Schema for NCBI Proteins - NCBI Proteins: annotated mature peptide products
  Database: wuhCor1    Primary Table: ncbiProducts Data last updated: 2020-05-13
Big Bed File: /gbdb/wuhCor1/bbi/ncbi/peptides.bb
Item Count: 16
Format description: bigGenePred gene models parsed from Genbank files
fieldexampledescription
chromNC_045512v2Reference sequence chromosome or scaffold
chromStart8554Start position in chromosome
chromEnd10054End position in chromosome
namensp4Name or ID of item, ideally both human readable and unique
score0Score (0-1000)
strand++ or - for strand
thickStart8554Start of where display should be thick (start codon)
thickEnd10054End of where display should be thick (stop codon)
reserved0RGB value (use R,G,B string in input file)
blockCount1Number of blocks
blockSizes1500Comma separated list of block sizes
chromStarts0Start positions relative to chromStart
name2nsp4Alternative/human readable name
cdsStartStatcmplStatus of CDS start annotation (none, unknown, incomplete, or complete)
cdsEndStatcmplStatus of CDS end annotation (none, unknown, incomplete, or complete)
exonFrames0Exon frame {0,1,2}, or -1 if no frame for exon
typeN.a.Transcript type
geneNamensp4Primary identifier for gene
geneName2nsp4Alternative/human readable gene name
geneTypeN.a.Gene type
notensp4B_TM; contains transmembrane domain 2 (TM2); produced by both pp1a and pp1abNotes
productYP_009725300.1Protein Product
geneIdNCBI Gene ID
_cdnaSeqAAAATTGTTAATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACCTGTTCATGTCATGTCTAAACATACTGACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTGACATAGCATCTACAGATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGCCAGCGTGGTGGTAGTTATACTAATGACAAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCACGATATTACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACACCATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTTTAAAGATGCTTCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTATGAAAGTTTACGCCCTGACACACGTTATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTTTTGATTCTGAGTACTGTAGGCACGGCACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTACTTAACAATGATTATTACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTACACCACTAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACATGCCTTGCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTCCTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTTACTTGTACTTGACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTTCACACCTTTAGTACCTTTCTGGATAACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTGTAGTCTTTAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAAGTTGCGTAGTGATGTGCTATTACCTCTTACGCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGAGCAATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGTTCTGATGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGcDNA Sequence
_cdnaPslcDNA to genome PSL alignment (or empty)
_protSeqOrderedDict([('gene', ['ORF1ab']), ('locus_tag', ['GU280_gp01']), ('product', ['nsp4']), ('note', ['nsp4B_TM; contains transmembrane domain 2 (TM2); produced by both pp1a and pp1ab']), ('protein_id', ['YP_009725300.1'])])Protein Sequence
_protPslprotein to cDNA PSL alignment (or empty)

