Multiz Alignments of 100 Vertebrates

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1078 in window, 56741761 - 56741838, 78 bps 
B D                     Human  tactttcttcaagtgctcccaacgctgaagtgaattgtgagacttttggaagct-ttgttgaagttcatc
B D                     Chimp  tactttcttcaagtgctcccaacgctgaagtgaattgtgagacttttggaagct-ttgttgaagttcatc
B D                   Gorilla  tactttcttcaagtgctcccaacgctgaagtgaattgtgagacttttggaagcg-ttgttgaagttcatc
B D                 Orangutan  tactttcttcaagtgctcccaacgctgaagtgaattgtgagacttttggaagct-ttgttgaagttcatc
B D                    Gibbon  tactttcttcaagtgctcccaacgctgaagtgaactgtgagacttttggaagtt-ttgttgaagttcatc
B D                    Rhesus  tactttcttcaagtgctcccaacgctgaagtgaattgtgagacttttggaagcc-ttgttgaagttcatc
B D       Crab-eating macaque  tactttcttcaagtgctcccaacgctgaagtgaattgtgagacttttggaagcc-ttgttgaagttcatc
B D                    Baboon  tactttcttcaagtgctcccaacgctgaagtgaattgtgagacttttggaagcc-ttgttgaagttcatc
B D              Green monkey  tactttcttcaagtgctcccaacgctgaagtgaattgtgagacttttggaagcc-ttgttgaagttcatc
B D                  Marmoset  tgctttcttcaagtgctcccaacgctgaagtgaactgtgagacttttggaagct-ttgttggagttcatc
B D           Squirrel monkey  tgctttcttcaagtgctcccaacgctgaagtgaactgtgagacttttggaagtt-ttgttgaagttcatc
B D                  Bushbaby  tgctttcttcaaatgctcccaacgctgatgtgaactgtgagacttttggaagtt-ttgttgaagttcatc
           Chinese tree shrew  tactttcttcaaatgttcccagcgctgaagtgaattgtgagacttttggaagtt-ttgttgaagttcatc
B D                  Squirrel  tactctcttcaaatactcccatctctgaagtgaactgtgagacttttggaagtt-tttttgaagatcttc
       Lesser Egyptian jerboa  tgttttcttcaattgctcccagcgctgaagtgaactgtgagacttctggaagtg-cttttgaagttcatc
                 Prairie vole  cactttcttcagatactcccagcgctgagatgaactgtgaagcctttgaaagcc-cttctgaagctcatc
B D           Chinese hamster  cactttcctcagatattcccagcgttgaggtgaactgtgaagcctttggaagcc-tctctgaagctcttc
               Golden hamster  cactttcctcagatactcccagcgttgagatgaactgtgaagcctttggaagcc-cctctgaagctcatc
B D                     Mouse  cactttcctcaggtgttcccagcgctgaggtgaactgtggaacttctggaaccc-tctttgcagctcatc
B D                       Rat  cactttcctcaggtattcccagcgctgaggtgaactgtgaaatctctgaaaccc-tttttgcagctcatc
B D            Naked mole-rat  tattcttttcagatgctcccaacgctgaagtgaattatgagacttctggaagta-tggttgaagttcttc
B D                Guinea pig  tactcttttcagatgctcccaacgctgaactgaattgtgagacttctggaagca-tgtctgaagttcttc
                   Chinchilla  tactctttttagatgctcccaacgctgaagtgaattgtgagacttctggaacgc-tgtctgaaggtcttc
             Brush-tailed rat  tactttttttagatgctcccaacgctgaagtgaattgtgagacttctggaagtt-tgtctgaagttcttc
B D                    Rabbit  tgttttcttcaggtgctcccaacgctgaagagagctgtgacacttctggaagcc-ttgttgaagatcagc
B D                      Pika  aactttcttcaaatattcccaacgttgaagggaattgtgacacttgacgaagcc-ttgctgaagttcatc
B D                       Pig  tgctttcttcaaatactcccaacgctgaagtgaattctgatgcttttggaagct-ttgttgaagttcatc
B D                    Alpaca  tgcttttttcaaatgctcccaacgctgaagtgaattgtgatccttttgaaagtt-ctgttgaagtttatc
               Bactrian camel  tgcttttttcaaatgctcccaacgctgaagtgaattgtgatccttttgaaagtt-ctgttgaagttcatc
B D                   Dolphin  tgctttcttcaaatgctcccagcgctgaagtgaattgtgatgcttttggaagct-ttgttgaagttcatc
                 Killer whale  tgctttcttcaaatgctcccagcgctgaagtgaattgtgatgcttttggaagct-ttgttgaagttcatc
             Tibetan antelope  ggtgttcttcaaattctcccaacgctgaagtgaattgctatgccttgggaagcc-ttgttgaagttcatc
B D                       Cow  ggtgttcttcaaagtctcccaacgctgaggtgaattgctctgcctttggaagcc-ttgttgaagttcatc
B D                     Sheep  ggtgttcttcaaattctcccaacgctgaagtgaattgctatgcctttggaagcc-ttgttgaagttcatc
                Domestic goat  ggtgttcttcaaattctcccaacgctgaagtgaattgctatgcctttggaagcc-ttgttgaagttcatc
B D                     Horse  tgccttcttcaaatactcccaacgctgaagtgaactgtgatgcttttggaagtt-ctgttgaaggtcatt
B D          White rhinoceros  ggctttcttcaattcctcccaacgctgaagtgaattgtgatgcttttggaagct-ttgttgaagttcacc
B D                       Cat  ggttttcttcaaatactcccaacgctgaagtgaattgtgatgcttttggaagtt-ttgttgaagtttctc
B D                       Dog  ggctttctttaaacactcccaacgctgaagtgaattgtgatgcttctggaagtt-ttgttgaagtttctc
B D                   Ferret   ggctttcatcaaatattcccaacgctgaagtgaattgtgatacttcgggaagtt-ttgctgaagtgtctc
B D                     Panda  gccttgcttcaaatattcccaacgctgaagtgaactgtgacacttctggaagtt-ttgctgaagtttctc
               Pacific walrus  ggctttcttcaaatattcccaacgctgaagtgaattgtgatacttctggaagtt-ttgctgaagtttctc
                 Weddell seal  ggctttcttcaaatattcccaacgctgaagtgaattgtgatgcttctggaagtt-ttgctgaagattctc
             Black flying-fox  tactttcttcaaatgctcccaacgctgaagtgaactgtgatgattttggaagac-ttgttgaagttcatc
B D                   Megabat  tactttcttcaaatgctcccaacgctgaagtgaactgtgatgattttggaagactttgttgaagttcatc
                Big brown bat  cactttcttcaaatgctcccaacgctgaagtgaactgtgatgcttttggaagat-tggttgaaggtcatc
         David's myotis (bat)  ctttttcttcaaatgctcccaacgctgaagtgaactgtgaggcttttggaagat-ttcttgaaggccatc
  D          Little brown bat  ctttttcttcaaatgctcccaacgctgaagtgaactgtgaggcttttggaagat-ttcttgaaggccatc
B D                  Hedgehog  cactttcttcaaatactcccaacgctgaagtgagttgtgctgcttttggaagct-ttgttgaagttcatc
B D                     Shrew  tactttcttcaaatactcccaacgctgaagtgagctatgacacttctggaaatt-acgttgaagatcatc
              Star-nosed mole  tgttttctttaaatgctcccaacgttgaagtgaattgtgatgcttttgaaagcc-acacagaagttcttc
B D                  Elephant  tactttcttgaaatattcccaacgctgaagcgaactgtgatacttctggaagcc-ttgttgaaggtcatc
          Cape elephant shrew  tattttcctcaaatattcccatcgctgaagtgaattgtgacatttttggaagcc-ttgctgaagttcatc
B D                   Manatee  tacttccttcaaatgttcccaacgctgaagtgaactgtgacacttctggaagcc-ttgttgaagctcatc
             Cape golden mole  tactgtcttcaaatatttccaccgctgaagtgaattgtgacatttttggaagcc-ttcttgaagtttatc
B D                    Tenrec  tgatttcttcaaatgttcccaacgctgaagtgaactgtggcacgtctggaagcg-ttcttgaagttcacc
                     Aardvark  tgtgtccttcaaatgttcccaacgctgaagtgaactctgacatttttggaagtc-tctttgaagttcatc
B D                 Armadillo  tactttcttcaagtactcccaacgctgaagtgagttgtgatgcttttggaaggc-ttgctgaagatcatc
B D                   Opossum  tactttcttcaaatattcccaatgctggactgaattgtgacatctttggaatcc-ttgctaaagatcagc
B D           Tasmanian devil  tacttgtttcaaatgttcccaacgctgaacagaattatgaaatttctggaatcc-ttgctgaagctcagc
B D                   Wallaby  tactttcttcaaatgttcccagcgctggactgaatcatgacacttctggaatcc-ttgctgaaggtcagc
B D                  Platypus  caccttcttcaggtgatgccagcgctgccgggagccggggagcttgggcaagtc-gctctgcagggtctc
  D            Painted turtle  cttctttttcaggagctcccagcgctggactgaatcatgctttttggggaattc-ccgcagcaggctctc
B D               Stickleback  atgatccttcaccagtttccaacgggtctctggtttcttctcgttttggaagac-ctgctgtaattcttt
B D                   Lamprey  ======================================================================
B D                Coelacanth  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  atg-aattgg
                        Chimp  atg-aattgg
                      Gorilla  atg-aattgg
                    Orangutan  atg-aattgg
                       Gibbon  atg-aattgg
                       Rhesus  atg-aattag
          Crab-eating macaque  atg-aattag
                       Baboon  atg-aattag
                 Green monkey  atg-aattag
                     Marmoset  acg-aattgg
              Squirrel monkey  atg-aattgg
                     Bushbaby  atg-aattgg
           Chinese tree shrew  atg-attagg
                     Squirrel  atg-aatagg
       Lesser Egyptian jerboa  atg-aattgg
                 Prairie vole  atg-aattgg
              Chinese hamster  gtg-aatggg
               Golden hamster  gtg-aatggg
                        Mouse  atg-aattgg
                          Rat  atg-aactgg
               Naked mole-rat  atg-aattgg
                   Guinea pig  atg-aattgg
                   Chinchilla  atg-aattgg
             Brush-tailed rat  atg-aattgg
                       Rabbit  atg-aattgg
                         Pika  atg-aattgg
                          Pig  atg-cattgg
                       Alpaca  atg-cattgg
               Bactrian camel  atg-cattgg
                      Dolphin  atg-cattgg
                 Killer whale  atg-cattgg
             Tibetan antelope  acg-cattgg
                          Cow  acg-cactgg
                        Sheep  acg-cattgg
                Domestic goat  acg-cattgg
                        Horse  atg-cattgg
             White rhinoceros  atg-aattgg
                          Cat  atg-aattgg
                          Dog  atg-aattgg
                      Ferret   atg-aattgg
                        Panda  atg-aattgg
               Pacific walrus  atg-aattgg
                 Weddell seal  atg-aattgg
             Black flying-fox  atg-aattag
                      Megabat  atgaaattag
                Big brown bat  atg-catcgg
         David's myotis (bat)  atg-cattgg
             Little brown bat  atg-cattgg
                     Hedgehog  atg-aactgg
                        Shrew  atg-cagtgg
              Star-nosed mole  atg-aattgg
                     Elephant  atg-cattgg
          Cape elephant shrew  atg-aatcgg
                      Manatee  atg-cattgg
             Cape golden mole  atg-cattgg
                       Tenrec  att-cattgg
                     Aardvark  atg-catcag
                    Armadillo  atg-aattgg
                      Opossum  atg-aagaga
              Tasmanian devil  atg-aagagg
                      Wallaby  atg-aatagg
                     Platypus  gcg-cagcgg
               Painted turtle  tcg-aaccgg
                  Stickleback  tct-cacatg
                      Lamprey  ==========
                   Coelacanth  ==========
                 Atlantic cod  ==========
                  Spotted gar  ==========
           Southern platyfish  ==========
       Yellowbelly pufferfish  ==========
                         Fugu  ==========
                       Turkey  ==========
                      Chicken  ==========
           Tibetan ground jay  ==========
                  Zebra finch  ==========
     Mexican tetra (cavefish)  ==========
                    Zebrafish  ==========
                       Medaka  ==========
          Pundamilia nyererei  ==========
                  Zebra mbuna  ==========
        Burton's mouthbreeder  ==========
          Princess of Burundi  ==========
                 Nile tilapia  ==========
                X. tropicalis  ==========
              Green seaturtle  ==========
           American alligator  ==========
                Scarlet macaw  ==========
                  Rock pigeon  ==========
          Collared flycatcher  ==========
          Medium ground finch  ==========
                       Lizard  ==========
             Peregrine falcon  ==========
                 Saker falcon  ==========
                       Parrot  ==========
     Chinese softshell turtle  ==========

