttccgggatag-ggt-ggagtc---
B D              Squirrel  tgac-tgatttatggagacttta---caa-catctggcctgggtccgcgggggcag-ggc-tgagtc---
B D            Guinea pig  cgac-agatttatggagacttta---cag-catctggtctgg---------gaaag-ggt-ggagtccac
B D                Rabbit  tgac-agatttatggaggcttga---cag-catctagcctgggtccgcgg-ggcag-ggc-agactc---
B D                  Pika  tgtcaagattaatgaaggcttaa---ctg-cacctggcctgggtccgctg-ggctg------cacgc---
B D                 Human  tgac-agatttatggagacttca---cag-catctggctggggtccgcgagggcag-ggc-ggagtc---
B D                 Chimp  tgac-agatttatggagacttca---cag-catctggctggggtccgcgagggca--ggc-ggagtc---
B D                Bonobo  tgac-agatttatggagacttca---cag-catctggctggggtccgcgagggca--ggc-ggagtc---
B D               Gorilla  tgac-agatttatggagacttca---cag-catctggctggggtccgcgagggcag-ggc-ggagtc---
B D                Rhesus  tgac-agatttatggagacttca---cag-catctgactggggtccgcgagggcag-ggc-ggagtc---
B D              Marmoset  tgac-agatttatggagacttca---cag-catctggctggggtcctcgagggcag-ggc-ggagtc---
B D               Tarsier  tgac-agatttatggagacttta---cag-catctggcctaggtccgcgggggcag-ggc-ggagtc---
B D              Bushbaby  tgac-agatttatgtagacttta---cag-catctggcctgggtctgccggggcag-ggc-ggagtc---
B D            Tree shrew  tgac-agatttatggagacttta---cag-cacctggcctgagtctgtggggactg-agc-agagtc---
B D  Malayan flying lemur  tgac-agatttatggagacatta---cag-catctggcctgggtccgcgggg-cag-ggt-ggagcc---
B D                   Pig  tgac-agatttatgaaaacttta---cag-catctggcctgggcccgc-ggggcag-ggcaggagtc---
B D               Dolphin  tgac-agatttatgaagacttta---cag-catctggcctgggcccgcaggggcag-ggaaggagtc---
B D                   Cow  tgac-agatttatgaagatttta---cgg-catctggccgaggcccgcaagggcag-ggaaggagtc---
B D                 Sheep  tgac-agatttatgaagatttta---cgg-catctggccggggcccgcaagggcag-ggaaggagtc---
B D                 Horse  tgac-agatttatgaagact------tag-catctggcctgggcccgcaggggcag-ggcaggagtc---
B D      Chinese pangolin  tgac-agatttatgaagactgtacagcag-catctggcttgggcccgcaggggcag-ggcaagagtc---
B D                   Dog  tgac-aggtttatgaagacttta---caa-catctggcctgggcctgcagtgg-ag-ggcaggagcc---
B D    Hawaiian monk seal  tgac-agatttatgaagacttta---cag-catctggcctgggcccgcagtggcag-ggcaggagtc---
B D              Hedgehog  taac---acttgtaaaaactttg---ccg-tctctgtcctgggccagaaggagaga-ggcaggagct---
B D                 Shrew  tgac-agatttatgaagaattta---cag-catctggcttgggccctgtggggacaggggaggcgtc---
B D              Elephant  tgac-agatttatggagacttaa---cag-catctggcctg----------ggcag-ggctcgagtc---
B D                Tenrec  tgac-agattgatggaggctgaa---cag-catctggctgg----------ggcag-ggcgctgggc---
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  cagaggagga----g--aag---ccctg-gagataaaactcc-----g----cagcactgtgcgggccta
                      Rat  cagcagagga----g--aag---ctctg-ggtataaagctcc-----g----cagcggtgtgcgggccta
            GCF_003668045  cagaggagga----g--aag---ccctt-gagataaagctccgca-gg----cagcggtgtgagggccta
                   Beaver  cagtggagga----g--aag---agctgcggtctaaagccacgca-aa----ccccaagccgcgggcc-a
                 Squirrel  cagccgagaa----a--aag---cactgagggctaaagcttc------------cccacctgtaagcc--
               Guinea pig  cagaggagaa----g--cat---gacag-aagctaaaactccccc-ag----ccttatcc--ctggccca
                   Rabbit  caggcgagga----a--gag---agctgtgggttaaaactccccc-ag----aagcatgcccccggccca
                     Pika  tgggtggggg----c--gggggtagccgcggg--------------------------------------
                    Human  cggtcgatcc----g--a-----tgctggggtctaaagcttcccc-ag----ccacacgcc-tgggccga
                    Chimp  cggtcgatcc----g--a-----tgctggggtctaaagcttcccc-ag----ccacacgcc-tgggccaa
                   Bonobo  cggtcgatcc----g--a-----cgctggggtctaaagcttcccc-ag----ccacacgcc-tgggccaa
                  Gorilla  cggccgatcc----g--a-----tgctggggtctaaagcttcccc-ag----ccacacgcc-tgggccga
                   Rhesus  cggtcgatccggt-g--g-----tgctggggtctaaagcttcccc-ag----ccacacgcc-tgggccaa
                 Marmoset  cagccgagcc----g--g-----tggtagggattaaaacttcccc-ag----ccgcacgcc-taggccga
                  Tarsier  cagccgagga----ggag-----tgctgagg-ctgaatcttcccc------------------------a
                 Bushbaby  cagaaagcct----g----------ctgcgggctaaagtttcccc-ag----actcacgcc--ggtccca
               Tree shrew  cagcagagga----g--gt----tgcaacgggtaa-agcttcccc-ta----cagcatgtc-ccgacctc
     Malayan flying lemur  cagctgagga----g--gcg---cgctgcggaccatagct--ccc-ag----ccgcacgcc-ccagccca
                      Pig  cgaccaaaaa----g--gtg---cactgcgagct-aaaattcccc-ag----ccgcgtgcc-tgagcctg
                  Dolphin  cagccaaaga----g--gcg---caaggcaggct-aaagttcccc-ag----ccgagaccc-cgaacccg
                      Cow  cagaaaaagg----g--gcg---c-------gct--aagttcccc-ag----ccgcgcgcc-gggacccg
                    Sheep  cagccaaagg----g--gcg---c-------gct--aaggccccc-cg----c-----------------
                    Horse  ctgccagaga----g--gcg---ggcggcggctc-cagctcccgc-ag----ccgcgtgcc-cg-gcctg
         Chinese pangolin  caggcaaaga----g--acg---cgctgcgggct-aaagtttcgcgag----gcgcgtgcc-cgaaccga
                      Dog  tagcctaa-g----a--gcg---cgctgcgggct-aagttacccc-ag----ccgcgcacc-cggggcga
       Hawaiian monk seal  caacccaagg----g--gtg---cgctgcgagctaaagttccccc-ag----ccgcgtgct-cgggccga
                 Hedgehog  ccgccaaaga----g--gca---cacagagggataaagcttactc-cagcccccaccacct-ccagcgtg
                    Shrew  cagccaaaga----g--gca---ctctgtgggcgaaagtttcctt-ag--ccccattcctc-caggccca
                 Elephant  cagcggagga----a--gcg---cgctgcggactgaagctccctc-ag----ccgcgcgcc-cgggccga
                   Tenrec  cagaggcgcaggcgg--gcg---cgctgcggaccgaagctccccc--g----ccgctcgcg-caggcctg
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  gctgcccctgcatt--------tctgg---gc--------ttggc-ttccac
                      Rat  gctgcccctgcatc--------tctgg---gc--------ttggc-ttccac
            GCF_003668045  actgcccctgcatc--------tctgg---gt--------ttgac-ttccac
                   Beaver  cccaaccctggagt--------tctgg---tc--------ctgct-cctcgc
                 Squirrel  -caggcccagccgt--------cctgg---gc--------ccggctttccgc
               Guinea pig  gatgcccatggggt--------cctga---gc--------ccggcaccctgc
                   Rabbit  gccactcctggagt-------cccggg---gc--------ctggcatcccat
                     Pika  -----tcctggctc-------ccctcg---gg--------tagacat--cac
                    Human  gtcgcccccagagt-------ccccgg---cc--------cctgctcccctt
                    Chimp  gtcgcccccagagt-------ccccgg---cc--------cctgctcccctt
                   Bonobo  gtcgcccccagagt-------ccccgg---cc--------cctgctcccctt
                  Gorilla  gtcgcccccagagt-------ccccgg---cc--------cctgctcccctt
                   Rhesus  gctgcacccagagt-------ccccgg---cc--------catgctcccctc
                 Marmoset  gccgcccccggagt-------ccccgg---ct--------cctgctcccctc
                  Tarsier  gtcgcccctggagt-------cccgga---cc--------ccggtttccctt
                 Bushbaby  gctggcggtagaat-------ccc-ag---cc--------ccggctcccctc
               Tree shrew  gaagtccccggagc-------tcccaaaattc--------ccaactcccctc
     Malayan flying lemur  gccgctcctggagt-------tcccgg---cc--------ccggcttccctc
                      Pig  gcagcctcgggaatc------cccggg---cg--------ccg-ctcccc--
                  Dolphin  gccgcctctggggt-------cccggg---cc--------ccgtgtcccc--
                      Cow  gccgtctctgaagtc------cccggg---cc--------ccgactcccc--
                    Sheep  -ccgtctctggagtc------cccggg---cc--------ccgactcccc--
                    Horse  gccgcctccggag--------ccccgg---cc----------ggctgtcc--
         Chinese pangolin  gccgcctctagagt-------ctccgg---cc--------ttggcacccc--
                      Dog  gccgcccctggagt-------cccggg---cc--------ctggcttccc--
       Hawaiian monk seal  gctgaccctgcagt-------ccccgg---cc--------ctggctcccc--
                 Hedgehog  gcgccggctgagttcccaccgcacatg---ctcctgcaggctgagccc----
                    Shrew  gctgccgctggagtc------cacggg---cc--------ctgactccct--
                 Elephant  gctgcccctggagt-------ctgggg---cc--------ctggccccgcg-
                   Tenrec  gccgccccgggagtc------ctgggg---cc--------gcggctcccct-
                Zebrafish  ====================================================
            X. tropicalis  ====================================================
                  Opossum  ====================================================
                  Chicken  ====================================================

