Schema for LRG Transcripts - Locus Reference Genomic (LRG) Fixed Transcript Annotations
|
|
Database: hg38 Primary Table: lrgTranscriptAli Data last updated: 2021-09-23
Big Bed File: /gbdb/hg38/bbi/lrgBigPsl.bb Item Count: 1,824
Format description: Locus Reference Genomic Transcript Annotations
field | example | description |
chrom | chr1 | Reference sequence chromosome or scaffold | chromStart | 167430639 | Start position in chromosome | chromEnd | 167518610 | End position in chromosome | name | LRG_36t1 | Name or ID of item, ideally both human readable and unique | score | 1000 | Score (0-1000) | strand | - | + or - indicates whether the query aligns to the + or - strand on the reference | thickStart | 167431680 | Start of where display should be thick (start codon) | thickEnd | 167518465 | End of where display should be thick (stop codon) | reserved | 0 | RGB value (use R,G,B string in input file) | blockCount | 8 | Number of blocks | blockSizes | 1107,36,57,36,81,57,104,203, | Comma separated list of block sizes | chromStarts | 0,2384,3380,4759,7930,8704,10024,87768, | Start positions relative to chromStart | oChromStart | 0 | Start position in other chromosome | oChromEnd | 1681 | End position in other chromosome | oStrand | + | + or -, - means that psl was reversed into BED-compatible coordinates | oChromSize | 1681 | Size of other chromosome. | oChromStarts | 0,1107,1143,1200,1236,1317,1374,1478, | Start positions relative to oChromStart or from oChromStart+oChromSize depending on strand | oSequence | tgctttctcaaaggccccacagtcctccacttcctggggaggtagctgcagaataaaaccagcagagactccttttctcctaaccgtcccggccaccgctgcctcagcctctgcctcccagcctctttctgagggaaaggacaagatgaagtggaaggcgcttttcaccgcggccatcctgcaggcacagttgccgattacagaggcacagagctttggcctgctggatcccaaactctgctacctgctggatggaatcctcttcatctatggtgtcattctcactgccttgttcctgagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgcagagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgctaacagccaggggatttcaccactcaaaggccagacctgcagacgcccagattatgagacacaggatgaagcatttacaacccggttcactcttctcagccactgaagtattcccctttatgtacaggatgctttggttatatttagctccaaaccttcacacacagactgttgtccctgcactctttaagggagtgtactcccagggcttacggccctggccttgggccctctggtttgccggtggtgcaggtagacctgtctcctggcggttcctcgttctccctgggaggcgggcgcactgcctctcacagctgagttgttgagtctgttttgtaaagtccccagagaaagcgcagatgctagcacatgccctaatgtctgtatcactctgtgtctgagtggcttcactcctgctgtaaatttggcttctgttgtcaccttcacctcctttcaaggtaactgtactgggccatgttgtgcctccctggtgagagggccgggcagaggggcagatggaaaggagcctaggccaggtgcaaccagggagctgcaggggcatgggaaggtgggcgggcaggggagggtcagccagggcctgcgagggcagcgggagcctccctgcctcaggcctctgtgccgcaccattgaactgtaccatgtgctacaggggccagaagatgaacagactgaccttgatgagctgtgcacaaagtggcataaaaaacatgtggttacacagtgtgaataaagtgctgcggagcaagaggaggccgttgattcacttcacgctttcagcgaatgacaaaatcatctttgtgaaggcctcgcaggaagacccaacacatgggacctataactgcccagcggacagtggcaggacaggaaaaacccgtcaatgtactaggatactgctgcgtcattacagggcacaggccatggatggaaaacgctctctgctctgctttttttctactgttttaatttatactggcatgctaaagccttcctattttgcataataaatgcttcagtgaaaatgca | Sequence on other chrom (or edit list, or empty) | oCDS | 146..640 | CDS in NCBI format | chromSize | 248956422 | Size of target chromosome | match | 1681 | Number of bases