Value histogram for hg38.snp150Flagged.observed
 
valuecountgraph
A/G48360************************************************************
C/T44864********************************************************
G/T14504******************
C/G13316*****************
A/C12181***************
A/T11511**************
A/G/T6964*********
C/G/T6844********
A/C/G6565********
A/C/T6356********
A/C/G/T4917******
-/A3582****
-/T3467****
-/G3037****
-/C2988****
lengthTooLong438*
-/AG427*
-/CT409*
-/AA377 
-/TT361 
-/AT316 
-/TG316 
-/CA271 
-/GA259 
-/GT258 
-/TA193 
-/TC176 
-/AAG143 
-/GAG121 
-/AGA104 
-/CC100 
-/AC99 
-/GAA94 
-/CTT89 
-/GG79 
-/TTC75 
-/GC70 
-/TCT69 
-/GGA60 
-/CCT56 
-/CTC55 
-/GTT53 
-/AGAA47 
-/AAGT45 
-/AAGA45 
-/AAAG44 
-/AACA44 
-/ATC44 
GC/TT43 
-/AAT42 
-/TCC41 
-/A/AA40 
-/CAG40 
-/CAA40 
-/CG40 
-/GAAA40 
-/TGA38 
-/GTTT38 
-/ATT38 
-/AAA36 
-/T/TT35 
-/AGG33 
-/AAC32 
AA/GC32 
-/CTTT31 
-/AAAA31 
-/ACA31 
-/TTT30 
-/ACAG29 
-/TTTG29 
-/CAAA28 
-/TGC28 
-/TGT28 
-/GAC27 
-/TTG27 
-/GCC27 
-/TCA27 
-/CTG27 
-/TGG26 
-/GCA24 
-/GGC24 
-/TAT24 
-/TAA23 
-/AGTA23 
-/AGC22 
-/AACT22 
-/ACT22 
-/ATTA22 
-/A/T22 
-/TCAA22 
-/GAGA21 
-/ACAA21 
-/GAT21 
-/AGAG21 
-/ACTT21 
-/ATG21 
-/CAGA21 
-/AGTG20 
-/TAAA20 
-/CCA19 
-/CTCT19 
-/CGG19 
-/GGT18 
-/TTAA18 
-/GATA18 
CT/GC18 
-/ACTG18 
-/GCT18 
-/ATCA18 
-/TTGT18 
-/C/T18 
-/GTG18 
-/TCAG17 
CT/TC17 
-/AATG17 
-/CTTA17 
-/GTAA17 
-/CAGT17 
-/CGC17 
GA/TT17 
-/GACT17 
-/ACC17 
-/TCTC17 
-/CCG17 
-/TGAA17 
-/GAGT16 
-/ATTT16 
-/AAAT16 
-/TCTT16 
-/GTGA16 
-/CACA16 
AA/TC16 
AT/GC16 
-/ATA16 
-/CTGT16 
-/CAT15 
-/TTTTA15 
-/AATT15 
-/ATCT15 
CTAGGACCACTTC/GATCGTGGAA15 
-/GTCT15 
-/CTCA15 
-/TTA15 
C/GG15 
-/AAAC15 
AG/GC15 
-/GGG15 
-/TAG15 
-/CTGA15 
-/TTAG15 
-/TATT14 
-/TTCT14 
-/TAC14 
-/TCTG14 
-/AATA14 
-/GACA14 
-/TCTA14 
-/TAAG14 
-/GTCA14 
-/GTTA14 
-/TGTT14 
AT/GA14 
-/A/G14 
-/AGTT13 
-/TTTT13 
-/TAAT13 
-/CAC13 
-/TGAG13 
-/TACA13 
CA/TG13 
-/AGAT13 
-/GTGT12 
-/G/GG12 
-/TAGA12 
-/TTTA12 
-/C/CC11 
-/TACT11 
AA/G11 
-/GAAG11 
-/ACG11 
-/AGAC11 
-/AAGAA11 
-/TTCA11 
-/A/C11 
AG/CC11 
-/AGT10 
-/GTC10 
-/CTTTT10 
-/G/T10 
-/CCGC10 
-/GGAAGCAGGCC10 
-/GGCGGCC10 
-/CCTGTTCACCTGTGGCCCCC10 
-/TTGA10 
-/GCCT10 
-/TGAC10 
-/GCAGCAGCCGATCT10 
-/ATAA10 
-/GCG10 
-/CTAA9 
-/TAGT9 
-/AATC9 
-/CATT9 
-/GTTTT9 
-/TCG9 
-/AAGTA9 
AG/GA9 
(DUP 4359 BP)/-9 
AA/GG9 
CC/G9 
-/ATTG9 
GA/TC9 
-/ACCA9 
-/AAAAG8 
-/ACTC8 
-/CTA8 
-/AGCA8 
-/ATGT8 
AG/TC8 
AG/C8 
-/CACACA8 
-/TTAT8 
AGACA/TTTGGC8 
-/ATTGT8 
AC/GT8 
-/GAAAA8 
-/GTGTGT8 
-/NNNN8 
-/CGT8 
-/AGCT7 
-/TATA7 
-/C/G7 
-/TACTT7 
-/TATC7 
-/AGGAA7 
-/TGTG7 
-/AGAGAGGTCACCCAGGCCCCCCGGGGC7 
-/GAAGA7 
-/ACCCAGGC7 
CTTCC/T7 
GC/TG7 
-/ACAC7 
-/TCCC7 
-/TTAC7 
AA/TG7 
-/CCCACTCACAGAC7 
AG/T7 
-/CCTG7 
-/TCACGACC/TCAGGACC7 
-/CCAA7 
-/CATC7 
CC/TT7 
-/T/TTT7 
-/TCAC7 
-/TTTC7 
-/TATG7 
-/AGTC7 
-/TGTC7 
-/GGCGGC7 
-/AGGG7 
-/GATT7 
AA/CC7 
-/CCC7 
-/TCCT7 
-/TGAT7 
C/TT7 
AT/TC7 
A/CC7 
-/CAAT6 
-/T/TT/TTT6 
-/A/AGA/G6 
-/GTAAGG6 
-/ACTA6 
-/GTA6 
-/TGGCGGGTCTG6 
-/CGCAG6 
GG/TT6 
-/GAAGCCCCTCACCCTGAGATGGG6 
-/GTAAGTGCA6 
-/TGGA6 
CG/GC6 
-/AGGCGG6 
-/ACCT6 
-/GCTCAGATCACCCA6 
-/AAAAA6 
CT/G6 
AC/GG6 
-/AGACGCCGAGG6 
-/AGGA6 
-/CTGC6 
A/GC6 
A/TT6 
-/GCCA6 
-/ACCGGAACACACAGA6 
-/AG/GA6 
CT/GG6 
CG/TA6 
-/CGCGGGCGCCGTGGATAGAGC6 
-/CCAGAT6 
-/GGGTCTCAGC6 
-/TGTGTG6 
-/TTTTT6 
G/TT6 
-/TGCGAC6 
-/GTAT6 
-/AGAAA6 
-/A/AA/AAA6 
-/TCCAGATCCTGTA6 
CT/TA6 
-/ACAAA6 
-/CAGC6 
-/GGTCAGGGCTGAGGCTTGG6 
AG/TT6 
-/ATCC6 
-/GGAG6 
-/GTGGAG6 
GG/T6 
-/CTTTA6 
AC/TT6 
AA/GT6 
-/GGCACGTGC6 
-/GACCTCAAGGGCCTCCACCAGCAGG6 
AA/T6 
-/GTGAGGAACCCCAGGGG6 
GT/TC6 
-/GACTGGG6 
-/CAAG6 
-/TCTCA5 
CT/TG5 
-/TAAAG5 
-/ACAT5 
-/GATTA5 
-/NNNNNNNN5 
-/GT/GTGT5 
-/GGCA5 
-/ATAT5 
-/CTAT5 
-/CCCC5 
C/GA5 
-/CCCT5 
AT/TA5 
-/CCTTT5 
-/ATATAT5 
CG/TT5 
A/CT5 
-/GGTA5 
-/AGGC5 
-/TTTTG5 
-/CCTT5 
GG/TC5 
-/TAAAA5 
-/AC/ACAC5 
C/TCT5 
-/AGCC5 
-/AA/AAA5 
-/TAAC5 
-/TGTA5 
AT/TG5 
-/GAGACTAC5 
-/GGTG5 
CC/GA5 
ACGAGGAGAA/TCGTGGAGAT5 
AG/CA5 
-/CA/CACA/CACACA5 
GC/TA5 
-/ATCTT5 
-/A/GT5 
-/TGCA5 
-/ATGA5 
-/GAAT5 
-/GGCC5 
-/ATTTT5 
-/GGCCT5 
-/CGTC4 
-/CTCTCT4 
-/TAAAT4 
-/TTCTT4 
CA/T4 
-/AAGGAGGATC4 
-/TACC4 
CA/GG4 
-/AACC4 
-/GTAAA4 
AT/GG4 
GT/TG4 
-/ATGC4 
-/GCAC4 
C/GT4 
-/CCGCCG4 
CC/T4 
-/ACACAC4 
-/ATGTGT4 
-/NNNNNNN4 
-/CGGG4 
-/GGGCC4 
-/TGGG4 
-/AATAA4 
-/CGCC4 
-/GTAAG4 
A/GG4 
-/AAGG4 
GG/TA4 
-/GTAG4 
-/TGCT4 
-/GAAAG4 
-/TTCC4 
-/GTTAA4 
-/CTCC4 
CC/GG4 
-/GCAT4 
-/GGCGGCGGC4 
-/ACCC4 
-/NNNNNNNNNNNNNNNNNNNN4 
-/AAAGA4 
-/GCCGCC4 
-/CTTC4 
-/GGAA4 
-/GCCGAG4 
-/ATAG4 
-/CCGG4 
-/AACTA4 
A/TC4 
CC/GT4 
-/AAGAG3 
-/CGGC3 
-/NNNNN3 
-/GATG3 
-/CACATCCGGATGTAGGATC3 
-/CAAAT3 
CC/TG3 
-/AAAGC3 
-/TCAT3 
-/GGCG3 
-/GGGG3 
-/GATGT3 
-/TGCC3 
-/CTAAT3 
-/CATGAGCAGGAGGCCCCAG3 
C/TA3 
-/CATA3 
GC/T3 
-/TTCCC3 
-/GT/TG3 
A/TTT3 
-/CCTC3 
-/A/AAA3 
-/CCAG3 
AA/CAC3 
-/CCCA3 
-/GTGG3 
AC/CA3 
-/AAACA3 
-/GGAGGA3 
-/GAAC3 
-/GGAAA3 
-/GCAG3 
-/GACTT3 
-/GTATAT3 
-/CTGG3 
-/AACG3 
-/CAAC3 
-/GCC/GCCGCC3 
-/AAAAT3 
-/TTAAA3 
AT/CC3 
AAA/GAG3 
-/AGACC3 
-/TGCCC3 
CG/T3 
-/GCGGC3 
CA/TC3 
-/CATG3 
AG/GT3 
-/AGTTA3 
CG/TC3 
-/CCACCA3 
-/TTGG3 
-/TGGT3 
-/AAGTT3 
-/GTGTAT3 
GT/TA3 
-/GAGAA3 
-/AAA/AAAA3 
-/GAGGT3 
-/CGAG3 
-/AACTC3 
-/GGCT3 
-/GAGAGA3 
-/TCTTA3 
-/CTTTG3 
AC/GA3 
-/ACGT3 
-/CGCCGCCGC3 
-/CAAAG3 
-/TTCAA3 
-/AT/TA3 
-/AAGC3 
-/TGAGG3 
-/TACACA3 
-/CAGCAG3 
-/AAGCT3 
-/TC/TCTC3 
AT/G3 
-/AC/ACAC/ACACAC3 
-/GTTCT3 
-/CTCTT3 
-/TTTTTT3 
-/GTAC3 
-/CTCAA3 
-/CACT3 
-/GCCCT3 
-/GCCG3 
AG/CT3 
AA/TAG3 
-/CTAC3 
-/ATAAA3 
-/GT/GTGT/GTGTGT3 
-/AGCCG3 
-/CTCTC3 
AC/CT3 
-/CTTAT3 
-/AGATA3 
-/GCGCCG3 
-/CTAG3 
-/CTTG3 
-/TTTGT3 
-/GTTAT3 
-/AGGT3 
AT/CG3 
AA/C3 
-/AAATT3 
CAGA/TTGTCGAGGTAAGTGT3 
-/TTATA3 
-/ATATA3 
-/ACACA3 
CA/TT3 
-/TTTAA3 
-/CAGCGC3 
C/TGA2 
-/TCTTG2 
ATA/TT2 
-/CTTAC2 
-/ACTTA2 
-/GAGCC2 
-/TATTA2 
CTC/TT2 
-/ACCAG2 
-/TAATA2 
-/CCAT2 
-/TCAAAAGGGACATAGAAAA2 
-/TCCTCC2 
-/GAGGA2 
-/AC/C2 
-/GCCGCGCCC2 
-/GGCCAA2 
-/CTCTCTAT2 
-/GATAA2 
-/CGAGCTCCAGGCCCAGATCGC2 
-/AGAAG2 
-/T/TC2 
-/GCGTC2 
-/CGA2 
-/TT/TTCT2 
-/GACAT2 
-/TAGAA2 
-/ACAATG2 
-/GGCAGCGGCGGCCCCCCC2 
-/ATCAT2 
-/GT/GTGTGT2 
-/GTGC2 
A/TG2 
-/GCAGCAGCAGCAGCA2 
-/TATCA2 
-/TA/TATATA2 
-/ATTAA2 
-/CCCTGCCCCTGCCTACACCCCCTC2 
-/AGTAA2 
-/CAACA2 
-/GGCGCGGGGCT2 
-/AGGCCC2 
-/AGAGGA2 
G/TGCTTTT2 
-/CGCCGGCCAGGAGGAGTAC2 
-/TCTATA2 
-/NNNNNNNNNNN2 
-/G/TGT2 
-/GCTG2 
-/CCAGAGAGGGCGGGGCCCAC2 
AC/CG2 
CTA/TT2 
-/GCCTCCGCCGCACCCCC2 
-/GCAGCAGCAGCA2 
-/AGAAT2 
-/AACAG2 
-/GGAGCGAGAG2 
-/ACCAGCTGG2 
-/G/GG/GGG2 
-/TGCTGGC2 
-/GACTAC2 
-/CTTCT2 
-/ACGGAGC2 
-/GTCCCGCATGGCGCTGTACTC2 
-/ATATT2 
-/TAACATCTTTAGAGTCGGGCATTTAAG2 
-/CCCGCGCGCCC2 
-/GATAAGA2 
-/A/C/T2 
-/TTATT2 
-/GACG2 
-/CCAAGAACCTGAGGA2 
-/AACAA2 
-/ATAAG2 
-/GCCAGTG2 
GTA/TT2 
AAAAACA/GAAGCTGC2 
-/T/TA2 
-/TTAAG2 
-/CCTCTGCCTCTACGCA2 
AA/AT/CT/GC/TA2 
-/GGAGG2 
-/ACCAA2 
-/AGGTAA2 
-/GCCTAGGCAAGAGTAAGACTCCA2 
-/GCGCT2 
-/AGGAGG2 
-/TT/TTTT2 
-/GGTGCA2 
AC/G2 
-/GCCCCC2 
C/TCTCCA2 
-/TGAACAGGAAGAAAAGTATG2 
-/AAAG/AAGA2 
-/CAGGC2 
-/CACC2 
-/GTTGA2 
-/GCCGACCTCCTCC2 
AC/TG2 
-/GGTT2 
-/TGGCC2 
ATA/CT2 
-/AGCTC2 
-/GAGAAT2 
-/CAGTGTGGA2 
-/TTGGCAG2 
-/TTTAC2 
-/CCCCG2 
-/ATCTG2 
GA/T2 
CGC/TGT2 
-/GCGC2 
-/AGCAAC2 
-/TGATG2 
-/GGGT2 
-/GCTGTCTGCTGGCTGTTGTCGGT2 
AGA/GGG2 
-/AGAAGAA2 
-/ATGGA2 
CC/TA2 
-/TAATT2 
-/TATAT2 
-/GTCATC2 
-/GCTA2 
-/ATGCT2 
-/GGC/GGCGGC2 
-/GCTC2 
-/AAGAAGA2 
-/GCAA2 
-/CAAAA2 
-/CTCCA2 
-/TATAA2 
A/GT2 
-/CGAGGAGG2 
-/AATAAACCTCACGGTGCCCCAG2 
-/AAAAC2 
CG/GA2 
ATGGTAAAAAAACA/TACC2 
-/CTCAG2 
-/ATCG2 
-/CTTCA2 
-/GGCGGCGGGGAGCAGCATGGAGCC2 
-/GGCAGC2 
-/AAGAGA2 
-/GTTAAA2 
-/GCAGCA/GCAGCAGCA2 
-/A/AG2 
ACCTG/GTAGATCA2 
-/TAGTG2 
CTGG/GGTC2 
-/CAGTGCTGATGAAAGCCCTGCGG2 
-/GGGCCCTGGGCTGCC2 
-/CGAT2 
-/CTACGGCAAGAAGGGAGCCAGTGGC2 
-/TGGGC2 
-/GGCCC2 
-/GCTGG2 
-/AGCCGCGGCCGCGGCCGCCGCGGC2 
-/TTAGA2 
-/TCTTC2 
-/GCAGCAGCA2 
-/AAAAAAAAAA2 
-/TCCA2 
-/GCAGCA2 
CCT/TCC2 
-/TGGC2 
-/NNNNNNNNNNNNNNNNN2 
-/CATGC2 
-/GGGGC2 
-/TCCTGGTGC2 
-/GGGGCTACC2 
-/CCTCA2 
-/ACCCCC2 
-/TTAAC2 
-/GGCCCC2 
-/GGT/GTG2 
-/TGACA2 
-/GGGC2 
-/GGCGGCGGCGGC2 
-/CTT/TCT2 
-/GCACAC2 
AC/T2 
-/CACAGA2 
-/AAAAAA2 
-/TGGCGG2 
-/GCCACC2 
-/CAGAA2 
-/CGG/CGGCGG2 
-/AGCGG2 
-/GTAGT2 
-/TTTTTTG2 
-/TGATA2 
-/CCTGTCTG/TCTGTCTG2 
-/GAGG2 
-/CAGG2 
CC/TCT2 
-/GGTC2 
-/C/CC/CCC2 
-/GTTC2 
-/TATTT2 
-/GCCCC2 
G/TC2 
-/CCATAACCTCTC2 
-/CGCCGCC2 
-/TAACT2 
-/CGCG2 
-/CATCTG2 
-/ATTAAA2 
-/GATGA2 
-/CTGCTG2 
GG/TGA2 
CCT/TC2 
-/ACCG2 
-/ATC/TCA2 
-/ACAAAA2 
-/TAACAG2 
-/TGTAA2 
-/ATAC2 
-/GGGCCC2 
-/AAACTTGCTCAACGACATCGTGAT2 
AT/C2 
-/CTTAA2 
-/A/T/TT2 
ACT/CCC2 
-/CGGCGG2 
A/CGG2 
A/CTGCGCTCCG2 
-/AACTT2 
-/A/TT2 
-/TGTGTA2 
-2 
-/AAATC2 
-/GAGCGGC2 
-/GTCTT2 
-/TCCTGCT2 
AA/GAG2 
-/GGAC2 
-/TGGAG2 
-/CCCG2 
-/GGACCTCTCCTCCAGGAGTGAT2 
-/GACC2 
-/AGCCCCGGCCCC2 
-/CCGA2 
-/GAGCTGCACTGTGAC2 
-/CCCTC2 
-/GTGGAGCACTCGA2 
-/TGAGA2 
-/ACCGGCAGCCGAGGA2 
-/AGAGA2 
-/T/TG2 
-/CACAC2 
-/ACTTG2 
-/CGCA2 
-/GGAGAATT2 
-/GAGC2 
AA/CG2 
-/TCAAGT2 
-/GGGACGCC2 
-/ATTAT2 
-/CCAC2 
-/GCA/GCAGCA2 
-/TTGTC2 
CAGTAC/GTTGAGA2 
-/ATCAA2 
-/ACTCGAGTGCTCC2 
-/CGC/CGCCGC/CGCCGCCGC2 
-/ACAAT2 
-/GAGAT2 
-/AAGAGGAAG2 
-/TAGAATGAGTTAC2 
-/TCTCCTCG2 
-/AATCC2 
-/ATGG2 
-/TTTCG2 
-/TGACAAGAT2 
-/TTCTTTT2 
ACG/GCT2 
-/GCCCTC2 
(TG(12))2 
-/AAGAAGAAG1 
-/AAAATGCTGAATGA1 
-/GACGA1 
-/AAGGACCTTTG1 
-/CTGCCG1 
-/GGCCGCGCCCGCCGCGCCCCC1 
-/AGGTCTAATCAAATTAAAA1 
-/TATGAGA1 
AAAA/TTT1 
AAG/C1 
-/GCGCTACGTGGAG1 
-/AAACCCTCCCACC1 
-/T/TTTT1 
-/GAGCAGGAG1 
-/CTATGATCATC1 
-/TTGTTGTGCATG1 
-/TCTCTTAGT1 
-/ACTCA1 
-/TAAAAAAAAA1 
-/AGAAAGT1 
-/CTAATTT1 
AG/TTAA1 
CC/GGTG1 
-/CCGAGGGATG1 
GGC/TGT1 
