Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 64 in window, 152018662 - 152018694, 33 bps 
B D                   Human  atggtggtgtctgccagccc-ttcatccagtgtg
B D                   Chimp  atggtggtgtctgccggccc-ttcatccagtg--
B D                 Gorilla  atggtggtgtctgccggccc-ttcatccagtg--
B D               Orangutan  atggtggtatctgctggccc-ttggtccagtg--
B D                  Gibbon  atggtggtatctgccggccc-ttcgtccagtg--
B D                  Rhesus  atggtggtatctgctggccc-ttggtccagtg--
B D     Crab-eating macaque  atggtggtatctgctggccc-ttggtccagtg--
B D                  Baboon  atggtggtatctgctggccctttggtccagtg--
B D            Green monkey  atggtggtatctgctggccc-ttggtccagtg--
B D                Marmoset  atggcggcacctggcagggt-gtg----------
B D                     Rat  ==================================
              Prairie vole  ==================================
            Golden hamster  ==================================
B D                   Mouse  ==================================
    Lesser Egyptian jerboa  ==================================
B D                    Pika  ----------------------------------
              Weddell seal  ==================================
B D                Hedgehog  ==================================
B D                   Shrew  ==================================
B D              Guinea pig  ==================================
B D                     Pig  ==================================
B D                  Rabbit  ==================================
                  Aardvark  ==================================
B D                 Dolphin  ==================================
        Southern platyfish  ----------------------------------
B D         Tasmanian devil  ----------------------------------
B D          Naked mole-rat  ==================================
B D                  Lizard  ==================================
          Brush-tailed rat  ==================================
                Chinchilla  ==================================
       Cape elephant shrew  ==================================
        Chinese tree shrew  ==================================
B D                Platypus  ==================================
B D                 Wallaby  ==================================
B D                 Manatee  ==================================
B D                Elephant  ==================================
B D         Chinese hamster  ==================================
B D                  Tenrec  ==================================
B D                     Cat  ==================================
B D                Bushbaby  ==================================
B D                 Ferret   ==================================
           Star-nosed mole  ==================================
             Domestic goat  ==================================
B D                   Sheep  ==================================
          Tibetan antelope  ==================================
            Bactrian camel  ==================================
B D                  Alpaca  ==================================
            Pacific walrus  ==================================
B D                   Panda  ==================================
              Killer whale  ==================================
B D                     Dog  ==================================
          Black flying-fox  ==================================
B D        White rhinoceros  ==================================
B D                   Horse  ==================================
B D                Squirrel  ==================================
B D               Armadillo  ==================================
      David's myotis (bat)  ==================================
             Big brown bat  ==================================
B D                Microbat  ==================================
B D         Squirrel monkey  ==================================
B D                     Cow  ==================================

Inserts between block 1 and 2 in window
B D               Marmoset 2046bp

Alignment block 2 of 64 in window, 152018695 - 152018775, 81 bps 
B D                   Human  agaaga----c-agagatgaacactggagaaatcaacaagaaattgcgcccccagccggcagagaacaaa
B D                   Chimp  agaaga----c-agagatgaacactggagaaatcaacaagaaattgcgcccccagccggcagagaactaa
B D                 Gorilla  agaaga----c-agagatgaacattggagaaatcaacaagaaattgcacccccagccggcagagaacaaa
B D               Orangutan  agaagg----c-agagatgaacattggagaaatcaacgagaaattgagcccccagccggcagagaacaaa
B D                  Gibbon  agaaga----caagagatgaacattggagaaatcaacgagaaattgcgcccccaaccggcagagaacaaa
B D                  Rhesus  agaagg----c-agagatgaacattctagaaatcaacgagaaattgcgaccccagctggcagagaagaaa
B D     Crab-eating macaque  agaagg----c-agagatgaacattctagaaatcaacgagaaattgcgaccccagctggcagagaagaaa
B D                  Baboon  agaagg----c-agagatgaacattctagaaatcaacgagaaattgcgaccccagctggcagagaagaaa
B D            Green monkey  agaaga----c-agagatgaacattctagaaatcaacgagaaattgcgaccccagctggcaaagaagaaa
B D                Marmoset  agaagaatccc-agaggagaacattacagaaggcattgagaaatccggctcacaacaggaagaaaacaaa
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D         Tasmanian devil  ----------------------------------------------------------------------
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                     Cow  ======================================================================

                      Human  cagcagttcagaaaca
                      Chimp  cagcagttcagaaaca
                    Gorilla  cagcagttcagaaaca
                  Orangutan  cagcagttcagaaaca
                     Gibbon  cagcagttcagaaaca
                     Rhesus  cagcagttcaaaaaca
        Crab-eating macaque  cagcagttcaaaaaca
                     Baboon  cagcagttcaaaaaca
               Green monkey  cagcagttcaaaaaca
                   Marmoset  ccgaatgtcggagcca
                        Rat  ================
               Prairie vole  ================
             Golden hamster  ================
                      Mouse  ================
     Lesser Egyptian jerboa  ================
                       Pika  ----------------
               Weddell seal  ================
                   Hedgehog  ================
                      Shrew  ================
                 Guinea pig  ================
                        Pig  ================
                     Rabbit  ================
                   Aardvark  ================
                    Dolphin  ================
         Southern platyfish  ----------------
            Tasmanian devil  ----------------
             Naked mole-rat  ================
                     Lizard  ================
           Brush-tailed rat  ================
                 Chinchilla  ================
        Cape elephant shrew  ================
         Chinese tree shrew  ================
                   Platypus  ================
                    Wallaby  ================
                    Manatee  ================
                   Elephant  ================
            Chinese hamster  ================
                     Tenrec  ================
                        Cat  ================
                   Bushbaby  ================
                    Ferret   ================
            Star-nosed mole  ================
              Domestic goat  ================
                      Sheep  ================
           Tibetan antelope  ================
             Bactrian camel  ================
                     Alpaca  ================
             Pacific walrus  ================
                      Panda  ================
               Killer whale  ================
                        Dog  ================
           Black flying-fox  ================
           White rhinoceros  ================
                      Horse  ================
                   Squirrel  ================
                  Armadillo  ================
       David's myotis (bat)  ================
              Big brown bat  ================
                   Microbat  ================
            Squirrel monkey  ================
                        Cow  ================

Inserts between block 2 and 3 in window
B D               Marmoset 1278bp

Alignment block 3 of 64 in window, 152018776 - 152018802, 27 bps 
B D                   Human  t-aaagagaaatttcttgtaactcaagt
B D                   Chimp  t-aaagagaaatttcttgtaactcaagt
B D                 Gorilla  t-aaagagaaatttcttgtaactcaagt
B D               Orangutan  tcaaagagaaatttcttgtaactcaagt
B D                  Gibbon  tcaaagagaaatttcttgtaacacaagt
B D                  Rhesus  tcaaagagaaatttcttgtaactcaagt
B D     Crab-eating macaque  tcaaagagaaatttcttgtaactcaagt
B D                  Baboon  tcaaagagaaatttcttgtaactcaagt
B D            Green monkey  tcaaagagaaatttcttgtaactcaagt
B D                Marmoset  -caaaaataaacttcttgtgagtcaagc
B D                     Rat  ============================
              Prairie vole  ============================
            Golden hamster  ============================
B D                   Mouse  ============================
    Lesser Egyptian jerboa  ============================
B D                    Pika  ----------------------------
              Weddell seal  ============================
B D                Hedgehog  ============================
B D                   Shrew  ============================
B D              Guinea pig  ============================
B D                     Pig  ============================
B D                  Rabbit  ============================
                  Aardvark  ============================
B D                 Dolphin  ============================
        Southern platyfish  ----------------------------
B D         Tasmanian devil  ----------------------------
B D          Naked mole-rat  ============================
B D                  Lizard  ============================
          Brush-tailed rat  ============================
                Chinchilla  ============================
       Cape elephant shrew  ============================
        Chinese tree shrew  ============================
B D                Platypus  ============================
B D                 Wallaby  ============================
B D                 Manatee  ============================
B D                Elephant  ============================
B D         Chinese hamster  ============================
B D                  Tenrec  ============================
B D                     Cat  ============================
B D                Bushbaby  ============================
B D                 Ferret   ============================
           Star-nosed mole  ============================
             Domestic goat  ============================
B D                   Sheep  ============================
          Tibetan antelope  ============================
            Bactrian camel  ============================
B D                  Alpaca  ============================
            Pacific walrus  ============================
B D                   Panda  ============================
              Killer whale  ============================
B D                     Dog  ============================
          Black flying-fox  ============================
B D        White rhinoceros  ============================
B D                   Horse  ============================
B D                Squirrel  ============================
B D               Armadillo  ============================
      David's myotis (bat)  ============================
             Big brown bat  ============================
B D                Microbat  ============================
B D         Squirrel monkey  ============================
B D                     Cow  ============================

Alignment block 4 of 64 in window, 152018803 - 152018950, 148 bps 
B D                   Human  ggcctaattcctggccaaccagcagaagaaatac------------cgtaagttcgataggctcaccatc
B D                   Chimp  ggcctacttcctggccaaccggcagaagaaatac------------cgtaagttcgataggctcaccatc
B D                 Gorilla  ggcctacttcctggccaactggcagaagaaatac------------cgtaagttcgataggctcaccatc
B D               Orangutan  ggcctacttcctggccaaccggcagaagaaatac------------cttaagttcgataggctcaccatc
B D                  Gibbon  ggcctacttcctggccaactggcagaagaaatac------------tgtaagttcgataggctcaccatc
B D                  Rhesus  ggcctgcttcctggccagccggcagaacaaatac------------agtaagatctataggctcaccatc
B D     Crab-eating macaque  ggcctgcttcctggccagccggcagaacaaatac------------agtaagatctataggctcaccatc
B D                  Baboon  ggcctgcttcctggccagccggcagaacaaatac------------agtaagatctataggctcaccatc
B D            Green monkey  ggcctgcttcctggccagctggcagaacaaatac------------agtaagatctataggctcaccatc
B D                Marmoset  agtctactccctggcctgtcagctgaagacggaa------------ggtaagttctataggttcaccatc
B D         Tasmanian devil  agtccaagtccaggccagccagctagagcaataccgagtcttatttcgtaagtcc--tgggttaaaagtt
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                     Cow  ======================================================================

                      Human  acaaaagtgaggaatgatgtcctgtct------------------------tctctctgagaaact--aa
                      Chimp  acaaaagtgaggaatgatgtcctgtct------------------------tctctctgagaaact--aa
                    Gorilla  acaaaagtgatgaatgatgtcctgtct------------------------tctctctgagaaact--aa
                  Orangutan  acaaaagtgatgaatgatgtcctgtct------------------------tctgtctgagaaact--aa
                     Gibbon  acgaaagtgatgaatgatgtcctgtct------------------------tctctctgagaaact--aa
                     Rhesus  acgaaagtgatgaatgacgtcctgtct------------------------tctctctgagaaact--aa
        Crab-eating macaque  acgaaagtgatgaatgacgtcctgtct------------------------tctctctgagaaact--aa
                     Baboon  acgaaagtgatgaatgacgtcctgtct------------------------tctctctgagaaact--aa
               Green monkey  acgaaagtgatgaatgatgtcctgtct------------------------tctctctgagaaact--aa
                   Marmoset  atggaagtactgaggagtgtcctgtct------------------------tgtctctgagaaacc--at
            Tasmanian devil  atcaaactgatatattgtacattaccttagatgttagaagaataccttagatttctctgaagagctcaaa
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                        Cow  ======================================================================

                      Human  atgctct-----ctccatcaaaaa-------------------taatttcatctttcccgtgcttctagg
                      Chimp  atgctct-----ctccatcaaaaa-------------------taatttcatctttcccgtgcttctagg
                    Gorilla  atgctct-----ctccatcaaaaa-------------------taatttcatctttcccgtgcttctagg
                  Orangutan  atgctct-----ctccatcaaaaa-------------------taatttcatctttcccatgcttctagg
                     Gibbon  atgctgt-----ctccatcaaaaa-------------------taatttcatctttctcgtgtttctagg
                     Rhesus  atg---------cactatcaaaaa-------------------taatttcttccttctcgtacttctagg
        Crab-eating macaque  atg---------ctctatcaaaaa-------------------taatttcttccttcccgtacttctagg
                     Baboon  atgctct-----ctctatcaaaaa-------------------taatttcttccttcccgtacttctagg
               Green monkey  atgctct-----ctctatcaaaaa-------------------taatttcttccttcccatacttctagg
                   Marmoset  acactct-----ctttttcaaaga-------------------taattttatccttcccatacttctagg
            Tasmanian devil  atatttgaaagacttaaaaaaaaaaaaaaaaaaactcttatattaaatctatc-ttccagtatttctgg-
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                        Cow  ======================================================================

Inserts between block 4 and 5 in window
B D               Marmoset 777bp

Alignment block 5 of 64 in window, 152018951 - 152019106, 156 bps 
B D                   Human  aaaatagaaatgggtattttaacattttgtt-----------agaaatggaagacagaggca-gaaagta
B D                   Chimp  aaaatagaaatgggtattttaacattttgtt-----------aaaaatggaagacagaggca-gaaagta
B D                 Gorilla  aaaatagaaatgggtattttaacattttgtt-----------aaaaatggaagacagaggca-gaaagta
B D               Orangutan  aaaatagaaatggatattttaacattttgtt-----------aaaaatggaagacagaggca-gaaagta
B D                  Gibbon  aaaatagaaatgggtattttaacattttgtt-----------aaaaatggaagacagaggca-gaaagta
B D                  Rhesus  aaaacagaaatgggaattttaacattttgtt-----------aaggttggaagacagaggtaccaaatta
B D     Crab-eating macaque  aaaacagaaatgggaattttaacattttgtt-----------aaggttggaagacagaggtaccaaatta
B D                  Baboon  aaaacagaaatgggaattttaacattttgtt-----------aaggttggaagacagaggtaccaaatta
B D            Green monkey  aaaacagaaatgggaattttaacattttgtt-----------aaggttggaagacagaggtaccaaatta
B D                Marmoset  aaaatagaaatgggtattgtaccatttggtt-----------aaagatggaagacagaggc--caaagtg
B D         Tasmanian devil  aaaggaagaaggggtattttttttttttttttaccgcatttcacggatggaaaattgaggcatagtaatg
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                     Cow  ======================================================================

                      Human  tttagcaacttttccatgtttgcagtcaggtggcggtgggattagagtta-------------aaaatcc
                      Chimp  tttagcaacttttccatgtttgcagtcaggtggcggtgggattcgagtta-------------aaaatcc
                    Gorilla  tttagcaacttttccatgtttgcagtcaggtggcggtgggattagagtta-------------aaaatcc
                  Orangutan  tttagcaacttttccatgtttgcagtca-gtggtggtgggattagagtta-------------aaaatcc
                     Gibbon  tttagcaacttttccatgtttgcagtcaggtgagggtgggattagagtta-------------aaaatcc
                     Rhesus  tttagcaac-tttccatgtttgcagtcaggtggcggtgggactagagtt--------------caaatcc
        Crab-eating macaque  tttagcaac-tttccatgtttgcagtcaggtggcggtgggactagagtt--------------caaatcc
                     Baboon  tttagcaac-tttccatgtttgcagtcaggtggcggtgagactagagtt--------------caaatcc
               Green monkey  tttagcaac-tttccatgtttgcagtcaggtggcggtgggactagagtt--------------caaatcc
                   Marmoset  tttagcaacttttccacgtctgcagtaacgtgggtgtgggactggggtt--------------acaatcc
            Tasmanian devil  tgaagcaac-ttgattcagttgcgg---gatctaagcagaactggagctaaatccagactgataaaatcc
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                        Cow  ======================================================================