Alignment block 2 of 1078 in window, 56741839 - 56741840, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Bushbaby  tg
           Chinese tree shrew  tg
B D                  Squirrel  tg
       Lesser Egyptian jerboa  tg
                 Prairie vole  tg
B D           Chinese hamster  tg
               Golden hamster  tg
B D                     Mouse  tg
B D                       Rat  tg
B D            Naked mole-rat  tg
B D                Guinea pig  tg
                   Chinchilla  tg
             Brush-tailed rat  tg
B D                    Rabbit  tg
B D                      Pika  tg
B D                       Pig  tg
B D                    Alpaca  tg
               Bactrian camel  tg
B D                   Dolphin  tg
                 Killer whale  tg
             Tibetan antelope  tg
B D                       Cow  tg
B D                     Sheep  tg
                Domestic goat  tg
B D                     Horse  tg
B D          White rhinoceros  tg
B D                       Cat  tg
B D                       Dog  ta
B D                   Ferret   tg
B D                     Panda  tg
               Pacific walrus  tg
                 Weddell seal  tg
             Black flying-fox  tg
B D                   Megabat  tg
                Big brown bat  tg
         David's myotis (bat)  tg
  D          Little brown bat  tg
B D                  Hedgehog  ta
B D                     Shrew  tg
              Star-nosed mole  ta
B D                  Elephant  tg
          Cape elephant shrew  tg
B D                   Manatee  tg
             Cape golden mole  ta
B D                    Tenrec  ta
                     Aardvark  tg
B D                 Armadillo  tg
B D           Tasmanian devil  tg
B D                   Wallaby  tg
B D                  Platypus  tg
  D            Painted turtle  tg
B D               Stickleback  tg
B D                   Lamprey  ==
B D                Coelacanth  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                    Turkey  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                   Opossum  --
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
  D  Chinese softshell turtle  ==

Inserts between block 2 and 3 in window
B D                 Platypus 95bp

Alignment block 3 of 1078 in window, 56741841 - 56741857, 17 bps 
B D                     Human  --atgggtc---attaaggaac
B D                     Chimp  --atgggtc---attaaggaac
B D                   Gorilla  --atgggtc---attaaggaac
B D                 Orangutan  --atgggtc---attaaggaac
B D                    Gibbon  --atgggtc---attaaggaac
B D                    Rhesus  --atgggtc---attaaggaac
B D       Crab-eating macaque  --atgggtc---attaaggaac
B D                    Baboon  --atgggtc---attaaggaac
B D              Green monkey  --atgggtc---attaaggaac
B D                  Marmoset  --atgggtc---attaaggaac
B D           Squirrel monkey  --atgggtc---attaagga--
B D                  Bushbaby  --atgggtc---attaaggaac
           Chinese tree shrew  --atgggtc---attaaggaat
B D                  Squirrel  --acg-atc---attaaagaac
       Lesser Egyptian jerboa  --atata-c---attaaggaat
                 Prairie vole  --acgcatc---attaaggaac
B D           Chinese hamster  --gtgcagc---gttaaggaac
               Golden hamster  --atgcagc---gttaaggaac
B D                     Mouse  --atgcttc---attaaggagc
B D                       Rat  --atgcttc---attaaggacc
B D            Naked mole-rat  --atgtgac---attaaggaac
B D                Guinea pig  --atgtgac---attaaggaac
                   Chinchilla  --atatgac---attaaggaat
             Brush-tailed rat  --atacaat---gttaaggaac
B D                    Rabbit  --atggatc---attaaggaac
B D                      Pika  --atggatc---attaaggaac
B D                       Pig  --aggggtg---attaaggaac
B D                    Alpaca  --atgggtc---attaaggaac
               Bactrian camel  --atgggtc---attaaggaac
B D                   Dolphin  --atgggtc---attaaggaac
                 Killer whale  --atgggtc---attaaggaac
             Tibetan antelope  --atggatc---attaaggaac
B D                       Cow  --atggatc---attaaggaac
B D                     Sheep  --atggatc---attaaggaac
                Domestic goat  --atggatc---attaaggaac
B D                     Horse  --atgggtcttaattaaggaac
B D          White rhinoceros  --atgggcc---attaaggaac
B D                       Cat  --acgagtc---attaaggaac
B D                       Dog  --atgagtc---attaaggaa-
B D                   Ferret   --atgagtc---attaaggaac
B D                     Panda  --atgagtc---attaaggaac
               Pacific walrus  --atgaatc---attaaggaac
                 Weddell seal  --atgaatc---attaaggaac
             Black flying-fox  --ataggtc---attaaggaat
B D                   Megabat  --ataggtc---attaaggaat
                Big brown bat  --atgggtc---attaaggaac
         David's myotis (bat)  --atgggtc---attaaggaac
  D          Little brown bat  --atgggtc---attaaggaac
B D                  Hedgehog  --acgagtt---attaaggagc
B D                     Shrew  --agacgtc---attaaggaac
              Star-nosed mole  --agaggtc---attaaggaac
B D                  Elephant  --atgggtc---attaaggaac
          Cape elephant shrew  --acaggtc---attaaggaac
B D                   Manatee  --atgggtc---attaaggaac
             Cape golden mole  --atgggtc---attaaggaac
B D                    Tenrec  --acaggtc---tttaaggaac
                     Aardvark  --atgggtc---attaaggaac
B D                 Armadillo  --atgggtc---attaaggaac
B D           Tasmanian devil  --acaggaa---attaagaaac
B D                   Wallaby  --acaggca---gttaagaaac
  D            Painted turtle  --atcagct---gttaaggggt
B D               Stickleback  aaagctgga---gttaaggtc-
B D                   Lamprey  ======================
B D                Coelacanth  ======================
B D              Atlantic cod  ======================
                 Spotted gar  ======================
          Southern platyfish  ======================
      Yellowbelly pufferfish  ======================
B D                      Fugu  ======================
B D                    Turkey  ======================
B D                   Chicken  ======================
          Tibetan ground jay  ======================
B D               Zebra finch  ======================
    Mexican tetra (cavefish)  ======================
B D                 Zebrafish  ======================
B D                    Medaka  ======================
         Pundamilia nyererei  ======================
                 Zebra mbuna  ======================
       Burton's mouthbreeder  ======================
         Princess of Burundi  ======================
B D              Nile tilapia  ======================
B D             X. tropicalis  ======================
  D           Green seaturtle  ======================
B D        American alligator  ======================
  D             Scarlet macaw  ======================
B D                   Opossum  ----------------------
  D               Rock pigeon  ======================
  D       Collared flycatcher  ======================
B D       Medium ground finch  ======================
B D                    Lizard  ======================
  D          Peregrine falcon  ======================
  D              Saker falcon  ======================
  D                    Parrot  ======================
B D                  Platypus  ======================
  D  Chinese softshell turtle  ======================

Inserts between block 3 and 4 in window
B D          Tasmanian devil 4bp
B D                  Wallaby 525bp
  D           Painted turtle 7bp

Alignment block 4 of 1078 in window, 56741858 - 56741866, 9 bps 
B D                     Human  agact---c-----------att
B D                     Chimp  agact---c-----------att
B D                   Gorilla  agact---c-----------att
B D                 Orangutan  agact---c-----------att
B D                    Gibbon  agact---c-----------att
B D                    Rhesus  agact---c-----------att
B D       Crab-eating macaque  agact---c-----------att
B D                    Baboon  agact---c-----------att
B D              Green monkey  agact---c-----------att
B D                  Marmoset  agact---c-----------att
B D           Squirrel monkey  agact---c-----------att
B D                  Bushbaby  acact---c-----------att
           Chinese tree shrew  atact---c-----------agt
B D                  Squirrel  acact---c-----------att
       Lesser Egyptian jerboa  acact---c-----------att
                 Prairie vole  acact---gagtgtgttcatatg
B D           Chinese hamster  acgtg---a-----------atc
               Golden hamster  acacg---g-----------atc
B D                     Mouse  atggt---c-----------act
B D                       Rat  atgct---c-----------act
B D            Naked mole-rat  acatt---c-----------att
B D                Guinea pig  acatt---c-----------att
                   Chinchilla  acatt---c-----------att
             Brush-tailed rat  acatt---c-----------att
B D                    Rabbit  acacc---c-----------act
B D                      Pika  acaccttgc-----------ttt
B D                       Pig  atact---c-----------att
B D                    Alpaca  atact---c-----------att
               Bactrian camel  atact---c-----------att
B D                   Dolphin  acact---c-----------att
                 Killer whale  acact---c-----------att
             Tibetan antelope  acact---c-----------att
B D                       Cow  acact---c-----------att
B D                     Sheep  atact---c-----------att
                Domestic goat  acact---c-----------att
B D                     Horse  acact---c-----------att
B D          White rhinoceros  acgct---c-----------ttt
B D                       Cat  acact---c-----------att
B D                       Dog  acact---c-----------att
B D                   Ferret   acagt---c-----------att
B D                     Panda  acact---c-----------ttt
               Pacific walrus  acact---c-----------att
                 Weddell seal  acact---c-----------att
             Black flying-fox  ttact---c-----------att
B D                   Megabat  ttact---c-----------att
                Big brown bat  atact---c-----------att
         David's myotis (bat)  atatt---c-----------att
  D          Little brown bat  ataat---c-----------att
B D                  Hedgehog  acatt---c-----------att
B D                     Shrew  acatt---t-----------at-
              Star-nosed mole  acatt---t-----------att
B D                  Elephant  acgct---c-----------att
          Cape elephant shrew  atact---c-----------agt
B D                   Manatee  acact---c-----------att
             Cape golden mole  aca--------------------
B D                    Tenrec  acaca---c-----------att
                     Aardvark  acagt---c-----------att
B D                 Armadillo  acagt---c-----------att
B D           Tasmanian devil  acttt---a-----------gct
  D            Painted turtle  aggct---c-----------gcc
B D               Stickleback  aaatc---c-----------att
B D                   Lamprey  =======================
B D                Coelacanth  =======================
B D              Atlantic cod  =======================
                 Spotted gar  =======================
          Southern platyfish  =======================
      Yellowbelly pufferfish  =======================
B D                      Fugu  =======================
B D                    Turkey  =======================
B D                   Chicken  =======================
          Tibetan ground jay  =======================
B D               Zebra finch  =======================
    Mexican tetra (cavefish)  =======================
B D                 Zebrafish  =======================
B D                    Medaka  =======================
         Pundamilia nyererei  =======================
                 Zebra mbuna  =======================
       Burton's mouthbreeder  =======================
         Princess of Burundi  =======================
B D              Nile tilapia  =======================
B D             X. tropicalis  =======================
  D           Green seaturtle  =======================
B D        American alligator  =======================
  D             Scarlet macaw  =======================
B D                   Opossum  -----------------------
  D               Rock pigeon  =======================
  D       Collared flycatcher  =======================
B D       Medium ground finch  =======================
B D                    Lizard  =======================
  D          Peregrine falcon  =======================
  D              Saker falcon  =======================
  D                    Parrot  =======================
B D                  Platypus  =======================
B D                   Wallaby  =======================
  D  Chinese softshell turtle  =======================

Inserts between block 4 and 5 in window
B D         White rhinoceros 265bp
B D          Tasmanian devil 7bp

Alignment block 5 of 1078 in window, 56741867 - 56741867, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  g
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  c
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
  D          Little brown bat  t
B D                  Hedgehog  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
B D                    Tenrec  c
                     Aardvark  t
B D                 Armadillo  t
B D           Tasmanian devil  t
  D            Painted turtle  t
B D               Stickleback  t
B D                   Lamprey  =
B D                Coelacanth  =
B D                     Shrew  -
B D              Atlantic cod  =
                 Spotted gar  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D               Zebra finch  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Cape golden mole  -
B D                  Platypus  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =

Inserts between block 5 and 6 in window
B D           Naked mole-rat 120bp
B D          Tasmanian devil 4bp
B D              Stickleback 80bp

