Multiz Alignments of 60 Vertebrates

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 373 in window, 56741761 - 56741787, 27 bps 
B D             Mouse  tttagaataatctgaaatttgccaatg
B D               Rat  tttagaataatctgaaatttgccaatg
B D             Chimp  tctaaaataaagtgcaa-atgacaatg
B D           Gorilla  tctaaaataaagtgcaa-atgacaatg
B D            Rabbit  ===========================
B D        Guinea pig  ===========================
B D          Bushbaby  ===========================
B D               Cow  ===========================
B D          Elephant  ===========================
B D           Manatee  ===========================
B D          Squirrel  ===========================
B D            Rhesus  ===========================
B D         Orangutan  ===========================
B D   Squirrel monkey  ===========================
B D               Pig  ===========================
B D             Horse  ===========================
B D             Panda  ===========================
B D               Dog  ===========================
B D          Marmoset  ===========================
B D            Gibbon  ===========================
B D    Naked mole-rat  ===========================
B D             Human  ---------------------------
B D           Tarsier  ===========================
B D            Tenrec  ===========================
B D              Pika  ===========================
B D            Alpaca  ===========================
B D        Tree shrew  ===========================
B D             Sheep  ===========================
B D            Medaka  ===========================
B D     X. tropicalis  ===========================
B D          Platypus  ===========================
B D            Turkey  ===========================
B D        Coelacanth  ===========================
B D   Tasmanian devil  ===========================
B D           Opossum  ===========================
B D            Lizard  ===========================
B D        Budgerigar  ===========================
B D       Zebra finch  ===========================
B D           Chicken  ===========================
B D    Painted turtle  ===========================
B D             Shrew  ===========================
  D  Little brown bat  ===========================
B D            Baboon  ===========================
B D             Sloth  ===========================
B D         Armadillo  ===========================
B D               Cat  ===========================
B D       Mouse lemur  ===========================
B D          Hedgehog  ===========================
B D      Kangaroo rat  ===========================
B D        Rock hyrax  ===========================
B D           Megabat  ===========================
B D           Dolphin  ===========================

Inserts between block 1 and 2 in window
B D            Chimp 6bp
B D          Gorilla 6bp

Alignment block 2 of 373 in window, 56741788 - 56741794, 7 bps 
B D             Mouse  cctaatt
B D               Rat  tctaatt
B D             Chimp  cctaaaa
B D           Gorilla  cctaaaa
B D           Tarsier  cctaaaa
B D            Rabbit  =======
B D        Guinea pig  =======
B D          Bushbaby  =======
B D               Cow  =======
B D          Elephant  =======
B D           Manatee  =======
B D          Squirrel  =======
B D            Rhesus  =======
B D         Orangutan  =======
B D   Squirrel monkey  =======
B D               Pig  =======
B D             Horse  =======
B D             Panda  =======
B D               Dog  =======
B D          Marmoset  =======
B D            Gibbon  =======
B D    Naked mole-rat  =======
B D             Human  -------
B D            Tenrec  =======
B D              Pika  =======
B D            Alpaca  =======
B D        Tree shrew  =======
B D             Sheep  =======
B D            Medaka  =======
B D     X. tropicalis  =======
B D          Platypus  =======
B D            Turkey  =======
B D        Coelacanth  =======
B D   Tasmanian devil  =======
B D           Opossum  =======
B D            Lizard  =======
B D        Budgerigar  =======
B D       Zebra finch  =======
B D           Chicken  =======
B D    Painted turtle  =======
B D             Shrew  =======
  D  Little brown bat  =======
B D            Baboon  =======
B D             Sloth  =======
B D         Armadillo  =======
B D               Cat  =======
B D       Mouse lemur  =======
B D          Hedgehog  =======
B D      Kangaroo rat  =======
B D        Rock hyrax  =======
B D           Megabat  =======
B D           Dolphin  =======

Inserts between block 2 and 3 in window
B D          Tarsier 12bp

Alignment block 3 of 373 in window, 56741795 - 56741824, 30 bps 
B D             Mouse  atagaaatgcaataaataaatgtatgacca
B D               Rat  atagaaatgcaataaataaatatataacca
B D          Squirrel  acaaaaaaactagaaagaaa---atatcta
B D             Chimp  acatgggt-------ataaagatgtttcta
B D           Gorilla  acatgggt-------ataaagatgtttcta
B D           Tarsier  aaagagat-------gtaaagaggtttcca
B D            Rabbit  ==============================
B D        Guinea pig  ==============================
B D          Bushbaby  ==============================
B D               Cow  ==============================
B D          Elephant  ==============================
B D           Manatee  ==============================
B D            Rhesus  ==============================
B D         Orangutan  ==============================
B D   Squirrel monkey  ==============================
B D               Pig  ==============================
B D             Horse  ==============================
B D             Panda  ==============================
B D               Dog  ==============================
B D          Marmoset  ==============================
B D            Gibbon  ==============================
B D    Naked mole-rat  ==============================
B D             Human  ------------------------------
B D            Tenrec  ==============================
B D              Pika  ==============================
B D            Alpaca  ==============================
B D        Tree shrew  ==============================
B D             Sheep  ==============================
B D            Medaka  ==============================
B D     X. tropicalis  ==============================
B D          Platypus  ==============================
B D            Turkey  ==============================
B D        Coelacanth  ==============================
B D   Tasmanian devil  ==============================
B D           Opossum  ==============================
B D            Lizard  ==============================
B D        Budgerigar  ==============================
B D       Zebra finch  ==============================
B D           Chicken  ==============================
B D    Painted turtle  ==============================
B D             Shrew  ==============================
  D  Little brown bat  ==============================
B D            Baboon  ==============================
B D             Sloth  ==============================
B D         Armadillo  ==============================
B D               Cat  ==============================
B D       Mouse lemur  ==============================
B D          Hedgehog  ==============================
B D      Kangaroo rat  ==============================
B D        Rock hyrax  ==============================
B D           Megabat  ==============================
B D           Dolphin  ==============================

Inserts between block 3 and 4 in window
B D            Chimp 4bp
B D          Gorilla 4bp
B D          Tarsier 4bp

Alignment block 4 of 373 in window, 56741825 - 56741854, 30 bps 
B D             Mouse  tta---------aaaatgcccttagcttattgaatagtc
B D               Rat  gtatgagaaataaaaaagcccatagtttactaaatcatc
B D          Squirrel  ttg---------caagaaccc-tagtttgctaagtcatc
B D             Human  ------------------tct-tagtttgctaagtcatt
B D             Chimp  -----------ttaaaaatct-tagtttgctaagtcatt
B D           Gorilla  -----------ttaaaaatct-tagtttgctaagtcatt
B D         Orangutan  -----------ttaaaaatct-tagtttgctaagtcatt
B D            Gibbon  -----------ttaaaaatct-tagtttgctaagtcatt
B D            Rhesus  -----------ttaaaagtgt-tagtatgctaagtcatt
B D            Baboon  -----------ttaaaagtgt-tagtatgctaagtcatt
B D   Squirrel monkey  -----------ttagaaatct-tagtttgctaagtcatt
B D           Tarsier  -----------ttaaaaatct-taatttactaaattgtc
B D       Mouse lemur  -----------ttaaaaatct-tagtttgctaaatcatc
B D             Sloth  -----------ttaaaaattc-tagttcatt--------
B D            Rabbit  =======================================
B D        Guinea pig  =======================================
B D          Bushbaby  =======================================
B D               Cow  =======================================
B D          Elephant  =======================================
B D           Manatee  =======================================
B D               Pig  =======================================
B D             Horse  =======================================
B D             Panda  =======================================
B D               Dog  =======================================
B D          Marmoset  =======================================
B D    Naked mole-rat  =======================================
B D            Tenrec  =======================================
B D              Pika  =======================================
B D            Alpaca  =======================================
B D        Tree shrew  =======================================
B D             Sheep  =======================================
B D            Medaka  =======================================
B D     X. tropicalis  =======================================
B D          Platypus  =======================================
B D            Turkey  =======================================
B D        Coelacanth  =======================================
B D   Tasmanian devil  =======================================
B D           Opossum  =======================================
B D            Lizard  =======================================
B D        Budgerigar  =======================================
B D       Zebra finch  =======================================
B D           Chicken  =======================================
B D    Painted turtle  =======================================
B D             Shrew  =======================================
  D  Little brown bat  =======================================
B D         Armadillo  =======================================
B D               Cat  =======================================
B D          Hedgehog  =======================================
B D      Kangaroo rat  =======================================
B D        Rock hyrax  =======================================
B D           Megabat  =======================================
B D           Dolphin  =======================================

Alignment block 5 of 373 in window, 56741855 - 56741909, 55 bps 
B D             Mouse  agaattgagatgac-----taaatattaatttg--gatagtattgtttcttcttattttgaa
B D               Rat  aggattgagagactaaatttaaatattgatttg--gatagtattgtttcttcttagtttgaa
B D          Squirrel  agaattgggatgactgaactaagtattaatttg--tgcagcatc-tttcttacaatcttcag
B D             Human  agaattaggatgactaaactaaggattaatttg--gatagcatc-tttctcatcatcttgaa
B D             Chimp  agaattaggatgactaaactaaggattaatttg--gatagcatc-tttctcatcatcttgaa
B D           Gorilla  agaattaggatgactaaactaaggattaatttg--gatagcatc-tttctcatcatcttgaa
B D         Orangutan  agaatcaggatgactaaactaaggattaatttg--gatagcatc-tttctcatcgtcttgaa
B D            Gibbon  agaattaggatgactaaactaaggattaatttg--gatagcatc-tttctcatcatcttgaa
B D            Rhesus  agaattaggatgactaaactaagtattaatttg--gatagcatc-tttctcatcatcttgag
B D            Baboon  agaattaggatgactaaactaagtattaatttg--gatagcatc-tttgacatcattttgag
B D   Squirrel monkey  agaatgaggatgactaaactaagtattaatttg--attagcatc-tttctcatcatcttgaa
B D           Tarsier  agacttaggctggttaaactaagtgttaatttg---ataccatc-ttttttatcatcttgga
B D       Mouse lemur  acaattacgatggctaaacttagtattaatttggagatagtatc-tttctcatcatcttgaa
B D        Tree shrew  agaagtaagatgacctggccaattattaatttg--ggtaacatt-tttctcat-atctggaa
B D             Sloth  acaactaggatgactgagctaagtattaatttg--gatatcattttttctcatccacttgaa
B D            Rabbit  ==============================================================
B D        Guinea pig  ==============================================================
B D          Bushbaby  ==============================================================
B D               Cow  ==============================================================
B D          Elephant  ==============================================================
B D           Manatee  ==============================================================
B D               Pig  ==============================================================
B D             Horse  ==============================================================
B D             Panda  ==============================================================
B D               Dog  ==============================================================
B D          Marmoset  ==============================================================
B D    Naked mole-rat  ==============================================================
B D            Tenrec  ==============================================================
B D              Pika  ==============================================================
B D            Alpaca  ==============================================================
B D             Sheep  ==============================================================
B D            Medaka  ==============================================================
B D     X. tropicalis  ==============================================================
B D          Platypus  ==============================================================
B D            Turkey  ==============================================================
B D        Coelacanth  ==============================================================
B D   Tasmanian devil  ==============================================================
B D           Opossum  ==============================================================
B D            Lizard  ==============================================================
B D        Budgerigar  ==============================================================
B D       Zebra finch  ==============================================================
B D           Chicken  ==============================================================
B D    Painted turtle  ==============================================================
B D             Shrew  ==============================================================
  D  Little brown bat  ==============================================================
B D         Armadillo  ==============================================================
B D               Cat  ==============================================================
B D          Hedgehog  ==============================================================
B D      Kangaroo rat  ==============================================================
B D        Rock hyrax  ==============================================================
B D           Megabat  ==============================================================
B D           Dolphin  ==============================================================

