Schema for CRISPR Detection - CRISPR Detection Guides
|
|
Database: wuhCor1 Primary Table: crisprDet Row Count: 5   Data last updated: 2020-03-27
Format description: Summary info about a patSpace alignment
field | example | SQL type | info | description |
bin | 585 | smallint(5) unsigned | range | Indexing field to speed chromosome range queries. |
matches | 28 | int(10) unsigned | range | Number of bases that match that aren't repeats |
misMatches | 0 | int(10) unsigned | range | Number of bases that don't match |
repMatches | 0 | int(10) unsigned | range | Number of bases that match but are part of repeats |
nCount | 0 | int(10) unsigned | range | Number of 'N' bases |
qNumInsert | 0 | int(10) unsigned | range | Number of inserts in query |
qBaseInsert | 0 | int(10) unsigned | range | Number of bases inserted in query |
tNumInsert | 0 | int(10) unsigned | range | Number of inserts in target |
tBaseInsert | 0 | int(10) unsigned | range | Number of bases inserted in target |
strand | - | char(2) | values | + or - for strand. First character query, second target (optional) |
qName | Broad_Orf1b_crRNA_v1 | varchar(255) | values | Query sequence name |
qSize | 64 | int(10) unsigned | range | Query sequence size |
qStart | 36 | int(10) unsigned | range | Alignment start position in query |
qEnd | 64 | int(10) unsigned | range | Alignment end position in query |
tName | NC_045512v2 | varchar(255) | values | Target sequence name |
tSize | 29903 | int(10) unsigned | range | Target sequence size |
tStart | 6509 | int(10) unsigned | range | Alignment start position in target |
tEnd | 6537 | int(10) unsigned | range | Alignment end position in target |
blockCount | 1 | int(10) unsigned | range | Number of blocks in alignment |
blockSizes | 28, | longblob | | Size of each block |
qStarts | 0, | longblob | | Start of each block in query. |
tStarts | 6509, | longblob | | Start of each block in target. |
|
| |
|
|
Sample Rows
|
|
bin | matches | misMatches | repMatches | nCount | qNumInsert | qBaseInsert | tNumInsert | tBaseInsert | strand | qName | qSize | qStart | qEnd | tName | tSize | tStart | tEnd | blockCount | blockSizes | qStarts | tStarts |
---|
585 | 28 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | - | Broad_Orf1b_crRNA_v1 | 64 | 36 | 64 | NC_045512v2 | 29903 | 6509 | 6537 | 1 | 28, | 0, | 6509, |
585 | 28 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | - | Broad_scRNA_v1 | 64 | 36 | 64 | NC_045512v2 | 29903 | 22322 | 22350 | 1 | 28, | 0, | 22322, |
585 | 23 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | - | NYU_Guide1 | 23 | 0 | 23 | NC_045512v2 | 29903 | 22341 | 22364 | 1 | 23, | 0, | 22341, |
585 | 20 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | + | Mammoth_E-gene_pan-coronavirus_Guide | 41 | 21 | 41 | NC_045512v2 | 29903 | 26313 | 26333 | 1 | 20, | 21, | 26313, |
585 | 20 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | + | Mammoth_N-gene_Cov2-Specific_Guide | 41 | 21 | 41 | NC_045512v2 | 29903 | 29195 | 29215 | 1 | 20, | 21, | 29195, |
|
Note: all start coordinates in our database are 0-based, not
1-based. See explanation
here.
| |
|
|
CRISPR Detection (crisprDet) Track Description
|
|
Description
This track shows the locations of CRISPR detection guides and flanking primers. There are three studies on this topic,
with the one by Mammoth Biosciences the most advanced. The Broad Institute's guides were validated, the NYU guides are predictions for now.
Prefix
|
Institution
|
Overview
|
Links
|
Mammoth |
Mammoth Biosciences |
There are three guides in the set, two are shown on the genome. The third guide detects human RNAseP, as a sample control. Target sequence: TAATTTCTACTAAGTGTAGATAATTACTTGGGTGTGACCCT
|
Protocol and preprint.
|
Broad |
Sabeti Lab, Broad Institute |
Various guides are predicted, the one shown here is from the protocol.
|
Protocol from Mar 21 2020, Guide website and preprint.
|
NYU |
Sanjana Lab, New York University |
These are predictions by a new algorithm. Shown is the prediction with the highest score.
|
Website
|
Methods
Sequences were mapped with BLAT.
Credits
Thanks to the labs for producing this work, as well as Kiley Charbonneau for pointing us to the papers.
| |
|
|
|