Multiz Alignments of 60 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 730 in window, 56691767 - 56691847, 81 bps 
B D             Mouse  ccaagg-gcaac-aggtcagtgtga---gcgcc------------cctctcgcgc-----------tacc
B D               Rat  ccaagg-ccaac-aggtcagtgt------------------------------gc-----------tacc
B D      Kangaroo rat  tccagg-tcagc-aggtcagtatgt---gggcg------------cctcccgcgc-----------tccc
B D    Naked mole-rat  tgcctg-caggc-aggtcagtgtat---gcgcg-----------tccccgcg-at-----------tccc
B D        Guinea pig  tcctgg-caggc-aggtcagtgtct---gtgcg--------------ccgcgcat-----------ttcc
B D          Squirrel  cc--------gc-aggtcagtgtgt---gggcg------------cctcccgcat-----------cctt
B D            Rabbit  tccaga----gc-aggtcagtgtgt---gggtc-----------ctctccggcgt-----------cctc
B D              Pika  tccaga----gc-aggtcagtgcgtaggggggc-----------ttctccgcctccggctatcctgcctc
B D             Human  tccagg-cc-gc-aggtcagtgtgc---gggcg------------cctcctgtcc-----------tcct
B D             Chimp  tccagg-cc-gc-aggttagtgtgc---gggcg------------cctcctgtcc-----------tcct
B D           Gorilla  tccagg-cc-gc-aggtcagtgtgc---gggcg------------cctcctgtcc-----------tcct
B D         Orangutan  tccagg-cc-gc-aggtcagtgtgc---gggcg------------cctcctgtcc-----------tctt
B D            Gibbon  tccagg-cc-gc-aggtcagtgtgc---gggcg------------cctccggtcc-----------tcct
B D            Rhesus  tccagg-cc-gc-aggtcagtgtgt---gggcg------------cctcctgtcc-----------tcct
B D            Baboon  tccagg-cc-gc-aggtcagtgtgt---gggcg------------cctcctgtcc-----------tcct
B D          Marmoset  ttcaaacccggc-aagtcagtgtgc---tggcg------------ccacaagtcc-----------tcct
B D   Squirrel monkey  tccggg-ccggc-aggtcagtgtgc---ggacg------------ccacctgtct-----------tcct
B D       Mouse lemur  cccagg-ccagc-aggtcagtgtgt---gggcg------------cctcctgtcc-----------tccc
B D          Bushbaby  tccagg-ccagc-aggtcagtgtgt---gggtg------------cctcctatcc-----------ttcc
B D               Pig  tccagg-ctgtcaaggtcagtgtct---ggcca------------ccccac---------------cccc
B D           Dolphin  tacagg-ctggc-aggtcagtgtct---ggaca------------ctccctg--------------cccc
B D             Sheep  tacagg-ctggc-aggtcagtgcct---ggaca------------ccccct---------------cccc
B D               Cow  tacagg-ctggc-aggtcagtgcct---ggaca------------ccccct---------------cccc
B D               Cat  tccagg-cctgc-aggtcagtgtgt---gggca------------cctcca---------------cacc
B D               Dog  tccagg-cctgc-aggtcagtgtgt---gggca------------cctcca---------------cacc
B D             Panda  tccagg-cctgc-aggtcagtgtgt---gggca------------ccccca---------------cacc
B D             Horse  tccagc-ccgga-aggtcagtgtgt---gggca------------tc---------------------cc
  D  Little brown bat  tccagg-cccgc-aggtcagtgtgc---cgccaccccctccccctccctct---------------cccc
B D           Megabat  tccagg-ccggc-aggtcagtgtgc---gggca------------ccgtcc---------------cctc
B D          Hedgehog  tccagg-ctggc-aggtcagtgagt---gtagt------------cccctg---------------tcct
B D          Elephant  tccagg-ccagc-aggtcagtatgt---gg-cg------------ct-------------------tctc
B D           Manatee  tccagg-ccggc-aggtcagtgtgt---gg-cg------------ct-------------------gccc
B D         Armadillo  tccagg-cccgc-aggtcagtgagc---ggaca------------ct-------------------ctcc
B D          Platypus  aacaaa-agaca-aggtcgatttca---attct------------cctctcccgc-----------tccc
B D           Tarsier  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D            Alpaca  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  ctat---------cct-----------------t-------------ccctgtcagaa-----gatccct
                  Rat  ctac---------cct-----------------t-------------ccctgacagag-----gacccct
         Kangaroo rat  ccct---------ccc-----------------t----------aagccaggctaggg-----atcccct
       Naked mole-rat  gcgc---------ccc-----------------ttgc-------cggcctggccagggccgaggactcag
           Guinea pig  ccgc---------ccc-----------------actc-------tggcctggccaaagccactgactgga
             Squirrel  cccc---------cta-----------------actc-------gggcatggttaata--------ccct
               Rabbit  tcgg---------cct-----------------ggtt-------ggggctca----gg-----atcccct
                 Pika  ccac---------ccc-----------------gcccctgcccggaggcccagcgggg-----actcccc
                Human  ctcc---------cac-------------------------------------cagag-----gacccct
                Chimp  ctcc---------cac-------------------------------------cagag-----gacccct
              Gorilla  ctcc---------cac-------------------------------------cagag-----gacccct
            Orangutan  ctcc---------cac-------------------------------------cagag-----gacccct
               Gibbon  ctcc---------cac-----------------cccggatc---tgccttgggcagag-----gacccct
               Rhesus  ctcc---------cac-----------------tccggatc---tgcctggggcagag-----gacccct
               Baboon  ctcc---------cac-----------------tccggatc---tgcctggggcagag-----gacccct
             Marmoset  ctcc---------cac-----------------cccgagtc---tggctgggacagag-----gaccact
      Squirrel monkey  ctcc---------cac-----------------cccgggtc---tggctggggtagag-----gacctct
          Mouse lemur  cacc---------ccc---------------------ggcc---tggctggggccgag-----gaccccc
             Bushbaby  cacc---------cac-----------------tctgggcc---tggctggcgcccag-----gaccccc
                  Pig  gcac---------cccttccattaccaccaccaccctggcc---tggttggggctgaa-----ggcccgt
              Dolphin  ccatcacc-----cccccccccccccgcc----ccccggcc---tggctgaggctgag-----ggcccgt
                Sheep  tcatcaccaccagcaccaccaccaccaccactaccctggcc---cggctgaggctgag-----cgcccgg
                  Cow  tcaccaccac---caccaccaccaccaccactaccctggcc---tggctgaggctgag-----cgcccgg
                  Cat  ccaa---------ccc------------------gggtccc---cggctggggctgag-----ggccctg
                  Dog  ccaa---------ccc-----------------aggaggcc---tggctggggctg-g-----ggccctg
                Panda  ccaa---------ccc-----------------aggggccc---tggctggggctgag-----ggccctg
                Horse  ccat---------ccc-----------------tcagggcc---tggctggggctgag-----ggcccc-
     Little brown bat  ctcc---------ccc-----------------ctccggcc---tggctgggggtgag-----ggcccca
              Megabat  ccct---------acc-----------------ccccagac----ggccagtgttcag-----gatcccc
             Hedgehog  cca--------------------------------cgggcc---tggct-----tggg-----ggtccct
             Elephant  gctc---------gcc----------------------------tggctggggctgag-----gctcctc
              Manatee  gcgc---------gcc----------------------------tggct-ggtctgag-----ggtcct-
            Armadillo  gcgg---------acc----------------------------cgcct-gcggtagg-----ggtttcc
             Platypus  catc---------cct-----------------ccc-----------------ccgga-----ggcaccg
              Tarsier  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
               Alpaca  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
           Rock hyrax  ======================================================================

                Mouse  ----g-t----------------a------gct-------ggctccg
                  Rat  ----g-c----------------ag-----gct-------gactctg
         Kangaroo rat  ----g-c----------------ctaggtcttc-------tactcca
       Naked mole-rat  ----g-t----------------gg-----gct-------gtctcct
           Guinea pig  ----g-caacctgtgtgtgtgtagg-----ggg-------gtctctt
             Squirrel  ----g-c----------------gg-----gct-------gactccc
               Rabbit  gcggg-c----------------ta-----tcc-------ttccaac
                 Pika  ----g-c----------------tc-----tcc-------gcccaac
                Human  ----g-a----------------gg-----gct-------gtctcca
                Chimp  ----g-a----------------gg-----gct-------gtctcta
              Gorilla  ----g-a----------------gg-----gct-------gtctcca
            Orangutan  ----g-a----------------gg-----gct-------gtctcca
               Gibbon  ----g-a----------------gg-----gct-------gtctcca
               Rhesus  ----g-a----------------ag-----gct-------gtctccc
               Baboon  ----g-a----------------ag-----gct-------gtctccc
             Marmoset  ----gaa----------------gg-----gct-------gtctcca
      Squirrel monkey  ----g-a----------------gg-----gct-------gtctcca
          Mouse lemur  ----g-c----------------gg-----gct-------gtctcc-
             Bushbaby  ----g-c----------------ag-----gct-------gtcttc-
                  Pig  ----t-c----------------tg-----gct-------gtctct-
              Dolphin  ----g-c----------------gg-----gct-------gtttct-
                Sheep  ----g-c----------------ag-----gcg-------gtctct-
                  Cow  ----g-c----------------ag-----gcg-------gtctct-
                  Cat  ----g-c----------------gg-----tct-------gtctct-
                  Dog  ----g-c----------------ag-----tct------cgtccct-
                Panda  ----g-t----------------gg-----tct-------gtctct-
                Horse  ----g-c----------------gg-----gca-------gcctct-
     Little brown bat  ----g-a----------------gg-----gct-------gtctct-
              Megabat  ----g-a----------------ga-----gc---------tctct-
             Hedgehog  ----g-t----------------gg-----gctggcgggggctccc-
             Elephant  ----g-c----------------gc-----gct-------gtctct-
              Manatee  ------c----------------gc-----gct-------gtctct-
            Armadillo  ----g-c----------------gg-----gct-------gga-ca-
             Platypus  ----g-t----------------gg-----at---------------
              Tarsier  ===============================================
               Tenrec  ===============================================
              Wallaby  ===============================================
               Alpaca  ===============================================
                 Fugu  ===============================================
         Atlantic cod  ===============================================
         Nile tilapia  ===============================================
            Zebrafish  ===============================================
        X. tropicalis  ===============================================
               Turkey  ===============================================
           Coelacanth  ===============================================
      Tasmanian devil  ===============================================
              Opossum  ===============================================
               Lizard  ===============================================
           Budgerigar  ===============================================
          Zebra finch  ===============================================
              Chicken  ===============================================
       Painted turtle  ===============================================
                Shrew  ===============================================
                Sloth  ===============================================
           Rock hyrax  ===============================================

Alignment block 2 of 730 in window, 56691848 - 56691868, 21 bps 
B D             Mouse  tcctcagccccca-------gt---------gcttgt-
B D               Rat  tcctcagtcccca-------gt---------ggctat-
B D      Kangaroo rat  gcccccccccccattttgcttt---------agctgc-
B D    Naked mole-rat  tccccagctcccc-------gt---------ggtggt-
B D        Guinea pig  tcttcagctcccc-------gc---------gttggt-
B D          Squirrel  ttcttagcaccta-------at---------gtttgt-
B D            Rabbit  ctccccg-gcccc-------gc---------gatcgt-
B D              Pika  ctccctgcgctgg-------gc---------aattga-
B D             Human  tccccaat-cccc-------gc---------gactgc-
B D             Chimp  tccccaat-cccc-------gc---------gactgc-
B D           Gorilla  tctccaat-cccc-------gc---------gactgc-
B D         Orangutan  tccccaat-cccc-------gc---------gactgc-
B D            Gibbon  tccccaat-cccc-------gc---------gactgc-
B D            Rhesus  tccccaat-cccc-------ga---------gactgc-
B D            Baboon  tccccaat-cccc-------ga---------gactgc-
B D          Marmoset  ttcccaatccccc-------gc---------tactgc-
B D   Squirrel monkey  tccctgatccccc-------gc---------tactgc-
B D           Tarsier  tcccccttcccct-------ga---------ggttgt-
B D       Mouse lemur  ttctcaatacccc-------ga---------ggttgt-
B D          Bushbaby  tcctctatcccgg-------gc---------cattct-
B D               Pig  ---------------------------------ttct-
B D           Dolphin  ---cccacaccgc-------ct---------ggctct-
B D             Sheep  ---cccacacccc-------ct---------ggctct-
B D               Cow  ---cccacacccc-------ct---------ggctct-
B D               Cat  ---ccttcacccc-------ag---------aaattt-
B D               Dog  ---ccctcacccc-------aa---------agcttt-
B D             Panda  ---ctctccccca-------aa---------agcgtt-
B D             Horse  ---cccctatccc-------ag---------ggctct-
  D  Little brown bat  ---ttctcacc-c-------tt---------ggccct-
B D           Megabat  ---tcctcaccgc-------at---------ggcttt-
B D          Hedgehog  ---ccaccccctc-------cc---------agctct-
B D          Elephant  tccccagcccctt-------gcta-------cgctgt-
B D           Manatee  tccccagccgggt-------gcta-------ggctgt-
B D         Armadillo  ccaccagcccact-------cccagcgccgcggcggc-
B D          Platypus  -tccggaggcccc-------gg---------gacgagt
B D            Tenrec  ======================================
B D           Wallaby  ======================================
B D            Alpaca  ======================================
B D              Fugu  ======================================
B D      Atlantic cod  ======================================
B D      Nile tilapia  ======================================
B D         Zebrafish  ======================================
B D     X. tropicalis  ======================================
B D            Turkey  ======================================
B D        Coelacanth  ======================================
B D   Tasmanian devil  ======================================
B D           Opossum  ======================================
B D            Lizard  ======================================
B D        Budgerigar  ======================================
B D       Zebra finch  ======================================
B D           Chicken  ======================================
B D    Painted turtle  ======================================
B D             Shrew  ======================================
B D             Sloth  ======================================
B D        Rock hyrax  ======================================

Inserts between block 2 and 3 in window
B D         Platypus 23bp

Alignment block 3 of 730 in window, 56691869 - 56691885, 17 bps 
B D             Mouse  ttct-tcta---gctg---cag-cc--
B D               Rat  ttctatcca---gctg---ctg-cc--
B D      Kangaroo rat  tgcc-ttta---gcgg---cgg-ct--
B D    Naked mole-rat  ttgc-ttta---gcct---ctg-tc--
B D        Guinea pig  tcgc-ttta---gcct---tgg-cc--
B D          Squirrel  tccc-tttg---gtggtcccag-ct--
B D            Rabbit  gccc-cttaggtgccg---ccg-tc--
B D              Pika  atcc-ttcg---gccg---ctg-tg--
B D             Human  tcct-ttta---gccg---cca-tc--
B D             Chimp  tcct-ttta---gccg---cca-tc--
B D           Gorilla  tcct-ttta---gccg---cca-tc--
B D         Orangutan  tcct-ttta---gccg---cca-tc--
B D            Gibbon  tcct-tttg---gccg---ccg-cc--
B D            Rhesus  tcct-ttta---gcgg---ccg-cc--
B D            Baboon  tcct-ttta---gcgg---ccg-cc--
B D          Marmoset  acca-ttta---gcca---cgc-cc--
B D   Squirrel monkey  accc-ttta---gccc---ccg-ac--
B D           Tarsier  ttcc-ttca---gccc---cc------
B D       Mouse lemur  tccc-cgta---gccg---ccg-cc--
B D          Bushbaby  tccc-ttta---gccg---ctg-tt--
B D               Pig  tctc-tcta---gcag---ct------
B D           Dolphin  tccc-tgta---gccg---ccg-cc--
B D             Sheep  tccc-tcta---gccg---ccg-cc--
B D               Cow  tctc-tcta---gccg---ctg-cc--
B D               Cat  ccgc-tgtg---gcca---cct-ct--
B D               Dog  tccc-tcta---gccg---ccg-cc--
B D             Panda  tccc-tcta---gccg---ccg-cc--
B D             Horse  ttcc-t-tg---gccg---ccg-cc--
  D  Little brown bat  tccc-tcta---ccca---ccg-cc--
B D           Megabat  tccc-tcta---gctg---cct-cc--
B D          Hedgehog  tctc-tctg------------------
B D          Elephant  tcct-tt-----gccg---ctg-cccc
B D           Manatee  tcct-tt-----gccg---ctg-cccc
B D         Armadillo  tccg-ttta---gcca---cagccccc
B D            Tenrec  ===========================
B D           Wallaby  ===========================
B D            Alpaca  ===========================
B D              Fugu  ===========================
B D      Atlantic cod  ===========================
B D      Nile tilapia  ===========================
B D         Zebrafish  ===========================
B D     X. tropicalis  ===========================
B D          Platypus  ===========================
B D            Turkey  ===========================
B D        Coelacanth  ===========================
B D   Tasmanian devil  ===========================
B D           Opossum  ===========================
B D            Lizard  ===========================
B D        Budgerigar  ===========================
B D       Zebra finch  ===========================
B D           Chicken  ===========================
B D    Painted turtle  ===========================
B D             Shrew  ===========================
B D             Sloth  ===========================
B D        Rock hyrax  ===========================

Inserts between block 3 and 4 in window
B D            Human 3bp
B D            Chimp 3bp
B D          Gorilla 3bp
B D        Orangutan 3bp
B D           Gibbon 3bp
B D           Rhesus 3bp
B D           Baboon 3bp
B D         Marmoset 407bp
B D  Squirrel monkey 2bp
B D              Pig 9bp
B D          Dolphin 9bp
B D            Sheep 9bp
B D              Cow 9bp
B D              Cat 9bp
B D              Dog 8bp
B D            Panda 8bp
B D            Horse 9bp
  D Little brown bat 27bp
B D          Megabat 9bp
B D         Hedgehog 6bp