                      Human  cagttc----ttgatttctgacacaggcacagcaccacctgtttt
                      Chimp  cagttc----ttgatttctgacacaggcacagcaccacctgtttt
                    Gorilla  cagttc----ttgatttctgacacaggcacagcaccacctgtttt
                  Orangutan  cagttc----ttgatttctgacacaggcacagcaccacctgtttt
                     Gibbon  cagttc----ttgatttctgacacaggcacagcaccacctgtttt
                     Rhesus  cagtta----ttgatttctgacacctgtacagcaccacctgtttt
        Crab-eating macaque  cagtta----ttgatttctgacacctgtacagcaccacctgtttt
                     Baboon  cagtta----ttgatttctgacacctgtacagcaccacctgtttt
               Green monkey  cagtta----ttgatttctgacacctgtacggcaccacctgtttt
                   Marmoset  cagcta----tggatttctgacacaggcacggaaccacctgtttt
            Tasmanian devil  caagtccattctgccttctaagagcaggttaaccctcctttttat
                        Rat  =============================================
               Prairie vole  =============================================
             Golden hamster  =============================================
                      Mouse  =============================================
     Lesser Egyptian jerboa  =============================================
                       Pika  ---------------------------------------------
               Weddell seal  =============================================
                   Hedgehog  =============================================
                      Shrew  =============================================
                 Guinea pig  =============================================
                        Pig  =============================================
                     Rabbit  =============================================
                   Aardvark  =============================================
                    Dolphin  =============================================
         Southern platyfish  ---------------------------------------------
             Naked mole-rat  =============================================
                     Lizard  =============================================
           Brush-tailed rat  =============================================
                 Chinchilla  =============================================
        Cape elephant shrew  =============================================
         Chinese tree shrew  =============================================
                   Platypus  =============================================
                    Wallaby  =============================================
                    Manatee  =============================================
                   Elephant  =============================================
            Chinese hamster  =============================================
                     Tenrec  =============================================
                        Cat  =============================================
                   Bushbaby  =============================================
                    Ferret   =============================================
            Star-nosed mole  =============================================
              Domestic goat  =============================================
                      Sheep  =============================================
           Tibetan antelope  =============================================
             Bactrian camel  =============================================
                     Alpaca  =============================================
             Pacific walrus  =============================================
                      Panda  =============================================
               Killer whale  =============================================
                        Dog  =============================================
           Black flying-fox  =============================================
           White rhinoceros  =============================================
                      Horse  =============================================
                   Squirrel  =============================================
                  Armadillo  =============================================
       David's myotis (bat)  =============================================
              Big brown bat  =============================================
                   Microbat  =============================================
            Squirrel monkey  =============================================
                        Cow  =============================================

Inserts between block 5 and 6 in window
B D               Marmoset 2210bp

Alignment block 6 of 64 in window, 152019107 - 152019107, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D         Tasmanian devil  c
B D                     Rat  =
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  =
B D                    Pika  -
              Weddell seal  =
B D                Hedgehog  =
B D                   Shrew  =
B D              Guinea pig  =
B D                     Pig  =
B D                  Rabbit  =
                  Aardvark  =
B D                 Dolphin  =
        Southern platyfish  -
B D          Naked mole-rat  =
B D                  Lizard  =
          Brush-tailed rat  =
                Chinchilla  =
       Cape elephant shrew  =
        Chinese tree shrew  =
B D                Platypus  =
B D                 Wallaby  =
B D                 Manatee  =
B D                Elephant  =
B D         Chinese hamster  =
B D                  Tenrec  =
B D                     Cat  =
B D                Bushbaby  =
B D                 Ferret   =
           Star-nosed mole  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Bactrian camel  =
B D                  Alpaca  =
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
B D                     Dog  =
          Black flying-fox  =
B D        White rhinoceros  =
B D                   Horse  =
B D                Squirrel  =
B D               Armadillo  =
      David's myotis (bat)  =
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  =
B D                     Cow  =

Inserts between block 6 and 7 in window
B D        Tasmanian devil 8192bp

Alignment block 7 of 64 in window, 152019108 - 152019308, 201 bps 
B D                   Human  tcagcaagaggctaaat-catg-ttactagaatcctctctgtaccataaaagattctgcagacaagtagc
B D                   Chimp  tcagcaagaggctaaat-cacg-ttactagaatcctctctgtaccataaaagatcctgcagagaagtagc
B D                 Gorilla  tcagcaagaggctaaat-catg-ttactagaatcctctctgtaccattaaagattctgcagacaagtagc
B D               Orangutan  tcagcaagaggctaaat-cata-ttactagaatcctctctgtaccataaaagattctgcagacaagtagc
B D                  Gibbon  tcagcaagaggctaaat-tgtg-ttactagaatcctctctgtaccacaaaagattctgcagacaagtagc
B D                  Rhesus  tcagcaagaggctaaat-catg-ttactagaatcctctctgtaccataaaagattctgcagacaagtagc
B D     Crab-eating macaque  tcagcaagaggctaaat-catg-ttactagaatcctctctgtaccataaaagattctgcagacaagtagc
B D                  Baboon  tcagcaagaggctaaat-catg-ttactagaatcctctctgtaccataaaagattctgcagacaagtagc
B D            Green monkey  tcagcaagaggctaaat-catg-ttactagaatcctctctgaaccataaaagattctgcagacaagtagc
B D                Marmoset  tcagcaagaggctaaatccatgtttacaggaatcctctgtgtacagtataagatcctgcagagaagtagc
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                     Cow  ======================================================================

                      Human  atctagtctgttggtctaaatatgtgggactcatgaacttccattcagttcaagtctctgttgaggccca
                      Chimp  atctagtctgttggtctaaatatgtgggactcatgaacttccattcagttcaagtctctgttgaggccaa
                    Gorilla  atctagtctgttggtctaaatatgtgggactcatgaacttccattcagctcaagtctctgttgaggccca
                  Orangutan  atctagtctgttgatctaaatatgtgggactcatgaacttccattcagttcaagtctctattgtggccca
                     Gibbon  atctagtctgttggtctaaatatgtgggactcatgaacttccactcagttcaagtctctgttgaggccca
                     Rhesus  atctagtctgttggtctaaatgtctgggactcacgaacttccattcagttcaagtctctgttgaggccca
        Crab-eating macaque  atctagtctgttggtctaaatgtctgggactcacgaacttccattcagttcaagtctctgttgaggccca
                     Baboon  atctagtctgttggtctaaatgtctgggactcatgaacttccattcagttcaagtctctgttgaggccca
               Green monkey  atctagtctgttggtctaaatgtctgggactcatgaacttccattcagttcaagtctctgttgaggccca
                   Marmoset  atctagtctgttggtctaaatgtctgaggctgctgaacttccattgtgttccggtttctgctgaggccca
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                        Cow  ======================================================================

                      Human  ataggcaaagctctgttctggagaccctggaggaaacatggtgttagtacacagtacccgcac
                      Chimp  ataggcaaagctctgttctggagaccctgggggaaacatggtgttagtatacagtgcccacac
                    Gorilla  ataggcaaagctctgttctggagaccctgggggaaacatcatgttagtacacagtacccgcac
                  Orangutan  ataggcaaagctctgttctggagaccctgggggaaacatggtgttaatacacagtacccatgc
                     Gibbon  ataggcaaagctctgttctggagaccctgggggaaacatggtgttagtacatagtatctgctc
                     Rhesus  ataggcaaagctctgttctggggaccctgggggaaacgtggtgttagtacacagtactcctgc
        Crab-eating macaque  ataggcaaagctctgttctggggaccctgggggaaacgtggtgttagtacacagtacccctgc
                     Baboon  ataggcaaagctctgttctggggaccctgggggaaacgtggtgttagtacacagtacccctgc
               Green monkey  ataggcaaagctctgttctggggaccctgggggaaacgtggtgttagtacacagtacccctgc
                   Marmoset  gcaggcaaagctgtgtgttggggaccctgggggaaacacagcgatagcagacagtatctcctg
                        Rat  ===============================================================
               Prairie vole  ===============================================================
             Golden hamster  ===============================================================
                      Mouse  ===============================================================
     Lesser Egyptian jerboa  ===============================================================
                       Pika  ---------------------------------------------------------------
               Weddell seal  ===============================================================
                   Hedgehog  ===============================================================
                      Shrew  ===============================================================
                 Guinea pig  ===============================================================
                        Pig  ===============================================================
                     Rabbit  ===============================================================
                   Aardvark  ===============================================================
                    Dolphin  ===============================================================
         Southern platyfish  ---------------------------------------------------------------
            Tasmanian devil  ===============================================================
             Naked mole-rat  ===============================================================
                     Lizard  ===============================================================
           Brush-tailed rat  ===============================================================
                 Chinchilla  ===============================================================
        Cape elephant shrew  ===============================================================
         Chinese tree shrew  ===============================================================
                   Platypus  ===============================================================
                    Wallaby  ===============================================================
                    Manatee  ===============================================================
                   Elephant  ===============================================================
            Chinese hamster  ===============================================================
                     Tenrec  ===============================================================
                        Cat  ===============================================================
                   Bushbaby  ===============================================================
                    Ferret   ===============================================================
            Star-nosed mole  ===============================================================
              Domestic goat  ===============================================================
                      Sheep  ===============================================================
           Tibetan antelope  ===============================================================
             Bactrian camel  ===============================================================
                     Alpaca  ===============================================================
             Pacific walrus  ===============================================================
                      Panda  ===============================================================
               Killer whale  ===============================================================
                        Dog  ===============================================================
           Black flying-fox  ===============================================================
           White rhinoceros  ===============================================================
                      Horse  ===============================================================
                   Squirrel  ===============================================================
                  Armadillo  ===============================================================
       David's myotis (bat)  ===============================================================
              Big brown bat  ===============================================================
                   Microbat  ===============================================================
            Squirrel monkey  ===============================================================
                        Cow  ===============================================================

Alignment block 8 of 64 in window, 152019309 - 152019376, 68 bps 
B D                   Human  tgaggagcttaaagagaactctgctcctaatagaacctgtggtatctatgagtgacagcatcaagagc
B D                   Chimp  tgaggagcttaaagagaactctgctcctaatagaacctgtggtatctataagtgacagcatcaagagc
B D                 Gorilla  tgaggagcttaaagagaactctactcctaatagaacctgtggtatctataagtgacagcatcaagagc
B D               Orangutan  tgaggagattaaagagaactctgctcctaatagaacctgtggtatctataagtgacagcatcaagagc
B D                  Gibbon  tgaggagcttaaagaggactctgctcctaatagaacctgtggtatctataagtgacagcatcaagagc
B D                  Rhesus  tgaggagcttaaagagaactctgctcctaatggaacctgtggtatctataagtgacagcatcaagagg
B D     Crab-eating macaque  tgaggagcttaaagagaactctgctcctaatggaacctgtggtatctataagtgacagcatcaagagg
B D                  Baboon  tgaggagcttaaagagaactctgctcctaatggaacctgtggtatctataagtgacagcatcaagagg
B D            Green monkey  tgaggagcttaaagagaactctgctcctaatggaacctgtggtatctataagtgacagcatcaagagg
B D                Marmoset  tgaggaactgaaaggggatcctgctcttgatagaacctgtgg----tataagtggccccatgaagagc
B D                 Dolphin  tgggg---------------------------gaagc-------------------------------
B D                     Rat  ====================================================================
              Prairie vole  ====================================================================
            Golden hamster  ====================================================================
B D                   Mouse  ====================================================================
    Lesser Egyptian jerboa  ====================================================================
B D                    Pika  --------------------------------------------------------------------
              Weddell seal  ====================================================================
B D                Hedgehog  ====================================================================
B D                   Shrew  ====================================================================
B D              Guinea pig  ====================================================================
B D                     Pig  ====================================================================
B D                  Rabbit  ====================================================================
                  Aardvark  ====================================================================
        Southern platyfish  --------------------------------------------------------------------
B D         Tasmanian devil  ====================================================================
B D          Naked mole-rat  ====================================================================
B D                  Lizard  ====================================================================
          Brush-tailed rat  ====================================================================
                Chinchilla  ====================================================================
       Cape elephant shrew  ====================================================================
        Chinese tree shrew  ====================================================================
B D                Platypus  ====================================================================
B D                 Wallaby  ====================================================================
B D                 Manatee  ====================================================================
B D                Elephant  ====================================================================
B D         Chinese hamster  ====================================================================
B D                  Tenrec  ====================================================================
B D                     Cat  ====================================================================
B D                Bushbaby  ====================================================================
B D                 Ferret   ====================================================================
           Star-nosed mole  ====================================================================
             Domestic goat  ====================================================================
B D                   Sheep  ====================================================================
          Tibetan antelope  ====================================================================
            Bactrian camel  ====================================================================
B D                  Alpaca  ====================================================================
            Pacific walrus  ====================================================================
B D                   Panda  ====================================================================
              Killer whale  ====================================================================
B D                     Dog  ====================================================================
          Black flying-fox  ====================================================================
B D        White rhinoceros  ====================================================================
B D                   Horse  ====================================================================
B D                Squirrel  ====================================================================
B D               Armadillo  ====================================================================
      David's myotis (bat)  ====================================================================
             Big brown bat  ====================================================================
B D                Microbat  ====================================================================
B D         Squirrel monkey  ====================================================================
B D                     Cow  ====================================================================