Inserts between block 46 and 47 in window
B D                  Pig 6bp
B D              Dolphin 12bp
B D                  Cow 12bp
B D                Sheep 12bp
B D                Horse 11bp
B D     Chinese pangolin 11bp
B D                  Dog 12bp
B D   Hawaiian monk seal 12bp
B D                Shrew 65bp

Alignment block 47 of 340 in window, 56739681 - 56739721, 41 bps 
B D                 Mouse  ag----------------------------------tgggctgc---cc---ggtgccaagtgtgtaga-
B D                   Rat  ag----------------------------------cgggctgc---cc---tgtgccaagtgtgtaga-
            GCF_003668045  tg----------------------------------gaggctgc---cc---agtgccaagtgtgtagg-
                   Beaver  tggcggatgtatat--------------------ccgtggccga---cc---tgtgccgagcgcgtgga-
B D              Squirrel  cagcgggtgtaccc--------------------cggggtaaga---tc---agtgccaagtgtgtgga-
B D            Guinea pig  aggctagtgtaagcaccctgcaggctagtgtacacggtacccag---cc---agtgccaagtgtgtgga-
B D                Rabbit  gg----------------------------------aggtccag---cc---agtgccaagtgtgtgcg-
B D                  Pika  gc----------------------------------aggtccag---cc---agagccaagagcctgca-
B D                 Human  gggcgggtgtacacaa--------------------ggatccgg---cc---agcgccgagtgtactgg-
B D                 Chimp  gggcgggtgtacacaa--------------------ggatccgg---cc---agcgccgagtgtactgg-
B D                Bonobo  gggcgggtgtacacaa--------------------ggatccgg---cc---agcgccgagtgtactgg-
B D               Gorilla  gggcgggtgtacacaa--------------------ggatccgg---cc---agcgccgagtgtactgg-
B D                Rhesus  gggcgggtgtacacta--------------------ggatccgg---cc---agcgccgagtgtactgg-
B D              Marmoset  gggcgggtgtacaccg--------------------ggatccgg---cc---cgcaccgagtgtacaga-
B D               Tarsier  gggctggtgtacaccg--------------------ggatcagg---cc---agttcagggtgtgcgga-
B D              Bushbaby  gggcaggtttacaccc--------------------ggatctgg---cc---agtgcggagggcacgga-
B D            Tree shrew  cagctagtgtattcag--------------------cgatgggg---tcatcagggcctagtgtgcaga-
B D  Malayan flying lemur  aggcgggtggacaccg---------------------ggtacgg---tc----------agggtgccg--
B D                   Pig  -----------------------------acacttctgtcctcg---cc---agtggctaacgcatggat
B D               Dolphin  -----------------------------acacgtctgtccccg---cc---agtgtcgagcgtacgga-
B D                   Cow  -----------------------------acaggtctgtccccg---cc---agtgtagagcgtacgga-
B D                 Sheep  -----------------------------acaggtctgtccccg---cc---agtgtcgagcgtacgga-
B D                 Horse  -----------------------------gcaaggccg-ccctg---cc---agcgcgcagcggagggg-
B D      Chinese pangolin  -----------------------------acctgtctgtccccg---cc---agtgctgagtgaacgaa-
B D                   Dog  -----------------------------atac-tctgtccctg---cc---agcgtggagcgcccgga-
B D    Hawaiian monk seal  -----------------------------acacgtctgtccccg---tc---ggtgtcgagcgtagggt-
B D              Hedgehog  --------------------------------agtcggtccctgctacc---agggtgacgctcgggggt
B D              Elephant  --------------------cgggggtgtagaggtctatcctgg---cc---agcgccgagcgagcggg-
B D                Tenrec  --------------------c-gggctggacaggcccctgccag---cc---agtgcgaagcgtcccgg-
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D                 Shrew  ======================================================================

                    Mouse  atcc------------tgg--------tgtaa
                      Rat  atcc------------tgg--------cgtaa
            GCF_003668045  atac------------tgg--------tgcag
                   Beaver  ttccccacact-----cgc--------tgtaa
                 Squirrel  ttccccccacc-----tag--------t-tag
               Guinea pig  ttcc-tcctcc-----cga--------t-tag
                   Rabbit  ataactacccctaagctgg--------catgg
                     Pika  ccaactacccctaagacgg--------tgtgc
                    Human  ttcctcccacc-----cag--------tgtag
                    Chimp  ttcctcccacc-----cag--------tgtag
                   Bonobo  ttcctcccacc-----cag--------tgtag
                  Gorilla  ttcctcccacc-----cgg--------tgtag
                   Rhesus  ttcctcccacc-----cgg--------tgcag
                 Marmoset  tccctccaacc-----ctg--------tgtag
                  Tarsier  ttcctcccacg-----cgg--------tgtag
                 Bushbaby  ttcctcccat------cgg--------tgcag
               Tree shrew  actcccccacc-----aag--------tgtag
     Malayan flying lemur  attccccaacc-----cga--------tgtag
                      Pig  ttttctccacc-----cgg--------tctag
                  Dolphin  ttctctccacc-----tcg--------tgtag
                      Cow  gtctctccacc-----cct--------tgaag
                    Sheep  gtctctccacc-----cct--------cgaag
                    Horse  --ctctctacc-----ccc--------tgtcg
         Chinese pangolin  ttctctccacc-----ccg--------tgtag
                      Dog  ttctctccacc-----ccg--------tgtag
       Hawaiian monk seal  ttctctccacc-----ccg--------tgtag
                 Hedgehog  tcctctctact-----cgc--------tgtaa
                 Elephant  -ttcccccact-----cgg--------tggag
                   Tenrec  -tctccccccg-----cggccccccattggag
                Zebrafish  ================================
            X. tropicalis  ================================
                  Opossum  ================================
                  Chicken  ================================
                    Shrew  ================================

Inserts between block 47 and 48 in window
B D               Rhesus 1bp
B D             Marmoset 1bp

Alignment block 48 of 340 in window, 56739722 - 56739724, 3 bps 
B D                 Mouse  cct--
B D                   Rat  cct--
            GCF_003668045  cct--
                   Beaver  cct--
B D              Squirrel  cct--
B D            Guinea pig  cct--
B D                Rabbit  tca--
B D                  Pika  cccct
B D                 Human  ccc--
B D                 Chimp  ccc--
B D                Bonobo  ccc--
B D               Gorilla  ccc--
B D                Rhesus  ccc--
B D              Marmoset  ccc--
B D               Tarsier  ccc--
B D              Bushbaby  ccc--
B D            Tree shrew  ccc--
B D  Malayan flying lemur  ccc--
B D                   Pig  ccc--
B D               Dolphin  ccc--
B D                   Cow  ccc--
B D                 Sheep  ccc--
B D                 Horse  ccc--
B D      Chinese pangolin  ccc--
B D                   Dog  ccc--
B D    Hawaiian monk seal  ccc--
B D              Hedgehog  ccc--
B D                 Shrew  cct--
B D              Elephant  ccc--
B D                Tenrec  tcc--
B D             Zebrafish  =====
B D         X. tropicalis  =====
B D               Opossum  =====
B D               Chicken  =====