Inserts between block 5 and 6 in window
B D         Squirrel 14bp
B D            Human 11bp
B D            Chimp 14bp
B D          Gorilla 14bp
B D        Orangutan 14bp
B D           Gibbon 14bp
B D           Rhesus 9bp
B D           Baboon 9bp
B D  Squirrel monkey 14bp
B D          Tarsier 14bp
B D      Mouse lemur 14bp
B D       Tree shrew 14bp

Alignment block 6 of 373 in window, 56741910 - 56741911, 2 bps 
B D             Mouse  -aa
B D               Rat  -aa
B D    Naked mole-rat  -ag
B D          Squirrel  -ac
B D             Human  -cc
B D             Chimp  -cc
B D           Gorilla  -cc
B D         Orangutan  -cc
B D            Gibbon  -tc
B D            Rhesus  -cc
B D            Baboon  -cc
B D   Squirrel monkey  -cc
B D           Tarsier  -ac
B D       Mouse lemur  -ac
B D        Tree shrew  -ac
B D             Sloth  aa-
B D            Rabbit  ===
B D        Guinea pig  ===
B D          Bushbaby  ===
B D               Cow  ===
B D          Elephant  ===
B D           Manatee  ===
B D               Pig  ===
B D             Horse  ===
B D             Panda  ===
B D               Dog  ===
B D          Marmoset  ===
B D            Tenrec  ===
B D              Pika  ===
B D            Alpaca  ===
B D             Sheep  ===
B D            Medaka  ===
B D     X. tropicalis  ===
B D          Platypus  ===
B D            Turkey  ===
B D        Coelacanth  ===
B D   Tasmanian devil  ===
B D           Opossum  ===
B D            Lizard  ===
B D        Budgerigar  ===
B D       Zebra finch  ===
B D           Chicken  ===
B D    Painted turtle  ===
B D             Shrew  ===
  D  Little brown bat  ===
B D         Armadillo  ===
B D               Cat  ===
B D          Hedgehog  ===
B D      Kangaroo rat  ===
B D        Rock hyrax  ===
B D           Megabat  ===
B D           Dolphin  ===

Inserts between block 6 and 7 in window
B D            Sloth 231bp

Alignment block 7 of 373 in window, 56741912 - 56741923, 12 bps 
B D             Mouse  catatctcagtg---------
B D               Rat  catacctcagtg---------
B D    Naked mole-rat  tatatcttggtgagggctgac
B D          Squirrel  aaaatcttggtg----tcaac
B D             Human  tagatctcggtgagagctgac
B D             Chimp  tagatcttggtgagagctgac
B D           Gorilla  tagatcttggtgagagctgac
B D         Orangutan  tagatcttggtgagagctgac
B D            Gibbon  tagatcttggtgagagctgac
B D            Rhesus  tagatcttggtgagagttgac
B D            Baboon  tagatcttggtgagagttgac
B D   Squirrel monkey  tagatcttggtgagagttgat
B D           Tarsier  tagattttagtgagaactgac
B D       Mouse lemur  tagatcttggtaagagtttac
B D        Tree shrew  tagatcttaatgagaaccaac
B D            Rabbit  =====================
B D        Guinea pig  =====================
B D          Bushbaby  =====================
B D               Cow  =====================
B D          Elephant  =====================
B D           Manatee  =====================
B D               Pig  =====================
B D             Horse  =====================
B D             Panda  =====================
B D               Dog  =====================
B D          Marmoset  =====================
B D            Tenrec  =====================
B D              Pika  =====================
B D            Alpaca  =====================
B D             Sheep  =====================
B D            Medaka  =====================
B D     X. tropicalis  =====================
B D          Platypus  =====================
B D            Turkey  =====================
B D        Coelacanth  =====================
B D   Tasmanian devil  =====================
B D           Opossum  =====================
B D            Lizard  =====================
B D        Budgerigar  =====================
B D       Zebra finch  =====================
B D           Chicken  =====================
B D    Painted turtle  =====================
B D             Shrew  =====================
  D  Little brown bat  =====================
B D             Sloth  =====================
B D         Armadillo  =====================
B D               Cat  =====================
B D          Hedgehog  =====================
B D      Kangaroo rat  =====================
B D        Rock hyrax  =====================
B D           Megabat  =====================
B D           Dolphin  =====================

Alignment block 8 of 373 in window, 56741924 - 56741969, 46 bps 
B D             Mouse  aaatattcaaatggtatttgttgactgaccattccatgagattcac
B D               Rat  aaatattccaatggtgtccattgactgaccattccatgagatttgc
B D    Naked mole-rat  aaatattcaaatggaatttattgattgtctagtccctgattttcac
B D          Squirrel  aaatattcaaatggcatttattga-tgtctgtgtcctaattttcac
B D             Human  aaatattcaagtggcatttgctaattgtctgtttcctgattttcac
B D             Chimp  aaatattcaagtggcatttgctaattgtctgtttcctgattttcac
B D           Gorilla  aaatattcaagtggcatttgctaattgtctgtttcctgattttcac
B D         Orangutan  aaatattcaggtggcatttgctaattgtctgttttctgattttcac
B D            Gibbon  agatattcaagtggcatttgctaattgtctgtttcctgattttcac
B D            Rhesus  aaatattcaaatggcatttgctaattgtccgtttcctgattttcac
B D            Baboon  aaatattcaaatggcatttgctaattgtccgtttcctgattttcac
B D   Squirrel monkey  gaatacccaaatggcatttgctaattgtctgtttcctgattttcac
B D           Tarsier  aaatattcagatgacatttactgatcatctattccctgattttcac
B D       Mouse lemur  aaatattcaaatggcacttactgatcttctaattcctgattttcac
B D        Tree shrew  aaaaattcaaatagcatttactgattgtcaatttcctgattttcac
B D             Horse  aaatattcaaatgacatttactga-ggcctactgccggatgttccc
B D           Megabat  aaatattcaaacgacatatactgatagtctattgcctgattttcac
B D            Rabbit  ==============================================
B D        Guinea pig  ==============================================
B D          Bushbaby  ==============================================
B D               Cow  ==============================================
B D          Elephant  ==============================================
B D           Manatee  ==============================================
B D               Pig  ==============================================
B D             Panda  ==============================================
B D               Dog  ==============================================
B D          Marmoset  ==============================================
B D            Tenrec  ==============================================
B D              Pika  ==============================================
B D            Alpaca  ==============================================
B D             Sheep  ==============================================
B D            Medaka  ==============================================
B D     X. tropicalis  ==============================================
B D          Platypus  ==============================================
B D            Turkey  ==============================================
B D        Coelacanth  ==============================================
B D   Tasmanian devil  ==============================================
B D           Opossum  ==============================================
B D            Lizard  ==============================================
B D        Budgerigar  ==============================================
B D       Zebra finch  ==============================================
B D           Chicken  ==============================================
B D    Painted turtle  ==============================================
B D             Shrew  ==============================================
  D  Little brown bat  ==============================================
B D             Sloth  ==============================================
B D         Armadillo  ==============================================
B D               Cat  ==============================================
B D          Hedgehog  ==============================================
B D      Kangaroo rat  ==============================================
B D        Rock hyrax  ==============================================
B D           Dolphin  ==============================================

Inserts between block 8 and 9 in window
B D   Naked mole-rat 2bp
B D         Squirrel 2bp
B D           Baboon 897bp

Alignment block 9 of 373 in window, 56741970 - 56741976, 7 bps 
B D             Mouse  tcatatg--
B D               Rat  tcatatg--
B D    Naked mole-rat  tccttgg--
B D          Squirrel  gtgtaag--
B D             Human  tggcttg--
B D             Chimp  tggcttg--
B D           Gorilla  tggcttg--
B D         Orangutan  tggcttg--
B D            Gibbon  tggcttg--
B D            Rhesus  tgacttg--
B D   Squirrel monkey  tggcttg--
B D           Tarsier  tggctta--
B D       Mouse lemur  tggcttg--
B D        Tree shrew  tg-------
B D             Horse  tggcttggg
B D           Megabat  tggcttaag
B D            Rabbit  =========
B D        Guinea pig  =========
B D          Bushbaby  =========
B D               Cow  =========
B D          Elephant  =========
B D           Manatee  =========
B D               Pig  =========
B D             Panda  =========
B D               Dog  =========
B D          Marmoset  =========
B D            Tenrec  =========
B D              Pika  =========
B D            Alpaca  =========
B D             Sheep  =========
B D            Medaka  =========
B D     X. tropicalis  =========
B D          Platypus  =========
B D            Turkey  =========
B D        Coelacanth  =========
B D   Tasmanian devil  =========
B D           Opossum  =========
B D            Lizard  =========
B D        Budgerigar  =========
B D       Zebra finch  =========
B D           Chicken  =========
B D    Painted turtle  =========
B D             Shrew  =========
  D  Little brown bat  =========
B D            Baboon  =========
B D             Sloth  =========
B D         Armadillo  =========
B D               Cat  =========
B D          Hedgehog  =========
B D      Kangaroo rat  =========
B D        Rock hyrax  =========
B D           Dolphin  =========

Inserts between block 9 and 10 in window
B D            Human 2bp
B D            Chimp 2bp
B D          Gorilla 2bp
B D        Orangutan 2bp
B D           Gibbon 2bp
B D           Rhesus 1654bp
B D  Squirrel monkey 2bp
B D          Tarsier 2bp
B D      Mouse lemur 2bp
B D       Tree shrew 6bp

