Schema for RAPID/Midnight Primers - RAPID/Midnight 1200bp amplicon Oxford Nanopore sequencing primers
  Database: wuhCor1    Primary Table: rapid Data last updated: 2020-07-06
Big Bed File Download: /gbdb/wuhCor1/bbi/rapid.bb
Item Count: 58
The data is stored in the binary BigBed format.

Format description: Browser extensible data (<=12 fields)
fieldexampledescription
chromNC_045512v2Chromosome (or contig, scaffold, etc.)
chromStart20553Start position in chromosome
chromEnd20581End position in chromosome
nameSARSCoV_1200_21_LEFTName of item
score0Score from 0-1000
strand++ or -
sequenceTCTGTAGTTTCTAAGGTTGTCAAAGTGA Sequence
pool1 Pool
length28 Length
tm60.58 Tm
gCperc35.71 GC%

Sample Rows
 
chromchromStartchromEndnamescorestrandsequencepoollengthtmgCperc
NC_045512v22055320581SARSCoV_1200_21_LEFT0+TCTGTAGTTTCTAAGGTTGTCAAAGTGA12860.5835.71
NC_045512v22067620698SARSCoV_1200_20_RIGHT0-GATTAGGCATAGCAACACCCGG22261.3954.55
NC_045512v22153221562SARSCoV_1200_22_LEFT0+GTGATGTTCTTGTTAACAACTAAACGAACA23061.4433.33
NC_045512v22162021642SARSCoV_1200_21_RIGHT0-GCAGGGGGTAATTGAGTTCTGG12260.9554.55
NC_045512v22251122537SARSCoV_1200_23_LEFT0+ACTTTAGAGTCCAACCAACAGAATCT12660.1838.46
NC_045512v22259022612SARSCoV_1200_22_RIGHT0-AACAGATGCAAATCTGGTGGCG22262.0350
NC_045512v22351823544SARSCoV_1200_24_LEFT0+GCTGAACATGTCAACAACTCATATGA22660.1338.46
NC_045512v22360923631SARSCoV_1200_23_RIGHT0-TGACTAGCTACACTACGTGCCC12261.5254.55
NC_045512v22463324658SARSCoV_1200_25_LEFT0+TGCTGCTACTAAAATGTCAGAGTGT12560.5140
NC_045512v22471424736SARSCoV_1200_24_RIGHT0-ATGAGGTGCTGACTGAGGGAAG22261.7454.55

RAPID/Midnight Primers (rapid) Track Description
 

Description

This track shows the primers for the RAPID SARS-CoV-2 sequencing protocol, also commonly referred to as Midnight. The primers enable amplification of the genome of SARS-CoV-2. This approach uses multiplexed 1200 base pair (bp) tiled amplicons. Briefly, two PCR reactions are performed for each SARS-CoV-2 positive patient sample to be sequenced. One PCR reaction contains thirty primers that generate the odd numbered amplicons ("Pool 1"), while the second PCR reaction contains twenty eight primers that generate the even numbered amplicons ("Pool 2"). After PCR, the two amplicon pools are combined and can be used for a range of downstream sequencing approaches. Primers were all designed using Primal Scheme and described in Nature Protocols 2017. This primer set results in amplicons that exhibit lower levels of variation in coverage compared to other commonly used primer sets.

Display Conventions and Configuration

Genomic locations of primers are highlighted. A click on them shows the primer pool. This is one of the few tracks that may be best displayed in "full" mode.

Methods

RAPID primer sequences were downloaded from the Google Spreadsheet and converted to bigBed. More details are available in the paper referenced below or in the supplemental files on Zenodo.

Data Access

The raw data can be explored interactively with the Table Browser or combined with other datasets in the Data Integrator tool. For automated analysis, the genome annotation is stored in a bigBed file that can be downloaded from the download server.

Annotations can be converted from binary to ASCII text by our command-line tool bigBedToBed. Instructions for downloading this command can be found on our utilities page. The tool can also be used to obtain features within a given range without downloading the file, for example:

bigBedToBed http://hgdownload.soe.ucsc.edu/gbdb/wuhCor1/bbi/rapid.bb -chrom=NC_045512v2 -start=0 -end=29902 stdout

Please refer to our mailing list archives for questions, or our Data Access FAQ for more information.

References

Freed NE, Vlková M, Faisal MB, Silander OK. Rapid and inexpensive whole-genome sequencing of SARS-CoV-2 using 1200 bp tiled amplicons and Oxford Nanopore Rapid Barcoding. Biol Methods Protoc. 2020;5(1):bpaa014. PMID: 33029559; PMC: PMC7454405