Sample Rows
 
chromchromStartchromEndnamescorestrandthickStartthickEndreservedblockCountblockSizeschromStartsname2cdsStartStatcdsEndStatexonFramestypegeneNamegeneName2geneTypenoteproductgeneId_cdnaSeq_cdnaPsl_protSeq_protPsl
NC_045512v2855410054nsp40+8554100540115000nsp4cmplcmpl0N.a.nsp4nsp4N.a.nsp4B_TM; contains transmembrane domain 2 (TM2); produced by both pp1a and pp1abYP_009725300.1AAAATTGTTAATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACCTGTTCATGTCATGTCTAAACATACTGACTTTTCAAGTGAAAT ...OrderedDict([('gene', ['ORF1ab']), ('locus_tag', ['GU280_gp01']), ('product', ['nsp4']), ('note', ['nsp4B_TM; contains transmemb ...
NC_045512v210054109723C-like proteinase0+10054109720191803C-like proteinasecmplcmpl0N.a.3C-like proteinase3C-like proteinaseN.a.nsp5A_3CLpro and nsp5B_3CLpro; main proteinase (Mpro); mediates cleavages downstream of nsp4. 3D structure of the SARSr-CoV homo ...YP_009725301.1AGTGGTTTTAGAAAAATGGCATTCCCATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTTGATGACGTAGTTTACTGTCCAAGACATGTGAT ...OrderedDict([('gene', ['ORF1ab']), ('locus_tag', ['GU280_gp01']), ('product', ['3C-like proteinase']), ('note', ['nsp5A_3CLpro a ...
NC_045512v21097211842nsp60+1097211842018700nsp6cmplcmpl0N.a.nsp6nsp6N.a.nsp6_TM; putative transmembrane domain; produced by both pp1a and pp1abYP_009725302.1AGTGCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAGTTTTAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTT ...OrderedDict([('gene', ['ORF1ab']), ('locus_tag', ['GU280_gp01']), ('product', ['nsp6']), ('note', ['nsp6_TM; putative transmembr ...
NC_045512v21184212091nsp70+1184212091012490nsp7cmplcmpl0N.a.nsp7nsp7N.a.produced by both pp1a and pp1abYP_009725303.1TCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGAATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAA ...OrderedDict([('gene', ['ORF1ab']), ('locus_tag', ['GU280_gp01']), ('product', ['nsp7']), ('note', ['produced by both pp1a and pp ...
NC_045512v21209112685nsp80+1209112685015940nsp8cmplcmpl0N.a.nsp8nsp8N.a.produced by both pp1a and pp1abYP_009725304.1GCTATAGCCTCAGAGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAGCAGGCTGTTGCTAATGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAA ...OrderedDict([('gene', ['ORF1ab']), ('locus_tag', ['GU280_gp01']), ('product', ['nsp8']), ('note', ['produced by both pp1a and pp ...
NC_045512v21268513024nsp90+1268513024013390nsp9cmplcmpl0N.a.nsp9nsp9N.a.ssRNA-binding protein; produced by both pp1a and pp1abYP_009725305.1AATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTAGGTTTGTACTTGC ...OrderedDict([('gene', ['ORF1ab']), ('locus_tag', ['GU280_gp01']), ('product', ['nsp9']), ('note', ['ssRNA-binding protein; produ ...
NC_045512v21302413441nsp100+1302413441014170nsp10cmplcmpl0N.a.nsp10nsp10N.a.nsp10_CysHis; formerly known as growth-factor-like protein (GFL); produced by both pp1a and pp1abYP_009725306.1GCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTGTTAA ...OrderedDict([('gene', ['ORF1ab']), ('locus_tag', ['GU280_gp01']), ('product', ['nsp10']), ('note', ['nsp10_CysHis; formerly know ...
NC_045512v21344113480nsp110+134411348001390nsp11cmplcmpl0N.a.nsp11nsp11N.a.produced by pp1a onlyYP_009725312.1TCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGOrderedDict([('gene', ['ORF1ab']), ('locus_tag', ['GU280_gp01']), ('product', ['nsp11']), ('note', ['produced by pp1a only']), ( ...
NC_045512v21344116236RNA-dependent RNA polymerase0+13441162360227,27690,26RNA-dependent RNA polymerasecmplcmpl0,0N.a.RNA-dependent RNA polymeraseRNA-dependent RNA polymeraseN.a.nsp12; NiRAN and RdRp; produced by pp1ab onlyYP_009725307.1TCAGCTGATGCACAATCGTTTTTAAACCGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGC ...OrderedDict([('gene', ['ORF1ab']), ('locus_tag', ['GU280_gp01']), ('product', ['RNA-dependent RNA polymerase']), ('note', ['nsp1 ...
NC_045512v21623618039helicase0+16236180390118030helicasecmplcmpl0N.a.helicasehelicaseN.a.nsp13_ZBD, nsp13_TB, and nsp_HEL1core; zinc-binding domain (ZD), NTPase/helicase domain (HEL), RNA 5'-triphosphatase; produced b ...YP_009725308.1GCTGTTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTTATGTTGTAAATGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTT ...OrderedDict([('gene', ['ORF1ab']), ('locus_tag', ['GU280_gp01']), ('product', ['helicase']), ('note', ["nsp13_ZBD, nsp13_TB, and ...

NCBI Proteins (ncbiProducts) Track Description
 

Description

The NCBI Mature Proteins track for the 13 Jan 2020 SARS-CoV-2 virus/GCF_009858895.2 genome assembly is constructed from the NCBI nuccore entry for NC_045512.2 https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2

It shows the mature peptides, after cleavage, as annotated on the Genbank record.

Data Access

The raw data can be explored interactively with the Table Browser, or the Data Integrator. For automated analysis, the genome annotation is stored in a bigBed file that can be downloaded from the download server. Annotations can be converted to ASCII text by our tool bigBedToBed which can be compiled from the source code or downloaded as a precompiled binary for your system. Instructions for downloading source code and binaries can be found on our utilities page. The tool can also be used to obtain features within a given range, for example:

bigBedToBed http://hgdownload.soe.ucsc.edu/gbdb/wuhCor1/ncbiGene.bb -chrom=NC_045512v2 -start=0 -end=29902 stdout

Please refer to our mailing list archives for questions, or our Data Access FAQ for more information.

Credits

This track was created by Max Haeussler and Brian Raney at UCSC, with help from Daniel Schmelter and many others. Thanks to NCBI and the US National Institutes of Health for making all data available for download.