Schema for Swift Primers - Swift BioSciences sequencing primers
  Database: wuhCor1    Primary Table: swift Data last updated: 2021-03-11
Big Bed File: /gbdb/wuhCor1/bbi/swift.bb
Item Count: 682
Format description: Browser extensible data (6 fields) plus sequence
fieldexampledescription
chromNC_045512v2Chromosome (or contig, scaffold, etc.)
chromStart19893Start position
chromEnd19920End position
names16175_D_44FName
score0Score from 0-1000 (BED placeholder)
strand++ (forward) or - (reverse)
sequenceGCTCCAGCACATATATCTACTATTGGTSequence

Sample Rows
 
chromchromStartchromEndnamescorestrandsequence
NC_045512v21989319920s16175_D_44F0+GCTCCAGCACATATATCTACTATTGGT
NC_045512v21993019953s16175_D_43R0-TGGTTTCTTGGCTATGTCAGTCA
NC_045512v21998820012s16175_D_45F0+TGATGGTAGAGTTGATGGTCAAGT
NC_045512v22002220042s16175_D_44R0-ACACCATTACGGGCATTTCT
NC_045512v22007220092s16175_D_46F0+ACAACCATCTGTAGGTCCCA
NC_045512v22011120135s16175_D_45R0-ACGGCTTCTCCAATTAATGTGACT
NC_045512v22016220182s16175_D_47F0+AGTTGATGGTGTTGTCCAAC
NC_045512v22018620214s16175_D_46R0-TCTACTCTGAGTAAAGTAAGTTTCAGGT
NC_045512v22025220279s16175_D_48F0+TGATTTCTTAGAATTAGCTATGGATGA
NC_045512v22028820312s16175_D_47R0-GCATAGCCTTCTAATTTATACCGT

Swift Primers (swift) Track Description
 

Description

This track shows the primers for the Swift Amplicon ® SARS-CoV-2 Panel single-tube NGS assay:

This kit leverages patented multiplex PCR technology, enabling library construction from 1st-strand or 2nd-strand cDNA using tiled primer pairs to target the entire 29.9 kb viral genome with a single pool of multiplexed primer pairs. Primers were designed against the NCBI Reference Sequence NC_045512.2 (Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome). In silico analysis predicted zero off-target products from human host genome sequences.

Display Conventions and Configuration

Genomic locations of primers are highlighted. A click on them shows the primer sequence. This is one of the few tracks that may be best displayed in "full" mode.

Methods

Primer sequences, names and genomic locations were downloaded from Swift and converted to bigBed. More details are available from Swift Biosciences.

Data Access

The raw data can be explored interactively with the Table Browser or combined with other datasets in the Data Integrator tool. For automated analysis, the genome annotation is stored in a bigBed file that can be downloaded from the download server.

Annotations can be converted from binary to ASCII text by our command-line tool bigBedToBed. Instructions for downloading this command can be found on our utilities page. The tool can also be used to obtain features within a given range without downloading the file, for example:

bigBedToBed http://hgdownload.soe.ucsc.edu/gbdb/wuhCor1/bbi/swift.bb -chrom=NC_045512v2 -start=0 -end=29902 stdout

Please refer to our mailing list archives for questions, or our Data Access FAQ for more information.