Multiz Alignments of 100 Vertebrates

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 641 in window, 56694976 - 56695099, 124 bps 
B D                     Human  aaagtgctgggattacgggcgtgagccactgcgccctgctgtgcccggctaatttttgtatttttagtag
B D                     Chimp  aaagtgctgggattacaggcgtgagccaccgcgccctgctgtgcccggctaatttttgtatttttagtag
B D                   Gorilla  aaagtgctgggattacaggcataagccaccgcgccctgctgtgcccggctaatttttgtatttttagtag
B D                 Orangutan  aaagtgctgggattacaggcatgagccactgcaccctgctgtgcccggctaatttttgtatttttagtag
B D                    Rhesus  aaagtgctgggattacaggcatgagccaacgcgccctgctgtgcccagcaaatttttgtatttttagtgg
B D       Crab-eating macaque  aaagtgctgggattacaggcatgagccaccgcgccctgctgtgcccagcaaatttttgtatttttagtgg
B D              Green monkey  gaagtgctgggattacaggcatgagccaccacgccctgctgtgcccagcaaatttttgtatttttagtgg
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                Coelacanth  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
            Brush-tailed rat  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Gibbon  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ======================================================================
                  Chinchilla  ======================================================================
B D            Naked mole-rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
            Cape golden mole  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Manatee  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                   Megabat  ======================================================================
B D                  Bushbaby  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
B D                   Dolphin  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
             Star-nosed mole  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
B D                 Armadillo  ======================================================================
                Weddell seal  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
  D          Little brown bat  ======================================================================
B D                  Marmoset  ======================================================================
B D                       Dog  ======================================================================
B D                       Cow  ======================================================================
                Killer whale  ======================================================================

                        Human  agatggggttttgtgatgttggccaggctggtcttgtactcccaacctcaggtg
                        Chimp  agatggggttttgtgatgttggccaggctggtcttgaactcccaacttcaggtg
                      Gorilla  agatggggttttgtgatgttggccaggctggtcttgaactcccaacctcaggtg
                    Orangutan  agat-ggattttgtgatgttggccaggctggtcttgaactcccaacctcagg--
                       Rhesus  agacagggttttgtgatgttggccaggctggtgttgaactcctaacctcaggtg
          Crab-eating macaque  agacagggttttgtgatgttggccaggctggtgttgaactcctaacctcaggtg
                 Green monkey  agacagggttttgtgatgttggccaggctggtgttgaactcctaacctcaagtg
                     Hedgehog  ======================================================
                   Guinea pig  ======================================================
                         Pika  ======================================================
                       Rabbit  ======================================================
                   Coelacanth  ======================================================
                        Shrew  ======================================================
               Golden hamster  ======================================================
             Brush-tailed rat  ======================================================
                 Atlantic cod  ======================================================
                       Gibbon  ======================================================
                  Spotted gar  ======================================================
                  Stickleback  ======================================================
           Southern platyfish  ======================================================
       Yellowbelly pufferfish  ======================================================
                         Fugu  ======================================================
                    Tetraodon  ======================================================
                      Chicken  ======================================================
                 Mallard duck  ======================================================
           Tibetan ground jay  ======================================================
                  Zebra finch  ======================================================
                       Medaka  ======================================================
          Pundamilia nyererei  ======================================================
                  Zebra mbuna  ======================================================
        Burton's mouthbreeder  ======================================================
          Princess of Burundi  ======================================================
                 Nile tilapia  ======================================================
               Painted turtle  ======================================================
              Green seaturtle  ======================================================
           American alligator  ======================================================
                Scarlet macaw  ======================================================
                      Opossum  ======================================================
                   Chinchilla  ======================================================
               Naked mole-rat  ======================================================
       Lesser Egyptian jerboa  ======================================================
                  Rock pigeon  ======================================================
          Collared flycatcher  ======================================================
          Medium ground finch  ======================================================
                       Lizard  ======================================================
             Peregrine falcon  ======================================================
                 Saker falcon  ======================================================
             Cape golden mole  ======================================================
           Chinese tree shrew  ======================================================
          Cape elephant shrew  ======================================================
                     Platypus  ======================================================
                      Manatee  ======================================================
              Chinese hamster  ======================================================
                 Prairie vole  ======================================================
                     Aardvark  ======================================================
                     Elephant  ======================================================
                       Tenrec  ======================================================
                          Cat  ======================================================
                      Megabat  ======================================================
                     Bushbaby  ======================================================
                          Pig  ======================================================
     Chinese softshell turtle  ======================================================
                      Ferret   ======================================================
                      Dolphin  ======================================================
                          Rat  ======================================================
                        Mouse  ======================================================
                        Panda  ======================================================
                Domestic goat  ======================================================
                        Sheep  ======================================================
             Tibetan antelope  ======================================================
              Star-nosed mole  ======================================================
               Bactrian camel  ======================================================
                       Alpaca  ======================================================
               Pacific walrus  ======================================================
             Black flying-fox  ======================================================
             White rhinoceros  ======================================================
                        Horse  ======================================================
                     Squirrel  ======================================================
                    Armadillo  ======================================================
                 Weddell seal  ======================================================
         David's myotis (bat)  ======================================================
                Big brown bat  ======================================================
             Little brown bat  ======================================================
                     Marmoset  ======================================================
                          Dog  ======================================================
                          Cow  ======================================================
                 Killer whale  ======================================================

Alignment block 2 of 641 in window, 56695100 - 56695257, 158 bps 
B D                     Human  atccaccagccttggcctcccaaagtgctaagatgacaggcgtgagccactgcgcctggccac-ttcgag
B D                     Chimp  atccaccagccttggcctcccaaagtgctaagatgacaggcgtgagccactgcgcctggccac-tacgag
B D                   Gorilla  atccaccagccttggcctcccaaagtgctaagatgac--gcgtgaaccactgcgcctggccac-tacgag
B D                 Orangutan  ------------tggcctcccaaagtgctaggatgacaagcgtgagccactgcacctggccacgtacgag
B D                    Rhesus  atccaccagcctcagcctcccaaagtgctaggatgacaggagtgagccactgtgcgtggccacttatgag
B D       Crab-eating macaque  atccaccagcctcagcctcccaaagtgctaggatgacaggagtgagccactgtgcgtggccacttacaag
B D                    Baboon  atccaccagcctcagcctcccaaagtgctaggatgacaggcgtgagccactgtgcgtggccacttacgag
B D              Green monkey  atccaccaacctcagcctcccaaagtgctaggatgacaggagtgagccactgtgcctggccatttacgag
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                Coelacanth  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
            Brush-tailed rat  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Gibbon  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ======================================================================
                  Chinchilla  ======================================================================
B D            Naked mole-rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
            Cape golden mole  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Manatee  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                   Megabat  ======================================================================
B D                  Bushbaby  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
B D                   Dolphin  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
             Star-nosed mole  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
B D                 Armadillo  ======================================================================
                Weddell seal  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
  D          Little brown bat  ======================================================================
B D                  Marmoset  ======================================================================
B D                       Dog  ======================================================================
B D                       Cow  ======================================================================
                Killer whale  ======================================================================

                        Human  aatctaatgcttgatggaacggtttcattccaaaactattccctcaccatggaaaaacttgtcttgcaca
                        Chimp  aatctaatgcttgatggaacggtttcattccaaaactattccctcaccatggaaaaacttgtcttgcaca
                      Gorilla  aatctaatgcttgatggaacggtttcattccaaaactattccctcaccatggaaaaacttgtcttgcaca
                    Orangutan  aatctaatacttgatggaacggtttctttccaaaactattccctcaccgtggaaaaacttgtcttgcata
                       Rhesus  aatctaatgcttgatggaacagtttcattccaaaactattccctcaccatggaaaaacttgtcttgcaca
          Crab-eating macaque  aatctaatgcttgatggaacagtttcattccaaaactattccctcaccatggaaaaacttgtcttgcaca
                       Baboon  aatctaatgcttgatggaacagtttcattccaaaactattccctcaccatggaaaaacttgtcttgcaca
                 Green monkey  aatctaatgcttgatggaacagtttcattccaaaactattctctcaccatggaaaaacttgtcttgcaca
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                   Coelacanth  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  ======================================================================
             Brush-tailed rat  ======================================================================
                 Atlantic cod  ======================================================================
                       Gibbon  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
             Little brown bat  ======================================================================
                     Marmoset  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  aaacccatttctggtgcca
                        Chimp  aaacccatttctggtgcca
                      Gorilla  aaacccatttctgatgcca
                    Orangutan  aaacccatttctggtgcca
                       Rhesus  aaacccatttctggtgcca
          Crab-eating macaque  aaacccatttctggtgcca
                       Baboon  aaacccatttctggtgcca
                 Green monkey  aaacccatttctggtgcca
                     Hedgehog  ===================
                   Guinea pig  ===================
                         Pika  ===================
                       Rabbit  ===================
                   Coelacanth  ===================
                        Shrew  ===================
               Golden hamster  ===================
             Brush-tailed rat  ===================
                 Atlantic cod  ===================
                       Gibbon  ===================
                  Spotted gar  ===================
                  Stickleback  ===================
           Southern platyfish  ===================
       Yellowbelly pufferfish  ===================
                         Fugu  ===================
                    Tetraodon  ===================
                      Chicken  ===================
                 Mallard duck  ===================
           Tibetan ground jay  ===================
                  Zebra finch  ===================
                       Medaka  ===================
          Pundamilia nyererei  ===================
                  Zebra mbuna  ===================
        Burton's mouthbreeder  ===================
          Princess of Burundi  ===================
                 Nile tilapia  ===================
               Painted turtle  ===================
              Green seaturtle  ===================
           American alligator  ===================
                Scarlet macaw  ===================
                      Opossum  ===================
                   Chinchilla  ===================
               Naked mole-rat  ===================
       Lesser Egyptian jerboa  ===================
                  Rock pigeon  ===================
          Collared flycatcher  ===================
          Medium ground finch  ===================
                       Lizard  ===================
             Peregrine falcon  ===================
                 Saker falcon  ===================
             Cape golden mole  ===================
           Chinese tree shrew  ===================
          Cape elephant shrew  ===================
                     Platypus  ===================
                      Manatee  ===================
              Chinese hamster  ===================
                 Prairie vole  ===================
                     Aardvark  ===================
                     Elephant  ===================
                       Tenrec  ===================
                          Cat  ===================
                      Megabat  ===================
                     Bushbaby  ===================
                          Pig  ===================
     Chinese softshell turtle  ===================
                      Ferret   ===================
                      Dolphin  ===================
                          Rat  ===================
                        Mouse  ===================
                        Panda  ===================
                Domestic goat  ===================
                        Sheep  ===================
             Tibetan antelope  ===================
              Star-nosed mole  ===================
               Bactrian camel  ===================
                       Alpaca  ===================
               Pacific walrus  ===================
             Black flying-fox  ===================
             White rhinoceros  ===================
                        Horse  ===================
                     Squirrel  ===================
                    Armadillo  ===================
                 Weddell seal  ===================
         David's myotis (bat)  ===================
                Big brown bat  ===================
             Little brown bat  ===================
                     Marmoset  ===================
                          Dog  ===================
                          Cow  ===================
                 Killer whale  ===================

Alignment block 3 of 641 in window, 56695258 - 56695274, 17 bps 
B D                     Human  aaaactttgaggaccac
B D                     Chimp  aaaacattgaggaccac
B D                   Gorilla  aaaacattgaggaccac
B D                 Orangutan  aaaacattgaggaccac
B D                    Rhesus  aaaacattgagcaccac
B D       Crab-eating macaque  aaaacattgaggaccac
B D                    Baboon  aaaacattgaggaccac
B D              Green monkey  aaaacattgaggaccac
B D                     Horse  aaatcttctaaaaatgg
B D          White rhinoceros  aaatcttctaaaaatgg
  D          Little brown bat  aaatcttctaaaaatgg
B D                  Hedgehog  =================
B D                Guinea pig  =================
B D                      Pika  =================
B D                    Rabbit  =================
B D                Coelacanth  =================
B D                     Shrew  =================
              Golden hamster  =================
            Brush-tailed rat  =================
B D              Atlantic cod  =================
B D                    Gibbon  =================
                 Spotted gar  =================
B D               Stickleback  =================
          Southern platyfish  =================
      Yellowbelly pufferfish  =================
B D                      Fugu  =================
B D                 Tetraodon  =================
B D                   Chicken  =================
  D              Mallard duck  =================
          Tibetan ground jay  =================
B D               Zebra finch  =================
B D                    Medaka  =================
         Pundamilia nyererei  =================
                 Zebra mbuna  =================
       Burton's mouthbreeder  =================
         Princess of Burundi  =================
B D              Nile tilapia  =================
  D            Painted turtle  =================
  D           Green seaturtle  =================
B D        American alligator  =================
  D             Scarlet macaw  =================
B D                   Opossum  =================
                  Chinchilla  =================
B D            Naked mole-rat  =================
      Lesser Egyptian jerboa  =================
  D               Rock pigeon  =================
  D       Collared flycatcher  =================
B D       Medium ground finch  =================
B D                    Lizard  =================
  D          Peregrine falcon  =================
  D              Saker falcon  =================
            Cape golden mole  =================
          Chinese tree shrew  =================
         Cape elephant shrew  =================
B D                  Platypus  =================
B D                   Manatee  =================
B D           Chinese hamster  =================
                Prairie vole  =================
                    Aardvark  =================
B D                  Elephant  =================
B D                    Tenrec  =================
B D                       Cat  =================
B D                   Megabat  =================
B D                  Bushbaby  =================
B D                       Pig  =================
  D  Chinese softshell turtle  =================
B D                   Ferret   =================
B D                   Dolphin  =================
B D                       Rat  =================
B D                     Mouse  =================
B D                     Panda  =================
               Domestic goat  =================
B D                     Sheep  =================
            Tibetan antelope  =================
             Star-nosed mole  =================
              Bactrian camel  =================
B D                    Alpaca  =================
              Pacific walrus  =================
            Black flying-fox  =================
B D                  Squirrel  =================
B D                 Armadillo  =================
                Weddell seal  =================
        David's myotis (bat)  =================
               Big brown bat  =================
B D                  Marmoset  =================
B D                       Dog  =================
B D                       Cow  =================
                Killer whale  =================