Alignment block 4 of 730 in window, 56691886 - 56691902, 17 bps 
B D             Mouse  a----cccgcc----------------gct-tgggaca
B D               Rat  a----cccgcg----------------tct-tgggcca
B D      Kangaroo rat  c----cccgcg----------------tcgatggggca
B D    Naked mole-rat  cttg-cctggg----------------gct-tccggag
B D        Guinea pig  cctg-cctgag----------------gct-tcaggag
B D          Squirrel  ttggacccgca----------------gct-ccaagca
B D            Rabbit  t----cttgcg----------------gcg-tcacccg
B D              Pika  t----ccgccg----------------gct-ccacgcg
B D             Human  ----tcccgca----------------gcg-cagatc-
B D             Chimp  ----tcccgca----------------gcg-cagatc-
B D           Gorilla  ----acccgca----------------gcg-cagatc-
B D         Orangutan  ----tcccgca----------------gcg-cagatc-
B D            Gibbon  ----tcccgca----------------gcg-cagatc-
B D            Rhesus  ----tcccgca----------------gcg-aagatc-
B D            Baboon  ----tcccgca----------------gcg-aagatc-
B D   Squirrel monkey  ----ttccgcg----------------gcg-cagatt-
B D           Tarsier  ----gcccgcag--------ctccac-gcg-cagatc-
B D       Mouse lemur  -----cccgccctcccgcagctccac-gcg-aagatc-
B D          Bushbaby  -----cccgccc--------------------------
B D               Pig  ----agtcgcg--------gctccac-gca-taggtt-
B D           Dolphin  ----gcccgcg--------gctccac-gcg-cagata-
B D             Sheep  ----gcccgcg--------gtcccgg-gct-cagata-
B D               Cow  ----gcccgcg--------gtccccg-gcg-cagata-
B D               Cat  ----gcccgct--------gcttcac-gcg-cagatc-
B D               Dog  ----acccgcg--------gctctacggcg-cagatc-
B D             Panda  ----gcccgcg--------gctccac-gcg-cagatc-
B D             Horse  ----gcccgtg--------gctcccc-gcg-caggtc-
  D  Little brown bat  ----gcccgcg--------gctccaa-gtg-cagatc-
B D           Megabat  ----gcccgcc--------tttctaa-gcg-cagatc-
B D          Hedgehog  ----gcctgtg--------gcttcat-gcg-cccacg-
B D          Elephant  ----gcccgcg--------gctccac-gcg-ccagtc-
B D           Manatee  ----gcccgca--------gttccac-gcg-ctggtc-
B D         Armadillo  ----gcccgcg--------gctcc-c-gca-gcagat-
B D          Marmoset  ======================================
B D            Tenrec  ======================================
B D           Wallaby  ======================================
B D            Alpaca  ======================================
B D              Fugu  ======================================
B D      Atlantic cod  ======================================
B D      Nile tilapia  ======================================
B D         Zebrafish  ======================================
B D     X. tropicalis  ======================================
B D          Platypus  ======================================
B D            Turkey  ======================================
B D        Coelacanth  ======================================
B D   Tasmanian devil  ======================================
B D           Opossum  ======================================
B D            Lizard  ======================================
B D        Budgerigar  ======================================
B D       Zebra finch  ======================================
B D           Chicken  ======================================
B D    Painted turtle  ======================================
B D             Shrew  ======================================
B D             Sloth  ======================================
B D        Rock hyrax  ======================================

Alignment block 5 of 730 in window, 56691903 - 56692029, 127 bps 
B D             Mouse  tagagttgc--tgggc--ga--gcctt--ctt-gggtgaacctggc---ct-ggct-------------g
B D               Rat  tagatttgc--taggc--ga--gcctt--cttagggtgaacctggc---ct-ggcc-------------g
B D      Kangaroo rat  ggggaggg----aggg--ca--gccgt--cca-gagtggaccctcc---ct-ggccttgaactcaagcag
B D    Naked mole-rat  ctgctcagc--tgggc--aa--gcagt--cca-gggtagacacgtc---ct-ggcc-------------t
B D        Guinea pig  ctgatcggctttgggc--ga--gcagc--cca-ggggggacccatt---ct-ggcc-------------t
B D          Squirrel  cggatctgc--ctgga-------------cta-gggtggacccctt---ctaggcc-------------t
B D            Rabbit  cagatctgg--caggtc-ca--gcagc--cct-gggtggacgctcc---cg-tgcc-------------t
B D              Pika  cagatctgg--cggctcaaa--gcagc--ctt-gagtggactctcc---ca-ggcc-------------t
B D             Human  -----ctgc-aggggc--ca--gcggt--cca-gggcggaccctcc---ct-cgcc-------------c
B D             Chimp  -----ctgc-aggggc--ca--gcggt--cca-gggcggaccctcc---ct-cgcc-------------c
B D           Gorilla  -----ctgc-aggggc--ca--gcggt--cca-gggcggaccctcc---ct-cgcc-------------c
B D         Orangutan  -----ctgc--tgggc--ca--gcggt--cca-gggcggaccctcc---ct-cgcc-------------c
B D            Gibbon  -----ctgc--aaggc--ca--gcggt--cca-gggcggaccctcc---ca-ctcc-------------c
B D            Rhesus  -----ctgc--agggc--ca--gcggt--cct-gggcggaccctcc---ct-ctcc-------------c
B D            Baboon  -----ctgc--agggc--ca--gcggt--cct-gggcggaccctcc---ct-ctcc-------------c
B D   Squirrel monkey  -----ctgc--agggc--ca--gcggt--cca-gggaggacccacc---ct-cgcc-------------c
B D           Tarsier  -----cggc--ggggc--ca--gcagt--cca-gggtgaaccctcc---ct-cgcc-------------t
B D       Mouse lemur  -----cggc--ctggc--ca--gcagt--cga-ggggggacccttc---ct-cgtc-------------g
B D          Bushbaby  -------gc--gcggc--cc--gcagt--cta-ggggggaccctcc---ct-tgcc-------------t
B D               Pig  -----gggt--ccatc--cc--tcagc--tca-tggtgga-----c---ct-ctcc-------------t
B D           Dolphin  -----gagt--ccagc--cc--gcagc--tca-gggtggaccttcc---ct-ctct-------------t
B D             Sheep  -----gggt--ccagc--cc--gcggc--cca-gggtggaccctcc---ct-ctcc-------------t
B D               Cow  -----gggt--ccagc--cc--gcggc--cct-gggtggaccctcc---ct-ctcc-------------t
B D               Cat  -----ccgc--ctggc--cc--acagc--tca-gcgtggaccctcc---ct-cgcc-------------t
B D               Dog  -----ccgc--ctggc--cc--gcagc--tca-gggtgga-cctcc---ct-ggcc-------------t
B D             Panda  -----ccgc--ctggc--cc--gcaac--tca-gggtgga-cctcc---ct-cgcc-------------t
B D             Horse  -----cggc--c-ggc--cc--gcagc--tca-gggtggaccctcc---ct-ggcc-------------t
  D  Little brown bat  -----c-gc--ccggc--tt---cagc--tca-ggatggatcct-c---gt-cgcc-------------t
B D           Megabat  -----c-gc--ccggc--tt---caac--tca-gagtggaccctcc---ct-cgcc-------------t
B D          Hedgehog  -----gggc--atgac--ccccgcagcggccc-gggtgggtcactt---ct-cgcc-------------t
B D          Elephant  -----gcgc--cgggc--gg--ccggc--cgg-tggaggatcctcc---ct-ggcc-------------t
B D           Manatee  -----gcgc--ggggc--tg--gcagc--cca-tggagtaccctcc---ct-ggcc-------------t
B D         Armadillo  -----ccgc--ccggc--gc--accgc--ctc-gggcggaccctcc---ct-cgcc-------------c
B D          Platypus  -----taga--attgc--tc--cctgc--ctg-gggt-----ctccaagct-aagc-------------g
B D          Marmoset  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D            Alpaca  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D        Rock hyrax  ======================================================================

                Mouse  ----tggttgcggggcgc----------gccggttgcc-ctgacactttc------tggggagcttagtt
                  Rat  ----tgagtgacagacgc----------gccggttgcc-ctgacacttac------tggggagcttag-c
         Kangaroo rat  ----ggggggaggggtgc--ttctagctgccacttgac-ccggcactcgc------tgggaggcgcag-a
       Naked mole-rat  ----tggacgtggggtgcgcttctggctgccacttgcctccacgattgac------cggag-gcaccg-t
           Guinea pig  ----tgagcacggggcacacttctggctgccacttgcc-acgcgactgac------ctga--gcacct-t
             Squirrel  ----tgggcacggggcacgcttctggctgcc-cctgtt-gcagcagttgc------tacgaggtgcag-t
               Rabbit  ----tgggctcggggcgcgcttccggttgccacttgcg-gcgacagtcgc------tgggaggaacag-c
                 Pika  ----cgggctccggccgctcttccgactgccactcgcg-gggacagtcgc------gggaaggagcag-c
                Human  ----tgggcgcggggcgagcttctggctgtcacttgcc-gctgcagtttc------agggaaactcag-c
                Chimp  ----tgggcgcggggcgagcttctggctgtcacttgcc-gctgcagtttc------agggaaactcag-c
              Gorilla  ----tgggcgcggggcgagcttctggctgtcacttgcc-gctgcagtttc------agggaaactcag-c
            Orangutan  ----tgggcgcggggcgagcttctggctgtcacttgcc-gctgcagtttc------tgggaaactcag-c
               Gibbon  ----tgggagccgggcgagcttctggctgtcacttgcc-gctgcagtttc------tgggaaactcag-c
               Rhesus  ----cgggcgcgggaagagcttctggctgtcacttgcc-gctgcagtttc------tgggaaactcag-t
               Baboon  cgggcgggcgcggggcgagcttctggctgtcacttgcc-gctgcagtttc------tgggaaactcag-t
      Squirrel monkey  ----cgggcgccgggcactcttccggctgtcacttgca-gctgtagtttc------tgggaaactcag-t
              Tarsier  ----tgggcgcggggcgcccttccggctaccacttgcc-gccgcagtcgc------tggggagcccag-t
          Mouse lemur  ----tggacgcgggtctcgcttccggctgccacttgcg-gc-gcagttgc------tgggg-tcccag-t
             Bushbaby  ----ttggctcagggtgcactt-aggatgccacttgcg-gc-gccgttgcggggggtgggg-gggcac-t
                  Pig  ----tagacacct-gtacacttcaggctgccgcgtgcg-gcagaagaagc------tgggaggacgag-t
              Dolphin  ----taggcaccgggtgcgcctccggctgccacgtgct-acagcagacgc------tgggaggtccag-t
                Sheep  ----taagcacccggtgcgcttccggctgccacgtgcg-gcagcagacac------tgggaggtccag-t
                  Cow  ----taggcaccgggtgcgcttccggctgccacgtgcg-gcagcagacac------tgggaggtccag-t
                  Cat  ----taggcacggggtgcgcttccggctgccacgtgcc-gcagcaggcgc------ggggaggtcgag-g
                  Dog  ----cgggcacagggcgcgcttccggctgccacgtgcc-gcagcaggcgc------tgggaggtcgag-t
                Panda  ----tgggcgcagggtgcgcttccggctgccacgtgcc-gcagcaggccc------tgggaggtcgag-t
                Horse  ----agggcacggggtgcgcttcaggctgccacgtgcg-gccgcggtcgc------caagaggtcgag-t
     Little brown bat  ----tggggacccggtgcgctgcgggctgccac-tgcg-gcagcagtcgc------tagaaggtcaag-a
              Megabat  ----tgggcaccgggtgcactgttagctgccacgtgcg-gcagcagacgc------tgggaggtccag-a
             Hedgehog  ----ggggcacggggcgcgctgcctgctgccacgtgcg-gccgcgctggc------cgggaggccgag-t
             Elephant  ----tgggcgcgggatgcgcttccggctgccacgtgcg-gcggtagtcgc------tgggagaccgag-t
              Manatee  ----tgggcgcggggcgcgcttccggctgccacgtgcg-gccgtggtagc------tgggaggccgag-t
            Armadillo  ----tgggcta-----gcgcttctggctgccgagtgcg-gcggcagtt-c------tgggagaccccg-a
             Platypus  ----tggccgggacccacgcttct-gctatcaccttgc-tctgca-----------gaggaggttcgt-t
             Marmoset  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
               Alpaca  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
           Rock hyrax  ======================================================================

                Mouse  gggtgcgctga-------aca-------ctgaccctgcaaggctgggc
                  Rat  gggtgtgctga-------gc--------caggccctgcaaggttgggc
         Kangaroo rat  ggg------ga-------gga-------ctgatctgggggggcttggc
       Naked mole-rat  gggcg----ga-------ggagccaccgttgaccccgctaga------
           Guinea pig  gggcg----ga-------ggagccaccgttgactccgagagg------
             Squirrel  gggca----ga-------ggaaccgatgctgaccgtgtgaagcagggc
               Rabbit  gggcg----gg-------ggagcggtctccgaccgtggcaggccgagt
                 Pika  gggcg----ga-------gaagcggcctctgaccccggcaggccgggt
                Human  tggcc----g------------------cttaccctgcaagacgggga
                Chimp  tggcc----g------------------cttaccctgcaagacgggga
              Gorilla  tggcc----g------------------cttaccctgcaagacgggga
            Orangutan  tggcc----g------------------cttaccctgcaagacgggga
               Gibbon  tggcc----g------------------cttactctgcaagacgggga
               Rhesus  tggcc----c------------------cttaccctgcaagacgggga
               Baboon  tggcc----g------------------cttaccctgcaagacgggga
      Squirrel monkey  tggcc----g------------------cttactctgcaagaacagga
              Tarsier  gggct----g------------------ctgaccctgcgacactggga
          Mouse lemur  gggcc----g------------------ctgaccctgcgagacctggg
             Bushbaby  gggcc----g------------------ctga-cttgcaggg------
                  Pig  -ggtg----ga-------ggggtagtcgctgaccctaccaagccagaa
              Dolphin  gggca----g--------ggggctgacgctgaccctaccgggccggga
                Sheep  gggcg----ga-------ggggcggccgctgaccctacc-ggccggaa
                  Cow  gggcg----ga-------ggggcggccgctgaccccaccaggccgaaa
                  Cat  gggcg----ga-------ggagctgccgctgaccccgtgtggccggga
                  Dog  aggcg----ga-------ggagcggccgctgaccccgagtggccggga
                Panda  aggcg----ga-------ggagcggccgctgaccccgagtggcccgga
                Horse  gggcg----ga-------ggagcggccgctca-cctgcgaggccggga
     Little brown bat  tgggg----ga-------ggaggggccgctgaccgtgcgaggcccaga
              Megabat  gggcg----ga-------agagcggccgctgaccctgcgaggccggga
             Hedgehog  gggcg----gaggacgcgggagcgg-cgctgaccctgcagggccgggc
             Elephant  gggcg----ga-------ggagcggccggtggccctgcgaagccagag
              Manatee  gggcg----ga-------ggagcggccgctgaccctgcgaagccaggg
            Armadillo  gggcg----aa-------ggagcggccgcggaccctgcgaggctgggg
             Platypus  gcgca----tg-------gaatcagatcgcgcctctgccatgttctgt
             Marmoset  ================================================
               Tenrec  ================================================
              Wallaby  ================================================
               Alpaca  ================================================
                 Fugu  ================================================
         Atlantic cod  ================================================
         Nile tilapia  ================================================
            Zebrafish  ================================================
        X. tropicalis  ================================================
               Turkey  ================================================
           Coelacanth  ================================================
      Tasmanian devil  ================================================
              Opossum  ================================================
               Lizard  ================================================
           Budgerigar  ================================================
          Zebra finch  ================================================
              Chicken  ================================================
       Painted turtle  ================================================
                Shrew  ================================================
                Sloth  ================================================
           Rock hyrax  ================================================

Inserts between block 5 and 6 in window
B D         Hedgehog 2410bp

Alignment block 6 of 730 in window, 56692030 - 56692035, 6 bps 
B D             Mouse  cctaac
B D               Rat  cctaat
B D      Kangaroo rat  ctcggc
B D          Squirrel  cttcgc
B D            Rabbit  cctagc
B D              Pika  cacagc
B D             Human  catagc
B D             Chimp  catagc
B D           Gorilla  catagc
B D         Orangutan  catagc
B D            Gibbon  catagc
B D            Rhesus  catagc
B D            Baboon  catagc
B D   Squirrel monkey  cacagc
B D           Tarsier  caccgt
B D       Mouse lemur  catagc
B D          Bushbaby  ---agc
B D               Pig  tgtagt
B D           Dolphin  cttagc
B D             Sheep  cgtagc
B D               Cow  cgtagc
B D               Cat  cagagc
B D               Dog  cggagc
B D             Panda  cagagc
B D             Horse  cacagc
  D  Little brown bat  cctagc
B D           Megabat  catagc
B D          Elephant  cccggc
B D           Manatee  cctggc
B D         Armadillo  cgcggc
B D          Platypus  ccc---
B D        Guinea pig  ------
B D          Marmoset  ======
B D    Naked mole-rat  ------
B D            Tenrec  ======
B D           Wallaby  ======
B D            Alpaca  ======
B D              Fugu  ======
B D      Atlantic cod  ======
B D      Nile tilapia  ======
B D         Zebrafish  ======
B D     X. tropicalis  ======
B D            Turkey  ======
B D        Coelacanth  ======
B D   Tasmanian devil  ======
B D           Opossum  ======
B D            Lizard  ======
B D        Budgerigar  ======
B D       Zebra finch  ======
B D           Chicken  ======
B D    Painted turtle  ======
B D             Shrew  ======
B D             Sloth  ======
B D          Hedgehog  ======
B D        Rock hyrax  ======

Inserts between block 6 and 7 in window
B D              Pig 27bp
B D          Dolphin 39bp
B D            Sheep 39bp
B D              Cow 39bp
B D              Cat 4bp
B D              Dog 4bp
B D            Panda 4bp
B D            Horse 4bp
  D Little brown bat 4bp
B D          Megabat 1252bp
B D         Elephant 46bp
B D          Manatee 47bp
B D        Armadillo 47bp