Alignment block 6 of 1078 in window, 56741868 - 56741877, 10 bps 
B D                     Human  agggaacatc
B D                     Chimp  agggaacatc
B D                   Gorilla  agggaacatc
B D                 Orangutan  agggaacatc
B D                    Gibbon  agggaacgtc
B D                    Rhesus  aggggacatc
B D       Crab-eating macaque  aggggacatc
B D                    Baboon  aggggacatc
B D              Green monkey  aggggacatc
B D                  Marmoset  aggggacgtc
B D           Squirrel monkey  aagggacatc
B D                  Bushbaby  agggcacatc
           Chinese tree shrew  aggaaacatc
B D                  Squirrel  agggtacatc
       Lesser Egyptian jerboa  gggacacatt
                 Prairie vole  gggatacctg
B D           Chinese hamster  ggg-tagctc
               Golden hamster  ggg-tacctc
B D                     Mouse  gggatacctc
B D                       Rat  gggataattc
B D                Guinea pig  agggcatatc
                   Chinchilla  aaggcatatc
             Brush-tailed rat  -aggcatatc
B D                    Rabbit  agggcatata
B D                      Pika  agagtgtat-
B D                       Pig  agggcacata
B D                    Alpaca  agggcacatc
               Bactrian camel  agggcacatc
B D                   Dolphin  agggcacatc
                 Killer whale  agggcacatc
             Tibetan antelope  agggtacatc
B D                       Cow  agggtacatc
B D                     Sheep  agggtacatc
                Domestic goat  agggtacatc
B D                     Horse  agggcacatc
B D          White rhinoceros  agggcacatc
B D                       Cat  atgacacatt
B D                       Dog  agggcacatc
B D                   Ferret   acagc-cact
B D                     Panda  agagcacatc
               Pacific walrus  agagcgcact
                 Weddell seal  agagcacact
             Black flying-fox  agggcacatc
B D                   Megabat  agggcacatc
                Big brown bat  agggcatatc
         David's myotis (bat)  agggcacatc
  D          Little brown bat  agggcacatc
B D                  Hedgehog  aaaacatgtc
B D                     Shrew  --ggtacatt
              Star-nosed mole  agggcacatg
B D                  Elephant  agagcacatc
          Cape elephant shrew  agggtacatt
B D                   Manatee  agggcacatc
             Cape golden mole  --------tc
B D                    Tenrec  aaggcaagcc
                     Aardvark  agagcacagc
B D                 Armadillo  agggcacatc
B D           Tasmanian devil  aagataaatt
  D            Painted turtle  aggggccaac
B D                   Lamprey  ==========
B D                Coelacanth  ==========
B D              Atlantic cod  ==========
                 Spotted gar  ==========
B D               Stickleback  ==========
          Southern platyfish  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
    Mexican tetra (cavefish)  ==========
B D                 Zebrafish  ==========
B D                    Medaka  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D              Nile tilapia  ==========
B D             X. tropicalis  ==========
  D           Green seaturtle  ==========
B D        American alligator  ==========
  D             Scarlet macaw  ==========
B D                   Opossum  ----------
B D            Naked mole-rat  ==========
  D               Rock pigeon  ==========
  D       Collared flycatcher  ==========
B D       Medium ground finch  ==========
B D                    Lizard  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D                    Parrot  ==========
B D                  Platypus  ==========
B D                   Wallaby  ==========
  D  Chinese softshell turtle  ==========

Inserts between block 6 and 7 in window
  D           Painted turtle 1629bp

Alignment block 7 of 1078 in window, 56741878 - 56741895, 18 bps 
B D                     Human  aatgaacaattt-agttt-t
B D                     Chimp  aatgaacaattt-agttt-t
B D                   Gorilla  aatgaacaattt-agttt-t
B D                 Orangutan  aatgaacaattt-agttt-t
B D                    Gibbon  aatgaacaattt-agttt-t
B D                    Rhesus  aatgaacaactt-agttt-t
B D       Crab-eating macaque  aatgaacaactt-agttt-t
B D                    Baboon  aatgaacaactt-agttt-t
B D              Green monkey  aatgaacaactt-agttt-t
B D                  Marmoset  aatgaacaactt-agttt-t
B D           Squirrel monkey  aatgaacaagtt-aattt-t
B D                  Bushbaby  aatgaacaactt-agttt-t
           Chinese tree shrew  aatgaa-----t-agttt-t
B D                  Squirrel  agtgaacaacttaagttt-t
       Lesser Egyptian jerboa  aataaataactt-agt-t-t
                 Prairie vole  agtatgtc-----agtct-g
B D           Chinese hamster  agcaggtta----agtgt-g
               Golden hamster  agtaagtta----agtgt-g
B D                     Mouse  aatgagta-----agtct-t
B D                       Rat  aacgaata-----agtct-t
B D                Guinea pig  agcaaactactg-agttt-t
                   Chinchilla  aacaaacaactt-agttt-t
             Brush-tailed rat  aacaaataactt-agttt-t
B D                    Rabbit  cacgaacaactc-agttt-t
B D                      Pika  -------cagtg-agttt-t
B D                       Pig  aatgaacaactt-atttt--
B D                    Alpaca  aatgaacagctt-atttt--
               Bactrian camel  aatgaacagctt-atttt--
B D                   Dolphin  aacgaacaactt-atttt--
                 Killer whale  aacgaacaactt-atttt--
             Tibetan antelope  aatgaacaactt-atttt--
B D                       Cow  aacaaacaactt-atttt--
B D                     Sheep  aatgaacaactt-atttt--
                Domestic goat  aatgaacaactt-atttt--
B D                     Horse  agtgaacaactt-atttt--
B D          White rhinoceros  agtgaacaactt-atttt--
B D                       Cat  aatgaacaactt-atttc--
B D                       Dog  aacgaacaactt-gtttt--
B D                   Ferret   gatgaacaactt-atttt--
B D                     Panda  gatgaacaactt-atttt--
               Pacific walrus  gatgaacaactt-atttt--
                 Weddell seal  gatgaacaactt-agttt--
             Black flying-fox  aattaacaactt-atttt--
B D                   Megabat  aattaacaactt-atttt--
                Big brown bat  aacaaacaactt-atttt--
         David's myotis (bat)  aacaaacaactt-atttt--
  D          Little brown bat  aacaaacaactt-atttt--
B D                  Hedgehog  agttaacagctt-cttttt-
B D                     Shrew  aacgaacaagat-attttc-
              Star-nosed mole  agc-aacaattt-actttc-
B D                  Elephant  agtgaacaactc-agttt-t
          Cape elephant shrew  tgtgaacagctt-agttt-t
B D                   Manatee  agtgaacaactt-agttt-t
             Cape golden mole  agtgaacaactt-aattt-g
B D                    Tenrec  ggtgaacaacct-agctt-t
                     Aardvark  agtgaacaactt-agttt-t
B D                 Armadillo  aatgaagaactt-tgttt-t
B D           Tasmanian devil  cccaaaca---t-gattt--
B D                   Lamprey  ====================
B D                Coelacanth  ====================
B D              Atlantic cod  ====================
                 Spotted gar  ====================
B D               Stickleback  ====================
          Southern platyfish  ====================
      Yellowbelly pufferfish  ====================
B D                      Fugu  ====================
B D                    Turkey  ====================
B D                   Chicken  ====================
          Tibetan ground jay  ====================
B D               Zebra finch  ====================
    Mexican tetra (cavefish)  ====================
B D                 Zebrafish  ====================
B D                    Medaka  ====================
         Pundamilia nyererei  ====================
                 Zebra mbuna  ====================
       Burton's mouthbreeder  ====================
         Princess of Burundi  ====================
B D              Nile tilapia  ====================
B D             X. tropicalis  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D        American alligator  ====================
  D             Scarlet macaw  ====================
B D                   Opossum  --------------------
B D            Naked mole-rat  ====================
  D               Rock pigeon  ====================
  D       Collared flycatcher  ====================
B D       Medium ground finch  ====================
B D                    Lizard  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
  D                    Parrot  ====================
B D                  Platypus  ====================
B D                   Wallaby  ====================
  D  Chinese softshell turtle  ====================

Inserts between block 7 and 8 in window
B D                 Hedgehog 891bp

Alignment block 8 of 1078 in window, 56741896 - 56741906, 11 bps 
B D                     Human  ---aagtatgtatt
B D                     Chimp  ---aagtatgtatt
B D                   Gorilla  ---aagtatgtatt
B D                 Orangutan  ---aagtatgtatt
B D                    Gibbon  ---aagtatgtatt
B D                    Rhesus  ---aagtatgtatt
B D       Crab-eating macaque  ---aagtatgtatt
B D                    Baboon  ---aagtatgtatt
B D              Green monkey  ---aagtatgtatt
B D                  Marmoset  ---caatatgtatt
B D           Squirrel monkey  ---caatatgtatt
B D                  Bushbaby  ---cagtatgtatt
           Chinese tree shrew  ---cagtatgtat-
B D                  Squirrel  ---tag-atgtatc
       Lesser Egyptian jerboa  ---tggtatgtagt
                 Prairie vole  ---tagtatgtatc
B D           Chinese hamster  ---cagtgtgtgct
               Golden hamster  ---caatatgtgtt
B D                     Mouse  ---tagtacatatt
B D                       Rat  ---tagtacatatt
B D                Guinea pig  ---tagtatgtatt
                   Chinchilla  ---tagtatgtatt
             Brush-tailed rat  ---tagta--tatt
B D                    Rabbit  ---cagtgtggatc
B D                      Pika  ---cagtgtacatt
B D                       Pig  ---cagtgtgtatt
B D                    Alpaca  ---ca-tatgcatt
               Bactrian camel  ---ca-tatgcatt
B D                   Dolphin  ---cagtatgtatt
                 Killer whale  ---cagtatgtatt
             Tibetan antelope  ---caatgtgtatt
B D                       Cow  ---caatgtgtatt
B D                     Sheep  ---caatgtgtatt
                Domestic goat  ---caatgtgtatt
B D                     Horse  ---cagtatgtatt
B D          White rhinoceros  ---cagtatgtatt
B D                       Cat  ---cagtatgtgtt
B D                       Dog  ---cagtatgtatt
B D                   Ferret   ---cagtatgtatt
B D                     Panda  ---cagtatgtatt
               Pacific walrus  ---cagtatgtatt
                 Weddell seal  ---cagtatatatt
             Black flying-fox  ---ccacatgtatt
B D                   Megabat  ---ccacatgtatt
                Big brown bat  ---ctgcgtgtatt
         David's myotis (bat)  ---ctgtatgtatt
  D          Little brown bat  ---ctgtatgtatt
B D                     Shrew  ----agta---att
              Star-nosed mole  ----agta---ata
B D                  Elephant  ---cagtatgtatt
          Cape elephant shrew  ---caatatatatt
B D                   Manatee  ---cagtatgtatt
             Cape golden mole  ---cagaatgtatc
B D                    Tenrec  ---cggtatgcatt
                     Aardvark  ---cagtatgtatt
B D                 Armadillo  ---cagtatgtatt
B D           Tasmanian devil  aaacaatggata--
B D                  Hedgehog  ==============
B D                   Lamprey  ==============
B D                Coelacanth  ==============
B D              Atlantic cod  ==============
                 Spotted gar  ==============
B D               Stickleback  ==============
          Southern platyfish  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
    Mexican tetra (cavefish)  ==============
B D                 Zebrafish  ==============
B D                    Medaka  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
B D             X. tropicalis  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D        American alligator  ==============
  D             Scarlet macaw  ==============
B D                   Opossum  --------------
B D            Naked mole-rat  ==============
  D               Rock pigeon  ==============
  D       Collared flycatcher  ==============
B D       Medium ground finch  ==============
B D                    Lizard  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D                    Parrot  ==============
B D                  Platypus  ==============
B D                   Wallaby  ==============
  D  Chinese softshell turtle  ==============

Inserts between block 8 and 9 in window
B D                   Rhesus 312bp

Alignment block 9 of 1078 in window, 56741907 - 56741907, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -a
           Chinese tree shrew  -a
B D                  Squirrel  -a
       Lesser Egyptian jerboa  -a
                 Prairie vole  -a
B D           Chinese hamster  -a
               Golden hamster  -a
B D                     Mouse  -a
B D                       Rat  -a
B D                Guinea pig  -a
                   Chinchilla  -a
             Brush-tailed rat  -g
B D                    Rabbit  -a
B D                      Pika  -a
B D                       Pig  -a
B D                    Alpaca  -a
               Bactrian camel  -a
B D                   Dolphin  -a
                 Killer whale  -a
             Tibetan antelope  -a
B D                       Cow  -a
B D                     Sheep  -a
                Domestic goat  -a
B D                     Horse  -a
B D          White rhinoceros  -a
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
                 Weddell seal  -a
             Black flying-fox  -a
B D                   Megabat  -a
                Big brown bat  -a
         David's myotis (bat)  -a
  D          Little brown bat  -a
B D                     Shrew  -c
              Star-nosed mole  -a
B D                  Elephant  -a
          Cape elephant shrew  -a
B D                   Manatee  -a
             Cape golden mole  -a
B D                    Tenrec  -a
                     Aardvark  -a
B D                 Armadillo  -a
B D           Tasmanian devil  c-
B D                  Hedgehog  ==
B D                   Lamprey  ==
B D                Coelacanth  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                    Turkey  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D             X. tropicalis  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                   Opossum  --
B D            Naked mole-rat  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                  Platypus  ==
B D                   Wallaby  ==
  D  Chinese softshell turtle  ==

Inserts between block 9 and 10 in window
B D                 Marmoset 465bp
B D                    Shrew 3bp