Alignment block 49 of 340 in window, 56739725 - 56739914, 190 bps 
B D                 Mouse  cctccttcaca-ccctctggtcc-tctagcttc----cagtctcctactgagtaaatatttac-------
B D                   Rat  cctccttcaca-ccctctggccc-tccagcttc----cagtcgcctactgagtaaatatttac-------
            GCF_003668045  tctccttcacacccctctggtcc-tccagcttc----cagtctgctactaagtaaatatttac-------
                   Beaver  cctccttcaca-ccctctggccc-gccagcttt----cagtatctcactgagtaaatatttac-------
B D              Squirrel  cctccgtcaca-ctttctggcccggccagcttc----ca-tctcccattgaataaatatttac-------
B D            Guinea pig  catcgctcaca-ctctgaagtcctgctggcttc----cagtcccccactgagtaaatatttac-------
B D                Rabbit  cctccttcaca-ccctct-gcccggccagcttc----cagtttcccactgagtaaatatttac-------
B D                  Pika  cctctttcacg-ccctgtggcctgactagcttc----cggtctcccgccgagtaaatatttac-------
B D                 Human  cctccttcaca-ctctc-ggccc----ggcttc----cagtctcccactgagtaaatatttat-------
B D                 Chimp  cctccttcaca-ctctcgggccc----ggcttc----cagtctcccactgagtaaatatttat-------
B D                Bonobo  cctccttcaca-ctctcgggccc----ggcttc----cagtctcccactgagtaaatatttat-------
B D               Gorilla  cctccttcaca-ctctcgggccc----ggcttc----cagtctcccactgagtaaatatttat-------
B D                Rhesus  ccttcttcaca-ctctcgggcccggctggcttc----cagtctcccactgaataaatatttac-------
B D              Marmoset  cctccttcaca-ctcta-ggcccggctggcttc----cagtctcccactgagtaaatatttac-------
B D               Tarsier  cctccttcaga-ccctccggtccggccagcttc----cagtctcccactgagtaaatatttac-------
B D              Bushbaby  cctccttcaca-ccctctggcccggtctgtttc----cagtctcccactgagtaaatatttag-------
B D            Tree shrew  cctccttcaca-ctctctagtccaaccagcttt----cagtctcccgctgagtaaatatttac-------
B D  Malayan flying lemur  cctttttaaca-cgctctggctcggccaacttc----cagtct-ctactgagtaaatattta--------
B D                   Pig  actccttcaca-ccctccagctccatctgcttc----cagtcccctactgagtaaatatttac-------
B D               Dolphin  cctccttcaca-ccctcccaccctgccagcttc----cagtctcccactgagtaaatatttac-------
B D                   Cow  cctccttcaca-agctcgtgtccagccagcttc----cagtctcccactgagtaaatatttac-------
B D                 Sheep  cctccttcata-cgctcccgtccagccagcttc----tagtctcccactgagtaaatatttac-------
B D                 Horse  cctccttcaca-ccct-ccgcccggccagcttc----cagtctcccactgagtaaatatttac-------
B D      Chinese pangolin  cctccttcaca-gcgtccctcccggccagcttc----cagtctcccactgagtaaatatttac-------
B D                   Dog  gctccttccca-ccct-ccccc--gttagcttc----cagtctcctactgagtaaatatttac-------
B D    Hawaiian monk seal  tctccttccca-ccct-ccccc--gctagcttc----cagtctcccactgagtaaatatttac-------
B D              Hedgehog  cttcctccaca-ccctcctgcctgaccaacttccagtcagtctcccactgagtaaatatttac-------
B D                 Shrew  tcgccttcaca-ccctcc--cccggccagcttc----cagtctcccactgagtaaatatttac-------
B D              Elephant  cctccttcaca-cgct-ctgcccggccagcttc----cagtctcccactgagtaaatatttac-------
B D                Tenrec  cctcctttaca-cgcg-gggcccggccagcttc----caggcccccactgagtaaatatttac-------
B D               Opossum  cctccttcata-ttccttctctt-gaaaacttg----aagttttctgatgagtaaatatttacattgaga
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  ccagagaaggggtcgcccc--agaggaggcctt----ggagtttaga--gaa-agg-ctttt-ggtttcc
                      Rat  ccagagaaggggtcgccct--agaggaggcctt----agcgcccagg--gaa-agg-ctttt-ggtttcc
            GCF_003668045  ccagagaaggggtcgcccc--agaggaggcctt----agcgcctagggagaa-agg-ctttt-agcttc-
                   Beaver  ctagggaaggggtcgccccttggaggaggactttgacagagcctagg--gaa-agg--tttt-ggcttc-
                 Squirrel  ccagagaaggggttactcctcggagaaggcctc-gacagcgcctagg--gaa-aag-ctttt-ggcttct
               Guinea pig  ccagaaaaggggtcacccctggtaggaggctct-gatagtgctcaag--gaa-agg-ctttt-ggtttct
                   Rabbit  ccagagaaggggtcacccctcagaggagtcctc-agcagcacccaag--gag-aggattttt-ggacgcc
                     Pika  ccagagaagaggtcacccctcggaggagtcctc--gcagctccgcgg--gaa-agg-ctttg-ggattct
                    Human  ccagagagcgagtcgcccctcggaggaggcctc-gac-gcggctagg--gaa-agg-ctttttggcttct
                    Chimp  ccagagagcgagtcgcccctcggaggaggcctc-gac-gcggctagg--gaa-agg-ctttttggcttct
                   Bonobo  ccagagagtgagtcgcccctcggaggaggcctc-gac-gcggctagg--gaa-agg-ctttttggcttct
                  Gorilla  ccagagagcgagtcgcccctcggaggaggcctc-gac-gcggctagg--gaa-agg-ctttttggcttct
                   Rhesus  ccagagagcgggtcgcccctcggaggaggcctc-gac-gcgactagg--aaa-agg-ctttttggcttct
                 Marmoset  ccagagagccggtcgcccctcggaggaggcctc-gac-gagactagg--gaa-agg-ctttttggcttct
                  Tarsier  ccagagagcgggtcgcccctcggaggaggcctc-aacagcctctagg--gaa-agg-cttttgggcttct
                 Bushbaby  tcagagagcgggtcgccccaccgaggaggcctt-gacagcgcctagg--ggatagg-ctttttggcttct
               Tree shrew  ccaaagaacgggttgcccacc---ataggcctc-gaatgcgcctagg--gaa-agg-ctttt-ggcttct
     Malayan flying lemur  ccaaagcacgggtcgctcctccgaggaggcctc-gacagcgtctacg--gaa-agg-ctttt-ggcttct
                      Pig  ccagggaatgggtccctcctcagaggaggccca-gacagcaccctaa--gaa-ggg-ctttt-gacttct
                  Dolphin  ccggagaacgggtcgctcctcagaggaggccta-gacagcgccctgg--gaa-ggg-ctttt-ggcttct
                      Cow  ccggaggacgggtcgctcctccgagaa---cta-gacagagcccttg--gaa-ggg-ctttt-ggcttct
                    Sheep  ccggaggac-ggtcgctcctctgagaa---cta-gacagcgccctgg--gaa-ggg-ctttt-ggcttct
                    Horse  ccagagaacgggtcgcccctcggaggaggcctc-gacagcgtcc-gg--gaa-ggg-ctttt-ggcttct
         Chinese pangolin  ccagagaacgggtcgcccctcagaggaggcctt-gacagcgccctgt--gaa-ggg-ttttc-ggctttt
                      Dog  cctgagagagggtagccccttggaggaggcctc-gacagcaccctgg--gaa--gg-ctttt-gacttct
       Hawaiian monk seal  ccagagaacgggtagcctcttggaggaggcctc-gacagcaccctgg--gaa-ggg-ctttg-ggcttct
                 Hedgehog  ccagagaactggtcgacccttagtggaagcctcggacagtgcccagg--gaa-gaa-ctttc-agcttct
                    Shrew  ccagggaacaggtcgcccctctgaggaggtctc-caccgcgccctgg--gaa-gga-ctttt-ggcttct
                 Elephant  ccagagaacggttcgcccctgggaggaggcctc-gccagcgacaagg--gaa-gga-cgttt-ggctttc
                   Tenrec  ccagagaacgggtcgcccctgggaggaggcctc-gccagcgcccagg--gaa-gga-ctttt-ggcttt-
                  Opossum  actgagaacggatctcccctaaaagga-------------------a--gct-gag-gtttt-ggttttt
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================