-/AAAGTC1 
-/GCAAAA1 
-/GTCCGGCCCCTCCA1 
-/GGGCTT1 
-/GGAGATGCTTGTG1 
-/GGAGCC/GGATCC1 
-/ACATG1 
-/GAGTGT1 
-/CCCATG1 
-/GGCTCGCCCGGGTT1 
-/TCCGGC1 
-/AAATAAACGAG1 
-/GCCTGGTCAAGA1 
-/TTACAATTTACTGGCA1 
-/GAAAGCTCTCAAAGCAAAG1 
-/CTTTCC1 
(12678 BP DEL)/-1 
-/TGCTCTTTGAGT1 
-/GCCAAGAGCCTGCCCTG1 
-/AGCGCC1 
AGA/TGTGTGTGTGTGTGT1 
-/GCCGCCGGGCC1 
-/GTTGCTTCCCTCTC1 
-/TAATCAA1 
-/TAAGGG1 
CCACA/GCTG1 
-/CTTCTAAAATG1 
-/AATGACAAGAATAAAAGCTGC1 
-/CGCTGCGCG1 
-/TGCTGCTGC1 
(CAG(6_31))1 
CCAGCTGTTCT/G1 
-/CTTAGCGTCCTGCGACAG1 
-/CAGCGCTCCTCGG1 
-/GGAATTAAGAGAAGC1 
-/TGCACACACTCAGCGGGCCGAGTGGCC1 
-/CAGCAGTGACGCGCGCTGGG1 
CCT/GCTA1 
-/ACTTCCTT1 
CCT/G1 
-/GCACGTTTTACG1 
-/NNNN/TTCC1 
-/CTGCTC1 
-/GGCCTG1 
-/CAGCACCCACGCCT1 
-/TAACCTC1 
-/CGCGAGCCGCGCCAGGTAG1 
CGC/GGG1 
-/AATCTGCTTG1 
-/NNNNNNNNNNNNNNNNNNNNN1 
-/GGCGCGGC1 
-/TCTCAAG1 
C/GGCCATCTTT1 
-/ATTAAGAGAAGCAACATC1 
-/ACAGA1 
AGACT/TC1 
-/GCGGCTACTGCACAAGCTGCAGCAG1 
ACA/T1 
-/AGGGCAACACGGAGC1 
C/GTAGTCATGCAT1 
CTG/TGACCCA1 
-/TGCTGGCGCTGGCGCTGG1 
-/ATGGCGG1 
-/TTCCCTGAGGAGGAGAAGTGCTTCTGC1 
CTGCGCT/TGGCGCTGCCTGC1 
-/CGCCCACCTCCCC1 
-/TGCGGCGGCGGCGGC1 
CCCCCAGGCCCTCCTGG/T1 
-/GAAGT1 
AA/TT1 
-/CAGGGAGGAGAGCTCTGCC1 
AA/CATCTCCGAAAGCCAACAAGGAAATC1 
-/GTGGCTGGCGCAGGCGGGC1 
GGA/T1 
-/AAGTTCATCAAGGG1 
-/TCTTTT1 
-/CATCTTG1 
-/GAGGAA1 
CAC/GG1 
ACC/CAGCCAGGAACTG1 
-/GACAGGA1 
-/CCCCAGCAAG1 
-/TTGGCACCCACCTGGGCC1 
-/GGCGGC/GGCGGCGGC1 
-/CGCCGCCGT1 
-/AAATATATATTTATG1 
-/CAGCT1 
-/GAACATGGA1 
GAACCCTGCAAAAAGTGACACTATC/T1 
-/CCCCCACGT1 
-/ATCTCGCTCCGG1 
-/TCGG1 
-/A/AC1 
-/CCCTTATGATGCCAGCAAGTGGGAGTTT1 
-/GCCGCCGCTGCCGCG1 
-/GAAGAGCA1 
-/GCCATGG1 
-/ACTAC1 
-/ACTTTCATGAAGTTC1 
-/TAGATAATTCAA1 
-/AGTATGAGTA1 
-/ATCACCA1 
-/CTAACTGCA1 
-/TCTGTGAAGCTGGGGAC1 
-/TAACCTGT1 
-/GAAAACAAACAAA1 
-/CCCGGCCCGGGT1 
AAA/TAAAG1 
-/AGTCA1 
CATCATGCATGATTCG/GGCC1 
-/GA/GAGA/GAGAGA/GAGAGAGAG1 
-/TACGG1 
-/ACCACC1 
-/GGGACCCCGGCTCC1 
-/CTGGCTCCTGG1 
GTGCTCC/TAAG1 
AAAAACCAAAA/GAAAACCAG1 
-/CCT/CTC1 
-/CCTTGTGCTG1 
-/TTTAAGT1 
-/GCAGGTGTG1 
CAGG/TGA1 
(GAT(14))1 
-/GGCCCGTGGTCCTCCTGG1 
-/AGTTTCGCTGCCACGA1 
-/TATGGAA1 
ATGCATGCACC/GATCCA1 
-/GACGCTGTGTGCACCCGC1 
-/CTATCTCCACGT1 
-/TCAGCTTTTGAAGTACTTCG1 
-/GGCAGCAGGTG1 
CG/TCT1 
-/CGAGGTGAGTGTATACAAAA1 
-/ATAATC/ATCATA1 
(A 5858 BP DEL)/-1 
-/AGAGCTCCGAG1 
-/CCTTGAATG1 
-/TC/TCAC1 
GATGCC/TTCGGCATCGCAATGGTT1 
-/AC/ACACAC1 
-/GGCGAGTGCATCCACTCCAGC1 
AGA/CT1 
-/GGCTAAAT1 
-/GTTATTCGGCGGCTGGA1 
-/AG/TCAG/TG/TGTG1 
-/GAGCAAGTCCAGCTCCT1 
-/GTGGAACTGGCTGACC1 
-/TATGCA1 
-/GCAGCGGCGGCG1 
AA/GAT1 
(DUP 22727 BP)/-1 
-/ACCTCCACC1 
-/GCAGCAGCAACAGCA1 
CAACAATGATG/T1 
-/ATCAC1 
-/TTAAGACAG1 
-/TGCGGG1 
-/GGACAAATCTG1 
-/GAAACTGCCA1 
-/AGCATGCCAGCAAACAGATCAG1 
AACACC/GAAA1 
-/ATAAAACCCTAGCCTTCAAA1 
-/GTTTGTTTGTTT1 
-/GGGAGTGATGCCACCCTGCCT1 
-/TCCTCCTCC/TCCTCCTCT1 
-/AGGGTGCCG1 
-/TTTT/TTTTT1 
-/GAGCTTA1 
-/TCGCCCCGCCGCGGG1 
-/AGTTG1 
-/AGAAGGAGCACCACCACCATCACCACCA1 
-/GCATACTAATAAAAG1 
-/AAGGT1 
-/TAGGTA1 
-/ACCCGGCTGCCCC1 
-/AGGATC1 
-/TTTGTGCTTTTCA1 
-/TTCAAGAACTCTAC1 
AA/CTCCCTT1 
-/TCCTGGGTC1 
GGATACAACAAAGGGGACTTC/TAAA1 
-/TGTGGGCTC1 
-/GCCCGGCTCCGCCACATC1 
-/CTGGCCCACCAGGGTGTGCGGC1 
-/GACATGTCCCTTTAT1 
-/TTCGGT1 
-/GGGGAGTGTGGTGGCAG1 
-/GAGTGG1 
-/ACTTTGGAGGTAAAGTTGTTACT1 
-/GCTGTTT/T1 
-/GGCTGCCGGC1 
A/CTGAAT1 
-/GCGTTGAAG1 
GT/TAAAAAG1 
ATTAA/TT1 
-/ACCCCGGCCTGAGGAGCCGCACCTGTC1 
-/CAGGAAGGGAA1 
-/GGAGCGGCCA1 
-/ACAACAGCA1 
CCCCGAT/NNNNNNN/TCCCGGAC1 
-/CA/G1 
-/GACT/TTGA/TTGG1 
-/ATAT/ATATAT/ATATATAT1 
-/TAAACATTGC1 
-/CAGTCCCCA1 
-/GGCCCTCCTGGTCCACCAG1 
-/TGGTAAA1 
-/GGGTATG1 
-/ACCCTGCGGAGGCT1 
-/ATGTTCAC1 
-/ACATT1 
-/CAAGTGCTGTTGG1 
A/GGCTTTGGAGGCGGCAGCG1 
-/T/TGTT1 
-/CGAGTCCGAAAT1 
-/TATACCGTGAAGGGC1 
-/GGCGCGGGGATCTAGGACGCCG1 
AGAT/TGGAGGAG1 
-/GCAAAAAC1 
CACCCTGAAGGG/GTCAGCATCCCCAAC1 
-/CCCTCCCTCCCTCCCTCCCTCCCTCCCT1 
-/AGCGA1 
AAAAGC/CGCG1 
-/GGCCTCTTGCT1 
-/CGTCTTCCTTTGCCTG1 
-/ACTGCCA1 
-/CCGGG1 
A/GCTCT1 
AAT/TTATTGAAAGTGG1 
-/AAAAATGCCA1 
AAGA/G1 
-/CAGTC1 
AACC/GTTAATGA/NNNNNNNN1 
-/AAGCACCTCCTCCCGG1 
-/GTGCCG1 
AA/TAC1 
-/ACCTTCCTTT1 
C/TAT1 
-/C/CCC1 
ATG/GGC1 
-/TAGTAGGGGTAGGCCGAGGGGA1 
CCG/TCCGCAGCCACTCC1 
-/AGATC1 
-/CTCGGGCCGCCGGGGGCCGG1 
-/TATAAGCTCCGCAATG1 
-/TGTTT1 
-/TATAATGCAATGG1 
-/ATTCACTCAGATTG1 
-/GGTAATTTC1 
-/AGAAAGAG1 
GGTACT/TAATG1 
-/CCTGGGATTTA1 
-/TTATCATCTTGCAACTTCAAAAT1 
-/AGAAAT1 
-/TTATCTTC1 
GGCCTC/TGCGTCTGTGTGTG1 
CG/GT1 
-/AGGGACCATGTGCATCTATGG1 
GA/TGGAGGAACAGT1 
-/AGAGGAGCCAGCGC1 
-/ATAAAACCCATGCTTGCTATGA1 
ATT/GG1 
-/AATCT1 
AGAATCCAGAAGGCCTTTC/TTT1 
-/CAAGAGGTGT1 
-/CCCGGC1 
(2502 BP DEL)/-1 
-/GCCTGG1 
-/AATTTAC1 
-/GCCGCCGCCTCCTC1 
CTGTGGTGG/TTCTTGGA1 
-/CTGCCC1 
GTGGGG/T1 
ACAG/GC1 
-/CGGCCCGGCGGCACA1 
-/GCCGCACCGCCGCCTGCCCC1 
-/CGGGAACAAG1 
-/TAATC1 
-/GGCAACTACAGCAGCAGCAGCAGC1 
-/CCAGTG1 
-/AAGGA1 
-/ACCGACCACATCTGCAGA1 
-/GCAGCAGCAGCAGCAGCA1 
-/GTATT1 
-/TGGTGGTGGTGG1 
-/ACAGGGCCCTATATGTTC1 
GAA/TAT1 
-/GC/T1 
-/GGAATTAAG1 
-/CCGCGGAGGGCGCTGGAGACG1 
-/CCGATCGGCC1 
-/TTTCAC1 
GTTACTTCC/T1 
-/GTGGACTGCTGGAGTT1 
AA/GAAATT1 
-/GCTCGTCCCTGTGATGCCGCAGGA1 
AGTGA/T1 
-/CGGACC1 
-/CGCCAGGT1 
-/CGTTACA1 
-/TTTATAAAA1 
-/TTGGGAAAGT1 
-/GAGGCCGTCACCAG1 
-/GATTC1 
-/TCCTGCCCACCACGCTCACCACC1 
ATTAAGAGAAG/GC1 
-/CCCCCGCAGCCCCCGTCTA1 
-/GCTACTGCACAAGCTGCAGCAGCTGCCC1 
-/TCATTCAT/TCATTCATTCAT1 
-/GTACTGATGGCTTTCTACCAG1 
-/AATCTGGTGACTATAC1 
-/GATTTCAG1 
-/CGTGGAGT1 
-/GCTGGCGCTGGC1 
CC/TGTTATTAGTGATATATCTAA1 
-/CGAGCT1 
-/CTTCAGACTTAGGAGGCAG1 
-/GACGCCTGCCGTT1 
-/GTTTGGATGGTCCCCCTGGTCCAGATG1 
CTTTGGA/GG1 
ATC/TCCTGGTTTA1 
-/GGCCTGGGCT1 
-/ATCTCCGAAAGCCAACAAGGAAAT1 
-/GCACAGG1 
(CTG(10_37))1 
-/CACGT1 
-/GCCCTG1 
-/GTTTTG1 
-/CCATGGTGGTG1 
-/GAGGGAGAGGGAGGC1 
-/CTGCACGCTT1 
-/TTTTTTGTC1 
-/T/TA/TC/TG1 
-/GGCTCTCTGGGGAGCCCACC1 
-/CAAGCTGC1 
-/AAGATGCCGACCAGAACCA1 
-/CCCTCTCA1 
-/CTCCCTT1 
-/CACGTG1 
-/TGGGTCCCGGAG1 
-/ATGAA1 
-/GGTTTCAA1 
-/ATTTA1 
-/A/AA/T/TA1 
-/CGGGTGGCTTCTGTGAG1 
-/CCGCCCGGCACCC1 
ATGCA/GCCTG1 
-/CACACTCCATA1 
AGAAA/TAAT1 
-/CCTGC1 
-/GTATTA1 
-/AATAAT1 
-/CCCGGCCCG1 
-/GGATCGTCATAACAGAATTT1 
-/TTACTAA1 
-/GTCCCGGCCCGG1 
-/GAAAAAGAAGAGAA1 
CCAG/T1 
-/CATCATGCATGA/GACATCATGCAT1 
-/GTTTTGTTTT1 
-/AACCT1 
-/GCCGCCCGCCTGGC1 
-/GCCATC1 
-/GGGGGCATCTATGTCTGC1 
-/ACCAGTAA1 
-/AGTGCCATCTC1 
CC/TTACTGAT1 
-/GGCGGGAC1 
-/TTTAAGTA1 
-/GCCGGAC1 
-/AGGAAG1 
A/TCTCAT1 
-/TCCCCCTGG1 
-/GCCACGATGGGAAGTGCATCT1 
AGT/C1 
-/TCAAA1 
-/CCTTA1 
-/AATCCC1 
-/TATCTCCACGTC1 
-/TCTGGAAAAGCAGAGA1 
-/CCGTTCCATGTCGGGT1 
-/CTCAAGGAGACAATCGAAGACTGTT1 
-/CT/CTCT1 
-/A/AAT1 
(A 4555 BP DEL)/-1 
-/GAAAC1 
-/CCTCCACCTGAGCCCGAGAGCTCCGA1 
-/GAATGT1 
-/AAGGCAGTCAGGAGAGAGGCT1 
-/CCTGCCCTT1 
-/AAGGCCAAGAGAA1 
-/TCTCTC1 
-/AGTGCATCCACTCCAGCTGGCG1 
-/AAATAAATTAAAG1 
AGT/TTAC/TTCC1 
-/CTGGAA1 
-/ACCAT1 
-/A/CCCA1 
-/GT/GTGT/GTGTGT/GTGTGTGTGTGT1 
-/AGCAAGTCCAGCTCCTC1 
-/CTGAGGGGTGG1 
-/TGGGCTGCGC1 
-/GATCGTTAGCAGAAACA1 
-/CAGAACTTTGATCT1 
G/NNNNNNNNNNNNNNNNNNNN1 
-/GAACA1 
-/TGCTCCCACCCCTGCCCCCACCTCCAC1 
-/CCAGCAGCAACA1 
-/TCGTCCC1 
-/ATTTAACAT1 
-/ATTCACCACCAT1 
-/ATGGGCACCCTGATCTCGGAGC1 
-/GGACAAATCTGA1 
-/TAATG1 
GC/TCATACAGGTCATCGCT1 
CAGT/TCCTG1 
-/TTAGATCGT1 
GATAATCTA/TTATG1 
-/GAGCTCGCCATCC1 
-/TAATGG1 
-/CC/TCTTTTT1 
-/TATTTATTTT1 
GATAGA/T1 
-/CCTCGGCG1 
-/A/CATTCATG/G/NNNNNNNN1 
-/GCAGCAGCAGCGCC1 
AGTACAGG/TTTGA1 
-/A/AA/AAA/GA/TA1 
CATC/T1 
-/AATTTGGTGCT1 
-/GCCAATGC1 
A/TAG1 
-/GAGTGTCAGGATCCCGAC1 
-/CAACTTGTTGA1 
CATGG/NNNNNNNNNNNN1 
ACAGAAGAACTTA/CTT1 
C/GCCAACCGGCGGGAGAA1 
-/GTATGG1 
-/GGGCTCCCC1 
-/GATTGC1 
CATAAACAAAG/TAA1 
-/GAGACC1 
-/AAAGCAAGAGAATTTGAGAAGATGAA1 
-/GAAACAAGAA1 
-/NNNNNNNNNNNNNNNNNNNNNNN1 
-/GTAATTGCCATCAATCAGGAC1 
-/CCCACTTTGGA1 
AA/CTTAC1 
-/TGAAGAC1 
-/CCTGGCGCGGG1 
-/TCCAAGC1 
AA/TTTCT1 
AT/TAG1 
ATT/CTAATAA1 
-/GAGTCCTCAGGTGGTGGGGATGTGGGG1 
-/GATTACCCCTTCTG1 
-/TGGGGGATC1 
-/GCATGCACCAGCAGCCCAGCCTG1 
-/GGGCACCGTGCTGGACGACAGCCG1 
-/CTTACAGCTGCCTCTGTTGT1 
-/AGGAAC1 
-/GATT/TTGA1 
-/TAAATGAG1 
ATA/NN/TT1 
-/GGACACGGAAGCT1 
-/GGGACTT1 
-/CAGAATAGCTATGG1 
-/CACCCCCAGTGCC1 
-/ACGTGTTC1 
-/TGGTGTGAGAGGACCAC1 
-/CATGGCTGAG1 
-/TTCATGTTATCTACAGAC1 
-/GGCTCCGGAGGTAGCAGCTAC1 
-/GAGAAA1 
-/TGTGGTGAAGGAGCTTTCATCATTCACC1 
-/AAGGAAAAGCCAGGCCCC1 
-/GCAGCCCCT1 
-/GATAGGAGT1 
-/TTGCC1 
GGTATGCTGTTA/TT1 
-/CAACATGG1 
-/CCCTCCCTCCCTCCCTCCCTCCCT1 
(CAG(12_28))1 
-/CGGCCAGCTCCCATCGCCCC1 
-/CTTATA1 
GGGT/TCTTC1 
-/TCCTTCT1 
-/CCCGG1 
-/TGTAGAAAAA1 
A/TAC1 
-/AAGAAG1 
AATA/TCTATGATCTCTTTAGGGGT1 
-/TCCCTGTGCCAAAGAGA1 
AGATCATG/CA1 
-/TCTGGTCCGCC1 
-/GCGA1 
-/TGGCCAGTG1 
-/TCGCTTTTCA1 
-/TCGCAGGATTTTTCT1 
A/TTTTAT1 
-/ATGGAGATCCACGCC1 
-/ACCAGACGCC1 
-/ATGCA1 
-/CGCTGC1 
-/ACAGCCACCACTTCT1 
(TATA(3))1 
-/AAAACATGCAGAGCAG1 
AG/GCC1 
-/TGCCAC1 
-/ACGTGCTGCGGGCACTGG1 
-/CCAAACC1 
GTT/TTTGCCAAGGAA1 
-/ATTAAAATGGAAGCAAAA1 
-/ACTTTTTTTTTTCCCTTTGGTG1 
AGT/GC1 
AGTCAGCTCCACAGCATC/CA1 
-/ACAGCCCCCCG1 
-/CGCGCTGTGCAG1 
-/TATAAAACCCATGCTTGCTATG1 
-/A/AA/AAAAAA1 
CTATAAGCCAGAA/TT1 
-/AGATAT1 
-/CCCGGCCCCGGC1 
AGG/TC1 
C/GGCGATG1 
NNN/TGAGG1 
-/ATAGGGCAAGGGATGGCAGCTAGAGC1 
-/TGCTCCCTGC1 
AACCGGCG/GGGA1 
-/CTGCACAAGGAC1 
-/ACTGG1 
-/ATCAGT1 
CG/TCC1 
-/GGCAAACAGAGCGTGCAGCAG1 
-/CAGGCCAAGACGGCTCCC1 
-/ACCGCCGC1 
-/GCCCAGTCCCCCGAACCCCG1 
-/GAGTTGG1 
-/CTGATGTCCTGGCCCGCC1 
-/ACCCCACCA1 
-/TGGGACTGTA1 
-/TTGAAGC1 
-/CTGCCCGGCCCC1 
CGCCGCTGCT/TGCA1 
-/CTTGAATCTAATATTGGCCCTG1 
-/GAT/TGAT1 
AGG/C1 
-/TGCCTGGC1 
AATTC/GGAATTAAGAGAAG1 
-/TCTCGG1 
-/CGCGGAGCGGTGCGGCGGCGG1 
-/ATGATG1 
-/GTTACTTC1 
-/TAGATT1 
-/CTCAGGG1 
AAGAAGGACAGG/T1 
-/GCTCGG1 
-/CCATTAAGG1 
-/GAAAGAACCTGTAGGTGGA1 
-/AGCCGCG1 
CAC/GAATGAGTATGAA1 
-/ATGT/TG/TGTG1 
-/CAGGAGGCC1 
-/AATTGATGG1 
ATTAAGAGAAGCAA/GC1 
-/TGGAACC1 
(T(12_46))1 
-/AGGCGGCTACTGCACAAGCTGCAGCAGC1 
AGCATCCAGC/GGCATCCAGG1 