Alignment block 10 of 373 in window, 56741977 - 56742101, 125 bps 
B D             Mouse  tactgggtt-gtacaataaactgaaactcagatg-tttga-actcatat----tt--gtgagtttggact
B D               Rat  tactgggtt-gtgcaatagagtaaaactcacagattttga-actcagat----tt--gtgggtttgaact
B D    Naked mole-rat  ctctgggtgagtactagaaagtgtaatatatggattttaa-gctcatgtg---cc--ttgagtttgaact
B D          Squirrel  ttctgggtgggtacaagaaagtataacacatggattttaa-actcatgc----tctgttgaatttgagcc
B D             Human  tgctgtgtgtgtataagcaaatgtaatgcat-cattttaa-actcaagtgctttg--ttgagttcggact
B D             Chimp  tgctgtgtgtgtataagcaaatgtaatgcat-cattttaa-actcaagtgctttg--ttgagttcggact
B D           Gorilla  tgctgtgtgtgtataaacaaatgtaatgcat-cattttaa-actcaagtgctttg--ttgagtttggact
B D         Orangutan  tgctgtgtgtgtatcagaaaatgtaatgcat-cattttaa-actcaagtgctttg--ttgagttcgaact
B D            Gibbon  tgctgtgtgtgtataagcaaatgtaatgcat-cattttaa-actcaagtgctttg--ttgagttcaaact
B D   Squirrel monkey  tgctgtgtgtgtataagcaaatgtaatgcatggattttaa-attcaagtgccttg--ttgagtttgaact
B D           Tarsier  acctgggcaggtataaggacatgtaatgcatgggttttta-actcaggtactttt--gtggtattgaact
B D       Mouse lemur  tgctgggtgggtatgagaaagtgtaacgcatggattttaa-attcaagtgctttg--ttgagtttgaagt
B D        Tree shrew  ggttgatggggtacc-gaaagtataacacatggatttttacattgaagtgctttt--ttgaatttgagct
B D             Horse  tgttaggtgagtacaaagaagcgtaacgcatggattttga-actcaagtgctttg--ctgagtttgaact
B D           Megabat  tgttaggtgggtacaaagaagtataa--catggatttgga-actcaagtgccttg--tcgagtttgaact
B D            Rabbit  ======================================================================
B D        Guinea pig  ======================================================================
B D          Bushbaby  ======================================================================
B D               Cow  ======================================================================
B D          Elephant  ======================================================================
B D           Manatee  ======================================================================
B D            Rhesus  ======================================================================
B D               Pig  ======================================================================
B D             Panda  ======================================================================
B D               Dog  ======================================================================
B D          Marmoset  ======================================================================
B D            Tenrec  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D             Sheep  ======================================================================
B D            Medaka  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
  D  Little brown bat  ======================================================================
B D            Baboon  ======================================================================
B D             Sloth  ======================================================================
B D         Armadillo  ======================================================================
B D               Cat  ======================================================================
B D          Hedgehog  ======================================================================
B D      Kangaroo rat  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Dolphin  ======================================================================

                Mouse  gtaactgtt---aattaaat-----atttcagagtctaacagactaattagaaacaggactctcaagt-c
                  Rat  gtagctgttaacaattaagt-----gtcgcagaggctaacaa------------------tctagagt-c
       Naked mole-rat  ctaactgtc----actaagt-----aaatcaggggatattgtagtaattacaagtagggtcttggagc-c
             Squirrel  ctagttgtc----aataagt-----agatcagagagtaacatagtaattggaaataagagcttagagg--
                Human  ctagttgtc----agtaatt-----a-attggagagtagcatagtaattggaaataggagctcagagc-t
                Chimp  ctagttgtc----agtaatt-----a-attggagagtagcatagtaattggaaataggagctcagagc-t
              Gorilla  ctagttgtc----agtaatt-----a-attggagagtagcatagtaattggaaataggagctcagagc-t
            Orangutan  ctagttgtc----agtaact-----a-attggagagtagcatagtaattggaaataggagctcagagc-t
               Gibbon  ctagttgtc----agtaatt-----a-attggagagtagcatagtaactggaaataggagctcagagc-t
      Squirrel monkey  ctagttgtc----agtaatt-----a-attggagaatagcatagtaattggaaataggagctcagagc-t
              Tarsier  ctagctgcc----cataattaagtaa-atcagagggtagcatagtcatcagaaacagaagttcagagc-c
          Mouse lemur  ctagttgtc----aat--tt-----acatcagagggtagcatagtaa-tagaaataggagcttgg-----
           Tree shrew  ctagttgtt----aataatgacgtaa-atcagagggtaggatagtaattag-aataggagctcagagt-c
                Horse  ctacttgtg----cataattacataa-ctcagagggtagcat-gtagttagaaataggggctcacagc-c
              Megabat  ctagttgtg----aatcaataagtaa-atcagagagtagtatagtagctagaaataagggatcaaaacac
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
               Rhesus  ======================================================================
                  Pig  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Dolphin  ======================================================================

                Mouse  agc
                  Rat  aga
       Naked mole-rat  aaa
             Squirrel  aga
                Human  aga
                Chimp  aga
              Gorilla  aga
            Orangutan  aga
               Gibbon  aga
      Squirrel monkey  aga
              Tarsier  aga
          Mouse lemur  aga
           Tree shrew  aaa
                Horse  agg
              Megabat  aca
               Rabbit  ===
           Guinea pig  ===
             Bushbaby  ===
                  Cow  ===
             Elephant  ===
              Manatee  ===
               Rhesus  ===
                  Pig  ===
                Panda  ===
                  Dog  ===
             Marmoset  ===
               Tenrec  ===
                 Pika  ===
               Alpaca  ===
                Sheep  ===
               Medaka  ===
        X. tropicalis  ===
             Platypus  ===
               Turkey  ===
           Coelacanth  ===
      Tasmanian devil  ===
              Opossum  ===
               Lizard  ===
           Budgerigar  ===
          Zebra finch  ===
              Chicken  ===
       Painted turtle  ===
                Shrew  ===
     Little brown bat  ===
               Baboon  ===
                Sloth  ===
            Armadillo  ===
                  Cat  ===
             Hedgehog  ===
         Kangaroo rat  ===
           Rock hyrax  ===
              Dolphin  ===

Alignment block 11 of 373 in window, 56742102 - 56742191, 90 bps 
B D             Mouse  cagtcccaga-tcagaggctcagcaacaccatttacta-----------accttggtaagtatttcaccc
B D               Rat  catcccctgg-gttgaggcttagcagcagcacttagta-----------actttgggaagtatttcacct
B D    Naked mole-rat  taattccagg-tttgagcctcagtaatgccatctgaaa-----------actttggcaa-tatttcatcc
B D          Squirrel  cagctccagc-tttgagtctcccccataacacttgcta-----------gctttggcaagtattttatcc
B D             Human  cagttccaag-tttgagtctcagcaataccacttgcta------------ctttggcaagtattttatcc
B D             Chimp  cagttccaag-tttgagtctcagcagtaccacttgcta------------ctttggcaagtattttatcc
B D           Gorilla  cagttccaag-tttgagtctcaacaatacgacttgcta------------ctttggcaagtattttatcc
B D         Orangutan  cagttacaag-tttgagtctcagcaataccacttgcta------------ctttggcaagtattttatcc
B D            Gibbon  cagttccaag-tttgagtctcagcaataccacttgcta------------ctttggcaagtattttatcc
B D   Squirrel monkey  cagttccaag-tttgagtctcagcaataccacttgcta------------ctttagcaagtattttatcc
B D           Tarsier  cagctccatt-tttgagtcttaacagtatcacctccta-----------tctttggcaagtattttatcc
B D       Mouse lemur  cagcttcagg-tttgtgtc--agcagtaaggctggcta-----------actttggcaagta-tttattc
B D        Tree shrew  gaactccagg-tttgagtctcagcaacagctcttattaactttgctaatactttgccaagtgtgtcattc
B D           Dolphin  cagtcccaagctttgaatcccagaaatatcacttgcta-----------gcttaagcaggtattttatcc
B D             Horse  ctgccccagg-tttgagtctcagcaataccacttgctg-----------gcttgggcaagtattttatcc
B D           Megabat  caaccccagg-tttgagtctcagcatcaccacttgcta-----------gctcagggaattattttaccc
B D            Rabbit  ======================================================================
B D        Guinea pig  ======================================================================
B D          Bushbaby  ======================================================================
B D               Cow  ======================================================================
B D          Elephant  ======================================================================
B D           Manatee  ======================================================================
B D            Rhesus  ======================================================================
B D               Pig  ======================================================================
B D             Panda  ======================================================================
B D               Dog  ======================================================================
B D          Marmoset  ======================================================================
B D            Tenrec  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D             Sheep  ======================================================================
B D            Medaka  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
  D  Little brown bat  ======================================================================
B D            Baboon  ======================================================================
B D             Sloth  ======================================================================
B D         Armadillo  ======================================================================
B D               Cat  ======================================================================
B D          Hedgehog  ======================================================================
B D      Kangaroo rat  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  tgtctgat-ttatcttcacgccact--------tatatgta-
                  Rat  tctctgat-tcatcttcacaccact--------tagttgta-
       Naked mole-rat  tctctggt-atatcttcaattcctt--------aatttgtg-
             Squirrel  tctctgacaaaatccttatttcact--------agtttgta-
                Human  tctctgat-tgattctcactttattaatttctaaatttcta-
                Chimp  tctctgat-taattctcactttatt--------aatttcta-
              Gorilla  tctctgat-taattctcactttattaatttctaaatttcta-
            Orangutan  tctccgat-taattctcactttatt--------aatttcta-
               Gibbon  tctccgat-taattctcactttatt-------aattttcta-
      Squirrel monkey  tctccaat-taatcctcactttatt--------aatttgta-
              Tarsier  tctttgat-taatccttcctttact--------aacttgta-
          Mouse lemur  tctctgat-ttatcctcaccttacc--------gatttgta-
           Tree shrew  tctctggt-ttatcctccccttact--------aatttgca-
              Dolphin  tct--gat-ttatcctcacttcatt--------catctgtaa
                Horse  tct--gat-ttatcctcactttact--------catttgtaa
              Megabat  tct--gat-ttatcctcactttact--------cacttgtga
               Rabbit  ==========================================
           Guinea pig  ==========================================
             Bushbaby  ==========================================
                  Cow  ==========================================
             Elephant  ==========================================
              Manatee  ==========================================
               Rhesus  ==========================================
                  Pig  ==========================================
                Panda  ==========================================
                  Dog  ==========================================
             Marmoset  ==========================================
               Tenrec  ==========================================
                 Pika  ==========================================
               Alpaca  ==========================================
                Sheep  ==========================================
               Medaka  ==========================================
        X. tropicalis  ==========================================
             Platypus  ==========================================
               Turkey  ==========================================
           Coelacanth  ==========================================
      Tasmanian devil  ==========================================
              Opossum  ==========================================
               Lizard  ==========================================
           Budgerigar  ==========================================
          Zebra finch  ==========================================
              Chicken  ==========================================
       Painted turtle  ==========================================
                Shrew  ==========================================
     Little brown bat  ==========================================
               Baboon  ==========================================
                Sloth  ==========================================
            Armadillo  ==========================================
                  Cat  ==========================================
             Hedgehog  ==========================================
         Kangaroo rat  ==========================================
           Rock hyrax  ==========================================

