Schema for foldUtr5
  Database: hg38    Primary Table: foldUtr5    Row Count: 97,090   Data last updated: 2022-05-15
Format description: Info about folding of RNA into secondary structure
fieldexampleSQL type info description
name ENST00000000233.10varchar(255) values mRNA accession
seq cugcugcugcugcgccccauccccccg...longblob   mRNA sequence (U's instead of T's)
fold ..((((..((((.(((....((........longblob   Parenthesis and .'s that describe folding
energy -30.6float range Estimated free energy of folding (negative)

Connected Tables and Joining Fields
        hg38.bioCycPathway.kgID (via foldUtr5.name)
      hg38.ccdsKgMap.geneId (via foldUtr5.name)
      hg38.ceBlastTab.query (via foldUtr5.name)
      hg38.dmBlastTab.query (via foldUtr5.name)
      hg38.drBlastTab.query (via foldUtr5.name)
      hg38.foldUtr3.name (via foldUtr5.name)
      hg38.gnfAtlas2Distance.query (via foldUtr5.name)
      hg38.gnfAtlas2Distance.target (via foldUtr5.name)
      hg38.gnfU95Distance.query (via foldUtr5.name)
      hg38.gnfU95Distance.target (via foldUtr5.name)
      hg38.humanHprdP2P.query (via foldUtr5.name)
      hg38.humanHprdP2P.target (via foldUtr5.name)
      hg38.humanVidalP2P.query (via foldUtr5.name)
      hg38.humanVidalP2P.target (via foldUtr5.name)
      hg38.humanWankerP2P.query (via foldUtr5.name)
      hg38.humanWankerP2P.target (via foldUtr5.name)
      hg38.keggPathway.kgID (via foldUtr5.name)
      hg38.kgAlias.kgID (via foldUtr5.name)
      hg38.kgColor.kgID (via foldUtr5.name)
      hg38.kgProtAlias.kgID (via foldUtr5.name)
      hg38.kgSpAlias.kgID (via foldUtr5.name)
      hg38.kgTargetAli.qName (via foldUtr5.name)
      hg38.kgXref.kgID (via foldUtr5.name)
      hg38.knownAttrs.kgID (via foldUtr5.name)
      hg38.knownBlastTab.query (via foldUtr5.name)
      hg38.knownBlastTab.target (via foldUtr5.name)
      hg38.knownCanonical.transcript (via foldUtr5.name)
      hg38.knownCds.name (via foldUtr5.name)
      hg38.knownGene.name (via foldUtr5.name)
      hg38.knownGeneMrna.name (via foldUtr5.name)
      hg38.knownGenePep.name (via foldUtr5.name)
      hg38.knownIsoforms.transcript (via foldUtr5.name)
      hg38.knownToEnsembl.name (via foldUtr5.name)
      hg38.knownToGnfAtlas2.name (via foldUtr5.name)
      hg38.knownToHprd.name (via foldUtr5.name)
      hg38.knownToKeggEntrez.name (via foldUtr5.name)
      hg38.knownToLocusLink.name (via foldUtr5.name)
      hg38.knownToLynx.name (via foldUtr5.name)
      hg38.knownToMrna.name (via foldUtr5.name)
      hg38.knownToMrnaSingle.name (via foldUtr5.name)
      hg38.knownToMupit.name (via foldUtr5.name)
      hg38.knownToNextProt.name (via foldUtr5.name)
      hg38.knownToPfam.name (via foldUtr5.name)
      hg38.knownToRefSeq.name (via foldUtr5.name)
      hg38.knownToSuper.gene (via foldUtr5.name)
      hg38.knownToTag.name (via foldUtr5.name)
      hg38.knownToU133.name (via foldUtr5.name)
      hg38.knownToU95.name (via foldUtr5.name)
      hg38.knownToVisiGene.name (via foldUtr5.name)
      hg38.knownToWikipedia.name (via foldUtr5.name)
      hg38.mmBlastTab.query (via foldUtr5.name)
      hg38.rnBlastTab.query (via foldUtr5.name)
      hg38.scBlastTab.query (via foldUtr5.name)
      hg38.ucscScop.ucscId (via foldUtr5.name)

Sample Rows
 
nameseqfoldenergy
ENST00000000233.10cugcugcugcugcgccccauccccccgcggccggccaguuccagcccgcaccccgcgucggugcccgcgccccuccccgggccccgcc..((((..((((.(((....((......))..)))))))..)))).(((.....))).(((.(((((.(......).))))).)))..-30.6
ENST00000000412.8agaguggggcacagcgaggcgcuagggggaacgcuggccucugaaacuagcucugggaccggggucugcggccggccccuagcuggccccgucucccauccccagaaggguauucacuggggauucug ......((((((.((.(.(((..((((((((...(((.((((.(((...(((....)))...))))))).))).....))))))))(((((....(((..((((((((...........))))))))...) ...-64.6
ENST00000000442.11gucagcuggaggaagcggaguaggaagcggccgcgauguccuuuuguguccuacaagcagccggcggcgccgccgagugaggggacgcggcgcgguggggcggcgcggcccgaggaggcggcggagga ...((((.((((.((...(((....(((((.(((......))))))))(((((((.....((..(((((....)))))..))..)))))))((((((((.((((((((((((((..((((..(.((((((( ...-125.5
ENST00000001008.6ccuaccccagcucucgcgccgcgugcagaggugcucaagccuccucgcgguccgcagucagugccgccgcgcccggccucccgcacgccccgcagguagcgcccccgcccgcggcccagagugcgcuc .............(((.(((((.((((((.(((((......)))))..(((((..((((.((.(.(((((.(((...(((((((.((.......)).)).)).)))..)))..))))).).)).)))).)) ...-74.2
ENST00000001146.7acagccaaucccccgagcggccgccaac...(((..((....))..))).......-4.5
ENST00000002125.9gucuaagccccagcuccuggcggagcgagcuagccugcgaauuucagc.....(((....(((((....)))))..))).....((........))-11
ENST00000002165.11gcggcauacucagcggcagagacggaagaacagcgcucccgaggccgcgggagccugcagagaggacagccggccugcgccgggac((.((.......)).)).............(((.(((((((......))))))))))............(((((....)))))...-32.3
ENST00000002501.11gcugccccgaugcgcugcgcccggagccggggccgagucgcugccgcagcuguuggggcgcccgggccaggcgacgccgccgucgcccgugccccucccagaccgcaccggccgc(((((((((..((.(((....))).))))))))..))).((.((((..((.((((((((((..((((..((((....))))...))))))))))).....))).))..)))).))-56.9
ENST00000002596.6cucugcgcccuggcagccaggagucgccgccacgacagccgggucucagugggugccugcgccuucuccccgcccgccugccccgggccauccagaaacuugcucuacccgccgcgggugcucggcag .......(((((((((...))))).).)))(((((((.....(((((((((((..(.(((.(((((((...((.(((((((.((((((((((((.(((..(((.(((.((((((...))))))...))))) ...-129.6
ENST00000002829.8gagcgccccugagccuucccauggcccgggcuggggcccgggcccucggcugcugacgcgcccgaagcccgcggaaccgguuaagccgcggccgcggcgccgaucccggcugaggcgcagcggcgaga ......((((.(((.(((((.....(((((((((....))))))))).((((.(((....))).)))).(((.((((...((((...))))...)))))))((((....)))).))))).))).)))).(( ...-173.4

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.