Alignment block 4 of 641 in window, 56695275 - 56695276, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                     Horse  tc
B D          White rhinoceros  tc
B D                   Ferret   ta
B D                     Panda  ta
                 Weddell seal  ta
  D          Little brown bat  tc
B D                 Armadillo  tg
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                      Pika  ==
B D                    Rabbit  ==
B D                Coelacanth  ==
B D                     Shrew  ==
              Golden hamster  ==
            Brush-tailed rat  ==
B D              Atlantic cod  ==
B D                    Gibbon  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                   Opossum  ==
                  Chinchilla  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
            Cape golden mole  ==
          Chinese tree shrew  ==
         Cape elephant shrew  ==
B D                  Platypus  ==
B D                   Manatee  ==
B D           Chinese hamster  ==
                Prairie vole  ==
                    Aardvark  ==
B D                  Elephant  ==
B D                    Tenrec  ==
B D                       Cat  ==
B D                   Megabat  ==
B D                  Bushbaby  ==
B D                       Pig  ==
  D  Chinese softshell turtle  ==
B D                   Dolphin  ==
B D                       Rat  ==
B D                     Mouse  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
             Star-nosed mole  ==
              Bactrian camel  ==
B D                    Alpaca  ==
              Pacific walrus  ==
            Black flying-fox  ==
B D                  Squirrel  ==
        David's myotis (bat)  ==
               Big brown bat  ==
B D                  Marmoset  ==
B D                       Dog  ==
B D                       Cow  ==
                Killer whale  ==

Alignment block 5 of 641 in window, 56695277 - 56695343, 67 bps 
B D                     Human  ttctaccccaaacatcaccttatc------ttatgtttacatctga-------agtttatattatagaaa
B D                     Chimp  ttctaccccaaacatcaccttatc------ttatgtttacatctga-------agtttatattatagaaa
B D                   Gorilla  ttctaccccaaacatcaccttatc------ttatgtttacgtctga-------agtttatattatagaaa
B D                 Orangutan  ttctaccccaaacatcaccttatc------ttatgtttacatctga-------agtttatattatagaaa
B D                    Rhesus  ttctaccccaaacatcaccttata------ttat--------------------gtttatattatagaaa
B D       Crab-eating macaque  ttctaccccaaacatcaccttata------ttat--------------------gtttatattatagaaa
B D                    Baboon  ttctaccccaaacatcaccttata------ttat--------------------gtttatattatagaaa
B D              Green monkey  ttctaccccaaacatcaccttata------ttat--------------------gtttatattatagaaa
B D                    Alpaca  ttctacccacaacatcaccttacagcatatagatgtagacatatagattccagagtttacattgtagaaa
               Bactrian camel  ttctaccccaaacatcaccttacagcatatagatatagacatatagattccagagtttacattgtagaaa
B D                   Dolphin  ttctaccccaaacatcaccttacagc---------------------------tgttcatgttgtagaaa
                 Killer whale  ttctaccccaaacatcaccttacagc---------------------------agttcatgttgtagaaa
B D                     Sheep  ttctaccccaaacatcaccttactgc---------------------------agttcatattgtagaaa
                Domestic goat  ttctaccccaaacatcaccttactgc---------------------------agttcatattgtagaaa
B D                     Horse  ttctacccaaaacatcacct-------------catatatacctgg-------agttcataatgtagaaa
B D          White rhinoceros  ttctaccccaaacatcacct-------------catatatacctgg-------agttcatattatagaaa
B D                   Ferret   ttctatcccaaataacaccttaca------gtatatacataccttg-------agttcatagtatagaaa
B D                     Panda  ttctatcccaaatatcaccttata------gtatatacatacctag-------agttcgtagtatagaaa
                 Weddell seal  ttctatcccaaatatcaccttaca------gtatatacatacctag-------agttcatagtatagaaa
             Black flying-fox  ttgcaccccaaactttaccg----------atgtatatacatgtgg-------agtttatactatagaaa
B D                   Megabat  ttgcaccccaaactttaccg----------atatatatacatgtgg-------agtttatattatagaaa
  D          Little brown bat  ttctcccccaaacattaacttgtagc----atgtatgtaaacatgg-------agttcatattatagaaa
B D                 Armadillo  gtctgtcccaaacatcacttttta------gtatatatacatgt---------agtttatatcatagaaa
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                Coelacanth  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
            Brush-tailed rat  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Gibbon  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ======================================================================
                  Chinchilla  ======================================================================
B D            Naked mole-rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
            Cape golden mole  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Manatee  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                  Bushbaby  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
            Tibetan antelope  ======================================================================
             Star-nosed mole  ======================================================================
              Pacific walrus  ======================================================================
B D                  Squirrel  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
B D                  Marmoset  ======================================================================
B D                       Dog  ======================================================================
B D                       Cow  ======================================================================

                        Human  ataagaccat
                        Chimp  ataagaccat
                      Gorilla  ataagaccat
                    Orangutan  ataagaccat
                       Rhesus  ataagacccc
          Crab-eating macaque  ataagacccc
                       Baboon  ataagacccc
                 Green monkey  ataagacccc
                       Alpaca  ataagacagt
               Bactrian camel  ataagacagt
                      Dolphin  ataagac---
                 Killer whale  ataagac---
                        Sheep  atatgacaat
                Domestic goat  atatgacaat
                        Horse  ataagaccat
             White rhinoceros  ataagactat
                      Ferret   attagactat
                        Panda  atgaagctat
                 Weddell seal  atgagactat
             Black flying-fox  atgagactgt
                      Megabat  atgagactgt
             Little brown bat  ataagactat
                    Armadillo  ataagacaat
                     Hedgehog  ==========
                   Guinea pig  ==========
                         Pika  ==========
                       Rabbit  ==========
                   Coelacanth  ==========
                        Shrew  ==========
               Golden hamster  ==========
             Brush-tailed rat  ==========
                 Atlantic cod  ==========
                       Gibbon  ==========
                  Spotted gar  ==========
                  Stickleback  ==========
           Southern platyfish  ==========
       Yellowbelly pufferfish  ==========
                         Fugu  ==========
                    Tetraodon  ==========
                      Chicken  ==========
                 Mallard duck  ==========
           Tibetan ground jay  ==========
                  Zebra finch  ==========
                       Medaka  ==========
          Pundamilia nyererei  ==========
                  Zebra mbuna  ==========
        Burton's mouthbreeder  ==========
          Princess of Burundi  ==========
                 Nile tilapia  ==========
               Painted turtle  ==========
              Green seaturtle  ==========
           American alligator  ==========
                Scarlet macaw  ==========
                      Opossum  ==========
                   Chinchilla  ==========
               Naked mole-rat  ==========
       Lesser Egyptian jerboa  ==========
                  Rock pigeon  ==========
          Collared flycatcher  ==========
          Medium ground finch  ==========
                       Lizard  ==========
             Peregrine falcon  ==========
                 Saker falcon  ==========
             Cape golden mole  ==========
           Chinese tree shrew  ==========
          Cape elephant shrew  ==========
                     Platypus  ==========
                      Manatee  ==========
              Chinese hamster  ==========
                 Prairie vole  ==========
                     Aardvark  ==========
                     Elephant  ==========
                       Tenrec  ==========
                          Cat  ==========
                     Bushbaby  ==========
                          Pig  ==========
     Chinese softshell turtle  ==========
                          Rat  ==========
                        Mouse  ==========
             Tibetan antelope  ==========
              Star-nosed mole  ==========
               Pacific walrus  ==========
                     Squirrel  ==========
         David's myotis (bat)  ==========
                Big brown bat  ==========
                     Marmoset  ==========
                          Dog  ==========
                          Cow  ==========

Inserts between block 5 and 6 in window
B D                    Sheep 1128bp
               Domestic goat 1087bp
B D                    Panda 1346bp
                Weddell seal 4bp
B D                Armadillo 2336bp

Alignment block 6 of 641 in window, 56695344 - 56695349, 6 bps 
B D                     Human  tgagtg
B D                     Chimp  tgagtg
B D                   Gorilla  tgagtg
B D                 Orangutan  tgagtg
B D                    Rhesus  tgagtg
B D       Crab-eating macaque  tgagtg
B D                    Baboon  tgattg
B D              Green monkey  tgagtg
B D                    Alpaca  agagtg
               Bactrian camel  agagtg
B D                   Dolphin  --aata
                 Killer whale  --aata
B D                     Horse  -----a
B D          White rhinoceros  -----a
B D                   Ferret   --aggg
                 Weddell seal  caagtg
             Black flying-fox  -----a
B D                   Megabat  -----a
B D                  Hedgehog  ======
B D                Guinea pig  ======
B D                      Pika  ======
B D                    Rabbit  ======
B D                Coelacanth  ======
B D                     Shrew  ======
              Golden hamster  ======
            Brush-tailed rat  ======
B D              Atlantic cod  ======
B D                    Gibbon  ======
                 Spotted gar  ======
B D               Stickleback  ======
          Southern platyfish  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                 Tetraodon  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
B D                    Medaka  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                   Opossum  ======
                  Chinchilla  ======
B D            Naked mole-rat  ======
      Lesser Egyptian jerboa  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
            Cape golden mole  ======
          Chinese tree shrew  ======
         Cape elephant shrew  ======
B D                  Platypus  ======
B D                   Manatee  ======
B D           Chinese hamster  ======
                Prairie vole  ======
                    Aardvark  ======
B D                  Elephant  ======
B D                    Tenrec  ======
B D                       Cat  ======
B D                  Bushbaby  ======
B D                       Pig  ======
  D  Chinese softshell turtle  ======
B D                       Rat  ======
B D                     Mouse  ======
B D                     Panda  ======
               Domestic goat  ======
B D                     Sheep  ======
            Tibetan antelope  ======
             Star-nosed mole  ======
              Pacific walrus  ======
B D                  Squirrel  ======
B D                 Armadillo  ======
        David's myotis (bat)  ======
               Big brown bat  ======
  D          Little brown bat  ------
B D                  Marmoset  ======
B D                       Dog  ======
B D                       Cow  ======

Inserts between block 6 and 7 in window
B D                   Alpaca 956bp
              Bactrian camel 956bp

Alignment block 7 of 641 in window, 56695350 - 56695363, 14 bps 
B D                     Human  ggc--agggtggctca
B D                     Chimp  ggc--agggtggctca
B D                   Gorilla  ggc--agggtggctca
B D                 Orangutan  ggc--agggtggctca
B D                    Rhesus  ggc--agggtggctca
B D       Crab-eating macaque  ggc--agggtggctca
B D                    Baboon  ggc--agggtggctca
B D              Green monkey  ggc--agggtgac-ca
B D                   Dolphin  aat--agagtgatata
                 Killer whale  aat--agagtgatata
B D                     Horse  aaa--agagtgatata
B D          White rhinoceros  aaa--agagtgatata
B D                   Ferret   gcacctgggtg-----
                 Weddell seal  ata--tgagtgctata
             Black flying-fox  aaa--agagtggtatg
B D                   Megabat  aaa--agagtggtatg
  D          Little brown bat  aaa--agagtgaaata
B D                  Hedgehog  ================
B D                Guinea pig  ================
B D                      Pika  ================
B D                    Rabbit  ================
B D                Coelacanth  ================
B D                     Shrew  ================
              Golden hamster  ================
            Brush-tailed rat  ================
B D              Atlantic cod  ================
B D                    Gibbon  ================
                 Spotted gar  ================
B D               Stickleback  ================
          Southern platyfish  ================
      Yellowbelly pufferfish  ================
B D                      Fugu  ================
B D                 Tetraodon  ================
B D                   Chicken  ================
  D              Mallard duck  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
B D                    Medaka  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
B D        American alligator  ================
  D             Scarlet macaw  ================
B D                   Opossum  ================
                  Chinchilla  ================
B D            Naked mole-rat  ================
      Lesser Egyptian jerboa  ================
  D               Rock pigeon  ================
  D       Collared flycatcher  ================
B D       Medium ground finch  ================
B D                    Lizard  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
            Cape golden mole  ================
          Chinese tree shrew  ================
         Cape elephant shrew  ================
B D                  Platypus  ================
B D                   Manatee  ================
B D           Chinese hamster  ================
                Prairie vole  ================
                    Aardvark  ================
B D                  Elephant  ================
B D                    Tenrec  ================
B D                       Cat  ================
B D                  Bushbaby  ================
B D                       Pig  ================
  D  Chinese softshell turtle  ================
B D                       Rat  ================
B D                     Mouse  ================
B D                     Panda  ================
               Domestic goat  ================
B D                     Sheep  ================
            Tibetan antelope  ================
             Star-nosed mole  ================
              Bactrian camel  ================
B D                    Alpaca  ================
              Pacific walrus  ================
B D                  Squirrel  ================
B D                 Armadillo  ================
        David's myotis (bat)  ================
               Big brown bat  ================
B D                  Marmoset  ================
B D                       Dog  ================
B D                       Cow  ================

Inserts between block 7 and 8 in window
B D                    Horse 6bp
B D         White rhinoceros 6bp
B D                  Ferret  1754bp
                Weddell seal 6bp
            Black flying-fox 6bp
B D                  Megabat 6bp
  D         Little brown bat 6bp