Alignment block 9 of 64 in window, 152019377 - 152019391, 15 bps 
B D                   Human  agggagtaccctggt
B D                   Chimp  agggag---------
B D                 Gorilla  agggagtaccctggt
B D               Orangutan  agggaataccctggt
B D                  Gibbon  agggagtacccttgt
B D                  Rhesus  cgggagtaccctggt
B D     Crab-eating macaque  cgggagtaccctggt
B D                  Baboon  cgggagtaccctggt
B D            Green monkey  cgggagtaccctggt
B D                Marmoset  aggaagtactcttgt
B D                     Rat  ===============
              Prairie vole  ===============
            Golden hamster  ===============
B D                   Mouse  ===============
    Lesser Egyptian jerboa  ===============
B D                    Pika  ---------------
              Weddell seal  ===============
B D                Hedgehog  ===============
B D                   Shrew  ===============
B D              Guinea pig  ===============
B D                     Pig  ===============
B D                  Rabbit  ===============
                  Aardvark  ===============
B D                 Dolphin  ===============
        Southern platyfish  ---------------
B D         Tasmanian devil  ===============
B D          Naked mole-rat  ===============
B D                  Lizard  ===============
          Brush-tailed rat  ===============
                Chinchilla  ===============
       Cape elephant shrew  ===============
        Chinese tree shrew  ===============
B D                Platypus  ===============
B D                 Wallaby  ===============
B D                 Manatee  ===============
B D                Elephant  ===============
B D         Chinese hamster  ===============
B D                  Tenrec  ===============
B D                     Cat  ===============
B D                Bushbaby  ===============
B D                 Ferret   ===============
           Star-nosed mole  ===============
             Domestic goat  ===============
B D                   Sheep  ===============
          Tibetan antelope  ===============
            Bactrian camel  ===============
B D                  Alpaca  ===============
            Pacific walrus  ===============
B D                   Panda  ===============
              Killer whale  ===============
B D                     Dog  ===============
          Black flying-fox  ===============
B D        White rhinoceros  ===============
B D                   Horse  ===============
B D                Squirrel  ===============
B D               Armadillo  ===============
      David's myotis (bat)  ===============
             Big brown bat  ===============
B D                Microbat  ===============
B D         Squirrel monkey  ===============
B D                     Cow  ===============

Alignment block 10 of 64 in window, 152019392 - 152019662, 271 bps 
B D                   Human  gagagggaagtcctgcttcctagggcactggctcttgttcctaaaaaggaagaaagacggcacccaagac
B D                   Chimp  ---agggaagtcctgcttcctagggcactggctcttgttcctaaaaaggaagaaagacggcacccaagac
B D                 Gorilla  gagagggaagtcctgcttcctagggcactggctcttgttcctaaaaaggaagaaagacggcacccaaaac
B D               Orangutan  gagagggaagtcctgcttcctagggcactggctcttgttcctaaaaaggaagaaagatggcacccaagac
B D                  Gibbon  gagagggaagtcctgcttcgtagggcattggctcttgttcctaaaaaggaagaaagacggcacccaagac
B D                  Rhesus  gagagggaagtcctgcttcctggggccctggctcttgttcctaaagaggaagaaagatggcacccaagac
B D     Crab-eating macaque  gagagggaagtcctgcttcctggggccctggctcttgttcctaaagaggaagaaagatggcacccaagac
B D                  Baboon  aagagggaagtcctgcttcctggggcactggctcttgttcctacagaggaagaaagatggcacccaagac
B D            Green monkey  gagagggaagtcctgcttcctggggcactggctcttattcctaaagaggaagaaagatggcacccaagac
B D                Marmoset  cagagggatgtcctgcttttt-ttgcagaggctctcgttggtaaagaggaagaacgacggcacccatgac
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                     Cow  ======================================================================

                      Human  tttgtggaggtagca-tgtgtagagcagggaccctgggccagtgtcctgggctccacccaagttgcttgt
                      Chimp  tttgtggaggtagcagtgtgtagagcagggaccctgggccagtgtcctgggctccacccaagttgcttgt
                    Gorilla  tttgtggaggtagcagtgtgtagagcagggaccctgggccagtgtcctgggctccacccaagttgcttgt
                  Orangutan  cttgtggaggtagcagtgtgtagagcagggaccccgggccagtgtcctgggctctacccaagttgcttgt
                     Gibbon  tttgtggaggtagcagtgtgtagagcagggaccccaggccagtgtcctgggctccacccaagttgcttgt
                     Rhesus  tctgtgaaggtagcagtgtgtagagcagggaccctgggccagtgtcctgggctccatccaagttgcttgt
        Crab-eating macaque  tctgtgaaggtagcagtgtgtagagcagggaccctgggccagtgtcctgggctccatccaagttgcttgt
                     Baboon  tctgtgaaggtagcagtgtgtagagcagggaccctgggccagtgtcctgggctccatccaagttgcttgt
               Green monkey  tctgtgaaggtagcagtatgtagagcagggaccctgggccagtgtcctgggctccatccaagttgcttgt
                   Marmoset  tttttgaaggcagcagtacatagaggagggaccctgggccagtctcctgagctccatccaagttgcttct
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                        Cow  ======================================================================

                      Human  cttctctgttcctctgcttcttcatctgtccatagggtactataataatacctacctctgcaaattgctg
                      Chimp  cttctccgttcctctgcttcttcatctgtccatagggtactataataatacctacctctgcaaattgctg
                    Gorilla  cttctctgttcctctgcttcttcatctgtccatagggtactataataatatctacctctgcaaattgctg
                  Orangutan  cttctctgttcctcagcttcttcatctgtccatagggtactataataatacctacttctgcaaattgctg
                     Gibbon  cttctctgttcctcagcttcttcatccgtccgtagggtactataataatacctacctctgtaaattgctg
                     Rhesus  cttctctgttcctcagctgcttcatccatccatagtgtactataataatacctacctctataagttgctg
        Crab-eating macaque  cttctctgttcctcagctgcttcatccatccatagtgtactataataatacctacctctataagttgctg
                     Baboon  cttctctgttcctcagcttcttcatccatccatagggtactataataatacctacctctataagttgctg
               Green monkey  cttctctgttcctcagctgcttcatccatccatagggtactataataatacctacctctataagttgctg
                   Marmoset  tttgtttgttactcagttttgtcacctgttcgtaggatactataataatgcctacctctgtcaattgctg
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                        Cow  ======================================================================

                      Human  caatgaattacatgacctatttcttgtaaacctcctggaacagttgttggcacagagtaaac
                      Chimp  caatgaattacatgacctatttcttgtaaacctcctggaacaattgttggcacagagtaaac
                    Gorilla  caatgaattacatgacctatttcttgtaaacctcctggaaca---gttggcacagagaaaac
                  Orangutan  caatgaattacatgacctatttcttgtaaacctcctggaacagttgttggcacagagtaaac
                     Gibbon  caatgaattacatgacctatttcttgtaaacctcctggaacagttgttggcacagagtaaac
                     Rhesus  caatgattt--atgacctgtttcttgtaaacctcctggaacagttgttggcacagagtaagc
        Crab-eating macaque  caatgattt--atgacctgtttcttgtaaacctcctggaacagttgttggcacagagtaagc
                     Baboon  caattattt--atgacctgtttcttgtaaacctcctggaacagttgttggcacagagtaagc
               Green monkey  caatgaattacatgacctgtttcttgtaaacctcctggaacagttgttggcacagagtaagc
                   Marmoset  cactgaattagatggcctatttattgtaactctcccgggacagttgttggcacagagtaaac
                        Rat  ==============================================================
               Prairie vole  ==============================================================
             Golden hamster  ==============================================================
                      Mouse  ==============================================================
     Lesser Egyptian jerboa  ==============================================================
                       Pika  --------------------------------------------------------------
               Weddell seal  ==============================================================
                   Hedgehog  ==============================================================
                      Shrew  ==============================================================
                 Guinea pig  ==============================================================
                        Pig  ==============================================================
                     Rabbit  ==============================================================
                   Aardvark  ==============================================================
                    Dolphin  ==============================================================
         Southern platyfish  --------------------------------------------------------------
            Tasmanian devil  ==============================================================
             Naked mole-rat  ==============================================================
                     Lizard  ==============================================================
           Brush-tailed rat  ==============================================================
                 Chinchilla  ==============================================================
        Cape elephant shrew  ==============================================================
         Chinese tree shrew  ==============================================================
                   Platypus  ==============================================================
                    Wallaby  ==============================================================
                    Manatee  ==============================================================
                   Elephant  ==============================================================
            Chinese hamster  ==============================================================
                     Tenrec  ==============================================================
                        Cat  ==============================================================
                   Bushbaby  ==============================================================
                    Ferret   ==============================================================
            Star-nosed mole  ==============================================================
              Domestic goat  ==============================================================
                      Sheep  ==============================================================
           Tibetan antelope  ==============================================================
             Bactrian camel  ==============================================================
                     Alpaca  ==============================================================
             Pacific walrus  ==============================================================
                      Panda  ==============================================================
               Killer whale  ==============================================================
                        Dog  ==============================================================
           Black flying-fox  ==============================================================
           White rhinoceros  ==============================================================
                      Horse  ==============================================================
                   Squirrel  ==============================================================
                  Armadillo  ==============================================================
       David's myotis (bat)  ==============================================================
              Big brown bat  ==============================================================
                   Microbat  ==============================================================
            Squirrel monkey  ==============================================================
                        Cow  ==============================================================

Inserts between block 10 and 11 in window
B D               Marmoset 514bp

Alignment block 11 of 64 in window, 152019663 - 152019737, 75 bps 
B D                   Human  actattagttcttcattctactgtttctaacttaacagaaacttgattagtatttcggcatatttccttc
B D                   Chimp  actattagttctttattctactgtttctaacttaacagaaacttgattagtatttgggcatatttccttc
B D                 Gorilla  actattagttcttcattctactgtttctaacttaacagaaacttgattagtatttgggcatatttccttc
B D               Orangutan  actattagttcttcattctactgtttctaacttaacagaaacttgattagtattagggcatatttccttc
B D                  Gibbon  actattagttcttcattctactgtttctaacttaacaaaaacttgattagtatttgggcatatttccttc
B D                  Rhesus  actattagttcttcattctactgtttgtaacttaacagaaacttgattagtatttgggcatacttccttc
B D     Crab-eating macaque  actattagttcttcattctactgtttctaacttaacagaaacttgattagtatttgggcatatttccttc
B D                  Baboon  actattagttcttcattctactgtttctaacttaacagaaacttggttagtatttgggcatatttccttc
B D            Green monkey  actattagttcttcattctactgtttctaacttaacagaaacttgattagtgtttgggcatatttccttc
B D                Marmoset  actgttagttcttcattctactgtgtctagcataagggaaactttattagtctttgtgcatatttctttt
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                     Cow  ======================================================================

                      Human  atggc
                      Chimp  atggc
                    Gorilla  atggc
                  Orangutan  atggc
                     Gibbon  atggc
                     Rhesus  atggc
        Crab-eating macaque  atggc
                     Baboon  atgac
               Green monkey  atggc
                   Marmoset  atggc
                        Rat  =====
               Prairie vole  =====
             Golden hamster  =====
                      Mouse  =====
     Lesser Egyptian jerboa  =====
                       Pika  -----
               Weddell seal  =====
                   Hedgehog  =====
                      Shrew  =====
                 Guinea pig  =====
                        Pig  =====
                     Rabbit  =====
                   Aardvark  =====
                    Dolphin  =====
         Southern platyfish  -----
            Tasmanian devil  =====
             Naked mole-rat  =====
                     Lizard  =====
           Brush-tailed rat  =====
                 Chinchilla  =====
        Cape elephant shrew  =====
         Chinese tree shrew  =====
                   Platypus  =====
                    Wallaby  =====
                    Manatee  =====
                   Elephant  =====
            Chinese hamster  =====
                     Tenrec  =====
                        Cat  =====
                   Bushbaby  =====
                    Ferret   =====
            Star-nosed mole  =====
              Domestic goat  =====
                      Sheep  =====
           Tibetan antelope  =====
             Bactrian camel  =====
                     Alpaca  =====
             Pacific walrus  =====
                      Panda  =====
               Killer whale  =====
                        Dog  =====
           Black flying-fox  =====
           White rhinoceros  =====
                      Horse  =====
                   Squirrel  =====
                  Armadillo  =====
       David's myotis (bat)  =====
              Big brown bat  =====
                   Microbat  =====
            Squirrel monkey  =====
                        Cow  =====

Alignment block 12 of 64 in window, 152019738 - 152020035, 298 bps 
B D                   Human  cttatggtcttatgcctcatattttatgcagtttatccagatagtatttttaaaatctttgacatagttg
B D                   Chimp  cttatggtcttatgcctcatattttatgcagtttatccagatagtatttttaaaatctttgacatagttg
B D                 Gorilla  cttatggtcttatgcctcatattttatgcaatttatccagatagcatttttaaaatctttgacatagttg
B D               Orangutan  cttatggtcttatgcctcatattttatgcaatttatccagatagtatttttaaaatctttgacatagttg
B D                  Gibbon  cttatggtcttatgcctcatattttatgcaatttatccagatagtatttttaaaatctttgacatagttg
B D                  Rhesus  tttatggtcttatgcttcatattttatgcaatttatccagatagtatttttaaaatctttgacatagttg
B D     Crab-eating macaque  tttatggtcttatgcttcatattttatgcaatttatccagatagtatttttaaaatctttgacatagttg
B D                  Baboon  tttatggtcttatgcttcatattttatccaatttatccagatagtattttaaaaatctttgacatagttg
B D            Green monkey  tttatggtcttatgcttcatattttaggcaatttatccagagagtatttttaaaatctttgacatagttg
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ----------------------------------------------------------------------
B D                     Cow  ======================================================================