                    Mouse  ttc---tg-----gcccgagccagctgcaggccttt----ctggttgtgttttgg--ttttggtcttaga
                      Rat  ttc---tg-----gcccgagccagctgcgggccttt----ctggttatgttttgg--tttgggtcttaag
            GCF_003668045  -tc---tg-----gcctgagccagatgcaggccttt----ctggccatgttttgg--ttttggtcttaag
                   Beaver  -tc---tg-----------ggcagctgcaggcctta----ctggttatgttttgg--ttttggtcttaaa
                 Squirrel  ccc---tg-----gctagaaccagctgcaggcctta----ctgattgtgttttgg--ttttggtcttaaa
               Guinea pig  ccc---tg-----gcctgagccagctgtaggcctta----caggttgtgttttgg--ttttagtcttaaa
                   Rabbit  ccc---caccaccaccagaagcagctgcaggcctta----ctggttgtgttttgg-tttttggtcttaaa
                     Pika  ctg---agaggccatt---agcagctgcaggcctta----ttgggtatgtgtgggttttttggtctttaa
                    Human  ccc---tg-----gcctgagccagctgcaggcctta----ctg---gtgttttgg--ttttggtcttaaa
                    Chimp  ccc---tg-----gcctgagccagctgcaggcctta----ctggttgtgttttgg--ttttggtcttaaa
                   Bonobo  ccc---tg-----gcctgagccagctgcaggcctta----ctggttgtgttttgg--ttttggtcttaaa
                  Gorilla  ccc---tg-----gcctgagccagctgcgggcctta----ctgattgtgttttgg--ttttggtcttaaa
                   Rhesus  ccg---cg-----gcctgagccagctgcaggcctta----ctggttgtgttttgg--ttttggtcttaaa
                 Marmoset  ccc---cg-----gcctgagccagctgcaggcctta----ctggttgtgttttgg--ttttggtcttaaa
                  Tarsier  ccc---tg-----gcctgagccagctgcaggcctta----ctggttgtgttttgg--tttgggtcttaaa
                 Bushbaby  ccc---tg-----gcctgagccagctgcaggcctta----ctggttgtgttttgg--ttttggtcttaaa
               Tree shrew  cct---ct-----gcctttgtcagctgtaggcctta----ctggtcctgttttgg--ttttggtcttaaa
     Malayan flying lemur  ctc---cg-----gcctgagccagctgcaggcctta----ccggttgtgttttgg--tttgggtcttaaa
                      Pig  tct---gg-----gcctgtgtcaactgcaggcctta----ctggttgtgttgtgg--tttgggtcttaaa
                  Dolphin  ccc---cg-----gcctgtgtcagctgcagacctta----ctggttgtgttttgg--ttttggtcttaaa
                      Cow  tcc---cg-----gcctatgtcagctgcaggactta----cttgttgt------g--ttttggtcttaaa
                    Sheep  tcc---cg-----gcctgtgtcagctgcaggactta----c---ttgt------g--ttttggtcttaaa
                    Horse  ccc---cg-----gcctgtgtcagctgcaggcctta-----cggtcgtgttttgg--ttttggtcttaaa
         Chinese pangolin  ccc---cg-----gcctgtgtcagctgcaggccttaatggttggttgtgttttgg--ttttggtcttaaa
                      Dog  ccccctcg-----gcctgtgttagctgcaggcctta----ctggttgtgttttgg--ttttg--------
       Hawaiian monk seal  ccc---cg-----gcctgtgtcagctgcaggcctta----ctggttgtgttttgg--tttggtcttttag
                 Hedgehog  ccg---ag-----gcctgagtcagcttcaagcctta----cagacagtgttttgg--tttgtgtctggtg
                    Shrew  ccg---tg-----gcctgtgtcagctgcaggccttg----ctggctgtgttttgg--ttgtggtcttaaa
                 Elephant  tcc---cg-----gtctgagtcagctgcaggcctta----ctgattgtgttttgg--ttttgttcttaaa
                   Tenrec  tcc---tt-----gtctgagtcagctgcaggcctta----ctggttgtgttttgg--ttttgttcttaaa
                  Opossum  ctt---cc-----atttga---aactgtaag---------ggatttgtgcttttc--atttgtctttaaa
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Chicken  ======================================================================

                    Mouse  tttt--tcctttca-gtaaa---------a
                      Rat  tttc--ccctttta-gtaaa---------a
            GCF_003668045  tttc--tcctttta-gtaga---------a
                   Beaver  ttt-----ctttta-gtcca---------g
                 Squirrel  ttt----cctttta-atcga---------a
               Guinea pig  tttc--ctccctca-gccga---------a
                   Rabbit  tttc--ttcattta-gtcaa---------a
                     Pika  tgtc--t---tttg-gtttaatgtctttta
                    Human  tttc--tcctttta-gtcga---------a
                    Chimp  tttc--tcctttta-gtcga---------a
                   Bonobo  tttc--tcctttta-gtcga---------a
                  Gorilla  tttc--tcctttta-gtcga---------a
                   Rhesus  tttc--tcctttta-gtcga---------a
                 Marmoset  tttc--tcctttta-gttga---------a
                  Tarsier  tttc--tcctttta-gttga---------a
                 Bushbaby  tttc--t--tttta-gtcga---------a
               Tree shrew  tttc--ccctcct---tag-----------
     Malayan flying lemur  tttc--ctcttcta-gtaga---------a
                      Pig  ------tttcttta-gtgga---------a
                  Dolphin  ------tttcttta-gtcga---------a
                      Cow  ------tttcttta-gctga---------a
                    Sheep  ------tttcttta-gccga---------a
                    Horse  t-----ttctttta-gtcga---------a
         Chinese pangolin  t-----ttcttgta-gtcga---------a
                      Dog  ------gtctttta-gttga---------c
       Hawaiian monk seal  aagaaattccttta-gtaga---------c
                 Hedgehog  t-----ttctttca-gtgga---------a
                    Shrew  t-----ttctttta-ggcga---------a
                 Elephant  tttc--ccctttta-attga---------a
                   Tenrec  tttc--ctttttaaggtcga---------a
                  Opossum  tata--tctttgca-gtcaa---------a
                Zebrafish  ==============================
            X. tropicalis  ==============================
                  Chicken  ==============================

Inserts between block 49 and 50 in window
B D              Opossum 2729bp

Alignment block 50 of 340 in window, 56739915 - 56739994, 80 bps 
B D                 Mouse  a-ttctcctgattccccca----tgacc--tctt--ggatccagatc--tca--gtaa----cca-g-gg
B D                   Rat  a-tgctcccgattcctcta----tgacc--tctt--gagtccagat---tca--gtaa----ccc-g-gg
            GCF_003668045  a-ttctcccaattcctata----tgacc--tcct--ggatccagact--tca--gtaa----cca-g-gg
                   Beaver  a-ctcttccaagccctgtg----tgatc--tc-t--gggtccagagcgagca--gtaa----cca-gagg
B D              Squirrel  a-ttcttccgatccctgtg----tgatc--tcct--gcgtccagaaggggca--gtaa----cca-gggg
B D            Guinea pig  a-ttcttccagctcctgtg----tgatt--tcct--ggatttggaacaggca--gtaa----cta-aggg
B D                Rabbit  a-ttcttccgatccc--tg----tgatc--tcct--gggtatagagtgagca--gtaa----aca-gggg
B D                  Pika  g-ttcttccgaaccc--tg----tcagc--tcct--gggcccggagtaagca--gtaa----aca-gggg
B D                 Human  a-ttcttccgatctctttg----agatc--ttct--gagtccagagtgagcagtgtaa----cca-ggcg
B D                 Chimp  a-ttcttccgatctctttg----agatc--ttct--gagtccagagtgagcagtgtaa----cca-ggcg
B D                Bonobo  a-ttcttccgatctctttg----agatc--ttct--gagtccagagtgagcagtgtaa----cca-ggcg
B D               Gorilla  a-ttcttccgatctctttg----agatc--ttct--gagtccagagtgagcagtgtaa----cca-ggcg
B D                Rhesus  a-tttttcccatctctttg----tgatc--ttct--gggtccagagtgagca--gtaa----cca-aggg
B D              Marmoset  a-ttcttctaatctctttg----tgatc--tcct--gggtccagactggcca--gtac----cca-gggg
B D               Tarsier  a-ttcttccgattccactg----tgatc--tcct--ggatccagagtgggca--gtaa----cca-gggg
B D              Bushbaby  a-ttcttccgattcctgtg----tgacc--tcct--aagtccagagcgggca--gtaa----cct-gggg
B D            Tree shrew  ---ttttctgatccccgtg----tgatt--tcc---acgtccagagatggca--gtga----ctt-ggga
B D  Malayan flying lemur  t-ttcttccgatctctgtg----tgatc--tcct--gggtccagagcgggca--gtaa----cca-aggg
B D                   Pig  a-tacttccgatctctgtg----tgatc--tcct--gggttctgagggggca--gtaa----cca-gggg
B D               Dolphin  a-ttcttccgatctctgtg----tgatc--tccc--gggttcagagcaggca--gtaa----cca-gggg
B D                   Cow  a-ttcttccgatctctgtg----tgatc--tcct--gggttcggagggggca--gtaa----cca-gggg
B D                 Sheep  a-ttcttccgatctctgtg----tgatc--tcct--gggttcggagggggca--ttaa----cca-gagg
B D                 Horse  a-ttcttcccttctctgtg----tgatc--tccc--gggtccagaccaggca--gtaa----ccaggggg
B D      Chinese pangolin  a-ttcttccgatctctggg----tgatc--tccc--agatctagagccggca--gtaa----cca-gggg
B D                   Dog  a-tttttccgatctcagtg----taactgagtct--gggtccacagcgggca--gtaa----tcg-ggca
B D    Hawaiian monk seal  attttttccgatctctttg----taatc--ttcc--gggtccgcagcgggca--gtaa----cca-ggga
B D              Hedgehog  a-ttcttcccatctctgtg----ttctc--cctccagagttctgagcggata--gtaagtagtca-gggg
B D                 Shrew  a-ttcttcctttctccatg----tgatc--tctc--aggtccagagcgggca--gaaa----cca-gggg
B D              Elephant  a-ttcttccgacccctgagtgtatgatc--tcct--gggtccggagcgggca--gtaa----cca-cggg
B D                Tenrec  a-ttcttccgaccccggcg----tgatc--tccc-----------ccaggca--gtaa----cca-gggg
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  gccctggacctcagtgaccctt-gctcttt
                      Rat  gccctggacctcagtaaccctt-gctcttt
            GCF_003668045  tccctgaccctcagtgaccttc-tcacttt
                   Beaver  gcgctgaccccaagcgaccctt-gctcttt
                 Squirrel  gcgctgaccccaggtgaccctt-gctattt
               Guinea pig  gagctgccccttcctgactttt-actctgt
                   Rabbit  gtactgaccccagctgaccctt-gctctct
                     Pika  gtgctgaccctgcctgaccctt-gttctct
                    Human  gca--gactccagctgaccctt-gttcttg
                    Chimp  gca--gactccagctgaccctt-gttcttg
                   Bonobo  gca--gactccagctgaccctt-gttcttg
                  Gorilla  gca--gactccagctgaccctt-gttcttg
                   Rhesus  gcactgactccagctgaccctt-gttcttt
                 Marmoset  gcagtgactccagctgactctt-gtttttt
                  Tarsier  gcg----------ctgaccctc-gt-----
                 Bushbaby  gcgctgaccccagttgaccctc-gctcttt
               Tree shrew  accctgaccccatttgaccctt-gttcccc
     Malayan flying lemur  gcactgaccccagctgaccttt-gtt----
                      Pig  gcgctgacctcaactgaccctt-gcttttt
                  Dolphin  gcgctgacctcaactgaccctt-gcttttt
                      Cow  gcgctgacctcaactgaccctt-ccttttt
                    Sheep  gcgctgacctcaactgaccctt-ccttttt
                    Horse  gcgctgaccccagctgaccctt-gttcttt
         Chinese pangolin  gcgctgaccccagctgaccctt-attcttt
                      Dog  gcgctgaccccagctgccccttggctcttt
       Hawaiian monk seal  gcgctaaccccagctgccccttggctcttt
                 Hedgehog  gccttgaccccagctgaccctt-gctcttt
                    Shrew  gcactgaccccagctgaccctt-actcttt
                 Elephant  gcgctgaccccagctgaccctt-gcttttt
                   Tenrec  gcgctgcccccagctgaccctt-gctcttt
                Zebrafish  ==============================
            X. tropicalis  ==============================
                  Opossum  ==============================
                  Chicken  ==============================