Alignment block 8 of 641 in window, 56695364 - 56695370, 7 bps 
B D                     Human  ttcctgt
B D                     Chimp  ttcctgt
B D                   Gorilla  ttcctgt
B D                 Orangutan  ttcttgt
B D                    Rhesus  ttcctgt
B D       Crab-eating macaque  ttcctgt
B D                    Baboon  ttcctgt
B D              Green monkey  ttcctgt
B D                   Dolphin  tgcttgt
                 Killer whale  tgcttgt
B D                     Horse  tttctat
B D          White rhinoceros  tttctat
                 Weddell seal  tttctat
             Black flying-fox  tttctat
B D                   Megabat  tttctat
  D          Little brown bat  tttctat
B D                  Hedgehog  =======
B D                Guinea pig  =======
B D                      Pika  =======
B D                    Rabbit  =======
B D                Coelacanth  =======
B D                     Shrew  =======
              Golden hamster  =======
            Brush-tailed rat  =======
B D              Atlantic cod  =======
B D                    Gibbon  =======
                 Spotted gar  =======
B D               Stickleback  =======
          Southern platyfish  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D                 Tetraodon  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
B D                    Medaka  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
  D             Scarlet macaw  =======
B D                   Opossum  =======
                  Chinchilla  =======
B D            Naked mole-rat  =======
      Lesser Egyptian jerboa  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  =======
B D       Medium ground finch  =======
B D                    Lizard  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
            Cape golden mole  =======
          Chinese tree shrew  =======
         Cape elephant shrew  =======
B D                  Platypus  =======
B D                   Manatee  =======
B D           Chinese hamster  =======
                Prairie vole  =======
                    Aardvark  =======
B D                  Elephant  =======
B D                    Tenrec  =======
B D                       Cat  =======
B D                  Bushbaby  =======
B D                       Pig  =======
  D  Chinese softshell turtle  =======
B D                   Ferret   =======
B D                       Rat  =======
B D                     Mouse  =======
B D                     Panda  =======
               Domestic goat  =======
B D                     Sheep  =======
            Tibetan antelope  =======
             Star-nosed mole  =======
              Bactrian camel  =======
B D                    Alpaca  =======
              Pacific walrus  =======
B D                  Squirrel  =======
B D                 Armadillo  =======
        David's myotis (bat)  =======
               Big brown bat  =======
B D                  Marmoset  =======
B D                       Dog  =======
B D                       Cow  =======

Inserts between block 8 and 9 in window
B D                  Dolphin 1303bp
                Killer whale 1302bp
  D         Little brown bat 2077bp

Alignment block 9 of 641 in window, 56695371 - 56695371, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                     Horse  g
B D          White rhinoceros  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
B D                  Hedgehog  =
B D                Guinea pig  =
B D                      Pika  =
B D                    Rabbit  =
B D                Coelacanth  =
B D                     Shrew  =
              Golden hamster  =
            Brush-tailed rat  =
B D              Atlantic cod  =
B D                    Gibbon  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  =
                  Chinchilla  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
            Cape golden mole  =
          Chinese tree shrew  =
         Cape elephant shrew  =
B D                  Platypus  =
B D                   Manatee  =
B D           Chinese hamster  =
                Prairie vole  =
                    Aardvark  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
B D                  Bushbaby  =
B D                       Pig  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
B D                   Dolphin  =
B D                       Rat  =
B D                     Mouse  =
B D                     Panda  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
             Star-nosed mole  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                  Squirrel  =
B D                 Armadillo  =
        David's myotis (bat)  =
               Big brown bat  =
  D          Little brown bat  =
B D                  Marmoset  =
B D                       Dog  =
B D                       Cow  =
                Killer whale  =

Inserts between block 9 and 10 in window
B D                    Horse 1412bp
B D         White rhinoceros 1369bp
                Weddell seal 1397bp
            Black flying-fox 2306bp
B D                  Megabat 2287bp

Alignment block 10 of 641 in window, 56695372 - 56695515, 144 bps 
B D                     Human  atcccagtacttagggggccaagatgggaggtttgcttgagcccaggagtttgagaccagcctggactac
B D                     Chimp  atcccagtacttagggggccaagatgggaggtttgcttgagtccaggagtttgagaccagcctggacaac
B D                   Gorilla  atcccagtacttggggggccaagatgggaggtttgcttgagcccaggagtttgagaccagcctggacaac
B D                 Orangutan  atcccagtacttggggggccaagatgggaggtttgcttgagcccaggagtttgagaccagcctggacaac
B D                    Rhesus  atcccagtacttggggggccaagacgggaggattgcttgaacccaggagtttgagaccaacctggacaac
B D       Crab-eating macaque  atcccagtacttggggggccaagacgggaggattgcttgaacccaggagtttgagaccaacctggacaac
B D                    Baboon  atcccagtacttggggggccaagacgggaggattgcttgaacccaggagtttgataccaacctggacaac
B D              Green monkey  atcccagtactt-gggggccaagacaggaggatttcttgaacccaggagtttgagaccaacctggacaac
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                Coelacanth  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
            Brush-tailed rat  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Gibbon  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ======================================================================
                  Chinchilla  ======================================================================
B D            Naked mole-rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
            Cape golden mole  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Manatee  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                   Megabat  ======================================================================
B D                  Bushbaby  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
B D                   Dolphin  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
             Star-nosed mole  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
B D                 Armadillo  ======================================================================
                Weddell seal  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
  D          Little brown bat  ======================================================================
B D                  Marmoset  ======================================================================
B D                       Dog  ======================================================================
B D                       Cow  ======================================================================
                Killer whale  ======================================================================

                        Human  atagggagagcctgtcactacaaaaaataaaaaattagccagatgtggtatatggtgatgctgggattac
                        Chimp  atagggagagcctgtcactacaaaaaataaaaaattagccagatgtggtatatggtgatgctgggattac
                      Gorilla  atagggagagcctgtcactacaaaaaataaaaaattagccagatgtggtatatggtgatgctgggattac
                    Orangutan  atagggagagcctgtcactacaaaaaataaaaaattagccagatgtggtatatggtgatgctgggattac
                       Rhesus  atagggagagcctgtcactac-gaaaataaaaaattagccagatgcggtatatggtgatgctgggattac
          Crab-eating macaque  atagggagagcctgtcactac-gaaaataaaaaattagccagatgtggtatatggtgatgctgggattac
                       Baboon  atagggagagcctgtcactac-gaaaataaaaaattagccagatgtggtatatggtgatgctgggattac
                 Green monkey  atagggagagcctgtcactac-gataataaaaaattagccaaatgtggtatatggtgatgctgggattac
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                   Coelacanth  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  ======================================================================
             Brush-tailed rat  ======================================================================
                 Atlantic cod  ======================================================================
                       Gibbon  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
             Little brown bat  ======================================================================
                     Marmoset  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  agac
                        Chimp  agac
                      Gorilla  aggc
                    Orangutan  aggc
                       Rhesus  aggc
          Crab-eating macaque  aggc
                       Baboon  aggc
                 Green monkey  atgc
                     Hedgehog  ====
                   Guinea pig  ====
                         Pika  ====
                       Rabbit  ====
                   Coelacanth  ====
                        Shrew  ====
               Golden hamster  ====
             Brush-tailed rat  ====
                 Atlantic cod  ====
                       Gibbon  ====
                  Spotted gar  ====
                  Stickleback  ====
           Southern platyfish  ====
       Yellowbelly pufferfish  ====
                         Fugu  ====
                    Tetraodon  ====
                      Chicken  ====
                 Mallard duck  ====
           Tibetan ground jay  ====
                  Zebra finch  ====
                       Medaka  ====
          Pundamilia nyererei  ====
                  Zebra mbuna  ====
        Burton's mouthbreeder  ====
          Princess of Burundi  ====
                 Nile tilapia  ====
               Painted turtle  ====
              Green seaturtle  ====
           American alligator  ====
                Scarlet macaw  ====
                      Opossum  ====
                   Chinchilla  ====
               Naked mole-rat  ====
       Lesser Egyptian jerboa  ====
                  Rock pigeon  ====
          Collared flycatcher  ====
          Medium ground finch  ====
                       Lizard  ====
             Peregrine falcon  ====
                 Saker falcon  ====
             Cape golden mole  ====
           Chinese tree shrew  ====
          Cape elephant shrew  ====
                     Platypus  ====
                      Manatee  ====
              Chinese hamster  ====
                 Prairie vole  ====
                     Aardvark  ====
                     Elephant  ====
                       Tenrec  ====
                          Cat  ====
                      Megabat  ====
                     Bushbaby  ====
                          Pig  ====
     Chinese softshell turtle  ====
                      Ferret   ====
                      Dolphin  ====
                          Rat  ====
                        Mouse  ====
                        Panda  ====
                Domestic goat  ====
                        Sheep  ====
             Tibetan antelope  ====
              Star-nosed mole  ====
               Bactrian camel  ====
                       Alpaca  ====
               Pacific walrus  ====
             Black flying-fox  ====
             White rhinoceros  ====
                        Horse  ====
                     Squirrel  ====
                    Armadillo  ====
                 Weddell seal  ====
         David's myotis (bat)  ====
                Big brown bat  ====
             Little brown bat  ====
                     Marmoset  ====
                          Dog  ====
                          Cow  ====
                 Killer whale  ====

Alignment block 11 of 641 in window, 56695516 - 56695535, 20 bps 
B D                     Human  atgagtcactgtgcctggcc
B D                     Chimp  atgagtcactgtgcctggcc
B D                   Gorilla  atgagtcactgtacctggcc
B D                 Orangutan  atgagtcactgtgcctggcc
B D                    Rhesus  atgagttactgtgcatggcc
B D       Crab-eating macaque  atgagttactgtgcatggcc
B D                    Baboon  ttgagttactgtgcatggcc
B D              Green monkey  atgagttactgtgcatggcc
B D                     Horse  atgctttactgtgactgg--
B D                  Hedgehog  ====================
B D                Guinea pig  ====================
B D                      Pika  ====================
B D                    Rabbit  ====================
B D                Coelacanth  ====================
B D                     Shrew  ====================
              Golden hamster  ====================
            Brush-tailed rat  ====================
B D              Atlantic cod  ====================
B D                    Gibbon  ====================
                 Spotted gar  ====================
B D               Stickleback  ====================
          Southern platyfish  ====================
      Yellowbelly pufferfish  ====================
B D                      Fugu  ====================
B D                 Tetraodon  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
          Tibetan ground jay  ====================
B D               Zebra finch  ====================
B D                    Medaka  ====================
         Pundamilia nyererei  ====================
                 Zebra mbuna  ====================
       Burton's mouthbreeder  ====================
         Princess of Burundi  ====================
B D              Nile tilapia  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D        American alligator  ====================
  D             Scarlet macaw  ====================
B D                   Opossum  ====================
                  Chinchilla  ====================
B D            Naked mole-rat  ====================
      Lesser Egyptian jerboa  ====================
  D               Rock pigeon  ====================
  D       Collared flycatcher  ====================
B D       Medium ground finch  ====================
B D                    Lizard  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
            Cape golden mole  ====================
          Chinese tree shrew  ====================
         Cape elephant shrew  ====================
B D                  Platypus  ====================
B D                   Manatee  ====================
B D           Chinese hamster  ====================
                Prairie vole  ====================
                    Aardvark  ====================
B D                  Elephant  ====================
B D                    Tenrec  ====================
B D                       Cat  ====================
B D                   Megabat  ====================
B D                  Bushbaby  ====================
B D                       Pig  ====================
  D  Chinese softshell turtle  ====================
B D                   Ferret   ====================
B D                   Dolphin  ====================
B D                       Rat  ====================
B D                     Mouse  ====================
B D                     Panda  ====================
               Domestic goat  ====================
B D                     Sheep  ====================
            Tibetan antelope  ====================
             Star-nosed mole  ====================
              Bactrian camel  ====================
B D                    Alpaca  ====================
              Pacific walrus  ====================
            Black flying-fox  ====================
B D          White rhinoceros  ====================
B D                  Squirrel  ====================
B D                 Armadillo  ====================
                Weddell seal  ====================
        David's myotis (bat)  ====================
               Big brown bat  ====================
  D          Little brown bat  ====================
B D                  Marmoset  ====================
B D                       Dog  ====================
B D                       Cow  ====================
                Killer whale  ====================

Alignment block 12 of 641 in window, 56695536 - 56695536, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Squirrel  t
B D                  Hedgehog  =
B D                Guinea pig  =
B D                      Pika  =
B D                    Rabbit  =
B D                Coelacanth  =
B D                     Shrew  =
              Golden hamster  =
            Brush-tailed rat  =
B D              Atlantic cod  =
B D                    Gibbon  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  =
                  Chinchilla  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
            Cape golden mole  =
          Chinese tree shrew  =
         Cape elephant shrew  =
B D                  Platypus  =
B D                   Manatee  =
B D           Chinese hamster  =
                Prairie vole  =
                    Aardvark  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
B D                   Megabat  =
B D                  Bushbaby  =
B D                       Pig  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
B D                   Dolphin  =
B D                       Rat  =
B D                     Mouse  =
B D                     Panda  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
             Star-nosed mole  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                 Armadillo  =
                Weddell seal  =
        David's myotis (bat)  =
               Big brown bat  =
  D          Little brown bat  =
B D                  Marmoset  =
B D                       Dog  =
B D                       Cow  =
                Killer whale  =

Alignment block 13 of 641 in window, 56695537 - 56695537, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Squirrel  g
B D                    Alpaca  g
               Bactrian camel  g
B D          White rhinoceros  g
B D                       Dog  g
B D                   Manatee  g
B D                  Hedgehog  =
B D                Guinea pig  =
B D                      Pika  =
B D                    Rabbit  =
B D                Coelacanth  =
B D                     Shrew  =
              Golden hamster  =
            Brush-tailed rat  =
B D              Atlantic cod  =
B D                    Gibbon  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  =
                  Chinchilla  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
            Cape golden mole  =
          Chinese tree shrew  =
         Cape elephant shrew  =
B D                  Platypus  =
B D           Chinese hamster  =
                Prairie vole  =
                    Aardvark  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
B D                   Megabat  =
B D                  Bushbaby  =
B D                       Pig  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
B D                   Dolphin  =
B D                       Rat  =
B D                     Mouse  =
B D                     Panda  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
             Star-nosed mole  =
              Pacific walrus  =
            Black flying-fox  =
B D                     Horse  -
B D                 Armadillo  =
                Weddell seal  =
        David's myotis (bat)  =
               Big brown bat  =
  D          Little brown bat  =
B D                  Marmoset  =
B D                       Cow  =
                Killer whale  =