                      Human  tgcttgaaattctcagtaaaagggaaactgtcagtctcattgtcctaggggccttaccaactctacggaa
                      Chimp  tacttgaaattctcagtaaaagggaaactgtcagtcccattgtcctaggggccttaccaactctacggaa
                    Gorilla  tgcttgaaattctcagtaaaagggaaactgtcagtcccattgtcctaggggccttaccaactctacggaa
                  Orangutan  tgcttgaaattcccagtaaaagggaaaccatcagtcccattgtcctaggggccttaccaactctacggaa
                     Gibbon  tgcttgaaattcccaataaaagggaaactgtcagtctcattgtcctaggggccttaccgactctacggaa
                     Rhesus  tgcttgaaattcccagtaaaagggaaaccatcagtcccatagtcctaggggccttcccgactctacggaa
        Crab-eating macaque  tgcttgaaattcccagtaaaagggaaaccatcagtcccatagtcctaggggccttcccgactctacggaa
                     Baboon  tgcttgaaattcccagtaaaagggaaaccatcagtcccatagtcctaggggccttcccgactctacggaa
               Green monkey  tgcttgaaattcccagtaaaagggaaaccatcggtcccatagtcctaggggccttcccgactctacggaa
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  aatcacttcatggcccagtgcagtgtttacaggagaggctgcaagccttgggaaaatggcccaggattca
                      Chimp  aatcacttcatggcccagtgcagtgtttacaggagaggctgcaaggcttgggaaaatggcccaggattca
                    Gorilla  aatcacttcatggcccagtgcaatgtttacaggagaggctgcaaggcttgggaaaatggcccaggattca
                  Orangutan  aatcacttcatggcccagtgcagtgtttacaggagaggctgcaaggcttgggaaaatggcccaggattca
                     Gibbon  aatcacttcatggcccagtgccgtgtttacaggagaggctgcaaggcttgggaaaatggcccaggattca
                     Rhesus  aatcacttcatggcccagtgcagtgtttacaggagaggctg-aaggcttgggaaagtggcccaggattca
        Crab-eating macaque  aatcacttcatggcccagtgcagtgtttacaggagaggctg-aaggcttgggaaagtggcccaggattca
                     Baboon  aatcacttcatggcccagtgcagtgtttacaggagaggctg-aaggcttgggaaagtggcccaggattca
               Green monkey  aatcacttcatggcccagtgcagtgtttacaggagagactg-aaggcttgggaaagtggcccaggattca
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  gagtcagacctcaggggttgtgaattcggactccacttcgttgtgattgaatcatcttgtcaacttagtt
                      Chimp  gagtcagacctcaggggttgtgaattcggactccacttcgttgtggttgaatcatcttgtcaacttagtt
                    Gorilla  gagtcagacctgaggggttgtgaattcggactccacttcgttgtggttgaatcatcttgtcaacttagtt
                  Orangutan  gagtcagacctcaggggttgtgaattcggactgcacttcactgtggttgaatcatcttgtcaacttagtt
                     Gibbon  gagtcagacctcaggggctgtgaattcggactccacttcgttgtggttgaatcatcttgtcaacttagtt
                     Rhesus  gagtcagacctcaggggctgtgaattctgactccacttcattgtggctgaatcatcttgtcaacttagtt
        Crab-eating macaque  gagtcagacctcaggggctgtgaattctgactccacttcattgtggctgaatcatcttgtcaacttagtt
                     Baboon  gagtcagacctcaggggctgtgaattctgactccacttcattgtggctgaatcatcgtgtcaacttagtt
               Green monkey  gagtcagacctcaggggctgtgaattctgactccacttcattgtggctgaatcatcttgtcaacttagtt
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  ggtgtgcccttgagtttc
                      Chimp  ggtgtgcccttgagtttc
                    Gorilla  ggtgtgcccttgagtttc
                  Orangutan  ggtgtgcccttgagtttc
                     Gibbon  ggtgtgcccttgagtttc
                     Rhesus  ggtgtgcccttgagtttc
        Crab-eating macaque  ggtgtgcccttgagtttc
                     Baboon  ggtgtgcccttgagtttc
               Green monkey  ggtgtgcccttgagtttc
                        Rat  ==================
               Prairie vole  ==================
             Golden hamster  ==================
                      Mouse  ==================
     Lesser Egyptian jerboa  ==================
                       Pika  ------------------
               Weddell seal  ==================
                   Hedgehog  ==================
                      Shrew  ==================
                 Guinea pig  ==================
                        Pig  ==================
                     Rabbit  ==================
                   Aardvark  ==================
                    Dolphin  ==================
         Southern platyfish  ------------------
            Tasmanian devil  ==================
             Naked mole-rat  ==================
                     Lizard  ==================
           Brush-tailed rat  ==================
                 Chinchilla  ==================
        Cape elephant shrew  ==================
         Chinese tree shrew  ==================
                   Platypus  ==================
                    Wallaby  ==================
                    Manatee  ==================
                   Elephant  ==================
            Chinese hamster  ==================
                     Tenrec  ==================
                        Cat  ==================
                   Bushbaby  ==================
                    Ferret   ==================
            Star-nosed mole  ==================
              Domestic goat  ==================
                      Sheep  ==================
           Tibetan antelope  ==================
             Bactrian camel  ==================
                     Alpaca  ==================
             Pacific walrus  ==================
                      Panda  ==================
               Killer whale  ==================
                        Dog  ==================
           Black flying-fox  ==================
           White rhinoceros  ==================
                      Horse  ==================
                   Squirrel  ==================
                  Armadillo  ==================
       David's myotis (bat)  ==================
              Big brown bat  ==================
                   Microbat  ==================
            Squirrel monkey  ==================
                   Marmoset  ------------------
                        Cow  ==================

Alignment block 13 of 64 in window, 152020036 - 152020062, 27 bps 
B D                   Human  tctttcttcatctctaaattttggagg--
B D                   Chimp  tctttcttcatctctaaattttggagg--
B D                 Gorilla  tctttcttcatctctaaattttggagg--
B D               Orangutan  tctttcttcatctctaaattttggagg--
B D                  Gibbon  tctttcttcatctccaaattttggagg--
B D                  Rhesus  tctctcttcatctctaaattttggagg--
B D     Crab-eating macaque  tctctcttcatctctaaattttggagg--
B D                  Baboon  tctctcttcatctctaaattttggagg--
B D            Green monkey  tctctcttcatctctaaattttggagg--
                   Aardvark  tctttacttggctctaaa--agggaagcg
B D                     Rat  =============================
              Prairie vole  =============================
            Golden hamster  =============================
B D                   Mouse  =============================
    Lesser Egyptian jerboa  =============================
B D                    Pika  -----------------------------
              Weddell seal  =============================
B D                Hedgehog  =============================
B D                   Shrew  =============================
B D              Guinea pig  =============================
B D                     Pig  =============================
B D                  Rabbit  =============================
B D                 Dolphin  =============================
        Southern platyfish  -----------------------------
B D         Tasmanian devil  =============================
B D          Naked mole-rat  =============================
B D                  Lizard  =============================
          Brush-tailed rat  =============================
                Chinchilla  =============================
       Cape elephant shrew  =============================
        Chinese tree shrew  =============================
B D                Platypus  =============================
B D                 Wallaby  =============================
B D                 Manatee  =============================
B D                Elephant  =============================
B D         Chinese hamster  =============================
B D                  Tenrec  =============================
B D                     Cat  =============================
B D                Bushbaby  =============================
B D                 Ferret   =============================
           Star-nosed mole  =============================
             Domestic goat  =============================
B D                   Sheep  =============================
          Tibetan antelope  =============================
            Bactrian camel  =============================
B D                  Alpaca  =============================
            Pacific walrus  =============================
B D                   Panda  =============================
              Killer whale  =============================
B D                     Dog  =============================
          Black flying-fox  =============================
B D        White rhinoceros  =============================
B D                   Horse  =============================
B D                Squirrel  =============================
B D               Armadillo  =============================
      David's myotis (bat)  =============================
             Big brown bat  =============================
B D                Microbat  =============================
B D         Squirrel monkey  =============================
B D                Marmoset  -----------------------------
B D                     Cow  =============================

Inserts between block 13 and 14 in window
                  Aardvark 383bp

Alignment block 14 of 64 in window, 152020063 - 152020451, 389 bps 
B D                   Human  attagatgccagaaagttgggagaccaaagagtaaaaatatggaaatccctgcctagagcctggtactgg
B D                   Chimp  attagatgccagaaagtcgggagaccgaagagtaaagatatggaaatccctgcctagagcctggtactgg
B D                 Gorilla  attagatgccagaaagtcgggagaccgaagagtaaagatatggaaatccctgcctagagcctggtactgg
B D               Orangutan  attagatgccagaaagtcgggagaccgaagagtaaagatgtggaaatccctgcctagagcctggtactgg
B D                  Gibbon  ttcagatgccagaaagtcgggagaccgaagattaaagatgtggaaatccctgcctagagcctggtactgg
B D                  Rhesus  atcagatgccagaaagtcgggagaccgaagagtaaagatgtggaaatccctgcctagagccgggtactgg
B D     Crab-eating macaque  atcagatgccagaaagtcgggagaccgaagagtaaagatgtggaaatccctgcctagagccgggtactgg
B D                  Baboon  atcagatgccagaaagtcgggagaccgaagagtaaagatgtggaaatccctgcctagagccgggtactgg
B D            Green monkey  atcagatgccagaaagtcgggagaccgaagagtaaagatgtggaaatccctgcctagagtcggatactgg
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ----------------------------------------------------------------------
B D                     Cow  ======================================================================

                      Human  ggacagttttgtccttgggatggacctgtctcctgccctgtaggcaatgaccacagcagcatgtctagcc
                      Chimp  ggacagttttgtccttgggatggacctgtctcctgccctgtaggcaatgaccgcagcagcatgtctagcc
                    Gorilla  ggacagtttagtccttgggatggacctgtctcctgccctgtaggcaatgaccacagcagcatgtctagcc
                  Orangutan  ggacagttttgtccttgggatggacctgcctcctgtcctgtaggcggtgaccacagcagcatgtctagcc
                     Gibbon  ggacagttttgtccttgggatggacctgcctcctgccctgtaggcagtgaccacagcagcatgtccaacc
                     Rhesus  ggacagttttgtccttgggatggacctgcctcctgccttgtaggcagtgaccacagcagcatgtccagcc
        Crab-eating macaque  ggacagttttgtccttgggatggacctgcctcctgccttgtaggcagtgaccacagcagcatgtccagcc
                     Baboon  ggacagttttgtccttgggatggacctgcctcctgccttgtaggcagtgaccacagcagcatgtccagcc
               Green monkey  ggatagttttgtccttgggatggacctgcctcctgccttgtaggcagtgaccacagcagcatgtccagcc
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  ttccactgaggcaggcgcgtctgtcttttctcagagtatgaagaattcaaagacctcataaaatctatgc
                      Chimp  ttccactgaggcaggcgcgtctgtcttttctcagagtatgaagaattcaaagacctcataaaatctatgc
                    Gorilla  ttccactgaggcaggcatgtctgtcttttctcagagtatgaagaattcaaagacctcataaaatctatgc
                  Orangutan  ttccactgaggcaggcatgtgtgtcttttctcagagtatgaagaattcaaagacctcatgaaatctgtgc
                     Gibbon  ttccactgaggcaggcgtgtctgtcttttctcagagtatgaagaattcaaagacctcataaaatctatgc
                     Rhesus  ttccactgaggcaggcgtgtctgtcttttctcagagtatgaagaatgcaaagacctcatacaatctatgc
        Crab-eating macaque  ttccactgaggcaggcgtgtctgtcttttctcagagtatgaagaatgcaaagacctcatacaatctatgc
                     Baboon  ttccactgaggcaggcgtgtctgtcttttctcagagtatgaagaatgcaaagacctcatacaatctatgc
               Green monkey  tttcactgaggcaggcgtgtctgtcttttctcagagtatgaagaatgcaaagacctcatacaatctatgc
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  tgagggatgagctgcaattcaaggacgagaagcttgcagagcagcttgggcaagctgaggagctcaggtg
                      Chimp  tgagggatgagctgcaattcaaggacgagaagcttgcagagcagctcgggcaagctgaggagctcaggtg
                    Gorilla  tgagggatgagctgcaattcaaggacgagaagcttgcagagcagctcaggcaagctgaggagctcaggtg
                  Orangutan  tgagggatgagctgcagttcacggaggagaagcttgcagagcagcttgggcaagctgaggagctcaggtg
                     Gibbon  tgagggatgagctgcagttcaaggacgagaagcttgcagagcagctcgggcaagctgaggagctcaggtg
                     Rhesus  tgagggatgagctgcaggtcaaggaggagaagcttgtagagcagcttgggcaagctgaggagctcaggtg
        Crab-eating macaque  tgagggatgagctgcaggtcaaggaggagaagcttgtagagcagcttgggcaagctgaggagctcaggtg
                     Baboon  tgagggatgagctgcaggtcatggaggagaagcttgtagagcagcttgggcaagctgaggagctcaggtg
               Green monkey  tgagggatgcgctgcaggtcaaggaggagaagcttgtagagcagcttgggcaagctgaggagctcaggtg
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  aggcggccccgtgggggcaggcaggtgggcaggtatgtgaatctctgaagtacagc-------------a
                      Chimp  agggggccccgtgggggcaggcaggtgggcaggtgtgtgaatctctgaagtacagc-------------a
                    Gorilla  agggggccccgtgggggcaggcaggtgggcaggtgtgtgaatctctgaagtacagc-------------a
                  Orangutan  agggggccccatgggggcaggcaggtgagcaggtgtgtaaatctctgaagtacagc-------------a
                     Gibbon  agggggccccatgggggcaggcaggtgggcaggtgtgtgaatctctgaagtacagc-------------g
                     Rhesus  agggggccccgtgggggcaggcaggtgggcaggtgtgtaaatctctaaagtacagcagctcggcagggaa
        Crab-eating macaque  agggggccccgtgggggcaggcaggtgggcaggtgtgtaaatctctgaagtacagc-------------a
                     Baboon  aggggggcccgtgggggcaggcaggtgggcaggtgtgtaaatctctgaagtacagc-------------a
               Green monkey  agggggccccgtgggggcaggcaggtgggcaggtgtgtaaatctctgaagtatagc-------------a
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  gctcagccgggagaaataagagctaagctgggccaggggaagggcaggaatt
                      Chimp  gctcagcggggagaaataagagctaagctgggccaggggaagggcaggaatt
                    Gorilla  gctcagcggggagaaataagagctaagctgggccaggggaagggcaggaatt
                  Orangutan  gctcggtcgggagaagtaagagctaagctgggccaggggaagggcaggaatt
                     Gibbon  gctcagcggggagaagtaagagctaagctgggccaggggaagggcaggaatt
                     Rhesus  gctcggcggggagaagtaagagctaagctgggccagaggaagggcaggaatt
        Crab-eating macaque  gctcggcggggagaagtaagagctaagctgggccagaggaagggcaggaatt
                     Baboon  gctcggcggggagaagtaagagctaagctgggccagaggaagggcaggaatt
               Green monkey  gctcagcggggagaagtaagagctaagctgggccaggggaagggcaggaatt
                        Rat  ====================================================
               Prairie vole  ====================================================
             Golden hamster  ====================================================
                      Mouse  ====================================================
     Lesser Egyptian jerboa  ====================================================
                       Pika  ----------------------------------------------------
               Weddell seal  ====================================================
                   Hedgehog  ====================================================
                      Shrew  ====================================================
                 Guinea pig  ====================================================
                        Pig  ====================================================
                     Rabbit  ====================================================
                   Aardvark  ====================================================
                    Dolphin  ====================================================
         Southern platyfish  ----------------------------------------------------
            Tasmanian devil  ====================================================
             Naked mole-rat  ====================================================
                     Lizard  ====================================================
           Brush-tailed rat  ====================================================
                 Chinchilla  ====================================================
        Cape elephant shrew  ====================================================
         Chinese tree shrew  ====================================================
                   Platypus  ====================================================
                    Wallaby  ====================================================
                    Manatee  ====================================================
                   Elephant  ====================================================
            Chinese hamster  ====================================================
                     Tenrec  ====================================================
                        Cat  ====================================================
                   Bushbaby  ====================================================
                    Ferret   ====================================================
            Star-nosed mole  ====================================================
              Domestic goat  ====================================================
                      Sheep  ====================================================
           Tibetan antelope  ====================================================
             Bactrian camel  ====================================================
                     Alpaca  ====================================================
             Pacific walrus  ====================================================
                      Panda  ====================================================
               Killer whale  ====================================================
                        Dog  ====================================================
           Black flying-fox  ====================================================
           White rhinoceros  ====================================================
                      Horse  ====================================================
                   Squirrel  ====================================================
                  Armadillo  ====================================================
       David's myotis (bat)  ====================================================
              Big brown bat  ====================================================
                   Microbat  ====================================================
            Squirrel monkey  ====================================================
                   Marmoset  ----------------------------------------------------
                        Cow  ====================================================