Alignment block 7 of 730 in window, 56692036 - 56692101, 66 bps 
B D             Mouse  ------tgggaggc-ca------------gatccgaa---t---gagtctagttgct-------------
B D               Rat  ------tgggcggc-ca------------gatccgaa---g---gagcctagttgct-------------
B D      Kangaroo rat  ------cgtgagcc-ct------------ggtctgga---g---atgtctggttctc-------------
B D    Naked mole-rat  -----------gcc-ca------------ggtctgga---g---acgccgggcctcc-------------
B D        Guinea pig  -----------gcc-ca------------gttctgga---g---aggcccggtctcc-------------
B D          Squirrel  ------tgtgggcc-ca------------ggtctaga---a---aagccggaactct-------------
B D            Rabbit  ------agtgggca-ga------------ggtctgca---g---cagcagagccttt-------------
B D              Pika  ------ggtgggtg-ga------------gggctgcc---g---aagccgagcctct-------------
B D             Human  ------agagggcc-ga------------gttctgga---g---aagctgggcttgt-------------
B D             Chimp  ------agagggcc-ga------------gttctgaa---g---aagctgggcttgt-------------
B D           Gorilla  ------agagggcc-ga------------gttctgga---g---aagctgggcctgt-------------
B D         Orangutan  ------agagggcc-ga------------gttctgga---g---gagctgggcctgt-------------
B D            Gibbon  ------agagggcc-ga------------gttctgga---g---aagctgggct----------------
B D            Rhesus  ------agcgggccaga------------gttctgga---g---aagctgggcctgt-------------
B D            Baboon  ------agcgggccaga------------gttctgga---g---aagctgggcctgt-------------
B D   Squirrel monkey  ------agcggccc-ga------------gttctgga---g---aaggtgggcctgt-------------
B D           Tarsier  ------actgggcc-ga------------ggtctgga---g---aagctgggcc----------------
B D       Mouse lemur  ------agtgggcc-ga------------gttctgga---g---aagct-ggcctcc-------------
B D          Bushbaby  ------ggtgggac-ca------------gggcggaa---c---aagctgggtctct-------------
B D               Pig  ------ggcagcgt-agt---------ttagagaggaat-g---aagtccggcccct-------------
B D           Dolphin  ------ggcagcgc-ggt---------ttggcgaggact-ggagaagcctggcctct-------------
B D             Sheep  ------ggcagcgc-agt---------ttggtgaggacc-g---aagtccggcctct-------------
B D               Cow  ------ggcagcgc-agt---------ttggcgaggacc-gcacaagtccggcctcc-------------
B D               Cat  ------ggcaggtc-gg------------ggttggaacccg---tggcccaggcgtt-------------
B D               Dog  ------ggcaggtc-gg------------ggctggaacccg---tggcccgggcg---------------
B D             Panda  ------ggcagatc-gg------------ggttggaacctg---tggcccgggcgtt-------------
B D             Horse  ------ggccgatc-cg------------gattggcacc-g---cggcccgagcttcgg-agcgc-----
  D  Little brown bat  ------ggcggatc-gg------------gattgaaaccca---tggctcaggcgttggcaacacagttt
B D          Elephant  ------ggtttcct-ga------------ggtctgga---g---tagccaggcc--t-------------
B D           Manatee  ------ggtttggt-ga------------gatctgga---g---aagccgggcc--t-------------
B D         Armadillo  ------tgttccgc-gg------------cgtctaga---g---aagcctg-----t-------------
B D          Platypus  tgccctgtcggacc-cgtccacccctctgaccctgcc---a---ttgctcagtc----------------
B D          Marmoset  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D            Alpaca  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D          Hedgehog  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Megabat  ======================================================================

                Mouse  ---------------------------------------------------tttt--ttttaaagtcaag
                  Rat  ---------------------------------------------------tttt--------aggcaag
         Kangaroo rat  ---------------------------------------------------ttct---------------
       Naked mole-rat  ---------------------------------------------------acac--------ag-----
           Guinea pig  ---------------------------------------------------aagc--------ag-----
             Squirrel  ---------------------------------------------------cccc--cccccccgccccg
               Rabbit  ---------------------------------------------------tttc--tctctgcgccgct
                 Pika  ---------------------------------------------------tttc--catttgcgccgat
                Human  ---------------------------------------------------tttt-ctctctgcaccgcg
                Chimp  ---------------------------------------------------tttt-ctctctgcaccgcg
              Gorilla  ---------------------------------------------------tttt-ctctctgcaccgcg
            Orangutan  ---------------------------------------------------tttt-ctctctgcaccgcg
               Gibbon  ----------------------------------------------------------------------
               Rhesus  ---------------------------------------------------tttt-ctctctgcacagcg
               Baboon  ---------------------------------------------------tttt-ctctctgcaccgcg
      Squirrel monkey  ---------------------------------------------------tttt-ctctctgcgccgca
              Tarsier  ---------------------------------------------------------tctctacgccgcg
          Mouse lemur  ---------------------------------------------------tttc-ctctctatggcgag
             Bushbaby  ---------------------------------------------------tttt-ttctccatgcctac
                  Pig  ---------------------------------------------------tatt-ctctccacgccgcg
              Dolphin  ---------------------------------------------------ttttcctctctacgcggcg
                Sheep  ---------------------------------------------------tttt-ctctctacgaggcg
                  Cow  ---------------------------------------------------tttt-ctctctacgaggcg
                  Cat  ---------------------------------------------------------------agcagcg
                  Dog  ----------------------------------------------------------------gtagcg
                Panda  ---------------------------------------------------------------cgccgct
                Horse  --------------gctttggctcggactggaga-------agcccggcctcttt-ctctccacgccgcg
     Little brown bat  ggagaggaatggagacatcggcgctctctctctctctctctctctccctccctcc-ctccctacgccgcg
             Elephant  ---------------------------------------------------tttg-ctgtctacgacgcg
              Manatee  ---------------------------------------------------cttg-ctgtctatgccacg
            Armadillo  ---------------------------------------------------tttc-ctctcaacaccgcg
             Platypus  ---------------------------------------------------ctgt-cccgccctgcccag
             Marmoset  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
               Alpaca  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
             Hedgehog  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================

                Mouse  --------tg-------------------------------------------------------caat-
                  Rat  --------tg-------------------------------------------------------caga-
         Kangaroo rat  ----------------------------------------------------------------------
       Naked mole-rat  ----------------------------------------------------------------------
           Guinea pig  ----------------------------------------------------------------------
             Squirrel  cgcctcaccg-------------------------------------------------------caat-
               Rabbit  --------gg-------------------------------------------------------caat-
                 Pika  -------ggg-------------------------------------------------------caat-
                Human  --------cg-------------------------------------------------------caat-
                Chimp  --------cg-------------------------------------------------------caat-
              Gorilla  --------cg-------------------------------------------------------cgat-
            Orangutan  --------cg-------------------------------------------------------caac-
               Gibbon  ----------------------------------------------------------------------
               Rhesus  --------cg-------------------------------------------------------caat-
               Baboon  --------cg-------------------------------------------------------caat-
      Squirrel monkey  --------cg-------------------------------------------------------caat-
              Tarsier  --------cg-------------------------------------------------------aaac-
          Mouse lemur  --------cg-------------------------------------------------------caat-
             Bushbaby  --------ag-------------------------------------------------------taat-
                  Pig  --------cg-------------------------------------------------------caat-
              Dolphin  --------cg-------------------------------------------------------caat-
                Sheep  --------tg-------------------------------------------------------caat-
                  Cow  --------tg-------------------------------------------------------caat-
                  Cat  --------ca------------------------------------------------------------
                  Dog  --------ca---------gtctgcagaggactgaagtccggcctcctttactctacgccgcgctcaat-
                Panda  --------ca---------gtctggtgaggactgaagtccggcctctttttctctacgccgcgctccat-
                Horse  --------cgcaatccttcacttact--------------------------------------------
     Little brown bat  --------cg-------------------------------------------------------caat-
             Elephant  --------cg-------------------------------------------------------caag-
              Manatee  --------cg-------------------------------------------------------caag-
            Armadillo  --------cg-------------------------------------------------------aaac-
             Platypus  --------tc-------------------------------------------------------caatc
             Marmoset  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
               Alpaca  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
             Hedgehog  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================

                Mouse  -------gccacactcac
                  Rat  -------tccacatttat
         Kangaroo rat  -------------ctctg
       Naked mole-rat  ---------cccactcac
           Guinea pig  -------tctccactcaa
             Squirrel  -------cccgggttcac
               Rabbit  -------cccccactcac
                 Pika  -------gccccgcacgc
                Human  ------gccccaactgac
                Chimp  ------gccccaactgac
              Gorilla  ------gccccaactgac
            Orangutan  ------gccccaactgac
               Gibbon  ---------ccaactgac
               Rhesus  ------accccaaatcat
               Baboon  ------accccaactcat
      Squirrel monkey  ------gccccaactcac
              Tarsier  -------cccccactcac
          Mouse lemur  --------ccccactcac
             Bushbaby  --------ccccactcac
                  Pig  -------ctttcgcctac
              Dolphin  -------ccttcacttac
                Sheep  -------ccttcacttac
                  Cow  -------ccttcacttac
                  Cat  ------------------
                  Dog  -------ctttcacttac
                Panda  -------ctttcacttac
                Horse  ------------------
     Little brown bat  -------ccttgacctac
             Elephant  -------cccgcactcac
              Manatee  -------tcagcactcgc
            Armadillo  -------ctgacactctc
             Platypus  caagtccccgacgctggc
             Marmoset  ==================
               Tenrec  ==================
              Wallaby  ==================
               Alpaca  ==================
                 Fugu  ==================
         Atlantic cod  ==================
         Nile tilapia  ==================
            Zebrafish  ==================
        X. tropicalis  ==================
               Turkey  ==================
           Coelacanth  ==================
      Tasmanian devil  ==================
              Opossum  ==================
               Lizard  ==================
           Budgerigar  ==================
          Zebra finch  ==================
              Chicken  ==================
       Painted turtle  ==================
                Shrew  ==================
                Sloth  ==================
             Hedgehog  ==================
           Rock hyrax  ==================
              Megabat  ==================

Inserts between block 7 and 8 in window
B D             Pika 594bp
B D         Elephant 1bp
B D          Manatee 1bp
B D        Armadillo 1bp

Alignment block 8 of 730 in window, 56692102 - 56692180, 79 bps 
B D             Mouse  cta--acacaggcgtg-ctgt-a------------------------------ga---------------
B D               Rat  ttaacacacaggcgtg-ctgt-a------------------------------ga---------------
B D      Kangaroo rat  ctg---------cgtg-caat-------------------------------------------------
B D    Naked mole-rat  cct--acagaggcattcctccgg------------------------------gg---------------
B D        Guinea pig  ccg--gcagagtcatttctgt-g------------------------------gg---------------
B D          Squirrel  ctt-agcaatggctttcctgt-g------------------------------ag---------------
B D            Rabbit  ----------------cctct-g------------------------------aa---------------
B D             Human  ----------------cctga-a------------------------------gg---------------
B D             Chimp  ----------------cctga-a------------------------------ag---------------
B D           Gorilla  ----------------cctga-a------------------------------ag---------------
B D         Orangutan  ----------------cctga-a------------------------------ag---------------
B D            Gibbon  ----------------cctga-a------------------------------ag---------------
B D            Rhesus  ----------------cctga-a------------------------------ag---------------
B D            Baboon  ----------------cctga-a------------------------------ag---------------
B D   Squirrel monkey  ----------------cctga-a------------------------------ag---------------
B D           Tarsier  ----------------cctgg-aaggggcgctcccgtgcggcaacccaactcgag---------------
B D       Mouse lemur  ----------------cctgg-a------------------------------agaggcg------gtcc
B D          Bushbaby  ----------------cctgg-a------------------------------agagacg------ctca
B D               Pig  ----------------cctgg-a------------------------------agaggcg------ctcc
B D           Dolphin  ----------------cctgg-a------------------------------agaggca------ctcc
B D             Sheep  ----------------ca-gg-a------------------------------agaggag------ctcc
B D               Cow  ----------------ca-gc-a------------------------------agaggag------cttc
B D               Cat  ----------------------------------------------------------------------
B D               Dog  ----------------cctga-a------------------------------agaggcg------ctcc
B D             Panda  ----------------ccaga-a------------------------------agaggcg------ctcc
B D             Horse  -----------------ctgg-a------------------------------agaggag------ctcc
  D  Little brown bat  ----------------cctag-a------------------------------agacgcg------ctcc
B D          Elephant  -----------------ctcg-a------------------------------agagactcccccactcc
B D           Manatee  -----------------ctcg-a------------------------------agaaact-ccccactcc
B D         Armadillo  -----------------ctcg-a------------------------------agacacttccccattcg
B D          Platypus  ----------------------------------------------------------------------
B D          Marmoset  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D          Hedgehog  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Megabat  ======================================================================

                Mouse  ------------ggaactcaa-----------ctcgaggtccagccttt----gcctgaaaacttc----
                  Rat  ------------ggaactcga-----------cgcgaggtccagccttt----gccggaaagtttc----
         Kangaroo rat  -----------------------------------------cagcc-------actcgaaag--------
       Naked mole-rat  ------------ggaa---aa-----------gtgtcggttttcccttt----gcctaccatttgc----
           Guinea pig  ------------ggaa---aa-----------gagtccgttttgcctgt----gcccaccattttc----
             Squirrel  ------------ggaaccaga-----------g------------------------------tcc----
               Rabbit  ------------gaagactca-----------g-----gtcaggccttta---gcaagtatttttc----
                Human  --------------------------------------gtcttgccttt----actg--catttgc----
                Chimp  --------------------------------------gtcttgccttt----actg--catttgc----
              Gorilla  --------------------------------------gtcttgccttt----agtg--catttgc----
            Orangutan  --------------------------------------gtcttgccttt----actg--catttgc----
               Gibbon  --------------------------------------gtcttgccttt----actg--catttgc----
               Rhesus  --------------------------------------gtcttgccttt----actg--cgttttc----
               Baboon  --------------------------------------gtcttgccttt----actg--cgttttc----
      Squirrel monkey  --------------------------------------gtcttgacttt----actg--catgt-t----
              Tarsier  --------------------------------------gtctttccttt----accg--catttcc----
          Mouse lemur  cgt------gggggaagcgga-----------cgcgaagtcttgtcctt----atcg--cctctcc----
             Bushbaby  cgt------ggggaaaatg-------------------atcttgtcatt----atca--catttcc----
                  Pig  cgt------gggagaaccgga-----------tcggaaggcttgcctct----atcg--cgttttc----
              Dolphin  cgt------gggggaacagga-----------tcggaggtcttgcctct----acta--tattctc----
                Sheep  cgt------ggggaaacagga-----------tcggagatcttgcctct----accg--tattctc----
                  Cow  cgt------gggggaaccgga-----------tcggagatcttgccttt----accg--tattctc----
                  Cat  --------------------------------------gtgtgg--------------------------
                  Dog  ctg------gggaggaccgga-----------ttcgagatcttgtttct----acct--cattccct---
                Panda  ctt------gggagaatcgga-----------ttcgagatcttgtttct----acct--cattccct---
                Horse  cgc------cggggagccgga-----------tccgagaccttgcctct----acgg--cattccc----
     Little brown bat  ctt------gggggaaccgga-----------tgtgagatctggcctcc----accg--catcccc----
             Elephant  cgt------gggggaactggc-----------cctgaggtcttgcctgtactgactg--cttttcc----
              Manatee  cgt------gggcgaactgga-----------cctgaggtcttgcctct----accg--cgtttct----
            Armadillo  cgctctccgggaggaaccagc-----------cccaaggttttgcctct----accg--cattccc----
             Platypus  ----ctcgagggagatccgagaaacagctttttggaacggctggacgcg----gatc--cgttgtttgag
             Marmoset  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
                 Pika  ======================================================================
               Alpaca  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
             Hedgehog  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================

                Mouse  ----c-cccagacagctgcaa------gaa
                  Rat  ----c-cccagatagctgcaa------aaa
         Kangaroo rat  ---------gggcagctgctt------gga
       Naked mole-rat  ----c-cttgattgattggaa------aaa
           Guinea pig  ----a-cttgattggctggaa------gaa
             Squirrel  ----c-tcagaatggttggaa------gaa
               Rabbit  ----t-ttcccggggctggaa------gaa
                Human  ----c-cccagacggctagaa---------
                Chimp  ----c-cccagacggctagaa---------
              Gorilla  ----c-cccagacggctagaa---------
            Orangutan  ----c-cccagacggctagaa---------
               Gibbon  ----c-cccagacggctagaa---------
               Rhesus  ----t-cccagacggctagaa---------
               Baboon  ----t-cccagacggctagaa---------
      Squirrel monkey  ----t-cccagacagttagaa---------
              Tarsier  ----c-ctcagatggctggaaaaa------
          Mouse lemur  ----c-ctcagacgtctggaa---gaa---
             Bushbaby  ----c-c-------tttggga---gaa---
                  Pig  ----c-ctcagatgactggaa------aaa
              Dolphin  ----c-ctcagacgactggaa------gaa
                Sheep  ----c-ctcagacgactggaa------gaa
                  Cow  ----c-ctcagacgactggaa------gaa
                  Cat  ----------cgaggaccga----------
                  Dog  ----c-cactcgaggttggaa------gaa
                Panda  ----c-ctcacgaggctggaa------gca
                Horse  ----c-ctcggacggctggaa------gaa
     Little brown bat  ----c-cgccgacagctaaaa------gca
             Elephant  ----c-ctca--------------------
              Manatee  ----t-cgtagaccgctgaaa------gag
            Armadillo  ----cgctcgcaccgctggaa------gaa
             Platypus  caaat-ccca--------------------
             Marmoset  ==============================
               Tenrec  ==============================
              Wallaby  ==============================
                 Pika  ==============================
               Alpaca  ==============================
                 Fugu  ==============================
         Atlantic cod  ==============================
         Nile tilapia  ==============================
            Zebrafish  ==============================
        X. tropicalis  ==============================
               Turkey  ==============================
           Coelacanth  ==============================
      Tasmanian devil  ==============================
              Opossum  ==============================
               Lizard  ==============================
           Budgerigar  ==============================
          Zebra finch  ==============================
              Chicken  ==============================
       Painted turtle  ==============================
                Shrew  ==============================
                Sloth  ==============================
             Hedgehog  ==============================
           Rock hyrax  ==============================
              Megabat  ==============================

Inserts between block 8 and 9 in window
B D          Tarsier 606bp
B D              Cat 2bp