Alignment block 10 of 1078 in window, 56741908 - 56741919, 12 bps 
B D                     Human  c-cacaagggtgt
B D                     Chimp  c-cacaagggtgt
B D                   Gorilla  c-cacaaggatgt
B D                 Orangutan  c-cacaagggtat
B D                    Gibbon  c-cacaagggtat
B D                    Rhesus  c-cacaagggtat
B D       Crab-eating macaque  c-cacaagggtat
B D                    Baboon  c-cacaggggtat
B D              Green monkey  c-cacaagggtat
B D                  Marmoset  c-cacaagggtat
B D           Squirrel monkey  c-cacaagggtat
B D                  Bushbaby  t-cacaaggatat
           Chinese tree shrew  c-cataaagttag
B D                  Squirrel  t-tacaagaatat
       Lesser Egyptian jerboa  t-cacaaggacat
                 Prairie vole  t-tacagggatgc
B D           Chinese hamster  t-cataaggatgc
               Golden hamster  t-cacaaggatgt
B D                     Mouse  t-tacaagaaggt
B D                       Rat  t-taccagaatgt
B D                Guinea pig  c-cacaaagatat
                   Chinchilla  c-cacaaggatat
             Brush-tailed rat  c-cataaggatat
B D                    Rabbit  t-catgt------
B D                      Pika  c-catgt------
B D                       Pig  t-cataagga-aa
B D                    Alpaca  c-cacaaagatgt
               Bactrian camel  c-cacaaagatgt
B D                   Dolphin  c-cacaaggatat
                 Killer whale  c-cacaaggatat
             Tibetan antelope  c-cacaaggatat
B D                       Cow  c-cacaaggatat
B D                     Sheep  c-cacaaggatat
                Domestic goat  c-cacaaggatat
B D                     Horse  c-cacaaggatat
B D          White rhinoceros  c-cacaaggatat
B D                       Cat  c-aacaaggataa
B D                       Dog  c-cacaaggattt
B D                   Ferret   ctcacaaggatac
B D                     Panda  c-cacaaggctat
               Pacific walrus  c-cacaaggatat
                 Weddell seal  c-cacaaggatat
             Black flying-fox  c-cacaaggatat
B D                   Megabat  c-cacaaggatat
                Big brown bat  c-cacaagaatat
         David's myotis (bat)  c-cacaagaatat
  D          Little brown bat  c-cacaagaatat
B D                     Shrew  a-cacagggatgg
              Star-nosed mole  c-cacaaggatat
B D                  Elephant  c-cacaaggatat
          Cape elephant shrew  g-cacagaaatat
B D                   Manatee  c-tgtaaggatat
             Cape golden mole  c-cacaagaatat
B D                    Tenrec  c-cacaagaatag
                     Aardvark  c-tataagaatat
B D                 Armadillo  t-cataagaatct
B D           Tasmanian devil  t-tataagaatat
B D                  Hedgehog  =============
B D                   Lamprey  =============
B D                Coelacanth  =============
B D              Atlantic cod  =============
                 Spotted gar  =============
B D               Stickleback  =============
          Southern platyfish  =============
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
B D                    Turkey  =============
B D                   Chicken  =============
          Tibetan ground jay  =============
B D               Zebra finch  =============
    Mexican tetra (cavefish)  =============
B D                 Zebrafish  =============
B D                    Medaka  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D              Nile tilapia  =============
B D             X. tropicalis  =============
  D            Painted turtle  =============
  D           Green seaturtle  =============
B D        American alligator  =============
  D             Scarlet macaw  =============
B D                   Opossum  -------------
B D            Naked mole-rat  =============
  D               Rock pigeon  =============
  D       Collared flycatcher  =============
B D       Medium ground finch  =============
B D                    Lizard  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
  D                    Parrot  =============
B D                  Platypus  =============
B D                   Wallaby  =============
  D  Chinese softshell turtle  =============

Inserts between block 10 and 11 in window
B D          Squirrel monkey 176bp
          Chinese tree shrew 6bp
B D                 Squirrel 6bp
      Lesser Egyptian jerboa 6bp
                Prairie vole 6bp
B D          Chinese hamster 6bp
              Golden hamster 6bp
B D                    Mouse 6bp
B D                      Rat 6bp
B D               Guinea pig 8bp
                  Chinchilla 1384bp
            Brush-tailed rat 8bp
B D                   Rabbit 9bp
B D                     Pika 11bp
B D                    Horse 11bp
B D         White rhinoceros 11bp
B D                      Cat 11bp
B D                      Dog 10bp
B D                  Ferret  10bp
B D                    Panda 10bp
              Pacific walrus 9bp
                Weddell seal 9bp
            Black flying-fox 11bp
B D                  Megabat 147bp
               Big brown bat 9bp
        David's myotis (bat) 9bp
  D         Little brown bat 9bp

Alignment block 11 of 1078 in window, 56741920 - 56741922, 3 bps 
B D                     Human  ctt------
B D                     Chimp  ctt------
B D                   Gorilla  ctt------
B D                 Orangutan  ctt------
B D                    Gibbon  ctt------
B D                    Rhesus  ctt------
B D       Crab-eating macaque  ctt------
B D                    Baboon  ctt------
B D              Green monkey  ctt------
B D                  Marmoset  ctt------
B D           Squirrel monkey  ctt------
B D                  Bushbaby  ttt------
           Chinese tree shrew  ctt------
B D                  Squirrel  ttt------
       Lesser Egyptian jerboa  ctt------
                 Prairie vole  ttc------
B D           Chinese hamster  ttc------
               Golden hamster  ttc------
B D                     Mouse  ttc------
B D                       Rat  ttc------
B D                Guinea pig  ttc------
             Brush-tailed rat  tct------
B D                    Rabbit  ctt------
B D                      Pika  tct------
B D                       Pig  ata------
B D                    Alpaca  cta------
               Bactrian camel  cta------
B D                   Dolphin  cta------
                 Killer whale  cta------
             Tibetan antelope  cta------
B D                       Cow  cta------
B D                     Sheep  cta------
                Domestic goat  cta------
B D                     Shrew  cta------
              Star-nosed mole  aga------
B D                  Elephant  cta------
          Cape elephant shrew  cta------
B D                   Manatee  cta------
             Cape golden mole  cta------
B D                    Tenrec  cta------
                     Aardvark  cta------
B D                 Armadillo  cta------
B D           Tasmanian devil  ctaaaattt
B D                  Hedgehog  =========
B D                   Lamprey  =========
B D                Coelacanth  =========
B D              Atlantic cod  =========
                 Spotted gar  =========
B D               Stickleback  =========
          Southern platyfish  =========
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
B D                    Turkey  =========
B D                   Chicken  =========
          Tibetan ground jay  =========
B D               Zebra finch  =========
    Mexican tetra (cavefish)  =========
B D                 Zebrafish  =========
B D                    Medaka  =========
         Pundamilia nyererei  =========
                 Zebra mbuna  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D              Nile tilapia  =========
B D             X. tropicalis  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D        American alligator  =========
  D             Scarlet macaw  =========
B D                   Opossum  ---------
                  Chinchilla  =========
B D            Naked mole-rat  =========
  D               Rock pigeon  =========
  D       Collared flycatcher  =========
B D       Medium ground finch  =========
B D                    Lizard  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D                    Parrot  =========
B D                  Platypus  =========
B D                   Wallaby  =========
B D                       Cat  =========
B D                   Megabat  =========
  D  Chinese softshell turtle  =========
B D                   Ferret   =========
B D                     Panda  =========
              Pacific walrus  =========
            Black flying-fox  =========
B D          White rhinoceros  =========
B D                     Horse  =========
                Weddell seal  =========
        David's myotis (bat)  =========
               Big brown bat  =========
  D          Little brown bat  =========
B D                       Dog  =========

Inserts between block 11 and 12 in window
B D      Crab-eating macaque 1601bp
B D                 Elephant 6bp
         Cape elephant shrew 4bp
B D                  Manatee 6bp
            Cape golden mole 6bp
B D                   Tenrec 6bp
                    Aardvark 6bp
B D                Armadillo 6bp

Alignment block 12 of 1078 in window, 56741923 - 56741930, 8 bps 
B D                     Human  ac--a------aatat
B D                     Chimp  at--a------aatat
B D                   Gorilla  at--a------aatat
B D                 Orangutan  at--a------aatat
B D                    Gibbon  at--a------aatat
B D                    Rhesus  at--a------aatac
B D                    Baboon  at--a------aatac
B D              Green monkey  at--a------aatac
B D                  Marmoset  at--a------aatat
B D           Squirrel monkey  at--a------aatat
B D                  Bushbaby  at--a------aatac
           Chinese tree shrew  at--a------aatat
B D                  Squirrel  gc--a------cat--
       Lesser Egyptian jerboa  atcaa------cac--
                 Prairie vole  cc--a------cac--
B D           Chinese hamster  ac--a------tac--
               Golden hamster  ac----------ac--
B D                     Mouse  ac--a------cat--
B D                       Rat  gc--a------cat--
B D                Guinea pig  at--a------tat--
             Brush-tailed rat  at--a------tat--
B D                    Rabbit  ct--aactac------
B D                      Pika  at--a-----------
B D                       Pig  --------------aa
B D                    Alpaca  --------------aa
               Bactrian camel  --------------aa
B D                   Dolphin  --------------aa
                 Killer whale  --------------aa
             Tibetan antelope  --------------aa
B D                       Cow  --------------aa
B D                     Sheep  --------------aa
                Domestic goat  --------------aa
B D                     Shrew  --------------ca
              Star-nosed mole  --------------aa
B D                  Elephant  ------------ataa
          Cape elephant shrew  ------------acat
B D                   Manatee  ------------ataa
             Cape golden mole  ------------ataa
B D                    Tenrec  ------------ataa
                     Aardvark  ------------ataa
B D                 Armadillo  ------------ataa
B D           Tasmanian devil  --------gcaaatat
B D                  Hedgehog  ================
B D                   Lamprey  ================
B D                Coelacanth  ================
B D       Crab-eating macaque  ================
B D              Atlantic cod  ================
                 Spotted gar  ================
B D               Stickleback  ================
          Southern platyfish  ================
      Yellowbelly pufferfish  ================
B D                      Fugu  ================
B D                    Turkey  ================
B D                   Chicken  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
    Mexican tetra (cavefish)  ================
B D                 Zebrafish  ================
B D                    Medaka  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
B D             X. tropicalis  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
B D        American alligator  ================
  D             Scarlet macaw  ================
B D                   Opossum  ----------------
                  Chinchilla  ================
B D            Naked mole-rat  ================
  D               Rock pigeon  ================
  D       Collared flycatcher  ================
B D       Medium ground finch  ================
B D                    Lizard  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D                    Parrot  ================
B D                  Platypus  ================
B D                   Wallaby  ================
B D                       Cat  ================
B D                   Megabat  ================
  D  Chinese softshell turtle  ================
B D                   Ferret   ================
B D                     Panda  ================
              Pacific walrus  ================
            Black flying-fox  ================
B D          White rhinoceros  ================
B D                     Horse  ================
                Weddell seal  ================
        David's myotis (bat)  ================
               Big brown bat  ================
  D          Little brown bat  ================
B D                       Dog  ================

Inserts between block 12 and 13 in window
B D                 Squirrel 8bp
      Lesser Egyptian jerboa 2bp
                Prairie vole 2bp
B D          Chinese hamster 2bp
              Golden hamster 2bp
B D                    Mouse 2bp
B D                      Rat 2bp
B D               Guinea pig 318bp
B D                      Pig 6bp
B D                   Alpaca 5bp
              Bactrian camel 5bp
B D                  Dolphin 6bp
                Killer whale 6bp
            Tibetan antelope 6bp
B D                      Cow 6bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                    Shrew 4bp
             Star-nosed mole 5bp
B D                 Elephant 4bp
         Cape elephant shrew 4bp
B D                  Manatee 4bp
            Cape golden mole 4bp
B D                   Tenrec 4bp
                    Aardvark 4bp
B D                Armadillo 4bp