Alignment block 12 of 373 in window, 56742192 - 56742200, 9 bps 
B D             Mouse  aacaaggat
B D               Rat  aaccaggat
B D    Naked mole-rat  aacatggat
B D          Squirrel  tataagggt
B D             Human  aataaggat
B D             Chimp  aataaggat
B D           Gorilla  aataaggat
B D         Orangutan  aataaggac
B D            Gibbon  cataaggat
B D            Baboon  aacaacaac
B D   Squirrel monkey  aataaggat
B D           Tarsier  aacaagttt
B D       Mouse lemur  aacaaggat
B D        Tree shrew  tacaagata
B D           Dolphin  aataaggat
B D             Horse  aataaggat
B D           Megabat  aataaagat
B D            Rabbit  =========
B D        Guinea pig  =========
B D          Bushbaby  =========
B D               Cow  =========
B D          Elephant  =========
B D           Manatee  =========
B D            Rhesus  =========
B D               Pig  =========
B D             Panda  =========
B D               Dog  =========
B D          Marmoset  =========
B D            Tenrec  =========
B D              Pika  =========
B D            Alpaca  =========
B D             Sheep  =========
B D            Medaka  =========
B D     X. tropicalis  =========
B D          Platypus  =========
B D            Turkey  =========
B D        Coelacanth  =========
B D   Tasmanian devil  =========
B D           Opossum  =========
B D            Lizard  =========
B D        Budgerigar  =========
B D       Zebra finch  =========
B D           Chicken  =========
B D    Painted turtle  =========
B D             Shrew  =========
  D  Little brown bat  =========
B D             Sloth  =========
B D         Armadillo  =========
B D               Cat  =========
B D          Hedgehog  =========
B D      Kangaroo rat  =========
B D        Rock hyrax  =========

Inserts between block 12 and 13 in window
B D              Rat 3bp
B D   Naked mole-rat 3bp
B D         Squirrel 3bp
B D            Human 3bp
B D            Chimp 351bp
B D          Gorilla 348bp
B D        Orangutan 3bp
B D           Gibbon 3bp
B D          Tarsier 3bp
B D      Mouse lemur 3bp
B D       Tree shrew 2bp

Alignment block 13 of 373 in window, 56742201 - 56742207, 7 bps 
B D             Mouse  ---aacagaa
B D               Rat  ---aacagat
B D    Naked mole-rat  ---tgtagaa
B D          Squirrel  ---aaaaaa-
B D             Human  ---gatagaa
B D             Chimp  ---aaaaaaa
B D           Gorilla  ---aaaaaaa
B D         Orangutan  ---gatagaa
B D            Gibbon  ---gatagaa
B D            Baboon  ---aacaaaa
B D   Squirrel monkey  ---aataata
B D           Tarsier  ---aatagaa
B D       Mouse lemur  ---aatagat
B D        Tree shrew  ---aatagac
B D           Dolphin  aataatagaa
B D             Horse  aatgatagac
B D           Megabat  aataataaaa
B D            Rabbit  ==========
B D        Guinea pig  ==========
B D          Bushbaby  ==========
B D               Cow  ==========
B D          Elephant  ==========
B D           Manatee  ==========
B D            Rhesus  ==========
B D               Pig  ==========
B D             Panda  ==========
B D               Dog  ==========
B D          Marmoset  ==========
B D            Tenrec  ==========
B D              Pika  ==========
B D            Alpaca  ==========
B D             Sheep  ==========
B D            Medaka  ==========
B D     X. tropicalis  ==========
B D          Platypus  ==========
B D            Turkey  ==========
B D        Coelacanth  ==========
B D   Tasmanian devil  ==========
B D           Opossum  ==========
B D            Lizard  ==========
B D        Budgerigar  ==========
B D       Zebra finch  ==========
B D           Chicken  ==========
B D    Painted turtle  ==========
B D             Shrew  ==========
  D  Little brown bat  ==========
B D             Sloth  ==========
B D         Armadillo  ==========
B D               Cat  ==========
B D          Hedgehog  ==========
B D      Kangaroo rat  ==========
B D        Rock hyrax  ==========

Inserts between block 13 and 14 in window
B D            Human 346bp
B D           Baboon 5bp
B D  Squirrel monkey 3bp

Alignment block 14 of 373 in window, 56742208 - 56742214, 7 bps 
B D             Mouse  tcctcct
B D               Rat  tccttct
B D    Naked mole-rat  tcttcct
B D          Squirrel  ---ttct
B D             Human  tcttcct
B D             Chimp  tcttcct
B D           Gorilla  tcttcct
B D         Orangutan  tcttcct
B D            Gibbon  tcttcct
B D            Baboon  tcctcac
B D   Squirrel monkey  tctt---
B D           Tarsier  ttttcca
B D       Mouse lemur  ttttcct
B D        Tree shrew  tatttct
B D           Dolphin  tcttcct
B D             Horse  tcttcct
B D           Megabat  tct----
B D            Rabbit  =======
B D        Guinea pig  =======
B D          Bushbaby  =======
B D               Cow  =======
B D          Elephant  =======
B D           Manatee  =======
B D            Rhesus  =======
B D               Pig  =======
B D             Panda  =======
B D               Dog  =======
B D          Marmoset  =======
B D            Tenrec  =======
B D              Pika  =======
B D            Alpaca  =======
B D             Sheep  =======
B D            Medaka  =======
B D     X. tropicalis  =======
B D          Platypus  =======
B D            Turkey  =======
B D        Coelacanth  =======
B D   Tasmanian devil  =======
B D           Opossum  =======
B D            Lizard  =======
B D        Budgerigar  =======
B D       Zebra finch  =======
B D           Chicken  =======
B D    Painted turtle  =======
B D             Shrew  =======
  D  Little brown bat  =======
B D             Sloth  =======
B D         Armadillo  =======
B D               Cat  =======
B D          Hedgehog  =======
B D      Kangaroo rat  =======
B D        Rock hyrax  =======

Inserts between block 14 and 15 in window
B D        Orangutan 1126bp
B D           Gibbon 377bp
B D           Baboon 6bp
B D          Tarsier 1bp
B D          Dolphin 1bp

Alignment block 15 of 373 in window, 56742215 - 56742227, 13 bps 
B D             Mouse  tataaga---ctgctg
B D               Rat  tacagga---ttgctg
B D    Naked mole-rat  catagtg---ttgttg
B D          Squirrel  caaaata---tcacta
B D             Human  cacagga---ttgttg
B D             Chimp  cacagga---ttgttg
B D           Gorilla  cacagga---ttgttg
B D            Baboon  ------------tttg
B D   Squirrel monkey  cctgagg---ctggtg
B D           Tarsier  tatagga---ttcttg
B D       Mouse lemur  tatagga---cagttg
B D        Tree shrew  --taggg---ttcttg
B D           Dolphin  cataggattgttgttg
B D             Horse  catagga---ttgttg
B D           Megabat  --tagga---ttgctg
B D            Rabbit  ================
B D        Guinea pig  ================
B D          Bushbaby  ================
B D               Cow  ================
B D          Elephant  ================
B D           Manatee  ================
B D            Rhesus  ================
B D         Orangutan  ================
B D               Pig  ================
B D             Panda  ================
B D               Dog  ================
B D          Marmoset  ================
B D            Gibbon  ================
B D            Tenrec  ================
B D              Pika  ================
B D            Alpaca  ================
B D             Sheep  ================
B D            Medaka  ================
B D     X. tropicalis  ================
B D          Platypus  ================
B D            Turkey  ================
B D        Coelacanth  ================
B D   Tasmanian devil  ================
B D           Opossum  ================
B D            Lizard  ================
B D        Budgerigar  ================
B D       Zebra finch  ================
B D           Chicken  ================
B D    Painted turtle  ================
B D             Shrew  ================
  D  Little brown bat  ================
B D             Sloth  ================
B D         Armadillo  ================
B D               Cat  ================
B D          Hedgehog  ================
B D      Kangaroo rat  ================
B D        Rock hyrax  ================

Inserts between block 15 and 16 in window
B D            Human 4bp
B D            Chimp 4bp
B D          Gorilla 4bp
B D           Baboon 4bp
B D  Squirrel monkey 766bp
B D      Mouse lemur 6bp

Alignment block 16 of 373 in window, 56742228 - 56742256, 29 bps 
B D             Mouse  ctacaataactaagtctatggactgactg
B D               Rat  ttacaacaactaagtctatggacttactg
B D    Naked mole-rat  taatgataaataagtgaatgaacttagtc
B D          Squirrel  ca--------------tatg---------
B D             Human  tgttg--aaagaagtcaatgaacttagtc
B D             Chimp  tgttg--aaagaagtcaatgaacttagtc
B D           Gorilla  tgttg--aaagaagtcaatgaacttagtc
B D            Baboon  tgttg--gaagaagtcaatgaacttagtc
B D           Tarsier  tgatgataaacaagtcagtgaacttagcc
B D       Mouse lemur  t------aggtcagtcggtgaaatcagtt
B D        Tree shrew  tgatgataaataagtcattgaactggctg
B D           Dolphin  tgatgataaataagtcaatgaactttgcc
B D             Horse  tgatg----ataagtcaatgaactgcatc
B D           Megabat  tgatgttatataagtcaatgaattttgtc
B D            Rabbit  =============================
B D        Guinea pig  =============================
B D          Bushbaby  =============================
B D               Cow  =============================
B D          Elephant  =============================
B D           Manatee  =============================
B D            Rhesus  =============================
B D         Orangutan  =============================
B D   Squirrel monkey  =============================
B D               Pig  =============================
B D             Panda  =============================
B D               Dog  =============================
B D          Marmoset  =============================
B D            Gibbon  =============================
B D            Tenrec  =============================
B D              Pika  =============================
B D            Alpaca  =============================
B D             Sheep  =============================
B D            Medaka  =============================
B D     X. tropicalis  =============================
B D          Platypus  =============================
B D            Turkey  =============================
B D        Coelacanth  =============================
B D   Tasmanian devil  =============================
B D           Opossum  =============================
B D            Lizard  =============================
B D        Budgerigar  =============================
B D       Zebra finch  =============================
B D           Chicken  =============================
B D    Painted turtle  =============================
B D             Shrew  =============================
  D  Little brown bat  =============================
B D             Sloth  =============================
B D         Armadillo  =============================
B D               Cat  =============================
B D          Hedgehog  =============================
B D      Kangaroo rat  =============================
B D        Rock hyrax  =============================