Alignment block 9 of 730 in window, 56692181 - 56692184, 4 bps 
B D             Mouse  ctca-
B D               Rat  ctca-
B D      Kangaroo rat  --ca-
B D    Naked mole-rat  gtca-
B D        Guinea pig  gtcg-
B D          Squirrel  atca-
B D            Rabbit  gtcg-
B D             Human  gtca-
B D             Chimp  gtca-
B D           Gorilla  gtca-
B D         Orangutan  gtca-
B D            Gibbon  gtca-
B D            Rhesus  gtca-
B D            Baboon  gtca-
B D   Squirrel monkey  gtca-
B D       Mouse lemur  gtca-
B D          Bushbaby  gtca-
B D               Pig  gtaa-
B D           Dolphin  ggaa-
B D             Sheep  gtaa-
B D               Cow  gtaa-
B D               Dog  gtca-
B D             Panda  gtcg-
B D             Horse  gtca-
  D  Little brown bat  ct---
B D           Manatee  gtca-
B D         Armadillo  gtca-
B D          Platypus  -ctag
B D          Elephant  -----
B D          Marmoset  =====
B D           Tarsier  =====
B D            Tenrec  =====
B D           Wallaby  =====
B D              Pika  =====
B D            Alpaca  =====
B D              Fugu  =====
B D      Atlantic cod  =====
B D      Nile tilapia  =====
B D         Zebrafish  =====
B D     X. tropicalis  =====
B D            Turkey  =====
B D        Coelacanth  =====
B D   Tasmanian devil  =====
B D           Opossum  =====
B D            Lizard  =====
B D        Budgerigar  =====
B D       Zebra finch  =====
B D           Chicken  =====
B D    Painted turtle  =====
B D             Shrew  =====
B D             Sloth  =====
B D               Cat  =====
B D          Hedgehog  =====
B D        Rock hyrax  =====
B D           Megabat  =====

Inserts between block 9 and 10 in window
B D          Manatee 16bp

Alignment block 10 of 730 in window, 56692185 - 56692185, 1 bps 
B D             Mouse  c
B D               Rat  c
B D      Kangaroo rat  g
B D    Naked mole-rat  c
B D        Guinea pig  c
B D          Squirrel  c
B D            Rabbit  c
B D             Human  a
B D             Chimp  a
B D           Gorilla  a
B D         Orangutan  a
B D            Gibbon  a
B D            Rhesus  a
B D            Baboon  a
B D   Squirrel monkey  a
B D       Mouse lemur  a
B D          Bushbaby  t
B D               Pig  c
B D             Sheep  c
B D               Cow  c
B D               Dog  c
B D             Panda  c
B D             Horse  c
B D         Armadillo  c
B D          Platypus  c
B D          Elephant  -
B D           Manatee  =
B D          Marmoset  =
B D           Tarsier  =
B D            Tenrec  =
B D           Wallaby  =
B D              Pika  =
B D            Alpaca  =
B D              Fugu  =
B D      Atlantic cod  =
B D      Nile tilapia  =
B D         Zebrafish  =
B D     X. tropicalis  =
B D            Turkey  =
B D        Coelacanth  =
B D   Tasmanian devil  =
B D           Opossum  =
B D            Lizard  =
B D        Budgerigar  =
B D       Zebra finch  =
B D           Chicken  =
B D    Painted turtle  =
B D             Shrew  =
  D  Little brown bat  -
B D             Sloth  =
B D               Cat  =
B D          Hedgehog  =
B D        Rock hyrax  =
B D           Megabat  =
B D           Dolphin  -

Inserts between block 10 and 11 in window
B D           Rabbit 1bp
B D              Dog 78bp
B D            Panda 2bp
B D            Horse 2bp
B D        Armadillo 57bp

Alignment block 11 of 730 in window, 56692186 - 56692189, 4 bps 
B D             Mouse  agta---
B D               Rat  agtg---
B D      Kangaroo rat  agcg---
B D    Naked mole-rat  tgta---
B D        Guinea pig  tata---
B D          Squirrel  tgta---
B D             Human  tgca---
B D             Chimp  tgca---
B D           Gorilla  tgca---
B D         Orangutan  tgca---
B D            Gibbon  tgca---
B D            Rhesus  tgca---
B D            Baboon  tgca---
B D   Squirrel monkey  tgca---
B D       Mouse lemur  tgca---
B D          Bushbaby  tgta---
B D               Pig  tg-----
B D             Sheep  tg-----
B D               Cow  tg-----
B D               Cat  tc-----
B D             Panda  tg-----
B D             Horse  tg-----
B D          Platypus  ---agga
B D            Rabbit  =======
B D          Elephant  -------
B D           Manatee  =======
B D               Dog  =======
B D          Marmoset  =======
B D           Tarsier  =======
B D            Tenrec  =======
B D           Wallaby  =======
B D              Pika  =======
B D            Alpaca  =======
B D              Fugu  =======
B D      Atlantic cod  =======
B D      Nile tilapia  =======
B D         Zebrafish  =======
B D     X. tropicalis  =======
B D            Turkey  =======
B D        Coelacanth  =======
B D   Tasmanian devil  =======
B D           Opossum  =======
B D            Lizard  =======
B D        Budgerigar  =======
B D       Zebra finch  =======
B D           Chicken  =======
B D    Painted turtle  =======
B D             Shrew  =======
  D  Little brown bat  -------
B D             Sloth  =======
B D         Armadillo  =======
B D          Hedgehog  =======
B D        Rock hyrax  =======
B D           Megabat  =======
B D           Dolphin  -------

Inserts between block 11 and 12 in window
B D              Pig 2bp
B D            Sheep 1bp
B D              Cow 2bp

Alignment block 12 of 730 in window, 56692190 - 56692191, 2 bps 
B D             Mouse  ct
B D               Rat  ct
B D    Naked mole-rat  ca
B D        Guinea pig  cg
B D          Squirrel  ct
B D             Human  ct
B D             Chimp  ct
B D           Gorilla  ct
B D         Orangutan  ct
B D            Gibbon  ct
B D            Rhesus  ct
B D            Baboon  ct
B D   Squirrel monkey  ct
B D       Mouse lemur  ct
B D          Bushbaby  ct
B D               Pig  ct
B D           Dolphin  ct
B D               Cat  cg
B D             Panda  ct
B D             Horse  ct
B D          Platypus  ct
B D            Rabbit  ==
B D               Cow  ==
B D          Elephant  --
B D           Manatee  ==
B D               Dog  ==
B D          Marmoset  ==
B D           Tarsier  ==
B D            Tenrec  ==
B D           Wallaby  ==
B D              Pika  ==
B D            Alpaca  ==
B D             Sheep  ==
B D              Fugu  ==
B D      Atlantic cod  ==
B D      Nile tilapia  ==
B D         Zebrafish  ==
B D     X. tropicalis  ==
B D            Turkey  ==
B D        Coelacanth  ==
B D   Tasmanian devil  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D       Zebra finch  ==
B D           Chicken  ==
B D    Painted turtle  ==
B D             Shrew  ==
  D  Little brown bat  --
B D             Sloth  ==
B D         Armadillo  ==
B D          Hedgehog  ==
B D      Kangaroo rat  --
B D        Rock hyrax  ==
B D           Megabat  ==

Inserts between block 12 and 13 in window
B D              Rat 7bp
B D       Guinea pig 68bp
B D         Squirrel 67bp
B D      Mouse lemur 49bp
B D         Bushbaby 74bp
B D              Pig 152bp
B D            Panda 34bp

Alignment block 13 of 730 in window, 56692192 - 56692192, 1 bps 
B D             Mouse  -g
B D      Kangaroo rat  -g
B D             Human  -a
B D             Chimp  -a
B D           Gorilla  -a
B D         Orangutan  -g
B D            Gibbon  -g
B D            Rhesus  -g
B D            Baboon  -g
B D   Squirrel monkey  -g
B D           Dolphin  -g
B D          Platypus  c-
B D            Rabbit  ==
B D        Guinea pig  ==
B D          Bushbaby  ==
B D               Cow  ==
B D          Elephant  --
B D           Manatee  ==
B D          Squirrel  ==
B D               Pig  ==
B D             Horse  --
B D             Panda  ==
B D               Dog  ==
B D          Marmoset  ==
B D    Naked mole-rat  --
B D           Tarsier  ==
B D            Tenrec  ==
B D           Wallaby  ==
B D              Pika  ==
B D            Alpaca  ==
B D             Sheep  ==
B D              Fugu  ==
B D      Atlantic cod  ==
B D      Nile tilapia  ==
B D         Zebrafish  ==
B D     X. tropicalis  ==
B D            Turkey  ==
B D        Coelacanth  ==
B D   Tasmanian devil  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D       Zebra finch  ==
B D           Chicken  ==
B D    Painted turtle  ==
B D             Shrew  ==
  D  Little brown bat  --
B D             Sloth  ==
B D         Armadillo  ==
B D               Cat  --
B D       Mouse lemur  ==
B D          Hedgehog  ==
B D        Rock hyrax  ==
B D           Megabat  ==
B D               Rat  ==

Inserts between block 13 and 14 in window
B D        Orangutan 54bp
B D           Rhesus 41bp
B D           Baboon 41bp
B D          Dolphin 1bp

Alignment block 14 of 730 in window, 56692193 - 56692198, 6 bps 
B D             Mouse  ---gttttt
B D      Kangaroo rat  ---g-----
B D           Dolphin  ---gctct-
B D             Sheep  ---gtttt-
B D          Platypus  ggggac---
B D            Rabbit  =========
B D        Guinea pig  =========
B D          Bushbaby  =========
B D               Cow  =========
B D          Elephant  ---------
B D           Manatee  =========
B D          Squirrel  =========
B D            Rhesus  =========
B D         Orangutan  =========
B D   Squirrel monkey  ---------
B D               Pig  =========
B D             Horse  ---------
B D             Panda  =========
B D               Dog  =========
B D          Marmoset  =========
B D            Gibbon  ---------
B D           Gorilla  ---------
B D             Chimp  ---------
B D    Naked mole-rat  ---------
B D             Human  ---------
B D           Tarsier  =========
B D            Tenrec  =========
B D           Wallaby  =========
B D              Pika  =========
B D            Alpaca  =========
B D              Fugu  =========
B D      Atlantic cod  =========
B D      Nile tilapia  =========
B D         Zebrafish  =========
B D     X. tropicalis  =========
B D            Turkey  =========
B D        Coelacanth  =========
B D   Tasmanian devil  =========
B D           Opossum  =========
B D            Lizard  =========
B D        Budgerigar  =========
B D       Zebra finch  =========
B D           Chicken  =========
B D    Painted turtle  =========
B D             Shrew  =========
  D  Little brown bat  ---------
B D            Baboon  =========
B D             Sloth  =========
B D         Armadillo  =========
B D               Cat  ---------
B D       Mouse lemur  =========
B D          Hedgehog  =========
B D        Rock hyrax  =========
B D           Megabat  =========
B D               Rat  =========

Inserts between block 14 and 15 in window
B D            Sheep 660bp

Alignment block 15 of 730 in window, 56692199 - 56692287, 89 bps 
B D             Mouse  gtgtgtctttctttcttttctttctttctttctttctttctttctt-------------tctttc-----
B D      Kangaroo rat  ----------------------------------------------------------------------
B D           Dolphin  ---------------------------------------------------------gaaaaccc-----
B D               Cat  ----------gcctctttttccgctctccgccgcgctcttttccttaccc--tgcaagagcgctcctttg
  D  Little brown bat  ----------------------------------gtgcttttccct-------------gagctc-----
B D          Elephant  -------------------------gagtgcatttcgttctgctct-----------gaaaacc------
B D          Platypus  ------gtggacctcttttgtccctaacatcccctcttctcctccttcccttttctgtcccactc-----
B D            Rabbit  ======================================================================
B D        Guinea pig  ======================================================================
B D          Bushbaby  ======================================================================
B D               Cow  ======================================================================
B D           Manatee  ======================================================================
B D          Squirrel  ======================================================================
B D            Rhesus  ======================================================================
B D         Orangutan  ======================================================================
B D   Squirrel monkey  ----------------------------------------------------------------------
B D               Pig  ======================================================================
B D             Horse  ----------------------------------------------------------------------
B D             Panda  ======================================================================
B D               Dog  ======================================================================
B D          Marmoset  ======================================================================
B D            Gibbon  ----------------------------------------------------------------------
B D           Gorilla  ----------------------------------------------------------------------
B D             Chimp  ----------------------------------------------------------------------
B D    Naked mole-rat  ----------------------------------------------------------------------
B D             Human  ----------------------------------------------------------------------
B D           Tarsier  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D              Pika  ======================================================================
B D            Alpaca  ======================================================================
B D             Sheep  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D            Baboon  ======================================================================
B D             Sloth  ======================================================================
B D         Armadillo  ======================================================================
B D       Mouse lemur  ======================================================================
B D          Hedgehog  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Megabat  ======================================================================
B D               Rat  ======================================================================

                Mouse  ------------------tttctttctttctttctttctttctttctttccttct
         Kangaroo rat  --------------------------------------------------caact
              Dolphin  -------------------------------------------------------
                  Cat  ggagaaccgggggcgagatcttgtttctacctccttccctcct------------
     Little brown bat  -------------------------------------------------------
             Elephant  -------------------------------------------------------
             Platypus  ---------------------cctctcccctttcttccctccg------------
               Rabbit  =======================================================
           Guinea pig  =======================================================
             Bushbaby  =======================================================
                  Cow  =======================================================
              Manatee  =======================================================
             Squirrel  =======================================================
               Rhesus  =======================================================
            Orangutan  =======================================================
      Squirrel monkey  -------------------------------------------------------
                  Pig  =======================================================
                Horse  -------------------------------------------------------
                Panda  =======================================================
                  Dog  =======================================================
             Marmoset  =======================================================
               Gibbon  -------------------------------------------------------
              Gorilla  -------------------------------------------------------
                Chimp  -------------------------------------------------------
       Naked mole-rat  -------------------------------------------------------
                Human  -------------------------------------------------------
              Tarsier  =======================================================
               Tenrec  =======================================================
              Wallaby  =======================================================
                 Pika  =======================================================
               Alpaca  =======================================================
                Sheep  =======================================================
                 Fugu  =======================================================
         Atlantic cod  =======================================================
         Nile tilapia  =======================================================
            Zebrafish  =======================================================
        X. tropicalis  =======================================================
               Turkey  =======================================================
           Coelacanth  =======================================================
      Tasmanian devil  =======================================================
              Opossum  =======================================================
               Lizard  =======================================================
           Budgerigar  =======================================================
          Zebra finch  =======================================================
              Chicken  =======================================================
       Painted turtle  =======================================================
                Shrew  =======================================================
               Baboon  =======================================================
                Sloth  =======================================================
            Armadillo  =======================================================
          Mouse lemur  =======================================================
             Hedgehog  =======================================================
           Rock hyrax  =======================================================
              Megabat  =======================================================
                  Rat  =======================================================

Inserts between block 15 and 16 in window
  D Little brown bat 3bp

Alignment block 16 of 730 in window, 56692288 - 56692290, 3 bps 
B D             Mouse  ttc-
B D      Kangaroo rat  cgc-
B D            Rabbit  cac-
B D               Cat  cac-
B D          Platypus  -agg
B D        Guinea pig  ====
B D          Bushbaby  ====
B D               Cow  ====
B D          Elephant  ----
B D           Manatee  ====
B D          Squirrel  ====
B D            Rhesus  ====
B D         Orangutan  ====
B D   Squirrel monkey  ----
B D               Pig  ====
B D             Horse  ----
B D             Panda  ====
B D               Dog  ====
B D          Marmoset  ====
B D            Gibbon  ----
B D           Gorilla  ----
B D             Chimp  ----
B D    Naked mole-rat  ----
B D             Human  ----
B D           Tarsier  ====
B D            Tenrec  ====
B D           Wallaby  ====
B D              Pika  ====
B D            Alpaca  ====
B D             Sheep  ====
B D              Fugu  ====
B D      Atlantic cod  ====
B D      Nile tilapia  ====
B D         Zebrafish  ====
B D     X. tropicalis  ====
B D            Turkey  ====
B D        Coelacanth  ====
B D   Tasmanian devil  ====
B D           Opossum  ====
B D            Lizard  ====
B D        Budgerigar  ====
B D       Zebra finch  ====
B D           Chicken  ====
B D    Painted turtle  ====
B D             Shrew  ====
  D  Little brown bat  ====
B D            Baboon  ====
B D             Sloth  ====
B D         Armadillo  ====
B D       Mouse lemur  ====
B D          Hedgehog  ====
B D        Rock hyrax  ====
B D           Megabat  ====
B D           Dolphin  ----
B D               Rat  ====

Inserts between block 16 and 17 in window
B D              Cat 20bp

Alignment block 17 of 730 in window, 56692291 - 56692292, 2 bps 
B D             Mouse  -tt
B D      Kangaroo rat  -tg
B D            Rabbit  -t-
B D               Cat  -tg
B D          Platypus  ct-
B D        Guinea pig  ===
B D          Bushbaby  ===
B D               Cow  ===
B D          Elephant  ---
B D           Manatee  ===
B D          Squirrel  ===
B D            Rhesus  ===
B D         Orangutan  ===
B D   Squirrel monkey  ---
B D               Pig  ===
B D             Horse  ---
B D             Panda  ===
B D               Dog  ===
B D          Marmoset  ===
B D            Gibbon  ---
B D           Gorilla  ---
B D             Chimp  ---
B D    Naked mole-rat  ---
B D             Human  ---
B D           Tarsier  ===
B D            Tenrec  ===
B D           Wallaby  ===
B D              Pika  ===
B D            Alpaca  ===
B D             Sheep  ===
B D              Fugu  ===
B D      Atlantic cod  ===
B D      Nile tilapia  ===
B D         Zebrafish  ===
B D     X. tropicalis  ===
B D            Turkey  ===
B D        Coelacanth  ===
B D   Tasmanian devil  ===
B D           Opossum  ===
B D            Lizard  ===
B D        Budgerigar  ===
B D       Zebra finch  ===
B D           Chicken  ===
B D    Painted turtle  ===
B D             Shrew  ===
  D  Little brown bat  ===
B D            Baboon  ===
B D             Sloth  ===
B D         Armadillo  ===
B D       Mouse lemur  ===
B D          Hedgehog  ===
B D        Rock hyrax  ===
B D           Megabat  ===
B D           Dolphin  ---
B D               Rat  ===