Alignment block 13 of 1078 in window, 56741931 - 56741952, 22 bps 
B D                     Human  tcagaaagtagtta-ttaacatt
B D                     Chimp  tcagaaagtagtta-ttaacatt
B D                   Gorilla  tcagaaagtagtta-ttaacatt
B D                 Orangutan  tcagaaagtagtta-ttaacatt
B D                    Gibbon  tcagaaagtagtta-ttaacatt
B D                    Rhesus  ttagaaagcagtta-ttaatgtt
B D                    Baboon  ttagaaagcagtta-ttaatgtt
B D              Green monkey  ttagaaagtagtta-ttaatgtt
B D                  Marmoset  ttagacagtaatta-ttaatgtt
B D           Squirrel monkey  ttagacagtaatta-ttaacgtt
B D                  Bushbaby  tt----agtaattg-ttaatgat
           Chinese tree shrew  ttaggaagtaatta-ttaacatt
B D                  Squirrel  atagaaagtaacta-ttactgtc
       Lesser Egyptian jerboa  ------agaaagtaactattaat
                 Prairie vole  ------aggaactatttaatgat
B D           Chinese hamster  ------agaagcta-ctagtgat
               Golden hamster  ------agaaacta-ttagtgat
B D                     Mouse  ------agaaacta-ttaatgat
B D                       Rat  ------agaaggta-ttaatgat
             Brush-tailed rat  ttatatatagcttt-gttttgtt
B D                    Rabbit  tgagaaagtaatta-ctaaggtc
B D                      Pika  ---------aatta-ttaagaca
B D                       Pig  ctagaaagctatta-ctatt---
B D                    Alpaca  -----aagtaatca-gtgtt---
               Bactrian camel  -----aagtaatca-gtgtt---
B D                   Dolphin  atagaaagtaatta-ttgtt---
                 Killer whale  atagaaattaatta-ttgtt---
             Tibetan antelope  atagcaagtaatta-ttgtt---
B D                       Cow  ac----agtaatta-ttgtc---
B D                     Sheep  atagaaagtaatta-ttatt---
                Domestic goat  atagaaagtaatta-ttgtt---
B D                     Horse  atagaaagtaatta-ttgtt---
B D          White rhinoceros  atagaaagtaatta-ttgtt---
B D                       Cat  ctagaa----atta-ttgtt---
B D                       Dog  ttagaaagtaatta-tggtt---
B D                   Ferret   ctagaaagtaatta-ttgtt---
B D                     Panda  ctagaaagtgatta-ttgtt---
               Pacific walrus  ctagaaagtaatta-tcgtt---
                 Weddell seal  ctagaaagtaatta-tcgtt---
             Black flying-fox  ataga----aatta-ttgtt---
                Big brown bat  atagaaaataatta-ctgtt---
         David's myotis (bat)  atagaaaataattc-ttgtt---
  D          Little brown bat  atagaaaataattc-ttgtt---
B D                     Shrew  --------caataa--tgtt---
              Star-nosed mole  tgagaaaacggtta--tatt---
B D                  Elephant  ttggaaagtaatta-ttaatgtt
          Cape elephant shrew  ttagaaaatagtta-t---tgtt
B D                   Manatee  ttagaaggtaatta-ttaatgtt
             Cape golden mole  tta-aaagtaatta-ttaatgtt
B D                    Tenrec  ttagaaagtaacta-ttaatgtt
                     Aardvark  ttagaaagtagttg-ttaatgtt
B D                 Armadillo  -tataaagtaatta-taagtggt
B D           Tasmanian devil  ttaggggataagtg-cacatttt
B D                  Hedgehog  =======================
B D                Guinea pig  =======================
B D                   Lamprey  =======================
B D                Coelacanth  =======================
B D       Crab-eating macaque  =======================
B D              Atlantic cod  =======================
                 Spotted gar  =======================
B D               Stickleback  =======================
          Southern platyfish  =======================
      Yellowbelly pufferfish  =======================
B D                      Fugu  =======================
B D                    Turkey  =======================
B D                   Chicken  =======================
          Tibetan ground jay  =======================
B D               Zebra finch  =======================
    Mexican tetra (cavefish)  =======================
B D                 Zebrafish  =======================
B D                    Medaka  =======================
         Pundamilia nyererei  =======================
                 Zebra mbuna  =======================
       Burton's mouthbreeder  =======================
         Princess of Burundi  =======================
B D              Nile tilapia  =======================
B D             X. tropicalis  =======================
  D            Painted turtle  =======================
  D           Green seaturtle  =======================
B D        American alligator  =======================
  D             Scarlet macaw  =======================
B D                   Opossum  -----------------------
                  Chinchilla  =======================
B D            Naked mole-rat  =======================
  D               Rock pigeon  =======================
  D       Collared flycatcher  =======================
B D       Medium ground finch  =======================
B D                    Lizard  =======================
  D          Peregrine falcon  =======================
  D              Saker falcon  =======================
  D                    Parrot  =======================
B D                  Platypus  =======================
B D                   Wallaby  =======================
B D                   Megabat  =======================
  D  Chinese softshell turtle  =======================

Inserts between block 13 and 14 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 2bp
                Prairie vole 1bp
B D          Chinese hamster 11bp
B D                    Mouse 1bp
B D                      Rat 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
  D         Little brown bat 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 14 of 1078 in window, 56741953 - 56741956, 4 bps 
B D                     Human  -tc---tt
B D                     Chimp  -tc---tt
B D                   Gorilla  -tc---tt
B D                 Orangutan  -tc---tt
B D                    Gibbon  -tc---tt
B D                    Rhesus  -cc---tt
B D                    Baboon  -cc---tt
B D              Green monkey  -cc---tt
B D                  Marmoset  -tc---tt
B D           Squirrel monkey  -tc---tt
B D                  Bushbaby  -ct---tt
           Chinese tree shrew  -gt---at
B D                  Squirrel  -tc---t-
       Lesser Egyptian jerboa  --c---g-
                 Prairie vole  -cc---g-
               Golden hamster  -tc---c-
B D                     Mouse  -cc---t-
B D                       Rat  -cc---t-
             Brush-tailed rat  -tt---t-
B D                    Rabbit  -tc---t-
B D                      Pika  -tc---t-
B D                       Pig  -tcttat-
B D                    Alpaca  -tg---t-
               Bactrian camel  -tc---t-
B D                   Dolphin  -tc---t-
                 Killer whale  -tc---t-
             Tibetan antelope  -tc---t-
B D                       Cow  -tc---t-
B D                     Sheep  -tc---t-
                Domestic goat  -tc---t-
B D                     Horse  -tc---t-
B D          White rhinoceros  -tc---t-
B D                       Cat  -tc---t-
B D                       Dog  -tc---t-
B D                   Ferret   -tc---a-
B D                     Panda  -tc---t-
               Pacific walrus  -tc---t-
                 Weddell seal  -tc---t-
             Black flying-fox  -tc---t-
                Big brown bat  -tc---t-
         David's myotis (bat)  -tc---t-
  D          Little brown bat  -tc---t-
B D                     Shrew  -tc---t-
              Star-nosed mole  -tc---t-
B D                  Elephant  -tt---t-
          Cape elephant shrew  -tc---t-
B D                   Manatee  -tt---t-
             Cape golden mole  -tc---t-
B D                    Tenrec  -tc---c-
                     Aardvark  -tc---t-
B D                 Armadillo  -tc---t-
B D           Tasmanian devil  ttt---t-
B D                  Hedgehog  ========
B D                Guinea pig  ========
B D                   Lamprey  ========
B D                Coelacanth  ========
B D       Crab-eating macaque  ========
B D              Atlantic cod  ========
                 Spotted gar  ========
B D               Stickleback  ========
          Southern platyfish  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D                    Turkey  ========
B D                   Chicken  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  ========
B D                    Medaka  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
B D             X. tropicalis  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
  D             Scarlet macaw  ========
B D                   Opossum  --------
                  Chinchilla  ========
B D            Naked mole-rat  ========
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D       Medium ground finch  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D                    Parrot  ========
B D                  Platypus  ========
B D                   Wallaby  ========
B D           Chinese hamster  ========
B D                   Megabat  ========
  D  Chinese softshell turtle  ========

Inserts between block 14 and 15 in window
B D                   Baboon 1bp
B D                 Squirrel 253bp

Alignment block 15 of 1078 in window, 56741957 - 56741960, 4 bps 
B D                     Human  -gaaa
B D                     Chimp  -gaaa
B D                   Gorilla  -gaaa
B D                 Orangutan  -gaaa
B D                    Gibbon  -gaaa
B D                    Rhesus  -aaaa
B D                    Baboon  -aaaa
B D              Green monkey  -aaaa
B D                  Marmoset  -aaaa
B D           Squirrel monkey  -aaaa
B D                  Bushbaby  -aaaa
           Chinese tree shrew  -aaaa
       Lesser Egyptian jerboa  -aaaa
                 Prairie vole  -aaaa
               Golden hamster  -aaaa
B D                     Mouse  -gaga
B D                       Rat  -aaaa
             Brush-tailed rat  -gaga
B D                    Rabbit  -aaaa
B D                      Pika  -aaga
B D                       Pig  -taaa
B D                    Alpaca  -aaaa
               Bactrian camel  -aaaa
B D                   Dolphin  -aaaa
                 Killer whale  -aaaa
             Tibetan antelope  -aaaa
B D                       Cow  -aaaa
B D                     Sheep  -aaaa
                Domestic goat  -aaaa
B D                     Horse  -aaaa
B D          White rhinoceros  -aaaa
B D                       Cat  -aaaa
B D                       Dog  -aaaa
B D                   Ferret   -aaaa
B D                     Panda  -aaaa
               Pacific walrus  -aaaa
                 Weddell seal  -aaaa
             Black flying-fox  -ataa
                Big brown bat  -aaaa
         David's myotis (bat)  -aaaa
  D          Little brown bat  -aaaa
B D                     Shrew  -aaaa
              Star-nosed mole  -aaaa
B D                  Elephant  -gaaa
          Cape elephant shrew  -gaaa
B D                   Manatee  -gaaa
             Cape golden mole  -gaaa
B D                    Tenrec  -aaag
                     Aardvark  -gaaa
B D                 Armadillo  -gcaa
B D           Tasmanian devil  taaa-
B D                  Hedgehog  =====
B D                Guinea pig  =====
B D                   Lamprey  =====
B D                Coelacanth  =====
B D       Crab-eating macaque  =====
B D              Atlantic cod  =====
                 Spotted gar  =====
B D               Stickleback  =====
          Southern platyfish  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                    Turkey  =====
B D                   Chicken  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D                    Medaka  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
B D             X. tropicalis  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
  D             Scarlet macaw  =====
B D                   Opossum  -----
                  Chinchilla  =====
B D            Naked mole-rat  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
B D                  Platypus  =====
B D                   Wallaby  =====
B D           Chinese hamster  =====
B D                   Megabat  =====
  D  Chinese softshell turtle  =====
B D                  Squirrel  =====

Alignment block 16 of 1078 in window, 56741961 - 56741962, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  ca
B D           Squirrel monkey  ca
B D                  Bushbaby  ca
           Chinese tree shrew  ta
       Lesser Egyptian jerboa  ca
                 Prairie vole  ca
               Golden hamster  ca
B D                     Mouse  ca
B D                       Rat  ca
             Brush-tailed rat  ca
B D                    Rabbit  ca
B D                      Pika  ca
B D                       Pig  ca
B D                    Alpaca  tg
               Bactrian camel  tg
B D                   Dolphin  tg
                 Killer whale  tg
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D                     Horse  tg
B D          White rhinoceros  tg
B D                       Cat  tg
B D                       Dog  tg
B D                   Ferret   tg
B D                     Panda  tg
               Pacific walrus  ag
                 Weddell seal  ag
             Black flying-fox  ag
                Big brown bat  tg
         David's myotis (bat)  tg
  D          Little brown bat  tg
B D                     Shrew  tg
              Star-nosed mole  ta
B D                  Elephant  ca
          Cape elephant shrew  tg
B D                   Manatee  cg
             Cape golden mole  ca
B D                    Tenrec  aa
                     Aardvark  ca
B D                 Armadillo  tg
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                   Lamprey  ==
B D                Coelacanth  ==
B D       Crab-eating macaque  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                    Turkey  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D           Tasmanian devil  --
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D             X. tropicalis  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                   Opossum  --
                  Chinchilla  ==
B D            Naked mole-rat  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D           Chinese hamster  ==
B D                   Megabat  ==
  D  Chinese softshell turtle  ==
B D                  Squirrel  ==

Inserts between block 16 and 17 in window
            Brush-tailed rat 255bp

Alignment block 17 of 1078 in window, 56741963 - 56741966, 4 bps 
B D                     Human  taaa
B D                     Chimp  taaa
B D                   Gorilla  taaa
B D                 Orangutan  taaa
B D                    Gibbon  taaa
B D                    Rhesus  taaa
B D                    Baboon  taaa
B D              Green monkey  taaa
B D                  Marmoset  taaa
B D           Squirrel monkey  taaa
B D                  Bushbaby  caaa
           Chinese tree shrew  taaa
       Lesser Egyptian jerboa  taaa
                 Prairie vole  aaaa
               Golden hamster  taaa
B D                     Mouse  cacg
B D                       Rat  caag
B D                    Rabbit  taaa
B D                      Pika  caca
B D                       Pig  cata
B D                    Alpaca  caaa
               Bactrian camel  caaa
B D                   Dolphin  caaa
                 Killer whale  caaa
             Tibetan antelope  caaa
B D                       Cow  caaa
B D                     Sheep  caca
                Domestic goat  caaa
B D                     Horse  caaa
B D          White rhinoceros  caaa
B D                       Cat  caaa
B D                       Dog  caaa
B D                   Ferret   caaa
B D                     Panda  caaa
               Pacific walrus  caaa
                 Weddell seal  caaa
             Black flying-fox  caaa
                Big brown bat  caaa
         David's myotis (bat)  caac
  D          Little brown bat  caac
B D                     Shrew  taaa
              Star-nosed mole  ttaa
B D                  Elephant  caaa
          Cape elephant shrew  caaa
B D                   Manatee  caaa
             Cape golden mole  taaa
B D                    Tenrec  aaaa
                     Aardvark  caaa
B D                 Armadillo  caaa
B D                  Hedgehog  ====
B D                Guinea pig  ====
B D                   Lamprey  ====
B D                Coelacanth  ====
B D       Crab-eating macaque  ====
            Brush-tailed rat  ====
B D              Atlantic cod  ====
                 Spotted gar  ====
B D               Stickleback  ====
          Southern platyfish  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                    Turkey  ====
B D                   Chicken  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D           Tasmanian devil  ----
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D             X. tropicalis  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                   Opossum  ----
                  Chinchilla  ====
B D            Naked mole-rat  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
B D                  Platypus  ====
B D                   Wallaby  ====
B D           Chinese hamster  ====
B D                   Megabat  ====
  D  Chinese softshell turtle  ====
B D                  Squirrel  ====