Inserts between block 16 and 17 in window
B D       Tree shrew 940bp

Alignment block 17 of 373 in window, 56742257 - 56742336, 80 bps 
B D             Mouse  caatg-------------------taagccctcaccat-tgcttacttttttaaaataagaacaccagtt
B D               Rat  tagtg-------------------taagcggtcactgt-tgtttgcttttt----gtaataacagcagtt
B D    Naked mole-rat  cagtg-------------------taatcattccctatatgtttaggtgta---aataataatggtattt
B D          Squirrel  -------------------------------tcactgtatatttagctatt---aataatagtggcaatt
B D             Human  cactgtaaacaacttagtccattctaagcattcactatacatttaggtgtt---aacgataatggcaatt
B D             Chimp  cattgtaaacaacttagtccattctaagcattcactatacatttaggtgtt---aacgataatggcaatt
B D           Gorilla  cattgtaaacaacttagtccattctaagcattcactatacatttaggtgtt---aacaataacggcaatt
B D            Baboon  cattgtaagcaacttagtccattctaagcattcactatacacttaggtgtt---aacaataatggcagtt
B D           Tarsier  cattg-------------------taagcattcgctgtatataaagctgta---aataataataaccatt
B D       Mouse lemur  cgttg-------------------taagcattcactacatatttagctgtt---aataataatggcaatt
B D           Dolphin  ctatg-------------------taagcatttactataca-ttagctgtt---aataataatggcaatt
B D             Horse  ctctg-------------------taag-attcactatata-gtagctgtt---aataataatggcaatt
B D           Megabat  ctgtg-------------------taagcattcactgtacg-ttagctgtt---aataataatagcaatt
B D            Rabbit  ======================================================================
B D        Guinea pig  ======================================================================
B D          Bushbaby  ======================================================================
B D               Cow  ======================================================================
B D          Elephant  ======================================================================
B D           Manatee  ======================================================================
B D            Rhesus  ======================================================================
B D         Orangutan  ======================================================================
B D   Squirrel monkey  ======================================================================
B D               Pig  ======================================================================
B D             Panda  ======================================================================
B D               Dog  ======================================================================
B D          Marmoset  ======================================================================
B D            Gibbon  ======================================================================
B D            Tenrec  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D        Tree shrew  ======================================================================
B D             Sheep  ======================================================================
B D            Medaka  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
  D  Little brown bat  ======================================================================
B D             Sloth  ======================================================================
B D         Armadillo  ======================================================================
B D               Cat  ======================================================================
B D          Hedgehog  ======================================================================
B D      Kangaroo rat  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  actactggcagtaata-----agtta-tgataat-aa
                  Rat  actactgactgtaata-----agtta-tgataat-aa
       Naked mole-rat  atg--tgacaatcataaaaatagttc-taataat-aa
             Squirrel  atg-ctgacaataata-----aatcagtaataac-aa
                Human  atg-ctgacaatcataaaaatagtta-taacaat-aa
                Chimp  atg-ctgacaatcataaaaatagtta-taacaat-aa
              Gorilla  atg-ctgacaaccataaaaatagtta-taacaat-aa
               Baboon  atg-ctgaaaatcataaaaatagtta-taacaat-aa
              Tarsier  agg-ctgacaatcataaaagtagtta-taatgataaa
          Mouse lemur  atg-ctgacagtcataaaaatagtta-taataat-aa
              Dolphin  atg-aagataataaaac---tagtca-taatagt-aa
                Horse  atg-ctg------------------a-taagaat-aa
              Megabat  gtg-ctgataataaaaa--gtagtta-taataat-aa
               Rabbit  =====================================
           Guinea pig  =====================================
             Bushbaby  =====================================
                  Cow  =====================================
             Elephant  =====================================
              Manatee  =====================================
               Rhesus  =====================================
            Orangutan  =====================================
      Squirrel monkey  =====================================
                  Pig  =====================================
                Panda  =====================================
                  Dog  =====================================
             Marmoset  =====================================
               Gibbon  =====================================
               Tenrec  =====================================
                 Pika  =====================================
               Alpaca  =====================================
           Tree shrew  =====================================
                Sheep  =====================================
               Medaka  =====================================
        X. tropicalis  =====================================
             Platypus  =====================================
               Turkey  =====================================
           Coelacanth  =====================================
      Tasmanian devil  =====================================
              Opossum  =====================================
               Lizard  =====================================
           Budgerigar  =====================================
          Zebra finch  =====================================
              Chicken  =====================================
       Painted turtle  =====================================
                Shrew  =====================================
     Little brown bat  =====================================
                Sloth  =====================================
            Armadillo  =====================================
                  Cat  =====================================
             Hedgehog  =====================================
         Kangaroo rat  =====================================
           Rock hyrax  =====================================

Inserts between block 17 and 18 in window
B D   Naked mole-rat 854bp

Alignment block 18 of 373 in window, 56742337 - 56742368, 32 bps 
B D             Mouse  aataatggatataaagtct-ttgctagttaaaa
B D               Rat  aataatggatacaaatcac-ttgttggtcaaaa
B D          Squirrel  aatcacaga---aaattttacttttagttgagg
B D             Human  aatgacaggt--gatttct-ttgttagttgaag
B D             Chimp  aatgacaggt--gatttct-ttgttagttgaag
B D           Gorilla  aatgacaggt--gatttat-ctgttagttgaag
B D            Baboon  aatgacaggt--aatttct-ttgttagttgaag
B D           Tarsier  aataacaagt--aatttct-ttattagtt----
B D       Mouse lemur  aa-aacaagc--attttct-ttgttagttgaa-
B D           Dolphin  aataacaggt--aatttct-ttggtagttgaa-
B D             Horse  aatagcaggt--aatttct-ttgttagttgaa-
B D           Megabat  aataacaggt--aattatt-ttgttcgttgaa-
B D            Rabbit  =================================
B D        Guinea pig  =================================
B D          Bushbaby  =================================
B D               Cow  =================================
B D          Elephant  =================================
B D           Manatee  =================================
B D            Rhesus  =================================
B D         Orangutan  =================================
B D   Squirrel monkey  =================================
B D               Pig  =================================
B D             Panda  =================================
B D               Dog  =================================
B D          Marmoset  =================================
B D            Gibbon  =================================
B D    Naked mole-rat  =================================
B D            Tenrec  =================================
B D              Pika  =================================
B D            Alpaca  =================================
B D        Tree shrew  =================================
B D             Sheep  =================================
B D            Medaka  =================================
B D     X. tropicalis  =================================
B D          Platypus  =================================
B D            Turkey  =================================
B D        Coelacanth  =================================
B D   Tasmanian devil  =================================
B D           Opossum  =================================
B D            Lizard  =================================
B D        Budgerigar  =================================
B D       Zebra finch  =================================
B D           Chicken  =================================
B D    Painted turtle  =================================
B D             Shrew  =================================
  D  Little brown bat  =================================
B D             Sloth  =================================
B D         Armadillo  =================================
B D               Cat  =================================
B D          Hedgehog  =================================
B D      Kangaroo rat  =================================
B D        Rock hyrax  =================================

Inserts between block 18 and 19 in window
B D            Human 8bp
B D            Chimp 1bp
B D          Gorilla 1bp
B D           Baboon 1bp
B D          Tarsier 5bp
B D      Mouse lemur 2bp

Alignment block 19 of 373 in window, 56742369 - 56742468, 100 bps 
B D             Mouse  --cagtggcaatgaacaggctgcattcacagggaacctggggtcaattcctagcacccacagtgcatgga
B D               Rat  --cagtggcaaag-actggctgcattcacagagggcctggggtcaattcctagcacccacagtgcatgga
B D          Squirrel  --cagtggcagtc---------------------------------------------------------
B D             Chimp  --cagtggcaacc-aaaagctg------------------------------------------------
B D           Gorilla  --cagtggcaacc-aaaagctg------------------------------------------------
B D            Baboon  --cagtggcaa-----------------------------------------------------------
B D           Tarsier  --tagtgtcaatt---------------------------------------------------------
B D       Mouse lemur  --cagtgag-------------------------------------------------------------
B D           Dolphin  ggcaatgaca------------------------------------------------------------
B D             Horse  ggcaatgaca------------------------------------------------------------
B D           Megabat  ggtgacaaca------------------------------------------------------------
B D            Rabbit  ======================================================================
B D        Guinea pig  ======================================================================
B D          Bushbaby  ======================================================================
B D               Cow  ======================================================================
B D          Elephant  ======================================================================
B D           Manatee  ======================================================================
B D            Rhesus  ======================================================================
B D         Orangutan  ======================================================================
B D   Squirrel monkey  ======================================================================
B D               Pig  ======================================================================
B D             Panda  ======================================================================
B D               Dog  ======================================================================
B D          Marmoset  ======================================================================
B D            Gibbon  ======================================================================
B D    Naked mole-rat  ======================================================================
B D             Human  ======================================================================
B D            Tenrec  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D        Tree shrew  ======================================================================
B D             Sheep  ======================================================================
B D            Medaka  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
  D  Little brown bat  ======================================================================
B D             Sloth  ======================================================================
B D         Armadillo  ======================================================================
B D               Cat  ======================================================================
B D          Hedgehog  ======================================================================
B D      Kangaroo rat  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  tataactgcagacaaaccactcacacacataa
                  Rat  catacctgc-----------------------
             Squirrel  --------------------------------
                Chimp  --------------------------------
              Gorilla  --------------------------------
               Baboon  --------------------------------
              Tarsier  --------------------------------
          Mouse lemur  --------------------------------
              Dolphin  --------------------------------
                Horse  --------------------------------
              Megabat  --------------------------------
               Rabbit  ================================
           Guinea pig  ================================
             Bushbaby  ================================
                  Cow  ================================
             Elephant  ================================
              Manatee  ================================
               Rhesus  ================================
            Orangutan  ================================
      Squirrel monkey  ================================
                  Pig  ================================
                Panda  ================================
                  Dog  ================================
             Marmoset  ================================
               Gibbon  ================================
       Naked mole-rat  ================================
                Human  ================================
               Tenrec  ================================
                 Pika  ================================
               Alpaca  ================================
           Tree shrew  ================================
                Sheep  ================================
               Medaka  ================================
        X. tropicalis  ================================
             Platypus  ================================
               Turkey  ================================
           Coelacanth  ================================
      Tasmanian devil  ================================
              Opossum  ================================
               Lizard  ================================
           Budgerigar  ================================
          Zebra finch  ================================
              Chicken  ================================
       Painted turtle  ================================
                Shrew  ================================
     Little brown bat  ================================
                Sloth  ================================
            Armadillo  ================================
                  Cat  ================================
             Hedgehog  ================================
         Kangaroo rat  ================================
           Rock hyrax  ================================