Alignment block 14 of 641 in window, 56695538 - 56695542, 5 bps 
B D                     Human  gtgga
B D                     Chimp  gtgga
B D                   Gorilla  gtgga
B D                 Orangutan  gtgga
B D                    Rhesus  gtgga
B D       Crab-eating macaque  gtgga
B D                    Baboon  ctgaa
B D              Green monkey  gtgga
B D                  Squirrel  gtgga
B D                       Pig  gtgaa
B D                    Alpaca  atgga
               Bactrian camel  atgga
B D                   Dolphin  gtgga
                 Killer whale  gtgga
             Tibetan antelope  gtgga
B D                     Sheep  gtgga
                Domestic goat  gtgga
B D                     Horse  ----a
B D          White rhinoceros  gtgga
B D                       Dog  gtaca
               Pacific walrus  gtgca
                 Weddell seal  gtgca
B D                  Elephant  gtgga
B D                   Manatee  gtgga
B D                  Hedgehog  =====
B D                Guinea pig  =====
B D                      Pika  =====
B D                    Rabbit  =====
B D                Coelacanth  =====
B D                     Shrew  =====
              Golden hamster  =====
            Brush-tailed rat  =====
B D              Atlantic cod  =====
B D                    Gibbon  =====
                 Spotted gar  =====
B D               Stickleback  =====
          Southern platyfish  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                 Tetraodon  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
B D                    Medaka  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
  D             Scarlet macaw  =====
B D                   Opossum  =====
                  Chinchilla  =====
B D            Naked mole-rat  =====
      Lesser Egyptian jerboa  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
            Cape golden mole  =====
          Chinese tree shrew  =====
         Cape elephant shrew  =====
B D                  Platypus  =====
B D           Chinese hamster  =====
                Prairie vole  =====
                    Aardvark  =====
B D                    Tenrec  =====
B D                       Cat  =====
B D                   Megabat  =====
B D                  Bushbaby  =====
  D  Chinese softshell turtle  =====
B D                   Ferret   =====
B D                       Rat  =====
B D                     Mouse  =====
B D                     Panda  =====
             Star-nosed mole  =====
            Black flying-fox  =====
B D                 Armadillo  =====
        David's myotis (bat)  =====
               Big brown bat  =====
  D          Little brown bat  =====
B D                  Marmoset  =====
B D                       Cow  =====

Alignment block 15 of 641 in window, 56695543 - 56695550, 8 bps 
B D                     Human  cacatgtc
B D                     Chimp  cacatttc
B D                   Gorilla  cacatttc
B D                 Orangutan  cacatttc
B D                    Rhesus  cacatttc
B D       Crab-eating macaque  cacatttc
B D                    Baboon  cacttttc
B D              Green monkey  cacatttc
B D                  Squirrel  taaattcc
B D                       Pig  caagtttc
B D                    Alpaca  caagtttc
               Bactrian camel  caagtttc
B D                   Dolphin  caagcttc
                 Killer whale  caagcttc
             Tibetan antelope  caagcttc
B D                     Sheep  caagcttc
                Domestic goat  caagcttc
B D                     Horse  caagtttc
B D          White rhinoceros  taattttc
B D                       Dog  caagtttc
               Pacific walrus  caagtttc
                 Weddell seal  caagtttc
             Black flying-fox  caaatttc
B D                   Megabat  caaatttc
B D                  Elephant  caagttcc
B D                   Manatee  caagtctt
B D                  Hedgehog  ========
B D                Guinea pig  ========
B D                      Pika  ========
B D                    Rabbit  ========
B D                Coelacanth  ========
B D                     Shrew  ========
              Golden hamster  ========
            Brush-tailed rat  ========
B D              Atlantic cod  ========
B D                    Gibbon  ========
                 Spotted gar  ========
B D               Stickleback  ========
          Southern platyfish  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D                 Tetraodon  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
B D                    Medaka  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
  D             Scarlet macaw  ========
B D                   Opossum  ========
                  Chinchilla  ========
B D            Naked mole-rat  ========
      Lesser Egyptian jerboa  ========
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D       Medium ground finch  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
            Cape golden mole  ========
          Chinese tree shrew  ========
         Cape elephant shrew  ========
B D                  Platypus  ========
B D           Chinese hamster  ========
                Prairie vole  ========
                    Aardvark  ========
B D                    Tenrec  ========
B D                       Cat  ========
B D                  Bushbaby  ========
  D  Chinese softshell turtle  ========
B D                   Ferret   ========
B D                       Rat  ========
B D                     Mouse  ========
B D                     Panda  ========
             Star-nosed mole  ========
B D                 Armadillo  ========
        David's myotis (bat)  ========
               Big brown bat  ========
  D          Little brown bat  ========
B D                  Marmoset  ========
B D                       Cow  ========

Alignment block 16 of 641 in window, 56695551 - 56695565, 15 bps 
B D                     Human  ttgagtgagaccact
B D                     Chimp  ttgagtgagaccact
B D                   Gorilla  ttgagtgagaccact
B D                 Orangutan  ttgagtgagagcact
B D                    Rhesus  ttgagtgagagcact
B D       Crab-eating macaque  ttgagtgagagcact
B D                    Baboon  ttgattgatagcact
B D              Green monkey  ttgagtgagagcact
B D                  Squirrel  ttgaatgtgagaact
B D                       Pig  ttaagtatag-----
B D                    Alpaca  ttgactatagggact
               Bactrian camel  ttgactatagggact
B D                   Dolphin  ttgcgtataggtact
                 Killer whale  ttgcgtataggtact
             Tibetan antelope  ttgactacagggact
B D                     Sheep  ttgactacagggact
                Domestic goat  ttgactgcagggact
B D                     Horse  ttgagtgtacaaact
B D          White rhinoceros  ttgagtatagggact
B D                       Dog  ttgaat---------
               Pacific walrus  ttgagtg--------
                 Weddell seal  ttgagtg--------
             Black flying-fox  ttgagtatagggact
B D                   Megabat  ttgagtatagggact
         David's myotis (bat)  tttaat---aagact
  D          Little brown bat  tttaat---gagact
B D                  Elephant  ctgagtatagggact
B D                   Manatee  ctgagtgtagggact
B D                  Hedgehog  ===============
B D                Guinea pig  ===============
B D                      Pika  ===============
B D                    Rabbit  ===============
B D                Coelacanth  ===============
B D                     Shrew  ===============
              Golden hamster  ===============
            Brush-tailed rat  ===============
B D              Atlantic cod  ===============
B D                    Gibbon  ===============
                 Spotted gar  ===============
B D               Stickleback  ===============
          Southern platyfish  ===============
      Yellowbelly pufferfish  ===============
B D                      Fugu  ===============
B D                 Tetraodon  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
          Tibetan ground jay  ===============
B D               Zebra finch  ===============
B D                    Medaka  ===============
         Pundamilia nyererei  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D              Nile tilapia  ===============
  D            Painted turtle  ===============
  D           Green seaturtle  ===============
B D        American alligator  ===============
  D             Scarlet macaw  ===============
B D                   Opossum  ===============
                  Chinchilla  ===============
B D            Naked mole-rat  ===============
      Lesser Egyptian jerboa  ===============
  D               Rock pigeon  ===============
  D       Collared flycatcher  ===============
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
            Cape golden mole  ===============
          Chinese tree shrew  ===============
         Cape elephant shrew  ===============
B D                  Platypus  ===============
B D           Chinese hamster  ===============
                Prairie vole  ===============
                    Aardvark  ===============
B D                    Tenrec  ===============
B D                       Cat  ===============
B D                  Bushbaby  ===============
  D  Chinese softshell turtle  ===============
B D                   Ferret   ===============
B D                       Rat  ===============
B D                     Mouse  ===============
B D                     Panda  ===============
             Star-nosed mole  ===============
B D                 Armadillo  ===============
               Big brown bat  ===============
B D                  Marmoset  ===============
B D                       Cow  ===============

Alignment block 17 of 641 in window, 56695566 - 56695577, 12 bps 
B D                     Human  gccgt--catgctt
B D                     Chimp  gccgt--catgctt
B D                   Gorilla  gccgt--catgctt
B D                 Orangutan  gctgt--catactt
B D                    Rhesus  gctgt--catactt
B D       Crab-eating macaque  gctgt--catactt
B D                    Baboon  gctgt--catactt
B D              Green monkey  gctgt--catactt
B D                  Squirrel  gacgt--tatgctt
B D                       Pig  ggtgt--catattt
B D                    Alpaca  ggtgttatatattt
               Bactrian camel  ggtgt--tatattt
B D                   Dolphin  ggtgt--catattt
                 Killer whale  ggtgt--catattt
             Tibetan antelope  ggtgt--catattt
B D                     Sheep  ggtgt--catattt
                Domestic goat  ggtgt--catattt
B D                     Horse  ggtat--catattt
B D          White rhinoceros  ggtat--catattt
B D                       Dog  ----t--catattt
               Pacific walrus  ----t--catattt
                 Weddell seal  ----t--catattt
             Black flying-fox  ggtgt--catattt
B D                   Megabat  ggtgt--catattt
         David's myotis (bat)  aatgc--tatagtg
  D          Little brown bat  aatgc--tatagtg
B D                  Elephant  agtgt--tatattt
B D                   Manatee  ggcgt--tatgttt
                     Aardvark  ---gc--tg---tc
B D                  Hedgehog  ==============
B D                Guinea pig  ==============
B D                      Pika  ==============
B D                    Rabbit  ==============
B D                Coelacanth  ==============
B D                     Shrew  ==============
              Golden hamster  ==============
            Brush-tailed rat  ==============
B D              Atlantic cod  ==============
B D                    Gibbon  ==============
                 Spotted gar  ==============
B D               Stickleback  ==============
          Southern platyfish  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
B D                 Tetraodon  ==============
B D                   Chicken  ==============
  D              Mallard duck  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
B D                    Medaka  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D        American alligator  ==============
  D             Scarlet macaw  ==============
B D                   Opossum  ==============
                  Chinchilla  ==============
B D            Naked mole-rat  ==============
      Lesser Egyptian jerboa  ==============
  D               Rock pigeon  ==============
  D       Collared flycatcher  ==============
B D       Medium ground finch  ==============
B D                    Lizard  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
            Cape golden mole  ==============
          Chinese tree shrew  ==============
         Cape elephant shrew  ==============
B D                  Platypus  ==============
B D           Chinese hamster  ==============
                Prairie vole  ==============
B D                    Tenrec  ==============
B D                       Cat  ==============
B D                  Bushbaby  ==============
  D  Chinese softshell turtle  ==============
B D                   Ferret   ==============
B D                       Rat  ==============
B D                     Mouse  ==============
B D                     Panda  ==============
             Star-nosed mole  ==============
B D                 Armadillo  ==============
               Big brown bat  ==============
B D                  Marmoset  ==============
B D                       Cow  ==============

Inserts between block 17 and 18 in window
B D                 Elephant 4bp
B D                  Manatee 4bp
                    Aardvark 4bp

Alignment block 18 of 641 in window, 56695578 - 56695585, 8 bps 
B D                     Human  t-tc-tc--------------------act
B D                     Chimp  t-tc-tc--------------------act
B D                   Gorilla  t-tc-tc--------------------act
B D                 Orangutan  t-tc-tc--------------------act
B D                    Rhesus  t-tc-tc--------------------act
B D       Crab-eating macaque  t-tc-tc--------------------act
B D                    Baboon  t-tc-tc--------------------act
B D              Green monkey  t-tc-tc--------------------act
B D                  Squirrel  tata-tc--------------------att
B D                       Pig  t-tt-------------------------t
B D                    Alpaca  g-tcttt--------------------tgt
               Bactrian camel  g-tcttt--------------------tgt
B D                   Dolphin  g-tt-------------------------t
                 Killer whale  g-tt-------------------------t
             Tibetan antelope  g-tc-tt--------------------tgt
B D                     Sheep  g-tc-tt--------------------tgt
                Domestic goat  g-tc-tt--------------------tgt
B D                     Horse  g-tc--------------------------
B D          White rhinoceros  g-tcttt--------------------tgt
B D                       Dog  g-tctct--------------------tgt
               Pacific walrus  g-tcttt--------------------tgt
                 Weddell seal  g-ccttt--------------------tgt
             Black flying-fox  c-tctt---------------------tat
B D                   Megabat  c-tctt---------------------tat
         David's myotis (bat)  t-gtctggcactagaaacaaagacaaatat
  D          Little brown bat  t-gtctggcactagaaacaaagacaaatat
B D                  Elephant  --------------------------ttgt
B D                   Manatee  --------------------------ttgt
                     Aardvark  --------------------------gtct
B D                 Armadillo  --------------------------ttgt
B D                  Hedgehog  ==============================
B D                Guinea pig  ==============================
B D                      Pika  ==============================
B D                    Rabbit  ==============================
B D                Coelacanth  ==============================
B D                     Shrew  ==============================
              Golden hamster  ==============================
            Brush-tailed rat  ==============================
B D              Atlantic cod  ==============================
B D                    Gibbon  ==============================
                 Spotted gar  ==============================
B D               Stickleback  ==============================
          Southern platyfish  ==============================
      Yellowbelly pufferfish  ==============================
B D                      Fugu  ==============================
B D                 Tetraodon  ==============================
B D                   Chicken  ==============================
  D              Mallard duck  ==============================
          Tibetan ground jay  ==============================
B D               Zebra finch  ==============================
B D                    Medaka  ==============================
         Pundamilia nyererei  ==============================
                 Zebra mbuna  ==============================
       Burton's mouthbreeder  ==============================
         Princess of Burundi  ==============================
B D              Nile tilapia  ==============================
  D            Painted turtle  ==============================
  D           Green seaturtle  ==============================
B D        American alligator  ==============================
  D             Scarlet macaw  ==============================
B D                   Opossum  ==============================
                  Chinchilla  ==============================
B D            Naked mole-rat  ==============================
      Lesser Egyptian jerboa  ==============================
  D               Rock pigeon  ==============================
  D       Collared flycatcher  ==============================
B D       Medium ground finch  ==============================
B D                    Lizard  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================
            Cape golden mole  ==============================
          Chinese tree shrew  ==============================
         Cape elephant shrew  ==============================
B D                  Platypus  ==============================
B D           Chinese hamster  ==============================
                Prairie vole  ==============================
B D                    Tenrec  ==============================
B D                       Cat  ==============================
B D                  Bushbaby  ==============================
  D  Chinese softshell turtle  ==============================
B D                   Ferret   ==============================
B D                       Rat  ==============================
B D                     Mouse  ==============================
B D                     Panda  ==============================
             Star-nosed mole  ==============================
               Big brown bat  ==============================
B D                  Marmoset  ==============================
B D                       Cow  ==============================