ACTGCTCAT/C1 
-/ATCTGGTGACTATACA1 
-/GTTAATACAGA1 
-/TATTACTATCCTTGAGCTCCC1 
-/GTACT1 
-/GAGCTG1 
-/TGAAGTC1 
-/GTTTA1 
-/GTCCAGATGGATTGCAAGGTCCCCCAG1 
-/GGAAGGT1 
-/TATGACCAGGT1 
-/GACTGGAG1 
-/ATGGAT1 
-/TCTCCGAAAGCCAACAAGGAAATC1 
-/GCCGCCAGCCCCCGCCCG1 
-/TACAG1 
-/CACACGTTCTTGCAGC1 
-/TCCAGTCTGT1 
(CTATT(10_22))1 
-/TTTTACTACCAGGCTCTGAGTG1 
-/ACTGGACACCCA1 
-/CTATTACATGGATAAA1 
-/GCTCCTCCT1 
-/C/CA/CC/CT1 
-/CATGGCTCTCTGGGG1 
AGTC/T1 
-/CGCT1 
-/GGAGGGGGAAGAGGAGGAAGG1 
-/GTATGGGCCAGCAG1 
-/GGTCCTATTAT1 
ACT/GTG1 
CCCCACTTTTT/TTACAA1 
-/TCCGGCAGC1 
-/TTGAT1 
-/TCTCCAGGCTCCAGCA1 
-/GATAATCACACA1 
-/CACCACCTT/CACCTTCAC1 
-/ACACCCCCGCCC1 
-/GTCG1 
-/ACACGTT1 
-/CTGGTGGAGATGACCCCTCCAGAC1 
GGACC/TTA1 
-/CCACCACCA1 
-/CCTAT1 
-/CCTGGCTTTTATC1 
-/ATT/ATTATT1 
-/CGGCTC1 
CTCCTCCT/TG1 
AAAAAGG/GAAAAAGA1 
-/ATCATGCATGAT1 
-/ACACTGCCAGGTACTGACGTTTTACTT1 
-/GGATGGGG1 
-/NNNNNNNNNNNNNNNNNNNNNNNN1 
-/GGGCATCTATGTCTG1 
-/TCCCAGGGTC1 
CACA/TACTATGG1 
-/CCTTGTA1 
-/G/GAGTGG/GG/GGGTGG1 
-/TTAAGT1 
-/ACAAGGTGCAGGCAGGCTGGCCTGGGG1 
-/TCTGTGGCTGCCTGCAATTTCTGTCG1 
-/TCCTCTTCTGGGAGCAGTACATCGGCCT1 
-/TGGACCTCC1 
-/GGAAGTG1 
-/AGCTGAA1 
AAGAGAA/T1 
-/TTCTCT1 
-/GCGCCTGCCCTGCCCTCCTGGAGT1 
-/GGATG1 
-/TTCAAGTC1 
-/CGTGGTGTACGAGATGCGCGTC1 
-/AAAAAAAAAAAA1 
-/CATGTTGCAGAGCT1 
-/TATGA1 
-/TGAGCCCGAGAGCTCC1 
AATGTAAAACAAGGTTT/TA1 
-/CTGGTA1 
-/CTTCCTGCC1 
-/ACAACAGCAGCA1 
-/AATGG1 
-/ATCCACTCAGCTGGC1 
-/ATAAATTAAA1 
-/GGCTT1 
-/ATTGATAGAA1 
(2220 BP DEL)/-1 
-/TGAACCG1 
-/CGACAGGCGTTCCTGTCCGGCCGGTC1 
-/CAGGACATCCTCG1 
CGCG/GC1 
-/GTACCCA1 
GCA/TT1 
(CAG(8_36))1 
-/CCCACCTCC1 
-/ACCGTCTTC1 
-/TCCTCCGTCGG1 
-/A/C/G/T1 
A/TGGGCTG1 
CC/GTAATCCCA1 
G/TGCA1 
-/TGACAGCAGGTTACAG1 
ATCATT/G1 
-/GTCTGGT1 
GGAGGTC/TGAGGTT1 
-/CGGGCCTGGGCCGGCTCATCGAGCTGA1 
-/ACGAT1 
-/CTT/TTC1 
-/AAAATA1 
-/AGTGTTTACTAG/GTGTTTACTAGA1 
-/CACCCCCACCCC1 
-/CGTAAAA1 
-/GCGCAGCAGCAGCG1 
ACGGA/NNNN1 
(T(17_21))1 
-/GGTTGTGC1 
G/TATTCCCC1 
-/GCTCTGCGTGAA1 
GTC/TT1 
-/GGTTT1 
-/CTTGGAGAAGAATAT1 
CGGGCGGCCG/TA1 
-/GACATCGGGAAGA1 
-/GGCTCCCCA1 
-/CGGCTCCGCCACATCAAG1 
-/TCAGCACC1 
-/CGGCAG1 
-/AAGC/CAAG/GCAA1 
-/GAAGAAA1 
-/CCGAAAGCCGGGG1 
AATC/TT1 
-/AAAGAAAGCAAAAGGAAACACA1 
-/GTAAACAAG1 
-/TGTGCTGGACGGTGTCCC1 
-/GTGGTGGAT1 
ATTGA/NNNN1 
-/GGAATTGCCCACTTCCCCGCCACCTGA1 
-/GGGA1 
-/ACCCCAGAT1 
-/CCAGGCCTGT1 
-/GAAGG1 
-/CCGGTTCCGGCGGCCGGGGCTG1 
-/ACAGGA1 
-/AATT/TAAG1 
-/CCCTGTGTCTGCCTGC1 
-/ATACC1 
-/GCTTCTGCCT1 
-/CCAGGCCCC1 
-/CGTCTCC1 
CA/GTGGAGAGCAGGCTGGAT1 
-/AGGGCATTGTTTTTCAACATCCA1 
-/TGAGAGG1 
-/AATTC1 
-/TAAGA1 
-/GGGGCCAGCCGGCCGCC1 
-/GGCTACGGCTCTGGAGGTAGCAGCTAT1 
-/A/AAT/AT/T/TAT1 
-/CTGTGGTGAAGGAGCTT1 
AAATCCCTGCCCTGTTC/G1 
-/GATCCCGACTCCGGGACAGCACCAGCC1 
ACCGCTGCAGG/GCCCT1 
ATCAGTTTGATCACT/TACTCCCA1 
-/CAGCCTCCC1 
-/CCCTCCCTCCCTCCCTCCCT1 
-/CGCCCGCGC1 
-/CAGGCTGGGGAAG1 
-/TGTTCTGAGAGTGATCACTCCAGAAAT1 
-/AACTCTGACCCA1 
-/TGCCTGGGGGTCTTCCTT1 
-/GGGTTGGGTTCCAT1 
-/GAAAAAGA1 
-/GTGTCAG1 
-/TGCTTTACATGGA1 
-/AGCCGG1 
-/TAGGAATT1 
-/CAACAAGT1 
-/ATTGCAGACAA1 
-/GGCTGCGCTTTGCC1 
AC/GTAATAT1 
-/GACTGCA1 
ACACACACACA/G1 
CACGGAAAGCA/GACTTG1 
-/GAGCCCCCGGGCCACAG1 
-/GCATCA1 
-/TTTATCA1 
-/ATAATCTTAGTCTTCACAAGTGTTTT1 
-/CCCCAATTGAAAGTT1 
-/ATACCGCTGGTAAGAGGAGCGAGGGCA1 
-/GCTTCAAA1 
-/CCAGGCAGAAGTGGGGCCC1 
AAAGGAAT/GG1 
-/A/TTAA1 
-/AGTAAA1 
-/AAAAGTATGAAAA1 
GCTACAAGAAACAC/T1 
-/ACAGAAAAAC1 
-/GCGCGGG1 
-/CATGCCCGCCTGGAACTT1 
-/TGTATAAAACCCATGCTTGCTAT1 
-/AAAGAT1 
A/GATTTCT1 
-/CTTTCTTCCA1 
-/TTGCAAT1 
-/TCGCGG1 
-/TGCTGGCTGTGCCAG1 
-/CCCCTCCAATTCGGA1 
CCT/GAGGA1 
AG/NNNNNNNNNNNNNNNNNN1 
-/TCTCTCT1 
-/TCTGCACA1 
CA/GT1 
-/AAATGGACAAGGT1 
-/T/TT/TTT/TTTT1 
-/AGTGTC1 
-/AGCGTGTGCAGCGACGGC1 
-/CTACTGGTGTCTGCTCCGG1 
G/TAGAA1 
-/CTGGGGCGCGCGCTGCG1 
GAA/TTTC1 
-/GCGGGCCAGG1 
-/GTGTGCTGGCCC1 
-/GTCTTGGCC1 
-/AGCCGC/CGC1 
-/TAATTGTCGGAC1 
-/TTTTTTTT1 
-/CAGCCTCAGTG1 
AATTC/GGAATTAAGAGAAGCAA1 
-/CTGGC1 
-/CTGAGC/GAGCCT1 
ATTCTATTGTTGTGCTATTGTTAT/TA1 
-/ATG/ATGATG1 
-/TACAC1 
-/CT/TT1 
-/CGAACATAC1 
-/CATACACA1 
-/GGCAACCCTAAG1 
-/AAAA/AGAA1 
-/CTTGT1 
-/GGGTCGCCATCGACAAC1 
ATCT/CTCA1 
-/CAGAAC1 
-/TCTGCCCAAATCA1 
-/TCACCGACTG1 
-/AAATAGG1 
-/AAGCTGACGG1 
-/TTAAGAGAA1 
-/AAAGAGG1 
-/GAGGTGCAGGCCATGCTCGGC1 
-/GGCCCAGGATCAGTAGGTGGAATAG1 
AGCATCCAGCACCT/GGCATCCAGCACC1 
-/GATGAG1 
-/AA/GT1 
-/AAAGGGGGCCCT1 
-/TTAAT1 
-/ATTACTATCCTTGAGCTCCCC1 
-/TGTTGAGTGGGCTGGGCCCAGCC1 
-/GAGAGTGT1 
-/CAGGCATCTG1 
-/GAGGATGCTGGCTACTTAAAGACCCCAG1 
(1913 BP DEL)/-1 
-/TTTCTAAAAA1 
-/ACAGTTCAGGAATGGTAAGTT1 
-/CGTGT1 
-/TCCAGGAAGCCT1 
-/CGGCGGCGCGG1 
-/GCCTGTAAT1 
-/ACTAAATGTAAGAAAAA1 
A/CACCAGCATTGG1 
-/GAAAAAGAAGAACTTTTTGAATGC1 
-/AGCTCTGACCT1 
-/GGCGGCGTGGAC1 
-/ATTGTAAGTTGAAAAT1 
-/AAGCCCTCGGGGGCTGCC1 
-/TGTTGGTGAACCAGTTCAGG1 
-/GAGGAGCAA1 
-/TTGCCGCGGCGACGGCGACTT1 
-/CCGGGCTCGTGTTCCAG1 
GGCCGTGGAAGAA/TGCCGTGGTGGAG1 
-/GTCTCCCTAAGGG1 
-/TCTTTTTCAATGAGGAGAA1 
-/TAGTACTGGT1 
-/ATCTATTCAGGCAG1 
C/GGAACTGCTCGCCCGAGCGTCGG1 
(CAG(36_38))1 
-/TGGGAAGCT1 
-/T/TTCACTTTTC1 
-/GAAATTTT1 
-/GCCGCT1 
-/CA/CACA/CACACA/CACACACACA1 
-/GTGGTG1 
-/ACCCCCGCCC1 
-/ACCAGCG1 
-/TTCCGGGATTAGCGAACTTCCAG1 
A/TAT1 
-/CCCCTC1 
AGTG/TT1 
-/ACCCGCCGCC1 
-/AACAGGTAA1 
AG/CATCACAGCTT1 
-/TTTGTTAC1 
-/CTCTGGCTC1 
-/CAGTTGTTTTCAC1 
AC/TTCTGCAAACTCCT1 
-/AAAGAATTTGTCAA1 
-/CCTGATAT1 
-/TCATGCATGATT1 
-/GAATT1 
-/GTCCGGAGCCT1 
-/GGGAGCAGAAGGCCCTGCGGCCCTC1 
-/ATCACGTCA1 
ACCT/TTCAAGAATGGC1 
-/GGTGCTGCTGGTCCTCCTGGGCCACCT1 
-/TGCTGCAGCA1 
-/AATG/ATGA1 
-/GACGGCG1 
-/TTAAGTA1 
-/AGAGTTAGCTGACTTTACACGGAG1 
-/ATGTATCCACGGCCCAA1 
-/TGGGTCCA1 
-/AGCCACGAAGGG1 
-/CTCCC1 
-/TCGGCAGTTCGTCTGTGACTCAGAC1 
AGGTACTACTTCCTGTAAAAC/T1 
(8651 BP DEL)/-1 
-/T/TT/TTTTT1 
-/AGCCCCTGTGTTGCCAGAGAGTACAGAA1 
-/GGCTGATGAGCCTGGAGAACCCGCT1 
-/GCGCGTC1 
-/GTT/GTTTTTTTT1 
-/TTGCT1 
-/CTAATTT/TAATTTC1 
-/TATCTTT1 
-/ATTTGCCAAA1 
-/CACCTCCACCTGAGCCCGAGAGCTCC1 
-/AATGTAAAACAAGGT1 
-/TATCCAGTTAT1 
-/GGTGGTGGGCA1 
-/C/TG1 
-/TAAGT1 
-/TGATGGTGG1 
-/GAGCGTCCCCTCACAA1 
-/AAAAAGTC1 
-/TGGAAC1 
-/AGTAG/GAGTA/TAGAG1 
-/CCATC1 
-/CCTGGAC1 
-/CGGCA1 
GTG/TTA1 
-/GCGT1 
-/ATATATCCAA1 
-/GCCCCCACCT1 
-/GAGGCCAAGT1 
-/ACAATAACTATAAG1 
AAAAA/CAAAC1 
-/TCTGACGAG1 
AGC/T1 
-/CGCGCAGCTTGT1 
ACACCC/G1 
-/TCCTT1 
-/AGGAACAGG1 
CC/GGA1 
A/TACATTAATGCTTC1 
-/ATAAATAAATATATATAT/ATAT1 
-/GAGTTTTTTGT1 
-/CACCCC1 
-/TGGAAATTGGTAAA1 
-/CCCAAGGGGCGCAGC1 
ATGACTGG/T1 
-/AGCAGAT1 
-/AAATGAA1 
CTCA/TGAGTACTATGAG1 
-/TGAGAGTGAATGG1 
CTCTGC/GT1 
AG/NNNNNNNNNNNNNNNNNNNNNN1 
-/TGAATATAGAT1 
-/AAATGTCAGTGAA1 
-/ATC/CAT/TCA1 
GGAAGC/T1 
-/CTCCGCC1 
-/TGCTGG1 
GGCCGGCCGG/TGCCCGTCTGC1 
-/TAGCCGCAGCCGCAGCCG1 
-/TGAGAAGATGA1 
-/TACTTAT1 
CAAGAGATACAGAATCCAAAT/TG1 
-/AGCCGGG1 
CAGTTA/GGCAACTTT1 
CA/GTAAAATTCCAC1 
AC/TCA1 
ACACTGAT/TGAC1 
-/CTCCCTCCTCAGCTCCTCCAGG1 
-/CAGAGGCGGCA1 
-/ACTGACTGG1 
-/CACCCAGATG1 
C/TGAGG1 
NNNNNN/T1 
-/TCCCCGGGG1 
-/TAAGAGC1 
-/GACAGTGGACGAGGT1 
-/ATAGACTGACTACATTGGAAGCTT1 
-/TTCTGGAGTGCTCTG1 
-/GATC1 
-/AGGACCTCCAG1 
-/CCCCCCAGG1 
CA/GCGTCTTGGTGT1 
-/TCCCCTC1 
-/GGGCGACG1 
-/TTCTCTACATATAATCCTCAAGT1 
-/GCCAGTATCTGTG1 
-/CGAGTA1 
AAG/CAT1 
-/TGGCGCGTCCCGCCCAGGT1 
-/CCCGCCTGCTGCGCGACTACCAGG1 
CACACACACACACACACACACACACAC/T1 
AGTGA/TGTGG1 
-/GGGCCCGGGGGGCGCC1 
-/CAGCCAGGG1 
-/GGACTTGCCGCAGAG1 
-/TGTTAAGGC1 
-/TCTAC1 
-/CCCTCCCTCCCT1 
CA/GCAGGGGGCATC1 
-/GCGCGGGCG1 
-/ATCGCGCAG1 
-/AGGTAAATG1 
-/AGCATCAAC1 
CTAAG/TAACGA1 
-/AATTTCAC1 
-/TCACAGA1 
-/A/TGTT1 
GCTG/TTCATTCTGC/TTGATTCTGC1 
-/ACAAATC1 
-/TGAGCAAACAGCGGGGCTCCA1 
-/TGCGC1 
GTTTGGCAG/TGGTGGGGCTTT1 
AAA/CTGTAC1 
-/GAAAT1 
-/AC/ACAC/ACACAC/ACACACACAC1 
-/GCACGCAC1 
-/AGCATTGGAAA1 
(CAG(21_30))1 
-/CGGGGGGTGGTG1 
AG/TA1 
-/CCTCT1 
GTGTGGTGG/TGTTTTTTACATGACAGGT1 
-/TTGAAAGTTCCCCAA1 
-/AGGCTGGGCTGGCTCCA1 
-/ATATAGTGATGA1 
AA/TAGAGTGTGGGCCTCAGGAG1 
-/GGCAC1 
AAACAGAACCA/TGACTTAAAATTAATG1 
-/GATGGCAATGGAAGT1 
-/AAGAGCTAACATACAG1 
-/ACACTTGGGCTCAA1 
-/AGATATAGAGA1 
-/CCTCCCCCAGACGCC1 
-/AGCACTTCCGT1 
-/AGGCCCACCGTGA1 
-/AAATGCTGGT1 
-/TCCTTGTATAAAACCCATGCTTG1 
-/AAATGC1 
-/AAAGGAGAG1 
-/CATTCAAGAACCTCCACTTCA1 
-/ACCCCGCCCCCAGTCCCGGTCC1 
-/GCTGGCTGTGCCAGA1 
-/GTCGCCTGG1 
G/TA1 
-/TGCGTCAGCAAGTGTGCCTGATGCC1 
CTTT/GTTTTCTC1 
-/GGGCT1 
-/CCACTGGAGCGACTGG1 
-/GTACAGG1 
-/GCTATCCA1 
-/GTGGGGTTTGTGGCGCCCTCCCTCA1 
-/GAGGTTG1 
-/GGCCGCACCCCCGCCTCCGCCGC1 
CATTCACACACA/T1 
GGA/TT1 
-/GTGTGCTGGCCC/TGAT1 
-/GTAGA1 
-/GCAGCAGCC1 
-/TGCTGCTGCTGCTGCTGCTGC1 
-/TGAAGTGGAGA1 
-/CACAT1 
-/TAGCGGC1 
-/CAACTTGTGCAAAAAGATAGAATC1 
(504 BP DEL)/-1 
-/AATTCCCGTCGCTATCAA1 
-/CTACCT1 
-/TTCTACAACAAGAGCGAGGAT1 
-/GTATC1 
-/GAAACTCAAGCTCACCA1 
-/GTCAT1 
-/GAAAGTCTCAAAT1 
-/CCATACAC1 
-/GATTATCTGAAGGTG1 
AGCT/TCCACTCCTGATGCTGTTA1 
-/AACGGGTCGCCATCGAC1 
-/AGTCAAAAGATAAGAAAGA1 
-/AGCATAT1 
-/AAAAAAGAAA1 
-/ATGGCCGGC1 
-/ATAGGAA1 
CA/TTAAGAGAAGCAACATCTCC1 
-/GTGAC1 
-/AGCAGCGCCACAAGGAGG1 
GGAT/NNNNNNNNNNNNNNNNNNN1 
-/GGTGCAGGGAA1 
-/GCTCCT1 
-/CAAGA1 
-/AAGGTACGGCCTTGCCTGCCCTACATC1 
-/TCCCCGCA1 
-/TTGGTG1 
CGTGC/GCTGT1 
-/AAGGCGAGCATGGAG1 
-/AGCCTGCGC1 
AAG/CTT1 
ATTATGTTCCTTCTCCTTTTCC/CA1 
AAT/GCC1 
-/CACTGC1 
GTCCAGCAGCTTGCTAGTG/T1 
-/ACCATC/TCCAGGAAGCCT1 
-/ACGGCG1 
-/G/T/TC1 
-/AACTAAA1 
-/T/TC/TT/TTA1 
-/GGCCCCG1 
-/GTTCTTCCTGTAGG1 
(558 BP DEL)/-1 
AGAGACCGGCG/CA1 
-/AGACAAGACTTCTATCAG1 
-/TCTCCTCCTCCT1 
-/GGCGAC1 
CATGGCAT/GATC1 
-/CCATCG1 
ATA/TTT1 
-/ACAATAAGTTATATT1 
-/ATGTGCGGCGG1 
G/TTAACTTGGCAT1 
-/GAAGGCCTTAGAA1 
-/TGGCACTGACCCGAGACTCTGAGCG1 
-/CCGGGACTGGGCC1 
AAT/G1 
ATCGATCGAT/GAC/NNNNNNNNNN1 
-/GGCGGGCGCGGGAAGATGGCGGC1 
-/CACATA1 
-/CCGACGGCA1 
-/CACACCCCCGCCC1 
-/CAGGCCCCGCCGTGCGGCT1 
ATT/CACAGATTAAAAGAAATG1 
-/TGTGATTGAA1 
-/ACTGGGAG1 
AAATTAAGA/GGTTG1 
-/CCGCCCCGCAACCGCCGCCGCCGCCGC1 
-/GTTTACTTT1 
CCGCC/T1 
(CT(8_9))1 
-/GTGT/GTGTGT/GTGTGTGT1 