Inserts between block 50 and 51 in window
B D               Rabbit 4bp
B D                 Pika 1912bp

Alignment block 51 of 340 in window, 56739995 - 56740095, 101 bps 
B D                 Mouse  cttgaagtcctgcatct--c-tatgtcca-------cta-------gggc-tcactgg------------
B D                   Rat  cttcaagttctgtatcc--c-tatgttca-------cta-------gggc-tcactgg------------
            GCF_003668045  cttgaagtcctgcatct--c-tatgccca-------gga-------aggc-tcactggt--act------
                   Beaver  cttgaactcctcttcct--c-tcctctc---------------------c-tctcctc------------
B D              Squirrel  ctccaagtcccgtatcc--c-tattctc------------------------------------------
B D            Guinea pig  ctcaaagttttacattc--c-tgtgccta-------cag-------gggt-tcactga------------
B D                Rabbit  ctcttagtcctacatcc--t-taggccca-------ccatctgtctgggt-ttactgga--ccttagtgc
B D                 Human  ttctaggtcctgcatcc--t-tacattca-------tcg-------ggac-tgaccaga--cctt-----
B D                 Chimp  ttctaagtcctgcatcc--t-tacattca-------tcg-------ggac-tgaccaga--cctt-----
B D                Bonobo  ttctaagtcctgcatcc--t-tacattca-------tcg-------ggac-tgaccaga--cctt-----
B D               Gorilla  ttctaagtcctgcatcc--t-tacattca-------tcg-------ggac-tgaccaga--cctt-----
B D                Rhesus  ctctaagtcctgcatcc--t-tacgttca-------tcg-------ggac-tgaccaga--cctt-----
B D              Marmoset  ctctaagtcctacgtcc--t-tacgccca-------ttg-------gaac-tgactata--cctg-----
B D               Tarsier  -tctaagtccttcatcc--c-tatgcccacc----ctcg-------gggc-ttactaga--cttc-----
B D              Bushbaby  ctcaaaatcttacatgc--t-tgtgccca-------cca-----ccaggc-ttactaga--cctt-----
B D            Tree shrew  cccccattccaacctc---c-taaacccaca----gttg-------gggctttactaaa--tctt-----
B D  Malayan flying lemur  cttaaagtcctgcatct--c-tacgcctacc----gtaa-------gagc-ttattgga--cctt-----
B D                   Pig  ct-------ctgaatcc--c-tacgcccactgtgggtag-------cggt-ttactggt--cctc-----
B D               Dolphin  ct-------ctgcatcc--c-tacgcccatcgtcggtcg-------aggc-ttactgtc--cctt-----
B D                   Cow  ct-------ctgcatcc--c-tacgctcaccatcagtcg-------aggc-ttattggc--cctt-----
B D                 Sheep  ct-------ctgcatcc--c-tacgctcatcatcagtcg-------aggc-ttattggc--cctt-----
B D                 Horse  cgctaagtcctgcatcc--t-tatgcccacc----gttg-------aggt-ttaccggc--cctt-----
B D      Chinese pangolin  ctccaagtcctgcatccctt-tacactcacc----gtcg-------aggc-ttattggc--cctt-----
B D                   Dog  ctccaagttctgcgtcc--c-taggcccact----gtcg-------aggc-ttactggc--cctt-----
B D    Hawaiian monk seal  ctcgaagtcctgcgtcc--c-taggcccacc----gtcg-------aggc-ttaccagc--cctt-----
B D              Hedgehog  cttgcagcccaacccac--t-agagcgctcc----ctct-------ggcc-ctcccgcccgcctt-----
B D                 Shrew  atagcagc-------------------------------------------------cttgcatt-----
B D              Elephant  --cacagacctgcacct--tattcgcccacc----gtct-------ggcc-ttgctggc--cgtc-----
B D                Tenrec  --cccagccctgcatcc--c-ttcgcccacc----gtct-------agcc-ttactgtc--ttgc-----
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  --agg--------------gc------t--------------ctcttct---------------------
                      Rat  --agg--------------gc------t--------------ctcttct---------------------
            GCF_003668045  --aag--------------tt------t--------------cttttcc---------------------
                   Beaver  --aag--------------tc------t--------------cctctgc---------------------
                 Squirrel  ---------------------------t--------------ctcttct---------------------
               Guinea pig  --atc--------------ag------t--------------ctctttc---------------------
                   Rabbit  ccagt--------------gc------t--------------cttctct---------------------
                    Human  --agt--------------gt------t--------------ctctctt---------------------
                    Chimp  --agt--------------gt------t--------------ctctctt---------------------
                   Bonobo  --agt--------------gt------t--------------ctctctt---------------------
                  Gorilla  --agt--------------gt------t--------------ctctctt---------------------
                   Rhesus  --aga--------------gt------t--------------ctctctc---------------------
                 Marmoset  --aat--------------gt------t--------------ctttctc---------------------
                  Tarsier  --agt--------------gtaccctct--------------ctctctc---------------------
                 Bushbaby  --agt--------------gc------t--------------ctctctt---------------------
               Tree shrew  --aat-------------------------------------ctctctc---------------------
     Malayan flying lemur  --agt--------------ga------g--------------cgctctc---------------------
                      Pig  --aca--------------gt------tttagtcagtttcaatctccct---------------------
                  Dolphin  --act--------------gt------t--------------tctctct---------------------
                      Cow  --act--------------gt------t--------------tctctct---------------------
                    Sheep  --act--------------gt------t--------------tctctct---------------------
                    Horse  --agt--------------gt------t--------------tctc--t---------------------
         Chinese pangolin  --aatttccaccccaccacgc------t--------------tccccat---------------------
                      Dog  --tac--------------gt------c--------------tctccct---------------------
       Hawaiian monk seal  --tag--------------gt------t--------------tctctctctccctccctcccgcctgccc
                 Hedgehog  --cct--------------ct------t--------------tccatct---------------------
                    Shrew  --tct--------------gt------g--------------cctatct---------------------
                 Elephant  --agc--------------gt------c--------------ctc-tct---------------------
                   Tenrec  --agg--------------gc------t--------------ctcttct---------------------
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -----cc----atctcctacc-------------------------------------ctcttctacc--
                      Rat  -----cc----ctcccctact-------------------------------------ctcttctacc--
            GCF_003668045  -----cc------------ct-------------------------------------ctctctggtc--
                   Beaver  -----cctcctctcctctcct-------------------------------------ctcttctctt--
                 Squirrel  -----ct------------ct-------------------------------------cccttc------
               Guinea pig  -----cc--------tgttcc-------------------------------------cccttgtgtc--
                   Rabbit  -----ag----ctcgccttct-------------------------------------ttcctccatc--
                    Human  -----tt------------cc-------------------------------------ttccttcat---
                    Chimp  -----tt------------cc-------------------------------------ttccttcat---
                   Bonobo  -----tt------------cc-------------------------------------ttccttcat---
                  Gorilla  -----tt------------cc-------------------------------------ttccttcat---
                   Rhesus  -----tt------------cc-------------------------------------ttctcccatc--
                 Marmoset  -----tt------------cc-------------------------------------ttcctctatc--
                  Tarsier  -----tt------------cc-------------------------------------ttcctccctt--
                 Bushbaby  -----t--------------c-------------------------------------ctcctccatt--
               Tree shrew  -----tt------------tc-------------------------------------tccccgtac---
     Malayan flying lemur  -----tt------------ct-------------------------------------t-----------
                      Pig  -----cc------------ct-------------------------------------tccttcctc---
                  Dolphin  -----ct------------ct-------------------------------------ccctac--c---
                      Cow  -----tt------------ct-------------------------------------c-----------
                    Sheep  -----tt------------ct-------------------------------------c-----------
                    Horse  -----ct------------c--------------------------------------------------
         Chinese pangolin  -----tt------------c--------------------------------------------------
                      Dog  -----cc------------ca-------------------------------------gttctagccctc
       Hawaiian monk seal  gcctgcc------------cg-------------------------------------cctctagccctc
                 Hedgehog  -----tt------------ctctccaatagtcttttactggggttgggagggtgtgggctacccagccac
                    Shrew  -----ta------------cc-------------------------------------ccacccggc---
                 Elephant  -----gt------------ct-------------------------------------cacccacatc--
                   Tenrec  -----gt------------tt-------------------------------------cgcc----tc--
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  -----------------------cactccttc---atttcttg--tctctc---acc
                      Rat  -----------------------catttctgc---attccttcc-tctctc---acc
            GCF_003668045  -----------------------catttgtgc---attccttcc-tct--------c
                   Beaver  -----------------------cccttctcc---tcttctcc--ttcctc---ccc
                 Squirrel  ------------------------------------ttcctaa--ttcctc---tcc
               Guinea pig  -----------------------tccatctct---gtccctccg-tttttc---cat
                   Rabbit  -----------------------cttcttgcccagattgcttt--tttttt---ttt
                    Human  -----------------------cctctttct---ctgcctcagatccgtc---gtc
                    Chimp  -----------------------cctctttct---ctgcctcagatccgtc---gtc
                   Bonobo  -----------------------cctctttct---ctgcctcagatccgtc---gtc
                  Gorilla  -----------------------cctctttct---ctgcctcagatccgtc---gtc
                   Rhesus  -----------------------cctctttct---ctccctcagatccgtc---gtc
                 Marmoset  -----------------------cctctttct---ctccctcagatccgtc---gtc
                  Tarsier  -----------------------cctctttcc---ttccctcagatctgtc----tc
                 Bushbaby  -----------------------cttcttttt---ctcccttagatctg------tc
               Tree shrew  -----------------------ctctgcccc---tctcctctgctttcaccctttt
     Malayan flying lemur  -----------------------------tcc---ttcccttagatgtctagtggtc
                      Pig  -----------------------cctccttcc---tttctccccacc----------
                  Dolphin  -----------------------ccccatccc---tccccccccacc----------
                      Cow  -----------------------------ccc---ccgccccacacc----------
                    Sheep  -----------------------------ccc---tcgccccacacc----------
                    Horse  -----------------------cctctttat---ctccttcaggtc----------
         Chinese pangolin  -----------------------cgtcattcc---ctccttcaggtc----------
                      Dog  tagt-------------------cctctttcc---cttcttctggtc----------
       Hawaiian monk seal  gagt-------------------cctctttcc---ccttttcaggtc----------
                 Hedgehog  agagctcagtctgtgaatgggagtaccaaccc---cttcct----------------
                    Shrew  -----------------------tccctcccg---ctccgt----------------
                 Elephant  -----------------------cctccagtc---agtcagctgct-----------
                   Tenrec  -----------------------cagtcagtt---cgccagcggct-----------
                     Pika  =========================================================
                Zebrafish  =========================================================
            X. tropicalis  =========================================================
                  Opossum  =========================================================
                  Chicken  =========================================================