Alignment block 15 of 64 in window, 152020452 - 152020470, 19 bps 
B D                   Human  gccatggcaggctcacgac
B D                   Chimp  gccatggcaggctcacgac
B D                 Gorilla  gccatggcaggctcacgac
B D               Orangutan  gccatggcaggctcacgac
B D                  Gibbon  gccacggcaggctcacgac
B D                  Rhesus  gccatggcaggctcacgac
B D     Crab-eating macaque  gccatggcaggctcacgac
B D                  Baboon  gccatggcaggctcacgac
B D            Green monkey  gccatggcaggctcacgac
                   Aardvark  ----aggaaggtacaagac
B D                     Rat  ===================
              Prairie vole  ===================
            Golden hamster  ===================
B D                   Mouse  ===================
    Lesser Egyptian jerboa  ===================
B D                    Pika  -------------------
              Weddell seal  ===================
B D                Hedgehog  ===================
B D                   Shrew  ===================
B D              Guinea pig  ===================
B D                     Pig  ===================
B D                  Rabbit  ===================
B D                 Dolphin  ===================
        Southern platyfish  -------------------
B D         Tasmanian devil  ===================
B D          Naked mole-rat  ===================
B D                  Lizard  ===================
          Brush-tailed rat  ===================
                Chinchilla  ===================
       Cape elephant shrew  ===================
        Chinese tree shrew  ===================
B D                Platypus  ===================
B D                 Wallaby  ===================
B D                 Manatee  ===================
B D                Elephant  ===================
B D         Chinese hamster  ===================
B D                  Tenrec  ===================
B D                     Cat  ===================
B D                Bushbaby  ===================
B D                 Ferret   ===================
           Star-nosed mole  ===================
             Domestic goat  ===================
B D                   Sheep  ===================
          Tibetan antelope  ===================
            Bactrian camel  ===================
B D                  Alpaca  ===================
            Pacific walrus  ===================
B D                   Panda  ===================
              Killer whale  ===================
B D                     Dog  ===================
          Black flying-fox  ===================
B D        White rhinoceros  ===================
B D                   Horse  ===================
B D                Squirrel  ===================
B D               Armadillo  ===================
      David's myotis (bat)  ===================
             Big brown bat  ===================
B D                Microbat  ===================
B D         Squirrel monkey  ===================
B D                Marmoset  -------------------
B D                     Cow  ===================

Inserts between block 15 and 16 in window
                  Aardvark 2190bp

Alignment block 16 of 64 in window, 152020471 - 152020648, 178 bps 
B D                   Human  acccaaatatttatcaaacagagaacaaggataataataagttatgagttgcagttgtttctcagaacct
B D                   Chimp  acccaaatatttatcaaacagagaacaaggataataataagttatgagttgcagttgtttctcagaacct
B D                 Gorilla  acccaaatatttatcaaacagagaacaaggataataataagttatgagttgcagttgtttctcagaacct
B D               Orangutan  acccaaatatttatcaaacagagaacaaggataataataagttatgggttgcagttgtttctcagaacct
B D                  Gibbon  acccaaatatttatcaaacagagaacaaggataataataagttatgggttgcagttgtttctcagagcct
B D                  Rhesus  acacaaatatttat----cagagaac-aggataataataagttatgggttgcagttttttctcagaacct
B D     Crab-eating macaque  acacaaatatttat----cagagaac-aggataataataagttatgggttgcagttttttctcagaacct
B D                  Baboon  acacaaatatttat----cagagaac-aggataataataagttatgggttgcagttttttctcagaatct
B D            Green monkey  acacacatatttat----cagagaac-aggataataataagttatgggttgcagttttttctcagaactt
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ----------------------------------------------------------------------
B D                     Cow  ======================================================================

                      Human  tgttttctctttttcaaacaagtaactgttgaggtgaaacttgcataatgcaaaattaaccaaaggagtg
                      Chimp  tgttttctctttttcaaacaagtaactgttgaggtgaaacttgcataacgcaaaattaaccaaaggagtg
                    Gorilla  tgttttctctttttcaaacaagtaactgttgaggtgaaacttgcataatgcaaaattaaccaaaggagtg
                  Orangutan  tgttttctctttttcaaacaagtaactgttgaggtgaaacttgcataatgcaaaattaaccaaaggagtg
                     Gibbon  tgttttctctttttcaaacaagtaactgttgaggtgaaacttgcataacgcaaaattaaccaaaggagtg
                     Rhesus  tgttttctctttttcaaacaagtaactgttgaggtgaaacttgcataacacgaaattaaccaaaggagtg
        Crab-eating macaque  tgttttctctttttcaaacaagtaactgttgaggtgaaacttgcataacacgaaattaaccaaaggagtg
                     Baboon  tgttttctctttttcaaacaagtaactgttgaggtgaaacttgaataacacgaaattaaccaaaggagtg
               Green monkey  tgttttctctttttcaaacaagtaactgttgaggtgaaacttgcataacacgaaattaaccaaaggagtg
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  gaaaccacccagcagcattcagtatactcaaaatggtg
                      Chimp  ggaaccacccagcagcattcagtatactcaaaatggtg
                    Gorilla  ggaaccatccggcagcattcagtatactcaaaatggtg
                  Orangutan  ggaaccacccagcagcattcagtatactcaaaatggtg
                     Gibbon  ggagccacccagcagcattcagtgtactcaaaatggtg
                     Rhesus  g-aacaacccagcagcattcagtatactcaaaatagtg
        Crab-eating macaque  g-aacaacccagcagcattcagtatactcaaaatagtg
                     Baboon  g-aacaacccagcagcattcagtatactcaaaatggtg
               Green monkey  gtaacaacccagcagcattcagtatactcaaaatggtg
                        Rat  ======================================
               Prairie vole  ======================================
             Golden hamster  ======================================
                      Mouse  ======================================
     Lesser Egyptian jerboa  ======================================
                       Pika  --------------------------------------
               Weddell seal  ======================================
                   Hedgehog  ======================================
                      Shrew  ======================================
                 Guinea pig  ======================================
                        Pig  ======================================
                     Rabbit  ======================================
                   Aardvark  ======================================
                    Dolphin  ======================================
         Southern platyfish  --------------------------------------
            Tasmanian devil  ======================================
             Naked mole-rat  ======================================
                     Lizard  ======================================
           Brush-tailed rat  ======================================
                 Chinchilla  ======================================
        Cape elephant shrew  ======================================
         Chinese tree shrew  ======================================
                   Platypus  ======================================
                    Wallaby  ======================================
                    Manatee  ======================================
                   Elephant  ======================================
            Chinese hamster  ======================================
                     Tenrec  ======================================
                        Cat  ======================================
                   Bushbaby  ======================================
                    Ferret   ======================================
            Star-nosed mole  ======================================
              Domestic goat  ======================================
                      Sheep  ======================================
           Tibetan antelope  ======================================
             Bactrian camel  ======================================
                     Alpaca  ======================================
             Pacific walrus  ======================================
                      Panda  ======================================
               Killer whale  ======================================
                        Dog  ======================================
           Black flying-fox  ======================================
           White rhinoceros  ======================================
                      Horse  ======================================
                   Squirrel  ======================================
                  Armadillo  ======================================
       David's myotis (bat)  ======================================
              Big brown bat  ======================================
                   Microbat  ======================================
            Squirrel monkey  ======================================
                   Marmoset  --------------------------------------
                        Cow  ======================================

Alignment block 17 of 64 in window, 152020649 - 152020677, 29 bps 
B D                   Human  tgccatcatcaccccacttacccttagtc
B D                   Chimp  tgccatcatcaccccacttacccttagtc
B D                 Gorilla  tgccatcatcaccccacttacccttagtc
B D               Orangutan  tgccatcaccaccccacttacccttagtc
B D                  Gibbon  tgccatcaccaccccacttaccgttagtc
B D                  Rhesus  tgccatcaccaccccatttacccttagtc
B D     Crab-eating macaque  tgccatcaccaccccacttacccttagtc
B D                  Baboon  tgccatcaccaccccacttacccttagtc
B D            Green monkey  caccatcaccaccccacttacccttagtc
                   Aardvark  tgcaattgttattcagcttatttgctgtt
B D                     Rat  =============================
              Prairie vole  =============================
            Golden hamster  =============================
B D                   Mouse  =============================
    Lesser Egyptian jerboa  =============================
B D                    Pika  -----------------------------
              Weddell seal  =============================
B D                Hedgehog  =============================
B D                   Shrew  =============================
B D              Guinea pig  =============================
B D                     Pig  =============================
B D                  Rabbit  =============================
B D                 Dolphin  =============================
        Southern platyfish  -----------------------------
B D         Tasmanian devil  =============================
B D          Naked mole-rat  =============================
B D                  Lizard  =============================
          Brush-tailed rat  =============================
                Chinchilla  =============================
       Cape elephant shrew  =============================
        Chinese tree shrew  =============================
B D                Platypus  =============================
B D                 Wallaby  =============================
B D                 Manatee  =============================
B D                Elephant  =============================
B D         Chinese hamster  =============================
B D                  Tenrec  =============================
B D                     Cat  =============================
B D                Bushbaby  =============================
B D                 Ferret   =============================
           Star-nosed mole  =============================
             Domestic goat  =============================
B D                   Sheep  =============================
          Tibetan antelope  =============================
            Bactrian camel  =============================
B D                  Alpaca  =============================
            Pacific walrus  =============================
B D                   Panda  =============================
              Killer whale  =============================
B D                     Dog  =============================
          Black flying-fox  =============================
B D        White rhinoceros  =============================
B D                   Horse  =============================
B D                Squirrel  =============================
B D               Armadillo  =============================
      David's myotis (bat)  =============================
             Big brown bat  =============================
B D                Microbat  =============================
B D         Squirrel monkey  =============================
B D                Marmoset  -----------------------------
B D                     Cow  =============================

Inserts between block 17 and 18 in window
                  Aardvark 27bp

Alignment block 18 of 64 in window, 152020678 - 152020683, 6 bps 
B D                   Human  agaatc
B D                   Chimp  agaatc
B D                 Gorilla  agaatc
B D               Orangutan  agaatc
B D                  Gibbon  agaatc
B D                  Rhesus  acaatt
B D     Crab-eating macaque  acaatt
B D                  Baboon  acaatt
B D            Green monkey  acaatt
B D                     Rat  ======
              Prairie vole  ======
            Golden hamster  ======
B D                   Mouse  ======
    Lesser Egyptian jerboa  ======
B D                    Pika  ------
              Weddell seal  ======
B D                Hedgehog  ======
B D                   Shrew  ======
B D              Guinea pig  ======
B D                     Pig  ======
B D                  Rabbit  ======
                  Aardvark  ======
B D                 Dolphin  ======
        Southern platyfish  ------
B D         Tasmanian devil  ======
B D          Naked mole-rat  ======
B D                  Lizard  ======
          Brush-tailed rat  ======
                Chinchilla  ======
       Cape elephant shrew  ======
        Chinese tree shrew  ======
B D                Platypus  ======
B D                 Wallaby  ======
B D                 Manatee  ======
B D                Elephant  ======
B D         Chinese hamster  ======
B D                  Tenrec  ======
B D                     Cat  ======
B D                Bushbaby  ======
B D                 Ferret   ======
           Star-nosed mole  ======
             Domestic goat  ======
B D                   Sheep  ======
          Tibetan antelope  ======
            Bactrian camel  ======
B D                  Alpaca  ======
            Pacific walrus  ======
B D                   Panda  ======
              Killer whale  ======
B D                     Dog  ======
          Black flying-fox  ======
B D        White rhinoceros  ======
B D                   Horse  ======
B D                Squirrel  ======
B D               Armadillo  ======
      David's myotis (bat)  ======
             Big brown bat  ======
B D                Microbat  ======
B D         Squirrel monkey  ======
B D                Marmoset  ------
B D                     Cow  ======

Inserts between block 18 and 19 in window
B D                 Rhesus 10205bp

Alignment block 19 of 64 in window, 152020684 - 152020703, 20 bps 
B D                   Human  acctcctgacggactgcggc
B D                   Chimp  acctcctgacggactgcggc
B D                 Gorilla  acctcctgacagactgcggc
B D               Orangutan  acctcctgacggactgtggc
B D                  Gibbon  acctcctgacggactgcggc
B D                  Rhesus  acctcctgactgactgcggc
B D     Crab-eating macaque  acctcctgactgactgcggc
B D                  Baboon  acctcctgactgactgcggc
B D            Green monkey  accacctgactgactgcggc
B D                     Rat  ====================
              Prairie vole  ====================
            Golden hamster  ====================
B D                   Mouse  ====================
    Lesser Egyptian jerboa  ====================
B D                    Pika  --------------------
              Weddell seal  ====================
B D                Hedgehog  ====================
B D                   Shrew  ====================
B D              Guinea pig  ====================
B D                     Pig  ====================
B D                  Rabbit  ====================
                  Aardvark  ====================
B D                 Dolphin  ====================
        Southern platyfish  --------------------
B D         Tasmanian devil  ====================
B D          Naked mole-rat  ====================
B D                  Lizard  ====================
          Brush-tailed rat  ====================
                Chinchilla  ====================
       Cape elephant shrew  ====================
        Chinese tree shrew  ====================
B D                Platypus  ====================
B D                 Wallaby  ====================
B D                 Manatee  ====================
B D                Elephant  ====================
B D         Chinese hamster  ====================
B D                  Tenrec  ====================
B D                     Cat  ====================
B D                Bushbaby  ====================
B D                 Ferret   ====================
           Star-nosed mole  ====================
             Domestic goat  ====================
B D                   Sheep  ====================
          Tibetan antelope  ====================
            Bactrian camel  ====================
B D                  Alpaca  ====================
            Pacific walrus  ====================
B D                   Panda  ====================
              Killer whale  ====================
B D                     Dog  ====================
          Black flying-fox  ====================
B D        White rhinoceros  ====================
B D                   Horse  ====================
B D                Squirrel  ====================
B D               Armadillo  ====================
      David's myotis (bat)  ====================
             Big brown bat  ====================
B D                Microbat  ====================
B D         Squirrel monkey  ====================
B D                Marmoset  --------------------
B D                     Cow  ====================

Alignment block 20 of 64 in window, 152020704 - 152020705, 2 bps 
B D                   Human  tt-
B D                   Chimp  tt-
B D                 Gorilla  tt-
B D               Orangutan  tt-
B D                  Gibbon  tt-
B D                  Rhesus  gt-
B D     Crab-eating macaque  gt-
B D                  Baboon  gt-
B D            Green monkey  gt-
                   Aardvark  -tg
B D                     Rat  ===
              Prairie vole  ===
            Golden hamster  ===
B D                   Mouse  ===
    Lesser Egyptian jerboa  ===
B D                    Pika  ---
              Weddell seal  ===
B D                Hedgehog  ===
B D                   Shrew  ===
B D              Guinea pig  ===
B D                     Pig  ===
B D                  Rabbit  ===
B D                 Dolphin  ===
        Southern platyfish  ---
B D         Tasmanian devil  ===
B D          Naked mole-rat  ===
B D                  Lizard  ===
          Brush-tailed rat  ===
                Chinchilla  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Wallaby  ===
B D                 Manatee  ===
B D                Elephant  ===
B D         Chinese hamster  ===
B D                  Tenrec  ===
B D                     Cat  ===
B D                Bushbaby  ===
B D                 Ferret   ===
           Star-nosed mole  ===
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
            Bactrian camel  ===
B D                  Alpaca  ===
            Pacific walrus  ===
B D                   Panda  ===
              Killer whale  ===
B D                     Dog  ===
          Black flying-fox  ===
B D        White rhinoceros  ===
B D                   Horse  ===
B D                Squirrel  ===
B D               Armadillo  ===
      David's myotis (bat)  ===
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ===
B D                Marmoset  ---
B D                     Cow  ===