ATGAAGTTA/TCATGGT1 
-/TGGACCGTCGC1 
-/AAAGAATTT1 
-/CATGATTCGAAC1 
-/AGCAGT1 
-/TTGTCCGT1 
-/CACAGAAG1 
-/GCCAG1 
-/ATGGCTTCCCTCCCTCTCTTTACCT1 
-/GCCACCTGGTGCTGCTGGTACTCCTGG1 
-/AGTCCTTCGTAACAATAAAAA1 
-/GCCC1 
-/TTAAGTAACAGTAGCAT1 
AACA/TG1 
-/AAGAAGAGG1 
AG/TACT1 
-/GAACTGACGGAACTGTGG1 
-/GAGATTACAGGTGGCTGCCCGGG1 
-/ACGATGGGAAGTGCATCTCTCGG1 
-/ATGAATATTACTAATAGTG1 
AACAGTTGT/GATACTTCAG1 
-/AGCAGTGAC1 
-/GGTACTACAAGCTG1 
-/CAAAAA1 
AGA/T1 
-/GGAACACCAGCTGGCTG1 
-/AGATGCGCG1 
-/TGTAT1 
A/GTTCATAGCGG1 
-/CAGAAA1 
-/TG/TGCACG/TGTG/TGTGTG1 
-/TGGCA1 
-/CCCACCTCCACCTGAGCCCGAGAGCTCC1 
-/TAAAACAAGGTTTCAATAACCAGCCTG1 
-/TCTCCTGGACCCCCGGAG1 
-/TGGTGGTGGGC1 
-/CGAGCTACTTTTCCAGAAGGTATATTT1 
-/GGCATCCACAAGGCCATCGAG1 
-/GATGGT1 
-/TGTAACTGAA1 
-/AAACT1 
-/GAAACATCCTTCT1 
-/AGGCGGAGCACCCCAAGCC1 
ACAAGTA/TGTT1 
-/GTTTGT1 
-/GTGGCCTCCGGC1 
-/ATCACCGATGCCCAGCCTGCCTTCAC1 
GG/TGGCCCT1 
C/GCA1 
-/CCCACC1 
CTCCA/GT1 
-/GGACCAGCT1 
-/TCTTGAAT1 
-/ACGACTA1 
-/ATACA1 
-/CGGTATGGGCGGGGCCAGGGTG1 
-/TCATTAC1 
-/TATAAAAGAAGA1 
-/TCTGTGC1 
CACACC/G1 
-/AGGT/GGTA1 
-/CGGCTTTCCCCGTGAA1 
-/GTCTTCCAC1 
C/GGA1 
AATGCCTTTG/TTTTGC1 
AA/CAT1 
-/TGAAAGTA1 
-/AAATTGG1 
-/AGAGCAGCCCCAAG1 
AA/TTAC1 
-/GGAACATGATTGCG1 
-/GTATATT1 
-/TCCGACCGCTCC1 
-/GTATGT1 
AGGGTGGCT/CACTGA1 
C/GTCAACTTGTT1 
-/AACAAATGGGCAG1 
-/GAACTACAGT1 
-/GACCTG1 
-/TTGGAC1 
-/CGCCA1 
-/CTGGGCCGAG1 
A/TACG1 
-/TAGCCGCAGCCGTAGCCG1 
-/ATTTC1 
AATGGCTTTGCCA/C1 
-/TTTGTATGAA1 
-/AAAGCTGAGGCCGA1 
-/CCAAGAT1 
-/GTAAAATTC1 
-/CCTGTATATTCTTAAG1 
ACACTGAC/TGAT1 
-/GAAAGGGGGCCTGAATGGTGTGGA1 
-/CCCAACACTCC1 
-/AAGAAATTACTGAAAATTACAA1 
-/TTGGC1 
-/GTGTGTCCACA1 
-/AATTTCTTTGGACCA1 
-/CTACC1 
-/CCCCACCCCCG1 
-/TTCAAGCGGGGCAAGGCCCAC1 
-/GA/TTT1 
-/AGGAATTA/ATTA1 
-/TCCTACGAAGCTCTGAAAGGT1 
-/AGTCAGAA1 
(324 BP DEL)/-1 
-/TGCAAGAGC1 
-/GCCCCGGGGCG1 
-/GAAGACT1 
-/AGTATCTGTGCC1 
-/ACCTCAAGATGTG1 
-/AACAGA1 
AAAAAAAA/G1 
-/GACCCTGAGATC1 
-/GAGTGGGGACCGCAT1 
GAA/TG1 
-/GAGGAGCTGCTGGCCCGGGCGGGCCGCG1 
-/CGGCCCCCC1 
-/GGCATTGCAAAAGCTCATTGA1 
-/TAGATCCT1 
-/ATGAAGAGAGCTACT1 
-/CCCTCCCT1 
-/GCCATGGAGACCCCG1 
-/TGCCGCGC1 
-/GGTGAGG1 
AGTGGCGC/TGG1 
-/C/TTT1 
-/GAGTCA1 
-/GCCCATA1 
-/CCAGATAGA1 
-/CCCCCTGCTCCAAGCA1 
-/TTTGTTTGTTTGTTTG1 
-/GCTGCTCTCAGAGA1 
-/GTTATGTTAT1 
-/TTAATAATCCTTTTGTTTTCTTAGAA1 
-/GTTTTAATTATTTG1 
GTC/TTT1 
-/CCTGCTGCTCGCGCTGGCCC1 
-/AAAACCGCTCGGAATTCCTTTTG1 
-/GGT/GGTGGT/GGTGGTGGT1 
-/GCGCTGCTCAA1 
AA/CCAGTAT1 
-/AGGGG1 
-/AATTTT1 
ACATA/C1 
-/GAGGGGGGTG1 
-/GTAGAGTGTGGGCCTCAG1 
-/CCGGGG1 
-/TACTGCGACCGGGGCTA1 
-/AT/ATAT/ATATAT/ATATATAT1 
-/TAACATAC1 
GAAGGATG/TTTTTCCT1 
-/ACCCTCTGTCA1 
AT/TTTA1 
-/CTGCAGA1 
-/GGTGTAAGAGCCCTCT1 
-/GCCACTGTC1 
-/GT/T1 
-/TAACTGTG1 
-/A/C/CC1 
-/AGAAAAGTAGTGAATAC1 
-/CAACGGTTGCCAGGG1 
-/GGCTGCA1 
-/TGGAGT1 
AGTGTGCCTCCAGTGCCTCGCTCCA/GC1 
-/GCGACCAG1 
-/CCACATTGGGATTATCGTCTACCGA1 
-/G/GA/GAG/GAGAG1 
AAGA/TCATTTAAGT1 
-/GCTAAAACAAG1 
(CAG(7_28))1 
-/GCTCCCTGTGTGTGTG1 
-/AGGTAGAAACAAG1 
AC/TGAAGGACGG1 
-/GGCCGCACCCCCGCCTC1 
CA/TAT1 
-/ACACACACACACACACTC1 
-/TGAAGC1 
-/TGTGCTG1 
-/GATACCTTCAGTTGGGCTTT1 
-/ACCTCGCCCCCCAGCTCCGGGG1 
-/GGGGGGG1 
-/GGCTGGCTCGTC1 
-/ATCCCCG1 
GAA/TGTTG1 
-/AAGATCA1 
-/GAACTCC1 
-/GAATTAAGAGAAGCAACA1 
-/TCGCTCCT1 
-/TCTACAACAAGAGCGAGG1 
-/CTTGAAGGGATG1 
CCAGGA/TCCCCCGCCACCGGGGCGCATTG1 
CAGG/TGTCCAAT1 
-/TTAGTTTT1 
-/TCCTCCTCACAGTCCCAGGGC1 
AAAG/GAT1 
CCAAGTCTGTA/T1 
-/ATGCAT1 
-/GGCCCTCCTGAG1 
-/TGACC1 
-/TGAGACTGGA1 
-/GGAAGA1 
-/TTAAGAGAAGCAACATCT1 
-/GCCCCGCC1 
-/A/TA1 
-/AG/AGAG/AGG1 
-/TGGTGCACAGGAA1 
-/CCCGT1 
CAAAGCT/TGAAGCTGTC1 
-/TGCAAGTGCT1 
-/CTT/CTTCTT1 
-/TAAGATT1 
-/TCTTT1 
-/AGTCAGA1 
-/GGTGGCTCAC1 
-/ACCCGTGCACGACG1 
-/TGGCCAGCG1 
-/CTTGATGCG1 
-/GCTGCTCTGCGCGCTGCT1 
CCATC/NNN1 
-/GGCCGTCGCGAGGCTG1 
-/CGCTGG1 
-/TCCTGGGAGAGACCGGCG1 
-/ATTAAAGACTGTGGC1 
-/TCTCCTCCT1 
-/G/GCGGTGCAGCCGAAGGAG1 
-/TGTTGACC1 
-/AAATACAAAGCCTAAGATGAG1 
C/TGGAGAACCTGAGAA1 
CTA/TAG1 
-/AGCGGA1 
-/AGCTCAGCGTAGACCTCCGCGCC1 
-/CATAG1 
-/CGCTGCAACA1 
-/GGGTCATTGAATCAA1 
-/CA/CACACA/CACACACACACA1 
-/AGTGAG1 
-/AAGATGTTTTGCCAAC1 
-/CCTGCTCTTCCGC1 
-/ATATG1 
-/TGTAAGGAAACAGACA1 
-/CTGT/GTCT/TCTG1 
-/CGCCCCGCAACCGCCGCCGCCGCC1 
-/GCTGGT1 
-/ACGAGG1 
-/TGTTTACTGG1 
CTAGAAG/TCTTCTA1 
-/AGCCATC1 
-/GTTCCAG1 
AG/TAC1 
ATGATTCGAA/C1 
-/AAAAAG1 
-/TTTTTG1 
-/AAACCGCCCC1 
-/CCAGG1 
-/AGCCTGGATGGCTTCCCTCCCTCTC1 
AGC/GGT1 
-/GAGGAGGAAGAG1 
-/TTCGATTTGCAGCAAATTGACTTCTTTA1 
-/ACGATACCTGCGTGGC1 
AGTAA/C1 
-/CGCAGA1 
(CAG(10_36))1 
-/ATCCCTTTTGA1 
-/GCACCTCTGGCTGCGGCTGCGCT1 
-/TGTTGAG1 
-/GCCGTGGCCCAG1 
-/TCCTGCC1 
ATTACTAAT/NN1 
AACAGTTG/NNNNNNNNNN1 
-/CTATCAC1 
-/GTGTTGAGAGAT1 
CAC/GT1 
-/CTTTCTCC1 
-/ATGCG1 
-/CGTA1 
-/AGAATCGCA1 
-/CAAGCT1 
-/GAGGATATTCTTCA1 
-/CCGAGAGC1 
-/ACAAGG1 
-/TGTCAGTGACGCACTTCC1 
-/AGTGCTGGGCT1 
-/CGAGAGACCATGCAGAGGTCGCC1 
-/GCTGGCTGC1 
-/GCCCCG1 
-/GGGAAAACCT/NNNNNNNNNN1 
-/CGCTGCAGG1 
C/TAA1 
CC/GCT1 
-/NNNNNNNNNNNNNNNNNNNNNNNNNNN1 
-/CGCCAGCCTCCTGAAGCCGC1 
-/GCGCCCGCCAGCC1 
CTTCTACCTCAAAAA/GGTTG1 
-/GCCGGGAGGCCCGCGCC1 
-/GCATAGTC1 
-/CCCCACC1 
-/AGCCCG1 
-/CAGCTGGGC1 
-/AAGACGGTGCGCTA1 
(T(5))/(T(5_9))/(T(7))/(T(9))1 
-/GCCCAACCCCTGCCA1 
-/CAACAGCAGCAGCAGCAGCAG1 
-/GGGCGGGGCCA1 
-/AATACTCA1 
-/GCATGTCA1 
CAC/TGT1 
-/TCTAATGACA1 
-/T/TCCTGACAGTTT1 
-/AGCAGCTGAGCAGT1 
CGGGTGCTCTGATCATCCCCT/GGG1 
AG/TGC1 
-/CATG/TGCA1 
-/GCCTGGCGGATCAGCGGCGGG1 
-/AGAAGTTT1 
-/AAGACCTGTAAGAGCCCTG1 
ATG/GTC1 
-/GCAGCGTGACACTATGGTAACCA1 
-/TTACCTTGTTAC1 
-/ATTGTGATTGGAGCTATAGCAG1 
-/GACCGCTCC1 
-/CGATATTTAC1 
-/C/GGCT1 
-/TGTAAGAATGATATAACCAAAA1 
-/AACAT1 
-/CCTGTCAACTAACATGT1 
-/ACAGCAGCAACAGCAGCA1 
-/CAC/CCA1 
A/GGCT1 
-/CATCAAGCGGCTCCGCCA1 
-/TACCGGCTCAAAGC1 
C/GCTTCGCCA1 
-/ACTAA1 
-/GAAAAGG1 
-/ATTTGTATGAACATCTGAC1 
-/CAGGAAGC1 
-/TACTGCAAT1 
G/TGGAGACCAGTATCTTCACTCC1 
-/CA/CACA/CACACA/CACACACA1 
-/A/AA/AAA/AAAA1 
-/AA/AATG/AATT1 
ATACTTTCA/CTC1 
-/CTGCTGT1 
-/TTACAAGAGAAATACTGAA1 
AACA/TTTATAAACAACTTTGTAGGACT1 
-/CCCCGGCTCCCACATCGGCGG1 
-/GTACATA1 
-/AGTGCCAGGAGCTGGACACC1 
AA/TGCAAGGAG1 
-/TCTGGGT1 
-/CATTGA1 
-/TTCCT1 
-/ATGGTAGCTGGGATGTTAGGGCTCAG1 
(1441 BP DEL)/-1 
-/CTGACCACC1 
-/AGGCCTCTGGCACAGAGCCC1 
-/G/GG/GGGG1 
-/CTCATCT1 
-/GCCCCGCAGATCAA1 
-/GCTGATGAT1 
AATACTGA/TGTTTTT1 
-/AAAAGAAA1 
-/GAGATTGACCCT1 
CTT/GTA1 
AGGTAAGA/CAACAT1 
-/ACAAGGCCCTCCCGGAGCCCCTG1 
-/CGGAGG1 
-/TAAAAT1 
-/CCTCCCCTCT1 
A/CG1 
-/GGGCGGGCC1 
-/GGAGACAAAT1 
ACG/GCC1 
C/GAT1 
-/CAGGG1 
-/ACTTCATTACTTGAAG1 
-/TGGAGAACTA1 
-/TCAGC1 
-/CCACTGGGTCTGCTGGCC1 
GAAGA/T1 
-/GTTG1 
-/GTGGAT1 
ACCCTG/CCCCCT1 
-/CGGTGAGTCAT1 
-/AAGTGGTACGCAC1 
-/TTTTA/TTTTATTTTA1 
-/AGATCGG1 
-/GGCCAC1 
-/ACCATGCGC1 
CCACCAC/T1 
-/CTATT1 
CTAAAATGTAACTAATTGAATA/GACT1 
GCTTTCAA/TGAAAGC1 
-/TCTCT1 
-/TCTGCAGCTGCAGTC1 
-/GGCGAGGGGACTC1 
CGGC/GGG1 
-/TCTCGCCTTGGCACGCCAG1 
-/AC/ATATAC1 
C/TACT1 
-/AGAACTA1 
AACCT/GGG1 
-/ACAGACAG1 
AGAAAGAA/T1 
-/ACTCACA1 
GGC/TGG1 
-/TATTAAAACT1 
-/CTGGCCCGGAGGGACG1 
-/CAGAAAAGTAGTGAATA1 
-/AGGGGCCTC1 
-/CGCCTGC1 
GCATC/TCATG1 
-/CGACGAGGCCT1 
-/GCTGGAGATTTTT1 
ATGGCACGGAGCC/CT1 
-/AACAAGAC1 
-/CTTCCTCTGACCGATGGAG1 
-/CA/CACACA1 
-/GACTAGAG1 
-/GGTCTCATTCTTGCCCG1 
-/CCGGCCGCACCCCCGCC1 
ACA/CCT1 
-/ACACACACTC1 
-/TCAGGAACATC1 
-/GAGAAGGAGCGCGAGCGC1 
-/ACGTGCTGGTCT1 
-/ATTATAATGG1 
-/TCTGTC1 
-/GGGGCTCGGCAC1 
-/GAGTCG1 
-/CATAGCC1 
-/GCACTTTG1 
-/GAATTAAGAGAAGCA1 
GC/TTAGAG1 
-/GTCATCCTG1 
-/TCCCAA1 
-/CTCCCCCGCCACC1 
-/GGAGC1 
-/AGAGAAGGAAGAGGCCAAGTCCCC1 
-/TAGTTTTGCTG1 
-/TGGTTCCCA1 
-/GAGTCCTTT1 
-/GTATATAT1 
-/ATTG/CTTGA1 
-/ACAAAC1 
-/CGAGGTGGCCGAGAC1 
-/TTATAGGACTGC1 
-/TCACAG1 
C/TTAAGAGAAGCAA1 
-/AGAGATTCCA1 
-/CTGCCCCTTCT1 
-/CCTTC1 
-/GGGCCAA1 
-/GTTTTGCAACCTGAGG1 
-/G/GGCAGCT1 
-/GCTGGA1 
-/CAGATGCT1 
-/ACGAGCTGTGCC1 
-/TGCCGGGGA1 
C/TGAGAG1 
-/GCGGGTGGCGCAGGTCA1 
-/CCCCATT1 
-/TTTCTTCTGTTTTTGTTAGCCA1 
-/CGGGTCGGGTGAGAGTGGC1 
-/ATTTT/TTTTT/TTTTTT1 
-/GGCCAGCGT1 
AGCTCGAGTCCCTCG/CC1 
-/GCTGCTGCTGCTCTGCGCGCTGCTCGC1 
-/GT/GTGTGT/GTGTGTGT1 
-/CTGAAGG1 
-/GAAACCACTTGGTTAAG1 
-/G/GGGG1 
-/TTTGAGGTGC1 
-/ACCACAGTGC1 
-/ACTTTGAACTGGTGGAGAGAT1 
-/GGAGCAGATCAT1 
-/AAAGTG1 
-/TTTTCGGTAAGTGATGGTCAGAGA1 
-/ATGGCGTCCTTTCCC1 
-/GCT/GCTGCT1 
-/GTCATCTCTACGC1 
-/GGGTCAGATAGGCCTGG1 
-/AAGTATCCAT/GTATCCAT1 
-/TAGGACCAATAAGTCTTAATTGGTTT1 
-/AGAGGG1 
CACACACACACACAC/GAGAG1 
-/GAGTCTGG1 
-/GTTGCCC1 
-/CCTGCTC1 
-/CAGTGTCTACCAACCA1 
-/TTTCA1 
-/AGCATTCTGGCCATCCAC1 
AAT/TG1 
-/AGCAGCAGCAGCCGCCGCCGCCGCCGC1 
-/CTGGTC1 
-/CCACCACC1 
(GAA(6))/(GAA(6_34))1 
-/TTTTAT1 
ACCCCGAAGG/GCCAACATGGCA1 
-/GCGATG1 
-/TGCACCTGGTTCTTTTACTA1 
AGG/TAGC1 
-/AAACCCATGTATGAAGTACAGTGGAAG1 
-/TCCCC1 
-/ACAAAAA1 
-/TAGCTT1 
ATGA/TC1 
-/CTGCTGTGCT1 
-/GGGTGAGAAAGGTGAAGGAGGCCCTCC1 
-/TTCCTCTTCTTCTTCTTCCTCCTC1 
-/GAGAAGCGGCGGCAGATCAG1 
-/AACAGT1 
-/GCCACGGCCGCAG1 
(CAG(7_37))1 
-/GCCGCCGCC1 
-/ATACAA1 
-/TGCCTACTTCTAGAACA1 
(G(4_5))1 
-/CGGT1 
-/CGGAGCAGAA1 
AATC/CATT1 
-/ACGTTGACTGAG1 
(CAG(10_16))1 
-/CTTTCTCCTCGGACATCA1 
-/TGTATTTTA1 
-/GTAGTGGAACTTCTGCAAG1 
-/AATCGCAAG1 
ATGGCT/TG1 
-/TAGAT1 
-/CCCCACCTCCACCTGAGCCCGAGAGC1 
-/ACAAGGTTTCAATAA1 
-/G/GC/GGG1 
-/GTAAGT1 
-/TTGTCAGACATATACCAA1 
-/GTGGACGGCGTC1 
AAAA/GAAAG/NNNNN1 
ATT/NNN/TTTA1 
-/CTGTT1 
CCC/GGGCTAAAAGTACTGTTGGGG1 
-/AGAGT1 
C/GAGG1 
-/CGCGCGCGCGTCGACGTCGAG1 
GCA/TTT1 
ATTA/TC1 
GTGTGTGTGTGTG/T1 
-/TATTCAC1 
-/CCTGCCCCCACC1 
-/GTAATCCT1 
-/GCATGC1 
-/AAAGACGGTGCGC1 
-/TTCTCAC1 
-/GGCGGCTGCGGCGGCGGC1 
-/TTCCAGCTGT1 
-/GCATGTGGAGC1 
-/TTCAAAAGTGGAATTCAAAA1 
GTG/TGACATCTTAC1 
-/TCCTGACAGTTT1 
-/CT/TC1 
-/AAGAAGCGCCAC1 
GGAG/TGA1 
-/ACCCTGGGCAAGGTCATCTCC1 
-/TTTCTAGTCGTTCC1 
-/ATCT/CTAT1 
-/CCGCCAGGCCCCACCCGTGAT1 
-/ACTCC1 
AGAAGAGC/NNNNNNNNNNNNNNNNNN1 
AA/TAGGT1 
-/GATACAATCAGCTCCA1 
-/TTATGAT1 
-/AGTGAT1 
-/TCAAGAGG1 
-/AGCTGGACC1 
-/CATTAA1 
-/TCAGT1 