Inserts between block 18 and 19 in window
                    Aardvark 8bp

Alignment block 19 of 641 in window, 56695586 - 56695595, 10 bps 
B D                     Human  a-ttctga--gtc
B D                     Chimp  a-ttctga--gtc
B D                   Gorilla  a-ttctga--gtc
B D                 Orangutan  a-ttctga--gtc
B D                    Rhesus  a-ttctca--gtc
B D       Crab-eating macaque  a-ttctca--gtc
B D                    Baboon  a-ttctca--gtc
B D              Green monkey  a-ttctca--gtc
B D                  Squirrel  a-tattcactatg
B D                       Pig  g-tttcca--gta
B D                    Alpaca  g-tttcca--gta
               Bactrian camel  g-tttcca--gta
B D                   Dolphin  g-tttcca--gtg
                 Killer whale  g-tttcca--gtg
             Tibetan antelope  g-tttcca--gtg
B D                     Sheep  g-tttcca--gtg
                Domestic goat  g-tttcta--gtg
B D                     Horse  --tttcca--gtg
B D          White rhinoceros  g-tttcca--gag
B D                       Dog  g-tttcta--atg
               Pacific walrus  g-tttcta--atg
             Black flying-fox  g-tttcca--agg
B D                   Megabat  g-tttcca--agg
         David's myotis (bat)  gatttcca--gtg
  D          Little brown bat  gatttcca--gtg
B D                  Elephant  a-ttcatg--gtg
B D                   Manatee  a-ttcata--gtg
B D                    Tenrec  a-ctcaca--gtg
                     Aardvark  -----aca--tca
B D                 Armadillo  a-ttccca--ggg
B D                  Hedgehog  =============
B D                Guinea pig  =============
B D                      Pika  =============
B D                    Rabbit  =============
B D                Coelacanth  =============
B D                     Shrew  =============
              Golden hamster  =============
            Brush-tailed rat  =============
B D              Atlantic cod  =============
B D                    Gibbon  =============
                 Spotted gar  =============
B D               Stickleback  =============
          Southern platyfish  =============
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
B D                 Tetraodon  =============
B D                   Chicken  =============
  D              Mallard duck  =============
          Tibetan ground jay  =============
B D               Zebra finch  =============
B D                    Medaka  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D              Nile tilapia  =============
  D            Painted turtle  =============
  D           Green seaturtle  =============
B D        American alligator  =============
  D             Scarlet macaw  =============
B D                   Opossum  =============
                  Chinchilla  =============
B D            Naked mole-rat  =============
      Lesser Egyptian jerboa  =============
  D               Rock pigeon  =============
  D       Collared flycatcher  =============
B D       Medium ground finch  =============
B D                    Lizard  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
            Cape golden mole  =============
          Chinese tree shrew  =============
         Cape elephant shrew  =============
B D                  Platypus  =============
B D           Chinese hamster  =============
                Prairie vole  =============
B D                       Cat  =============
B D                  Bushbaby  =============
  D  Chinese softshell turtle  =============
B D                   Ferret   =============
B D                       Rat  =============
B D                     Mouse  =============
B D                     Panda  =============
             Star-nosed mole  =============
                Weddell seal  -------------
               Big brown bat  =============
B D                  Marmoset  =============
B D                       Cow  =============

Alignment block 20 of 641 in window, 56695596 - 56695601, 6 bps 
B D                     Human  cctg---------gc
B D                     Chimp  cctg---------gc
B D                   Gorilla  cctg---------gc
B D                 Orangutan  cctg---------gc
B D                    Rhesus  cctg---------gc
B D       Crab-eating macaque  cctg---------gc
B D                    Baboon  ccta---------gc
B D              Green monkey  cctg---------gc
B D                  Squirrel  cctc---------gc
B D                       Pig  ccag---------aa
B D                    Alpaca  gcag---------ac
               Bactrian camel  gcag---------ac
B D                   Dolphin  ccag---------ac
                 Killer whale  ccag---------ac
             Tibetan antelope  ccag---------ac
B D                     Sheep  ccag---------ac
                Domestic goat  ccag---------ac
B D                     Horse  ccag---------ac
B D          White rhinoceros  ccag---------ac
B D                       Dog  ccag---------ac
               Pacific walrus  cc-----------ag
                 Weddell seal  --------------c
             Black flying-fox  ccag---------ac
B D                   Megabat  ccag---------ac
         David's myotis (bat)  ccag---------ac
  D          Little brown bat  ccag---------ac
B D                     Shrew  ccag---------gc
B D                  Elephant  ccaa---------gc
B D                   Manatee  ccag---------gc
B D                    Tenrec  ccag---------gc
                     Aardvark  ccagagctccttagc
B D                 Armadillo  tcag---------gc
B D                  Hedgehog  ===============
B D                Guinea pig  ===============
B D                      Pika  ===============
B D                    Rabbit  ===============
B D                Coelacanth  ===============
              Golden hamster  ===============
            Brush-tailed rat  ===============
B D              Atlantic cod  ===============
B D                    Gibbon  ===============
                 Spotted gar  ===============
B D               Stickleback  ===============
          Southern platyfish  ===============
      Yellowbelly pufferfish  ===============
B D                      Fugu  ===============
B D                 Tetraodon  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
          Tibetan ground jay  ===============
B D               Zebra finch  ===============
B D                    Medaka  ===============
         Pundamilia nyererei  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D              Nile tilapia  ===============
  D            Painted turtle  ===============
  D           Green seaturtle  ===============
B D        American alligator  ===============
  D             Scarlet macaw  ===============
B D                   Opossum  ===============
                  Chinchilla  ===============
B D            Naked mole-rat  ===============
      Lesser Egyptian jerboa  ===============
  D               Rock pigeon  ===============
  D       Collared flycatcher  ===============
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
            Cape golden mole  ===============
          Chinese tree shrew  ===============
         Cape elephant shrew  ===============
B D                  Platypus  ===============
B D           Chinese hamster  ===============
                Prairie vole  ===============
B D                       Cat  ===============
B D                  Bushbaby  ===============
  D  Chinese softshell turtle  ===============
B D                   Ferret   ===============
B D                       Rat  ===============
B D                     Mouse  ===============
B D                     Panda  ===============
             Star-nosed mole  ===============
               Big brown bat  ===============
B D                  Marmoset  ===============
B D                       Cow  ===============

Alignment block 21 of 641 in window, 56695602 - 56695618, 17 bps 
B D                     Human  acatagtagatgctc--aa
B D                     Chimp  acatagtagatgctc--aa
B D                   Gorilla  acatagtagatgctc--aa
B D                 Orangutan  acgtagtagatgctc--aa
B D                    Rhesus  acatagtagttgctc--aa
B D       Crab-eating macaque  acatagtagttgctc--aa
B D                    Baboon  acatagtagttgctc--aa
B D              Green monkey  acgtagtagttgctc--aa
B D                  Squirrel  tcatagtatgtttta--aa
B D                       Pig  acataataggtactc--aa
B D                    Alpaca  acataataggtgctc--aa
               Bactrian camel  acataataggttctc--aa
B D                   Dolphin  acataatagatgctc--aa
                 Killer whale  acataatagatgctc--aa
             Tibetan antelope  acgtaatagatgctc--aa
B D                     Sheep  acgtaatagatgctc--aa
                Domestic goat  acgtaataggtgctc--aa
B D                     Horse  gtatagtcggtgctc--aa
B D          White rhinoceros  acatagttggtactc--aa
B D                       Dog  acatatgtgtctggc--aa
               Pacific walrus  acatatgtgtctggc--aa
                 Weddell seal  atatatgtgtctggc--aa
             Black flying-fox  acatagtagatgctcaga-
B D                   Megabat  acatagtagatgctcaga-
                Big brown bat  acacaactgatactt--a-
         David's myotis (bat)  --acaattgatgctt--a-
  D          Little brown bat  --acaattgatgctt--a-
B D                     Shrew  atatagcagatgcac--ac
B D                  Elephant  acatagtaggtgctc--ag
B D                   Manatee  acatagcaggtgctc--ag
B D                    Tenrec  atctgttaggtactc--aa
                     Aardvark  ccatagtaggtactc--aa
B D                 Armadillo  acatagtaagttctc--aa
B D                  Hedgehog  ===================
B D                Guinea pig  ===================
B D                      Pika  ===================
B D                    Rabbit  ===================
B D                Coelacanth  ===================
              Golden hamster  ===================
            Brush-tailed rat  ===================
B D              Atlantic cod  ===================
B D                    Gibbon  ===================
                 Spotted gar  ===================
B D               Stickleback  ===================
          Southern platyfish  ===================
      Yellowbelly pufferfish  ===================
B D                      Fugu  ===================
B D                 Tetraodon  ===================
B D                   Chicken  ===================
  D              Mallard duck  ===================
          Tibetan ground jay  ===================
B D               Zebra finch  ===================
B D                    Medaka  ===================
         Pundamilia nyererei  ===================
                 Zebra mbuna  ===================
       Burton's mouthbreeder  ===================
         Princess of Burundi  ===================
B D              Nile tilapia  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D        American alligator  ===================
  D             Scarlet macaw  ===================
B D                   Opossum  ===================
                  Chinchilla  ===================
B D            Naked mole-rat  ===================
      Lesser Egyptian jerboa  ===================
  D               Rock pigeon  ===================
  D       Collared flycatcher  ===================
B D       Medium ground finch  ===================
B D                    Lizard  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
            Cape golden mole  ===================
          Chinese tree shrew  ===================
         Cape elephant shrew  ===================
B D                  Platypus  ===================
B D           Chinese hamster  ===================
                Prairie vole  ===================
B D                       Cat  ===================
B D                  Bushbaby  ===================
  D  Chinese softshell turtle  ===================
B D                   Ferret   ===================
B D                       Rat  ===================
B D                     Mouse  ===================
B D                     Panda  ===================
             Star-nosed mole  ===================
B D                  Marmoset  ===================
B D                       Cow  ===================

Inserts between block 21 and 22 in window
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Dog 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
B D                    Shrew 3bp

Alignment block 22 of 641 in window, 56695619 - 56695628, 10 bps 
B D                     Human  aaat--gtttgt
B D                     Chimp  aaat--gtttgt
B D                   Gorilla  aaat--gtttgt
B D                 Orangutan  aaat--gtttgt
B D                    Rhesus  caat--gtttgt
B D       Crab-eating macaque  caat--gtttgt
B D                    Baboon  caat--gtttgt
B D              Green monkey  caat--gtttgt
B D                  Squirrel  aaaa--atttgt
B D                       Pig  --aa--gtttgt
B D                    Alpaca  --aa--gtttgt
               Bactrian camel  --aa--gtttgt
B D                   Dolphin  --aa--gtttgt
                 Killer whale  --aa--gtttgt
             Tibetan antelope  --aa---tttgt
B D                     Sheep  --aa---tttgt
                Domestic goat  --aa---tttgt
B D                     Horse  gaat--gcttgt
B D          White rhinoceros  aaat--gtttgt
B D                       Dog  aaat--gtttgt
B D                     Panda  aaat--gtttgt
               Pacific walrus  aaat--gtttgt
                 Weddell seal  agat--gtttgt
             Black flying-fox  aaat--gtttgt
B D                   Megabat  aaat--gtttgt
                Big brown bat  aaat--gtttgt
         David's myotis (bat)  aaat--gtttgt
  D          Little brown bat  aaat--gtttgt
B D                     Shrew  aaat--atttct
B D                  Elephant  aaac--gtttgt
B D                   Manatee  aaat--gtttgt
B D                    Tenrec  aacc--gtttgt
                     Aardvark  aagt--gttcag
B D                 Armadillo  aaaaaggtttgt
B D                  Hedgehog  ============
B D                Guinea pig  ============
B D                      Pika  ============
B D                    Rabbit  ============
B D                Coelacanth  ============
              Golden hamster  ============
            Brush-tailed rat  ============
B D              Atlantic cod  ============
B D                    Gibbon  ============
                 Spotted gar  ============
B D               Stickleback  ============
          Southern platyfish  ============
      Yellowbelly pufferfish  ============
B D                      Fugu  ============
B D                 Tetraodon  ============
B D                   Chicken  ============
  D              Mallard duck  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
B D                    Medaka  ============
         Pundamilia nyererei  ============
                 Zebra mbuna  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D              Nile tilapia  ============
  D            Painted turtle  ============
  D           Green seaturtle  ============
B D        American alligator  ============
  D             Scarlet macaw  ============
B D                   Opossum  ============
                  Chinchilla  ============
B D            Naked mole-rat  ============
      Lesser Egyptian jerboa  ============
  D               Rock pigeon  ============
  D       Collared flycatcher  ============
B D       Medium ground finch  ============
B D                    Lizard  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
            Cape golden mole  ============
          Chinese tree shrew  ============
         Cape elephant shrew  ============
B D                  Platypus  ============
B D           Chinese hamster  ============
                Prairie vole  ============
B D                       Cat  ============
B D                  Bushbaby  ============
  D  Chinese softshell turtle  ============
B D                   Ferret   ============
B D                       Rat  ============
B D                     Mouse  ============
             Star-nosed mole  ============
B D                  Marmoset  ============
B D                       Cow  ============

