>ExoN
GCTGAAAATGTAACAGGACTCTTTAAAGATTGTAGTAAGGTAATCACTGG
GTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACACTAAATTCA
AAACTGAAGGTTTATGTGTTGACATACCTGGCATACCTAAGGACATGACC
TATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAA
TGGTTACCCTAACATGTTTATCACCCGCGAAGAAGCTATAAGACATGTAC
GTGCATGGATTGGCTTCGATGTCGAGGGGTGTCATGCTACTAGAGAAGCT
GTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCT
AGTTGCTGTACCTACAGGTTATGTTGATACACCTAATAATACAGATTTTT
CCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAACACCTCATA
CCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGT
ACAAATGTTAAGTGACACACTTAAAAATCTCTCTGACAGAGTCGTATTTG
TCTTATGGGCACATGGCTTTGAGTTGACATCTATGAAGTATTTTGTGAAA
ATAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTT
TTCCACTGCTTCAGACACTTATGCCTGTTGGCATCATTCTATTGGATTTG
ATTACGTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGTTTTACA
GGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCATGGTAATGC
ACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTCCACG
AGTGCTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGT
GATGAACTGAAGATTAATGCGGCTTGTAGAAAGGTTCAACACATGGTTGT
TAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTA
ACCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTC
TATGATGCACAGCCTTGTAGTGACAAAGCTTATAAAATAGAAGAATTATT
CTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTGTATGCCTAT
TTTGGAATTGCAATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGA
TTTGACACTAGAGTGCTATCTAACCTTAACTTGCCTGGTTGTGATGGTGG
CAGTTTGTATGTAAATAAACATGCATTCCACACACCAGCTTTTGATAAAA
GTGCTTTTGTTAATTTAAAACAATTACCATTTTTCTATTACTCTGACAGT
CCATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACC
ACTAAAGTCTGCTACGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCT
GTAGACATCATGCTAATGAGTACAGATTGTATCTCGATGCTTATAACATG
ATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTA
TAACCTCTGGAACACTTTTACAAGACTTCAG