ATTT/GTAAATCA1 
-/ACCTACCGCC1 
-/GCCAGCGGGTAGGGAATATGGGGCTCC1 
-/GCTTCGCC1 
-/CCGAGACA1 
-/AACTATAATGGAATTATAACTAACT1 
-/ATTGGAAGAGTT1 
AG/CTTGAT1 
-/TCATGGTGATCAAACGCCCCGGCAGG1 
A/TTATATGTGG1 
-/TGGAGACCAGTATCTT1 
-/CCGGGCT1 
-/CCAACTCTGCAGAGCAGC1 
-/GCTGGTGA1 
-/TACTGTGGTG1 
-/NNNN/TGCT/TTGC1 
-/GATTT1 
ACTGGT/NNNNNNNNNNNNNNNNNNNN1 
CC/GTCTTCCGGGCA1 
-/CATGGATAGGAT1 
-/ACACACACAC1 
-/GTTGATTGCA1 
-/AGGAATTTGC1 
-/GCGAGGAGGAG1 
-/TTCCTGGCCCGAAA1 
-/T/TGCAGA1 
-/CGTGCATCCCC1 
-/GCGG/GGCGG1 
-/GT/TT/TTGTGT1 
-/GCAGATCAACCCC1 
-/GGCCCCATTGGGCCCCCT1 
-/CTTCCAGGGAC1 
-/GCTAT1 
-/ACCGGGATAGCCGGGGGTCTGGCA1 
AGG/CAACAT1 
-/ACCTC1 
CGA/GGG1 
-/CGCCGCCGCCGC1 
CCCC/GCCCG1 
ACGAATCACAACAGATACTTGATCG/GA1 
-/CAGACTGACAGTTGG1 
A/GCCATCCCTGGTCCTTTC1 
-/GCGTCGTCCCCTCGGCTGACCTC1 
GC/TCCT1 
-/AGGTGG1 
-/A/AC/C1 
-/ATTAGTC1 
-/TGTTCC1 
-/TACA/TATA/TATATATA1 
-/ACTTT1 
AAA/GC1 
-/TAAAAC1 
-/AAGATTTGGCCCTCA1 
-/ATTA/TTAA1 
GCAGAGCTTCCT/TCAGA1 
-/ATGCCG1 
-/CTCTTC1 
-/GAAGAGCAGT1 
-/GCGCTGCCGCTGCCTGC1 
-/CCACAACCCAG1 
(CAG(25_42))1 
-/GCACTTTA1 
-/TG/TGTG/TGTGTGTG/TGTGTGTGTG1 
GTCTTCGCTC/TA1 
A/GAATCAGCCTC1 
-/GGTGG1 
(CCCCGCCCCGCG(2_3))1 
-/GCCGGT1 
-/AAGCTCT1 
-/CACACATA1 
-/TCTGTAGGTTT1 
-/AAAAGAC1 
CAG/TAT1 
-/C/TT1 
CC/GG/TG1 
-/CCTGTGTCAGATATT1 
-/ATAGGCCGCCC1 
-/GGCGC1 
-/ACCCATTTGGATAAAC1 
-/GAGTT1 
-/TCCACGAGGCGCTGGAGACCA1 
-/CAGGACC1 
-/TCGCC1 
GCCTGAGGAGGA/T1 
-/TGTACTC1 
-/GTTTTCTGC1 
AGA/CTGTG1 
-/ATCATATCAGGCCTCTGAA1 
-/AGGGAAAGACG1 
-/ACCAACCA1 
-/GGGCTGGGGCGGCAACGGGGTCGGCGA1 
-/ACCGG1 
-/TGCAGCAGCTGCGGCTGCAGCCGCGGGC1 
-/TACCAGAGATT1 
-/AAAAAAAA1 
AGGC/CTCAG/NNNN1 
CAGGCA/T1 
-/CTGGGCAACGTG1 
-/GTATA1 
-/GGCCCGGAGGCTGGGC1 
(GGGCAGGGGCAA(2_4))1 
-/TTTAATTTGT1 
GTTCAC/TGTACCA1 
-/CA/CACA/CACACACA1 
AT/GAATTAAGAGAAGCAAC1 
-/GACTCG1 
-/AGCTGCTGGCTGG1 
-/AAAGCTGAGCCCGCCATGCCTGGCCGC1 
-/GGCGGGTCGCCTGC1 
-/TCTTATACAGAACAATCCCAGCCT1 
-/TGAGAAGGCCAAGTCCCC1 
-/AAGATACTAGT1 
-/GACCCAG1 
-/AGATGG1 
-/CTTGA1 
-/AGTGGTG1 
-/CTGTAGTGAAGAATCAAAAT1 
(AGAA(10_18))1 
-/GGCCTGC1 
-/AAAA/AAAAA1 
C/TTAAGAGAAG1 
ACTA/NNNNNNNNN1 
-/GAAGTACTTCATAC1 
-/GGCGG1 
-/GAAGCATTTATCATTCAC1 
-/TTTCAGTGCC1 
-/TGCTCGGTGCAA1 
-/A/GA1 
-/CCCCAG1 
-/CCGTGTGTACCAA1 
-/GCTGCCAAATAAGCAACTACATTG1 
A/GACCTGTGCCGCC1 
-/TGGCACCAC1 
-/CACTCTGGAAG1 
CCA/GATGCACACACACCG1 
(865 BP DEL)/-1 
-/ATTCTCCTGAGCTG1 
-/CGCCACTCTCACCCGACCC1 
-/TTTTA/TTTTT1 
GAC/TGGG1 
-/CAATT1 
-/G/GTC1 
-/TTCAG1 
-/TTACTGT1 
-/CCTCTT1 
-/TGGCTGGCATGA1 
-/GCAGCTGTGAC1 
-/GGACGGAACAGCT1 
-/AACAGGTCC1 
-/AGATT1 
-/TTCTTTTCTTTCAA1 
-/CGGGGCGAC1 
-/AACTG1 
-/GGGAAG1 
-/GGTGCTGCT1 
-/ACGCTC1 
GCACTT/NNNNNNNNNNNNNNNNNNNN1 
-/GATC/GTAC1 
GT/TGGAACTGGTCCCCCAACTGGGTGGA1 
-/TCCAGCGG1 
-/CGCAGATGGCT1 
CAGAAGGCTTTAAGTA/TG1 
AAG/TAAGACT1 
AGCCCAGATGGACATGAA/CGC1 
CACACACACAC/GAGAGAGAGAGAGAG1 
-/CGCACGCAGCTCCGCCCCGCG1 
-/CGTCTGGGCTTC1 
-/TGAGTCCCTGCGCTAT1 
-/TGTCATTTGGTATAAAT1 
-/TAAAGC1 
-/GGCATCA1 
-/GACAGTTTG1 
-/AGCAGCAGCAGCCGCCGCCGCCGC1 
-/TCGTGG1 
-/ACCGCCACC1 
GTCA/TTG1 
-/GATTTAG1 
GCAA/TTTGGGTTGATCAAC1 
-/GATGGC1 
-/A/AGT/NNN1 
-/CCATGTATGAAGTAC1 
-/CCACTACTG1 
ATATT/TGGAGAGAAATA1 
-/CTCACCAG1 
-/GTCTTTATCC1 
GACCTGAGAC/TAGTAATGTAAGTA1 
-/AGCAGCGGCGGCGGCGGCGGCGGC1 
-/GA/T1 
-/A/AT/ATT/CT/TTT1 
-/CT/T1 
-/CCACCGCCG1 
-/A/GCA1 
-/TTCTTTCAGT1 
-/TTCCACTCTCCACC1 
-/GGAAGAGGAGGACGAGGAGGACGA1 
-/TCCCCCA1 
-/GTTTG1 
-/ACCGT1 
-/TTA/TTT/TTTTA/TTTTT1 
-/CTACCCCAGATTGAGAATGTTAAGGGC1 
-/GGTGCATATAT1 
-/GCAGCAGCAGCAGCAGCAGCA1 
-/CAGGAGCTGTCTAACG1 
CCCT/GG1 
-/TGAGCA1 
-/ATTCC1 
-/CCAGGCCCTTGGC1 
-/CGGCC1 
-/CCCCACCTCCACCTGAGCCCG1 
-/AGGTTTCAA1 
-/TGAGGGC1 
-/AA/TT1 
-/GTACCTGGTGGACGGCG1 
-/GACTGCAAGGACAAATC1 
-/AAAAGTGAAAGAGTTCACT1 
-/TAATTGATAATGGA1 
-/TGTTGGCCCT1 
-/TACCACCAC1 
-/TAGAG1 
-/AGAGGGCACAC1 
-/TATACCTTGG1 
AAG/T1 
-/CTGGTGCTATCTTCACCAAAG1 
ACTACA/T1 
-/TTCACCTA1 
-/GTGCCACTGCTCCCACCCCTGCCCCC1 
-/GCGATGATGATATC1 
AGGT/CGGC1 
-/AAGACGGTGCGC1 
-/CTGGATCCA1 
-/GTATATATAT1 
-/ACACTCTG1 
-/TCCATGTGGA1 
-/ACAATTATGAA1 
-/ACTCT/ATTCT/TCT1 
ATTTAGTT/TAAATGGGG1 
-/TTAATGTGCACCCCACAAAGCATG1 
-/AGAAGCGCCA1 
-/TCACACT1 
-/TGTTTT/TTTTTG1 
NNNNNNNNNNNNN/TGAGAAG1 
-/CTTCC1 
-/AACAGGCG1 
-/ATAGTG/CACTAT1 
-/AGCTATA1 
-/ACCTCTTCT1 
AAGTA/T1 
AGATATTGAAGAACA/T1 
-/GCTTGATT1 
-/GCTGCA1 
ATTT/TAAATCA1 
-/CTCACA1 
NNNNN/TGA1 
-/TGTCTTT1 
-/ACCTGAGTGGTGTCA1 
-/AACTA/T1 
-/AATGTTTG1 
CAAA/GG1 
CGCCCC/GGCCG1 
-/TTATATGTG1 
-/GTGCTGATGAAAGCCCTGCGGGA1 
CGTGCGTGC/T1 
-/ACATCG1 
-/TTTAGGTATTTTTAGGTATT1 
GCCCAATG/T1 
-/AGGCCTGCGCCCC1 
-/AGTAGTT1 
-/GTAGCACT1 
-/GCGGGCGCCTGG1 
-/CTGGACCCAGCC1 
-/ACGACCAGGTGAGGATGG1 
-/ACCGGCTG1 
-/CGCCGCCGCCGCCGC1 
CTT/GATA1 
AG/GAATTT1 
-/AGGTCTTC1 
ACC/CCT1 
-/TTCTC1 
-/GGGAGAG1 
-/GCGGCCA1 
-/ATGGCA1 
-/CAGATCAACCCCC1 
-/GGCGACAG1 
-/NNNN/TGAT1 
-/CTGTGA1 
-/TTTGAGTG1 
-/CAGAAGCCC1 
-/CCCTTCACCAACATGCCCACAGG1 
-/ATATATATAT/ATATATATATATAT1 
-/TCCCACAGACCTACTGTGTGTAC1 
AGGA/TT1 
-/GTGGGGTCGTCCAGGTACCCTTTG1 
-/TGAGGACCA1 
GTTTAAAAAGT/TAAAC1 
-/ATTTG1 
-/GAT/GATG1 
-/TTTT/TTTTTT/TTTTTTT1 
-/AAATA1 
AGTAATTATTCCATCATA/T1 
-/TGTGAG1 
-/TTAACTAATCT1 
-/AACCTAC1 
-/TTCACACC1 
-/GCTGCGGT1 
-/GTGGTCTTC1 
-/CTGTCGG1 
-/GGGTACTG1 
-/GGCAA1 
-/GCGGGCCC1 
-/ACAGCAGAGTCTAT1 
A/GAAG1 
-/ACGGAATATGAAGG1 
CAC/GAG1 
-/AGTGGGC1 
-/TTTTTA1 
AAA/TAT1 
GAAAA/TAT1 
-/GGAATCAGCC1 
-/GTT/GTTT/T/TT/TTT1 
(CCCCGCCCCGCG(30_125))1 
ACGAGTCCAGCTA/GTT1 
AAAAAA/TAAATAAAT1 
AACA/TT1 
-/G/GT1 
-/ACAACTA1 
-/TT/TTGG/TTGT/TTGTGT1 
-/AGCAGCCTGGGCAACCCGCCGCCGCC1 
-/ACTCCGTG1 
-/AGAAATA1 
-/CAACGCC1 
-/CTGT/TGT1 
-/CCTTCT1 
-/CGAAACGCCAAC1 
-/AGATAAAGAAGAACTT1 
-/CAGACTTTGAG1 
-/GTGTGTATTG1 
-/AGGAACTACAGG1 
-/GCTT1 
-/AAAATGGA1 
ACT/CC1 
GAATGATC/TTTCA1 
-/T/TTAC1 
-/AGTGTGGCTCAAGTTCAA1 
-/CCGGCATCTACTGCG1 
CAAGTAACAACAGTGTG/TT1 
-/AGATGTACTCCATCCCC1 
-/ATCC/ATCCATCCATCCATCC1 
-/TCCTAT1 
-/TCTAT1 
(AGCTGCGGCTGCAGC(3))1 
(CTG(6_27))1 
-/AATATATTTTTAATATACTTTTT1 
-/CGCCGCTGTCACCGGG1 
GCTTACTTCCC/T1 
-/CACCCCATC1 
-/GGGCAGGGGCAAGGGCAGGGGCAA1 
-/GCCGCCGCT1 
-/GCACCG1 
-/CCCCGCCGCCTCCGCCGC1 
-/AATTAAGAGAAGCAACAT1 
-/TGTTTACTAAACAAAAAGAAAGAGC1 
-/CCAGGCAGC1 
-/GAGGACTCCTCTGATGAG1 
-/AAGTGACGACTTTGG1 
-/TGACTTTCAGCGGGC1 
-/AAGGACA1 
-/GAAGATACTAG1 
-/CTGCGGGGCAGC/GCTGCCCCGCAG1 
-/TGGTCT1 
AAGTAACATGG/TGAAAGAAAAA1 
-/CTATTTAATG1 
ACAG/TGACCCATCC1 
(CTG(15_40))1 
(TTCT(10_18))1 
-/TGGCTGCT1 
-/ACTCCAA1 
A/CAAT/TTAAGAGAAGCAACATCTC1 
-/TGTGC1 
-/ACGCGC1 
-/AGTGGAGGAATCCAA1 
-/TTAAAACTTC1 
ATT/GTA1 
-/TATACTCAGAATCCTGGA1 
-/TATTAATGAA1 
-/TGCAGAGCCACC1 
-/CTCCATAG1 
-/TACTGGTGGCTGCCAA1 
-/TGCCGCACG1 
-/AGAGGCGGGGTCTGCAGGAACACCAG1 
-/GGATCTGTTGCAGCCGGAGCGGCCGC1 
-/CGCTGAAA1 
-/ACACACACAC/ACACACACACAC1 
ACACACACA/C1 
-/CCAGCGTGG/GTT1 
-/TAAGG1 
AG/TAAACTTTACCT1 
-/TCATC1 
-/ATACTCTAAAAGAC1 
-/CCCAGC1 
(CGG(11))1 
-/CGCAGCTGTGA1 
ACACT/CAGGTCAGGACATCCA1 
AGGGG/TCGGA1 
-/ATATATATATATATATATATAT/TA1 
-/GGCGGA/GGCGGAGGC1 
-/CGAGGACGCGCTGC1 
-/AAGCTT1 
AAGAAGC/CG1 
ACTA/TT1 
-/TCTTTACATGTAAAGC1 
-/GTGAG1 
-/CCCGGG1 
-/CCCCT/T1 
-/GGTTTGAAGAACTTT1 
-/AGCCCAGATGGACATGAA1 
CACACACAC/GAGAG1 
-/CCCCGCGTCCG1 
-/GGTTTCCGTCTGGGCTTC1 
-/GAGTCCC1 
AACTAC/T1 
-/AGCAGTCA1 
ACCG/GC1 
-/GTGGTCTTCTCCATCCTGGGCTTC1 
-/ACAGCCACCGCTGCAGCTGC1 
-/GCAGACAAGCCAT1 
AATCCCCTGTTGGGGGCCTCAC/TTG1 
(261BP DEL)/-1 
ATA/G1 
-/AGCTA1 
-/TGGAAG1 
-/CAGGCTGC1 
-/GATACATGT1 
-/TTGTCCTGCCTTTCTATCCGA1 
-/TTCCATG1 
-/GCTCCCGGTCCTGCTGGT1 
AAC/TACGGATAG1 
ATGTTCTAATAATT/GAA1 
-/TGGCAAACAGTGCTTCCAGCACATCTA1 
-/ATAATGATTCAGGATAT1 
-/TCTGCAAAGAGGAGAAGATGCCCAGA1 
-/CCATTGAGCCAGGTGTAG1 
CATAAGAAA/TTAT1 
-/CTATTAG1 
-/TGCCCCAGGGCCAAC1 
-/CTCAAG1 
-/TACATA1 
-/AACAGCTCCACCTGCATCC1 
GAACTAACC/NNNNNNNNNNNNN1 
-/CTGTG1 
-/AA/AAAA/AAAAA/AAAAAA1 
(CAG(8_25))1 
-/GGCCAGGGCTCATGAAAGTTCCA1 
-/CTGTACAAGTCA1 
A/CT/G1 
ATG/GTGA1 
-/AAAGCCGCAGCA1 
-/TTTTTTGATGACAG1 
CCTAG/TGA1 
-/GAAAGTTTCTAAAA1 
-/CCACCTCCACCTGAGCCC1 
-/AGGTTTCAATAACCA1 
-/AGGCA1 
-/GTGGTTGCCATCTGC1 
-/GCTTCCTA1 
AAGACAGA/GATGG1 
CCGACTG/TGCAAGGACAAATCTGAC1 
AAAGT/GATCCTC1 
-/TGATAAT1 
CAGGTAAGGTATAGTGA/T1 
-/AAGAAGATCTGGA1 
-/CC/CCC1 
AAG/TT1 
ATCAGC/TGATGAG1 
-/GAGGCCAGT1 
-/GTGCA1 
-/GTGACATTAAA1 
A/TTACAGCAATT1 
-/GCCCCCGTGCCACTGCTCCCACCCCTGC1 
-/TGCTGGGC1 
-/GTTCACCAAGTTAGATTA1 
-/GCAAAGACGGTGC1 
-/GTGATTATGG1 
-/CGCGCCTGCTCCCGCTCCAGGG1 
ATATATA/GTGTGTGTGTG1 
AGC/GCA1 
-/ACAATTATGAATCTGATGT1 
-/TGGAGCGCGGGGGCGGCGCTG1 
-/TTTCATAC1 
-/AGCGGGTGC/GGGTGCAGC1 
-/ACTACCTGTCT1 
-/TCCTGGTTG1 
-/TTTTTGTTTTAATTCCT1 
-/GTAAAACAAA1 
-/ATGCCACACATTC1 
-/CCCTGC1 
A/GGCGGCGGCG1 
-/ATGCC1 
-/GACTGTGAAGATATGGT1 
-/CCGGA1 
-/CTGTC1 
ATTTT/CTTG1 
-/CCCAGTG1 
CGCAAGTCACG/TCTGTGT1 
-/ATAG/TAGA1 
-/TGGTGGTTTTGC1 
-/CAGGTGCGGCTGCAG1 
-/ATGGC1 
-/CCCCCT1 
-/GCACCAAGACTACAGTGATTGTCGG1 
-/AACTA/ACTA1 
AAAGTCT/TG/TGTAG1 
-/ACGCC/C1 
-/AATAAAATAA1 
-/CGTGTG1 
CTTTTTTTTTTC/TCT1 
-/CTACCA1 
CACCCTA/GCCCAAT1 
ATC/GTTAGCTG1 
AATGAT/C1 
-/TAGGCGGGATGGTGCCGCTGTGC1 
-/TG/TGTG1 
-/GTGAAGTGCC1 
-/TGACCCGAGAGTGG1 
-/GGAGCGC1 
GCT/TCAA1 
-/GCCAC1 
-/TTCTTT1 
-/ATCCTCCGGGTC1 
AA/NN/TAG1 
-/CGCCG1 
-/GAAGGCCCTCCTGGGCCACCC1 
AT/TCTGCCAGCC1 
-/TTTTAGCTCTGTGGGTGCCCTGGAGGGC1 
-/CGGGC1 
-/ACCGCAGGCTGGAGACCAAG1 
-/ATGTT1 
-/CTGCGCCTGCCCGGACGGC1 
-/GTGCCCCTG1 
-/AGG/AGGAGG1 
C/GAAG1 
-/AGAAGCCCC1 
-/GTATTCCACTCC/GTATTCCACTTC1 
-/GAGTGAGC1 
-/ACGGGGCA1 
-/TCTCTTATGTTAAA1 
-/ATAACCAA1 
-/TCCAATCCAT1 
-/TGAAGGATGGGAC1 
GAT/TGGTCACCTGAGAG1 
-/GGGGACCGCGGGGGC1 
-/TGCCACT1 
-/AGTGGGGCTGGGAATTTCA1 
-/GAAAGA1 
AAATA/G1 
-/TGCCA1 
-/CACAAAAATTGGAATTGC1 
-/GGTGCCCTTT1 
-/NNNN/TTAG1 
-/AGCAAGTTGGGGTGTGC1 
-/GAGAGGGAGA1 
AAG/TTCTT1 
-/GTGAACGAGTCAGGCCGCG1 
-/CTACAC1 
-/CAAT/T1 
-/GGCCGCC1 
-/CTCCCGGCCCTGCACATCGC1 
-/GCAGG1 
-/CTAATT1 
-/GTCTGGTGGCT1 
-/TGGGCAG1 
-/GCTTTCGTCCTG1 
-/TCTCCCCCTGGAGCT1 
