Schema for CRISPR Detection - CRISPR Detection Guides
  Database: wuhCor1    Primary Table: crisprDet    Row Count: 5   Data last updated: 2020-03-27
Format description: Summary info about a patSpace alignment
fieldexampleSQL type info description
bin 585smallint(5) unsigned range Indexing field to speed chromosome range queries.
matches 28int(10) unsigned range Number of bases that match that aren't repeats
misMatches 0int(10) unsigned range Number of bases that don't match
repMatches 0int(10) unsigned range Number of bases that match but are part of repeats
nCount 0int(10) unsigned range Number of 'N' bases
qNumInsert 0int(10) unsigned range Number of inserts in query
qBaseInsert 0int(10) unsigned range Number of bases inserted in query
tNumInsert 0int(10) unsigned range Number of inserts in target
tBaseInsert 0int(10) unsigned range Number of bases inserted in target
strand -char(2) values + or - for strand. First character query, second target (optional)
qName Broad_Orf1b_crRNA_v1varchar(255) values Query sequence name
qSize 64int(10) unsigned range Query sequence size
qStart 36int(10) unsigned range Alignment start position in query
qEnd 64int(10) unsigned range Alignment end position in query
tName NC_045512v2varchar(255) values Target sequence name
tSize 29903int(10) unsigned range Target sequence size
tStart 6509int(10) unsigned range Alignment start position in target
tEnd 6537int(10) unsigned range Alignment end position in target
blockCount 1int(10) unsigned range Number of blocks in alignment
blockSizes 28,longblob   Size of each block
qStarts 0,longblob   Start of each block in query.
tStarts 6509,longblob   Start of each block in target.

Sample Rows
 
binmatchesmisMatchesrepMatchesnCountqNumInsertqBaseInserttNumInserttBaseInsertstrandqNameqSizeqStartqEndtNametSizetStarttEndblockCountblockSizesqStartstStarts
585280000000-Broad_Orf1b_crRNA_v1643664NC_045512v22990365096537128,0,6509,
585280000000-Broad_scRNA_v1643664NC_045512v2299032232222350128,0,22322,
585230000000-NYU_Guide123023NC_045512v2299032234122364123,0,22341,
585200000000+Mammoth_E-gene_pan-coronavirus_Guide412141NC_045512v2299032631326333120,21,26313,
585200000000+Mammoth_N-gene_Cov2-Specific_Guide412141NC_045512v2299032919529215120,21,29195,

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.

CRISPR Detection (crisprDet) Track Description
 

Description

This track shows the locations of CRISPR detection guides and flanking primers. There are three studies on this topic, with the one by Mammoth Biosciences the most advanced. The Broad Institute's guides were validated, the NYU guides are predictions for now.

Prefix Institution Overview Links
Mammoth Mammoth Biosciences

There are three guides in the set, two are shown on the genome. The third guide detects human RNAseP, as a sample control. Target sequence: TAATTTCTACTAAGTGTAGATAATTACTTGGGTGTGACCCT

Protocol and preprint.
Broad Sabeti Lab, Broad Institute Various guides are predicted, the one shown here is from the protocol. Protocol from Mar 21 2020, Guide website and preprint.
NYU Sanjana Lab, New York University These are predictions by a new algorithm. Shown is the prediction with the highest score. Website

Methods

Sequences were mapped with BLAT.

Credits

Thanks to the labs for producing this work, as well as Kiley Charbonneau for pointing us to the papers.