Inserts between block 20 and 21 in window
                  Aardvark 5bp

Alignment block 21 of 64 in window, 152020706 - 152020710, 5 bps 
B D                   Human  ctcat
B D                   Chimp  ctcat
B D                 Gorilla  ctcat
B D               Orangutan  ctcat
B D                  Gibbon  ctcat
B D                  Rhesus  ctcat
B D     Crab-eating macaque  ctcat
B D                  Baboon  ctcat
B D            Green monkey  ctcat
B D                     Rat  =====
              Prairie vole  =====
            Golden hamster  =====
B D                   Mouse  =====
    Lesser Egyptian jerboa  =====
B D                    Pika  -----
              Weddell seal  =====
B D                Hedgehog  =====
B D                   Shrew  =====
B D              Guinea pig  =====
B D                     Pig  =====
B D                  Rabbit  =====
                  Aardvark  =====
B D                 Dolphin  =====
        Southern platyfish  -----
B D         Tasmanian devil  =====
B D          Naked mole-rat  =====
B D                  Lizard  =====
          Brush-tailed rat  =====
                Chinchilla  =====
       Cape elephant shrew  =====
        Chinese tree shrew  =====
B D                Platypus  =====
B D                 Wallaby  =====
B D                 Manatee  =====
B D                Elephant  =====
B D         Chinese hamster  =====
B D                  Tenrec  =====
B D                     Cat  =====
B D                Bushbaby  =====
B D                 Ferret   =====
           Star-nosed mole  =====
             Domestic goat  =====
B D                   Sheep  =====
          Tibetan antelope  =====
            Bactrian camel  =====
B D                  Alpaca  =====
            Pacific walrus  =====
B D                   Panda  =====
              Killer whale  =====
B D                     Dog  =====
          Black flying-fox  =====
B D        White rhinoceros  =====
B D                   Horse  =====
B D                Squirrel  =====
B D               Armadillo  =====
      David's myotis (bat)  =====
             Big brown bat  =====
B D                Microbat  =====
B D         Squirrel monkey  =====
B D                Marmoset  -----
B D                     Cow  =====

Alignment block 22 of 64 in window, 152020711 - 152020711, 1 bps 
B D                   Human  -t
B D                   Chimp  -t
B D                 Gorilla  -t
B D               Orangutan  -t
B D                  Gibbon  -t
B D                  Rhesus  -t
B D     Crab-eating macaque  -t
B D                  Baboon  -t
B D            Green monkey  -t
                   Aardvark  g-
B D                     Rat  ==
              Prairie vole  ==
            Golden hamster  ==
B D                   Mouse  ==
    Lesser Egyptian jerboa  ==
B D                    Pika  --
              Weddell seal  ==
B D                Hedgehog  ==
B D                   Shrew  ==
B D              Guinea pig  ==
B D                     Pig  ==
B D                  Rabbit  ==
B D                 Dolphin  ==
        Southern platyfish  --
B D         Tasmanian devil  ==
B D          Naked mole-rat  ==
B D                  Lizard  ==
          Brush-tailed rat  ==
                Chinchilla  ==
       Cape elephant shrew  ==
        Chinese tree shrew  ==
B D                Platypus  ==
B D                 Wallaby  ==
B D                 Manatee  ==
B D                Elephant  ==
B D         Chinese hamster  ==
B D                  Tenrec  ==
B D                     Cat  ==
B D                Bushbaby  ==
B D                 Ferret   ==
           Star-nosed mole  ==
             Domestic goat  ==
B D                   Sheep  ==
          Tibetan antelope  ==
            Bactrian camel  ==
B D                  Alpaca  ==
            Pacific walrus  ==
B D                   Panda  ==
              Killer whale  ==
B D                     Dog  ==
          Black flying-fox  ==
B D        White rhinoceros  ==
B D                   Horse  ==
B D                Squirrel  ==
B D               Armadillo  ==
      David's myotis (bat)  ==
             Big brown bat  ==
B D                Microbat  ==
B D         Squirrel monkey  ==
B D                Marmoset  --
B D                     Cow  ==

Inserts between block 22 and 23 in window
                  Aardvark 12bp

Alignment block 23 of 64 in window, 152020712 - 152020723, 12 bps 
B D                   Human  ctttcactcaat
B D                   Chimp  ctttcactcaat
B D                 Gorilla  ctttcactcaat
B D               Orangutan  ctttcactcaat
B D                  Gibbon  ctttcactcaat
B D                  Rhesus  ctttcactcaat
B D     Crab-eating macaque  ctttcactcaat
B D                  Baboon  ctttcactcaat
B D            Green monkey  ctttcactcaat
B D                     Rat  ============
              Prairie vole  ============
            Golden hamster  ============
B D                   Mouse  ============
    Lesser Egyptian jerboa  ============
B D                    Pika  ------------
              Weddell seal  ============
B D                Hedgehog  ============
B D                   Shrew  ============
B D              Guinea pig  ============
B D                     Pig  ============
B D                  Rabbit  ============
                  Aardvark  ============
B D                 Dolphin  ============
        Southern platyfish  ------------
B D         Tasmanian devil  ============
B D          Naked mole-rat  ============
B D                  Lizard  ============
          Brush-tailed rat  ============
                Chinchilla  ============
       Cape elephant shrew  ============
        Chinese tree shrew  ============
B D                Platypus  ============
B D                 Wallaby  ============
B D                 Manatee  ============
B D                Elephant  ============
B D         Chinese hamster  ============
B D                  Tenrec  ============
B D                     Cat  ============
B D                Bushbaby  ============
B D                 Ferret   ============
           Star-nosed mole  ============
             Domestic goat  ============
B D                   Sheep  ============
          Tibetan antelope  ============
            Bactrian camel  ============
B D                  Alpaca  ============
            Pacific walrus  ============
B D                   Panda  ============
              Killer whale  ============
B D                     Dog  ============
          Black flying-fox  ============
B D        White rhinoceros  ============
B D                   Horse  ============
B D                Squirrel  ============
B D               Armadillo  ============
      David's myotis (bat)  ============
             Big brown bat  ============
B D                Microbat  ============
B D         Squirrel monkey  ============
B D                Marmoset  ------------
B D                     Cow  ============

Alignment block 24 of 64 in window, 152020724 - 152020724, 1 bps 
B D                   Human  -c
B D                   Chimp  -c
B D                 Gorilla  -c
B D               Orangutan  -c
B D                  Gibbon  -c
B D                  Rhesus  -c
B D     Crab-eating macaque  -c
B D                  Baboon  -c
B D            Green monkey  -c
                   Aardvark  a-
B D                     Rat  ==
              Prairie vole  ==
            Golden hamster  ==
B D                   Mouse  ==
    Lesser Egyptian jerboa  ==
B D                    Pika  --
              Weddell seal  ==
B D                Hedgehog  ==
B D                   Shrew  ==
B D              Guinea pig  ==
B D                     Pig  ==
B D                  Rabbit  ==
B D                 Dolphin  ==
        Southern platyfish  --
B D         Tasmanian devil  ==
B D          Naked mole-rat  ==
B D                  Lizard  ==
          Brush-tailed rat  ==
                Chinchilla  ==
       Cape elephant shrew  ==
        Chinese tree shrew  ==
B D                Platypus  ==
B D                 Wallaby  ==
B D                 Manatee  ==
B D                Elephant  ==
B D         Chinese hamster  ==
B D                  Tenrec  ==
B D                     Cat  ==
B D                Bushbaby  ==
B D                 Ferret   ==
           Star-nosed mole  ==
             Domestic goat  ==
B D                   Sheep  ==
          Tibetan antelope  ==
            Bactrian camel  ==
B D                  Alpaca  ==
            Pacific walrus  ==
B D                   Panda  ==
              Killer whale  ==
B D                     Dog  ==
          Black flying-fox  ==
B D        White rhinoceros  ==
B D                   Horse  ==
B D                Squirrel  ==
B D               Armadillo  ==
      David's myotis (bat)  ==
             Big brown bat  ==
B D                Microbat  ==
B D         Squirrel monkey  ==
B D                Marmoset  --
B D                     Cow  ==

Inserts between block 24 and 25 in window
                  Aardvark 493bp

Alignment block 25 of 64 in window, 152020725 - 152021001, 277 bps 
B D                   Human  agtgttgccttctcgaccctgtcattcttttcttctttcgtcttttcaatttg------ccccatctgca
B D                   Chimp  agtgttgccttctcgaccctgtcattcttttcttctttcgtcttttcaatttg------ccccatctgca
B D                 Gorilla  agtgttgccttcttgaccctgtcattcttttcttctttcatcttttcaattta------ccccatctgca
B D               Orangutan  agtgttgccttctcgaccctgtcattcttttcttctttcgtcttttcaatttg------ccccatctgca
B D                  Gibbon  agtgttgccttctcgaccctgtcattcttttcttctttcgtcttttcaattcg------ccccatctgca
B D                  Rhesus  agtgttgccttcttgaccctgtcattcttttcttcttttgtcttttcaatttg------ccccatctgca
B D     Crab-eating macaque  aatgttgccttcttgaccctgtcattcttttcttcttttgtcttttcaatttg------ccccatctgca
B D                  Baboon  aatgttgccttctcgaccctgtcattcttttcttcttttgtcttttcaatttg------ccccatctgca
B D            Green monkey  aatgttgccttctcgaccctgtcattcttttcttcttttgtcttttcaatttgccccatccccatctgca
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ----------------------------------------------------------------------
B D                     Cow  ======================================================================

                      Human  cctagcctcatttctgtacctggctttgtatctagtcaccacaaaataccttatgtgtattttcacatgg
                      Chimp  cctagcctcatttctgtacctggctttgtatctagtcaccacaaaatacactatgtgtattttcacatgg
                    Gorilla  cctagcctcatttctgtaccaggctttgtatctagtcaccacaaaatacactatgtgtattttcacatgg
                  Orangutan  cctagcctcatttctgtacgtggctttgtatctagtcaccacaaaatacactgtgtgtattttcacatgg
                     Gibbon  cctagcctcatttctgtacatggctttgtatccagtcactacaaaatacactatgtgtattttcacatgg
                     Rhesus  cccggcctcatttctgtacatggctttgtatctaatcgccgcaagatgcactatgtgtattttcacatgg
        Crab-eating macaque  cccggcctcatttctgtacatggctttgtatctaatcgccgcaagatgcactatgtgtattttcacatgg
                     Baboon  cccggcctcatttctgtacatggctttgtatctaatcgccgcaagatgcactatgtgtattttcacatgg
               Green monkey  ccgggcctcatttctgtacatggctttgtatctaatcgccacaagatgcactatgtgtattttcacatgg
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  ----aaatgtcgatggccaaagtgaggaattgaaaggatgtctttttgaaactgatttagaaagacctac
                      Chimp  ----aaatgtcgatggccaaagtgaggaattgaaaggatgtctttttgaaactgatttagaaagacctac
                    Gorilla  ----aaatgtcgatggccaaagtgaggaattgaaaggatgtctttttgaaactgatttagaaagacctac
                  Orangutan  ----aaatgttgatggccaaagtgaggaattgaaaggatgtctttttgaaactgatttagaaagacctac
                     Gibbon  ----aaatgtcgatggccaaagtgaggaactgaaaggatgtctttttgaaactgatttagaaagacctac
                     Rhesus  aaataaatgtccgtggccagggtgaggaactgaaaggatgtctttttgaaactgatttagaaagacctac
        Crab-eating macaque  aaataaatgtccgtggccagggtgaggaactgaaaggatgtctttttgaaactgatttagaaagacctac
                     Baboon  aaataaatgtccgtggccagggtgaggaactgaaaggatgtctttttgaaactgatttagaaagacctac
               Green monkey  ----aaatgtctgtggccagggtgaggaactgaaaggatgtctttttgaaactgatttagaaagacctac
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  ttttgtttacagaagagaaatatgaatgcaacattgtcgaggatatttcagttgcactctctgatataga
                      Chimp  ttttgtttacagaagagaaatatgaatgcaacattgtcgaggatatttcagttgcactctctgatataga
                    Gorilla  ttttgtttacagaagagaaatatgaatgcaacattgtcgaggatatttcagttgcactctctgatataga
                  Orangutan  ttttgtttacagaagagaaatatgaatgcaacattgtcgaggatatttcagttgcactctctgatataga
                     Gibbon  gtttgtttacagaagagaaatatgaatgcaacattgtcgaggatatttcagttgcactctctgatataga
                     Rhesus  ttttgtttacaaaagagaaagatgaatgcagcattgttgaggatctttcagttgcactctctgatataga
        Crab-eating macaque  ttttgtttacaaaagagaaagatgaatgcagcattgtcgaggatctttcagttgcactctctgatataga
                     Baboon  ttttgtttacaaaagagaaagatgaatgcagcattgtcgaggatctttcagttgcactctctgatataga
               Green monkey  ttttgtttacaaaagagaaagatgaacgcaacattgtcgaggatctttcagttgcactctctgatataga
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  ggaagcc
                      Chimp  ggaagcc
                    Gorilla  ggaagcc
                  Orangutan  ggaagcc
                     Gibbon  ggaagcc
                     Rhesus  ggaaacc
        Crab-eating macaque  ggaaacc
                     Baboon  ggaaacc
               Green monkey  ggaagcc
                        Rat  =======
               Prairie vole  =======
             Golden hamster  =======
                      Mouse  =======
     Lesser Egyptian jerboa  =======
                       Pika  -------
               Weddell seal  =======
                   Hedgehog  =======
                      Shrew  =======
                 Guinea pig  =======
                        Pig  =======
                     Rabbit  =======
                   Aardvark  =======
                    Dolphin  =======
         Southern platyfish  -------
            Tasmanian devil  =======
             Naked mole-rat  =======
                     Lizard  =======
           Brush-tailed rat  =======
                 Chinchilla  =======
        Cape elephant shrew  =======
         Chinese tree shrew  =======
                   Platypus  =======
                    Wallaby  =======
                    Manatee  =======
                   Elephant  =======
            Chinese hamster  =======
                     Tenrec  =======
                        Cat  =======
                   Bushbaby  =======
                    Ferret   =======
            Star-nosed mole  =======
              Domestic goat  =======
                      Sheep  =======
           Tibetan antelope  =======
             Bactrian camel  =======
                     Alpaca  =======
             Pacific walrus  =======
                      Panda  =======
               Killer whale  =======
                        Dog  =======
           Black flying-fox  =======
           White rhinoceros  =======
                      Horse  =======
                   Squirrel  =======
                  Armadillo  =======
       David's myotis (bat)  =======
              Big brown bat  =======
                   Microbat  =======
            Squirrel monkey  =======
                   Marmoset  -------
                        Cow  =======