-/GTGCCAGGCTCTGGCACAGGT1 
-/CAATGTTCAGC1 
-/TGGAATC1 
-/TTT/TTTT1 
CT/GTG1 
-/GGGGCCGGGGCC1 
-/TATGAC1 
(AT(11_13))1 
-/GCCGTACGGCA1 
CCCCCT/NNNNNNNNNNN/TGTGTGTGAAG1 
-/CAGTTTGGCCCCTCA1 
-/CTAGGTACACG1 
-/CCACACAGTGC1 
-/TCCCAGACCATC1 
-/GACAAG1 
-/ATCCAGAA1 
-/GAGTTG1 
-/GCATCTGGATTCT1 
-/CGTGCTTACAGACGCCACCTT1 
-/TAGTTACCGTACACGAGAAGA1 
-/TATAGC1 
-/TTTCAGA1 
AACT/C1 
-/CCTCTGTCCAGCAACATGG1 
-/GGGCGGAGACTTTGTG1 
A/TGTGTGTGTGT1 
(CAG(15_24))1 
-/CGGCTGCAGCAGCTGCGGCTGC1 
-/TTTAGAT1 
-/CGCGCGCG1 
-/GGTAA1 
-/GTCGGG1 
-/TGAGTCTATGGG1 
-/GCTTCAGGTAAGTGC1 
-/A/AA/AT/T1 
-/CAGCAGCAGCAA1 
-/GGGCAGGGGCAA1 
-/TGCCGCCGC1 
-/AGGCGGCGG1 
AATTAAGAGAAGCAACATCT/TC1 
-/CAAGCAAATTGGAAAAAGAAACTT1 
-/GCGGT1 
-/GTGGTGG1 
-/ATCATGCAGACCTATC1 
-/GGAGTG1 
-/ATACTAG1 
-/GGTCTATTTTCCCACCCTTAGGCTG1 
-/ACCAAGTG1 
ACCAAGA/TACTTC1 
(GGC(1))1 
-/CAGGCAA1 
-/AGCGAATGGG1 
-/TAAGAGAAGCAACATCTC1 
-/AGCAGGTTGG1 
ACGCGCGCGCG/GCGCACA1 
-/CCCCATCACGGAGAGGTGAGGGCTCC1 
ATA/CTT1 
-/TATTGTTATA1 
-/GCAATATTAA1 
-/C/CC/CCC/CCCC1 
AGA/CATCGAAATTGTAACTC1 
G/TTCT1 
-/AATATC1 
CA/GTCTTAGCAGCTG1 
-/TACACTCTGGATGGA1 
CCG/GGT1 
-/A/AA/GAAA/GAAAAAAA1 
ACACACACACA/C1 
-/CAGCGTGGA1 
-/AAGAACAAAT1 
-/AG/C/GG1 
-/AGGCTCTAGG1 
-/AGTCCCAAAGC1 
C/TGGCTGTGGGGGA1 
CGGCGGCGGC/T1 
-/TGGTATCAC1 
-/AGTTCCTGCATGGGCGGCATGAAC1 
-/GAAAACACT1 
CAC/GGAGCAAAGAA1 
-/TGGTGGACCTGGCAGAGGGCTGC1 
-/A/C/G1 
A/CGCC1 
-/CTAGAATGGTACCAAG1 
-/CTGGATCCGT1 
-/CCACGC1 
CAGCTGCAGCAGCAGCC/GCT1 
-/GGTGTCCT1 
-/AAATGTGTGAGTCA1 
-/TTTCTTC1 
-/GCCCAGATGGACATG1 
-/TCCGACCCGCGGATCCCGCG1 
-/CACCAGCCCCCTCCTGGCCCCTG1 
-/GTCCCTGCGCTATA1 
C/TGATTTTTCT1 
-/GGGGCGCCCCGGCCGC1 
-/CGACCTCCTCCCGGCCTCCT1 
-/GTCCGACTTGTCATGGCCCCT1 
ATGTCT/TACACCTTGAGGACA1 
-/GGCTGGCC1 
-/GGATGT1 
-/AAGTATTTACT1 
GACTTCA/TCTGTCACC1 
-/AACCTG1 
-/GCTAC1 
-/AAGGTTGTTGAGGAG1 
-/CGTGATGGGCCTCCGCG1 
-/GGGGCCCTCCCTT1 
-/CCC/CCG1 
-/GGGTCAAATG1 
-/T/TTT/TTTTTT1 
-/AGG/GGA1 
AGCT/GA1 
-/AAACTTGAT1 
-/CGTCTGCAAAG1 
AGGATGC/TTCGCCCCTGA1 
ATGG/GATTAC1 
-/TCACACAG1 
(GGC(4_10))1 
CACACACAC/TATATAT1 
-/TGGCTCGGATGA1 
-/TAAATCA1 
-/CTCAACTAACCCTT1 
-/TTT/TTTCT/TTTTT1 
-/AGCAGCAG1 
-/CGCGGCGC1 
-/GGTGCCGGCAGCCAGCACGGCC1 
-/ACCATTGCCTGAATGTTCTTC1 
-/AAGCCGCAGCAA1 
-/GA/GTGA/TG1 
C/GCCATCCG1 
-/ATCACCTT1 
-/CACCTCCACCTGAGCCC1 
-/TTCAATAACCAG1 
-/G/GT/GTG/GTGG/GTGT/GTGTGT1 
G/TAT1 
ATCTTCTTTGATGAACTGGA/T1 
-/CAAGGACAAATCTGACGAGGAA1 
ACT/GA1 
-/TCTGT1 
-/CCTCCAGCCCCAGCT1 
-/ATGACTAC1 
-/AGA/GAA1 
-/TCAGGATAGTGCA1 
-/TTCGT1 
-/CTGCCGCTCCTGCTGGTGCTCCTG1 
GGTAA/T1 
ATC/TGAACTCATG1 
-/TAAACTCAGAAATG1 
-/CCGTGCC1 
-/GAATCCTGGAGTTTATCAG1 
-/GCGGGA1 
-/AAAGACGGTGC1 
-/TACCCAAATTA1 
ATATATATA/GTGTG1 
-/CCCATCA1 
-/AGGGATGAAATCAGGAGCCA1 
-/CAAAAATA1 
TC1 
AGGC/GCCT1 
-/GCACATCGAGAGCA1 
-/GAGGTGT1 
-/CAACTC1 
-/GGCCTCCCT1 
(CGG(8_14))1 
-/AAAG/AGAA1 
-/CTTAAA1 
-/ACTCCCCAT1 
-/CTACCTGG1 
-/CACCCTTGTCAC1 
-/CTATG1 
-/CCTGGGGGG1 
-/GAGCGT1 
-/AACCTGTC1 
-/AT/ATAT/TGTATATA1 
-/CCAGC1 
ATCTGGACC/GG1 
-/CTGGACAAG1 
AAGGTGC/CCA1 
-/TTCCCC1 
-/TTTCAGAGGGGT1 
-/CTGACCTTAA/GTTTC1 
C/TCAGGAAGCTT1 
-/CCTGGCCAACAT1 
-/GCCCTGCGGCAGTGCTGATGAAA1 
-/TCTCAATGTTACTGT1 
AA/AG/GT1 
-/A/AA/AAA/AAAA/AAAAA1 
A/GTGGC1 
-/CACTTG1 
CTGTTTG/T1 
-/GGGCC/GGGCT1 
AGCCT/GGGCC1 
-/TGCCTGG1 
-/AGGCACCTGTGGTGACCCGAGAGTG1 
-/GGCGGGGC1 
-/TGGGCC1 
-/CTCTTTT1 
-/CTGAAAGTGG1 
-/CTCTCTTTCT1 
-/GCCAGAAAATT1 
-/ATGATACGGAAAT1 
-/CGCCGC1 
-/GGACCAAATGGACAACCT1 
-/CGCGGGGAGGGGTCCCGGAGC1 
-/AGTGTAT1 
-/AAAGGTCAGCT1 
-/AAGTGCTGAAATC1 
-/GGGAACATTCCACT1 
CCCATCGCTGTGG/TCTGACTGTGT1 
-/GT/GTATTCCACTCC1 
CA/GC1 
-/CCCCTGCGAGTTTG1 
-/ATCCTCTTCATC1 
-/AGATCAATGGCTACCCCAAA1 
A/CTTGGATTCTT1 
-/TCCTCCTCCTCCTCC1 
-/GCGCCCTTC1 
CC/TTTTTTTCT1 
-/GCACCACAGC1 
-/TGATCCTGAA1 
CTTCAAAA/TGG1 
-/ACATCTTCG1 
-/TGAGTCAAAAATGTTT1 
AGA/GG1 
GAA/TGAG1 
-/GTGGTAAGTCGG1 
-/CAGGTGGGCACAGGGGTGCG1 
ACTC/NNNNNNNNNNN1 
ACCGTGTGGAAG/TCCC1 
-/GCTGCG1 
-/TGCCAGTGAA1 
-/TTCTGTTT1 
-/AAAGCTGAGCTGGAAG1 
CCAGTTC/G1 
-/GAGGATGTGTACTCAGCCTGGGCCTG1 
CCA/TTT1 
-/CTTCTCCCCCTGGAG1 
-/GCAGC1 
-/TACTTGCCAAGGCAAGATCT1 
-/TTG/TTGTTTTT/TTTTTTTG1 
CTGA/TGG1 
-/AAAAGCAT1 
CGCTCC/TT1 
ACAG/GGT1 
(AT(13))/(AT(15))1 
-/CCACCTG1 
-/GT/GTGT/GTGTGT/GTGTGTGT/TA1 
-/TTTCAG1 
-/TTAATA1 
CC/TCA1 
C/TATATCACAGGCCTCGCCGA1 
-/CAGCAGCAGCAGCAG1 
(CCTG(75_11000))1 
CT/GA1 
-/CCTGGCAGCC1 
-/AGAA/NNNN1 
-/AAAAAGA1 
-/AC/TA1 
-/TTGAACCGC1 
-/GA/GAGAGA/GAGTGA/GAGTGAGA1 
-/TCAGGAAGTAAG1 
-/GTCTTCTGGGGTCAAG1 
-/TAACC1 
-/ATGGACC1 
ATCAAGGAATTAAGAGAAGC/GTCAA1 
CGT/TGG1 
-/CAAAGATGTCAGC1 
AGAGA/TGTGTGTGT1 
-/CGGCAGCCGCAGCGGCTGCAGCAGCTGC1 
-/TGTGTGCGCGCGCGCG1 
-/AGGAGAAT1 
ACGTTCTCTGA/TG1 
ACTC/T1 
-/GGACAGGGGCAA1 
-/GGAACCCCCGGCACCGCCGCCGCCGC1 
-/GGCCGC1 
-/GCCGCCCCCGTCGCCGCCGCCGCCA1 
-/CGCTA1 
-/CCCAT1 
-/AATTAAGAGAAGCAA1 
-/CATG/CCTG/CGTG/TCTG1 
-/GACCCGTGCGCCGCGCG1 
AAATATGAAC/T1 
-/GGCATATT1 
-/AGATTTGCTGAACCC1 
-/CTTAGG1 
-/CAAGCC1 
-/AGGAAGATACT1 
-/CCCGCTGGACTATCACCTT1 
-/TGGTCTATTTTCCCACCCTTAGGCT1 
-/CTGGCTCAGTCCATGTTAAGTTGA1 
-/CTCCCCGCCGAG1 
-/GCGCGG1 
(GT(11_22))1 
-/TAAGAGAAGCAA1 
-/GCTCCTTTTGTAAGCAGCA1 
ACGCGCGCGCGCA/GCG1 
-/CCTAC1 
-/TATTAAACGACACAAGTG1 
-/AACTGAAAGGA1 
-/CAGCAGCAACAG1 
AGCC/GA1 
GGCGGGC/TGGCGGGGG1 
AGTAGTCTATCCA/T1 
-/AACTTAGTGAACCAAGCCCTCCT1 
-/GCAGTAT1 
-/AGCCAGCCCTGGA1 
-/GCTCTGCTG1 
-/ACTTGGTA1 
-/AGGCTGTG1 
-/TTTGCTTCCCAG1 
-/AAAAAAAAAACAAAAAAAAAAAC1 
-/GGGTTG1 
-/AAATCGA1 
C/GTA1 
-/CAGTT1 
-/TCGCGGGCACCGGGCCCGGCGGGGAG1 
-/GCCGGCC1 
-/ACAGTTCCTGCATGGGCGGCA1 
-/GTTCTACCTGAAGAAGAGGAA1 
-/AGATG1 
(CGG(15_65))1 
-/TGTTGCTGA1 
-/GAGGTGTTTT1 
-/GGCTGTG1 
-/GAGCCGCTGGGCTCGGAGGACTCGG1 
-/GGCCGCAGCAG1 
-/AGAGAC1 
-/ATCGCGGAGGGAAT1 
-/TCCAGGTCCCCAGCCC1 
-/GTGCT1 
-/T/TT/TTTT1 
-/AAAAAAAAAAAAA1 
CTACTACTCGGCC/TTGACTACTACTACAG1 
-/AGACCGGGGCCACGACAAGTC1 
(2777 BP DEL)/-1 
(460BP DEL)/-1 
-/A/AT/T1 
-/A/GTTTCTCTTCTTTTTCTT1 
-/CTTA/TGAG1 
-/AAGGTTGTT1 
AGGA/GGCTG1 
-/CCATCTACACGG1 
-/AGGTTGTTGGTGC1 
-/AGGGAGC1 
-/GCACCATC1 
-/TATCT1 
A/TTGATTCTG1 
-/GCGTCTGCA1 
-/CCTGGAGCCCGTAT1 
-/GCTTGACCGAT1 
-/AACGGT1 
-/CCCGAAGGACG1 
ATCAGTT/TCA1 
ACACACA/TCTCTCTCTCT1 
-/CTGCGAAGA1 
-/CTCCTGA1 
-/AACTAACC1 
-/GGACCTAT1 
-/AGCAG1 
GAGCTGATGCCGCTCG/TACCC1 
-/CAG/CAGCAGCAGCAG1 
-/TCCAGCTGCCAAG1 
-/TCGCA1 
AA/TCGCGGTG1 
-/CGCTCGCACCCAGAGCTACCGCTCTG1 
-/AGGTGGGACACGGCAAG1 
-/ATCACCTTG1 
-/TCCACCTGAG1 
-/CTGTCTCTGGGGATG1 
-/GGCCCGGCGCGGCCCC1 
-/GATTCT1 
-/AATAGCTATGTTTAGTTT1 
-/GGAAAGTGCGTG1 
-/AAGGACAAATCTGACGAGGAAAACTGC1 
-/GACGTTC1 
-/TATCCACTTTGAAAAA1 
-/CGCCCC1 
AAAT/TTA1 
-/GCTTTCGAGGTG1 
-/GCATTGA1 
CAG/TAA1 
-/GGTGCTT1 
-/TAAAGACAAA1 
AAAA/G1 
A/GGTATACT1 
-/AATTA1 
-/CCCGTGCC1 
A/GAAGGC1 
AT/TTG1 
-/AGAACTGGA1 
-/AATCAC1 
-/GGCCAGCAT1 
-/GT/GTAT/GTGT/GTGTAT/GTGTGT1 
-/GGGACTGGTCAGATGAACC1 
-/CTAACCTT1 
-/TAAATG1 
-/ATC/CAT1 
-/TGTGAGC1 
-/GGCTCAGGTGCCAGCAC1 
-/CCAGGAGCCCGAGTGCACCCGATGA1 
-/TGAGGAAA1 
-/GTACATTATTTTC1 
-/CTCAAGCAAAGAAAAACTTAA/CTTAA1 
CTTTGTGGTAAGTTT/TA1 
-/GTACTCC1 
-/GGTCATCACAGCCC1 
ACTC/TTGTTTTAAGAGCGTTT1 
-/AGAAGAGGAGGA1 
AC/GTA1 
-/TCATCATTAAGAAAT1 
CGGCT/GCGCTGATG1 
-/TGTCCCATCTG1 
-/ATCTATA1 
-/GGGGA1 
-/AGATGGTCCCAAAGAAGGA1 
-/CCTCCTACCTGG1 
CTT/GTCTTCCTGG1 
(GGTGGTGGCTGGGGGCAGCCTCAT(4))1 
-/AAGT/TAAG1 
-/CCAGATGCTC1 
-/TTAACTT1 
ATGGTGAT/GTG1 
-/GTAATG1 
-/GGGCCTGACACACCAAA1 
-/AGCG1 
A/TACTACG1 
-/CCC/CCCC/GTTTTT1 
-/GGGTTGACT1 
-/GCGGCT1 
-/AAACG1 
-/GGGCA1 
GGAACACATTGTCTATAAAGC/NNNNN1 
A/GGTGACCCGAG1 
-/CGCTGGCCCGCG1 
-/CTGCTGCTG1 
-/CCAGTGGATCAAGCACGT1 
-/CTCTCTCTCTCT1 
-/AG/TC/TCATCT1 
-/AGGTGAGC1 
-/GGACCACCA1 
-/GGCCGGGTGCGATGGCGGCGGTGG1 
-/TGCGCC/TGCGCCTGCGGAAGGACAACT1 
-/GAGAGAAGAT1 
-/GTCAGCTCCACAG1 
-/CTGGTG1 
-/ACGAG1 
-/GGGTGGG1 
CCCATCGCTGTG/TCTGACTGTGT1 
-/ACAGAAA1 
CCGCCTCCT/TCTGCCCCGAAG1 
-/TGCCCACATTTT1 
-/GGGCGACGTCTTCAT1 
-/AGAAC1 
-/TGCAAGAA1 
-/TTCCTGACCCTA1 
-/GGGCGCGGCTG1 
-/AGGCTGCAGAC1 
-/TCTATCGAT1 
C/GTTATTTCAGA1 
-/TTCAC1 
-/AGCTGTCA1 
-/TAGG1 
ACCA/TAC1 
-/TCCTCCTTT1 
-/ATAGTGAG1 
-/NNNNNNNNNNNNN1 
-/AAGTCCTGC1 
ATAGAGGTTGT/TAC1 
AAAGGAT/TTATTA1 
-/CAGCAC1 
-/ATTCAGGTAAG1 
-/GATCAA1 
-/GATTAAA1 
-/AAGGACAG1 
-/TATGGC1 
AA/GTG1 
-/CTC/T1 
-/TGTCATCCTTT1 
-/TATATA1 
-/ACCCCGC1 
-/AAACATCTTACTTGCCAAGG1 
AGATGGATAGATAGATAGATA/G1 
-/GCTCCGGCCCC/GGCCCC1 
-/CTAGCAGAACCTTTATCA1 
-/GAGCATGGCC1 
-/GGAAAAC1 
ACTTCTACAAA/T1 
-/GCTCGATTCGGATGACT1 
-/CTGGATGC1 
-/GCGGA1 
-/GCTGCAGCTG1 
-/C/CGGGCGG1 
-/CAGCAGCAGCAG1 
(CCTG(8))1 
GATACTA/TAGT1 
-/TCTGA1 
-/TTCCATC1 
-/CGACC1 
-/TGGCCCACA1 
-/TTCCTGCGCTTC1 
-/GCTTATGC1 
-/AGTAAGA1 
ATGGAGC/GG1 
AAA/CAAGGAATTAAGAGAAGC1 
CCAGTAA/GCTGCTCGGAG1 
-/AGAAATCCAGTTCC1 
-/AGAGTG1 
GTGA/T1 
-/CTCACCCATGCCCTATGCCTCC1 
-/CTAGTTTT1 
CGCGCGCGC/TGT/TGTGT1 
-/GTCTA1 
-/TTCCCGGGAACACCC1 
CC/TCTGAGAACT1 
-/AGGAAATA1 
-/CTGGAGTCCCAGG1 
-/CCCTCA1 
-/TTAGCAGCCAGCAAAT1 
-/GCTGCCGCCGCGGAACCCCCGGC1 
-/GCCGCGGCC1 
-/ACCACAT1 
AATTAAGAGAAG/CAC/CCC1 
-/TACGGCGT1 
-/GGGCCCT1 
-/TGTCTGT1 
AAAA/CTCCAGACAGCTCC1 
-/TCGTT1 
-/AGGAAGATAC1 
-/TGGAGC1 
-/GAAGTTGGTGGT1 
-/CCTTCCTGGTCTTTGA1 
(AC(11_18))1 
-/ATCCAG1 
-/TGCCTCTGTG1 
CAACA/TGTTG1 
-/TAAGAGAAGCAACAT1 
-/CAATCCTCTGGAACC1 
ACGCGCGCGCGCACA/G1 
ATAGA/TTAGCTCTGGGCCAG1 
AT/GTAAC1 
-/ACCAGTTCCAGC1 
-/TTAAAG1 
AAGGAAGACAGAGAG/C1 
(T(4))1 
AGGG/GA1 
AGC/TTT1 
ACCTATATATATATATATATATAT/TCCC1 
-/TCAAGAGGTGAGTTGCCATCA1 
-/GCAACAGTGCA1 
-/AGTGCAGAAGTT1 
-/AAACAAAAAAAAAAAC1 
A/TGTATGAG1 
-/CTGGG1 
ACCC/GCGTGGACAACCG1 
-/GAGAC1 
-/TTATCACTGCAGGCTTT1 
-/CGCCCGG1 
-/ACCATATCAAAG1 
AACCTTGGG/CGGCAA1 
-/ACTACA1 
-/GGAAGAGGAAGTTCTACCTGA1 
-/AGACGCAGG1 
-/AGTTGA/GAAGTT1 
-/GCTCCCTCTCCCC1 
-/GGCTGCTGG1 
(GCC(6_25))1 
-/TGTGGCA1 
-/GGCGGTA1 
-/TACGTGGACAAGC1 
-/CTGGAGGTG1 
-/CGTTACT1 
-/ATTAGA1 
A/GACATCATGCATG1 
CACAG/GAGAGAGAGAGAA1 
-/GCGGAGGGAATGCC1 
-/TGGGCTGGGGACCTGGA1 