Inserts between block 17 and 18 in window
             Star-nosed mole 298bp

Alignment block 18 of 1078 in window, 56741967 - 56741967, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D                    Rabbit  c
B D                      Pika  a
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
                Big brown bat  t
         David's myotis (bat)  t
  D          Little brown bat  t
B D                     Shrew  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                  Hedgehog  =
B D                Guinea pig  =
B D                   Lamprey  =
B D                Coelacanth  =
B D       Crab-eating macaque  =
            Brush-tailed rat  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D           Tasmanian devil  -
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  -
                  Chinchilla  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                  Platypus  =
B D                   Wallaby  =
B D           Chinese hamster  =
B D                   Megabat  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
B D                  Squirrel  =

Inserts between block 18 and 19 in window
B D                      Pig 7bp
B D                    Shrew 1131bp

Alignment block 19 of 1078 in window, 56741968 - 56741968, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  a
       Lesser Egyptian jerboa  g
                 Prairie vole  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  t
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
                Big brown bat  a
         David's myotis (bat)  a
  D          Little brown bat  a
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                  Hedgehog  =
B D                Guinea pig  =
B D                   Lamprey  =
B D                Coelacanth  =
B D                     Shrew  =
B D       Crab-eating macaque  =
            Brush-tailed rat  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D           Tasmanian devil  -
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  -
                  Chinchilla  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                  Platypus  =
B D                   Wallaby  =
B D           Chinese hamster  =
B D                   Megabat  =
B D                       Pig  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
B D                  Squirrel  =

Inserts between block 19 and 20 in window
            Cape golden mole 15bp

Alignment block 20 of 1078 in window, 56741969 - 56741969, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
       Lesser Egyptian jerboa  t
                 Prairie vole  a
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D                    Rabbit  t
B D                      Pika  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
                Big brown bat  t
         David's myotis (bat)  t
  D          Little brown bat  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
B D                    Tenrec  t
                     Aardvark  t
B D                  Hedgehog  =
B D                Guinea pig  =
B D                   Lamprey  =
B D                Coelacanth  =
B D                     Shrew  =
B D       Crab-eating macaque  =
            Brush-tailed rat  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D           Tasmanian devil  -
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  -
                  Chinchilla  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Cape golden mole  =
B D                  Platypus  =
B D                   Wallaby  =
B D           Chinese hamster  =
B D                   Megabat  =
B D                       Pig  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
B D                  Squirrel  =
B D                 Armadillo  -

Inserts between block 20 and 21 in window
B D                      Cat 208bp

Alignment block 21 of 1078 in window, 56741970 - 56741970, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
       Lesser Egyptian jerboa  c
                 Prairie vole  c
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  g
                 Weddell seal  t
             Black flying-fox  t
                Big brown bat  t
         David's myotis (bat)  c
  D          Little brown bat  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
B D                    Tenrec  c
                     Aardvark  t
B D                 Armadillo  t
B D                  Hedgehog  =
B D                Guinea pig  =
B D                   Lamprey  =
B D                Coelacanth  =
B D                     Shrew  =
B D       Crab-eating macaque  =
            Brush-tailed rat  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D           Tasmanian devil  -
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  -
                  Chinchilla  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Cape golden mole  =
B D                  Platypus  =
B D                   Wallaby  =
B D           Chinese hamster  =
B D                       Cat  =
B D                   Megabat  =
B D                       Pig  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
B D                  Squirrel  =

Inserts between block 21 and 22 in window
      Lesser Egyptian jerboa 13bp
                Prairie vole 34bp
              Golden hamster 23bp
B D                      Rat 5bp
B D                   Rabbit 1bp
B D                     Pika 6bp

Alignment block 22 of 1078 in window, 56741971 - 56741972, 2 bps 
B D                     Human  ga-
B D                     Chimp  ga-
B D                   Gorilla  ga-
B D                 Orangutan  ga-
B D                    Gibbon  ga-
B D                    Rhesus  gg-
B D                    Baboon  gg-
B D              Green monkey  gg-
B D                  Marmoset  gg-
B D           Squirrel monkey  gg-
           Chinese tree shrew  aa-
                 Prairie vole  g--
               Golden hamster  g--
B D                    Rabbit  a--
B D                    Alpaca  -a-
               Bactrian camel  -a-
B D                   Dolphin  -a-
                 Killer whale  -a-
             Tibetan antelope  -a-
B D                       Cow  -a-
B D                     Sheep  -a-
                Domestic goat  -a-
B D                     Horse  -a-
B D          White rhinoceros  -a-
B D                       Dog  -a-
B D                   Ferret   -a-
B D                     Panda  -a-
               Pacific walrus  -a-
                 Weddell seal  -a-
             Black flying-fox  -a-
                Big brown bat  -a-
         David's myotis (bat)  -a-
  D          Little brown bat  -a-
B D                  Elephant  -aa
          Cape elephant shrew  -aa
B D                   Manatee  -aa
B D                    Tenrec  -aa
                     Aardvark  -aa
B D                 Armadillo  -aa
B D                  Hedgehog  ===
B D                Guinea pig  ===
B D                      Pika  ===
B D                   Lamprey  ===
B D                Coelacanth  ===
B D                     Shrew  ===
B D       Crab-eating macaque  ===
            Brush-tailed rat  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ---
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                   Opossum  ---
                  Chinchilla  ===
B D            Naked mole-rat  ===
      Lesser Egyptian jerboa  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Cape golden mole  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D           Chinese hamster  ===
B D                       Cat  ===
B D                   Megabat  ===
B D                  Bushbaby  ---
B D                       Pig  ===
  D  Chinese softshell turtle  ===
B D                       Rat  ===
B D                     Mouse  ---
             Star-nosed mole  ===
B D                  Squirrel  ===

Inserts between block 22 and 23 in window
                Prairie vole 1bp
              Golden hamster 1bp
B D                   Rabbit 1bp
B D                   Alpaca 6bp
              Bactrian camel 6bp
B D                  Dolphin 6bp
                Killer whale 6bp
            Tibetan antelope 8bp
B D                      Cow 8bp
B D                    Sheep 8bp
               Domestic goat 8bp
B D                    Horse 22bp
B D         White rhinoceros 12bp
B D                      Dog 249bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
               Big brown bat 15bp
        David's myotis (bat) 2bp
  D         Little brown bat 2bp
B D                 Elephant 4bp
         Cape elephant shrew 8bp
B D                   Tenrec 16bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 23 of 1078 in window, 56741973 - 56741974, 2 bps 
B D                     Human  -ct
B D                     Chimp  -ct
B D                   Gorilla  -ct
B D                 Orangutan  -ct
B D                    Gibbon  -ct
B D                    Rhesus  -cc
B D                    Baboon  -cc
B D              Green monkey  -cc
B D                  Marmoset  -cc
B D           Squirrel monkey  -cc
           Chinese tree shrew  -gt
                 Prairie vole  -cg
               Golden hamster  -ca
B D                   Ferret   -tt
B D                     Panda  -tt
               Pacific walrus  -tt
                 Weddell seal  -tt
             Black flying-fox  -ct
B D                   Manatee  ac-
B D                  Hedgehog  ===
B D                Guinea pig  ===
B D                      Pika  ===
B D                    Rabbit  ===
B D                   Lamprey  ===
B D                Coelacanth  ===
B D                     Shrew  ===
B D       Crab-eating macaque  ===
            Brush-tailed rat  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ---
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                   Opossum  ---
                  Chinchilla  ===
B D            Naked mole-rat  ===
      Lesser Egyptian jerboa  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Cape golden mole  ===
         Cape elephant shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D           Chinese hamster  ===
                    Aardvark  ===
B D                  Elephant  ===
B D                    Tenrec  ===
B D                       Cat  ===
B D                   Megabat  ===
B D                  Bushbaby  ---
B D                       Pig  ===
  D  Chinese softshell turtle  ===
B D                   Dolphin  ===
B D                       Rat  ===
B D                     Mouse  ---
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
             Star-nosed mole  ===
              Bactrian camel  ===
B D                    Alpaca  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D                  Squirrel  ===
B D                 Armadillo  ===
        David's myotis (bat)  ===
               Big brown bat  ===
  D          Little brown bat  ===
B D                       Dog  ===
B D                       Cow  ===
                Killer whale  ===

Inserts between block 23 and 24 in window
B D                  Ferret  9bp
            Black flying-fox 8bp
B D                  Manatee 586bp

Alignment block 24 of 1078 in window, 56741975 - 56741975, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  a
B D           Squirrel monkey  a
           Chinese tree shrew  g
                 Prairie vole  g
               Golden hamster  g
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
B D                  Hedgehog  =
B D                Guinea pig  =
B D                      Pika  =
B D                    Rabbit  =
B D                   Lamprey  =
B D                Coelacanth  =
B D                     Shrew  =
B D       Crab-eating macaque  =
            Brush-tailed rat  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D           Tasmanian devil  -
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  -
                  Chinchilla  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Cape golden mole  =
         Cape elephant shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  =
B D           Chinese hamster  =
                    Aardvark  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
B D                   Megabat  =
B D                  Bushbaby  -
B D                       Pig  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
B D                   Dolphin  =
B D                       Rat  =
B D                     Mouse  -
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
             Star-nosed mole  =
              Bactrian camel  =
B D                    Alpaca  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                 Armadillo  =
        David's myotis (bat)  =
               Big brown bat  =
  D          Little brown bat  =
B D                       Dog  =
B D                       Cow  =
                Killer whale  =

Inserts between block 24 and 25 in window
          Chinese tree shrew 455bp

Alignment block 25 of 1078 in window, 56741976 - 56741978, 3 bps 
B D                     Human  ggc
B D                     Chimp  ggt
B D                   Gorilla  ggc
B D                 Orangutan  ggc
B D                    Gibbon  ggc
B D                    Rhesus  ggc
B D                    Baboon  ggg
B D              Green monkey  ggc
B D                  Marmoset  ggc
B D           Squirrel monkey  ggc
B D                  Bushbaby  agg
                 Prairie vole  gca
               Golden hamster  gca
B D                     Panda  aac
               Pacific walrus  aac
B D                  Hedgehog  ===
B D                Guinea pig  ===
B D                      Pika  ===
B D                    Rabbit  ===
B D                   Lamprey  ===
B D                Coelacanth  ===
B D                     Shrew  ===
B D       Crab-eating macaque  ===
            Brush-tailed rat  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ---
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                   Opossum  ---
                  Chinchilla  ===
B D            Naked mole-rat  ===
      Lesser Egyptian jerboa  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Cape golden mole  ===
          Chinese tree shrew  ===
         Cape elephant shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D                   Manatee  ===
B D           Chinese hamster  ===
                    Aardvark  ===
B D                  Elephant  ===
B D                    Tenrec  ===
B D                       Cat  ===
B D                   Megabat  ===
B D                       Pig  ===
  D  Chinese softshell turtle  ===
B D                   Ferret   ===
B D                   Dolphin  ===
B D                       Rat  ===
B D                     Mouse  ---
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
             Star-nosed mole  ===
              Bactrian camel  ===
B D                    Alpaca  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D                  Squirrel  ===
B D                 Armadillo  ===
                Weddell seal  ---
        David's myotis (bat)  ===
               Big brown bat  ===
  D          Little brown bat  ===
B D                       Dog  ===
B D                       Cow  ===
                Killer whale  ===

Inserts between block 25 and 26 in window
B D                    Panda 4bp
              Pacific walrus 3bp