Alignment block 26 of 64 in window, 152021002 - 152021066, 65 bps 
B D                   Human  tgtaaaaaaaattc---tttttgtcttggccacaggcatttccccaaacatgtgctgaccttctgctt
B D                   Chimp  tgtaaaaaaaattc---tttttgtcttggccacaggcatttccccaaacatgtgctgaccttctgctt
B D                 Gorilla  tgtaaaaaaaattc---tttttgtcttggccacaggcatttccccaaacatgtgctgaccttctgctt
B D               Orangutan  tgt-aaaaaatttc---tttttgtcttggccacaggcatttccccaaacatgtgctgaccttctgctt
B D                  Gibbon  tgtaaaaaaatttc---tttttgtcttggccacaggcatttccccaaacatgtgctgaccttctgctt
B D                  Rhesus  tgt-aaaaaa--tt---tttttctcttggtcacaggcatttccccaaacatgtgttgaccttctgctt
B D     Crab-eating macaque  tgtaaaaaaa--tt---tttttctcttggtcacaggcatttccccaaacatgtgttgaccttctgctt
B D                  Baboon  tgtaaaaaaa--tt---tttttctcttggtcacaggcatttccccaaacatgtgttgaccttctgctt
B D            Green monkey  tgtaaaaaat--ta---tttttctcttggccacaggcatttccccaaacatgtgttgaccttctgctt
  D         Green seaturtle  tgtaaaccattttctattctttctcttggccacagacattcctttaaaaatgtgctgaccttctgctt
B D                     Rat  ====================================================================
              Prairie vole  ====================================================================
            Golden hamster  ====================================================================
B D                   Mouse  ====================================================================
    Lesser Egyptian jerboa  ====================================================================
B D                    Pika  --------------------------------------------------------------------
              Weddell seal  ====================================================================
B D                Hedgehog  ====================================================================
B D                   Shrew  ====================================================================
B D              Guinea pig  ====================================================================
B D                     Pig  ====================================================================
B D                  Rabbit  ====================================================================
                  Aardvark  ====================================================================
B D                 Dolphin  ====================================================================
        Southern platyfish  --------------------------------------------------------------------
B D         Tasmanian devil  ====================================================================
B D          Naked mole-rat  ====================================================================
B D                  Lizard  ====================================================================
          Brush-tailed rat  ====================================================================
                Chinchilla  ====================================================================
       Cape elephant shrew  ====================================================================
        Chinese tree shrew  ====================================================================
B D                Platypus  ====================================================================
B D                 Wallaby  ====================================================================
B D                 Manatee  ====================================================================
B D                Elephant  ====================================================================
B D         Chinese hamster  ====================================================================
B D                  Tenrec  ====================================================================
B D                     Cat  ====================================================================
B D                Bushbaby  ====================================================================
B D                 Ferret   ====================================================================
           Star-nosed mole  ====================================================================
             Domestic goat  ====================================================================
B D                   Sheep  ====================================================================
          Tibetan antelope  ====================================================================
            Bactrian camel  ====================================================================
B D                  Alpaca  ====================================================================
            Pacific walrus  ====================================================================
B D                   Panda  ====================================================================
              Killer whale  ====================================================================
B D                     Dog  ====================================================================
          Black flying-fox  ====================================================================
B D        White rhinoceros  ====================================================================
B D                   Horse  ====================================================================
B D                Squirrel  ====================================================================
B D               Armadillo  ====================================================================
      David's myotis (bat)  ====================================================================
             Big brown bat  ====================================================================
B D                Microbat  ====================================================================
B D         Squirrel monkey  ====================================================================
B D                Marmoset  --------------------------------------------------------------------
B D                     Cow  ====================================================================

Alignment block 27 of 64 in window, 152021067 - 152021084, 18 bps 
B D                   Human  ggaggtctccttgaggac
B D                   Chimp  ggaggtctccttgaggac
B D                 Gorilla  ggaggtctccttgaggac
B D               Orangutan  ggaggtctccttggggac
B D                  Gibbon  ggaggtctccttggggac
B D                  Rhesus  ggaggtctccttgaggac
B D     Crab-eating macaque  ggaggtctccttgaggac
B D                  Baboon  ggaggtctccttagggac
B D            Green monkey  ggaggtctccttgaggac
B D                 Wallaby  ggggatctccatgggatc
  D         Green seaturtle  cgaggtctccttgaggac
B D                     Rat  ==================
              Prairie vole  ==================
            Golden hamster  ==================
B D                   Mouse  ==================
    Lesser Egyptian jerboa  ==================
B D                    Pika  ------------------
              Weddell seal  ==================
B D                Hedgehog  ==================
B D                   Shrew  ==================
B D              Guinea pig  ==================
B D                     Pig  ==================
B D                  Rabbit  ==================
                  Aardvark  ==================
B D                 Dolphin  ==================
        Southern platyfish  ------------------
B D         Tasmanian devil  ==================
B D          Naked mole-rat  ==================
B D                  Lizard  ==================
          Brush-tailed rat  ==================
                Chinchilla  ==================
       Cape elephant shrew  ==================
        Chinese tree shrew  ==================
B D                Platypus  ==================
B D                 Manatee  ==================
B D                Elephant  ==================
B D         Chinese hamster  ==================
B D                  Tenrec  ==================
B D                     Cat  ==================
B D                Bushbaby  ==================
B D                 Ferret   ==================
           Star-nosed mole  ==================
             Domestic goat  ==================
B D                   Sheep  ==================
          Tibetan antelope  ==================
            Bactrian camel  ==================
B D                  Alpaca  ==================
            Pacific walrus  ==================
B D                   Panda  ==================
              Killer whale  ==================
B D                     Dog  ==================
          Black flying-fox  ==================
B D        White rhinoceros  ==================
B D                   Horse  ==================
B D                Squirrel  ==================
B D               Armadillo  ==================
      David's myotis (bat)  ==================
             Big brown bat  ==================
B D                Microbat  ==================
B D         Squirrel monkey  ==================
B D                Marmoset  ------------------
B D                     Cow  ==================

Inserts between block 27 and 28 in window
B D                Wallaby 6bp

Alignment block 28 of 64 in window, 152021085 - 152021138, 54 bps 
B D                   Human  attgtct--cagagatctctgttgcaatattagaactgatcactcatccctttcca
B D                   Chimp  attgtct--cagagatctctgttgcaatattagaactgatcactcatccctttcca
B D                 Gorilla  attgtct--cagagatctctgttgcaatattagaactgatcactcatccctttcca
B D               Orangutan  attgtct--cagagatctctgttgcagtattagaactgatcactcatccctttcca
B D                  Gibbon  attgtct--cagagatctctgttgcagtattagaactgatcactcatccttttcca
B D                  Rhesus  attgtct--cagaaatctctgttgcagtattagaactgatcactcatccctttcca
B D     Crab-eating macaque  attgtct--cagaaatctctgttgcagtattagaactgatcactcatccctttcca
B D                  Baboon  attgtct--cagaaatctctgttgtagtattagaactgatcactcatccctttcca
B D            Green monkey  attgtct--cagaaatctctgttgcagtattagaactgatcactcatccctttcca
B D                 Opossum  atggtcttccagagtccctagaaatagca-aaaagc----------tctcttttca
B D                 Wallaby  actgtctcccagagttcctagaaataacatacaacc----------tcccttttta
  D         Green seaturtle  attgtct--cagaaatctctgttgcaatatttgagcggatcactcaaccctttcca
B D                     Rat  ========================================================
              Prairie vole  ========================================================
            Golden hamster  ========================================================
B D                   Mouse  ========================================================
    Lesser Egyptian jerboa  ========================================================
B D                    Pika  --------------------------------------------------------
              Weddell seal  ========================================================
B D                Hedgehog  ========================================================
B D                   Shrew  ========================================================
B D              Guinea pig  ========================================================
B D                     Pig  ========================================================
B D                  Rabbit  ========================================================
                  Aardvark  ========================================================
B D                 Dolphin  ========================================================
        Southern platyfish  --------------------------------------------------------
B D         Tasmanian devil  ========================================================
B D          Naked mole-rat  ========================================================
B D                  Lizard  ========================================================
          Brush-tailed rat  ========================================================
                Chinchilla  ========================================================
       Cape elephant shrew  ========================================================
        Chinese tree shrew  ========================================================
B D                Platypus  ========================================================
B D                 Manatee  ========================================================
B D                Elephant  ========================================================
B D         Chinese hamster  ========================================================
B D                  Tenrec  ========================================================
B D                     Cat  ========================================================
B D                Bushbaby  ========================================================
B D                 Ferret   ========================================================
           Star-nosed mole  ========================================================
             Domestic goat  ========================================================
B D                   Sheep  ========================================================
          Tibetan antelope  ========================================================
            Bactrian camel  ========================================================
B D                  Alpaca  ========================================================
            Pacific walrus  ========================================================
B D                   Panda  ========================================================
              Killer whale  ========================================================
B D                     Dog  ========================================================
          Black flying-fox  ========================================================
B D        White rhinoceros  ========================================================
B D                   Horse  ========================================================
B D                Squirrel  ========================================================
B D               Armadillo  ========================================================
      David's myotis (bat)  ========================================================
             Big brown bat  ========================================================
B D                Microbat  ========================================================
B D         Squirrel monkey  ========================================================
B D                Marmoset  --------------------------------------------------------
B D                     Cow  ========================================================

Inserts between block 28 and 29 in window
B D                Opossum 6bp
B D                Wallaby 6bp

Alignment block 29 of 64 in window, 152021139 - 152021150, 12 bps 
B D                   Human  ttattaaatttt
B D                   Chimp  ttattaaatttt
B D                 Gorilla  ttattaaatttt
B D               Orangutan  ttatcaaatttt
B D                  Gibbon  ttattaaatttt
B D                  Rhesus  ctactaaatttt
B D     Crab-eating macaque  ctactaaatttt
B D                  Baboon  ctactaaatttt
B D            Green monkey  ctactaaatttt
B D                 Opossum  -ttctccattct
B D         Tasmanian devil  -ttcttcgttct
B D                 Wallaby  -ttctttattct
  D         Green seaturtle  ctcttaaatttt
B D                     Rat  ============
              Prairie vole  ============
            Golden hamster  ============
B D                   Mouse  ============
    Lesser Egyptian jerboa  ============
B D                    Pika  ------------
              Weddell seal  ============
B D                Hedgehog  ============
B D                   Shrew  ============
B D              Guinea pig  ============
B D                     Pig  ============
B D                  Rabbit  ============
                  Aardvark  ============
B D                 Dolphin  ============
        Southern platyfish  ------------
B D          Naked mole-rat  ============
B D                  Lizard  ============
          Brush-tailed rat  ============
                Chinchilla  ============
       Cape elephant shrew  ============
        Chinese tree shrew  ============
B D                Platypus  ============
B D                 Manatee  ============
B D                Elephant  ============
B D         Chinese hamster  ============
B D                  Tenrec  ============
B D                     Cat  ============
B D                Bushbaby  ============
B D                 Ferret   ============
           Star-nosed mole  ============
             Domestic goat  ============
B D                   Sheep  ============
          Tibetan antelope  ============
            Bactrian camel  ============
B D                  Alpaca  ============
            Pacific walrus  ============
B D                   Panda  ============
              Killer whale  ============
B D                     Dog  ============
          Black flying-fox  ============
B D        White rhinoceros  ============
B D                   Horse  ============
B D                Squirrel  ============
B D               Armadillo  ============
      David's myotis (bat)  ============
             Big brown bat  ============
B D                Microbat  ============
B D         Squirrel monkey  ============
B D                Marmoset  ------------
B D                     Cow  ============

Alignment block 30 of 64 in window, 152021151 - 152021274, 124 bps 
B D                   Human  ctctactgtctca----ccttaggcaatataaagtcctagttcactctcaggcacgagagctggcctggt
B D                   Chimp  ctctactgtctca----ccttaggcaatataaagtcctagttcactctcaggcacgagagctggcccggt
B D                 Gorilla  ctctactgtctca----ccttaggcaatataaagtcctagttcactctcaggcatgagagctggcccggt
B D               Orangutan  ctctactgtctca----ccttaggccatataaagtcctggttcactctcaggcacgagagctggcccggt
B D                  Gibbon  ctctactgtctca----ccttaggcaatataaggtcctagttcactctcaggcacgagagctggcccggt
B D                  Rhesus  ctctactgtgtta----ccttaggcaatataaagtcctggttcactctcagtcacgagagctggcccggt
B D     Crab-eating macaque  ctctactgtgtca----ccttaggcaatataaagtcctggttcactctcagtcacgagagctggcccggt
B D                  Baboon  ctctactgtgtca----ccttaggcaatataaagtcctggttcactctcagtcacgagagctggcccggt
B D            Green monkey  ctctacggtgtca----ccttaggcaatataaagtcctggttcactctcagtcacgagagctggcccggt
B D                 Opossum  -ccatcccctgca----catcaggaaatacgactccttgatccaggctcaggcccgagagctgtcacacc
B D         Tasmanian devil  cccatcccttgca----catcagaaaatacgactccttgatccaggctcaggcccgagagctgtcccatc
B D                 Wallaby  tccatcccttgca----catcaggaaatatgacttcttgatccaggctcaggcccgagagctgtcccatc
B D              Budgerigar  cccttcttgctcatccctcctaggaagtacaattcgttgatccaagcgcaggctcgggagctctcccacc
  D         Green seaturtle  ctctaccgtctca----ccttaggcaatataaagtcctggttcactctcaggaacgagagctgacccagt
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ----------------------------------------------------------------------
B D                     Cow  ======================================================================

                      Human  taaggaagagattacaggaagggagagatgcctcccgctcattgaatcagcatctcc-------------
                      Chimp  taaggaagagattacaggaagggagagatgcctcccgctcattgaatcagcatctcc-------------
                    Gorilla  taaggaagagattacaggaagggagagatgcctcccgctcattgaatcagcatctcc-------------
                  Orangutan  taaggaagagattacaggaagggagagatgcctcccgctcattgaatcagcatctcc-------------
                     Gibbon  taatgaagagattacaggaagggagagatgcctcctgctcattgaatcagcatctcc-------------
                     Rhesus  taagggagaagttacgggaagggagagatgcctcccgctcattgactcagcatctcc-------------
        Crab-eating macaque  taagggagaagttacgggaagggagagatgcctcccgctcattgaatcagcatctcc-------------
                     Baboon  taagggagaagttacgggaagggagagatgcctcccgctcattgaatcagcatctcc-------------
               Green monkey  taagggagaagttacgtgaagggagaaatgcctcccgctcattgaatcagcatctcc-------------
                    Opossum  tgcgccagaagattcgggaagggagaggtgtatgccatatcctcagccagcacctca-------------
            Tasmanian devil  tgcgtcagaaggtacgggaagggagaggtgtgtgccatatcctcagccagcacttca-------------
                    Wallaby  tgcgccagaagatacgcgaagggagaggtgtgtgccatatcctcacccataacctca-------------
                 Budgerigar  tgcggcagacactgcgggagggccgcggggtgagccacagcctggcccagcacctgcgcgatgccctgcg
            Green seaturtle  taagggagaagttacgggaagggagagatgcctcccgctcattgaatgagcatctcc-------------
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                       Pika  ----------------------------------------------------------------------
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                 Guinea pig  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                   Aardvark  ======================================================================
                    Dolphin  ======================================================================
         Southern platyfish  ----------------------------------------------------------------------
             Naked mole-rat  ======================================================================
                     Lizard  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                   Platypus  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                     Tenrec  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
                    Ferret   ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                  Armadillo  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ----------------------------------------------------------------------
                        Cow  ======================================================================

