Schema for knownGeneMrna
  Database: mm10    Primary Table: knownGeneMrna    Row Count: 142,446   Data last updated: 2019-09-20
Format description: The mRNA sequence that represents each UCSC Genes transcript.
fieldexampleSQL type info description
name ENSMUST00000193812.1varchar(255) values Name of gene
seq AAGGAAAGAGGATAACACTTGAAATGT...longblob   mRNA sequence

Connected Tables and Joining Fields
        mm10.bioCycPathway.kgID (via knownGeneMrna.name)
      mm10.ccdsKgMap.geneId (via knownGeneMrna.name)
      mm10.ceBlastTab.query (via knownGeneMrna.name)
      mm10.dmBlastTab.query (via knownGeneMrna.name)
      mm10.drBlastTab.query (via knownGeneMrna.name)
      mm10.foldUtr3.name (via knownGeneMrna.name)
      mm10.foldUtr5.name (via knownGeneMrna.name)
      mm10.hgBlastTab.query (via knownGeneMrna.name)
      mm10.keggPathway.kgID (via knownGeneMrna.name)
      mm10.kgAlias.kgID (via knownGeneMrna.name)
      mm10.kgColor.kgID (via knownGeneMrna.name)
      mm10.kgProtAlias.kgID (via knownGeneMrna.name)
      mm10.kgProtMap2.qName (via knownGeneMrna.name)
      mm10.kgSpAlias.kgID (via knownGeneMrna.name)
      mm10.kgTargetAli.qName (via knownGeneMrna.name)
      mm10.kgTxInfo.name (via knownGeneMrna.name)
      mm10.kgXref.kgID (via knownGeneMrna.name)
      mm10.knownAttrs.kgID (via knownGeneMrna.name)
      mm10.knownBlastTab.query (via knownGeneMrna.name)
      mm10.knownBlastTab.target (via knownGeneMrna.name)
      mm10.knownCanonical.transcript (via knownGeneMrna.name)
      mm10.knownCds.name (via knownGeneMrna.name)
      mm10.knownGene.name (via knownGeneMrna.name)
      mm10.knownGenePep.name (via knownGeneMrna.name)
      mm10.knownIsoforms.transcript (via knownGeneMrna.name)
      mm10.knownToEnsembl.name (via knownGeneMrna.name)
      mm10.knownToKeggEntrez.name (via knownGeneMrna.name)
      mm10.knownToLocusLink.name (via knownGeneMrna.name)
      mm10.knownToLynx.name (via knownGeneMrna.name)
      mm10.knownToMrna.name (via knownGeneMrna.name)
      mm10.knownToMrnaSingle.name (via knownGeneMrna.name)
      mm10.knownToPfam.name (via knownGeneMrna.name)
      mm10.knownToRefSeq.name (via knownGeneMrna.name)
      mm10.knownToSuper.gene (via knownGeneMrna.name)
      mm10.knownToTag.name (via knownGeneMrna.name)
      mm10.knownToVisiGene.name (via knownGeneMrna.name)
      mm10.knownToWikipedia.name (via knownGeneMrna.name)
      mm10.rnBlastTab.query (via knownGeneMrna.name)
      mm10.scBlastTab.query (via knownGeneMrna.name)
      mm10.ucscScop.ucscId (via knownGeneMrna.name)

Sample Rows
 
nameseq
ENSMUST00000193812.1AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAAAACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGTATAATCAA ...
ENSMUST00000082908.1GTGCTTGCTTCGGCAACACATACACTAAATTTTGAACGATACAGAGAAGATTAGCATGGGCCCTGCACAAGGATGACACACAAAATATAAATATTGAGTAACAAAAATAT
ENSMUST00000162897.1GCACACTACGGTCCATCTCCAACAACCGCAGTGTTGCCAGTGACCGTGATCAGAAATTTGCAGAGCGGGATGGATGTGTACCTGTGTTTCAAGTGAGACCAACTGCACCACCCACCCCATCATCTCGA ...
ENSMUST00000159265.1TTAGTTAAGAGCACTGACTGCTCTTGCAAAGGACCCAGGCTTGAGTAGTTCACTGCAACTCTAATTCCAGAAGATCTAATGTCCATTTTTGGCCTCCTCAAGCACTGCACACACATGGTGCATAGACA ...
ENSMUST00000070533.4GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGAAGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAAAGGAGTGC ...
ENSMUST00000192857.1TTCTTCTGTGTCTGAGCTATTGCATTATATCTTTGGAAACGCCACTCTCACTTCTCATCACTGATGCATTAATTAAAAGAATCATATTTTGACCTCAATTAGCCTTGGGGTTGACTTTTAATTGGGGA ...
ENSMUST00000195335.1TGCAGCTGCAGCAGAAACTCCACCTAAATGCTCCTGCTGCAGCAGCTCTGGTGCCTTTCCTCTCTCTAATTGGCTATTCATTGTGAGAAGAAAACACATCTTCATCTGTTTGGAATCAATTTTGTTCA ...
ENSMUST00000192336.1GCCATTTTTCAACGTGTAGCTTGGAACTCCTTGTGTAATGAGCAAAGCATTAAGCAAAGTTTTGAGAATGGCAGCAGGTCCATGCTCCTTCCCCAGCTCTAGGTCATTACTGGAGGCAGGGATTGCTC ...
ENSMUST00000194099.1AGGGAGCTGGTAAAGACGGGTTTCACTAGTAACACACAGAGTTTTAATTTAAAAAAACATACAAGAAAAAAATCACTACTTTTTAAAACAAAACAAATTGAAATATAGAGGATCAGATTAAAAGAAAT ...
ENSMUST00000161581.1TGAAAATGGATAGCAGTTCCCTTAATCTTCTTGTACTTATGGGAGGAAAGAGAAGAGGTGGAGATATGCCCGTGTGCAGTGAGATCTGTTGGATTCTAACGGCTTTGCCTGGATGGCATTTGAAATCT ...

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.