-/GCTCT1 
-/TGCAAGACGC1 
-/ACCTGGGCAAGCTGG1 
-/CGAGGAGGAGGA1 
-/TCTTAACCGA1 
-/AGCCGGGCGGCG1 
AAACAGTAC/TACAA1 
-/GCAGCCAGCCCAGGTGACATGCCGGT1 
-/CTCTTGGGATAGGGAGCCAGCTC1 
-/AGCCGC1 
-/CTAAGGGTGCTCGTGGTTT1 
-/TCTGGAGGT1 
-/CAGTGAAGAG1 
-/ATGAAGAAG1 
-/TTGTTG1 
-/TGACTGTGG1 
-/ATAAAG1 
AAAAAAAAAA/C1 
-/CACTACAGGGCTGGGCGG1 
-/TGTTCATCCGGGC1 
-/TAAAC1 
-/TCTCTGA1 
-/TAAAAAACCTG1 
-/AACCG1 
AAGAAT/G1 
-/CCCAGGACTTGAGCAGC1 
-/CCAGGACCCCCAGGACCTCCAGGACCCC1 
-/TGGCGGCGG1 
-/CACGC1 
ACACA/TCTCTCTCT/TCTCTCTCTCT1 
-/GGCTCGGA1 
-/ACTCCTG1 
-/CAAC/NNNN/TTAG/TTAT1 
-/TTTTTTTTTT1 
-/GGGTCAGACGCGGGAAGGC1 
-/AGCCCGAGCCCGCCGC1 
-/GCA/GCAGC/GCAGCAGCAGCA1 
CTGCCAAGGA/G1 
-/CTGGAGGT1 
GC/TCCGGGAACGAGCCTCGTTCCGCGT1 
-/GCTCGCACCCAGAGCTACCGCTCTGC1 
GTA/TTT1 
-/TGGAA1 
-/CCCCCACCTCCACCTG1 
CCA/TCC1 
-/CTGCAGCTG1 
-/CGTCTAAGGGTTTCTC1 
-/AAGTATG1 
-/GGAGGCCT1 
GACAAA/TTT1 
ATGT/CA1 
-/CCCGCC1 
-/GGCCAGAGGCTCAGCGGCTC1 
GCAAGTTACTCAGATGGAAAA/T1 
-/TAGC1 
-/GCAGGGCTCTG1 
AT/CA1 
-/AAATAAAGACAAAGC1 
-/TTAAGTCTA1 
-/TGCGGGCG1 
-/CCCAAAGGCCCCC1 
-/TGAAGA1 
-/GCAATAGAAA1 
ACCT/GC1 
-/AAAACTA1 
GCCG/TGGAA1 
-/GTGCG1 
-/CTTTACCATACTGTT1 
-/AAAAATC1 
-/TCGCCG1 
-/CTCTA1 
-/GGAGATGG/TGGGGAGA1 
-/GCATACGTGATG1 
-/TGGACACCAGC1 
-/GTGAGGGACAG1 
-/GCTGCTGT1 
-/GGAGACT1 
-/CATGATGA1 
-/TAAAAACATATATGAAATATTTCTTTTT1 
-/GATCTGTGCAGGAGACCGTACT1 
-/CCGCCGCGCC1 
-/GTTACTC1 
-/GTTCGTTAT1 
-/CAGAGT1 
C/GGT1 
-/TTGACAGAGC1 
-/TTGCAGAAGAGTA1 
ATCTAGCC/NNNNNNNNNNNNN1 
-/GACAGCCC1 
GTTGAGTTTCTGAA/T1 
-/AATGACCGCCTGGCCTCCTACCTG1 
-/GCTGCGCAGAAACGCC1 
CACACACAC/T1 
-/TCATGGTGGTGGCTGGGGGCAGCC1 
-/CTAACTGACCTTAAGTTTCAA1 
-/TCAGCATATA1 
-/CAAAGTGTGA1 
-/TGAGGGGGGTGGGGC1 
-/AGCCT1 
-/CACTCTGTCATTCG1 
AGC/AGT/GGA1 
-/TAAATTTG1 
-/GGAAGAC1 
-/AGCTGCGGC1 
-/NNNNNN/TGAGGA1 
-/AA/AAAAAAAAAAA1 
-/ATGTGTTCCACA/CA1 
-/GTGACCCGAG1 
-/AGTGGT1 
-/ACTCTC1 
-/GTGGCT1 
-/TCGGCTATAAAAAAGATAATGGA1 
-/AGACGGATCTCAG1 
-/ACCACCAGG1 
-/AGCTGTGGCGCTGGAAACCTGCAACC1 
CAC/TAT1 
-/GTGCGGT1 
-/CCACCCCTGG1 
-/CCCTGGTGC1 
-/GAGATTACATTCG1 
-/ACGTGATGACAGCTGGCAACTGTGGGAA1 
A/CCC1 
-/GGACAGA1 
A/CTGCTT1 
-/CCCGC1 
-/GGAGGAGGAGGAGGAGGA1 
-/TTAGCATCTCAAGCTCCTAAA1 
-/GGAGGAGGAGGAGGA1 
-/CTAGACC1 
-/GGGGGCGCGGC1 
-/GCTGCAGAC1 
-/CTCTCCTTGAGGCGCCGGTTGCC1 
-/ACAGCAGCA1 
-/CCTATGGCTCCGGAGAC1 
A/TCC1 
-/TTCTAC1 
-/ATGTTCC1 
-/TATATT1 
-/GGCCTGACCCCAGAAGAAT1 
-/ATGGTTC1 
-/ATGACCTT1 
-/AGCAGA1 
-/GCTCTCAGATATGGAGTCT1 
-/TGTAATGCG1 
-/ATCTTTCTC1 
-/TTTTATTTG1 
-/AGCGGC1 
-/TGGCCTGTCCTGGC1 
-/GACAAAATGATACTTTCAA1 
-/AATGGC1 
-/CTT/CTTT1 
-/TCAAGCTG1 
AAA/TAAG1 
AAA/GAAG1 
-/A/AGAT1 
-/CTGTCCCCTCCGC1 
-/AGCCCCGGCCCCGGCCCCGGCCCC1 
-/CTCTTTAG1 
-/GAGCACCC1 
-/TCTAGGACTTGCCCCTTTCGTCTATTT1 
-/TAGAATATGCT1 
-/GGTGATTAAAAACT1 
-/GTTAGTAGA1 
-/GCTGGGTTCGGGCGGC1 
-/TGCACTGC1 
-/ATACG1 
-/CAGCAGCAG1 
AAC/TT1 
GCCAA/TTC1 
A/TAAAAAGCGTGTGTGTGTGTG1 
-/TGC/TGCTGC1 
-/GGAATTTT1 
ACT/GCC1 
-/AGGAGGAAGAGG1 
-/ATGCATATACTGCA1 
-/CTTGCCAGTGTGGA1 
-/CACTGGATGA1 
-/AAGAAGGAC1 
-/TAAAGT1 
-/CAAGGAATTAAGAGAAGCA1 
-/GCAGT1 
-/CGCCAGTTC1 
-/CAGACA1 
-/ACCTCA1 
-/GTACCCAGATTTGACAAAGAA1 
C/CGC/TGTGTGTGTGTGTGTGTGTGT1 
-/ATAGCACCGTTGC1 
-/TCCTCCCTCTGACCACAGGGTCATGCC1 
-/GGCGGGCGGCGGCGGCGGCAG1 
-/TGTACTGC1 
AGC/TAA1 
CT/GCC1 
-/GGCCGCCGCGGCAGCCGCGGCCGC1 
AG/CGACCCC1 
-/GGTGCTGCAGCTGT1 
AATTAAGAGAAGCAA/TTC1 
-/CAGCTGGCC1 
-/GCTGCTGCT1 
-/GTCCACTGAAGG1 
-/ATCCTTTGGA1 
-/A/ACC1 
-/GATTTGG1 
-/AAGTTGG1 
-/GCCCGAT1 
-/GCCGCTGCT1 
-/ATTCAAGGAC1 
-/GCTCTGCCCAGGT1 
-/ACTGGCCGGTGCC1 
ATGAATGAATTCATT/CA1 
-/GCC/GCCGGTGCC1 
-/GGGCAACTCA1 
-/GGCACTA1 
-/TAAGAGAAG1 
-/TCCCCAAGCTGCGCCAGGCTG1 
CAGTGTTCATGACATTC/GTGTCTGGA1 
-/TCGCTCCTGGCC1 
ACTCACACA/C/CCC1 
-/TAACATTAGAGAAA1 
-/CAGGAGAAAGT1 
-/AAGCCC1 
GCATATG/TA1 
-/GATGTTTATGAA1 
AAC/CTTCCTGATGGAAT1 
-/CGAAGGC1 
CGTTTTCGC/NN1 
-/TAATAAAATTAGGAGGTACTT1 
-/GTTGT1 
AAGAACCAAAAAC/GACCCAAAAAT1 
-/TAGGCTGGAATGACCAGG1 
-/CAC/GCGTGGACA/GTT1 
ACAGCGCC/GTG1 
AGC/CA1 
-/AATGCAA1 
-/CC/T1 
AAG/TAC1 
-/CCGTGGGCAGCCCCGG1 
-/TGTACCAC1 
-/TCATATTCTTCATATTCC1 
-/TGGGAC1 
-/TATTTGG1 
-/AGAAGGAGGGCA1 
-/ATGTTTAAGGGAAG1 
-/CGCGCTTGTCCCGCCGCCTGCGCC1 
-/CCTGAG/TACTCTGTGAAGCTGAG1 
-/CTACGCCAAGGAGGT1 
-/TAAAGCAAGACCGAGAGCACCTGT1 
ATA/TCC1 
-/TTCATTG1 
-/AAATG1 
-/GACATCATG1 
-/GAGA/GAGAGA/GAGAGAGA1 
-/ACGGCGGGGAGGAGTCGG1 
-/TGGGCTGGGGACCTGG1 
-/GTAG/TAGG1 
-/GAGCCCC1 
CCTTCAGTAAGT/TACTAAATATA1 
-/GGAAGAAGAGGA1 
-/CCGA/CGAC1 
AACAGTACT/NNNNN1 
-/CGGGGGAACACGCTGA1 
GCGTC/TGG1 
AGACCT/CCGGG1 
-/ATTCCAGGTGG1 
-/GTAAATATTAAATTAGAAG1 
-/CCCAAGACGTGCTCCCAGGAC1 
-/CAGTGAAG1 
-/AAG/NNN1 
CAA/TGAGTAAGGC1 
-/TCCACGTCA1 
-/GC/GCAC1 
AA/CC/GG1 
-/ACCGGGA1 
-/GACCA1 
-/CAGTG1 
-/AAAAAACCTGGT1 
-/GCACG1 
-/TGTTGAA1 
-/GAGAGCTCCGAGGACCCCACCAGCCC1 
-/CAGGACCTCCAGGACCCC1 
-/GCGGCG1 
-/ACCGGC1 
AA/TTT1 
ACA/TCTCTCTCT/TCTCTCTCTCT1 
-/TTCCAAGGGGACAGTAGCCCCTG1 
GCAG/TAAA1 
ACCG/GCCC1 
-/TTGGA1 
GAA/TC1 
-/AGAAGT1 
-/GGCAT1 
CCGG/TGGA1 
-/CAGCCGAGGATCCGC1 
-/GGG/T1 
-/GGCGGGGTGAGCGGC1 
-/AAGATAG1 
-/CCACCT1 
-/CTTCTCTTCTCTTCTCTTCTCTTCT1 
GTTTT/TTTTGTTTTG1 
-/AGGGAGAATGATGATGAAGTAC1 
-/GGAGGCC1 
AAATCTGACG/TGCAA1 
-/AAATAGCA1 
-/ATGAAACATCTTA1 
GGTCTACAAC/TG1 
-/AGTGGCGGCGGC1 
AG/GTT1 
-/TTATTACGAATTG1 
-/TCCTTTG1 
-/TTTTCCCA1 
-/GAGCT1 
-/CTG/TGC1 
-/CGTCGC1 
-/CAAAGGCCCCC1 
GAAAATCTCAAA/T1 
-/CTTTC1 
-/CTGCCCACAGGCCAGG1 
A/CTCAAAACT1 
-/TTTTGTTAATGT1 
-/GAGTGCCTGTGCCCCGACGGCTTC1 
-/TGTTCTTTAC1 
-/AAATCAA1 
-/ATATATTTCA1 
A/GTC1 
-/ATACGTGATGGC/CTCCGTGATGGC1 
-/TGGCCCTGCACG1 
ATCGGT/CATCCC1 
-/ATTA/T1 
-/TACTGGATGTA1 
-/AAGAAAAA1 
-/CGATC1 
-/TCGGCTCCA1 
-/CAGTTAC1 
-/ACTGGACAGAAGACCCTGACC1 
CTTGGA/TGT1 
ATCCTACATACTTAAAATTTCTT/TGCTGG1 
ACGGCGTCTCTTCCTATG/CAGCTTA1 
-/GTGTCCCATCT1 
-/CAGTTGAAAT1 
-/TTCAGA1 
-/TATCAGCGGAGGC1 
-/GTT/TTG1 
-/GGTAGGAGGCCAGGC1 
-/CGGTGCAGCCAGCCCG1 
CACACACACACACAC/T1 
-/G/T/TT1 
-/TTTTTTTTTTTTTAATTTT1 
-/AGAGGGAA1 
-/ACGC1 
-/TCAAGAT1 
-/CCCCA1 
-/CACCTGATCTGTCA1 
-/GCGCCGGCGCCG1 
CACGCCCCTTTCATCCA/TTCTT1 
-/GGCCCACCCCT1 
AAGG/GAGT1 
ATAA/T1 
-/ATCGCCACCTACCGCAAGCTGCTGGAG1 
-/TATAAA1 
-/GGCAGATG1 
-/TCCCGG1 
-/GGGGGAAGAG1 
C/GCTG1 
CTT/GCC1 
-/TGCTTCTGGTAGA1 
GCAGT/TCCTTCA1 
-/AGAAGAT1 
-/GTGCCGTGC1 
-/TCCTGGACTTGATGTTCCAGGACC1 
-/GTGCCC1 
-/ATCGACATGGTGGCCGCCATCCCCTTC1 
-/CAAGAAGCCGGTAGTCTACACCCG1 
-/TGCGGTG1 
-/CGTTGCTGGCAGAGGAAATGA1 
-/ACCCCCTGG1 
-/CCTAAAGTACAGAGA1 
-/TGGCCAGGGGTCACTGATA1 
-/GTCCT1 
-/AGGGC1 
-/GACAG1 
-/CAGCCA1 
-/TCTGGCCTCTGACATGTGCGC1 
-/TCCCCACAGTCCCCGCGGTTCATTGG1 
-/GGAGGAGGA1 
-/TTGTGGCCT1 
-/GCCTGCTGCTCACCGCCGCGC1 
AAG/NNNNNNNNNNNNNNNNNN1 
-/ACAGCAGCAGCA1 
-/TAGGGGG1 
-/TATATCAAATTGATATTTCAACAAC1 
-/AGAGTC1 
-/TATGGTATGTA1 
-/CTGGCCTGACCCCAGAAGA1 
-/TTGCCAACTT1 
-/TTTCTTCTT1 
-/GGTAAATGA1 
-/GAAGCA1 
-/ACCTT1 
-/AATAATGGACG1 
AA/GTT1 
-/TTTTTTT1 
-/GGC/GGCAGC/GGCGGC1 
-/GTGTGTGT1 
-/GGCCCGGCCGGGCCAACGCGGGCCG1 
-/ATCTTCTC/GAGAAGAT1 
-/GACGCCG1 
-/TGGTGGAC1 
-/GCCCCTTCAACCTCCCA1 
-/CTCTGGGTGCA1 
-/GAA/GAAAGAA1 
-/AGAGGAGCTCA1 
-/A/CTTTT/G/T1 
-/TCCGGGGC1 
-/AGCCCCGGCCCCGGCCCC1 
-/TAGGA1 
-/TTGGACCCAG1 
-/AGAAATGTCTTCA1 
-/GAATCAG1 
AAAAAAAAA/G1 
-/CTCTCTCCA1 
-/CACCCCGG/TT1 
-/CA/CACA/CACACA/TC1 
-/AAGATCTGCAAA1 
-/AACCA1 
-/T/TGTT/TTGT1 
CCC/T1 
-/TGGCTA1 
-/ACCCA1 
-/TTTTGTC1 
GA/TG1 
-/CTGCATGCAAATGA1 
-/GTACAGTCACTTGTTCATGGTGGTTTG1 
CAAA/TGT1 
-/TTCAGGTTCTTT1 
AAAGTT/CAAGGAATTAAGAGAAGCAAC1 
-/GATGGGC1 
CCACGGCGGC/T1 
-/TGAAAAAA1 
-/CTCATCGCCATGGCG1 
A/CTCGC1 
-/CTACTAGGCATAGCACCGT1 
-/AGCTCC1 
-/CTGCACTGTGACAAG1 
(GCG(15_22))1 
-/GGGGTCAGGGGAGGAGG1 
AGCA/GGC1 
-/AATAAA1 
-/GGGCCGCCGCGGCAGCCGCGGCCG1 
-/ACCCTGGCAAAGCTCCC1 
AATTAAGAGAAGCAACATC/T1 
CAG/GTACCGTT1 
-/GGACATGG1 
-/CCCCATCCCG1 
-/CACTC1 
GTA/T1 
-/TCTAGAATT1 
-/CATGCTG1 
-/AAGGAAGATA1 
-/AAGGTAAC1 
CAC/G1 
C/TCTAGCAG1 
-/GAGGAGTGT1 
-/GGACACCAGGCGCGGCATGGGAA1 
-/TCTGCCCAGGTTAAGGGCCACGGC1 
-/GGAAATGAAACATCTG1 
-/CCTGGAGACCCAGGGCAA1 
CGAGCAGAA/T1 
-/GTTACAA1 
-/CAACTCAGGG1 
AAGA/CCCG1 
-/ATCCTGGTGACCGTGCTGGTG1 
-/AGGGA1 
-/CCCAACACTGT1 
-/GCCCCTTTGTTGTCCCCAGCC1 
ACTCACACACA/C/CCC1 
-/TAATAACATTA1 
-/GAGGCCACGGCTTCCATTGAC1 
CCAA/TCT1 
-/GGGCTGGCTGCTTAAGGTCCACCTTA1 
-/TCATGCCACC1 
-/TCTTCATAG1 
-/TAGCC1 
-/TTTGATGTATTTACAATTTTT1 
CACC/GACA1 
-/TAAATAAA1 
CTGG/GTGA1 
-/GGACAACCC1 
-/GTCCCGCTCCGG1 
-/AGCAGG1 
-/CTCCCGG1 
-/GTTTCCCTGT1 
-/GGGCCCAGCCCCC1 
-/CTATGAGCCGCC1 
-/TTAACTTAACA1 
-/ACGGCAGAGC1 
A/CTAGGACTGTGT1 
-/GGCCTGT1 
-/GATCCCGAGGTCCC1 
-/GAGCTGCGCCTGGCG1 
-/ACTACTCTGTGAAGC1 
-/GTTGTT1 
-/AGCCA1 
-/CCAGGGAGG1 
-/AGAGAGTAGCAGTATTTCA/C1 
ACATCATGCATGAT/GA1 
-/CAGAGA1 
-/AGAGTCCGGCCCGGA1 
(CCCCAGCCCTCCAGGT(1_2))1 
C/TGGTCTACTGCCTGG1 
-/GAATC1 
-/AGTGAGTATAGCTGC1 
-/ATTCAAGTAACTTGAA1 
-/CCTA1 
-/TTACTACC1 
-/AGTAC1 
-/GCCCTCGCGGCCTATGG1 
-/TGTTAAAGCATATAGCACAGATG1 
-/ACAGTCATCGGGGCAAGGCAGC1 
-/AGTATTGACTACTTCATTG1 
-/AGACGTGCTCCCA1 
-/TTGTA1 
-/CACA/CACACA1 
ACACACGCA/G1 
-/TCGACCCAAAGAGGACACACAG1 
-/AGGAGATCCTGCGTGA1 
-/TTTCCCCCAG1 
ATTA/GGAGCTGTAGCC1 
AAA/GCC1 
-/CCCTG1 
-/GAGGACCC1 
-/CAGGTCCTCCTGGTCCTC1 
-/AGAGAT1 
-/GGAATTAA1 
-/TC/TCTC/TCTCTCTC1 
-/ACAGTAG1 
CG/TGAGGATTT1 
G/TTT1 
GCCAAGGTGA/T1 
-/ATGTCTG1 
AATAC/T1 
-/GAGCCG1 
-/GAGGACGTTG1 
-/GGTTC1 
-/CCGGCAGCCGAGGAT1 
-/TCGCCTCCCGC1 
-/TCCTGAAAGTAG1 
-/CACCTCCACCT1 
-/C/CTTCT/CTTCTCTTCTCTTCTCTTCT1 
GTTTT/TTTTGTTTTGTTTTGTTTTG1 
-/GACATTGA1 
-/TGATTGATTTAC1 
-/GACGGACTGGCGCT1 
-/GACTGCAAGGACA1 
CAC/T1 
CGA/TTT1 
-/ATGCGG1 
-/CGCGGCGGC1 
AT/CT/GG1 
-/ACTCTATCC1 
-/ACAGTC1 
-/ACTTCTCCCTGCCTCCCCAGGG1 
ATGGG/GCT1 
-/TATTATA1 
-/CTCCTGGA1 
-/AAATGTT1 
AAGGC/GAGT1 
AGCATC/CATATAGCAAA1 
AGGC/GGTG1 
AGAAA/GAAATTCAATCCT1 
CCTGCCTA/G1 
CCTC/GA1 
-/CGAAGGTG1 
-/NNNNNNNNNNNNNNNNNNNNNNNNN1 
C/TTT1 
-/TGATAGA1 
-/TACAAA1 
-/GTCAGCC1 
G/TTAT1 
-/TGCACGCAAA1 
-/ACATCTAC1 
ACAATCTCAG/CATCA1 