matched. | misMatch | 0 | Number of bases that don't match | repMatch | 0 | Number of bases that match but are part of repeats | nCount | 0 | Number of 'N' bases | seqType | 1 | 0=empty, 1=nucleotide, 2=amino_acid | ncbiTranscript | NM_198053.2 | NCBI transcript name | ensemblTranscript | | Ensembl transcript name | ncbiProtein | NP_932170.1 | NCBI protein name | ensemblProtein | | Ensembl protein name | _lrgParent | LRG_36 | LRG ID without transcript decoration | geneName | CD247 | Corresponding gene name for this transcript | mouseOver | NM_198053.2 NP_932170.1 CD247 | NCBI and Ensembl transcripts and proteins |
|
| |
|
|
Sample Rows
|
|
chrom | chromStart | chromEnd | name | score | strand | thickStart | thickEnd | reserved | blockCount | blockSizes | chromStarts | oChromStart | oChromEnd | oStrand | oChromSize | oChromStarts | oSequence | oCDS | chromSize | match | misMatch | repMatch | nCount | seqType | ncbiTranscript | ensemblTranscript | ncbiProtein | ensemblProtein | _lrgParent | geneName | mouseOver |
chr1 | 167430639 | 167518610 | LRG_36t1 | 1000 | - | 167431680 | 167518465 | 0 | 8 | 1107,36,57,36,81,57,104,203, | 0,2384,3380,4759,7930,8704,10024,87768, | 0 | 1681 | + | 1681 | 0,1107,1143,1200,1236,1317,1374,1478, | tgctttctcaaaggccccacagtcctccacttcctggggaggtagctgcagaataaaaccagcagagactccttttctcctaaccgtcccggccaccgctgcctcagcctctgcctcccagcctcttt ... | 146..640 | 248956422 | 1681 | 0 | 0 | 0 | 1 | NM_198053.2 | | NP_932170.1 | | LRG_36 | CD247 | NM_198053.2 NP_932170.1 CD247 |
chr1 | 169511953 | 169586531 | LRG_553t1 | 1000 | - | 169514312 | 169586386 | 0 | 25 | 2506,183,152,145,156,104,72,117,180,211,237,175,2821,213,151,215,100,178,166,222,144,213,123,92,303, | 0,3490,6458,8566,11243,11847,12883,13947,15961,17654,18832,24552,28340,32342,34488,37847,38686,40603,43228,44692,47199,48600,602 ... | 0 | 9179 | + | 9179 | 0,2506,2689,2841,2986,3142,3246,3318,3435,3615,3826,4063,4238,7059,7272,7423,7638,7738,7916,8082,8304,8448,8661,8784,8876, | gcaagaactgcaggggaggaggacgctgccacccacagcctctagagctcattgcagctgggacagcccggagtgtggttagcagctcggcaagcgctgcccaggtcctggggtggtggcagccagcg ... | 146..6820 | 248956422 | 9179 | 0 | 0 | 0 | 1 | NM_000130.4 | ENST00000367797.9 | NP_000121.2 | ENSP00000356771.3 | LRG_553 | F5 | NM_000130.4 NP_000121.2 ENST00000367797.9 ENSP00000356771.3 F5 |
chr1 | 172659044 | 172666873 | LRG_58t1 | 1000 | + | 172659201 | 172666016 | 0 | 4 | 505,46,57,1252, | 0,1050,5289,6577, | 0 | 1860 | + | 1860 | 0,505,551,608, | gaggtgtttcccttagctatggaaactctataagagagatccagcttgcctcctcttgagcagtcagcaacagggtcccgtccttgacacctcagcctctacaggactgagaagaagtaaaaccgttt ... | 158..1003 | 248956422 | 1860 | 0 | 0 | 0 | 1 | NM_000639.1 | ENST00000367721.3 | NP_000630.1 | ENSP00000356694.2 | LRG_58 | FASLG | NM_000639.1 NP_000630.1 ENST00000367721.3 ENSP00000356694.2 FASLG |
chr1 | 173824672 | 173858546 | LRG_1270t1 | 1000 | + | 173825229 | 173857705 | 0 | 17 | 684,100,67,102,96,124,47,107,70,180,108,63,153,219,111,76,1029, | 0,2014,3660,5987,6862,8703,9800,12267,13517,14694,16193,20556,25654,28676,29122,31993,32845, | 0 | 3336 | + | 3336 | 0,684,784,851,953,1049,1173,1220,1327,1397,1577,1685,1748,1901,2120,2231,2307, | gaagggcgcttggaccccagcggcgatctgtgtttgggttcgcgctctgggagaattttggctttgctcgccttcctctttcagaagactcgaaatcggccagcaggtctgcgagatttgaaacgcga ... | 558..2495 | 248956422 | 3336 | 0 | 0 | 0 | 1 | NM_018122.5 | ENST00000649689.2 | NP_060592.2 | ENSP00000497569.1 | LRG_1270 | DARS2 | NM_018122.5 NP_060592.2 ENST00000649689.2 ENSP00000497569.1 DARS2 |