                      Human  --------a
                      Chimp  --------a
                    Gorilla  --------a
                  Orangutan  --------a
                     Gibbon  --------a
                     Rhesus  --------a
        Crab-eating macaque  --------a
                     Baboon  --------a
               Green monkey  --------a
                    Opossum  --------g
            Tasmanian devil  --------g
                    Wallaby  --------g
                 Budgerigar  gtcctttga
            Green seaturtle  --------a
                        Rat  =========
               Prairie vole  =========
             Golden hamster  =========
                      Mouse  =========
     Lesser Egyptian jerboa  =========
                       Pika  ---------
               Weddell seal  =========
                   Hedgehog  =========
                      Shrew  =========
                 Guinea pig  =========
                        Pig  =========
                     Rabbit  =========
                   Aardvark  =========
                    Dolphin  =========
         Southern platyfish  ---------
             Naked mole-rat  =========
                     Lizard  =========
           Brush-tailed rat  =========
                 Chinchilla  =========
        Cape elephant shrew  =========
         Chinese tree shrew  =========
                   Platypus  =========
                    Manatee  =========
                   Elephant  =========
            Chinese hamster  =========
                     Tenrec  =========
                        Cat  =========
                   Bushbaby  =========
                    Ferret   =========
            Star-nosed mole  =========
              Domestic goat  =========
                      Sheep  =========
           Tibetan antelope  =========
             Bactrian camel  =========
                     Alpaca  =========
             Pacific walrus  =========
                      Panda  =========
               Killer whale  =========
                        Dog  =========
           Black flying-fox  =========
           White rhinoceros  =========
                      Horse  =========
                   Squirrel  =========
                  Armadillo  =========
       David's myotis (bat)  =========
              Big brown bat  =========
                   Microbat  =========
            Squirrel monkey  =========
                   Marmoset  ---------
                        Cow  =========

Alignment block 31 of 64 in window, 152021275 - 152021277, 3 bps 
B D                   Human  ggc
B D                   Chimp  ggc
B D                 Gorilla  ggc
B D               Orangutan  ggc
B D                  Gibbon  ggc
B D                  Rhesus  ggc
B D     Crab-eating macaque  ggc
B D                  Baboon  ggc
B D            Green monkey  ggc
                   Aardvark  agt
B D                 Opossum  gga
B D         Tasmanian devil  gga
B D                 Wallaby  aga
B D              Budgerigar  gga
  D         Green seaturtle  ggc
B D                     Rat  ===
              Prairie vole  ===
            Golden hamster  ===
B D                   Mouse  ===
    Lesser Egyptian jerboa  ===
B D                    Pika  ---
              Weddell seal  ===
B D                Hedgehog  ===
B D                   Shrew  ===
B D              Guinea pig  ===
B D                     Pig  ===
B D                  Rabbit  ===
B D                 Dolphin  ===
        Southern platyfish  ---
B D          Naked mole-rat  ===
B D                  Lizard  ===
          Brush-tailed rat  ===
                Chinchilla  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Manatee  ===
B D                Elephant  ===
B D         Chinese hamster  ===
B D                  Tenrec  ===
B D                     Cat  ===
B D                Bushbaby  ===
B D                 Ferret   ===
           Star-nosed mole  ===
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
            Bactrian camel  ===
B D                  Alpaca  ===
            Pacific walrus  ===
B D                   Panda  ===
              Killer whale  ===
B D                     Dog  ===
          Black flying-fox  ===
B D        White rhinoceros  ===
B D                   Horse  ===
B D                Squirrel  ===
B D               Armadillo  ===
      David's myotis (bat)  ===
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ===
B D                Marmoset  ---
B D                     Cow  ===

Inserts between block 31 and 32 in window
                  Aardvark 293bp
B D                Opossum 21bp
B D        Tasmanian devil 21bp
B D                Wallaby 21bp

Alignment block 32 of 64 in window, 152021278 - 152021389, 112 bps 
B D                   Human  cctcctcactccggatgagcctgacaactcccaggggcaggatatctgagagcagctggctgagggctgc
B D                   Chimp  cctcctcactccggatgagcctgacaactcccaggggcaggatatccgagaacagctggctgagggctgc
B D                 Gorilla  cctcctcactccggatgagcctgacaactcccaggggcaggatatccgagaacagctggctgagggctgc
B D               Orangutan  cctcctcactccagatgagcctgacaactcccaggggcaggatatccgagagcagctggctgagggctgc
B D                  Gibbon  cctcctcactccagatgagcctgacaactcccaggggcaggatatccgagagcagctggctgagggctgc
B D                  Rhesus  cctcctccctctggatgagcctgacaactcccaggggcaggatctccgagagcagctggctgagggctgc
B D     Crab-eating macaque  cctcctccctctggatgagcctgacaactcccaggggcaggatctccgagagcagctggctgagggctgc
B D                  Baboon  cctcctcactccggatgagcctgacaactcccaggggcaggatctccgagagcagctggctgagggctgc
B D            Green monkey  cctcctccctccggatgagcctgacaactcccaggggcaggatctccgagagcagctggctgagggctgc
B D                 Opossum  cctgcttcgaggcacggacatcgactactacctgggacagagcttccgggagcagctagctcaggggagc
B D         Tasmanian devil  cctcctccgaggcacagacatcgactactacctgggacagagcttccgggagcagctagctcaggggagc
B D                 Wallaby  catactccgaggaactgacattgattactacctgggacagagcttccgggagcagctagttcaggggagc
B D              Budgerigar  cctcctccgcggcaccgacattgactattaccagggccagggctttcgagagcagctggctcagggcagg
  D         Green seaturtle  cctcctcactccggatgagccggacaagtcccaggggcaggacctccaagaacagctggctgaggggtgt
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ----------------------------------------------------------------------
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
                  Aardvark  ======================================================================
B D                 Dolphin  ======================================================================
        Southern platyfish  ----------------------------------------------------------------------
B D          Naked mole-rat  ======================================================================
B D                  Lizard  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ----------------------------------------------------------------------
B D                     Cow  ======================================================================

                      Human  aggctgacagagaacctcatccacaaactcagcccaggtaag
                      Chimp  aggctgacagagaacctcatccacaaactcagcccaggtaag
                    Gorilla  aggctgacagagaacctcatccacaaactcagcccaggtaaa
                  Orangutan  aggctgacagagaacctcatccacaaactcagccaaggtaag
                     Gibbon  aggctgacagagaacctcatccacaaactcagcccaggtaag
                     Rhesus  aggctaacagagaacctcatccacaaactcagcgcaggtaag
        Crab-eating macaque  aggctaacagagaacctcatccacaaactcagcgcaggtaag
                     Baboon  aggctaacggagaacctcatccacaaactcagcgcaggtaag
               Green monkey  aggctaacagagtacctcatccacaaactcagcgcaggtaag
                    Opossum  cagttagcagaaagactcaccaacaagctcaacaccagtaag
            Tasmanian devil  cagttaacagagagacttgccagcaaactcaacactagtaag
                    Wallaby  caggtagcagaaagactcaccaagaagctcagcaccagtaag
                 Budgerigar  cagctggctgagaggctcagtgacaagctgggcaccagtaag
            Green seaturtle  agactggcacagcaccttgtccaaaagctcagcccaggtaag
                        Rat  ==========================================
               Prairie vole  ==========================================
             Golden hamster  ==========================================
                      Mouse  ==========================================
     Lesser Egyptian jerboa  ==========================================
                       Pika  ------------------------------------------
               Weddell seal  ==========================================
                   Hedgehog  ==========================================
                      Shrew  ==========================================
                 Guinea pig  ==========================================
                        Pig  ==========================================
                     Rabbit  ==========================================
                   Aardvark  ==========================================
                    Dolphin  ==========================================
         Southern platyfish  ------------------------------------------
             Naked mole-rat  ==========================================
                     Lizard  ==========================================
           Brush-tailed rat  ==========================================
                 Chinchilla  ==========================================
        Cape elephant shrew  ==========================================
         Chinese tree shrew  ==========================================
                   Platypus  ==========================================
                    Manatee  ==========================================
                   Elephant  ==========================================
            Chinese hamster  ==========================================
                     Tenrec  ==========================================
                        Cat  ==========================================
                   Bushbaby  ==========================================
                    Ferret   ==========================================
            Star-nosed mole  ==========================================
              Domestic goat  ==========================================
                      Sheep  ==========================================
           Tibetan antelope  ==========================================
             Bactrian camel  ==========================================
                     Alpaca  ==========================================
             Pacific walrus  ==========================================
                      Panda  ==========================================
               Killer whale  ==========================================
                        Dog  ==========================================
           Black flying-fox  ==========================================
           White rhinoceros  ==========================================
                      Horse  ==========================================
                   Squirrel  ==========================================
                  Armadillo  ==========================================
       David's myotis (bat)  ==========================================
              Big brown bat  ==========================================
                   Microbat  ==========================================
            Squirrel monkey  ==========================================
                   Marmoset  ------------------------------------------
                        Cow  ==========================================

Alignment block 33 of 64 in window, 152021390 - 152021392, 3 bps 
B D                   Human  gtg
B D                   Chimp  gtg
B D                 Gorilla  gtg
B D               Orangutan  atg
B D                  Gibbon  gtg
B D                  Rhesus  gtg
B D     Crab-eating macaque  gtg
B D                  Baboon  gtg
B D            Green monkey  gtg
B D                 Opossum  tca
B D         Tasmanian devil  tgg
B D                 Wallaby  ttg
  D         Green seaturtle  gtg
B D                     Rat  ===
              Prairie vole  ===
            Golden hamster  ===
B D                   Mouse  ===
    Lesser Egyptian jerboa  ===
B D                    Pika  ---
              Weddell seal  ===
B D                Hedgehog  ===
B D                   Shrew  ===
B D              Guinea pig  ===
B D                     Pig  ===
B D                  Rabbit  ===
                  Aardvark  ===
B D                 Dolphin  ===
        Southern platyfish  ---
B D          Naked mole-rat  ===
B D                  Lizard  ===
          Brush-tailed rat  ===
                Chinchilla  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Manatee  ===
B D                Elephant  ===
B D         Chinese hamster  ===
B D                  Tenrec  ===
B D                     Cat  ===
B D                Bushbaby  ===
B D                 Ferret   ===
           Star-nosed mole  ===
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
            Bactrian camel  ===
B D                  Alpaca  ===
            Pacific walrus  ===
B D                   Panda  ===
              Killer whale  ===
B D                     Dog  ===
          Black flying-fox  ===
B D        White rhinoceros  ===
B D                   Horse  ===
B D                Squirrel  ===
B D               Armadillo  ===
      David's myotis (bat)  ===
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ===
B D                Marmoset  ---
B D                     Cow  ===

Alignment block 34 of 64 in window, 152021393 - 152021395, 3 bps 
B D                   Human  gcc
B D                   Chimp  gcc
B D                 Gorilla  gcc
B D               Orangutan  gcc
B D                  Gibbon  gcc
B D                  Rhesus  gcc
B D     Crab-eating macaque  gcc
B D                  Baboon  gcc
B D            Green monkey  gcc
B D                 Opossum  tcc
B D         Tasmanian devil  tcc
  D         Green seaturtle  gcc
B D                     Rat  ===
              Prairie vole  ===
            Golden hamster  ===
B D                   Mouse  ===
    Lesser Egyptian jerboa  ===
B D                    Pika  ---
              Weddell seal  ===
B D                Hedgehog  ===
B D                   Shrew  ===
B D              Guinea pig  ===
B D                     Pig  ===
B D                  Rabbit  ===
                  Aardvark  ===
B D                 Dolphin  ===
        Southern platyfish  ---
B D          Naked mole-rat  ===
B D                  Lizard  ===
          Brush-tailed rat  ===
                Chinchilla  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Manatee  ===
B D                Elephant  ===
B D         Chinese hamster  ===
B D                  Tenrec  ===
B D                     Cat  ===
B D                Bushbaby  ===
B D                 Ferret   ===
           Star-nosed mole  ===
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
            Bactrian camel  ===
B D                  Alpaca  ===
            Pacific walrus  ===
B D                   Panda  ===
              Killer whale  ===
B D                     Dog  ===
          Black flying-fox  ===
B D        White rhinoceros  ===
B D                   Horse  ===
B D                Squirrel  ===
B D               Armadillo  ===
      David's myotis (bat)  ===
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ===
B D                Marmoset  ---
B D                     Cow  ===

Inserts between block 34 and 35 in window
B D                Opossum 1bp

Alignment block 35 of 64 in window, 152021396 - 152021404, 9 bps 
B D                   Human  acaggccct
B D                   Chimp  acaggccct
B D                 Gorilla  acaggccct
B D               Orangutan  acaggccct
B D                  Gibbon  acaggccct
B D                  Rhesus  acaggccct
B D     Crab-eating macaque  acaggccct
B D                  Baboon  acaggccct
B D            Green monkey  acaggccct
B D                 Opossum  atgggcct-
  D         Green seaturtle  ataggccct
B D                     Rat  =========
              Prairie vole  =========
            Golden hamster  =========
B D                   Mouse  =========
    Lesser Egyptian jerboa  =========
B D                    Pika  ---------
              Weddell seal  =========
B D                Hedgehog  =========
B D                   Shrew  =========
B D              Guinea pig  =========
B D                     Pig  =========
B D                  Rabbit  =========
                  Aardvark  =========
B D                 Dolphin  =========
        Southern platyfish  ---------
B D         Tasmanian devil  =========
B D          Naked mole-rat  =========
B D                  Lizard  =========
          Brush-tailed rat  =========
                Chinchilla  =========
       Cape elephant shrew  =========
        Chinese tree shrew  =========
B D                Platypus  =========
B D                 Manatee  =========
B D                Elephant  =========
B D         Chinese hamster  =========
B D                  Tenrec  =========
B D                     Cat  =========
B D                Bushbaby  =========
B D                 Ferret   =========
           Star-nosed mole  =========
             Domestic goat  =========
B D                   Sheep  =========
          Tibetan antelope  =========
            Bactrian camel  =========
B D                  Alpaca  =========
            Pacific walrus  =========
B D                   Panda  =========
              Killer whale  =========
B D                     Dog  =========
          Black flying-fox  =========
B D        White rhinoceros  =========
B D                   Horse  =========
B D                Squirrel  =========
B D               Armadillo  =========