Schema for foldUtr3
  Database: mm10    Primary Table: foldUtr3    Row Count: 51,983   Data last updated: 2019-09-21
Format description: Info about folding of RNA into secondary structure
fieldexampleSQL type info description
name ENSMUST00000000001.4varchar(255) values mRNA accession
seq gaggauggcauaguaaaagcuauuaca...longblob   mRNA sequence (U's instead of T's)
fold ...((((((.........)))))).((...longblob   Parenthesis and .'s that describe folding
energy -538float range Estimated free energy of folding (negative)

Connected Tables and Joining Fields
        mm10.bioCycPathway.kgID (via foldUtr3.name)
      mm10.ccdsKgMap.geneId (via foldUtr3.name)
      mm10.ceBlastTab.query (via foldUtr3.name)
      mm10.dmBlastTab.query (via foldUtr3.name)
      mm10.drBlastTab.query (via foldUtr3.name)
      mm10.foldUtr5.name (via foldUtr3.name)
      mm10.hgBlastTab.query (via foldUtr3.name)
      mm10.keggPathway.kgID (via foldUtr3.name)
      mm10.kgAlias.kgID (via foldUtr3.name)
      mm10.kgColor.kgID (via foldUtr3.name)
      mm10.kgProtAlias.kgID (via foldUtr3.name)
      mm10.kgProtMap2.qName (via foldUtr3.name)
      mm10.kgSpAlias.kgID (via foldUtr3.name)
      mm10.kgTargetAli.qName (via foldUtr3.name)
      mm10.kgTxInfo.name (via foldUtr3.name)
      mm10.kgXref.kgID (via foldUtr3.name)
      mm10.knownAttrs.kgID (via foldUtr3.name)
      mm10.knownBlastTab.query (via foldUtr3.name)
      mm10.knownBlastTab.target (via foldUtr3.name)
      mm10.knownCanonical.transcript (via foldUtr3.name)
      mm10.knownCds.name (via foldUtr3.name)
      mm10.knownGene.name (via foldUtr3.name)
      mm10.knownGeneMrna.name (via foldUtr3.name)
      mm10.knownGenePep.name (via foldUtr3.name)
      mm10.knownIsoforms.transcript (via foldUtr3.name)
      mm10.knownToEnsembl.name (via foldUtr3.name)
      mm10.knownToKeggEntrez.name (via foldUtr3.name)
      mm10.knownToLocusLink.name (via foldUtr3.name)
      mm10.knownToLynx.name (via foldUtr3.name)
      mm10.knownToMrna.name (via foldUtr3.name)
      mm10.knownToMrnaSingle.name (via foldUtr3.name)
      mm10.knownToPfam.name (via foldUtr3.name)
      mm10.knownToRefSeq.name (via foldUtr3.name)
      mm10.knownToSuper.gene (via foldUtr3.name)
      mm10.knownToTag.name (via foldUtr3.name)
      mm10.knownToVisiGene.name (via foldUtr3.name)
      mm10.knownToWikipedia.name (via foldUtr3.name)
      mm10.rnBlastTab.query (via foldUtr3.name)
      mm10.scBlastTab.query (via foldUtr3.name)
      mm10.ucscScop.ucscId (via foldUtr3.name)

Sample Rows
 
nameseqfoldenergy
ENSMUST00000000001.4gaggauggcauaguaaaagcuauuacagggaggaguguugagaccagaugucaucuacugucucuugggucagcagcacgcaugacaggaccaaggaauggcagcaacacgcagaaucuuagcuagcg ......((((((.........)))))).((((((((((((..((((((((((((((((((..((...((((.....(((((((...((((((.....((((.((((((.....(((((.(((.(((..((( ...-538
ENSMUST00000000003.13ugacucaacaagaucaggauuagcauuacagaugacaucaggaauuuuccaguauauuuuuccuggaaccugaaacaucaauaugaagaugaagcaaucuugucucucagaucauauuuuccuauuua .........(((((.....(((..((...((((((.(((((((((....((((((.(......).)))))))))))......(((((((.((.((.(((....))).))))...))))))).........( ...-36.1
ENSMUST00000000010.8agaugaccacccccccuuccccagcucacucuuauuauuuaugugauggucaaaaagccacugcugucuggguuguacccaagugaguggggaagaguaucuccucuuuaaaaucccucaucugcacc .......(((((......((((((((.((((((............(((.((((......)))).)))....(((((...))))))))))))))))))).............((((((.((((....((((( ...-508.15
ENSMUST00000000028.13ggaauucaacuucuccagaagugaccuccuuuuccuuauuuauauuuccuggccacuauucaguuguaagauaacauuugaaaugugagacuauaugguuuuuaauaaaauguuugauguuuuauccc ...(((..(((.((((....)))))))..)))........................(((..(((((.(((......))).)))))..)))(((((....)))))...(((((((((...)))))))))... ...-19.4
ENSMUST00000000033.11aucaaauuaugugguaauucugcaauguaguaccaucaaucugugaccuccucuugagcagggacaguuccaucacgucccacacuaagaucucucugcuccacucccuccccagguuucuccuuacc ...........(((((((((((((((((.((.(........(((((((((.(((((((((....(((....)))........((((.((((((((((((((..(((((.(((.((((((((((.((((((( ...-1174.39
ENSMUST00000000049.5agucguuuccagaaucaaaauugaaugucguauuuguauuucugcuugucuuaggaauccaucugaaauagcagaauaaaguuacuggauugccucaguua.(..((.(((((..(((....)))...............(((((((.((.((((........)))).)))))))))........)))))..))..).....-15.6
ENSMUST00000000058.6ccacucagacccugggcagguccagacauuuggauacuguacaacuuuauugaugcaacaaacucacuacuguucuguucacuucccaacuguuaaaauuauucuuaaaauggaacccagauuuaucg .............(((((((((((((((....)))))).)))).............((.(((((((........))).)))))).....................(((((((((.((((...((....)). ...-430.9
ENSMUST00000000080.7aggagcagagggacgaauccuguaggcuaaaagaggcuuccaggcuaagaggcggccauggaaggagggaugccuguaacagccaaagcaugccauuuugcuuccuauccaguuaccuccaggggccu ....(((.((((((......((((..(((((((((((((((((((((((.......)))).)))))...((.(((((((...))).....)))).))..((((((((((((.((((((((((..((((((( ...-832.9
ENSMUST00000000087.12acaggaggcacucuucucccaggaagccgcccgccagcucccaggcaccuuaguagggcucugggugaccucaggacucuaggaggcuggaaagccaccacugcuacccuuccugcccugaugugucc ....((((.((((..(((((....)))))...(((((((.(.(((((((.(((....))))).))))).).....(((((.((((((((((((..((((.((((((....(((((((..........(((( ...-334.4
ENSMUST00000000090.7acucccuucgaugggcuuccuaaggacuuaacugcuauugcuacuugauugaaacaguugccuggaaauguuuuauuugaacaaauuuuccuuugaguaucaaaccauguaauaguaacuuggacuuu ......(((......))).((((..(((...((((((....................)))))))))))))....(((((((((((..(((((((((((.........(((.((.......)).)))..... ...-27.4

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.