Inserts between block 22 and 23 in window
B D                   Baboon 861bp

Alignment block 23 of 641 in window, 56695629 - 56695637, 9 bps 
B D                     Human  taaatatat
B D                     Chimp  taaatatat
B D                   Gorilla  taaatatat
B D                 Orangutan  taaatatat
B D                    Rhesus  taaatatat
B D       Crab-eating macaque  taaatatat
B D                    Baboon  taataataa
B D              Green monkey  taaatatat
B D                  Squirrel  tgattatat
B D                       Pig  gtaata---
B D                    Alpaca  ggaata---
               Bactrian camel  ggaata---
B D                   Dolphin  ggaata---
                 Killer whale  ggaata---
             Tibetan antelope  ggaata---
B D                     Sheep  ggaata---
                Domestic goat  ggaata---
B D                     Horse  ggaata---
B D          White rhinoceros  ggaata---
B D                       Dog  agaata---
B D                     Panda  ggaata---
               Pacific walrus  ggaata---
                 Weddell seal  ggaata---
             Black flying-fox  ggacta---
B D                   Megabat  ggacta---
                Big brown bat  ggaata---
         David's myotis (bat)  ggaata---
  D          Little brown bat  ggaata---
B D                     Shrew  aggcaa---
B D                  Elephant  taaatt---
B D                   Manatee  tcaatt---
B D                    Tenrec  tgagtt---
                     Aardvark  tgaatt---
B D                 Armadillo  taaata---
B D                  Hedgehog  =========
B D                Guinea pig  =========
B D                      Pika  =========
B D                    Rabbit  =========
B D                Coelacanth  =========
              Golden hamster  =========
            Brush-tailed rat  =========
B D              Atlantic cod  =========
B D                    Gibbon  =========
                 Spotted gar  =========
B D               Stickleback  =========
          Southern platyfish  =========
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
B D                 Tetraodon  =========
B D                   Chicken  =========
  D              Mallard duck  =========
          Tibetan ground jay  =========
B D               Zebra finch  =========
B D                    Medaka  =========
         Pundamilia nyererei  =========
                 Zebra mbuna  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D              Nile tilapia  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D        American alligator  =========
  D             Scarlet macaw  =========
B D                   Opossum  =========
                  Chinchilla  =========
B D            Naked mole-rat  =========
      Lesser Egyptian jerboa  =========
  D               Rock pigeon  =========
  D       Collared flycatcher  =========
B D       Medium ground finch  =========
B D                    Lizard  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
            Cape golden mole  =========
          Chinese tree shrew  =========
         Cape elephant shrew  =========
B D                  Platypus  =========
B D           Chinese hamster  =========
                Prairie vole  =========
B D                       Cat  =========
B D                  Bushbaby  =========
  D  Chinese softshell turtle  =========
B D                   Ferret   =========
B D                       Rat  =========
B D                     Mouse  =========
             Star-nosed mole  =========
B D                  Marmoset  =========
B D                       Cow  =========

Inserts between block 23 and 24 in window
B D                   Rhesus 326bp
B D             Green monkey 321bp

Alignment block 24 of 641 in window, 56695638 - 56695652, 15 bps 
B D                     Human  taataatttagctgt----
B D                     Chimp  taataatttagccgt----
B D                   Gorilla  taataatttagctgt----
B D                 Orangutan  taataatttagctgt----
B D                    Rhesus  taataatttagctgt----
B D       Crab-eating macaque  taataatttagctgt----
B D                    Baboon  taataatttagctgt----
B D              Green monkey  taataatttagctgt----
B D                  Squirrel  -------tttgt-------
B D                       Pig  ---taattc-gttgt----
B D                    Alpaca  ---taatat-gctgt----
               Bactrian camel  ---taatat-gctgt----
B D                   Dolphin  ---taattt-gc-------
                 Killer whale  ---taattt-gc-------
             Tibetan antelope  ---taattt-gc-------
B D                     Sheep  ---taattt-gc-------
                Domestic goat  ---taattt-gc-------
B D                     Horse  ---caattt-gctat----
B D          White rhinoceros  ---taattt-gccat----
B D                       Dog  ---taattt-accat----
B D                     Panda  ---taattt-aacat----
               Pacific walrus  ---taattc-aacat----
                 Weddell seal  ---taattc-accat----
             Black flying-fox  ---taattt-gccat----
B D                   Megabat  ---taattt-gccat----
                Big brown bat  ---taattt-gccat----
         David's myotis (bat)  ---taattt-gccat----
  D          Little brown bat  ---taattt-gccat----
B D                     Shrew  ---tagttt-actat----
B D                  Elephant  ---tgattt-gtcatctgg
B D                   Manatee  ---tgattt-gtcatctgg
B D                    Tenrec  ---tgattt-gtcatctgg
                     Aardvark  ---tcattc-gtcatctgg
B D                 Armadillo  ---taattt-gtcacttgg
B D                  Hedgehog  ===================
B D                Guinea pig  ===================
B D                      Pika  ===================
B D                    Rabbit  ===================
B D                Coelacanth  ===================
              Golden hamster  ===================
            Brush-tailed rat  ===================
B D              Atlantic cod  ===================
B D                    Gibbon  ===================
                 Spotted gar  ===================
B D               Stickleback  ===================
          Southern platyfish  ===================
      Yellowbelly pufferfish  ===================
B D                      Fugu  ===================
B D                 Tetraodon  ===================
B D                   Chicken  ===================
  D              Mallard duck  ===================
          Tibetan ground jay  ===================
B D               Zebra finch  ===================
B D                    Medaka  ===================
         Pundamilia nyererei  ===================
                 Zebra mbuna  ===================
       Burton's mouthbreeder  ===================
         Princess of Burundi  ===================
B D              Nile tilapia  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D        American alligator  ===================
  D             Scarlet macaw  ===================
B D                   Opossum  ===================
                  Chinchilla  ===================
B D            Naked mole-rat  ===================
      Lesser Egyptian jerboa  ===================
  D               Rock pigeon  ===================
  D       Collared flycatcher  ===================
B D       Medium ground finch  ===================
B D                    Lizard  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
            Cape golden mole  ===================
          Chinese tree shrew  ===================
         Cape elephant shrew  ===================
B D                  Platypus  ===================
B D           Chinese hamster  ===================
                Prairie vole  ===================
B D                       Cat  ===================
B D                  Bushbaby  ===================
  D  Chinese softshell turtle  ===================
B D                   Ferret   ===================
B D                       Rat  ===================
B D                     Mouse  ===================
             Star-nosed mole  ===================
B D                  Marmoset  ===================
B D                       Cow  ===================

Inserts between block 24 and 25 in window
B D      Crab-eating macaque 367bp
B D                      Pig 4bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                    Horse 4bp
B D         White rhinoceros 4bp
B D                      Dog 4bp
B D                    Panda 4bp
              Pacific walrus 4bp
                Weddell seal 4bp
            Black flying-fox 4bp
B D                  Megabat 4bp
               Big brown bat 4bp
        David's myotis (bat) 4bp
  D         Little brown bat 4bp
B D                    Shrew 4bp

Alignment block 25 of 641 in window, 56695653 - 56695656, 4 bps 
B D                     Human  aatg
B D                     Chimp  aatg
B D                   Gorilla  aatg
B D                 Orangutan  aatg
B D                    Rhesus  aatg
B D                    Baboon  aatg
B D              Green monkey  aatg
B D                  Squirrel  attt
B D                       Pig  aatg
B D                    Alpaca  agtg
               Bactrian camel  agtg
B D                   Dolphin  --tg
                 Killer whale  --tg
             Tibetan antelope  --tg
B D                     Sheep  --tg
                Domestic goat  --tg
B D                     Horse  tgtg
B D          White rhinoceros  tgtg
B D                       Dog  agtg
B D                     Panda  agtg
               Pacific walrus  agtg
                 Weddell seal  agtg
             Black flying-fox  agtg
B D                   Megabat  agtg
                Big brown bat  agtg
         David's myotis (bat)  agtg
  D          Little brown bat  agtg
B D                     Shrew  agtg
B D                  Elephant  agta
B D                   Manatee  agta
B D                    Tenrec  agta
                     Aardvark  aata
B D                 Armadillo  aata
B D                  Hedgehog  ====
B D                Guinea pig  ====
B D                      Pika  ====
B D                    Rabbit  ====
B D                Coelacanth  ====
              Golden hamster  ====
B D       Crab-eating macaque  ====
            Brush-tailed rat  ====
B D              Atlantic cod  ====
B D                    Gibbon  ====
                 Spotted gar  ====
B D               Stickleback  ====
          Southern platyfish  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                 Tetraodon  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D                    Medaka  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                   Opossum  ====
                  Chinchilla  ====
B D            Naked mole-rat  ====
      Lesser Egyptian jerboa  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
            Cape golden mole  ====
          Chinese tree shrew  ====
         Cape elephant shrew  ====
B D                  Platypus  ====
B D           Chinese hamster  ====
                Prairie vole  ====
B D                       Cat  ====
B D                  Bushbaby  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   ====
B D                       Rat  ====
B D                     Mouse  ====
             Star-nosed mole  ====
B D                  Marmoset  ====
B D                       Cow  ====

Inserts between block 25 and 26 in window
B D                   Tenrec 2bp

Alignment block 26 of 641 in window, 56695657 - 56695745, 89 bps 
B D                     Human  gagaaaaactatg----g--acaaaccagtcatggtagtttaggcaagagattagacccag----aacta
B D                     Chimp  gagtaaaactatg----g--acaaaccagtcatggtagtttaggcaagagattagacccag----aacta
B D                   Gorilla  gagaaaaactatg----g--acaaaccagtcatggtagtttaggcaagagattagacccag----aacta
B D                 Orangutan  gagaaaaactatg----g--acaaaccagtcgtggtagtttaggcaagagattagacccag----aacta
B D                    Rhesus  gagaaaaactatg----g--acaaaccagtcatggtagtttaggcaagagattacacccag----aacta
B D                    Baboon  gagaaaaactatg----g--acaaaccagtcatggtagtttaggcaagagattagacccag----aacta
B D              Green monkey  gagaaaaactatg----g--acaaaccagtcatggtagtttaggcaagagattagacccag----aacta
B D                  Squirrel  gtgaaaaactgtgggcag--acagaccagttgtgataatttaggcaagagagtagacctaa----aacta
B D                       Pig  gaaaaaggctgca----a--aaagaccagttttggtagttaaggcaagagagtagacccag----aacta
B D                    Alpaca  gaaaaagactgca----g--acagaccagttacagtaacttaggcaagagaatagaccaag----aacta
               Bactrian camel  gaaaaagactgca----g--acagaccagttacggtaatttaggcaagagaatagaccaag----aacta
B D                   Dolphin  taaaaagactgca----g--acaggccagctatggtagtttaggcaagagagtagagccag----aacta
                 Killer whale  taaaaagactgca----g--acaggccagctatggtagtttaggcaagagagtagagccag----aacta
             Tibetan antelope  gaaaaagactaca----g--acaggccagctatggtagtttaggcaagacagtagacccag----aacta
B D                     Sheep  gaaaaagactaca----g--acaggccagctatggtagtttaggcaagagagtagacccagaactaacta
                Domestic goat  gaaaaagactaca----g--acaggtcagctatggtagtttaggcaagacagtagacccag----aacta
B D                     Horse  cagaaagactgca----g--gcagatcagttatggtagtttaggcaagagagtagacccag----aacca
B D          White rhinoceros  cggaaagactgca----g--acagatcagttatggtggtttaggcaagagagtagacccgg----aacca
B D                       Dog  gagaaagacttca----g--acagactagttatgatagtttaggcaagaggtta----------------
B D                     Panda  gagaaagactaca----g--acagaccagttaagatagtttaggcaagagagcaggcccag----aacta
               Pacific walrus  gagaaagactgca----g--acagaccagttatgatcatttaggtaagagagtaggcccag----agcta
                 Weddell seal  gagaaagactgca----g--acagaccagttatgatagtttaggtaagagagtaggcccgg----agcta
             Black flying-fox  gagaaagactgta----g--acagactagctatagtagtttaagaaagacagtagacccaa----aacta
B D                   Megabat  gagaaagactgta----g--acagactagctatagtagtttaagaaagacagtagacccaa----aacta
                Big brown bat  gagaaagactgca----g--acagaccaactatgggagtttagacaagagagtagacccag----aacta
         David's myotis (bat)  gaga----------------acagaccaactatggcagtttagacaagagagtagacccag----accta
  D          Little brown bat  gaga----------------acagaccaactatggcagtttagacaagagagtagacccag----aacta
B D                     Shrew  atgaaagactgca----g--acagaccagctacagtaacttatgcaagaaagtaaaaccag----aatca
B D                  Elephant  gagagaggctgca----gacacaaaccatttatggtagttttggcaaaagattaggcccag----aagta
B D                   Manatee  gagagaggctgca----g--acaaaccatttacagtactttaggcaaaagattagacccag----aagta
             Cape golden mole  gagagagatggca----g--acaaatcctttatggtagtttaggtaaaagattagacctaa----aactt
B D                    Tenrec  gggaccacagatg----g--acaactcattgatgggagtttaagggaaagattagaccgag----aactg
                     Aardvark  gaaagagactgca----g--acaaaccatttattgtagttgaggcaaaagattagacccag----aacta
B D                 Armadillo  gagagagaccaca----g----agaccagttagggtagtttaggcaagattttagacccag----aacta
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                Coelacanth  ======================================================================
              Golden hamster  ======================================================================
B D       Crab-eating macaque  ======================================================================
            Brush-tailed rat  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Gibbon  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ======================================================================
                  Chinchilla  ======================================================================
B D            Naked mole-rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
B D                       Cat  ======================================================================
B D                  Bushbaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
             Star-nosed mole  ======================================================================
B D                  Marmoset  ======================================================================
B D                       Cow  ======================================================================