-/CCAGCAGGGGAGGCCC1 
-/AAAGCTA1 
-/TACCT1 
AGTCTTCTATCC/CACA1 
-/AAGCCTGGGC1 
-/TAGTT1 
-/ACGCCGGTCACGTGGCGGGGTGGGG1 
-/TATGGAAA1 
-/AGCTAGA1 
-/ATCCAGGCCCCCGAC1 
-/A/TGTC1 
-/GTTGAAATTA1 
-/CTCTCCATCTGAATCTGCAAAAGTA1 
AGCTGAGCCATCC/CG1 
A/TTCTT1 
-/CGCCTGGCCTCCTAC1 
-/GAGGGGAAC1 
-/CA/TA/TACA/TACACA/TATA1 
-/TTAGTAGTACT1 
-/TTACAGGAACT1 
AAGGG/TTTTTTTTTTTTT1 
-/TGTGTGTGTGTG1 
G/TCTTTCCACAGCCA1 
-/AGGGTCCTGGAGAAAAGTCCTGGGAAG1 
-/GCTTC1 
-/TGTCCCACCTGATC1 
-/TGGTATGTACCTCTGGCAAATGCCC1 
-/AGGTATCAATTACA1 
-/CTTGGCCGTC1 
-/GAGACTT1 
-/AAC/CAA1 
-/AAAC/AACA1 
-/ATTGGGCA1 
-/CTTACACTTCACTTCCCCAGACTACGGA1 
CTGT/TAC1 
CGC/TCT1 
-/CGC/CGCCGC1 
-/GTGGA1 
-/GGCTATAAAAAAGATAATGGAAA1 
CCTCAACGT/TGGC1 
-/AGGGATCCCCGGAGCACC1 
-/ACTGGTCCT1 
CT/TGAGGGCGCCGC1 
-/ATGCTGCGGACGCCGGGACGCCACGG1 
GGCCCCAT/TAAG1 
-/ATGCTGGTCCCCCTGG1 
ATATATATA/ATATATATATA/TTTTTTT1 
-/CGGGA1 
-/TCATG1 
GTGGTTT/NNNNNNNNNNNN1 
-/GACTTCTGGA1 
-/ATCACTGTGCAGCAGCAATCTT1 
-/GAGGCGGGGACACCAGGGCCTG1 
-/CAGAAGGCG1 
-/GCCCGGCGCCCCAGGTCCCGCGC1 
-/AGGAGGAGG1 
-/TGGATAC1 
-/GGCACCAGGAGAC1 
AAACTAAAG/GGACTA1 
ACAA/CCAGAC1 
-/GC/GCA/GCAGCA1 
-/CGGCGCC1 
-/AACAGAAGTTCAGCTTCGGTTT1 
-/TCAGAG1 
(CAG(7_17))1 
-/CTGGCCTGACCCCAGA1 
AA/TCT1 
-/GACATTTTTCCTACCACTTC1 
-/AGTGG1 
-/AACAAGCTGTGC1 
-/CATCAGATTTATAT1 
-/TGGTTTGGCAAAAGAAAAG1 
-/TCCTCCTCCAC1 
-/CGGCCGGGCC1 
GGAT/TGCTGTAAACTGTAACTGTAAA1 
-/GGCTCGCCACC1 
-/CAATCCGCGCGGCGGCCGCCGCC1 
-/GGTGTG1 
-/GAACCGTG1 
-/CCCGCGG1 
-/TGGTCAAAT1 
-/TTCTA1 
-/CACCCTGATCCAGCGCACAATCCGTGA1 
ACGTG/CCTTC1 
CTTAT/GAG1 
-/TGGGAGAACTGAAGG1 
-/AGGACTT1 
-/TGTGTCAGC1 
ACA/GTCTGTTTT1 
-/C/CC/TT1 
-/TAAAGCAGGTGG1 
-/GTATTTT1 
-/TCCGCCA1 
-/GAGAGAGA1 
-/CAGAAGGTGACTG1 
A/AGA/TGTGTGTGTGT1 
GGGCATCATCCGGC/TAGAGCACAGGA1 
ATC/TGAT1 
-/TCCCAG1 
-/NNNNNNNNNN/TAGCCCTGAG1 
-/CGCTGCCG1 
GCAG/TGGCTGGTGT1 
-/GGCCTC1 
-/CGCAGCTGGAGGCACTGCTGT1 
(CTG(5_37))1 
-/GCTGCTGTTGCT1 
C/GAATTATATCT/NNNNNNNNNNN1 
-/AGCCACCTTTGGAAGAGCTG1 
AA/AGAA/CAGTG1 
-/AAAATTCCCGTCGCTA1 
-/GCCCGCG1 
-/CACGGCGGC1 
-/TGGAGTT1 
-/GTACG1 
-/GTGGCGCTCATCGCC1 
-/TCGC1 
-/AAGCA1 
-/ATAGCACC1 
-/AGCGGCGGCTGCGGCGGCGGC1 
-/TTGTAGA1 
-/CCAGGTAGCG1 
-/GGAAGGTCGGCCAA1 
-/ATTATCCATTC1 
-/GCGGCGGCCGCGGCCGCGGCTGCCGCG1 
-/ATCCTAAA1 
GA/TGGTACGGGCAT1 
AATTAAGAGAAGCAACATCTC/TCT1 
AT/CGG1 
-/TACG1 
-/AGCAGCAGGCGGCTACTGCACAA1 
-/TCCAGACATGC1 
-/AACTCCACCGCGGCGGCGGC1 
-/TAGAATTTC1 
-/AGGGTTAGAAGGCTGCACC1 
AAA/C1 
-/CTATAAAA1 
-/AAGGTG1 
-/CACCAG1 
-/AGGAGTGTG1 
-/GCGGCGGC1 
-/GCGCTGACCAAC1 
-/GCCGCCGCCGCCGCCGCC1 
ATTAGTGGCCCTCCTG/NNN1 
-/AGGAGAG1 
-/ACCTGGTGG1 
-/TAGTTTT1 
-/AGCAACATCTCCGAAAGC1 
-/AT/T/TT1 
-/CGTT1 
-/TGCTC1 
-/ACAA/ACACAA/ACACACAT1 
ACTCACACACACACACA/C1 
-/GCATGACCTTGGCGTGGGCAT1 
-/GAGTA1 
-/A/AAAAAAAA/AAAAAAAAAAAA1 
-/TGTTACCTCGA1 
-/GTGTT1 
-/CCTCCT1 
-/TATTTATGCTAATAT1 
G/TGAA1 
-/GAT/GATA1 
-/GGGAGCCCCCAGTCGGCCC1 
-/ACAACCCCC/CGAACCCCC1 
-/CGGCTCCCGCTC1 
-/TCATCGGCAAGT1 
-/CAAAGTCCAAA1 
-/GGATCC1 
-/ACCTACCCACTCT1 
CTGGCGCAGGAGGCC/GCT1 
-/TCCCCCTCGCCGTCGC1 
-/GGTGCCCTATGAGCCG1 
-/TCTCCCCACCCCC1 
-/GGAC/T1 
-/AGGCG1 
-/TGAGGCTCT1 
-/TTCCA1 
CCGTATAGCTGG/TT1 
-/GCCGAGCTCCCG1 
-/TACTCTGTGA/TCTGTGA1 
-/TACAA1 
AG/CAA1 
-/TGGAT1 
-/ACCTCTG1 
-/CTCAT1 
-/TTTTAGTCCTGTTGTTCTA1 
ACATCATGCA/T1 
C/GAGAGAGAG/GAGAGAGAGAG1 
-/AGGCCGGG1 
AAGAACGT/TTCC1 
GTC/T1 
-/TGACAGAAGTGG1 
-/GACCCTGCA1 
-/TTCAAGTAACTTGAAA1 
-/ACGTG1 
AAAAA/NNNNNN1 
-/GGTGGCCCACGCCTACCGCCTCT1 
-/G/TGG1 
-/ACAAGCT1 
-/GCAATGGGAGCTT1 
(LARGE DELETION)/-1 
-/TGCTCCCAGGACG1 
-/AAATCTAAGCCCAC1 
-/TTTATCGCTTCTGTGACAGA1 
-/CTCTGA1 
-/ATTTCTACT1 
GCGGCTG/TCC1 
-/GAGGTCCACGCAGCCGC1 
-/TCCG1 
-/CTACAGCGTGG1 
AGCA/GGCGGCGGCGGCG1 
-/GGGTGTTT1 
-/ATCATG1 
AATCGTTTGTGTTTCAC/TTGGCT1 
-/GCCCGAGAGCTCCGAGGA1 
-/CCAATGCTG1 
AGTCCCCG/GGGGACTGGCT1 
-/ACGCGGT1 
-/TGCCCT1 
A/TCTCTCTCT/TCTCTCTCTCT1 
-/AGCCCCT1 
-/GGAGA1 
ACAT/TACCCCTATTG1 
-/GGTCAA1 
-/TGCTCTTCC1 
-/AGGGGTTATTCGGC1 
-/TACGGCCGC1 
-/AGTCG1 
-/TTCCAGAAGCACGGGGCATG1 
-/GGGACTCTTTATGCGCTGCGGC1 
-/GTTTTTCTCATGTCAGTTCAAATTC1 
-/CCTGCCCCCACCTCCACC1 
-/ACAGCA1 
-/TGTTTTGTTTTGTTT1 
-/CTTACTGTCTCCGGTG1 
-/TGATTTAC1 
-/ATCTGACGAGGAAAA1 
-/G/TC1 
-/GCCCTTT1 
G/H1 
-/TTCTCAGTTAAAAAAGT1 
-/GCTGTCATTGCCTTCCGTT1 
-/GACACCCAC1 
-/CCCCCA1 
-/TGGCGTCCAGGT1 
-/AAAATTCAAACTTCAGAAAT1 
-/ACTAT1 
-/CCATCCCGCCCCGCC1 
-/ATAATCAC1 
-/CACCACCATCACCACCACTC1 
AGG/T1 
(427 BP DEL)/-1 
-/TGCTGATAATCATGTGCTACCCTTGG1 
-/CGATACTG1 
-/ATGCGAAG1 
-/CTACAGA1 
-/TAGCCTCAACCA1 
-/TTCTAGTGGCAGGGCTA1 
-/TACGTGATGGCT/TCCGTGATGGCT1 
-/GAGCGGGT1 
-/CTGGCT1 
-/GTGAACC1 
-/GCAGCAAGGCTTGCTAAT1 
GG/TGCTAGACAA1 
NNNNNNNNNNNNNNNNNNNN/TGTACCCTT1 
AAAAAAAAGACT/GAAAG1 
-/AATTTCCA1 
-/NNNNNNNNNNNNNNNNNNNNNNNNNNNN1 
C/TG1 
-/CTAAGCC1 
-/GCTCC1 
-/ACATA1 
-/CTGTGGACTGG1 
-/AG/G1 
-/CACAAATTGCAAGAGTAGT1 
-/GTCCCCCCGGCCTGAGGAGCCACACCT1 
-/TCTCTTT1 
-/GTGGCGGCCT1 
-/GCCGCCCCAGCC1 
-/TTAAGGGAAGTTTG1 
-/CCCATCGAGCATGGTAT1 
-/CTCTGCGTGTTCTC1 
-/TCCTGGAGAAAAGTCCTGGGA1 
-/AGCCTGCAGAGGC1 
-/GGCTGATAAC1 
-/CTTCGAG1 
-/GCCTCC1 
-/AGTGCCTAACG1 
-/GGCCGTCTT1 
-/CTTTCCAGGACAAGTACTTTATGATAGG1 
AGCTGGTA/GGAG1 
-/GCAGCTTGCTA1 
-/GTTGTG1 
ATAGTGG/CA1 
-/TGTGTGTG1 
-/T/TC/TCC1 
CTGCT/TGTCTTTTTTATA1 
CTGTT/GAA1 
-/CTATAAAAAAGATAATGGAAAGG1 
-/TCCAGGACTGCACTCC1 
-/GTATGATGGG1 
-/ATAGG1 
CTGACCGACTCCTGCA/GTCAACCGCG1 
-/TCGGCCGACGACATCGAGG1 
-/CAGAAAACAACCCGAT1 
-/CTCCTCGTC1 
-/CTGCCATCTCTT1 
A/CCGT1 
-/GGCAGCAACAGTCTTACCTGGACT1 
-/AGAAACCA1 
-/AAGTACTTGATGT1 
-/ACGACTC1 
A/TGCCCGGG1 
-/ATGTCATCC1 
-/ATCGCGCCC1 
-/GGCTTTGA1 
-/TTCACCTC1 
NNNN/TTT1 
ATGGA/TGGG1 
-/ATGCCGGGGCATGAA1 
-/GTGAGTGG1 
AC/TAT1 
AAA/T1 
C/TGTGTGTGT/TGTGTGTGTGT1 
AGA/TTTT1 
-/GAGGCAAATATT1 
-/CTTATGAG1 
-/TGGCGGTGG1 
-/TA/TATA/TATATA1 
-/CTTTTGAGT1 
ATCA/TGAT1 
-/TAAAGTC1 
-/AAAGCA1 
-/GTGT/GTGTGT1 
-/GGACCTGCCCTGCT1 
-/AT/GGCTCGCCACC1 
(GAC(5))/(GAC(6))/(GAC(7))1 
-/TCGGACGAGGACAGCGTCTC1 
-/GCCCATGTATA1 
GAG/TA1 
-/ATCTC1 
-/ACCAGTAAAAATAAAGAACCAG1 
-/CTGGGC1 
-/CTGCCAGGC1 
-/GGCTCCGGCTCCGGCCCCGGCTCC1 
-/GCGTTTCGGAC1 
-/ACTGAAGGATGACGA1 
-/TTGTCAGACGA1 
-/GTCTCACCACAGATCTAACAGC1 
-/ACCAACCTGGTA1 
-/CGCATTGAGGACGGCTTC1 
-/ATT/ATTTA/ATTTG1 
-/CACCCTGCTACTGC1 
-/AAAGCAT1 
-/GGAGGTCCTTG1 
AGA/TGTGTGTGTGTGT1 
-/TCAGCCCTGCCAGCCCAGC1 
-/AGTTCGCA1 
-/TCTGGCCAACCACGCCGTGGCAGAG1 
-/GCAAAGCATGGATTCAA1 
-/CGAGGAC1 
-/AAAGTGGTGGC1 
-/ACCTCTAAGAG1 
-/AAAAGCTGCCATGCCAAGAAT1 
-/CCCGCTGGCCAC1 
-/TGCTGC1 
-/GAATTATATCT/T1 
-/TCGT1 
-/CCAGCTGTTC1 
-/CGAGGTGA1 
-/AAAATTCCCGTCGCTATC1 
-/AAGGTGAGTGGGACTGCC1 
-/GCGGCGGCT1 
-/A/CCA/CCCCA/CCCCCA/CCCCG/CCG1 
AAGAACACAGGGGAGAGCA/CTGGTG1 
-/TGGGAAGGAGTTTG1 
-/ACAATTTTTAATGAT1 
-/GCTTGTCCAGATGGCAGGAAGGAG1 
-/AATATACC1 
-/CAAGATTGTCGGCAAGTGG1 
(7399 BP DELETED)/-1 
-/GGCTGCGGCGGCGGCAGCGGC1 
-/CACCT1 
-/CGCTACCTGGCGCGGCTCG1 
ATCTGA/TAGATTC1 
-/ACTTTTAGTAAAAAATTTTTT1 
(GCG(17))1 
-/GGAGATCC1 
-/TCAAGTC1 
AATTAAGAGA/C1 
-/AGCTGGG1 
-/AGGCCCCG1 
-/GCAGCAGGCGGCTACTGCACAAGCT1 
-/TGGGGGT1 
ATTATAAATACCGGCC/TATTTATAAT1 
-/TTATAA1 
-/TGTTA1 
-/CAATAGCCTTGAC1 
GCG/TAAGTGGGTGTGA1 
AT/CT/GC/TT1 
-/TGATGAAGA1 
-/GCCCTGAGC1 
-/CCGAGAA1 
-/GGGTGAA1 
-/ACTTCAG1 
-/AT/ATAT/ATATAT1 
-/CGTCCGTGACC1 
-/ACATCTCCGAAAGCCAACAAGGAAA1 
-/AGGGGCAGAGTGTC1 
-/GAAGTTCATCAAGGGG1 
-/GGCCGCCGGGGGGGCGCGG1 
ACTCACACACACACACACACA/C/CC1 
-/NNNNN/TGAGA1 
-/ACCCCTGCAGCCAGGAACTG1 
AACCT/GACCCAGCGACTGCTAGAGATCC1 
AGT/G1 
GG/TTT1 
-/TGGACGC1 
-/AACTTCAA1 
-/TTTAAAAGATATAAGACTTAA1 
-/CCAAGGTCTTCA1 
-/AATT/TAAT1 
-/AACCCCCAC/CAC1 
-/CCGCTCGGGATC1 
-/GCAGGAGGGCCGT1 
-/GTCCAAA1 
-/CGTTGATTTCAGAGAATATGA1 
-/AA/AAA/AACAAA1 
-/CTATGAGCC1 
-/GCTTCTGGTCATCCTTCAGG1 
-/TCATAGC1 
-/ACAAAACAAAACAAA1 
-/GCCATCCCACTGGACTACGAG1 
-/TCAGTTCTCCAATCTTGAG1 
-/CGAGGCCTTCTCTGGC1 
-/TGTTCGAG1 
-/ACCACGTCCTCAGCTTC1 
-/TATATAC1 
-/CCATTA1 
-/AAAGATCTCA1 
CATCATGCATGAT/G1 
-/ACCGAGGTACG1 
-/CCACCA/CCACCC1 
-/A/AT1 
-/CAAAGAGGAGAACCTGGA1 
AGTT/TATACAGGCTCTGGAAAA1 
CG/GTC1 
-/GAGAGGG1 
A/GGAG1 
-/CGGCG1 
-/GCTGGTCCT1 
-/ACGAGTTTCG1 
-/NNNN/TAGT1 
AAACAAT/CACAAA1 
(TTTA(6_10))1 
-/CTTGGAGCT1 
-/GTTACAGAGTT1 
-/GGCCAAGCTGG1 
-/GGC/GGCGGCGGC1 
-/ACCAGCTCCTT1 
-/CTCCTAGTCCCT1 
-/TTATAT1 
-/GTTTGTG1 
-/CTCCGAG1 
GC/TGACG1 
-/CACACA/CTCACA1 
-/TCAGTTGTGAGT1 
-/TC/TCTCTC1 
-/TGGCGAGTGCATCCACTCCAG1 
-/TTAAAGCGTAAAAGG1 
-/AGATGAAGAG1 
GCA/T1 
-/CCGGAGGAAGTTTCTTTAC1 
-/GGTTATTCGGCGGCTGG1 
-/AGCCGGGG1 
-/GAACTGGCTGACCATG1 
-/CCGGATAATCGGCAGCCGAG1 
-/GGCGCTGGGACGCGACTGCGCTC1 
-/ATGAG1 
-/GAGTAT1 
-/GACCAGCTCA1 
-/CTGCCCCCACCTCCACC1 
-/CAG/CAGCAG1 
-/TGGAGGTGCAGGC1 
AAATGATTGAAAA/TG1 
-/GCGGGC1 
ACG/NNNNNNNNNNNNNN1 
-/CAGAGAATCCT1 
-/GGACG1 
ATT/GA1 
-/TTCTAATAGAGAACTGATAGAAATT1 
-/AACTTT1 
AAGATCGCC/CGTCGTGG1 
-/TTTTTTTTT1 
-/GTCCTATG1 
-/CCTCGCCCCGCCGCG1 
CAG/GACT1 
-/CATCACCACCAC1 
-/GTGAAGA1 
-/AACTTTCATCAGGAAAGGC1 
-/CCTCGCAT1 
-/TTTGGA1 
AGAGTGTCAGGATCCCGAC/T1 
CTGTG/NNNNNNN1 
-/CCTAATGT1 
CCAAAAATCAGAGCTTGGAGGG/NNNNN1 
-/TCT/TGT/TTT1 
-/ACCGATATCTACCCCT1 
GCCCCT/TGGCTGAGC1 
-/GACGAGG1 
-/ATCTCCCA1 
-/CTACAGCT1 
-/GGGAGTGTGGTGGCAGCCG1 
-/AGTGGCCTGTAATCCT1 
ACACTT/CCCTCC1 
AA/TGTT1 
GGTCCAT/TGTCCAC1 
AGTTA/GTT1 
AGAGACA/TCT1 
-/A/AG/C1 
-/AGTGGGGTTTAGGG1 
-/GGTGCCT1 
-/GCACCTGTCCCCCCGGCCTGAGGAGCC1 
-/CTTT/TCTT1 
-/GCCATGCCCCCA1 
-/AGGAGA1 
ACTCCT/CTCC1 
-/GACCTATGAAGGGCACTAC1 
-/TAGATGCTG1 
-/GGAAAATGTCAGG1 
-/TCTAAACATT1 
-/AGAAAAGTCCTGG1 
-/ACCTCAAGG1 
(T(27_30))1 
-/ACCAGTTCCCCCTCGAGGCC1 
-/CAATTGTCATG1 
-/TATTTTGGACAG1 
CTG/TT1 
-/AAGTTGTT1 
-/AGGAACAAGCTGGCC1 
-/CAGCTTGCT1 
-/GGTGTCCA1 
-/AGCGAGC1 
-/TGGGG1 
AGG/TGA1 
-/CTCT/T1 
A/GGATGACACAGCT1 
-/ACGTCAAGGCCCGT1 
AT/GTGGTGTACCTGG1 
-/CGCCCTGGCCC1 
-/GCCGACG1 
-/C/CCCCCCCCC/CCCCCCCCCCCT1 
-/GGTGAACAGCTTGTGGTGTCTGGCTCA1 
-/CGTCTTCCT1 
GCA/TGTTGCC1 
ATTAGC/G1 
-/CTGAAAATGTAA1 
AGCCCAG/C1