Inserts between block 51 and 52 in window
B D                  Pig 21bp
B D                  Cow 23bp
B D                Sheep 23bp
B D                Horse 7bp
B D     Chinese pangolin 6bp
B D                  Dog 7bp
B D   Hawaiian monk seal 7bp
B D             Hedgehog 14bp
B D                Shrew 14bp

Alignment block 52 of 340 in window, 56740096 - 56740216, 121 bps 
B D                 Mouse  tcacacatctccgccctcctggtt-----------------tt---------tgct-aagactcctggga
B D                   Rat  tcacacatctccttcctcttggtt-----------------tt---------tgct-cagacttcaggga
            GCF_003668045  tctcacacctcctctctccccact-----------------tt---------tgct-aggactccagaaa
                   Beaver  tc---catcagtggtctcccccgc-----------------gc---------ggct-cgg-ctgctgg--
B D              Squirrel  tc---caggtcag-----------------------------t---------tgct-ctggctc------
B D            Guinea pig  tccc-cagatcca-----------------------------t---------tgcc-----ctcagcggg
B D                Rabbit  taactcgggatcagagtgtgctttgag----aaggc-----tt---------cact-cag----------
B D                 Human  tc----------------------------------------t---------cggt-cggtctcagcggg
B D                 Chimp  tc----------------------------------------t---------cggt-cggtctcagcggg
B D                Bonobo  tc----------------------------------------t---------cggt-cggtctcagcggg
B D               Gorilla  tc----------------------------------------t---------cggt-cggtctcagcggg
B D                Rhesus  tc----------------------------------------t---------gggt-cggtctcagcggg
B D              Marmoset  tc----------------------------------------t---------cggt-ggagctcag----
B D               Tarsier  tc----------------------------------------t---------cgct-tcggtttagcggg
B D              Bushbaby  tc----------------------------------------t---------tgct-cgggctcagcggg
B D            Tree shrew  tc----------------------------------------tctgctcgtacact-cgggctcagccca
B D  Malayan flying lemur  tc----------------------------------------t---------cgct-ccggctcaactga
B D                   Pig  gg----------------------------------------t---------cactcggttctcatcagg
B D                   Cow  gg----------------------------------------t---------cact-gtctctcgccggg
B D                 Sheep  gg----------------------------------------t---------cact-gtctttcgccggg
B D                 Horse  tc----------------------------------------t---------cgtt-ggggcttattggg
B D      Chinese pangolin  tc----------------------------------------t---------cgct-ggggctcatcagg
B D                   Dog  tc----------------------------------------t---------ctct-tgggctcttctat
B D    Hawaiian monk seal  tc----------------------------------------t---------cgct-cgggctcttcgat
B D              Hedgehog  tt----------------------------------------t---------ctatctgctcccctgaag
B D                 Shrew  tc----------------------------------------t---------ctcctgtctcttctcagg
B D              Elephant  -------------------------tgggacaaggccatctct---------cgct-cgggctcagcggg
B D                Tenrec  -------------------------tgagacaaggccatcgct---------cgcc-agggctcagcggg
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================