Alignment block 18 of 730 in window, 56692293 - 56692294, 2 bps 
B D             Mouse  tt
B D      Kangaroo rat  ta
B D               Cow  tt
B D               Cat  ct
B D          Platypus  cc
B D            Rabbit  --
B D        Guinea pig  ==
B D          Bushbaby  ==
B D          Elephant  --
B D           Manatee  ==
B D          Squirrel  ==
B D            Rhesus  ==
B D         Orangutan  ==
B D   Squirrel monkey  --
B D               Pig  ==
B D             Horse  --
B D             Panda  ==
B D               Dog  ==
B D          Marmoset  ==
B D            Gibbon  --
B D           Gorilla  --
B D             Chimp  --
B D    Naked mole-rat  --
B D             Human  --
B D           Tarsier  ==
B D            Tenrec  ==
B D           Wallaby  ==
B D              Pika  ==
B D            Alpaca  ==
B D             Sheep  ==
B D              Fugu  ==
B D      Atlantic cod  ==
B D      Nile tilapia  ==
B D         Zebrafish  ==
B D     X. tropicalis  ==
B D            Turkey  ==
B D        Coelacanth  ==
B D   Tasmanian devil  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D       Zebra finch  ==
B D           Chicken  ==
B D    Painted turtle  ==
B D             Shrew  ==
  D  Little brown bat  ==
B D            Baboon  ==
B D             Sloth  ==
B D         Armadillo  ==
B D       Mouse lemur  ==
B D          Hedgehog  ==
B D        Rock hyrax  ==
B D           Megabat  ==
B D           Dolphin  --
B D               Rat  ==

Alignment block 19 of 730 in window, 56692295 - 56692298, 4 bps 
B D             Mouse  -tctt
B D      Kangaroo rat  -tttt
B D    Naked mole-rat  --ctg
B D            Rabbit  --ctg
B D             Human  ---t-
B D             Chimp  ---t-
B D           Gorilla  ---t-
B D            Gibbon  ---t-
B D   Squirrel monkey  ---t-
B D               Cow  ----t
B D               Cat  ----c
B D             Horse  ----c
B D          Platypus  cccc-
B D        Guinea pig  =====
B D          Bushbaby  =====
B D          Elephant  -----
B D           Manatee  =====
B D          Squirrel  =====
B D            Rhesus  =====
B D         Orangutan  =====
B D               Pig  =====
B D             Panda  =====
B D               Dog  =====
B D          Marmoset  =====
B D           Tarsier  =====
B D            Tenrec  =====
B D           Wallaby  =====
B D              Pika  =====
B D            Alpaca  =====
B D             Sheep  =====
B D              Fugu  =====
B D      Atlantic cod  =====
B D      Nile tilapia  =====
B D         Zebrafish  =====
B D     X. tropicalis  =====
B D            Turkey  =====
B D        Coelacanth  =====
B D   Tasmanian devil  =====
B D           Opossum  =====
B D            Lizard  =====
B D        Budgerigar  =====
B D       Zebra finch  =====
B D           Chicken  =====
B D    Painted turtle  =====
B D             Shrew  =====
  D  Little brown bat  =====
B D            Baboon  =====
B D             Sloth  =====
B D         Armadillo  =====
B D       Mouse lemur  =====
B D          Hedgehog  =====
B D        Rock hyrax  =====
B D           Megabat  =====
B D           Dolphin  -----
B D               Rat  =====

Inserts between block 19 and 20 in window
B D   Naked mole-rat 3bp
B D           Rabbit 3bp
B D            Human 4bp
B D            Chimp 4bp
B D          Gorilla 4bp
B D           Gibbon 4bp
B D  Squirrel monkey 4bp
B D              Cow 3bp
B D              Cat 3bp
B D            Horse 3bp

Alignment block 20 of 730 in window, 56692299 - 56692300, 2 bps 
B D             Mouse  at
B D               Rat  at
B D      Kangaroo rat  gt
B D    Naked mole-rat  at
B D            Rabbit  ac
B D             Human  at
B D             Chimp  at
B D           Gorilla  at
B D            Gibbon  at
B D          Marmoset  at
B D   Squirrel monkey  at
B D               Cow  aa
B D               Cat  aa
B D             Horse  aa
  D  Little brown bat  aa
B D          Platypus  ct
B D        Guinea pig  ==
B D          Bushbaby  ==
B D          Elephant  --
B D           Manatee  ==
B D          Squirrel  ==
B D            Rhesus  ==
B D         Orangutan  ==
B D               Pig  ==
B D             Panda  ==
B D               Dog  ==
B D           Tarsier  ==
B D            Tenrec  ==
B D           Wallaby  ==
B D              Pika  ==
B D            Alpaca  ==
B D             Sheep  ==
B D              Fugu  ==
B D      Atlantic cod  ==
B D      Nile tilapia  ==
B D         Zebrafish  ==
B D     X. tropicalis  ==
B D            Turkey  ==
B D        Coelacanth  ==
B D   Tasmanian devil  ==
B D           Opossum  ==
B D            Lizard  ==
B D        Budgerigar  ==
B D       Zebra finch  ==
B D           Chicken  ==
B D    Painted turtle  ==
B D             Shrew  ==
B D            Baboon  ==
B D             Sloth  ==
B D         Armadillo  ==
B D       Mouse lemur  ==
B D          Hedgehog  ==
B D        Rock hyrax  ==
B D           Megabat  ==
B D           Dolphin  --

Alignment block 21 of 730 in window, 56692301 - 56692312, 12 bps 
B D             Mouse  --ccatgtccagga
B D               Rat  --ccacatgcggga
B D      Kangaroo rat  --cc----cctgga
B D    Naked mole-rat  --cgctgtcctgga
B D            Rabbit  --ccctgtccggga
B D             Human  --cccagtcccgga
B D             Chimp  --cccagtcccgga
B D           Gorilla  --cccagtcccgga
B D            Gibbon  --cccagtcccgga
B D          Marmoset  --cccagtcccgga
B D   Squirrel monkey  --cccagtcccgga
B D           Dolphin  ------gtccggga
B D               Cow  --acccatccccga
B D               Cat  --acccgtcctgga
B D             Horse  --actcggcccgga
  D  Little brown bat  --acccaccctgga
B D          Elephant  --ccttgtcctgga
B D           Manatee  --ccttgtcctgga
B D          Platypus  ccaatcgcccagg-
B D        Guinea pig  ==============
B D          Bushbaby  ==============
B D          Squirrel  ==============
B D            Rhesus  ==============
B D         Orangutan  ==============
B D               Pig  ==============
B D             Panda  ==============
B D               Dog  ==============
B D           Tarsier  ==============
B D            Tenrec  ==============
B D           Wallaby  ==============
B D              Pika  ==============
B D            Alpaca  ==============
B D             Sheep  ==============
B D              Fugu  ==============
B D      Atlantic cod  ==============
B D      Nile tilapia  ==============
B D         Zebrafish  ==============
B D     X. tropicalis  ==============
B D            Turkey  ==============
B D        Coelacanth  ==============
B D   Tasmanian devil  ==============
B D           Opossum  ==============
B D            Lizard  ==============
B D        Budgerigar  ==============
B D       Zebra finch  ==============
B D           Chicken  ==============
B D    Painted turtle  ==============
B D             Shrew  ==============
B D            Baboon  ==============
B D             Sloth  ==============
B D         Armadillo  ==============
B D       Mouse lemur  ==============
B D          Hedgehog  ==============
B D        Rock hyrax  ==============
B D           Megabat  ==============

Alignment block 22 of 730 in window, 56692313 - 56692328, 16 bps 
B D             Mouse  gctgtcctggacactg
B D               Rat  gctgtcctggacactg
B D      Kangaroo rat  gct----tggattctg
B D    Naked mole-rat  act----cggtgtctg
B D            Rabbit  gct----agcactctg
B D             Human  cct----cggactctg
B D             Chimp  cct----cggactctg
B D           Gorilla  cct----cggactctg
B D            Gibbon  cct----cggactctg
B D            Rhesus  cct----gaaact---
B D            Baboon  cct----gaaact---
B D          Marmoset  -ct----cggactctg
B D   Squirrel monkey  -ct----cggactctg
B D           Dolphin  gct----cagactctg
B D               Cow  gct----cagactctg
B D               Cat  gct----cagactctg
B D             Panda  ---------------c
B D             Horse  gct----caggctcgg
  D  Little brown bat  gct----cagatcctg
B D          Elephant  tct----cggactctg
B D           Manatee  gct----cggactccg
B D         Armadillo  --t----c---cccgg
B D        Guinea pig  ================
B D          Bushbaby  ================
B D          Squirrel  ================
B D         Orangutan  ================
B D               Pig  ================
B D               Dog  ================
B D           Tarsier  ================
B D            Tenrec  ================
B D           Wallaby  ================
B D              Pika  ================
B D            Alpaca  ================
B D             Sheep  ================
B D              Fugu  ================
B D      Atlantic cod  ================
B D      Nile tilapia  ================
B D         Zebrafish  ================
B D     X. tropicalis  ================
B D          Platypus  ----------------
B D            Turkey  ================
B D        Coelacanth  ================
B D   Tasmanian devil  ================
B D           Opossum  ================
B D            Lizard  ================
B D        Budgerigar  ================
B D       Zebra finch  ================
B D           Chicken  ================
B D    Painted turtle  ================
B D             Shrew  ================
B D             Sloth  ================
B D       Mouse lemur  ================
B D          Hedgehog  ================
B D        Rock hyrax  ================
B D           Megabat  ================

Alignment block 23 of 730 in window, 56692329 - 56692332, 4 bps 
B D             Mouse  gctg
B D               Rat  gctg
B D      Kangaroo rat  gttg
B D    Naked mole-rat  gctg
B D            Rabbit  gct-
B D             Human  gctg
B D             Chimp  gctg
B D           Gorilla  gctg
B D            Gibbon  gctg
B D          Marmoset  gctg
B D   Squirrel monkey  gctg
B D       Mouse lemur  gcag
B D           Dolphin  gctg
B D               Cow  gctg
B D               Cat  cctc
B D             Panda  tctc
B D             Horse  gctg
  D  Little brown bat  gctg
B D          Elephant  gctg
B D           Manatee  gctg
B D         Armadillo  gctg
B D        Guinea pig  ====
B D          Bushbaby  ====
B D          Squirrel  ====
B D            Rhesus  ----
B D         Orangutan  ====
B D               Pig  ====
B D               Dog  ====
B D           Tarsier  ====
B D            Tenrec  ====
B D           Wallaby  ====
B D              Pika  ====
B D            Alpaca  ====
B D             Sheep  ====
B D              Fugu  ====
B D      Atlantic cod  ====
B D      Nile tilapia  ====
B D         Zebrafish  ====
B D     X. tropicalis  ====
B D          Platypus  ----
B D            Turkey  ====
B D        Coelacanth  ====
B D   Tasmanian devil  ====
B D           Opossum  ====
B D            Lizard  ====
B D        Budgerigar  ====
B D       Zebra finch  ====
B D           Chicken  ====
B D    Painted turtle  ====
B D             Shrew  ====
B D            Baboon  ----
B D             Sloth  ====
B D          Hedgehog  ====
B D        Rock hyrax  ====
B D           Megabat  ====

Inserts between block 23 and 24 in window
B D            Human 19bp
B D            Chimp 19bp
B D          Gorilla 19bp
B D           Gibbon 19bp
B D         Marmoset 19bp
B D  Squirrel monkey 19bp
B D      Mouse lemur 2bp
B D          Dolphin 8bp
B D              Cow 8bp
B D              Cat 9bp
B D            Panda 6bp
B D            Horse 7bp
  D Little brown bat 8bp
B D         Elephant 19bp
B D          Manatee 19bp
B D        Armadillo 19bp

Alignment block 24 of 730 in window, 56692333 - 56692352, 20 bps 
B D             Mouse  -cttcc--------caaggagcttcggta
B D               Rat  -catcc--------caaggagcttcagca
B D      Kangaroo rat  -cccaccgcagctgcaaactcccccagta
B D    Naked mole-rat  -cttcctgcgctt-ccagcagtggtggtg
B D            Rabbit  --tgcccgtaatt-cccgcaactccccta
B D             Human  -cctccgagtgga-caagaggc-------
B D             Chimp  -cctccgagtgga-caagaggc-------
B D           Gorilla  -cctccgagtgga-caagaggc-------
B D         Orangutan  -cctccgagtgga-caagagga-------
B D            Gibbon  -cctccgagtgga-caacaggc-------
B D            Rhesus  -cctccgagtgga-caagagga-------
B D            Baboon  -cctccgagtgga-caagaggc-------
B D          Marmoset  -cctctgagtgga-aaagaggt-------
B D   Squirrel monkey  -cctccgagtgga-aaagaggc-------
B D       Mouse lemur  -tcccagagtggg-ctagaggc-------
B D           Dolphin  -ccccggaa--------------------
B D               Cow  -ccccgaaa--------------------
B D               Cat  -cctcggag--------------------
B D             Panda  ----tggag--------------------
B D             Horse  -cctcggaa--------------------
  D  Little brown bat  -ccctgcag--------------------
B D          Elephant  -cctcag----------------------
B D           Manatee  -cccccg----------------------
B D         Armadillo  -tcacct----------------------
B D          Platypus  gtctccgag--------------------
B D        Guinea pig  =============================
B D          Bushbaby  =============================
B D          Squirrel  =============================
B D               Pig  =============================
B D               Dog  =============================
B D           Tarsier  =============================
B D            Tenrec  =============================
B D           Wallaby  =============================
B D              Pika  =============================
B D            Alpaca  =============================
B D             Sheep  =============================
B D              Fugu  =============================
B D      Atlantic cod  =============================
B D      Nile tilapia  =============================
B D         Zebrafish  =============================
B D     X. tropicalis  =============================
B D            Turkey  =============================
B D        Coelacanth  =============================
B D   Tasmanian devil  =============================
B D           Opossum  =============================
B D            Lizard  =============================
B D        Budgerigar  =============================
B D       Zebra finch  =============================
B D           Chicken  =============================
B D    Painted turtle  =============================
B D             Shrew  =============================
B D             Sloth  =============================
B D          Hedgehog  =============================
B D        Rock hyrax  =============================
B D           Megabat  =============================

Inserts between block 24 and 25 in window
B D   Naked mole-rat 18bp
B D           Rabbit 13bp
B D          Dolphin 6bp
B D              Cow 7bp
B D              Cat 22bp
B D            Panda 36bp
B D            Horse 22bp
  D Little brown bat 8bp

Alignment block 25 of 730 in window, 56692353 - 56692353, 1 bps 
B D             Mouse  g
B D               Rat  a
B D      Kangaroo rat  g
B D            Rabbit  g
B D             Human  g
B D             Chimp  g
B D           Gorilla  g
B D         Orangutan  g
B D            Gibbon  a
B D            Rhesus  g
B D            Baboon  g
B D          Marmoset  g
B D   Squirrel monkey  g
B D       Mouse lemur  g
B D          Bushbaby  g
B D           Dolphin  g
B D               Cow  g
B D               Cat  g
B D               Dog  g
B D             Horse  g
B D          Elephant  g
B D           Manatee  g
B D         Armadillo  g
B D          Platypus  g
B D        Guinea pig  =
B D          Squirrel  =
B D               Pig  =
B D             Panda  =
B D    Naked mole-rat  =
B D           Tarsier  =
B D            Tenrec  =
B D           Wallaby  =
B D              Pika  =
B D            Alpaca  =
B D             Sheep  =
B D              Fugu  =
B D      Atlantic cod  =
B D      Nile tilapia  =
B D         Zebrafish  =
B D     X. tropicalis  =
B D            Turkey  =
B D        Coelacanth  =
B D   Tasmanian devil  =
B D           Opossum  =
B D            Lizard  =
B D        Budgerigar  =
B D       Zebra finch  =
B D           Chicken  =
B D    Painted turtle  =
B D             Shrew  =
  D  Little brown bat  =
B D             Sloth  =
B D          Hedgehog  =
B D        Rock hyrax  =
B D           Megabat  =

Inserts between block 25 and 26 in window
B D     Kangaroo rat 10bp

Alignment block 26 of 730 in window, 56692354 - 56692359, 6 bps 
B D             Mouse  ggcata
B D               Rat  ggtgta
B D      Kangaroo rat  ggcacg
B D    Naked mole-rat  ggca-a
B D        Guinea pig  gacaca
B D          Squirrel  ggcgcc
B D            Rabbit  gccacc
B D             Human  ggcacc
B D             Chimp  ggcacc
B D           Gorilla  ggcacc
B D         Orangutan  ggcacc
B D            Gibbon  ggcacc
B D            Rhesus  ggcacc
B D            Baboon  ggcacc
B D          Marmoset  ggcacc
B D   Squirrel monkey  ggcacc
B D       Mouse lemur  gaccct
B D          Bushbaby  ggcatt
B D           Dolphin  ggcaga
B D               Cow  ggcagg
B D               Cat  ggcacg
B D               Dog  ggcacc
B D             Horse  gggacc
B D          Elephant  gtggtc
B D           Manatee  gtgatc
B D         Armadillo  ggactg
B D          Platypus  gataga
B D               Pig  ======
B D             Panda  ======
B D           Tarsier  ======
B D            Tenrec  ======
B D           Wallaby  ======
B D              Pika  ======
B D            Alpaca  ======
B D             Sheep  ======
B D              Fugu  ======
B D      Atlantic cod  ======
B D      Nile tilapia  ======
B D         Zebrafish  ======
B D     X. tropicalis  ======
B D            Turkey  ======
B D        Coelacanth  ======
B D   Tasmanian devil  ======
B D           Opossum  ======
B D            Lizard  ======
B D        Budgerigar  ======
B D       Zebra finch  ======
B D           Chicken  ======
B D    Painted turtle  ======
B D             Shrew  ======
  D  Little brown bat  ======
B D             Sloth  ======
B D          Hedgehog  ======
B D        Rock hyrax  ======
B D           Megabat  ======

Inserts between block 26 and 27 in window
B D          Dolphin 16bp
B D              Cow 16bp
B D         Elephant 2bp
B D          Manatee 2bp
B D        Armadillo 2bp