Alignment block 20 of 373 in window, 56742469 - 56742610, 142 bps 
B D             Mouse  aacgaaaaggtgaag-ctggttggagggggagga---------------a-taca-tgctt--ttccgta
B D               Rat  aaggaaaaggtgaag-ctggttggagggggagga---------------aggaca-tgctt--caccaca
B D          Squirrel  ----aaaaggtggtgcctgagttgagggagaaga---------------aggata-tgcttaatgtttct
B D             Human  aaccaaaagctggaatctgatttgagggagagaa---------------agcttc-ttttt--ttcttca
B D             Chimp  ------------gaatctgatttgagggagagaa---------------agctt--ttttt--ttcttca
B D           Gorilla  ------------gaatctgatttgagggagagaa---------------agcttc-ttttt--ttcttca
B D            Gibbon  aaccaaaaggtggaatctgatttgagggagagaa---------------agctgctttttt--ttcttcg
B D            Baboon  --ccaaaaggtggagcctgatttgagagagagaa---------------agcttc-tttat--ttcttca
B D           Tarsier  ----aaaatgtggagtatggtttaagggaaaaga---------------agcttc-ttcct--t--ctaa
B D       Mouse lemur  aatcaaaaggtgtaggctgccttgagggagagga-ggatatatttaattagcttc-ctctt--t--ctca
B D           Dolphin  -accaaaaggtggaggctgatttgagggggaggaaggacatgaataactagcctc-ttctt--g--ctca
B D             Horse  -atcaaaaggtggaggatgattggagggagaggaaggacgtacataactagtctc-tttct--t--ctca
B D           Megabat  -atcgaaagatggaggctgatttgagggaggggaaggatatgcaaaactagtctc-ttctt--t--ctca
B D            Rabbit  ======================================================================
B D        Guinea pig  ======================================================================
B D          Bushbaby  ======================================================================
B D               Cow  ======================================================================
B D          Elephant  ======================================================================
B D           Manatee  ======================================================================
B D            Rhesus  ======================================================================
B D         Orangutan  ======================================================================
B D   Squirrel monkey  ======================================================================
B D               Pig  ======================================================================
B D             Panda  ======================================================================
B D               Dog  ======================================================================
B D          Marmoset  ======================================================================
B D    Naked mole-rat  ======================================================================
B D            Tenrec  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D        Tree shrew  ======================================================================
B D             Sheep  ======================================================================
B D            Medaka  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
  D  Little brown bat  ======================================================================
B D             Sloth  ======================================================================
B D         Armadillo  ======================================================================
B D               Cat  ======================================================================
B D          Hedgehog  ======================================================================
B D      Kangaroo rat  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  -tacctttgtatgttcttttctttt-ctcagattcctggatct---tgatgaaa----ttctccagaaat
                  Rat  -gacttttggctggtcttttcttct-ctcagattcctggattc---tgatgaaa----tgctcaagaaat
             Squirrel  -tccttctgtatatgttttcctttc-cccagtatcctagacccttgtgatgaag----tccatcagaaat
                Human  ttccttctggctgtcctttcctttt-cccagagtcccagacctttgtgataaag----tccaccagaaat
                Chimp  ttccttctggctgtcctttcctttt-cccagagtcgcagacctttgtgataaag----tccaccagaaat
              Gorilla  ttccttctggctgtcctttcctttt-cccagagtcccagaactttgtgataaag----tccaccagaaat
               Gibbon  ttccttctggctgtcttttcctttt-cccagagtcccagacctttgtgataaag----tccaccagaaat
               Baboon  ttccttctggctgtcctttcctttt-ccaagagtcccagacctttgtgataaag----tccaccagaaat
              Tarsier  ttcctcctgactgtcctttcctttc-cccagggtcctgaac--ttgtggtgaag----tccatcagaaat
          Mouse lemur  ttcattatggctgtcctttcttttt-cctagagtcctggattcttgacatgaag----tccaccaaaaat
              Dolphin  ttccttttggctgtggtttcctttt-cccagagccctggacccttgtgacatgatccttcctacagaaat
                Horse  ctc-ctctggctgtcttttcctttt-cccagagccctggatccttgtgacaaag----tccaagagaaat
              Megabat  ttctttctggctatcccttccttttacccagagctctggacccttgtgacaaag----tctaatagaaat
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
       Naked mole-rat  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================

                Mouse  gt-------atgcaag-------atccacttcttccaagatccaa
                  Rat  gt-------atgcaag-------atccacttcttccaagacccaa
             Squirrel  gcatgaggaatgcaaaataacacatctgcttcctctgagacccaa
                Human  gcatgcagaatgcaagataacaggtctgcttcctctgagacccaa
                Chimp  gcatgcagaatgcaagataacaggtctgcttcctctgagacccaa
              Gorilla  gcatgcagaatgcaagataacagttctgcttcctctgagacccaa
               Gibbon  gcatgcagaatgcaagataacaggtctgcttcctctgagacccaa
               Baboon  gcatgcagaatgcaagacaacaggtctgcttcctccgagactcaa
              Tarsier  acatccagaatgcaagataacaggtctgcttcccctaaggctcaa
          Mouse lemur  tcatccagaatgcaagataacaggtctgcttcctctgaggcccaa
              Dolphin  gccttcagagtgcaagatcataggtctgctttttctgggagccac
                Horse  gtatccagaatacaagatcataggtctgctttctctgaggcccaa
              Megabat  gcctccagagtgcaagatcataggtctgcttcctctgaggctcaa
               Rabbit  =============================================
           Guinea pig  =============================================
             Bushbaby  =============================================
                  Cow  =============================================
             Elephant  =============================================
              Manatee  =============================================
               Rhesus  =============================================
            Orangutan  =============================================
      Squirrel monkey  =============================================
                  Pig  =============================================
                Panda  =============================================
                  Dog  =============================================
             Marmoset  =============================================
       Naked mole-rat  =============================================
               Tenrec  =============================================
                 Pika  =============================================
               Alpaca  =============================================
           Tree shrew  =============================================
                Sheep  =============================================
               Medaka  =============================================
        X. tropicalis  =============================================
             Platypus  =============================================
               Turkey  =============================================
           Coelacanth  =============================================
      Tasmanian devil  =============================================
              Opossum  =============================================
               Lizard  =============================================
           Budgerigar  =============================================
          Zebra finch  =============================================
              Chicken  =============================================
       Painted turtle  =============================================
                Shrew  =============================================
     Little brown bat  =============================================
                Sloth  =============================================
            Armadillo  =============================================
                  Cat  =============================================
             Hedgehog  =============================================
         Kangaroo rat  =============================================
           Rock hyrax  =============================================

Inserts between block 20 and 21 in window
B D          Tarsier 388bp

Alignment block 21 of 373 in window, 56742611 - 56742620, 10 bps 
B D             Mouse  actaatccaa
B D               Rat  cctaa-ccaa
B D          Squirrel  ccaaatccaa
B D             Human  ccaaattcaa
B D             Chimp  ccaaattcaa
B D           Gorilla  ccaaattcaa
B D            Gibbon  ccaaattcaa
B D            Baboon  ccaaattcaa
B D           Tarsier  accattccga
B D       Mouse lemur  ccaaatccaa
B D           Dolphin  ccatatccag
B D             Horse  tcaaatccaa
B D           Megabat  ccaaatctaa
B D            Rabbit  ==========
B D        Guinea pig  ==========
B D          Bushbaby  ==========
B D               Cow  ==========
B D          Elephant  ==========
B D           Manatee  ==========
B D            Rhesus  ==========
B D         Orangutan  ==========
B D   Squirrel monkey  ==========
B D               Pig  ==========
B D             Panda  ==========
B D               Dog  ==========
B D          Marmoset  ==========
B D    Naked mole-rat  ==========
B D            Tenrec  ==========
B D              Pika  ==========
B D            Alpaca  ==========
B D        Tree shrew  ==========
B D             Sheep  ==========
B D            Medaka  ==========
B D     X. tropicalis  ==========
B D          Platypus  ==========
B D            Turkey  ==========
B D        Coelacanth  ==========
B D   Tasmanian devil  ==========
B D           Opossum  ==========
B D            Lizard  ==========
B D        Budgerigar  ==========
B D       Zebra finch  ==========
B D           Chicken  ==========
B D    Painted turtle  ==========
B D             Shrew  ==========
  D  Little brown bat  ==========
B D             Sloth  ==========
B D         Armadillo  ==========
B D               Cat  ==========
B D          Hedgehog  ==========
B D      Kangaroo rat  ==========
B D        Rock hyrax  ==========

Inserts between block 21 and 22 in window
B D         Squirrel 367bp
B D            Human 5bp
B D            Chimp 5bp
B D          Gorilla 5bp
B D           Gibbon 5bp
B D           Baboon 5bp
B D          Tarsier 5bp
B D      Mouse lemur 5bp

Alignment block 22 of 373 in window, 56742621 - 56742699, 79 bps 
B D             Mouse  -----gaactagctaaggctcctctcctggcatggcacttcacatcagtgcctgctctcctttctgcagg
B D               Rat  -----ggcctagcttaggctcccctccaggcctagcgcctcac-tcagcacctgctctcctttcccaagg
B D             Human  -----ggggtag---agatcttgttccaggtacagtgcctcac-ccagga---gctttcctctct----g
B D             Chimp  -----ggggtag---agatcttgttccaggtatagtgcctcac-ccagga---gctttcctctct----g
B D           Gorilla  -----gggatag---agatcttgttccaggtatagtgcctcac-ccagga---gctttcctctct----g
B D            Gibbon  -----ggggtag---agatcttgttccaggtgtagtgcctcac-ccagga---gctttcctctct----g
B D            Baboon  -----ggggtag---agatcttgttccaggtatagtgcctcac-ccagga---gctttcctctct----g
B D           Tarsier  -----aggccag---agatctcattccagagatggcgccttat-ccagga---actctcctctct----g
B D       Mouse lemur  -----ggtctgg---aggtctcattccagggatagtgcctcactccagga---gctttcctctct----g
B D           Dolphin  ctcctgggctac---agatctcc---------taggtcatcacccca-gg---gctttcctctca----g
B D             Horse  cccctgggagaa---agatctccttcctgggatagttactcgccccaggg---gctcttttctcg----g
B D           Megabat  tccctgggctgg---agatctctttccagggatagtttcttaccccaggg---gctttcctctct----g
B D            Rabbit  ======================================================================
B D        Guinea pig  ======================================================================
B D          Bushbaby  ======================================================================
B D               Cow  ======================================================================
B D          Elephant  ======================================================================
B D           Manatee  ======================================================================
B D          Squirrel  ======================================================================
B D            Rhesus  ======================================================================
B D         Orangutan  ======================================================================
B D   Squirrel monkey  ======================================================================
B D               Pig  ======================================================================
B D             Panda  ======================================================================
B D               Dog  ======================================================================
B D          Marmoset  ======================================================================
B D    Naked mole-rat  ======================================================================
B D            Tenrec  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D        Tree shrew  ======================================================================
B D             Sheep  ======================================================================
B D            Medaka  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
  D  Little brown bat  ======================================================================
B D             Sloth  ======================================================================
B D         Armadillo  ======================================================================
B D               Cat  ======================================================================
B D          Hedgehog  ======================================================================
B D      Kangaroo rat  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  cagctgcaggtcct
                  Rat  cagctacagttcct
                Human  gagcagtaaatcct
                Chimp  gagcagtaaatcct
              Gorilla  gagcagtaaatcct
               Gibbon  gagcagtaaatcct
               Baboon  gagcagtagatcct
              Tarsier  aagcagtagatcct
          Mouse lemur  cagcagtagatcct
              Dolphin  gagcagcagatcct
                Horse  gagcggtagatcct
              Megabat  gagcagtaggtcct
               Rabbit  ==============
           Guinea pig  ==============
             Bushbaby  ==============
                  Cow  ==============
             Elephant  ==============
              Manatee  ==============
             Squirrel  ==============
               Rhesus  ==============
            Orangutan  ==============
      Squirrel monkey  ==============
                  Pig  ==============
                Panda  ==============
                  Dog  ==============
             Marmoset  ==============
       Naked mole-rat  ==============
               Tenrec  ==============
                 Pika  ==============
               Alpaca  ==============
           Tree shrew  ==============
                Sheep  ==============
               Medaka  ==============
        X. tropicalis  ==============
             Platypus  ==============
               Turkey  ==============
           Coelacanth  ==============
      Tasmanian devil  ==============
              Opossum  ==============
               Lizard  ==============
           Budgerigar  ==============
          Zebra finch  ==============
              Chicken  ==============
       Painted turtle  ==============
                Shrew  ==============
     Little brown bat  ==============
                Sloth  ==============
            Armadillo  ==============
                  Cat  ==============
             Hedgehog  ==============
         Kangaroo rat  ==============
           Rock hyrax  ==============