Alignment block 26 of 1078 in window, 56741979 - 56742022, 44 bps 
B D                     Human  gtggtggctcatgcctgtactcccagcactttgggaggcagagg
B D                     Chimp  gtggtggctcatgcctgtactcccagcactttgggaggctgagg
B D                   Gorilla  atggtggctcatgcctgtactcccagcactttgggaggctgagg
B D                 Orangutan  gtggtggctcatgcctgtactcccagcactttgggaggctgagg
B D                    Gibbon  gtggtggctcatgcctgtactcccagcactttgggaggctgagg
B D                    Rhesus  atggtggctcaagcctgtaatcccagcactttgggaggccgaga
B D                    Baboon  atggtggctcaagcctgtaatcccagcactttgggaggctgagg
B D              Green monkey  atggtggctcaagcctgtaatcccagcactttgggaggctgagg
B D                  Marmoset  atggt---------------------------------------
B D           Squirrel monkey  gtggt---------------------------------------
B D                  Bushbaby  gtggtgcct-----------------------------------
       Lesser Egyptian jerboa  -----------------------------cttgggctggagaga
                 Prairie vole  gtggtggcgcacacctttaatcccagca-ttagggatgcagagg
               Golden hamster  atggtgccacatgcatttaatcccagca-ctcggaaggcagagg
B D                  Hedgehog  ============================================
B D                Guinea pig  ============================================
B D                      Pika  ============================================
B D                    Rabbit  ============================================
B D                   Lamprey  ============================================
B D                Coelacanth  ============================================
B D                     Shrew  ============================================
B D       Crab-eating macaque  ============================================
            Brush-tailed rat  ============================================
B D              Atlantic cod  ============================================
                 Spotted gar  ============================================
B D               Stickleback  ============================================
          Southern platyfish  ============================================
      Yellowbelly pufferfish  ============================================
B D                      Fugu  ============================================
B D                    Turkey  ============================================
B D                   Chicken  ============================================
          Tibetan ground jay  ============================================
B D               Zebra finch  ============================================
B D           Tasmanian devil  --------------------------------------------
    Mexican tetra (cavefish)  ============================================
B D                 Zebrafish  ============================================
B D                    Medaka  ============================================
         Pundamilia nyererei  ============================================
                 Zebra mbuna  ============================================
       Burton's mouthbreeder  ============================================
         Princess of Burundi  ============================================
B D              Nile tilapia  ============================================
B D             X. tropicalis  ============================================
  D            Painted turtle  ============================================
  D           Green seaturtle  ============================================
B D        American alligator  ============================================
  D             Scarlet macaw  ============================================
B D                   Opossum  --------------------------------------------
                  Chinchilla  ============================================
B D            Naked mole-rat  ============================================
  D               Rock pigeon  ============================================
  D       Collared flycatcher  ============================================
B D       Medium ground finch  ============================================
B D                    Lizard  ============================================
  D          Peregrine falcon  ============================================
  D              Saker falcon  ============================================
  D                    Parrot  ============================================
            Cape golden mole  ============================================
          Chinese tree shrew  ============================================
         Cape elephant shrew  ============================================
B D                  Platypus  ============================================
B D                   Wallaby  ============================================
B D                   Manatee  ============================================
B D           Chinese hamster  ============================================
                    Aardvark  ============================================
B D                  Elephant  ============================================
B D                    Tenrec  ============================================
B D                       Cat  ============================================
B D                   Megabat  ============================================
B D                       Pig  ============================================
  D  Chinese softshell turtle  ============================================
B D                   Ferret   ============================================
B D                   Dolphin  ============================================
B D                       Rat  ============================================
B D                     Mouse  --------------------------------------------
B D                     Panda  ============================================
               Domestic goat  ============================================
B D                     Sheep  ============================================
            Tibetan antelope  ============================================
             Star-nosed mole  ============================================
              Bactrian camel  ============================================
B D                    Alpaca  ============================================
              Pacific walrus  ============================================
            Black flying-fox  ============================================
B D          White rhinoceros  ============================================
B D                     Horse  ============================================
B D                  Squirrel  ============================================
B D                 Armadillo  ============================================
                Weddell seal  --------------------------------------------
        David's myotis (bat)  ============================================
               Big brown bat  ============================================
  D          Little brown bat  ============================================
B D                       Dog  ============================================
B D                       Cow  ============================================
                Killer whale  ============================================

Inserts between block 26 and 27 in window
      Lesser Egyptian jerboa 13bp
              Golden hamster 17bp

Alignment block 27 of 1078 in window, 56742023 - 56742042, 20 bps 
B D                     Human  tgggtggatcac-gtgaggtc
B D                     Chimp  tgggtggatcac-gtgaggtc
B D                   Gorilla  tgggtggatcac-gtgaggtc
B D                 Orangutan  tgggtggatcac-gtgaggtc
B D                    Gibbon  tgggtggatcac-gtgaggtc
B D                    Rhesus  cgggcggatcac---gaggtc
B D                    Baboon  tgggtggatcac-gtgaggtc
B D              Green monkey  tgggtggatcac-gtgaggtc
B D                  Marmoset  -----ggatcac-ctgaggtc
B D           Squirrel monkey  -----ggatcac-ctgcagtc
B D                  Bushbaby  ---gtggctcag---------
       Lesser Egyptian jerboa  aaggcacttgcctgcaaagcc
                 Prairie vole  caggtagatctc---------
B D                  Hedgehog  =====================
B D                Guinea pig  =====================
B D                      Pika  =====================
B D                    Rabbit  =====================
B D                   Lamprey  =====================
B D                Coelacanth  =====================
B D                     Shrew  =====================
              Golden hamster  =====================
B D       Crab-eating macaque  =====================
            Brush-tailed rat  =====================
B D              Atlantic cod  =====================
                 Spotted gar  =====================
B D               Stickleback  =====================
          Southern platyfish  =====================
      Yellowbelly pufferfish  =====================
B D                      Fugu  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
B D           Tasmanian devil  ---------------------
    Mexican tetra (cavefish)  =====================
B D                 Zebrafish  =====================
B D                    Medaka  =====================
         Pundamilia nyererei  =====================
                 Zebra mbuna  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D              Nile tilapia  =====================
B D             X. tropicalis  =====================
  D            Painted turtle  =====================
  D           Green seaturtle  =====================
B D        American alligator  =====================
  D             Scarlet macaw  =====================
B D                   Opossum  ---------------------
                  Chinchilla  =====================
B D            Naked mole-rat  =====================
  D               Rock pigeon  =====================
  D       Collared flycatcher  =====================
B D       Medium ground finch  =====================
B D                    Lizard  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D                    Parrot  =====================
            Cape golden mole  =====================
          Chinese tree shrew  =====================
         Cape elephant shrew  =====================
B D                  Platypus  =====================
B D                   Wallaby  =====================
B D                   Manatee  =====================
B D           Chinese hamster  =====================
                    Aardvark  =====================
B D                  Elephant  =====================
B D                    Tenrec  =====================
B D                       Cat  =====================
B D                   Megabat  =====================
B D                       Pig  =====================
  D  Chinese softshell turtle  =====================
B D                   Ferret   =====================
B D                   Dolphin  =====================
B D                       Rat  =====================
B D                     Mouse  ---------------------
B D                     Panda  =====================
               Domestic goat  =====================
B D                     Sheep  =====================
            Tibetan antelope  =====================
             Star-nosed mole  =====================
              Bactrian camel  =====================
B D                    Alpaca  =====================
              Pacific walrus  =====================
            Black flying-fox  =====================
B D          White rhinoceros  =====================
B D                     Horse  =====================
B D                  Squirrel  =====================
B D                 Armadillo  =====================
                Weddell seal  ---------------------
        David's myotis (bat)  =====================
               Big brown bat  =====================
  D          Little brown bat  =====================
B D                       Dog  =====================
B D                       Cow  =====================
                Killer whale  =====================

Alignment block 28 of 1078 in window, 56742043 - 56742073, 31 bps 
B D                     Human  aggagatcgagaccagc-----ctg-------gccaacatggt
B D                     Chimp  aggagttcgagaccagc-----ctg-------gccaacatggt
B D                   Gorilla  aggagttcgagaccagc-----ctg-------gccaacatggt
B D                 Orangutan  aggagttcgagaccagc-----ctg-------gccaacatggt
B D                    Gibbon  aggagttcgagaccagc-----ctg-------gtcaacatggt
B D                    Rhesus  aggagatcgagaccatc-----ctggctaacagttaacgtggt
B D                    Baboon  aggagtttgagaccagc-----ctg-------gtgaacgtggt
B D              Green monkey  aggagtttgagaccagc-----ctg-------gtgaacgtggt
B D                  Marmoset  aggagttcaagaccagc-----ctg-------gccaacatggt
B D           Squirrel monkey  aggagttgaagaccagc-----ctg-------gccaacatggt
B D                  Bushbaby  -----------------------tg---------------ggt
       Lesser Egyptian jerboa  aaaggacccaggttcga-----ttc-------cccaaga----
                 Prairie vole  -tgagttccaggccagc-----ctg-------gtctacagagt
               Golden hamster  aagagttccaggacagccagagctg-------ttatacaga--
B D                  Hedgehog  ===========================================
B D                Guinea pig  ===========================================
B D                      Pika  ===========================================
B D                    Rabbit  ===========================================
B D                   Lamprey  ===========================================
B D                Coelacanth  ===========================================
B D                     Shrew  ===========================================
B D       Crab-eating macaque  ===========================================
            Brush-tailed rat  ===========================================
B D              Atlantic cod  ===========================================
                 Spotted gar  ===========================================
B D               Stickleback  ===========================================
          Southern platyfish  ===========================================
      Yellowbelly pufferfish  ===========================================
B D                      Fugu  ===========================================
B D                    Turkey  ===========================================
B D                   Chicken  ===========================================
          Tibetan ground jay  ===========================================
B D               Zebra finch  ===========================================
B D           Tasmanian devil  -------------------------------------------
    Mexican tetra (cavefish)  ===========================================
B D                 Zebrafish  ===========================================
B D                    Medaka  ===========================================
         Pundamilia nyererei  ===========================================
                 Zebra mbuna  ===========================================
       Burton's mouthbreeder  ===========================================
         Princess of Burundi  ===========================================
B D              Nile tilapia  ===========================================
B D             X. tropicalis  ===========================================
  D            Painted turtle  ===========================================
  D           Green seaturtle  ===========================================
B D        American alligator  ===========================================
  D             Scarlet macaw  ===========================================
B D                   Opossum  -------------------------------------------
                  Chinchilla  ===========================================
B D            Naked mole-rat  ===========================================
  D               Rock pigeon  ===========================================
  D       Collared flycatcher  ===========================================
B D       Medium ground finch  ===========================================
B D                    Lizard  ===========================================
  D          Peregrine falcon  ===========================================
  D              Saker falcon  ===========================================
  D                    Parrot  ===========================================
            Cape golden mole  ===========================================
          Chinese tree shrew  ===========================================
         Cape elephant shrew  ===========================================
B D                  Platypus  ===========================================
B D                   Wallaby  ===========================================
B D                   Manatee  ===========================================
B D           Chinese hamster  ===========================================
                    Aardvark  ===========================================
B D                  Elephant  ===========================================
B D                    Tenrec  ===========================================
B D                       Cat  ===========================================
B D                   Megabat  ===========================================
B D                       Pig  ===========================================
  D  Chinese softshell turtle  ===========================================
B D                   Ferret   ===========================================
B D                   Dolphin  ===========================================
B D                       Rat  ===========================================
B D                     Mouse  -------------------------------------------
B D                     Panda  ===========================================
               Domestic goat  ===========================================
B D                     Sheep  ===========================================
            Tibetan antelope  ===========================================
             Star-nosed mole  ===========================================
              Bactrian camel  ===========================================
B D                    Alpaca  ===========================================
              Pacific walrus  ===========================================
            Black flying-fox  ===========================================
B D          White rhinoceros  ===========================================
B D                     Horse  ===========================================
B D                  Squirrel  ===========================================
B D                 Armadillo  ===========================================
                Weddell seal  -------------------------------------------
        David's myotis (bat)  ===========================================
               Big brown bat  ===========================================
  D          Little brown bat  ===========================================
B D                       Dog  ===========================================
B D                       Cow  ===========================================
                Killer whale  ===========================================

Alignment block 29 of 1078 in window, 56742074 - 56742103, 30 bps 
B D                     Human  gaaaccccatctc---tactaaaaatagaaaaa
B D                     Chimp  gaaaccccatctc---tactaaaaatagaaaaa
B D                   Gorilla  gaaaccccatctc---tactaaaaatagaaaaa
B D                 Orangutan  gaaaccccacctc---cactaaaaatagaaaaa
B D                    Gibbon  gaaaccccatctc---tactaaaaatagaaaaa
B D                    Rhesus  gaaaccccatctc---tactaaaaatagaaaaa
B D                    Baboon  gaaaccccatctc---tactaaaaatagaaaaa
B D              Green monkey  gaaaccccatctc---tactaaaaatagaaaaa
B D                  Marmoset  gaaaccccatctc---tactaaaaatacaaaaa
B D           Squirrel monkey  aaaaccccatctc---tactaaaaatacaaaaa
B D                  Bushbaby  agggcaccagctc---cat---acattgag---
       Lesser Egyptian jerboa  ----ccca----catatgctaga----------
               Golden hamster  gaaacccggtctcaaaaactaaaaaccaaaaaa
B D                  Hedgehog  =================================
B D                Guinea pig  =================================
B D                      Pika  =================================
B D                    Rabbit  =================================
B D                   Lamprey  =================================
B D                Coelacanth  =================================
B D                     Shrew  =================================
B D       Crab-eating macaque  =================================
            Brush-tailed rat  =================================
B D              Atlantic cod  =================================
                 Spotted gar  =================================
B D               Stickleback  =================================
          Southern platyfish  =================================
      Yellowbelly pufferfish  =================================
B D                      Fugu  =================================
B D                    Turkey  =================================
B D                   Chicken  =================================
          Tibetan ground jay  =================================
B D               Zebra finch  =================================
B D           Tasmanian devil  ---------------------------------
    Mexican tetra (cavefish)  =================================
B D                 Zebrafish  =================================
B D                    Medaka  =================================
         Pundamilia nyererei  =================================
                 Zebra mbuna  =================================
       Burton's mouthbreeder  =================================
         Princess of Burundi  =================================
B D              Nile tilapia  =================================
B D             X. tropicalis  =================================
  D            Painted turtle  =================================
  D           Green seaturtle  =================================
B D        American alligator  =================================
  D             Scarlet macaw  =================================
B D                   Opossum  ---------------------------------
                  Chinchilla  =================================
B D            Naked mole-rat  =================================
  D               Rock pigeon  =================================
  D       Collared flycatcher  =================================
B D       Medium ground finch  =================================
B D                    Lizard  =================================
  D          Peregrine falcon  =================================
  D              Saker falcon  =================================
  D                    Parrot  =================================
            Cape golden mole  =================================
          Chinese tree shrew  =================================
         Cape elephant shrew  =================================
B D                  Platypus  =================================
B D                   Wallaby  =================================
B D                   Manatee  =================================
B D           Chinese hamster  =================================
                Prairie vole  ---------------------------------
                    Aardvark  =================================
B D                  Elephant  =================================
B D                    Tenrec  =================================
B D                       Cat  =================================
B D                   Megabat  =================================
B D                       Pig  =================================
  D  Chinese softshell turtle  =================================
B D                   Ferret   =================================
B D                   Dolphin  =================================
B D                       Rat  =================================
B D                     Mouse  ---------------------------------
B D                     Panda  =================================
               Domestic goat  =================================
B D                     Sheep  =================================
            Tibetan antelope  =================================
             Star-nosed mole  =================================
              Bactrian camel  =================================
B D                    Alpaca  =================================
              Pacific walrus  =================================
            Black flying-fox  =================================
B D          White rhinoceros  =================================
B D                     Horse  =================================
B D                  Squirrel  =================================
B D                 Armadillo  =================================
                Weddell seal  ---------------------------------
        David's myotis (bat)  =================================
               Big brown bat  =================================
  D          Little brown bat  =================================
B D                       Dog  =================================
B D                       Cow  =================================
                Killer whale  =================================