Alignment block 27 of 730 in window, 56692360 - 56692404, 45 bps 
B D             Mouse  gtgacctggacctt-gcttga--------------cccagtatgctcct-----------agc--a---g
B D               Rat  gtggcctgggcctt-acttga--------------ccctgtatactcct-----------agc--c---g
B D      Kangaroo rat  gtctcccaggcctt-tctggag-----atccgagttcctatgtgttccc-----------ggc--aatgg
B D    Naked mole-rat  gtc-tctgggcctt-gcgcagg-----g-------tcccatctggcccc-----------ggc--a--gg
B D        Guinea pig  gtcacctgggtctt-atgtagg-----g-------tccggtgcatcctc-----------agc--a--gg
B D          Squirrel  gtc-ctctggcttt-gctggga-----a-------tccagtctcttccc-----------agc--a--gg
B D            Rabbit  gtctcctgggcctc-gctccgg-------------tgcaatctgttccc-----------aac--g---g
B D             Human  gtcgcctgggcctc-gcttggggggg-g-------ggggtcctgtcccc-----------agc--a---g
B D             Chimp  gtcgcctgggcctc-gcttgggggggtg-------ggggtcctgtcccc-----------agc--a---g
B D           Gorilla  gtcgcctgggcctc-gcttggggggggg-------ggggtcctgtcccc-----------agc--a---g
B D         Orangutan  gtcgcctgggcctc-gcttggtgg---g-------gggctcctgtcccc-----------agc--a---g
B D            Gibbon  gtcgcctgggcctc-gcttgg------g-------gggatcctgtctcc-----------agc--a---g
B D            Rhesus  atcgcctagacctc-ccttg-------g-------gggatcgtgtcccc-----------agc--a---g
B D            Baboon  atcgcctggacctc-ccttg-------g-------gggatggtgtcccc-----------agc--a---g
B D          Marmoset  atcgcctgggcctc-gcct--------g-------ggggtcctgtccct-----------agc--a---g
B D   Squirrel monkey  atcgcctgtgtctc-gctc--------g-------cgggtcctgtccct-----------agc--a---g
B D       Mouse lemur  gtctcctgggcttg-ga----------g-------tccagtttggtccc-----------agcatt---g
B D          Bushbaby  gtctcttgg------------------------------gtctgttccc-----------ggc--t---g
B D            Alpaca  gtcgcctgggcctc-acccacg-----a-------tcctgtctgttccc-----------ggc--a--gg
B D           Dolphin  gtcgcctgggcctc-accctgg-----g-------tcctgtctttttcc-----------gac--a--ga
B D               Cow  gttgcctgggcctc-actctcg-----g-------tcctgtcttttccc-----------gac--a--ga
B D               Cat  gtcggctgtgcct--gccctgg-----c-------tcc----tgacccc-----------agg--a--gg
B D               Dog  gtcgcctgcgcct--gcccggg-----g-------tcc----tgtccccaggaggaggggagg--a--gg
B D             Panda  -------gcgcct--gcccggg-----g-------tcc----tgtttccc----------agg--a--gg
B D             Horse  gcagcctgggcctc-tcccggg-----g-------tcccg--tgttgct-----------ggc--a--gg
  D  Little brown bat  ---gcccgggcctcaccccggg-----g-------tcctgtttgtttct-----------ggc--t--gg
B D          Elephant  gaggctgacaggtc-acctagg-----g-------t----gttgtaccc-----------agc--a---g
B D           Manatee  gaggctagcaggtc-gcctagg-----g-------tcctgtctgtcccc-----------agc--a---g
B D         Armadillo  cattctgtc--ttt-gtctggg-----g-------ggttgactgctctc-----------ggc--a---g
B D          Platypus  ---------------------------g-------tggtcggagttccc-----------ggc--g---g
B D               Pig  ======================================================================
B D           Tarsier  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D              Pika  ======================================================================
B D             Sheep  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D          Hedgehog  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Megabat  ======================================================================

                Mouse  -------gg-gaca
                  Rat  -------gg-gaca
         Kangaroo rat  -------gg-aacc
       Naked mole-rat  -------gg-agca
           Guinea pig  -------gg-tgca
             Squirrel  -------ag-ggca
               Rabbit  -------gg-agcg
                Human  -------gg-ggca
                Chimp  -------gg-ggca
              Gorilla  -------gg-ggca
            Orangutan  -------gg-ggca
               Gibbon  -------gg-ggca
               Rhesus  -------gg-ggca
               Baboon  -------gg-ggca
             Marmoset  -------gg-tgca
      Squirrel monkey  -------gg-agca
          Mouse lemur  -------gg-gcaa
             Bushbaby  -------gg-gtca
               Alpaca  -------ag-g--a
              Dolphin  -------ggaggca
                  Cow  -------gg-ggca
                  Cat  -------aa-ggca
                  Dog  -------ag-ggca
                Panda  -------ag-ggca
                Horse  -------gg-ggcg
     Little brown bat  -------gg-ggca
             Elephant  --------------
              Manatee  --------------
            Armadillo  gggggca-------
             Platypus  -------tg-gaca
                  Pig  ==============
              Tarsier  ==============
               Tenrec  ==============
              Wallaby  ==============
                 Pika  ==============
                Sheep  ==============
                 Fugu  ==============
         Atlantic cod  ==============
         Nile tilapia  ==============
            Zebrafish  ==============
        X. tropicalis  ==============
               Turkey  ==============
           Coelacanth  ==============
      Tasmanian devil  ==============
              Opossum  ==============
               Lizard  ==============
           Budgerigar  ==============
          Zebra finch  ==============
              Chicken  ==============
       Painted turtle  ==============
                Shrew  ==============
                Sloth  ==============
             Hedgehog  ==============
           Rock hyrax  ==============
              Megabat  ==============

Alignment block 28 of 730 in window, 56692405 - 56692522, 118 bps 
B D             Mouse  ------------agttgcagagttcggtgcctacatactct--gct---ctaactcccg-tgttca----
B D               Rat  ------------agttgcagagttcggtgcctaagtatttt--gct---ctaactccta-tgttca----
B D      Kangaroo rat  ------------acatggacaactcag--------------------------ctcccgttgtcca----
B D    Naked mole-rat  ------------agatggaggaatcgc-----------------ct--cctaaatc----tgctca----
B D        Guinea pig  ------------aagtgaagcaacaac-----------------ct---ctaaatc----tgctca----
B D          Squirrel  ------------atctt---------------------------ctataccagctc----tgctca----
B D            Rabbit  ------------agttggaggcatctc-----------------ctcctccagttc----cgctgg----
B D             Human  ------------agttggaggaatcagctccttaatatttt---ct--gctagctc----tgcttg----
B D             Chimp  ------------agttggaggaatcagctccttaatatttt---ct--gctagctc----tgcttg----
B D           Gorilla  ------------agttggaggaatcagctccttaatatttt---ct--gctagctc----tgcttg----
B D         Orangutan  ------------agttggaggaatcagctccttaatatttt---ct--gctagctc----tgcttc----
B D            Gibbon  ------------agttggaggaatcagctccttaatatttt---ct--gctagctc----tgctt-----
B D            Rhesus  ------------agttgcaggaatcagctccttaatatttt---ct--gctagctc----tgcctg----
B D            Baboon  ------------agttggaggaatcagctccttaatatttt---ct--gctagctc----tgcctg----
B D          Marmoset  ------------agttggaggaatcagctccttaatatttt---ct--gctagctc----cgctagtcat
B D   Squirrel monkey  ------------agttggaggaatcagctccttaatatttt---ct--gctagctc----tgctag----
B D       Mouse lemur  ------------gttgagggtaatcag--------tctcct---ct--gccagctc----tgcttg----
B D          Bushbaby  ------------atttggagaaatcagctccttaatattct---ct--gcccgctc----tgcttg----
B D               Pig  ------------atttggaggaatctg---cttaatattctcctcg--gccacctc----tagtca----
B D            Alpaca  ------------agttggaggaatctgctcctcaatattct----a--gccaaccc----tattct----
B D           Dolphin  ------------agctggaggaatctgccccttaatattctcctcg--gccaactc----tagtct----
B D               Cow  ------------agttggaggaatctgctccttaacattctcgtcg--g-caactc----tagtct----
B D               Cat  ------------ggtcggaggcatctgccccttaatattcttctct--gtcaaccc----tgctct----
B D               Dog  ------------agttggaagaaactgccccttaa---tcttctcc--gccaactc----tgccct----
B D             Panda  ------------ggttggaagaatctgccccttaatattcttctct--gccaactc----tgctct----
B D             Horse  ------------agttggaggaatctgcttcttaatagtctccttt--gccaactc----tgctct----
  D  Little brown bat  -------------gctggaggaatctgttccttaacattcttctct--gccaactc----tgctct----
B D          Elephant  -------------gttggaagaatcggatcaatactattctcctct--gccagctc----tgctcg----
B D           Manatee  -------------gttggaagaatcagaccattactattctcctcc--gccagctc----tgctcc----
B D         Armadillo  ------------cgttggaggaatcagctcgttagtactcttctct--gcccactc----tgcttg----
B D          Platypus  gaggggtatcaggggtgacctgatcagtcctctcgccctctccctt--cctcaccc----tggtctcctc
B D           Tarsier  ======================================================================
B D            Tenrec  ======================================================================
B D           Wallaby  ======================================================================
B D              Pika  ======================================================================
B D             Sheep  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D          Hedgehog  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Megabat  ======================================================================

                Mouse  cctcaaccgcgagtagaaaaa--gagacccttccattctc----gcgcct-ccc----------------
                  Rat  ctgcaaccgcgggtagaaaaaaagagacccttccattccc----gctcct-ctct--------ct-c---
         Kangaroo rat  ctac--ccggg------------gagtcctgtccggcctc----ctctct-ccacaca--aa-cg-c---
       Naked mole-rat  tcacaactgcgact---------gagaacaggacatacac----accttc-ccc----------------
           Guinea pig  tcataactgcaaca---------gagaacaggacacacac----accttc-gcc----------------
             Squirrel  tcctaactgccact---------gagaacagga-ggactc----ttctcc-cgccacatgca-ta-c---
               Rabbit  tcttaaggacaact---------gggaataggaggacccc----tctccc-acgcatacaca-cg-cccc
                Human  tcataactgcaact---------cggaatagaacaacctc----tctccc-gtgcatacgca-cc-ccca
                Chimp  tcataactgcaact---------cggaatagaacaacctc----tctccc-gtgcatacgca-cc-ccca
              Gorilla  tcataactgcaact---------cggaatagaacaac--c----tctccc-atgcatacgca-cc-ccca
            Orangutan  tcataactgcaact---------cggaatagaacaacctc----tctccc-gcgcatacgc---------
               Gibbon  ccataactgcaact---------cggaatagaacagcctc----tctccc-gcgcatacgca-cc-cccc
               Rhesus  tcataactgcaact---------cggaatagaacaacctc----tctccc-gcgcatacgca-cc-ccct
               Baboon  tcataactgcaact---------cggaatagaacaacctc----tctccc-gcgcatacgca-cc-cccc
             Marmoset  tcattactgcaact---------cggaatagaacagcctc----tctcca-ggacacacacacacacctc
      Squirrel monkey  tcattactgcaact---------cggaaaagaacaacctc----tctcct-ggtcacacaca-ac-cccc
          Mouse lemur  tcacaactgcgact---------ggg-acaaaacgacccc----tctcct-gcgcatacgca-cg-cccc
             Bushbaby  tcataactataatt---------gggaacagcaagacccc----ctcttt-g-------ggg-gg-ggtc
                  Pig  ttctaaatgcgtct---------gggaacagcaagacccc----tcgcgc-gcgcatacaca-ag-cccc
               Alpaca  tcataaatgcaact---------gggaacaggaggacccc----tctccc-gcgcacacaca-ta-cccc
              Dolphin  tcctaaaagcgact---------ggaaacagcaggacccc----tctccc-gcgcatacaca-cg-cccc
                  Cow  ccctaaaagcgcct---------gagagtagcaggacccc----tctccc-gcgcatacaca-ca-cccc
                  Cat  ttacgagtgctact---------gagaacagccggacccc----tctcct-gcgcgtacaca-cg-ccca
                  Dog  tcataaatgcaact---------gcgaacggcaggacctc----tc-----gcgcgcgggga-cg-----
                Panda  tcgtaaatgcaacc---------gagaacagcaggaccct----tctcacggcgcacaggca-cg-ccc-
                Horse  tcaaaaccgccatt---------gggaacagcaggacc-c----tctccc-gtgcatccaca-cg-cccc
     Little brown bat  tcctaagtgcacct---------gggaaca---ggacccc----tctcca-gcgcaaacaca-cg-cccc
             Elephant  tcagaactggtact---------gagaacagcaggaccc-----cctccc-gcgcacacaca-cg-cctc
              Manatee  tcagaattgctact---------gggaacagcaggacccccccacctccg-gcgcgcacaca-cg-cctc
            Armadillo  tccttcctgc-aaa---------gggagcagcagaaccc-----ccggcg-gcgcctacgcg-cg-cccc
             Platypus  ccatctcttcattt---------ccccttcccattgcctc----cttccg-g------------------
              Tarsier  ======================================================================
               Tenrec  ======================================================================
              Wallaby  ======================================================================
                 Pika  ======================================================================
                Sheep  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
             Hedgehog  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================

                Mouse  ---------------------------cctactttc-----------tcttccacggtcg------c
                  Rat  -------------------------gccctaccttc-----------ttttccgctggcg------c
         Kangaroo rat  -------------------------gcgcgacctca-----------tcctcatccatcc------c
       Naked mole-rat  ----------------------------------tc-----------gcatccgcggtct------t
           Guinea pig  ----------------------------------tt-----------ccatctgctgtct------t
             Squirrel  -------------------------actttactctt-----------ccactcgcagtaa------t
               Rabbit  cc-------t--ct----------agcctttccctc-----------ccctgtacagtca------t
                Human  ac-------t--ct----------cgccctatcctc-----------ccatccacagtca------t
                Chimp  ac-------t--ct----------cgccctatcctc-----------ccatccacagtca------t
              Gorilla  ac-------t--ct----------cgccctatcctc-----------ccatccacagtca------t
            Orangutan  ac-------t--ct----------cgccctatcctc-----------ccatccgcagtca------t
               Gibbon  ac-------t--ct----------cgccctatcctc-----------ccatccgcagtca------t
               Rhesus  ac-------t--ct----------cgccctgtcctc-----------ccatccgcagtca------t
               Baboon  ac-------t--ct----------cgccctgtcctc-----------ccatccgcagtca------t
             Marmoset  ac-------t--ct----------cgccctatcctc-----------ccgtccgcagtca------t
      Squirrel monkey  ac-------t--ct----------cgccctatcctc-----------ccatccgcagtca------t
          Mouse lemur  tc-------t--ct----------cgccttcccctc-----------ccatccgcagtca------t
             Bushbaby  tg-------t--ct----------cgccttcccctc-----------ccatccacagtca------t
                  Pig  tc-------t--ctggccatacaatagcacttcccc-------------------------------
               Alpaca  tc-------t--ctcgcta-----tacactgtacccctttccccg--ccatctgcagtcg------t
              Dolphin  tc-------t--ctcgctataccaccccccgccccccgccccccgtcccgtctgcagtcg------t
                  Cow  tc-------t--------------caacccaccttcgcgctcccgtcccatctgcggtcg------t
                  Cat  tc-------t--ct----------cattctatcccc------------------cagccgcagccct
                  Dog  ------------------------------------------------------tagtcg------t
                Panda  tc-------t--ct----------cattctatcccc------------------cagccg------a
                Horse  cc-------c--ct----------cgctgtaccctcat----------------ccgccg------t
     Little brown bat  tctagctatt--cc----------cactcctccctcc-----------------cagtcc------t
             Elephant  cc-------t--tc----------tgccataccctc----------cccatccttagtgg------t
              Manatee  tc-------t--cc----------ggccataccctc----------cccatccgcagttg------t
            Armadillo  tt-------tcgcc----------ctgcgcgcgctc----------agcatcctcactca------c
             Platypus  -------------------------------------------------------------------
              Tarsier  ===================================================================
               Tenrec  ===================================================================
              Wallaby  ===================================================================
                 Pika  ===================================================================
                Sheep  ===================================================================
                 Fugu  ===================================================================
         Atlantic cod  ===================================================================
         Nile tilapia  ===================================================================
            Zebrafish  ===================================================================
        X. tropicalis  ===================================================================
               Turkey  ===================================================================
           Coelacanth  ===================================================================
      Tasmanian devil  ===================================================================
              Opossum  ===================================================================
               Lizard  ===================================================================
           Budgerigar  ===================================================================
          Zebra finch  ===================================================================
              Chicken  ===================================================================
       Painted turtle  ===================================================================
                Shrew  ===================================================================
                Sloth  ===================================================================
             Hedgehog  ===================================================================
           Rock hyrax  ===================================================================
              Megabat  ===================================================================

Inserts between block 28 and 29 in window
B D         Elephant 38bp

Alignment block 29 of 730 in window, 56692523 - 56692531, 9 bps 
B D             Mouse  agtcgacct
B D               Rat  catcgacct
B D      Kangaroo rat  ag--aacct
B D    Naked mole-rat  cactgacct
B D        Guinea pig  ---tcacca
B D          Squirrel  ccctggcct
B D            Rabbit  cactgacct
B D             Human  cactgacct
B D             Chimp  cactgacct
B D           Gorilla  cactgacct
B D         Orangutan  cactgacct
B D            Gibbon  cactgacct
B D            Rhesus  cactgacct
B D            Baboon  cactgacct
B D          Marmoset  cacagacct
B D   Squirrel monkey  cactgacct
B D       Mouse lemur  ctctgacct
B D          Bushbaby  cattgacca
B D               Pig  --ctgacct
B D            Alpaca  tgctgacgt
B D           Dolphin  agctgacct
B D               Cow  cgctgacct
B D               Cat  agctgaccc
B D               Dog  agctgacct
B D             Panda  agtcg----
B D             Horse  cgctgacct
  D  Little brown bat  cgctgaccc
B D          Elephant  agcagccca
B D            Tenrec  agccgccc-
B D           Manatee  ---tgccga
B D         Armadillo  ---cgccca
B D          Platypus  agctctcgt
B D           Tarsier  =========
B D           Wallaby  =========
B D              Pika  =========
B D             Sheep  =========
B D              Fugu  =========
B D      Atlantic cod  =========
B D      Nile tilapia  =========
B D         Zebrafish  =========
B D     X. tropicalis  =========
B D            Turkey  =========
B D        Coelacanth  =========
B D   Tasmanian devil  =========
B D           Opossum  =========
B D            Lizard  =========
B D        Budgerigar  =========
B D       Zebra finch  =========
B D           Chicken  =========
B D    Painted turtle  =========
B D             Shrew  =========
B D             Sloth  =========
B D          Hedgehog  =========
B D        Rock hyrax  =========
B D           Megabat  =========