Inserts between block 22 and 23 in window
B D          Tarsier 1649bp
B D      Mouse lemur 772bp
B D          Dolphin 87bp
B D          Megabat 341bp

Alignment block 23 of 373 in window, 56742700 - 56742700, 1 bps 
B D             Mouse  a
B D               Rat  a
B D             Human  a
B D             Chimp  a
B D           Gorilla  a
B D            Gibbon  a
B D            Baboon  a
B D             Horse  g
B D            Rabbit  =
B D        Guinea pig  =
B D          Bushbaby  =
B D               Cow  =
B D          Elephant  =
B D           Manatee  =
B D          Squirrel  =
B D            Rhesus  =
B D         Orangutan  =
B D   Squirrel monkey  =
B D               Pig  =
B D             Panda  =
B D               Dog  =
B D          Marmoset  =
B D    Naked mole-rat  =
B D           Tarsier  =
B D            Tenrec  =
B D              Pika  =
B D            Alpaca  =
B D        Tree shrew  =
B D             Sheep  =
B D            Medaka  =
B D     X. tropicalis  =
B D          Platypus  =
B D            Turkey  =
B D        Coelacanth  =
B D   Tasmanian devil  =
B D           Opossum  =
B D            Lizard  =
B D        Budgerigar  =
B D       Zebra finch  =
B D           Chicken  =
B D    Painted turtle  =
B D             Shrew  =
  D  Little brown bat  =
B D             Sloth  =
B D         Armadillo  =
B D               Cat  =
B D       Mouse lemur  =
B D          Hedgehog  =
B D      Kangaroo rat  =
B D        Rock hyrax  =
B D           Megabat  =
B D           Dolphin  =

Inserts between block 23 and 24 in window
B D            Human 15bp
B D            Chimp 346bp
B D          Gorilla 345bp
B D           Gibbon 346bp
B D           Baboon 311bp
B D            Horse 15bp

Alignment block 24 of 373 in window, 56742701 - 56742745, 45 bps 
B D             Mouse  cctacccttgcaaggagtggttgcctggtattaagaagtccctac
B D               Rat  cctatcttt----ggtcttgctgcctggtgttaagaaatgtccat
B D             Human  cttatccct-caaggtg-agtaccctgg--ctaaga--tctctgc
B D             Horse  cctatccct---tggta-agcatccttg--gtaagaactctccac
B D            Rabbit  =============================================
B D        Guinea pig  =============================================
B D          Bushbaby  =============================================
B D               Cow  =============================================
B D          Elephant  =============================================
B D           Manatee  =============================================
B D          Squirrel  =============================================
B D            Rhesus  =============================================
B D         Orangutan  =============================================
B D   Squirrel monkey  =============================================
B D               Pig  =============================================
B D             Panda  =============================================
B D               Dog  =============================================
B D          Marmoset  =============================================
B D            Gibbon  =============================================
B D           Gorilla  =============================================
B D             Chimp  =============================================
B D    Naked mole-rat  =============================================
B D           Tarsier  =============================================
B D            Tenrec  =============================================
B D              Pika  =============================================
B D            Alpaca  =============================================
B D        Tree shrew  =============================================
B D             Sheep  =============================================
B D            Medaka  =============================================
B D     X. tropicalis  =============================================
B D          Platypus  =============================================
B D            Turkey  =============================================
B D        Coelacanth  =============================================
B D   Tasmanian devil  =============================================
B D           Opossum  =============================================
B D            Lizard  =============================================
B D        Budgerigar  =============================================
B D       Zebra finch  =============================================
B D           Chicken  =============================================
B D    Painted turtle  =============================================
B D             Shrew  =============================================
  D  Little brown bat  =============================================
B D            Baboon  =============================================
B D             Sloth  =============================================
B D         Armadillo  =============================================
B D               Cat  =============================================
B D       Mouse lemur  =============================================
B D          Hedgehog  =============================================
B D      Kangaroo rat  =============================================
B D        Rock hyrax  =============================================
B D           Megabat  =============================================
B D           Dolphin  =============================================

Alignment block 25 of 373 in window, 56742746 - 56742755, 10 bps 
B D             Mouse  ttcattagtc
B D               Rat  tttgttaatc
B D             Horse  ttgatgagtc
B D            Rabbit  ==========
B D        Guinea pig  ==========
B D          Bushbaby  ==========
B D               Cow  ==========
B D          Elephant  ==========
B D           Manatee  ==========
B D          Squirrel  ==========
B D            Rhesus  ==========
B D         Orangutan  ==========
B D   Squirrel monkey  ==========
B D               Pig  ==========
B D             Panda  ==========
B D               Dog  ==========
B D          Marmoset  ==========
B D            Gibbon  ==========
B D           Gorilla  ==========
B D             Chimp  ==========
B D    Naked mole-rat  ==========
B D             Human  ----------
B D           Tarsier  ==========
B D            Tenrec  ==========
B D              Pika  ==========
B D            Alpaca  ==========
B D        Tree shrew  ==========
B D             Sheep  ==========
B D            Medaka  ==========
B D     X. tropicalis  ==========
B D          Platypus  ==========
B D            Turkey  ==========
B D        Coelacanth  ==========
B D   Tasmanian devil  ==========
B D           Opossum  ==========
B D            Lizard  ==========
B D        Budgerigar  ==========
B D       Zebra finch  ==========
B D           Chicken  ==========
B D    Painted turtle  ==========
B D             Shrew  ==========
  D  Little brown bat  ==========
B D            Baboon  ==========
B D             Sloth  ==========
B D         Armadillo  ==========
B D               Cat  ==========
B D       Mouse lemur  ==========
B D          Hedgehog  ==========
B D      Kangaroo rat  ==========
B D        Rock hyrax  ==========
B D           Megabat  ==========
B D           Dolphin  ==========

Inserts between block 25 and 26 in window
B D            Horse 3bp

Alignment block 26 of 373 in window, 56742756 - 56743190, 435 bps 
B D             Mouse  ctactgatcaatgaggttgggagatatttccatcttctgatatctccttcaa-ttctctttttaggaact
B D               Rat  ctacagatccatgaacttgggagatctttccatcttctgatatcttattcaatttctcttttcagggact
B D            Rabbit  ======================================================================
B D        Guinea pig  ======================================================================
B D          Bushbaby  ======================================================================
B D               Cow  ======================================================================
B D          Elephant  ======================================================================
B D           Manatee  ======================================================================
B D          Squirrel  ======================================================================
B D            Rhesus  ======================================================================
B D         Orangutan  ======================================================================
B D   Squirrel monkey  ======================================================================
B D               Pig  ======================================================================
B D             Horse  ======================================================================
B D             Panda  ======================================================================
B D               Dog  ======================================================================
B D          Marmoset  ======================================================================
B D            Gibbon  ======================================================================
B D           Gorilla  ======================================================================
B D             Chimp  ======================================================================
B D    Naked mole-rat  ======================================================================
B D             Human  ----------------------------------------------------------------------
B D           Tarsier  ======================================================================
B D            Tenrec  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D        Tree shrew  ======================================================================
B D             Sheep  ======================================================================
B D            Medaka  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
  D  Little brown bat  ======================================================================
B D            Baboon  ======================================================================
B D             Sloth  ======================================================================
B D         Armadillo  ======================================================================
B D               Cat  ======================================================================
B D       Mouse lemur  ======================================================================
B D          Hedgehog  ======================================================================
B D      Kangaroo rat  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Megabat  ======================================================================
B D           Dolphin  ======================================================================

                Mouse  tgaagttcttgtcatacagatctttcacttgcttggttaaagttataccaagctattttatagtaattat
                  Rat  tgaagttcttgtcacccagatctttcacttgtttggtcggagttataccaagatattttatattgtttgt
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  ggctattgtgaagggtgttgtttccctaatttctttctcagctcatttatcatttgtttaaaggggaatt
                  Rat  ggctattgtgaagggtgtcatttccctaatttctttctcaggtcatttatcactagtttaaaggggaatt
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  attgaattctttgcattaattttatatccatctactttgctgaacttgtttatcagctgttggagttctc
                  Rat  attgatatctttgcattaattttatagccagtcactttgctgaagttgtctatcagctgcaggagttctt
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  ggttagaatttttggggttgcttatgtatactatcatatcatctgtgaatagtgatactttgacttcttc
                  Rat  aggtagaa-tttggagctctcttatgtatactattatatcatctatgaatagtgataccttgacttcttc
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  ttttccaatttttatcccagtgatctcctttggttgtcttattgttttagtaaaaatgatagtcttacca
                  Rat  ctttccaattttt-tcccattgatctccttttgttgtcctattgttctagtaaaactggtcatcttatca
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  aacgcaatctgtagat
                  Rat  aaagcaatctacagat
               Rabbit  ================
           Guinea pig  ================
             Bushbaby  ================
                  Cow  ================
             Elephant  ================
              Manatee  ================
             Squirrel  ================
               Rhesus  ================
            Orangutan  ================
      Squirrel monkey  ================
                  Pig  ================
                Horse  ================
                Panda  ================
                  Dog  ================
             Marmoset  ================
               Gibbon  ================
              Gorilla  ================
                Chimp  ================
       Naked mole-rat  ================
                Human  ----------------
              Tarsier  ================
               Tenrec  ================
                 Pika  ================
               Alpaca  ================
           Tree shrew  ================
                Sheep  ================
               Medaka  ================
        X. tropicalis  ================
             Platypus  ================
               Turkey  ================
           Coelacanth  ================
      Tasmanian devil  ================
              Opossum  ================
               Lizard  ================
           Budgerigar  ================
          Zebra finch  ================
              Chicken  ================
       Painted turtle  ================
                Shrew  ================
     Little brown bat  ================
               Baboon  ================
                Sloth  ================
            Armadillo  ================
                  Cat  ================
          Mouse lemur  ================
             Hedgehog  ================
         Kangaroo rat  ================
           Rock hyrax  ================
              Megabat  ================
              Dolphin  ================