                        Human  aagcagtggcagtagg-----agtgg---acagataa-
                        Chimp  aagcagtggcagtagg-----agtgg---acagataa-
                      Gorilla  aagcagtggcagtagg-----agtgg---acagataa-
                    Orangutan  aagcagtggcagtagg-----agtgg---acagataa-
                       Rhesus  aagcagtggcagtagg-----aatgg---acagataa-
                       Baboon  aagcagtggcagtagg-----aatgg---acagataa-
                 Green monkey  aagcagtggcagtagg-----aatgg---acagataa-
                     Squirrel  aagcagtggcaataga-----agtaa---aaaga-aa-
                          Pig  tagcagtaactctagg-----agtaa---agaga-aa-
                       Alpaca  aagcagtcactgtagg-----gggga---agaga-aa-
               Bactrian camel  aagcagtcactgtagg-----gggga---agaga-aa-
                      Dolphin  aagcagttgctgaagg-----gctga---agaga-aa-
                 Killer whale  aagcagttgctgaagg-----gctga---agaga-aa-
             Tibetan antelope  aaacaatcgctgagga-----attga---agaga-ag-
                        Sheep  aaacaatt-ctcagga-----attga---agaga-ag-
                Domestic goat  aaacaatcactgagga-----attga---agaga-ag-
                        Horse  aagcagtagctgtagg-----agtaa---agagg-aa-
             White rhinoceros  aaggagtagctgtagg-----agtga---agaga-aa-
                          Dog  -----------------------------gaaaa-aa-
                        Panda  aagaagtaggggtacgataccagtgaag-aaaaa-aa-
               Pacific walrus  aagcaatagctgtacg-----agtgaagaaaaaa-aa-
                 Weddell seal  aagcagtagctgtaca-----agtgaagaaaaaa-aa-
             Black flying-fox  aagcaatagctgtggg-----agtga---agaga-aa-
                      Megabat  aagcaatagctgtggg-----agtga---agaga-aa-
                Big brown bat  aaaccgtaggtgtggg-----agtaa---aaaga-aa-
         David's myotis (bat)  aaaccgtaacggtggg-----aataa---aaaga-aa-
             Little brown bat  aaaccgtaactgtggg-----agtaa---aaaga-aa-
                        Shrew  aagcagtagct----------tttga---agtga-aa-
                     Elephant  aagcagtggctgtagg-----agtag---aaaga-aa-
                      Manatee  aagcagtgtctgtagg-----agtag---aaaga-aa-
             Cape golden mole  aagcagtagctgtagt-----aatac---aaaga-aaa
                       Tenrec  aagcagcgagtgtagg-----aatgg---aaaga-aaa
                     Aardvark  aagcagtccctgtagg-----agtgg---aaaga-aa-
                    Armadillo  agacagtgactgtatt-----aatgg---agaga-aa-
                     Hedgehog  ======================================
                   Guinea pig  ======================================
                         Pika  ======================================
                       Rabbit  ======================================
                   Coelacanth  ======================================
               Golden hamster  ======================================
          Crab-eating macaque  ======================================
             Brush-tailed rat  ======================================
                 Atlantic cod  ======================================
                       Gibbon  ======================================
                  Spotted gar  ======================================
                  Stickleback  ======================================
           Southern platyfish  ======================================
       Yellowbelly pufferfish  ======================================
                         Fugu  ======================================
                    Tetraodon  ======================================
                      Chicken  ======================================
                 Mallard duck  ======================================
           Tibetan ground jay  ======================================
                  Zebra finch  ======================================
                       Medaka  ======================================
          Pundamilia nyererei  ======================================
                  Zebra mbuna  ======================================
        Burton's mouthbreeder  ======================================
          Princess of Burundi  ======================================
                 Nile tilapia  ======================================
               Painted turtle  ======================================
              Green seaturtle  ======================================
           American alligator  ======================================
                Scarlet macaw  ======================================
                      Opossum  ======================================
                   Chinchilla  ======================================
               Naked mole-rat  ======================================
       Lesser Egyptian jerboa  ======================================
                  Rock pigeon  ======================================
          Collared flycatcher  ======================================
          Medium ground finch  ======================================
                       Lizard  ======================================
             Peregrine falcon  ======================================
                 Saker falcon  ======================================
           Chinese tree shrew  ======================================
          Cape elephant shrew  ======================================
                     Platypus  ======================================
              Chinese hamster  ======================================
                 Prairie vole  ======================================
                          Cat  ======================================
                     Bushbaby  ======================================
     Chinese softshell turtle  ======================================
                      Ferret   ======================================
                          Rat  ======================================
                        Mouse  ======================================
              Star-nosed mole  ======================================
                     Marmoset  ======================================
                          Cow  ======================================

Inserts between block 26 and 27 in window
B D                   Tenrec 13782bp

Alignment block 27 of 641 in window, 56695746 - 56695750, 5 bps 
B D                     Human  agcta
B D                     Chimp  agcta
B D                   Gorilla  agcta
B D                 Orangutan  agcta
B D                    Rhesus  agcta
B D                    Baboon  agcta
B D              Green monkey  agcta
B D                  Squirrel  agctc
B D                       Pig  tgctc
B D                    Alpaca  tgctc
               Bactrian camel  tgctc
B D                   Dolphin  tgctc
                 Killer whale  tgctc
             Tibetan antelope  tgctc
B D                     Sheep  tgctc
                Domestic goat  tgctt
B D                     Horse  agctc
B D          White rhinoceros  agctc
B D                       Dog  agctc
B D                     Panda  agctc
               Pacific walrus  agctc
                 Weddell seal  agctc
             Black flying-fox  agctc
B D                   Megabat  agctc
                Big brown bat  tgcta
         David's myotis (bat)  agcta
  D          Little brown bat  agcta
B D                     Shrew  agttc
B D                  Elephant  agctc
B D                   Manatee  agctt
                     Aardvark  agctt
B D                 Armadillo  agcac
B D                  Hedgehog  =====
B D                Guinea pig  =====
B D                      Pika  =====
B D                    Rabbit  =====
B D                Coelacanth  =====
              Golden hamster  =====
B D       Crab-eating macaque  =====
            Brush-tailed rat  =====
B D              Atlantic cod  =====
B D                    Gibbon  =====
                 Spotted gar  =====
B D               Stickleback  =====
          Southern platyfish  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                 Tetraodon  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
B D                    Medaka  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
  D             Scarlet macaw  =====
B D                   Opossum  =====
                  Chinchilla  =====
B D            Naked mole-rat  =====
      Lesser Egyptian jerboa  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
            Cape golden mole  -----
          Chinese tree shrew  =====
         Cape elephant shrew  =====
B D                  Platypus  =====
B D           Chinese hamster  =====
                Prairie vole  =====
B D                    Tenrec  =====
B D                       Cat  =====
B D                  Bushbaby  =====
  D  Chinese softshell turtle  =====
B D                   Ferret   =====
B D                       Rat  =====
B D                     Mouse  =====
             Star-nosed mole  =====
B D                  Marmoset  =====
B D                       Cow  =====

Alignment block 28 of 641 in window, 56695751 - 56695761, 11 bps 
B D                     Human  acccaga-------a-tt-t
B D                     Chimp  accgaga-------a-tt-t
B D                   Gorilla  acccaga-------a-tt-t
B D                 Orangutan  acccaga-------a-tt-t
B D                    Rhesus  acccaga-------a-tt-t
B D                    Baboon  acccaga-------a-tt-t
B D              Green monkey  acccaga-------a-tt-t
B D                  Squirrel  acccaga-------a-tt-t
B D                Guinea pig  atccaca-------a-gt-t
             Brush-tailed rat  atccaca-------a-tt-t
B D                       Pig  acccaga-------a-tt-t
B D                    Alpaca  agccaga-------a-tt-t
               Bactrian camel  agccaga-------a-tt-t
B D                   Dolphin  acccaga-------a-tt-t
                 Killer whale  acccaga-------a-tt-t
             Tibetan antelope  actcaaa-------a-tt-t
B D                     Sheep  actcaaa-------a-tt-t
                Domestic goat  actcaaa-------a-tt-t
B D                     Horse  atccagg-------a-tt-t
B D          White rhinoceros  acccaga-------a-tt-t
B D                       Dog  actcaga-------a-tt-t
B D                     Panda  accctga-------a-tt-t
               Pacific walrus  acccaga-------a-tt-t
                 Weddell seal  acccaga-------a-tt-t
             Black flying-fox  actcaga-------a-at-t
B D                   Megabat  actcaga-------a-at-t
                Big brown bat  acctaga-------a-tt-t
         David's myotis (bat)  acctaga-------attt-t
  D          Little brown bat  acctaga-------attt-t
B D                     Shrew  acccaga-------a-tt-t
B D                  Elephant  acccaca-------a-tt-t
B D                   Manatee  gtccaca-------a-tt-c
             Cape golden mole  gtacacaccaaatcg-tt-t
                     Aardvark  attcaca-------a-ttgt
B D                 Armadillo  acccaga-------a-at-t
B D                  Hedgehog  ====================
B D                      Pika  ====================
B D                    Rabbit  ====================
B D                Coelacanth  ====================
              Golden hamster  ====================
B D       Crab-eating macaque  ====================
B D              Atlantic cod  ====================
B D                    Gibbon  ====================
                 Spotted gar  ====================
B D               Stickleback  ====================
          Southern platyfish  ====================
      Yellowbelly pufferfish  ====================
B D                      Fugu  ====================
B D                 Tetraodon  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
          Tibetan ground jay  ====================
B D               Zebra finch  ====================
B D                    Medaka  ====================
         Pundamilia nyererei  ====================
                 Zebra mbuna  ====================
       Burton's mouthbreeder  ====================
         Princess of Burundi  ====================
B D              Nile tilapia  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D        American alligator  ====================
  D             Scarlet macaw  ====================
B D                   Opossum  ====================
                  Chinchilla  ====================
B D            Naked mole-rat  ====================
      Lesser Egyptian jerboa  ====================
  D               Rock pigeon  ====================
  D       Collared flycatcher  ====================
B D       Medium ground finch  ====================
B D                    Lizard  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
          Chinese tree shrew  ====================
         Cape elephant shrew  ====================
B D                  Platypus  ====================
B D           Chinese hamster  ====================
                Prairie vole  ====================
B D                    Tenrec  ====================
B D                       Cat  ====================
B D                  Bushbaby  ====================
  D  Chinese softshell turtle  ====================
B D                   Ferret   ====================
B D                       Rat  ====================
B D                     Mouse  ====================
             Star-nosed mole  ====================
B D                  Marmoset  ====================
B D                       Cow  ====================

Alignment block 29 of 641 in window, 56695762 - 56695785, 24 bps 
B D                     Human  tgatgtatttctaacttt---gaag---ac
B D                     Chimp  tgatgtatttctaacttt---gaag---ac
B D                   Gorilla  tgatgtatttctaacttt---gaag---ac
B D                 Orangutan  tgatgtatttctaacctt---gaag---ac
B D                    Rhesus  taatgtatttctaacctt---gaag---ac
B D       Crab-eating macaque  taatgtatttctaacctt---gaag---ac
B D                    Baboon  taatgtatttctaacctt---gaag---ac
B D              Green monkey  taatgtatttctaacctt---gaag---ac
B D                  Squirrel  cactgtgcttctgacctt---gaag---at
B D                Guinea pig  tg--atgtctctgacctt---gaag---at
             Brush-tailed rat  tac-aagcttctggtctt---gaaa---at
B D                       Pig  tgacaaatttctgacctt---gaag---ac
B D                    Alpaca  tgataaatttctgacctt---gaaa---ac
               Bactrian camel  tgataaatttctgacctt---gaag---ac
B D                   Dolphin  tgatacatttctgccctt---gaag---ac
                 Killer whale  tgatacatttctgccctt---gaag---ac
             Tibetan antelope  tgactaatttcggacctt---gaag---ac
B D                     Sheep  tgactaatttctgacctt---gaag---ac
                Domestic goat  ttactaatttctgacctt---gaag---ac
B D                     Horse  tgataaatttctgacctt---gaaa---ac
B D          White rhinoceros  tgat-aatttctgacctt---gaag---ac
B D                       Dog  tgataaatttctgacctt---gaaa---ac
B D                     Panda  tgataaa--tctgaccttgaagaag---ac
               Pacific walrus  tgataaatttctgacctt---gaag---ac
                 Weddell seal  tgataaatttctgacctt---gaag---ac
             Black flying-fox  tgataaatttctgacctt---gaag---ac
B D                   Megabat  tgataaatttctgacctt---gaag---ac
                Big brown bat  tgataaatatctgacatt---gaag---ac
         David's myotis (bat)  tgataaatttctgacctt---gaag---ac
  D          Little brown bat  tgataaatttctgacctt---gaag---ac
B D                     Shrew  t-ctaagttcatgatctt---gaat---aa
B D                  Elephant  tgatatatttctgacctt---aaag---ac
B D                   Manatee  tgatatatttctgacctt---gaag----c
             Cape golden mole  tgatatatctctgacctt---ggaggaaac
                     Aardvark  taatacatttctgacctt---gaag---ac
B D                 Armadillo  tgttaaattttttacctt---gaag---ac
B D                  Hedgehog  ==============================
B D                      Pika  ==============================
B D                    Rabbit  ==============================
B D                Coelacanth  ==============================
              Golden hamster  ==============================
B D              Atlantic cod  ==============================
B D                    Gibbon  ==============================
                 Spotted gar  ==============================
B D               Stickleback  ==============================
          Southern platyfish  ==============================
      Yellowbelly pufferfish  ==============================
B D                      Fugu  ==============================
B D                 Tetraodon  ==============================
B D                   Chicken  ==============================
  D              Mallard duck  ==============================
          Tibetan ground jay  ==============================
B D               Zebra finch  ==============================
B D                    Medaka  ==============================
         Pundamilia nyererei  ==============================
                 Zebra mbuna  ==============================
       Burton's mouthbreeder  ==============================
         Princess of Burundi  ==============================
B D              Nile tilapia  ==============================
  D            Painted turtle  ==============================
  D           Green seaturtle  ==============================
B D        American alligator  ==============================
  D             Scarlet macaw  ==============================
B D                   Opossum  ==============================
                  Chinchilla  ==============================
B D            Naked mole-rat  ==============================
      Lesser Egyptian jerboa  ==============================
  D               Rock pigeon  ==============================
  D       Collared flycatcher  ==============================
B D       Medium ground finch  ==============================
B D                    Lizard  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================
          Chinese tree shrew  ==============================
         Cape elephant shrew  ==============================
B D                  Platypus  ==============================
B D           Chinese hamster  ==============================
                Prairie vole  ==============================
B D                    Tenrec  ==============================
B D                       Cat  ==============================
B D                  Bushbaby  ==============================
  D  Chinese softshell turtle  ==============================
B D                   Ferret   ==============================
B D                       Rat  ==============================
B D                     Mouse  ==============================
             Star-nosed mole  ==============================
B D                  Marmoset  ==============================
B D                       Cow  ==============================