chr1 | 173903803 | 173917378 | LRG_577t1 | 1000 | - | 173903888 | 173917259 | 0 | 7 | 262,65,391,138,216,367,160, | 0,3646,5748,6950,7995,10749,13415, | 0 | 1599 | + | 1599 | 0,262,327,718,856,1072,1439, | tctgccccaccctgtcctctggaacctctgcgagatttagaggaaagaaccagttttcaggcggattgcctcagatcacactatctccacttgcccagccctgtggaagattagcggccatgtattcc ... | 120..1514 | 248956422 | 1599 | 0 | 0 | 0 | 1 | NM_000488.3 | ENST00000367698.4 | NP_000479.1 | ENSP00000356671.3 | LRG_577 | SERPINC1 | NM_000488.3 NP_000479.1 ENST00000367698.4 ENSP00000356671.3 SERPINC1 |
chr1 | 179550538 | 179575952 | LRG_887t1 | 1000 | - | 179551172 | 179575864 | 0 | 8 | 913,79,56,204,83,73,104,362, | 0,2064,3937,6488,9140,10750,14151,25052, | 0 | 1874 | + | 1874 | 0,913,992,1048,1252,1335,1408,1512, | cgcggacccgcagcgactccacagggactgcgctcccgtgcccctagcgctcccgcgctgctgctccagccgcccggcagctctgaggatggagaggagggcgcggagctcctccagggagtcccgcg ... | 89..1240 | 248956422 | 1874 | 0 | 0 | 0 | 1 | NM_014625.3 | ENST00000367615.9 | NP_055440.1 | ENSP00000356587.4 | LRG_887 | NPHS2 | NM_014625.3 NP_055440.1 ENST00000367615.9 ENSP00000356587.4 NPHS2 |
chr1 | 183555561 | 183590604 | LRG_88t1 | 1000 | - | 183556117 | 183590329 | 0 | 15 | 669,178,112,152,26,76,69,142,44,60,108,135,109,83,449, | 0,4534,7633,7872,8443,10142,11358,11642,13580,15218,17623,18925,22037,31333,34594, | 0 | 2412 | + | 2412 | 0,669,847,959,1111,1137,1213,1282,1424,1468,1528,1636,1771,1880,1963, | acactccacccctactcgccctctctctctctgcttctttccttttctctctcatggtagggttatgagtcagttgccaaaaggtggggacatttcctgatgcatttgcaacactgagaagttatctt ... | 276..1856 | 248956422 | 2412 | 0 | 0 | 0 | 1 | NM_000433.3 | ENST00000367535.8 | NP_000424.2 | ENSP00000356505.4 | LRG_88 | NCF2 | NM_000433.3 NP_000424.2 ENST00000367535.8 ENSP00000356505.4 NCF2 |
chr1 | 186828948 | 186988981 | LRG_596t1 | 1000 | + | 186854354 | 186988508 | 0 | 18 | 87,102,82,149,114,38,142,137,223,115,138,93,72,243,185,196,158,605, | 0,25337,41486,64062,65149,78016,82299,103814,110059,111031,117688,117920,121708,127153,136460,148644,150366,159428, | 0 | 2879 | + | 2879 | 0,87,189,271,420,534,572,714,851,1074,1189,1327,1420,1492,1735,1920,2116,2274, | actcaggataagactttctctaagtccggagctgaaaaaggatcctgactgaaagctagaggcattgaggagcctgaagattctcaggttttaaagacgctagagtgccaaagaagactttgaagtgt ... | 157..2406 | 248956422 | 2879 | 0 | 0 | 0 | 1 | NM_024420.3 | ENST00000367466.4 | NP_077734.2 | ENSP00000356436.3 | LRG_596 | PLA2G4A | NM_024420.3 NP_077734.2 ENST00000367466.4 ENSP00000356436.3 PLA2G4A |
chr1 | 193121957 | 193254815 | LRG_507t1 | 1000 | + | 193122200 | 193250712 | 0 | 17 | 374,106,70,63,53,89,217,99,79,65,58,36,88,162,101,142,4140, | 0,3154,8216,13433,13579,16127,19892,25909,28346,30422,81837,90107,90432,111035,114298,127772,128718, | 0 | 5942 | + | 5942 | 0,374,480,550,613,666,755,972,1071,1150,1215,1273,1309,1397,1559,1660,1802, | agtcaggcgttctccgcgggcagccggcggcggggccttgccttacagcgcggggtcctcggcggcctgggtggctactgcccctgctgctgtcgtaggcgaggacggctgttagtgctgctgctgtt ... | 244..1839 | 248956422 | 5942 | 0 | 0 | 0 | 1 | NM_024529.4 | ENST00000367435.5 | NP_078805.3 | ENSP00000356405.4 | LRG_507 | CDC73 | NM_024529.4 NP_078805.3 ENST00000367435.5 ENSP00000356405.4 CDC73 |