Inserts between block 29 and 30 in window
B D              Pig 6bp
B D           Alpaca 6bp
B D          Dolphin 6bp
B D              Cow 6bp
B D              Cat 6bp
B D              Dog 112bp
B D            Panda 15bp
B D            Horse 5bp
  D Little brown bat 20bp
B D         Elephant 1bp
B D           Tenrec 1bp
B D          Manatee 1bp
B D        Armadillo 1bp

Alignment block 30 of 730 in window, 56692532 - 56692609, 78 bps 
B D             Mouse  ccagggacacagacgctgagt------------actca--------------------------------
B D               Rat  acacagacgcagacgccggtt------------cttaagaa-----------------------------
B D      Kangaroo rat  ----ggccccagg-acagggt-------------------------------------------------
B D    Naked mole-rat  ----gcacgcacgcctcgaga------------gaccag-------------------------------
B D        Guinea pig  ----gcctgcatgccctgggaatctggtgtcagaacagg-------------------------------
B D          Squirrel  ----gcgtccgcaagctgaca------------tccgggca-----------------------------
B D            Rabbit  --------gcagaccccgagc------------aacaagcactcagaggagccgcagagc-cggacggcg
B D             Human  --------gtagacccggagg------------agcaggcttc------------------cgggggtcg
B D             Chimp  --------gtagacccggagg------------agcaggcttc------------------cgggcgtcg
B D           Gorilla  --------gtagacccggagg------------agcaggcttc------------------cgggcgtcg
B D         Orangutan  --------gtagacccggagg------------agcaggcttc------------------cgggcgtcg
B D            Gibbon  --------gtagacctggagg------------agcaggcttc------------------cgggcgtcg
B D            Rhesus  --------gtacacccgcagg------------agcaggcttc------------------ctggagtcg
B D            Baboon  --------gtagacccgcagg------------agcaggtttc------------------ctggagtcg
B D          Marmoset  --------gtagacccggagg------------agcagccttcccgcggagcagcttag--ccggcgtcg
B D   Squirrel monkey  --------gtagacccggagg------------agcagccttcccgcggagcagcttag--ccggcgtcg
B D       Mouse lemur  --------gtagaccccgaga------------agccggctcccggaggaacagctcagc-cgggcgtcg
B D          Bushbaby  --------gcagaccctgag-------------agcaagctccctaagaaacaactcatc-cgggctgac
B D               Pig  --------------cgaggga------------agcagacacccagcgcagcggtcc----aaggcgcga
B D            Alpaca  --------------ctgggga------------ggcaggcgcccggtagagcagatc----ggggcgtcg
B D           Dolphin  --------------cgcggga------------agcaggcgcccggcggagcagccc----aggacatcg
B D               Cow  --------------c-cggga------------agcaggcgcgaggcggagcctccc----gggacgtcg
B D               Cat  --------------tccggga------------agcag----------------ccc----agggtgttg
B D             Panda  --------------gccgggt------------agcag----------------ccc----ggggcgtcg
B D             Horse  --------------tcccgga------------agcaggcgcccggcggagggaccc----ggggcgtcg
  D  Little brown bat  -------------------------------------------------------cc----agggcgtcc
B D          Elephant  ----------------------------------------------------------------------
B D            Tenrec  ----------------------------------------------------------------------
B D           Manatee  ----------------------------------------------------------------------
B D         Armadillo  ----------------------------------------------------------------------
B D          Platypus  -----------------------------------------------------------ctaggccgacg
B D               Dog  ======================================================================
B D           Tarsier  ======================================================================
B D           Wallaby  ======================================================================
B D              Pika  ======================================================================
B D             Sheep  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D          Hedgehog  ======================================================================
B D        Rock hyrax  ======================================================================
B D           Megabat  ======================================================================

                Mouse  -------------ccgagatcaag--tgag----------------------tgctcacacac-------
                  Rat  -------------ttgagatcaaa--tgaggcctctccaag-----------tgctcacactc-------
         Kangaroo rat  -------------tggagatcatg--ggagttccctccga------------ggcccgca--c-------
       Naked mole-rat  -------------ctggggaccag--gcaggtctccccct------------gtccagcg--c-------
           Guinea pig  -------------ttagggacccg--gcagaccttcctgt------------gtcccaca--g-------
             Squirrel  ---------gg-ttggggatcggg--acaggtctccccga------------gtcccgca--c-------
               Rabbit  g----tccggg-ttgggggtcgag--ggcccgctcccagc------------ctcccgca--c-------
                Human  g----tccagg-ttggggatacag--ggaggggtcctcgc------------gttccgca--c-------
                Chimp  g----tccagg-ttggggatacag--ggaggggtcctcgc------------gttccaca--c-------
              Gorilla  g----tccagg-ttggggatacag--ggaggggtccttgc------------gttccgta--c-------
            Orangutan  g----tccagg-ttggggatacag--ggaggggtcctcgc------------gttcctca--c-------
               Gibbon  g----tccagg-ttggggatacag--ggaggggtcctcgc------------attccgca--c-------
               Rhesus  g----tccagg-ttggggatacag--ggaggagtccccgc------------gttccgca--c-------
               Baboon  g----tccagg-ttggggatacag--ggaggagtccccgt------------gttccgca--c-------
             Marmoset  g----tctggg-ttggggattcag--ggaggggtcctcgc------------gttccgca--c-------
      Squirrel monkey  g----tctagg-ttagggatacag--ggaggggtcctcgc------------gttccgca--c-------
          Mouse lemur  a----tccaggcttggggatccag--gga----tccccgc------------gccctgca--c-------
             Bushbaby  a----tccagg-ttggggatccag--agagagctccccgc------------gtcccgcc--c-------
                  Pig  g----tccggt-ttagagagc-----tgcgggcttcccac------------tttctgta--c-------
               Alpaca  g----tcaagg-ctggagaac-----agagggcttcccgc------------tccctgca--c-------
              Dolphin  c----tcagcg-ctggagggc------ggaggctccccac------------tccctgca--c-------
                  Cow  g----tccgtg-ttggagagcc----gggggggtccccac------------tccccgca--c-------
                  Cat  g----tcaggg-ttggagagcgatg-gaagagttcccc--------------ttcctcag--c-------
                Panda  g----tcaggg-ttgcagagctagg-gaagagttcccc--------------ttcctcaa--c-------
                Horse  g----ccagga-ccgcagatccagg-ctagggctccccg-------------ctcct-------------
     Little brown bat  gtcactcagga-ttgcagagctggg-cgagggctcccg--------------------------------
             Elephant  ------------ctggggatccag----------------------------gttggaga--g-------
               Tenrec  ------------ctagggatccag----------------------------gctgaaaa--g-------
              Manatee  ------------ctacagacccag--cgaag------------ggagc----gccgggag--gagcagcc
            Armadillo  ------------ctgcagacctgg--agaagcaggtacccgacggagtcaaggttggaga--g-------
             Platypus  g-------gag-acggagggcaaggtgtaggg--------------------------------------
                  Dog  ======================================================================
              Tarsier  ======================================================================
              Wallaby  ======================================================================
                 Pika  ======================================================================
                Sheep  ======================================================================
                 Fugu  ======================================================================
         Atlantic cod  ======================================================================
         Nile tilapia  ======================================================================
            Zebrafish  ======================================================================
        X. tropicalis  ======================================================================
               Turkey  ======================================================================
           Coelacanth  ======================================================================
      Tasmanian devil  ======================================================================
              Opossum  ======================================================================
               Lizard  ======================================================================
           Budgerigar  ======================================================================
          Zebra finch  ======================================================================
              Chicken  ======================================================================
       Painted turtle  ======================================================================
                Shrew  ======================================================================
                Sloth  ======================================================================
             Hedgehog  ======================================================================
           Rock hyrax  ======================================================================
              Megabat  ======================================================================

                Mouse  --------------------------agcctagagtgctgccttccgatggc
                  Rat  --------------------------accctagagtgctgccttccgatggc
         Kangaroo rat  --------------------------agcctgaagtcctgcgccccagcccg
       Naked mole-rat  --------------------------gttctgcagccctgggctcctccctc
           Guinea pig  --------------------------ggtctgcagccc-gggttcctacctg
             Squirrel  --------------------------aatctacagcaccccttcatgatctc
               Rabbit  --------------------------agcccccagcgcccgggtccgacttc
                Human  --------------------------aacctgtagtgcttgggtctgacttc
                Chimp  --------------------------aacctgtagtgcttgggtctgacttc
              Gorilla  --------------------------aacctgtagtgcttgggtctgacttc
            Orangutan  --------------------------aacctgtagtgcttgggtctgacctc
               Gibbon  --------------------------aacctgtaatgcttgggtctgacctc
               Rhesus  --------------------------aacctgcagtgcttgggtct------
               Baboon  --------------------------aacctgcagtgcttgggtct------
             Marmoset  --------------------------aacctgcagtgcttgggtctgacttc
      Squirrel monkey  --------------------------accctgcagtgcttgggtctgacctc
          Mouse lemur  --------------------------agcctgcggcgcctggctctcacctt
             Bushbaby  --------------------------agcctgtggcgcttgggtctgacctt
                  Pig  --------------------------agcctgttgcgcccagatccgacctt
               Alpaca  --------------------------agcctgttgcgccccgatccgaactc
              Dolphin  --------------------------agcctgttgctcccgggtccgacctc
                  Cow  --------------------------agcctgtggcgcctgggtccg-----
                  Cat  --------------------------agcctgtagcgccggggtcccgccgc
                Panda  --------------------------ggtccgtagcgccggggtcccacctc
                Horse  ----------------------------------gcgcc-------------
     Little brown bat  ---------------------------gggagctgcac--------------
             Elephant  ------------------------cgagcagagggc----------------
               Tenrec  ------------------------cgagccgagggc----------------
              Manatee  cagatgggtatgcaggtcagagagcgagccgacggc----------------
            Armadillo  -----------------cacggggagagcacccggc----------------
             Platypus  ----------------------------------------------------
                  Dog  ====================================================
              Tarsier  ====================================================
              Wallaby  ====================================================
                 Pika  ====================================================
                Sheep  ====================================================
                 Fugu  ====================================================
         Atlantic cod  ====================================================
         Nile tilapia  ====================================================
            Zebrafish  ====================================================
        X. tropicalis  ====================================================
               Turkey  ====================================================
           Coelacanth  ====================================================
      Tasmanian devil  ====================================================
              Opossum  ====================================================
               Lizard  ====================================================
           Budgerigar  ====================================================
          Zebra finch  ====================================================
              Chicken  ====================================================
       Painted turtle  ====================================================
                Shrew  ====================================================
                Sloth  ====================================================
             Hedgehog  ====================================================
           Rock hyrax  ====================================================
              Megabat  ====================================================

Inserts between block 30 and 31 in window
B D      Mouse lemur 8bp
B D              Pig 11bp
B D           Alpaca 11bp
B D          Dolphin 11bp
B D              Cat 16bp
B D            Panda 14bp
B D            Horse 35bp

Alignment block 31 of 730 in window, 56692610 - 56692639, 30 bps 
B D             Mouse  ggcggc--------gactgcc------cggatactct--------------gtgagcc-
B D               Rat  ggcagc-----------tgcc------cggatgcttc----------cttcgtgagca-
B D      Kangaroo rat  ggcagtcctcagttggccatt------tgcaggccct---------cctccaaggggg-
B D    Naked mole-rat  ggtagc------------cct------gggggatcctcggcc-gggccactgagggcg-
B D        Guinea pig  ggtagt------------cct------cgggtgccctcagac--atccactgagggcg-
B D          Squirrel  agtagc------------tct------tgggtgctgtctgcc-agtctcttgagggcg-
B D            Rabbit  tgcaga------------cct------ggattgctgtctgcc-ggccgttcgaaggcg-
B D             Human  ggcagc------------cct------cgggtacagtctgcc-----------------
B D             Chimp  ggcagc------------cct------cgggtacagtctgcc-----------------
B D           Gorilla  ggcagc------------cct------cgggtacagtcagcc-----------------
B D         Orangutan  ggcagc------------ctt------cgggtacagtctgcc-----------------
B D            Gibbon  ggcagc------------cca------cgggtacagtctgcc-----------------
B D            Rhesus  ----------------------------gggtacagtctgcc-----------------
B D            Baboon  ----------------------------gggtacagtctgcc-----------------
B D          Marmoset  agcagc------------cct------cgggtacagtctacc-----------------
B D   Squirrel monkey  tgcagc------------cct------cgggtacagtctaca-----------------
B D       Mouse lemur  ggtcgc------------cct------cgggtgcggtctgcttggccactcgagggcg-
B D          Bushbaby  ggcagc------------cct------ctggtgtcttctgcctagccactcgagggca-
B D               Pig  -----------------------------ggagccgtctgccaggccacacgagggcg-
B D            Alpaca  -----------------------------gtcgccgtctg-caggccgcgcgagggcg-
B D           Dolphin  -----------------------------ggcgccgtctgccgggtcgcgctggggcg-
B D               Cow  ----------------------------------------------------ggggcg-
B D               Cat  -----------------------------ggcgccatctaccaggctgctcgagggcg-
B D               Dog  -----------------------------ggcgccgtccgcccggttgcgcgagggcg-
B D             Panda  -----------------------------ggcgccgtctgccaggctgcgcgaggccg-
B D             Horse  -----------------------------ggcgccgtgtgccaggccgcgcgaggg-g-
  D  Little brown bat  -------------------------------agcctctagc------gctcgggtctg-
B D          Elephant  -------------------gc------cccgcacagcctgcagcac-------------
B D            Tenrec  -------------------gtgggcggacagcacagcctgcagccc-------------
B D           Manatee  -------------------gc------cccgcacaatctgcagcac-------------
B D         Armadillo  -------------------gt------cccgcccagcccgcggcgc-------------
B D          Platypus  -----------------------------ggcggaggcggcctgggttctctgtgggat
B D           Tarsier  ===========================================================
B D           Wallaby  ===========================================================
B D              Pika  ===========================================================
B D             Sheep  ===========================================================
B D              Fugu  ===========================================================
B D      Atlantic cod  ===========================================================
B D      Nile tilapia  ===========================================================
B D         Zebrafish  ===========================================================
B D     X. tropicalis  ===========================================================
B D            Turkey  ===========================================================
B D        Coelacanth  ===========================================================
B D   Tasmanian devil  ===========================================================
B D           Opossum  ===========================================================
B D            Lizard  ===========================================================
B D        Budgerigar  ===========================================================
B D       Zebra finch  ===========================================================
B D           Chicken  ===========================================================
B D    Painted turtle  ===========================================================
B D             Shrew  ===========================================================
B D             Sloth  ===========================================================
B D          Hedgehog  ===========================================================
B D        Rock hyrax  ===========================================================
B D           Megabat  ===========================================================

Inserts between block 31 and 32 in window
B D         Elephant 22bp
B D           Tenrec 20bp
B D          Manatee 22bp
B D        Armadillo 30bp

Alignment block 32 of 730 in window, 56692640 - 56692658, 19 bps 
B D             Mouse  gccgtgggaagag---ctagat---
B D               Rat  acggtaggaagag---ctagat---
B D      Kangaroo rat  acctcagagagcg---ccga-----
B D    Naked mole-rat  gccttggaaggag---cgagat---
B D        Guinea pig  gccttggaaggcg---cctgat---
B D          Squirrel  accttggaaggag---ctagat---
B D            Rabbit  gcctcggaggatg---atggtt---
B D             Human  ----------ggg---ctagat---
B D             Chimp  ----------ggg---ctagat---
B D           Gorilla  ----------ggg---ctagat---
B D         Orangutan  ----------ggg---ctagat---
B D            Gibbon  ----------ggg---ctagat---
B D            Rhesus  ----------cgg---ctagat---
B D            Baboon  ----------cgg---ctagat---
B D          Marmoset  ----------ggg---ctagat---
B D   Squirrel monkey  ----------ggg---ccaaat---
B D       Mouse lemur  gcctgggaaggag---ctatat---
B D          Bushbaby  gcctcaaaagaag---ctagat---
B D               Pig  gcctcgcaaggag---ctagat---
B D            Alpaca  gcctcagaaggag---ctagat---
B D           Dolphin  gcctcagaaggag---ctagac---
B D               Cow  gcctctgaaggag---ccagat---
B D               Cat  gcttcggatagag---ccagat---
B D               Dog  gcctcagaaagag---ctgga----
B D             Panda  gcctcggaaagag---ctagat---
B D             Horse  gcctcggaaggag---ccggac---
  D  Little brown bat  acctcggaagaaggttctagat---
B D          Elephant  gcctcggaagggg---ctagat---
B D        Rock hyrax  gcctcggaaggag---ctagat---
B D            Tenrec  gcctcggaagggg---ctggat---
B D           Manatee  ggctcggaaggag---ctagat---
B D         Armadillo  gtctctgaaggag---ttagac---
B D          Platypus  --gtcagaaggag---gagtaaagg
B D           Tarsier  =========================
B D           Wallaby  =========================
B D              Pika  =========================
B D             Sheep  =========================
B D              Fugu  =========================
B D      Atlantic cod  =========================
B D      Nile tilapia  =========================
B D         Zebrafish  =========================
B D     X. tropicalis  =========================
B D            Turkey  =========================
B D        Coelacanth  =========================
B D   Tasmanian devil  =========================
B D           Opossum  =========================
B D            Lizard  =========================
B D        Budgerigar  =========================
B D       Zebra finch  =========================
B D           Chicken  =========================
B D    Painted turtle  =========================
B D             Shrew  =========================
B D             Sloth  =========================
B D          Hedgehog  =========================
B D           Megabat  =========================