                    Mouse  tc-------------------------------------tgtggc--tac----------t--tgat-cc
                      Rat  tc-------------------------------------acccgc--tgc----------t--tagc-cc
            GCF_003668045  tc-------------------------------------acaggc--tcc----------a--tggc-ct
                   Beaver  ----------------------------------------ctggc--tac----------c--tcgc-cc
                 Squirrel  ------------------------------------------agc--tat----------t--tcgc-cc
               Guinea pig  tc-------------------------------------actgtc--tac----------t--tcac-cc
                   Rabbit  -c-------------------------------------accagc--acc----------t--t--c-ca
                    Human  tc-------------------------------------gctgac--tac----------c--tcgc-cc
                    Chimp  tc-------------------------------------gctgac--tac----------c--tcgc-gc
                   Bonobo  tc-------------------------------------gctgac--tac----------c--tcgc-gc
                  Gorilla  tc-------------------------------------gctgac--tac----------c--tcgc-cc
                   Rhesus  tc-------------------------------------gctgac--tac----------c--tcgc-cc
                 Marmoset  -----------------------------------------tgcc--tgc----------c--tcgc-cc
                  Tarsier  tc-------------------------------------g-tgactatac----------c--tcgc--c
                 Bushbaby  tg-------------------------------------tctgga--tgc----------c--ttgctcc
               Tree shrew  tg-------------------------------------gctggc--tac----------a--c------
     Malayan flying lemur  tc-------------------------------------gccggc--tac----------t--c-gc-cc
                      Pig  tcaccag--------------cacactggtctctgggctcctggc--tac----------c--tggc-ca
                      Cow  tc-------------------------------------tcaggc--tac----------c--tggc-ca
                    Sheep  tc-------------------------------------tcaggc--tac----------c--tggc-ca
                    Horse  tc-------------------------------------gccggc--tacctagccacggc--taga-ta
         Chinese pangolin  tc-------------------------------------gccggc--tac----------c--tggt-ca
                      Dog  tt-------------------------------------g--------------------------c-ca
       Hawaiian monk seal  tt-------------------------------------gcctgc--tac----------c--tgac-ca
                 Hedgehog  ct-ttagctagtgtacacacacacacacacacacacacacacact--cac----------c--agga-gt
                    Shrew  cc-ttag---------------------------atgcccgctgc--tac----------c--tggc-ca
                 Elephant  cc-------------------------------------gcgggc--tac----------c--tcgc-tc
                   Tenrec  cc-------------------------------------gcgggc--tcc----------aagtggc-cc
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  c-----ta-g--ggcact-gt--gtg--------------------------cccttgcttgggaagggg
                      Rat  c-----ta-g--ggtacttgt--gtg--------------------------cccttgcttgagaaggga
            GCF_003668045  c-----ca-g--gacacc-at--gtg--------------------------cc----cacgggaaggga
                   Beaver  c-----tata--gtcaat-gt--acg--------------------------ctc----------aggga
                 Squirrel  c-----taca--ctcagt-gt--gcg------------------------acccctgacccccgttcgga
               Guinea pig  c-----taca--cttggt-gt--gca--------------------------ccc----------aggga
                   Rabbit  c-----ta-a--gatatt-gtcgctg--------------------------ctc------------tgt
                    Human  t-----agca--ctcggt-cc--gcg--------------------------ccc---------cgggaa
                    Chimp  t-----agca--ctcggt-cc--gcg--------------------------ccc---------cgggaa
                   Bonobo  t-----agca--ctcggt-cc--gcg--------------------------ccc---------cgggaa
                  Gorilla  c-----agca--ctcggc-cc--gcg--------------------------ccc---------cgggaa
                   Rhesus  c-----agca--ctcggc-cc--gcg--------------------------ccc---------cgggaa
                 Marmoset  c-----agca--ctctgt-cc--gcg---------------------------cc---------tgggaa
                  Tarsier  g-----ggca--ctcaat-gt--gag--------------------------cct---------ccggaa
                 Bushbaby  t-----ggca------------------------------------------------------------
               Tree shrew  ---------------aac-gg--gcg--------------------------ccc---------tcagga
     Malayan flying lemur  c-----cgca--ctaagt-gc--gcg--------------------------ccc---------ccggga
                      Pig  c-----agca--ct--gt-gt--gca--------------------------tcc---------ccggga
                      Cow  c-----agtg--ctcagt-gt--gcg--------------------------tcc------gggcaggga
                    Sheep  c-----agtg--ctcaga-gt--gcg--------------------------tcc------gggcaggga
                    Horse  tccgggagtt--ttcagc-gt--c-acttcttcctctaggatcccgcgctctgtc---------ccttga
         Chinese pangolin  c-----agca--ctcagt-gt--g-a--------------------------gtc---------ccggga
                      Dog  t-----atca--ctcagt-gt--g-a--------------------------tcc---------cagggg
       Hawaiian monk seal  t-----agca--ctcagt-gt--gcg--------------------------gcc---------ccggga
                 Hedgehog  a-----attg--ctgatt-------a--------------------------ttc---------cctgga
                    Shrew  c-----agtg--ctga---------g--------------------------ttc--------------a
                 Elephant  c-----agca--cttgtg--t--ggc--------------------------ccc---------caggaa
                   Tenrec  c-----gggaagctttcg-ct--agc--------------------------ccc-----------gcct
                     Pika  ======================================================================
                Zebrafish  ======================================================================
            X. tropicalis  ======================================================================
                  Opossum  ======================================================================
                  Chicken  ======================================================================

                    Mouse  a------------gtttcct---ca----cagg---------cccctt-cttggag
                      Rat  a------------gtttctg---catgcgctgt---------cccttt-cttggag
            GCF_003668045  a------------gattcag---ca----ctag---------cccctt-cttggag
                   Beaver  g------------ggttcag---ta----ctaa---------ctctttcccttgag
                 Squirrel  g------------gattcag---ca----ccag---------cccttccagctaag
               Guinea pig  a------------g---------ta----ccag---------cctttcctgctgag
                   Rabbit  a------------gtttggg---ct----cctt---------ttgctc-ctaggga
                    Human  g------------gcttcag---ca----tcac---------cctcttctgctggg
                    Chimp  g------------gcttcag---ca----tcac---------cttcttctgctggg
                   Bonobo  g------------gcttcag---ca----tcac---------cttcttctgctggg
                  Gorilla  g------------gcttcag---ca----tcac---------cctcttctgcgggg
                   Rhesus  g------------gcttcag---cc----tcac---------cctcttctgctggg
                 Marmoset  g------------gcttcag---cg----tcac---------cctcttctgctggg
                  Tarsier  g------------g-tccgg---ca----tcag---------ccgcttctgctggg
                 Bushbaby  -------------gtttcag---tc----tcag---------cccctgctgttggg
               Tree shrew  g------------ggttcaa---ca----tcag---------tgccttc-ccctgg
     Malayan flying lemur  g------------ggttcag---ca----tctg---------ccgcttt-gctggg
                      Pig  g------------ggttctg---cc----ttag---------cccattctcctag-
                      Cow  ggtggcggggga-gagtctg---ca----tcag---------ccccttcatctag-
                    Sheep  ggtggggagggaggagcctg---ca----tcag---------ctccttcatctag-
                    Horse  a------------gcttcga---ct----c------------ctcttgcccccag-
         Chinese pangolin  g------------agttcag---ca----ccag---------ccccttcctctag-
                      Dog  g------------ggttcag---ca----tcag---------ccccttgctctag-
       Hawaiian monk seal  g------------ggttcag---ca----tcag---------caccttcctctag-
                 Hedgehog  g----------------------ct----ttggttcctagcctcagtttgttgag-
                    Shrew  g----------------------ca----atag---------ccactttctggag-
                 Elephant  g------------atttagg----a----ccgg---------tcccttccgttag-
                   Tenrec  g------------acctcggcagcg----ctgg---------tccttcctg-----
                     Pika  ========================================================
                Zebrafish  ========================================================
            X. tropicalis  ========================================================
                  Opossum  ========================================================
                  Chicken  ========================================================

Inserts between block 52 and 53 in window
B D                  Pig 11bp
B D                  Cow 14bp
B D                Sheep 14bp
B D                Horse 16bp
B D     Chinese pangolin 82bp
B D                  Dog 12bp
B D   Hawaiian monk seal 14bp
B D             Hedgehog 33bp
B D                Shrew 17bp

Alignment block 53 of 340 in window, 56740217 - 56740236, 20 bps 
B D                 Mouse  -------------------a----tgacat--ggctct-cctctat
B D                   Rat  -------------------a----tgacat--ggtttt-cctctat
            GCF_003668045  -------------------g----tgaaat--gtctct-cctctgt
                   Beaver  ----------------------------------ccct-tctctgc
B D              Squirrel  -------------------a----tccagc--tgccaa-tgtttgc
B D            Guinea pig  -------------------a----tttgctcaggtcct-cacctgc
B D                Rabbit  -------------------g----cgagct----------------
B D                 Human  -------------------a----tcccgc--tgaccc-tgt----
B D                 Chimp  -------------------a----tcctgc--tgaccc-tgt----
B D                Bonobo  -------------------a----tcccgc--tgaccc-tgt----
B D               Gorilla  -------------------a----tcccgc--tgaccc-tgt----
B D                Rhesus  -------------------a----tcccgc--tgacac-tgt----
B D              Marmoset  -------------------g----tctcac--tgacag-cgtctg-
B D               Tarsier  -------------------a----ccccgc--tgcccc-agt----
B D              Bushbaby  -------------------a----tccctc--tgctgc-tgtctgt
B D            Tree shrew  -------------------a----tcccgc--tgccccgcttttgc
B D  Malayan flying lemur  -------------------atccctcccgc--agtccc-cgtctgc
B D                   Pig  ------------------------tct-------------------
B D                   Cow  -------------------g----tct-------------------
B D                 Sheep  -------------------c----tct-------------------
B D                 Horse  -------------------t----gct-------------------
B D                   Dog  -------------------g----tct-------------------
B D    Hawaiian monk seal  -------------------a----tct-------------------
B D              Hedgehog  -------------------c----tcc-------------------
B D                 Shrew  -------------------c----tat-------------------
B D              Elephant  gtcaagccacttccgcctga----t---------------------
B D                Tenrec  -------cacttagtcgtga----c---------------------
B D                  Pika  ==============================================
B D             Zebrafish  ==============================================
B D         X. tropicalis  ==============================================
B D               Opossum  ==============================================
B D               Chicken  ==============================================
B D      Chinese pangolin  ==============================================