Inserts between block 29 and 30 in window
              Golden hamster 1bp

Alignment block 30 of 1078 in window, 56742104 - 56742127, 24 bps 
B D                     Human  tcagcagggcatggtggtgcacat
B D                     Chimp  tcagcagggcatggtggtgcacat
B D                   Gorilla  tcagcagggcatggtggtgcaaat
B D                 Orangutan  tcagcagggcatggtggtgcacat
B D                    Gibbon  tcagcagggcatggtggtgcacat
B D                    Rhesus  tcagcagggcatgatggctcacat
B D                    Baboon  tcagcagggcatggtggctcacat
B D              Green monkey  tcagcagggcatggtggctcacat
B D                  Marmoset  tcagctggggatggtgacacatat
B D           Squirrel monkey  tcagctggggatggtgacacagat
B D                  Bushbaby  ------------ggttgcaggcac
       Lesser Egyptian jerboa  -----tggacaaggtgacccacac
B D                  Hedgehog  ========================
B D                Guinea pig  ========================
B D                      Pika  ========================
B D                    Rabbit  ========================
B D                   Lamprey  ========================
B D                Coelacanth  ========================
B D                     Shrew  ========================
              Golden hamster  ========================
B D       Crab-eating macaque  ========================
            Brush-tailed rat  ========================
B D              Atlantic cod  ========================
                 Spotted gar  ========================
B D               Stickleback  ========================
          Southern platyfish  ========================
      Yellowbelly pufferfish  ========================
B D                      Fugu  ========================
B D                    Turkey  ========================
B D                   Chicken  ========================
          Tibetan ground jay  ========================
B D               Zebra finch  ========================
B D           Tasmanian devil  ------------------------
    Mexican tetra (cavefish)  ========================
B D                 Zebrafish  ========================
B D                    Medaka  ========================
         Pundamilia nyererei  ========================
                 Zebra mbuna  ========================
       Burton's mouthbreeder  ========================
         Princess of Burundi  ========================
B D              Nile tilapia  ========================
B D             X. tropicalis  ========================
  D            Painted turtle  ========================
  D           Green seaturtle  ========================
B D        American alligator  ========================
  D             Scarlet macaw  ========================
B D                   Opossum  ------------------------
                  Chinchilla  ========================
B D            Naked mole-rat  ========================
  D               Rock pigeon  ========================
  D       Collared flycatcher  ========================
B D       Medium ground finch  ========================
B D                    Lizard  ========================
  D          Peregrine falcon  ========================
  D              Saker falcon  ========================
  D                    Parrot  ========================
            Cape golden mole  ========================
          Chinese tree shrew  ========================
         Cape elephant shrew  ========================
B D                  Platypus  ========================
B D                   Wallaby  ========================
B D                   Manatee  ========================
B D           Chinese hamster  ========================
                Prairie vole  ------------------------
                    Aardvark  ========================
B D                  Elephant  ========================
B D                    Tenrec  ========================
B D                       Cat  ========================
B D                   Megabat  ========================
B D                       Pig  ========================
  D  Chinese softshell turtle  ========================
B D                   Ferret   ========================
B D                   Dolphin  ========================
B D                       Rat  ========================
B D                     Mouse  ------------------------
B D                     Panda  ========================
               Domestic goat  ========================
B D                     Sheep  ========================
            Tibetan antelope  ========================
             Star-nosed mole  ========================
              Bactrian camel  ========================
B D                    Alpaca  ========================
              Pacific walrus  ========================
            Black flying-fox  ========================
B D          White rhinoceros  ========================
B D                     Horse  ========================
B D                  Squirrel  ========================
B D                 Armadillo  ========================
                Weddell seal  ------------------------
        David's myotis (bat)  ========================
               Big brown bat  ========================
  D          Little brown bat  ========================
B D                       Dog  ========================
B D                       Cow  ========================
                Killer whale  ========================

Inserts between block 30 and 31 in window
      Lesser Egyptian jerboa 73bp

Alignment block 31 of 1078 in window, 56742128 - 56742206, 79 bps 
B D                     Human  ctgtaatcctagctactctggaggctgaggcaggaaaattgcttaaatctgcaaggtgaaggttgcagtg
B D                     Chimp  ctgtaatcctagctactctggaggctgaggcaggaaaattgcttaaacctgcaaggtgaaggttgcagtg
B D                   Gorilla  ctgtaatcctagctactctggaggctgaggcaggaaaattgcttaaacctgcaaggtgaaggttgcagtg
B D                 Orangutan  ctgtaatcctagttacactggaggctgaggcaggaaaattgcttaaacctgcaaggtgaaggttgcagtg
B D                    Gibbon  ctgtaatcctagctactctggaggctgaggcaggaaaattgcttaaacctgcaaggtgaaggttgcagtg
B D                    Rhesus  ctgtaatcgtacctactctggaggctgaggcaggaaaattgcttaaacccgcaaggtgaaggttgcagtg
B D                    Baboon  ctgtaatcgtagctactctggaggctgaggcaggaaaattgcttaaacccgcaaggtgaaggttgcagtg
B D              Green monkey  ctgtaatcgtagctactctagaggctgaggcaggaaaattgcttaaacccgcaaggtgaaggttgcagtg
B D                  Marmoset  ctgtaattccagctgcttgggaggcagaggcaggtgaaatgcttgaacttggaaggtataagttgcagtg
B D           Squirrel monkey  ctgtaattccagctacttgggaggcagaggcaggtgaaatgcttgaacccagaaggtatagattacagtg
B D                  Bushbaby  ctgtagttccagctacttgggatgctgaggcaagaggatcacttgagtcc-tgagttggagggtactgtg
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                   Lamprey  ======================================================================
B D                Coelacanth  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
B D       Crab-eating macaque  ======================================================================
            Brush-tailed rat  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D           Tasmanian devil  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
                  Chinchilla  ======================================================================
B D            Naked mole-rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Cape golden mole  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ----------------------------------------------------------------------
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
B D                   Dolphin  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ----------------------------------------------------------------------
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
             Star-nosed mole  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
B D                 Armadillo  ======================================================================
                Weddell seal  ----------------------------------------------------------------------
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
  D          Little brown bat  ======================================================================
B D                       Dog  ======================================================================
B D                       Cow  ======================================================================
                Killer whale  ======================================================================

                        Human  agctgagat
                        Chimp  agctgagat
                      Gorilla  agctgagat
                    Orangutan  aaccaagat
                       Gibbon  agccgagat
                       Rhesus  agcggagat
                       Baboon  agcggagat
                 Green monkey  agcggagat
                     Marmoset  agccaagat
              Squirrel monkey  agccaagat
                     Bushbaby  agctatga-
                     Hedgehog  =========
                   Guinea pig  =========
                         Pika  =========
                       Rabbit  =========
                      Lamprey  =========
                   Coelacanth  =========
                        Shrew  =========
               Golden hamster  =========
          Crab-eating macaque  =========
             Brush-tailed rat  =========
                 Atlantic cod  =========
                  Spotted gar  =========
                  Stickleback  =========
           Southern platyfish  =========
       Yellowbelly pufferfish  =========
                         Fugu  =========
                       Turkey  =========
                      Chicken  =========
           Tibetan ground jay  =========
                  Zebra finch  =========
              Tasmanian devil  ---------
     Mexican tetra (cavefish)  =========
                    Zebrafish  =========
                       Medaka  =========
          Pundamilia nyererei  =========
                  Zebra mbuna  =========
        Burton's mouthbreeder  =========
          Princess of Burundi  =========
                 Nile tilapia  =========
                X. tropicalis  =========
               Painted turtle  =========
              Green seaturtle  =========
           American alligator  =========
                Scarlet macaw  =========
                      Opossum  ---------
                   Chinchilla  =========
               Naked mole-rat  =========
       Lesser Egyptian jerboa  =========
                  Rock pigeon  =========
          Collared flycatcher  =========
          Medium ground finch  =========
                       Lizard  =========
             Peregrine falcon  =========
                 Saker falcon  =========
                       Parrot  =========
             Cape golden mole  =========
           Chinese tree shrew  =========
          Cape elephant shrew  =========
                     Platypus  =========
                      Wallaby  =========
                      Manatee  =========
              Chinese hamster  =========
                 Prairie vole  ---------
                     Aardvark  =========
                     Elephant  =========
                       Tenrec  =========
                          Cat  =========
                      Megabat  =========
                          Pig  =========
     Chinese softshell turtle  =========
                      Ferret   =========
                      Dolphin  =========
                          Rat  =========
                        Mouse  ---------
                        Panda  =========
                Domestic goat  =========
                        Sheep  =========
             Tibetan antelope  =========
              Star-nosed mole  =========
               Bactrian camel  =========
                       Alpaca  =========
               Pacific walrus  =========
             Black flying-fox  =========
             White rhinoceros  =========
                        Horse  =========
                     Squirrel  =========
                    Armadillo  =========
                 Weddell seal  ---------
         David's myotis (bat)  =========
                Big brown bat  =========
             Little brown bat  =========
                          Dog  =========
                          Cow  =========
                 Killer whale  =========

Alignment block 32 of 1078 in window, 56742207 - 56742242, 36 bps 
B D                     Human  tgtgccactgtgctacagcctgggcaacagagtgag
B D                     Chimp  tgtgccactgtgctacagcctgggcaacagagtgag
B D                   Gorilla  tgtgccactgcgctacagcctgggcaacagagtgag
B D                 Orangutan  tgtgccactgcgctacagcctgggcaacagagtgag
B D                    Gibbon  tgtgccactgcactacagcctgggcgacagagtgag
B D                    Rhesus  tgtgccactgcactacagcctgggtgacagagtgag
B D                    Baboon  tgtgccactgcactacagcctgggtgacagagtgag
B D              Green monkey  tgtgccactgcactacagcctgggtgacagagtgag
B D                  Marmoset  tgtgccattgcactacagcctgtgtgatagagtgag
B D           Squirrel monkey  tgtgcaattgcactacagcctgggtgatagggtgag
B D                  Bushbaby  --tgccattgcacactactgagggcgataaagtaag
             Brush-tailed rat  tgtgccactatgtgctgccacatttcttagggca--
B D                  Hedgehog  ====================================
B D                Guinea pig  ====================================
B D                      Pika  ====================================
B D                    Rabbit  ====================================
B D                   Lamprey  ====================================
B D                Coelacanth  ====================================
B D                     Shrew  ====================================
              Golden hamster  ====================================
B D       Crab-eating macaque  ====================================
B D              Atlantic cod  ====================================
                 Spotted gar  ====================================
B D               Stickleback  ====================================
          Southern platyfish  ====================================
      Yellowbelly pufferfish  ====================================
B D                      Fugu  ====================================
B D                    Turkey  ====================================
B D                   Chicken  ====================================
          Tibetan ground jay  ====================================
B D               Zebra finch  ====================================
B D           Tasmanian devil  ------------------------------------
    Mexican tetra (cavefish)  ====================================
B D                 Zebrafish  ====================================
B D                    Medaka  ====================================
         Pundamilia nyererei  ====================================
                 Zebra mbuna  ====================================
       Burton's mouthbreeder  ====================================
         Princess of Burundi  ====================================
B D              Nile tilapia  ====================================
B D             X. tropicalis  ====================================
  D            Painted turtle  ====================================