Inserts between block 32 and 33 in window
B D           Rabbit 5bp

Alignment block 33 of 730 in window, 56692659 - 56692663, 5 bps 
B D             Mouse  tccac
B D               Rat  tccac
B D      Kangaroo rat  -cccc
B D    Naked mole-rat  tccag
B D        Guinea pig  tccag
B D          Squirrel  tcccc
B D            Rabbit  tccct
B D              Pika  tccct
B D             Human  tcccg
B D             Chimp  tcccg
B D           Gorilla  tcccg
B D         Orangutan  tcttg
B D            Gibbon  tcctg
B D            Rhesus  tcctg
B D            Baboon  tcctg
B D          Marmoset  tcctg
B D   Squirrel monkey  tcctg
B D       Mouse lemur  tcctg
B D          Bushbaby  tcctg
B D               Pig  c----
B D            Alpaca  ccctg
B D           Dolphin  tcctg
B D               Cow  tccag
B D               Cat  tcctg
B D               Dog  tcctg
B D             Panda  tcctg
B D             Horse  tcttg
  D  Little brown bat  tccat
B D          Elephant  tctta
B D        Rock hyrax  tctta
B D            Tenrec  tttga
B D           Manatee  tctta
B D         Armadillo  tcttc
B D          Platypus  tcccc
B D           Tarsier  =====
B D           Wallaby  =====
B D             Sheep  =====
B D              Fugu  =====
B D      Atlantic cod  =====
B D      Nile tilapia  =====
B D         Zebrafish  =====
B D     X. tropicalis  =====
B D            Turkey  =====
B D        Coelacanth  =====
B D   Tasmanian devil  =====
B D           Opossum  =====
B D            Lizard  =====
B D        Budgerigar  =====
B D       Zebra finch  =====
B D           Chicken  =====
B D    Painted turtle  =====
B D             Shrew  =====
B D             Sloth  =====
B D          Hedgehog  =====
B D           Megabat  =====

Inserts between block 33 and 34 in window
B D         Platypus 3860bp

Alignment block 34 of 730 in window, 56692664 - 56692748, 85 bps 
B D             Mouse  ttcc---tgcgcatctctcctcagacctcgctcgtgcccaaag---------------------ggactt
B D               Rat  ttcc---tgcgcatctctcctcagacctcgctggtgcccaaag---------------------ggaccc
B D      Kangaroo rat  ttcc---c-cgaaagt---ctgagccctcgctagtg----gag---------------------ggagcg
B D    Naked mole-rat  taccttttctgcatttctccgcagaccccgttagttccgggag---------------------gg----
B D        Guinea pig  cacc----------ttctccgcagaccctgctagtgctgggag---------------------gg----
B D          Squirrel  gtct---c-catacctctcctcagatcccgctagagccaggag---------------------gg----
B D            Rabbit  ttcc---tgca--tttctcctcagatcccactggt-ccgggag---------------------gg----
B D              Pika  tctc---ggtatctctctcctcagaccccaccggt-ctgggaa---------------------ga----
B D             Human  ttgcttctccgcgtctctccgcgggccgctctagcgccgggaa---------------------gg----
B D             Chimp  ttgcttctccgcgtctctccgccggccgctctagcgccgggaa---------------------gg----
B D           Gorilla  ttgcttctccgcgtctctccgccggccgctctagcgccgggaa---------------------gg----
B D         Orangutan  ttgcttctccgcgtctctccgccggccgctctagtgccgggaa----------------------g----
B D            Gibbon  ttgcttctccgcgtctctccgccggccgctctagtgccaggaa---------------------gg----
B D            Rhesus  ttgcttctccgcgtctctctgccggccgctctagtgccgggaa---------------------gg----
B D            Baboon  ttgcttctccgcgtctctctgccggccgctctagtgccgggaa---------------------gg----
B D          Marmoset  ttgcttctccgcgtctctccgccagccgctctagtgcctggaa---------------------gg----
B D   Squirrel monkey  ttgcttctccgcgtctctccgccggccgctctagtgccgggaa---------------------gg----
B D       Mouse lemur  ttccttctccgcgtctctccgcagacctcgctagtgccgggag---------------------gg----
B D          Bushbaby  tttcttctccgtgtctctcctcagaccctgctaatattgaagg---------------------gg----
B D               Pig  ------ctccgcatctctcctcagaccccgcgggtgcccggag---------------------tg----
B D            Alpaca  ttccttctttgcatctctcctcagaccccgcgggtgccgggag---------------------gg----
B D           Dolphin  ttccttctccgaacctctcctcagaccccgctgctgccgggag---------------------gg----
B D               Cow  ttccttccccgcatctcttcccagaccccgctggtgccaggag---------------------gg----
B D               Cat  ttccttctcgtcgtctctcctcagacccggcctgtgccgagag---------------------gg----
B D               Dog  ttcctccgcgcggtctctccttggatcccgctagcgccgagag---------------------gg----
B D             Panda  ttccttctcgtcgtctctcctcagatcccgctagtgcggagag---------------------gg----
B D             Horse  ttctttctcggctcctctcctcggaccc----------gggag---------------------gg----
  D  Little brown bat  ttcgttttccgcatctttcctcagacacctctagggcggggaggtggtagtggaggcggggggtgg----
B D          Elephant  ttccttcccggcatcgcctctcagtccgcgctggggccagaag---------------------gg----
B D        Rock hyrax  ttcctatcctacatctcccctcagaccgcgct-gggccagaag---------------------gg----
B D            Tenrec  acctttctccgtagcttgcctctgaccgcccgggggccaggag---------------------gg----
B D           Manatee  ttcctttcaggcatctctcctcagaccacgctggggtcaggag---------------------gg----
B D         Armadillo  ttccttctccgcgcctccccttagacagcgctagggccagt-g---------------------gg----
B D           Tarsier  ======================================================================
B D           Wallaby  ======================================================================
B D             Sheep  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================
B D         Zebrafish  ======================================================================
B D     X. tropicalis  ======================================================================
B D          Platypus  ======================================================================
B D            Turkey  ======================================================================
B D        Coelacanth  ======================================================================
B D   Tasmanian devil  ======================================================================
B D           Opossum  ======================================================================
B D            Lizard  ======================================================================
B D        Budgerigar  ======================================================================
B D       Zebra finch  ======================================================================
B D           Chicken  ======================================================================
B D    Painted turtle  ======================================================================
B D             Shrew  ======================================================================
B D             Sloth  ======================================================================
B D          Hedgehog  ======================================================================
B D           Megabat  ======================================================================

                Mouse  ggtg-----c--------ac-----tgcaagtggcgggcccgtggcattg--ggaccac
                  Rat  ggtg-----c--------ac-----cgcaagtggcaggcccgtggcactg--ggaccac
         Kangaroo rat  agcgttcgcc--------ac-----cgctgat----ggcctttgacaccc--ggaccgc
       Naked mole-rat  -gcg-----c--------gc-----cacaggtgacggccccgtgacactg--ggaccgc
           Guinea pig  -gtg-----c--------ac-----cacagatcacagccccctgacact---ggaccac
             Squirrel  -gcg-----c--------gc-----cacaggtgat-ggcccgtgacactg--ggaccgc
               Rabbit  -tcg-----c--------ac-----tgcaggtgacggc----tcgcgcccctggagcac
                 Pika  -agg-----c--------gc-----cacaggtgaccacgtcgtagcactcgcaacacac
                Human  -ggg-----c--------gc-----cgcaggtgac-tgcccgcggcactg--ggacggc
                Chimp  -ggg-----c--------gc-----cgcaggtgac-tgcccgcggcactg--ggacggc
              Gorilla  -ggg-----c--------ac-----cgcaggtgac-tgcccgcggcactg--ggacggc
            Orangutan  -ggg-----c--------gc-----cgcaggtgac-tgcccgcggcactg--ggacggc
               Gibbon  -ggg-----c--------gc-----cgcaggtgac-tgcccgtggcactg--ggacggc
               Rhesus  -ggg-----c--------gc-----cgcaggtgac-tgcccgcggcactg--ggacggc
               Baboon  -ggg-----c--------gc-----cgcaggtgac-tgcccgcggcactg--ggacggc
             Marmoset  -ggg-----c--------gc-----agcaggtgac-tgcccgcggcactg--ggagggc
      Squirrel monkey  -ggg-----c--------gc-----agcaggtgac-tgcccgcggcactg--ggagggc
          Mouse lemur  -agg-----a-------cgc-----agcaggtgac-cgcccgcggcactc--ggaccgc
             Bushbaby  -ggg-----a--------gc------gcaggtgag-cgcccgcagcacta--ggaccgc
                  Pig  -gag-----c--------gc-----cgcaggtgac-tgccagtggcacca--ggaccgc
               Alpaca  -ggg-----c--------gc-----cgcaggtgac-cgcctgcggcactg--ggaccgc
              Dolphin  -gag-----g--------gcgggggcgcaggtgac-cgcccgcagcactg--ggaccgc
                  Cow  -gca-----c--------gc-----cgcaggtgat-cacccgaagcactg--ggaccgc
                  Cat  -ggg-----c--------ac-----cacaggttac-cgtccgcggcactg--ggaccgc
                  Dog  -ggg-----c---------c-----cacaggttac-tgtccgcggcacgg--cgaccgc
                Panda  -ggg-----c--------gc-----cacaggttac-cgtccgcggcactg--tgaccgc
                Horse  -ggg-----c--------gc-----cgcaggtgac-cgcccgcggccctg--ggaccgc
     Little brown bat  -ggg-----cgggaggccgc-----cgcaggtgaa-ggccagaggcactg--ggacagc
             Elephant  -gga-----c--------gc-----cgcaggtgat-tgcccgaggcactg--ggaccgc
           Rock hyrax  -ggg-----t--------gc-----cgcaggtgac-tgcccgcggccctg--ggaccac
               Tenrec  -gac-----c--------gc-----cgcaggtgac-cgccctcggccctg--agaccgc
              Manatee  -ggg-----c--------gt-----cgcaggtgac-tgcccgcggcactg--ggaccgc
            Armadillo  -gag-----a--------gc-----ctcgggtgac-cgcccgcaggactc--ggaccgc
              Tarsier  ===========================================================
              Wallaby  ===========================================================
                Sheep  ===========================================================
                 Fugu  ===========================================================
         Atlantic cod  ===========================================================
         Nile tilapia  ===========================================================
            Zebrafish  ===========================================================
        X. tropicalis  ===========================================================
             Platypus  ===========================================================
               Turkey  ===========================================================
           Coelacanth  ===========================================================
      Tasmanian devil  ===========================================================
              Opossum  ===========================================================
               Lizard  ===========================================================
           Budgerigar  ===========================================================
          Zebra finch  ===========================================================
              Chicken  ===========================================================
       Painted turtle  ===========================================================
                Shrew  ===========================================================
                Sloth  ===========================================================
             Hedgehog  ===========================================================
              Megabat  ===========================================================

Alignment block 35 of 730 in window, 56692749 - 56692765, 17 bps 
B D             Mouse  tgac-agatttatgaaga
B D               Rat  tgac-agatttatgaaga
B D      Kangaroo rat  tggc-aggctcgtggaga
B D    Naked mole-rat  tgac-agatttatgggaa
B D        Guinea pig  cgac-agatttatggaga
B D          Squirrel  tgac-tgatttatggaga
B D            Rabbit  tgac-agatttatggagg
B D              Pika  tgtcaagattaatgaagg
B D             Human  tgac-agatttatggaga
B D             Chimp  tgac-agatttatggaga
B D           Gorilla  tgac-agatttatggaga
B D         Orangutan  tgac-agatttatggaga
B D            Gibbon  tgac-agatttatggaga
B D            Rhesus  tgac-agatttatggaga
B D            Baboon  tgac-agatttatggaga
B D          Marmoset  tgac-agatttatggaga
B D   Squirrel monkey  tgac-agatttatggaga
B D       Mouse lemur  tgac-agatttatggaga
B D          Bushbaby  tgac-agatttatgtaga
B D        Tree shrew  tgac-agatttatggaga
B D               Pig  tgac-agatttatgaaaa
B D            Alpaca  tgac-agatttatgaaga
B D           Dolphin  tgac-agatttatgaaga
B D               Cow  tgac-agatttatgaaga
B D               Cat  tgac-agatttatgaaga
B D               Dog  tgac-aggtttatgaaga
B D             Panda  tgac-agatttatgaaga
B D             Horse  tgac-agatttatgaaga
  D  Little brown bat  tggc-agatgtgtgaaga
B D          Elephant  tgac-agatttatggaga
B D        Rock hyrax  tgac-agatttatggata
B D            Tenrec  tgac-agattgatggagg
B D           Manatee  tgac-agatttatggaga
B D         Armadillo  tgac-agatttatggaga
B D           Tarsier  ==================
B D           Wallaby  ==================
B D             Sheep  ==================
B D              Fugu  ==================
B D      Atlantic cod  ==================
B D      Nile tilapia  ==================
B D         Zebrafish  ==================
B D     X. tropicalis  ==================
B D          Platypus  ==================
B D            Turkey  ==================
B D        Coelacanth  ==================
B D   Tasmanian devil  ==================
B D           Opossum  ==================
B D            Lizard  ==================
B D        Budgerigar  ==================
B D       Zebra finch  ==================
B D           Chicken  ==================
B D    Painted turtle  ==================
B D             Shrew  ==================
B D             Sloth  ==================
B D          Hedgehog  ==================
B D           Megabat  ==================

Alignment block 36 of 730 in window, 56692766 - 56692905, 140 bps 
B D             Mouse  ctttacaagcatcgagcctgggtcgttggagg-cagggt-tgagttcaacagagga----ggagaa-gcc
B D               Rat  ctttacaagcatctagcctgggccgttggagg-cagcgt-tgagttcaacagcaga----ggagaa-gct
B D      Kangaroo rat  ctcc-ccagcttctggcctgggcctgccg-gg-aagggt-ggagtcccgccgggga----caacgg----
B D    Naked mole-rat  ctttac-agcatctggtctggatgagccgggg-ccgggc-ggagtccatcggagga----gaagc---gc
B D        Guinea pig  ctttac-agcatctggtctgggaaa----------gggt-ggagtccaccagagga----gaagca-tga
B D          Squirrel  ctttac-aacatctggcctgggtccgcggggg-cagggc-tgagtccagccgagaa----aaagca---c
B D            Rabbit  cttgac-agcatctagcctgggtccgcgg-gg-cagggc-agactccaggcgagga----agag---agc
B D              Pika  cttaac-tgcacctggcctgggtccgctg-gg-ctg-----cacgctgggtggggg----cgggggtagc
B D             Human  cttcac-agcatctggctggggtccgcgaggg-cagggc-ggagtccggtcgatcc----ga-----tgc
B D             Chimp  cttcac-agcatctggctggggtccgcgaggg-ca-ggc-ggagtccggtcgatcc----ga-----tgc
B D           Gorilla  cttcac-agcatctggctggggtccgcgaggg-cagggc-ggagtccggccgatcc----ga-----tgc
B D         Orangutan  cttcac-agcatctggctggggtccgcgaggg-cagggc-ggagtccggtcgatcc----ga-----tgc
B D            Gibbon  cttcac-agcatctggctggggtccgcgaggg-cagggc-ggagtccggtcgatcc----ga-----tgc
B D            Rhesus  cttcac-agcatctgactggggtccgcgaggg-cagggc-ggagtccggtcgatccggt-gg-----tgc
B D            Baboon  cttcac-agcatctgactggggtccgcgaggg-cagggc-ggagtccggtcgatccggt-gg-----tgc
B D          Marmoset  cttcac-agcatctggctggggtcctcgaggg-cagggc-ggagtccagccgagcc----gg-----tgg
B D   Squirrel monkey  cttcac-agcatctggatggggtccgcgaggg-cagggc-ggagtccagctgagcc----cg-----tgg
B D           Tarsier  ccttac-agcatctgggcttggatcgcgggggtcagggctggagtccagccgaggagg--ag-----tgc
B D       Mouse lemur  ctttac-agcatctggcctcggtccgtggggg-cagggc-ggagtccg--cgaagg----cg-----tgc
B D          Bushbaby  ctttac-agcatctggcctgggtctgccgggg-cagggc-ggagtcca---gaaag----cc-----tgc
B D        Tree shrew  ctttac-agcacctggcctgagtctgtgggga-ctgagc-agagtccagcagagga----gg-----ttg
B D               Pig  ctttac-agcatctggcctgggcccgc-gggg-cagggcaggagtccgaccaaaaa----ggtg---cac
B D            Alpaca  ctttac-agcatctggcctggacccgcagcga-cagagcaagagtccagcc--aga----ggcg---cac
B D           Dolphin  ctttac-agcatctggcctgggcccgcagggg-cagggaaggagtccagccaaaga----ggcg---caa
B D               Cow  ttttac-ggcatctggccgaggcccgcaaggg-cagggaaggagtccagaaaaagg----ggcg---c--
B D               Cat  ctttac-agcatctggcctgggcccgaagtgg-cagggcagaggtccagcctgaga----gacg---cgc
B D               Dog  ctttac-aacatctggcctgggcctgcagtgg--agggcaggagcctagcctaaga-----gcg---cgc
B D             Panda  ctttac-ggcatctggcct---------------------ggagtccagcctaaga----ggtg---ctc
B D             Horse  ctt----agcatctggcctgggcccgcagggg-cagggcaggagtcctgccagaga----ggcg---ggc
  D  Little brown bat  ctttac-agcatctggcctgggc--gcaggga-cggggtgagagtcgggccccaaa----ggcg---cgc
B D          Elephant  cttaac-agcatctggcc----------tggg-cagggctcgagtccagcggagga----agcg---cgc
B D        Rock hyrax  cttaac-agcatctggcc----------tgga-cagggcccgagtccagcggagga----ggcg---cgc
B D            Tenrec  ctgaac-agcatctggct----------gggg-cagggcgctgggccagaggcgcaggcgggcg---cgc
B D           Manatee  cttaac-agcatctggcc----------tggg-cagggcgcgagtccagccgaaga----ggcg---cgt
B D         Armadillo  ctttat-agcgtcaggccaggccccttaaggg-cagagcgggagtacacccgcgga----ggca---ggc
B D           Wallaby  ======================================================================
B D             Sheep  ======================================================================
B D              Fugu  ======================================================================
B D      Atlantic cod  ======================================================================
B D      Nile tilapia  ======================================================================