Inserts between block 53 and 54 in window
B D                  Pig 3bp
B D                  Cow 3bp
B D                Sheep 3bp
B D                Horse 3bp
B D                  Dog 3bp
B D   Hawaiian monk seal 3bp
B D             Hedgehog 5bp
B D                Shrew 89bp

Alignment block 54 of 340 in window, 56740237 - 56740293, 57 bps 
B D                 Mouse  tc--cagcatcttcgg-----tttata---------aggtctctaagcacc------g-----ggtggtc
B D                   Rat  tc--tagcatctttag-----ttccta---------aggtccctaagcagt------g-----agttgtc
            GCF_003668045  tc--ttgcatctccag-----ttcata---------aagtccttaatcaccgactttg-----gtttgtc
                   Beaver  tc--ctgcagcttcagcgcctttcttc-----------ttccttgagcgtg------g-----gcttgct
B D              Squirrel  tt--ctgtgtttctgc-----tcctga-----------gtatgtaggcttc------c-----gcttccc
B D            Guinea pig  tt--gtttggcttctg-----ttgttgtccgagtgtgagtcttctattacc------t-----gg-gata
B D                Rabbit  -----cacaagtcaga-----ttcttt-------gcaggctcttgagaata-------------------
B D                 Human  ----ctgcagcttcgg-----cttctc--------ttgctcccagagcggggtcttcg-----gcttgcc
B D                 Chimp  ----ctgcagcttcgg-----cttctc--------ttgctcccagagcggggtcttcg-----gcttgcc
B D                Bonobo  ----ctgcagcttcgg-----cttctc--------ttgctcccagagcggggtcttcg-----gcttgcc
B D               Gorilla  ----ctgcagcttcgg-----cttctc--------ttgctcctagagcggggtcttcg-----gcttgcc
B D                Rhesus  ----ctgcagcttcgg-----cttctt--------ttggtcccagatcgggggcttcg-----gcttgcc
B D              Marmoset  -ccgctgcagctttgt-----cttctc--------ttgctcccagagcggggtcctct-----gcttgcg
B D               Tarsier  ----ttgcccctgcgg-----c-------------tggctcccggagcgcaggcctctgatccgcttgct
B D              Bushbaby  ccctctgcaggttc-c-----ttccta--------ttgctcccagagcgccggcct-g-----gctggcc
B D            Tree shrew  tc--cagcagcggtgg-----ttcctc--------ttcctcccagggctcaggcctcg-----gcatgca
B D  Malayan flying lemur  cc--ctgcagcttcgg-----ctcccc--------ttgctcccagaccgcgctcctgg-----gcttgcc
B D                   Pig  cc--ctgaagctttga-----cttctc--------ttcatcccggagcccccgcttca-----aattgcc
B D                   Cow  cc--ctgaagcttcga-----ctcctc--------tagcccccggagccccggcctca-----ggttgc-
B D                 Sheep  cc--ctgaagcttcga-----ctcctc--------ttgccccc-gagccccggcgtca-----ggttgc-
B D                 Horse  cc--tag-----------------tta--------atgtccccaaacat----ccaag-----actcttc
B D                   Dog  cc--ctgaagtatcaa-----ctcctt--------ttgccacagaatctcgggcctca-----gtttacc
B D    Hawaiian monk seal  cc--ctgaagcttcga-----ctcttt--------ttgccgcccaagctcgggcctca-----gtttgcc
B D              Hedgehog  -t--ttgcagggtggg-----atgggg--------tgggtgggaa-------------------------
B D              Elephant  ct--ctgcagctttgg-----cccatc--------ctcctcccagagtcctgtcaagg------------
B D                Tenrec  ac--gggta--cttgg-----tgcctc--------aaagcaccagagat---tcaggg------------
B D                  Pika  ======================================================================
B D             Zebrafish  ======================================================================
B D         X. tropicalis  ======================================================================
B D               Opossum  ======================================================================
B D               Chicken  ======================================================================
B D                 Shrew  ======================================================================
B D      Chinese pangolin  ======================================================================

                    Mouse  atggg-cgctgaaag
                      Rat  atgag-tgctga--g
            GCF_003668045  atggg-tgctga--g
                   Beaver  gcgga-tgctta--g
                 Squirrel  tggga-tgctta--g
               Guinea pig  acagg-taatta--a
                   Rabbit  ------tgttaa---
                    Human  gcgga-tactta--g
                    Chimp  gcgga-tactta--g
                   Bonobo  gcgga-tactta--g
                  Gorilla  gcgga-tactta--g
                   Rhesus  gcgga-tactta--g
                 Marmoset  gtgga-tactta--g
                  Tarsier  gcgga-gactta--g
                 Bushbaby  gcgta-tactta--g
               Tree shrew  gcagg-tactta--g
     Malayan flying lemur  gcgga-tactta---
                      Pig  gccccatgctta--g
                      Cow  ------cgctga--g
                    Sheep  ------cgctga--g
                    Horse  gcgcg-ctcctg--g
                      Dog  acgag-ttctta--g
       Hawaiian monk seal  gcggg-ttctta--g
                 Hedgehog  ---------------
                 Elephant  ---------------
                   Tenrec  ---------------
                     Pika  ===============
                Zebrafish  ===============
            X. tropicalis  ===============
                  Opossum  ===============
                  Chicken  ===============
                    Shrew  ===============
         Chinese pangolin  ===============
                  Dolphin  NNNNNNNNNNNNNNN

Inserts between block 54 and 55 in window
B D                  Pig 17bp
B D                  Cow 6bp
B D                Sheep 6bp
B D                Horse 11bp

Alignment block 55 of 340 in window, 56740294 - 56740300, 7 bps 
B D                 Mouse  tggccca
B D                   Rat  tggtcca
            GCF_003668045  tggccca
                   Beaver  tggccca
B D              Squirrel  tggccca
B D            Guinea pig  cagccca
B D                Rabbit  --gccaa
B D                 Human  tggccca
B D                 Chimp  tggccca
B D                Bonobo  tggccca
B D               Gorilla  tggccca
B D                Rhesus  tggccca
B D              Marmoset  tggccca
B D               Tarsier  tggtcca
B D              Bushbaby  ttgtcca
B D            Tree shrew  cggtcca
B D  Malayan flying lemur  cagaccc
B D                   Pig  tgagctg
B D                   Cow  tgctccc
B D                 Sheep  tgctccg
B D      Chinese pangolin  tgtccca
B D                   Dog  tgtcccc
B D    Hawaiian monk seal  tgtcccc
B D              Hedgehog  tatct--
B D              Elephant  tgcccca
B D                Tenrec  cacattc
B D                 Horse  =======
B D                  Pika  =======
B D             Zebrafish  =======
B D         X. tropicalis  =======
B D               Opossum  =======
B D               Chicken  =======
B D                 Shrew  =======
B D               Dolphin  NNNNNNN

Alignment block 56 of 340 in window, 56740301 - 56740398, 98 bps 
B D                 Mouse  aagtgc-ccaag-----------gttgatttattctgggcct----ccaa--gaatattc----------
B D                   Rat  aattgc-ccaag-----------gttgattcattctgtgcac----ccaa--gaatattc----------
            GCF_003668045  aaacat-ccaag-----------attgattcattctgtgctt----cccc--gga-atgc----------
                   Beaver  aaacgcttctag-----------attgattcttccagggctc----ttaa--gaatgcactgagccaaga
B D              Squirrel  cagcgt-caaag-----------aatgactctttgcgcgctt----tgagctgatagcgc----------
B D            Guinea pig  gaatgc-ctacg-----------actgattcttttcttgctc----tgga--ggatgtac----------
B D                Rabbit  gagcgc-ccagc-----------atc-----------cgcaa----cagc--gcgtgtgg----------
B D                 Human  aaacac-ctaaa-----------attgactcttcctgcgctc----ttga--gaat-------gccaaga
B D                 Chimp  aaacac-ctaaa-----------attgactcttcctgcgctc----ttga--gaat-------gccaaga
B D                Bonobo  aaacac-ctaaa-----------attgactcttcctgcgctc----ttga--gaat-------gccaaga
B D               Go