Inserts between block 29 and 30 in window
B D                   Alpaca 2027bp
              Bactrian camel 2028bp

Alignment block 30 of 641 in window, 56695786 - 56695796, 11 bps 
B D                     Human  cagttagaaaa
B D                     Chimp  cagttagaaaa
B D                   Gorilla  cagttagaaaa
B D                 Orangutan  cagttagaaaa
B D                    Rhesus  cagttagaaaa
B D       Crab-eating macaque  cagttagaaaa
B D                    Baboon  cagttagaaaa
B D              Green monkey  cagttagaaaa
B D                  Squirrel  cagttagaaaa
B D                Guinea pig  cagttacaaag
             Brush-tailed rat  tagttaccaa-
B D                       Pig  cagttagaaaa
B D                   Dolphin  cagttagagaa
                 Killer whale  cagttagagaa
             Tibetan antelope  cagttagaaaa
B D                     Sheep  cagttagaaaa
                Domestic goat  cagttagaaaa
B D                     Horse  caattagaaaa
B D          White rhinoceros  taattagaaag
B D                       Dog  caattagaaat
B D                     Panda  catttagaaaa
               Pacific walrus  caattagaaaa
                 Weddell seal  caattagaaaa
             Black flying-fox  cagttagaaaa
B D                   Megabat  cagttagaaaa
                Big brown bat  cagttagaaaa
         David's myotis (bat)  caattagaaaa
  D          Little brown bat  cagttagaaaa
B D                     Shrew  aaggaagaaga
B D                  Elephant  tagctggaaaa
B D                   Manatee  tagttagaaaa
             Cape golden mole  cagttagaaat
                     Aardvark  cagttagaaaa
B D                 Armadillo  tagttagaaaa
B D                  Hedgehog  ===========
B D                      Pika  ===========
B D                    Rabbit  ===========
B D                Coelacanth  ===========
              Golden hamster  ===========
B D              Atlantic cod  ===========
B D                    Gibbon  ===========
                 Spotted gar  ===========
B D               Stickleback  ===========
          Southern platyfish  ===========
      Yellowbelly pufferfish  ===========
B D                      Fugu  ===========
B D                 Tetraodon  ===========
B D                   Chicken  ===========
  D              Mallard duck  ===========
          Tibetan ground jay  ===========
B D               Zebra finch  ===========
B D                    Medaka  ===========
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
         Princess of Burundi  ===========
B D              Nile tilapia  ===========
  D            Painted turtle  ===========
  D           Green seaturtle  ===========
B D        American alligator  ===========
  D             Scarlet macaw  ===========
B D                   Opossum  ===========
                  Chinchilla  ===========
B D            Naked mole-rat  ===========
      Lesser Egyptian jerboa  ===========
  D               Rock pigeon  ===========
  D       Collared flycatcher  ===========
B D       Medium ground finch  ===========
B D                    Lizard  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
          Chinese tree shrew  ===========
         Cape elephant shrew  ===========
B D                  Platypus  ===========
B D           Chinese hamster  ===========
                Prairie vole  ===========
B D                    Tenrec  ===========
B D                       Cat  ===========
B D                  Bushbaby  ===========
  D  Chinese softshell turtle  ===========
B D                   Ferret   ===========
B D                       Rat  ===========
B D                     Mouse  ===========
             Star-nosed mole  ===========
              Bactrian camel  ===========
B D                    Alpaca  ===========
B D                  Marmoset  ===========
B D                       Cow  ===========

Inserts between block 30 and 31 in window
B D                      Pig 1bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                    Panda 322bp

Alignment block 31 of 641 in window, 56695797 - 56695798, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Squirrel  gg
B D                Guinea pig  aa
B D                       Pig  -g
B D                   Dolphin  gg
                 Killer whale  gg
             Tibetan antelope  gg
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Dog  gg
B D                     Panda  gg
               Pacific walrus  gg
                 Weddell seal  gg
             Black flying-fox  gg
B D                   Megabat  gg
                Big brown bat  gg
         David's myotis (bat)  gg
  D          Little brown bat  gg
B D                     Shrew  -g
B D                  Elephant  gg
B D                   Manatee  gg
             Cape golden mole  gg
                     Aardvark  gg
B D                 Armadillo  gg
B D                  Hedgehog  ==
B D                      Pika  ==
B D                    Rabbit  ==
B D                Coelacanth  ==
              Golden hamster  ==
            Brush-tailed rat  --
B D              Atlantic cod  ==
B D                    Gibbon  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                   Opossum  ==
                  Chinchilla  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
          Chinese tree shrew  ==
         Cape elephant shrew  ==
B D                  Platypus  ==
B D           Chinese hamster  ==
                Prairie vole  ==
B D                    Tenrec  ==
B D                       Cat  ==
B D                  Bushbaby  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
B D                       Rat  ==
B D                     Mouse  ==
             Star-nosed mole  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                  Marmoset  ==
B D                       Cow  ==

Inserts between block 31 and 32 in window
B D                      Dog 1bp
              Pacific walrus 228bp
                Weddell seal 237bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
  D         Little brown bat 1bp

Alignment block 32 of 641 in window, 56695799 - 56695909, 111 bps 
B D                     Human  aatcagataaggaggtttctagtttgggagac----tgggt-gaaatgcgacaccattagctgagactga
B D                     Chimp  aatcagataaggaggtttctagtttgggagac----tgggt-gaaatgtgacaccattagctgagactga
B D                   Gorilla  aatcagataaggaggtttctagtttgggagac----tgggt-gaaatgcgacaccattagctgagactga
B D                 Orangutan  aatcagataaggaggtttctagtttgggagac----tgggt-gaaatgcgacaccattagctgagactga
B D                    Rhesus  agtcagagaaggaggtttctagtttgggagac----tgggt-gaaatttgacaccattagctgagactga
B D       Crab-eating macaque  agtcagagaaggaggtttctagtttgggagac----tgggt-gaaatttgacaccattagctgagactga
B D                    Baboon  agtcagagaaggaggtttctagtttgggagac----tgggt-gaaatttgacaccattagctgagactga
B D              Green monkey  agtcagagaaggaggtttctagtttgggagac----tgggt-gaaattcgacaccattagctgagactga
B D                  Squirrel  gaagagataacaaggtttctaatgtgggaaat----tggtt-gaaatgtgacaccattagctgagactga
B D                Guinea pig  gaagaga----aaagtttctagaatggaagat----tgatt-gaaatgtgataccattacctaactctga
             Brush-tailed rat  -aaaaaa----agagtttctaggttgtaagat----tggtt-gaaatgtgataccattacctaagactaa
B D                       Pig  gaagagataaagaggcttctagtttggtagag----tgggt-gaaatgagacaccattagctgagactaa
B D                   Dolphin  gaagagataaagaggcttctagtttgggagag----ggggt-gaaatgtgacaccattagctgagactga
                 Killer whale  gaagagataaagaggcttctagtttgggagag----ggggt-gaaatgtgacaccattagctgagactga
             Tibetan antelope  gacgagataaagaggcttctagtttgggagag----taggt-gaa---tgacaccattagctgaaactaa
B D                     Sheep  gacgagataaagagccttctagtttgggagag----taggt-gaa---tgacaccattagctgaaactaa
                Domestic goat  gacgagataaagaggcttctagtttgggagag----taggt-gaa---tgacaccattagctgaaactaa
B D                     Horse  aaggagataaggaggt----------agagac----tgggt-aaaatgtgacaccatttgctgagattca
B D          White rhinoceros  gaagagatagggaggtttttagtttgggagat----tgggt-gaaatgtgacaccatttgctgaaactga
B D                       Dog  gaagaaat---gaggtttctacttggggagtt----tcagtaaaaatgcaacaccatcagctgagactga
B D                     Panda  gaatagatgaggaggtttctagttggggagat----tgggt-aaaatgcaacaccattagctgagactga
               Pacific walrus  gaataggtaaggaggtttctagttggggagat----tgggt-aaaatgcaacaccattagctgagactga
                 Weddell seal  gaatagataaggaggtttctagttggggagat----tggat-aaaatgcaacaccattagctgagaccga
             Black flying-fox  gaagagataaggaagtttctagtttgggagat----agggt-gaaatatgacaccattagctgagaccga
B D                   Megabat  gaagagataaggaagtttctagtttgggagat----agggt-gaaatatgacaccattagctgagactga
                Big brown bat  ggatagataaggaggtttctagtttgagagat----tgggt-gacatgtgacaccattagctgagactga
         David's myotis (bat)  ggatagttaaggaggttcctagtttgggagat----tgagt-gaagtgtgacaccattagctgaggctga
  D          Little brown bat  ggatagttaaggaggtttctagtttgggagat----tgagt-g--gtgtgacaccattagctgagcctga
B D                     Shrew  ------atatggatgattccaatgtggaagac--------t-gaaatgtgataccgttagctgagactga
B D                  Elephant  gaagagataagaaggtttctagttcgggagat----tgcgt-gaaatgtgatacctttagatgagactga
B D                   Manatee  gaagagat---aaggtatctagtttgggagat----tgtgt-gaaatgtgataccattagctgagactga
             Cape golden mole  gaagagataaagaggtttctagtttgggagattgactgaat-gaaatgtgatacaattagctgagactga
                     Aardvark  gaagagataaggagttttctagtttgggagat----tgggt-ggaatatgataccattagctaag-ctaa
B D                 Armadillo  gaaaggataaggatgcttctggtttgggagat----tggat-aaaatatgacaccattagctgagactga
B D                  Hedgehog  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                Coelacanth  ======================================================================
              Golden hamster  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Gibbon  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ======================================================================
                  Chinchilla  ======================================================================
B D            Naked mole-rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                  Bushbaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
             Star-nosed mole  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                  Marmoset  ======================================================================
B D                       Cow  ======================================================================

                        Human  aagggac-------agatggaggagt-agaa--ata----taat----ttaatatagtt---------ta
                        Chimp  aagggac-------agatggaggagt-agaa--ata----taat----ttaatatagtt---------ta
                      Gorilla  aagggac-------agatggaggagt-agaa--ata----taat----ttaatatagtt---------ta
                    Orangutan  aagggac-------agatggagaagt-agaa--ata----taat----ttaatataatt---------ta
                       Rhesus  aagggac-------agatggaggagt-agaa--ata----tgat----ttaatattgtt---------ta
          Crab-eating macaque  aagggac-------agatggaggagt-agaa--ata----tgat----ttaatattgtt---------ta
                       Baboon  aagggac-------agatggaggagt-agaa--ata----tgat----ttaatattgtt---------ta
                 Green monkey  aagggac-------agatggaggagt-agaa--ata----tgat----ttaatattgtt---------ta
                     Squirrel  aagggac-------agatggaggagt-tgaaagaga----taat----ttaatattgta---------ta
                   Guinea pig  aaagggc-aatggaggatggaggaat-agaaagaga----aaat----ttaatagtgta---------ta
             Brush-tailed rat  aagggacaaatgaaggatggaggaat-------aga----aaat----ttaatagtgta---------ta
                          Pig  aagggac-------agatggaggagt-aaaaagag--------t----ttaatattgca---------ta
                      Dolphin  aagggac-------agatggaggagt-aaaaagaga----tagt----ttaatattgta---------ta
                 Killer whale  aagggac-------agatggaggagt-aaaaggaga----tagt----ttaatattgta---------ta
             Tibetan antelope  aagggac-------agatggagaagt-aaaaagaga----cact----ttaatattgta---------ta
                        Sheep  aagggac-------agatggagaagt-aaaaagaga----cact----ttaatattgta---------ta
                Domestic goat  aagggac-------agatggagaagt-aaaaagaga----cact----ttaatattgta---------ta
                        Horse  aagggac-------ag----aggagt-aagaagaga-------------gaatattgta----------a
             White rhinoceros  aagggac-------ag----aggagt-aaaaagagata--ctt------taatattgta---------ta
                          Dog  aagggac-------aaatataggagt-aaaaa-aca----taa------ctatattgta---------ta
                        Panda  aagggac-------agatatagaagt-aaaaagagataattta------ttattttgga---------ta
               Pacific walrus  aagggac-------agatataggaat-aagaagaga----tta------ttatattgta---------ta
                 Weddell seal  aagggac-------agatataggagt-aagaagaga----tta------ttatattata---------ta
             Black flying-fox  aagggac-------agacggaggagt-aaaaagaga-------------taatattgta---------ta
                      Megabat  aagggac-------agacggaggagt-aaaaagaga-------------taatattgta---------ta
                Big brown bat  aagggac-------a----gaggagt-aaaaaggga----tcat----ttaatattgta---------ta
         David's myotis (bat)  aagggac-------agatggaggagt-aaaa--aga----tcat----ttaatattgta---------ta
             Little brown bat  aagggac-------agatggaggagt-aaaaagaga----tcat----ttaatattgta---------ta
                        Shrew  aagggac-------agatggaggagt-aaaatgaga----taat----ttaatattgta---------ta
                     Elephant  aaggaac-------acatagggaagt-ggaaa-aga----ttataaatttaatattgta---------ta
                      Manatee  aagggac-------agatgggggagt-ggaaa-aga----ttatcaatttaatattgtatattactacta
             Cape golden mole  aaaggac-------agatagaggagt-agaaa-aga----ttatcaatttaatattgta---------ta
                     Aardvark  aaagggc-------acttgggggagt-ggaaa-aga----ttataa----aatattgca---------ta
                    Armadillo  aagggac-------agatggaggagtgggaaa-aga----taatacatttagtattg-----------ta
                     Hedgehog  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                   Coelacanth  ======================================================================
               Golden hamster  ======================================================================
                 Atlantic cod  ======================================================================
                       Gibbon  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ==================================================