Schema for foldUtr3
  Database: hg38    Primary Table: foldUtr3    Row Count: 95,320   Data last updated: 2023-02-18
Format description: Info about folding of RNA into secondary structure
On download server: MariaDB table dump directory
fieldexampleSQL type info description
name ENST00000000233.10varchar(255) values mRNA accession
seq ccagccaggggcaggccccugaugccc...longblob   mRNA sequence (U's instead of T's)
fold .....((((((....))))))..((((...longblob   Parenthesis and .'s that describe folding
energy -168.3float range Estimated free energy of folding (negative)

Connected Tables and Joining Fields
        hg38.bioCycPathway.kgID (via
      hg38.ccdsKgMap.geneId (via
      hg38.ceBlastTab.query (via
      hg38.dmBlastTab.query (via
      hg38.drBlastTab.query (via (via
      hg38.gnfAtlas2Distance.query (via (via
      hg38.gnfU95Distance.query (via (via
      hg38.humanHprdP2P.query (via (via
      hg38.humanVidalP2P.query (via (via
      hg38.humanWankerP2P.query (via (via
      hg38.keggPathway.kgID (via
      hg38.kgAlias.kgID (via
      hg38.kgColor.kgID (via
      hg38.kgProtAlias.kgID (via
      hg38.kgSpAlias.kgID (via
      hg38.kgTargetAli.qName (via
      hg38.kgXref.kgID (via
      hg38.knownAttrs.kgID (via
      hg38.knownBlastTab.query (via (via
      hg38.knownCanonical.transcript (via (via (via (via (via
      hg38.knownIsoforms.transcript (via (via (via (via (via (via (via (via (via (via (via (via (via
      hg38.knownToSuper.gene (via (via (via (via (via (via
      hg38.mmBlastTab.query (via
      hg38.rnBlastTab.query (via
      hg38.scBlastTab.query (via
      hg38.ucscScop.ucscId (via

Sample Rows
ENST00000000233.10ccagccaggggcaggccccugaugcccggaagcuccugcgugcauccccgggaugaccagacucccggacuccucaggcagugcccuuuccucccacuuuuccucccccauagccacaggccucugcu ........((((((....))))))..(((((((.....((((.((.....((((((.(......)))))))......)).)))).((((((.((((((......((((((....((((...(((((((((( ...-168.3
ENST00000000412.8auugcacuuuauauguccagccucuuccucagucccccaaaccaaagcuacacagccagauuucucaagcagucucaacuccagucccucaucucacccuuacuauugcucuugcuuuccaguuugcu .....((((........(((((((((..(((((((((((((((.......(((((..((((((((.((((.(.((.((....((((((..((((.((((((.((....((((((.(((((....((..((( ...-393.6
ENST00000000442.11ggcaaggggugggacugguggggguucuggcaggaccugccuagcauggggucagccccaagggcuggggcggagcuggggucugggcagugccacagccugcuggcagggccagggcaaugccauca ...(((..((((((((.(((((((..((((((((....((((((.(((.(((((....))))).((((((.((((..(((........)))..)))).)))))))))))))))))))))))....)))))) ...-332.9
ENST00000001008.6ccccucuccaccagcccuacuccugcggcugccugccccccagucuccccacuccacccuguuaguuuuguaaaaacugaagaauuuugagugaauuagaccuuuauuuuucuaucugguuggauggu .........(((((............(((.(((((((((((((((..(((.((((((((.....((((((((...))))))))(((.....(((((((.......))))))).....)))((((((((((( ...-673.5
ENST00000001146.7cccaagacccacccgccucagcccagcccaggcagcgggguggugguugugggagguagaaaccugugugugggagggggccggaacggggagggcgaguggcccccauacuugcccucccuugcucc ..........(((((..(((..(((((((((((((.((.(((((..(((((.(((((((..........(((..(((((((((..((...((((((((((((((.......))))))))))))))..)))) ...-1142.8
ENST00000002125.9uauuucagcuuggacauuuuacccuucagucggcccaagaaaucaaaauaaaggaaacacauuucauauacugcagguaacaaaagucaaaguauuuuaucuuuucacagcaagaacaguccauguug ..........(((((.............(((((..(((((...........((((((((((.(((((((((.(((..((((((................))))))..(((((((...((.((((.(((((( ...-201.7
ENST00000002165.11agugcagcagaguggcugaugcugcaaguuaugucuaaggcuaggaacuaucaggugucuauaauuguagcacauggagaaagcaaauguaaaacuggauaagaaaauuauuuuggcaguucagcccu .....(((((((..........)))))))((((((((...((((((((.........(((.((((....)))))))..((((((((..((.((..(((((..(((((......))))).)))))..))... ...-210.91
ENST00000002501.11accaucuccaccugccccagcuccugcagggaugggguccgaacacgauggcagaucugggcagugcugacccagcagacacacuucacccgcccacgaggcuccagccgucaccuccugacacacac .............(((((..........)))))(((((((.....((((((.(((((....((((((.((((.(((((((((((..........(((.....)))....(((((((.....))))...... ...-558.7
ENST00000002596.6uuugcaauaagcuaagcucagaaacuuuccuacuguaaguucugguguacaucugaggggaaaaagaauuuuaaaaaagcauuuaagguauaauuuauuuguaaaauccauaaaguacuucuguacag .....(((((((((((((((((((((.(((.........))))))))).))......((((((((((((((((........(((..((((......))))..)))............((((....)))).. ...-1704.4
ENST00000002829.8ggccagcugccugugccugccaugggccagccuagcccuugucccuuuuaauauaaaagauauauauauauauauauauauauaaaauaucuauauucuauacacacccugccccugcaaagacagua ...(((..((((((((.((..((...((((((.((.((((((((.((((((((...))))))((((((((((....)))))))))).......((((((((.(..(.((((......(((......))).. ...-415.7

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.