Inserts between block 26 and 27 in window
B D              Rat 745bp

Alignment block 27 of 373 in window, 56743191 - 56744832, 1642 bps 
B D             Mouse  ttgtttttgttagggttttactgctgtgaacagataccatgaccaatgcaaatcttataagggacaatat
B D            Rabbit  ======================================================================
B D        Guinea pig  ======================================================================
B D          Bushbaby  ======================================================================
B D               Cow  ======================================================================
B D          Elephant  ======================================================================
B D           Manatee  ======================================================================
B D          Squirrel  ======================================================================
B D            Rhesus  ======================================================================
B D         Orangutan  ======================================================================
B D   Squirrel monkey  ======================================================================
B D               Pig  ======================================================================
B D             Horse  ======================================================================
B D             Panda  ======================================================================
B D               Dog  ======================================================================
B D          Marmoset  ======================================================================
B D            Gibbon  ======================================================================
B D           Gorilla  ======================================================================
B D             Chimp  ======================================================================
B D    Naked mole-rat  ======================================================================
B D             Human  ----------------------------------------------------------------------
B D           Tarsier  ======================================================================
B D            Tenrec  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D        Tree shrew  ======================================================================
B D             Sheep  ======================================================================
B D            Medaka  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
  D  Little brown bat  ======================================================================
B D            Baboon  ======================================================================
B D             Sloth  ======================================================================
B D         Armadillo  ======================================================================
B D               Cat  ======================================================================
B D       Mouse lemur  ======================================================================
B D          Hedgehog  ======================================================================
B D      Kangaroo rat  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Megabat  ======================================================================
B D           Dolphin  ======================================================================
B D               Rat  ======================================================================

                Mouse  ttaattggggctggcttacaggtttagaggttcagtccattatcaccaaggcaggagcatggcagcgtcc
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  aggcagccatggtgcaggaggagctgagggttctacctcttcatctgaaggttgctagtggaaggctgac
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  ttccaggcaggtagggtaagagtctcaagcccacagtgacacacctacttcaacaaggccacacctctta
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  atagtaccacaccctggggcaagcatatacaaaccatcacaagattcaatgcaattcctatcaacattcc
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  aacacaattttttttttttacagaccttgaaaaggtacctctcagcttcatatggaaaacaaaaaatcca
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  cgacagctaaaacaactctgaacaataaaagaacttctggaggaagcatcatccctgatctcaagctgta
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  ctacagagcaatagtgataaaaactgcatgacattggtatagagacagacaggatgatcagtggaataga
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  atcaaagaatcagaaataaatccatatacctatggacccttgatttttgacaaagaagccaaaaccatac
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  agtgaaaaacagaaagcatttacaactaatggtgctggtttaagtaaatgtctgaatgtagaaaaatgca
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  aatagatccatatttatcaccatgcacaaaactcaattccaagtggatcaaggacctcaacataaaactg
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  gataaattaaatctactataagagaaagtgggaaataaccttgaatacactggtataggagacaatttct
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  tgaacagaacaccagtgtgtcaaagatcaacaattgataaatgggaacttataaaactgaaaggcaaata
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  tattgtcaataggacaaaatggcactatactgattgggaaaagatcttcactaaccatatgtccgacaga
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  gggctaatatccaaaatatataaaattctcaaaaagttagactccaacaaatcaaataactcaattaaaa
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  atgggatacagagataaacatcttttttcttattttatttattttttattagatattttctttatataca
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  ttccaaatgctatcctgaaagttccctatacactccctccgccctcctcccctacccacccactcccact
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  tcttggccctggcattcccctgtactggggcatataaagtttgcaataccaaggggcctctctcttttct
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  tttttaatatttttttattacatattttcctcaattacatttccaatgctatcccaaaagtcccccatac
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  cctcccccccacttctctacccacccattcccatttttttggccctggcgttcccctgtactggggcata
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  tacagtttgcgtgtccaatgggcctctctttccagtgatggccgactaggccaccttttgatacatatgc
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  agctagagtcaagagctccggggtactggttagttaataatgttgttccatctatagggttgcagatccc
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  aaggggcctctcttcccagtgatggccgactaggccatcttctgctacatatacagctagagatatgagc
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================
                  Rat  ======================================================================

                Mouse  tctgggggggggtactggttagttcatattcc
               Rabbit  ================================
           Guinea pig  ================================
             Bushbaby  ================================
                  Cow  ================================
             Elephant  ================================
              Manatee  ================================
             Squirrel  ================================
               Rhesus  ================================
            Orangutan  ================================
      Squirrel monkey  ================================
                  Pig  ================================
                Horse  ================================
                Panda  ================================
                  Dog  ================================
             Marmoset  ================================
               Gibbon  ================================
              Gorilla  ================================
                Chimp  ================================
       Naked mole-rat  ================================
                Human  --------------------------------
              Tarsier  ================================
               Tenrec  ================================
                 Pika  ================================
               Alpaca  ================================
           Tree shrew  ================================
                Sheep  ================================
               Medaka  ================================
        X. tropicalis  ================================
             Platypus  ================================
               Turkey  ================================
           Coelacanth  ================================
      Tasmanian devil  ================================
              Opossum  ================================
               Lizard  ================================
           Budgerigar  ================================
          Zebra finch  ================================
              Chicken  ================================
       Painted turtle  ================================
                Shrew  ================================
     Little brown bat  ================================
               Baboon  ================================
                Sloth  ================================
            Armadillo  ================================
                  Cat  ================================
          Mouse lemur  ================================
             Hedgehog  ================================
         Kangaroo rat  ================================
           Rock hyrax  ================================
              Megabat  ================================
              Dolphin  ================================
                  Rat  ================================

Alignment block 28 of 373 in window, 56744833 - 56746542, 1710 bps 
B D             Mouse  aacagaggaatcttgaatggccaagaagcacttaaagaaatgttcaaagtccttagtcatcagggaaatg
B D               Rat  aacagaggaatcttgaatggccaggaagtacttaaagacatgttcaaagttcttagtcatcagggaaatg
B D            Rabbit  ======================================================================
B D        Guinea pig  ======================================================================
B D          Bushbaby  ======================================================================
B D               Cow  ======================================================================
B D          Elephant  ======================================================================
B D           Manatee  ======================================================================
B D          Squirrel  ======================================================================
B D            Rhesus  ======================================================================
B D         Orangutan  ======================================================================
B D   Squirrel monkey  ======================================================================
B D               Pig  ======================================================================
B D             Horse  ======================================================================
B D             Panda  ======================================================================
B D               Dog  ======================================================================
B D          Marmoset  ======================================================================
B D            Gibbon  ======================================================================
B D           Gorilla  ======================================================================
B D             Chimp  ======================================================================
B D    Naked mole-rat  ======================================================================
B D             Human  ----------------------------------------------------------------------
B D           Tarsier  ======================================================================
B D            Tenrec  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D        Tree shrew  ======================================================================
B D             Sheep  ======================================================================
B D            Medaka  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
  D  Little brown bat  ======================================================================
B D            Baboon  ======================================================================
B D             Sloth  ======================================================================
B D         Armadillo  ======================================================================
B D               Cat  ======================================================================
B D       Mouse lemur  ======================================================================
B D          Hedgehog  ======================================================================
B D      Kangaroo rat  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Megabat  ======================================================================
B D           Dolphin  ======================================================================

                Mouse  caaatcaaaatgaccccgagagtccaccttacaccaatga-----------------gaatggctaagat
                  Rat  caaatcaaaatgacccagagagtctaccttacaccaatgatcttagctattacatctgaatgcttaagat
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  taaaacctcaacccacagcagatgctggcgaggatgtggagaaagggaaactctcctccattgctggtgg
                  Rat  caaaaactcaatcaa-agcagatgctggtgaggatgtggagaaaagggaatgttcttccattgctggtgg
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  gatcgcaaacttgtacaacttctctggaaaccaatctggccattcctcagaaaattggaaatagaaaatt
                  Rat  gattgcaaacttgtacaaactctctggaactcaatctggcagtttctcagaaaattggaaatag----tt
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  gaaaacctgaagaaccagctatgccgctcctaagcatatagccaaaaa-tgctccaccatactacaagga
                  Rat  ctata--tgaagacccagatataccacctctgggcatgtatccaaaaggtgctccacc-taccacaagga
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  cacatgctccactgtgttcatagcagccatattcataatagccagaaactgaaagcaacccagatgtccc
                  Rat  cacatgctccactatgttca-----gctttatccttaatagccagaaactggaagcaacccagatgtccc
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  tcaaccaaagtatggaaagagaaaatgtggttcatttacacatgtggaatattatttggctattaaaaac
                  Rat  tcaaccaaagtatggatgcatccaaaatggttcatttacaca-gtggaacactattcagccattatagac
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  aaggacatcaagaattttgtaggcaaatggatcaaactagaaaatattatcctgagtgaggctaccaagt
                  Rat  aagggcatcatgaacttagcaaacaaatggatcaaactagaaaatatcatcctgaacgaggttaccaaga
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  cccaaaaggaccatgcatggtatgtactcactgataagtgaatattagctacaaagtacaggatatccat
                  Rat  cccaaaaggac-atgcatggtatatactcattgataagtagacactagccacaaagtacaggatacacat
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  gatacaccc-acagacctaaagaagttaaataagaaggaaggttcaagcgagggtgcttaaatcttaatt
                  Rat  tatacaccccacacacctaaagaa-------aaacaagaaggttcaagcgaggatgcttgaatcttactt
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ======================================================================
             Marmoset  ======================================================================
               Gibbon  ======================================================================
              Gorilla  ======================================================================
                Chimp  ======================================================================
       Naked mole-rat  ======================================================================
                Human  ----------------------------------------------------------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
           Tree shrew  ======================================================================
                Sheep  ======================================================================
               Medaka  ======================================================================
        X. tropicalis  ======================================================================
             Platypus  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
     Little brown bat  ======================================================================
               Baboon  ======================================================================
                Sloth  ======================================================================
            Armadillo  ======================================================================
                  Cat  ======================================================================
          Mouse lemur  ======================================================================
             Hedgehog  ======================================================================
         Kangaroo rat  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================
              Dolphin  ======================================================================

                Mouse  ggaagagggaataaaagaatctttggaggtggatggagggaggaaactggctgagagaggggctaggaag
                  Rat  aggaggaggaataaaatagtcattggagattgatggagggaaga---tggctgggagaggtgataggaaa
               Rabbit  ======================================================================
           Guinea pig  ======================================================================
             Bushbaby  ======================================================================
                  Cow  ======================================================================
             Elephant  ======================================================================
              Manatee  ======================================================================
             Squirrel  ======================================================================
               Rhesus  ======================================================================
            Orangutan  ======================================================================
      Squirrel monkey  ======================================================================
                  Pig  ======================================================================
                Horse  ======================================================================
                Panda  ======================================================================
                  Dog  ============