chr1 | 196651877 | 196747504 | LRG_47t1 | 1000 | + | 196652117 | 196747313 | 0 | 22 | 298,186,106,77,192,171,174,195,177,183,177,177,183,180,177,183,186,174,177,177,183,394, | 0,21100,21979,24111,25598,27745,33186,37542,38185,61857,63715,73243,74592,74883,76468,84946,85597,88741,89997,91574,93939,95233, | 0 | 4127 | + | 4127 | 0,298,484,590,667,859,1030,1204,1399,1576,1759,1936,2113,2296,2476,2653,2836,3022,3196,3373,3550,3733, | acagcattaacatttagtgggagtgcagtgagaattgggtttaacttctggcatttctgggcttgtggcttgtggttgattttttatttactttgcaaaagtttctgataggcggagcatctagtttc ... | 241..3936 | 248956422 | 4127 | 0 | 0 | 0 | 1 | NM_000186.3 | ENST00000367429.9 | NP_000177.2 | ENSP00000356399.4 | LRG_47 | CFH | NM_000186.3 NP_000177.2 ENST00000367429.9 ENSP00000356399.4 CFH |
|
| |
|
|
LRG Transcripts (lrgTranscriptAli) Track Description
|
|
Description
This track shows the fixed (unchanging) transcript(s) associated with
each
Locus Reference Genomic (LRG) sequence.
LRG
sequences are manually curated, stable DNA sequences that surround a
locus (typically a gene) and provide an unchanging coordinate system
for reporting sequence variants. They are not necessarily identical
to the corresponding sequence in a particular reference genome
assembly (such as Dec. 2013 (GRCh38/hg38)), but can be mapped to each version of a
reference genome assembly in order to convert between the stable LRG
variant coordinates and the various assembly coordinates.
The LRG Regions track, in the Mapping and Sequencing Tracks section,
includes more information about the LRG including the HGNC gene symbol
for the gene at that locus, source of the LRG sequence, and summary of
differences between LRG sequence and the genome assembly.
Methods
LRG sequences are suggested by the community studying a locus (for example,
Locus-Specific Database curators, research laboratories, mutation consortia).
LRG curators then examine the submitted transcript as well as other known
transcripts at the locus, in the context of alignment and public expression
data.
For more information on the selection and annotation process, see the
LRG FAQ,
(Dalgleish, et al.) and (MacArthur, et al.).
Credits
This track was produced at UCSC using
LRG XML files.
Thanks to
LRG
collaborators for making these data available.
References
Dalgleish R, Flicek P, Cunningham F, Astashyn A, Tully RE, Proctor G, Chen Y, McLaren WM, Larsson P,
Vaughan BW et al.
Locus Reference Genomic sequences: an improved basis for describing human DNA variants.
Genome Med. 2010 Apr 15;2(4):24.
PMID: 20398331; PMC: PMC2873802
MacArthur JA, Morales J, Tully RE, Astashyn A, Gil L, Bruford EA, Larsson P, Flicek P, Dalgleish R,
Maglott DR et al.
Locus Reference Genomic: reference sequences for the reporting of clinically relevant sequence
variants.
Nucleic Acids Res. 2014 Jan;42(Database issue):D873-8.
PMID: 24285302; PMC: PMC3965024
| |
|
|
|