Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 586 in window, 770550 - 770567, 18 bps 
B D                     Human  tctgtct---------------------------------------------------------------
B D                     Chimp  tctgtct---------------------------------------------------------------
B D                   Gorilla  tctgtct---------------------------------------------------------------
B D                 Orangutan  tctgtct---------------------------------------------------------------
B D                    Gibbon  tctgtct---------------------------------------------------------------
B D                    Rhesus  tctgtct---------------------------------------------------------------
B D       Crab-eating macaque  tctgtct---------------------------------------------------------------
B D                    Baboon  tctgtct---------------------------------------------------------------
B D              Green monkey  tctgtct---------------------------------------------------------------
B D                  Marmoset  -ct-------------------------------------------------------------------
B D           Squirrel monkey  tct-------------------------------------------------------------------
B D                  Bushbaby  tccctcc---------------------------------------------------------------
           Chinese tree shrew  -ctctcc---------------------------------------------------------------
B D                  Squirrel  accctcc---------------------------------------------------------------
       Lesser Egyptian jerboa  ttcatct---------------------------------------------------------------
                 Prairie vole  --tctcc---------------------------------------------------------------
B D           Chinese hamster  tatctcc---------------------------------------------------------------
B D                     Mouse  tacatcc---------------------------------------------------------------
B D                       Rat  tgcagcc---------------------------------------------------------------
B D            Naked mole-rat  --cctct---------------------------------------------------------------
B D                    Alpaca  -----cc---------------------------------------------------------------
               Bactrian camel  -----cc---------------------------------------------------------------
B D                   Dolphin  -----cc---------------------------------------------------------------
                 Killer whale  -----cc---------------------------------------------------------------
B D                       Cow  -----ct---------------------------------------------------------------
B D                     Sheep  -----ct---------------------------------------------------------------
B D                     Horse  caggtccagctggcacgttatcctgcctcctggggagggtcagcctctgctccacctggggggacaggga
B D          White rhinoceros  ctggccc---------------------------------------------------------------
B D                       Dog  ---gctc---------------------------------------------------------------
B D                   Ferret   gactccc---------------------------------------------------------------
B D                     Panda  gaggctc---------------------------------------------------------------
               Pacific walrus  gaggctc---------------------------------------------------------------
                 Weddell seal  gaggctc---------------------------------------------------------------
                Big brown bat  cactgct---------------------------------------------------------------
B D                   Manatee  cctatcc---------------------------------------------------------------
B D                   Opossum  agtg------------------------------------------------------------------
B D           Tasmanian devil  acag------------------------------------------------------------------
  D          Peregrine falcon  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
            Black flying-fox  ======================================================================
B D                    Tenrec  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
B D                   Megabat  ======================================================================
               Domestic goat  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================
B D                  Elephant  ======================================================================
B D                       Cat  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================

                        Human  -----------agtcaa--ca---gtg
                        Chimp  -----------agtcaa--ca---gtg
                      Gorilla  -----------agtcaa--ca---gtg
                    Orangutan  -----------agtcaa--ca---gcg
                       Gibbon  -----------agtcaa--ca---gtg
                       Rhesus  -----------agtcaa--ca---gcg
          Crab-eating macaque  -----------agtcaa--ca---gcg
                       Baboon  -----------agtcaa--ca---gcg
                 Green monkey  -----------agtcga--ca---gcg
                     Marmoset  ------------gtcag--ca---gtg
              Squirrel monkey  ------------gtcgg--ca---gca
                     Bushbaby  -----------aggc------------
           Chinese tree shrew  -----------aggc------------
                     Squirrel  -----------tgtggg--gggtg---
       Lesser Egyptian jerboa  -----------tgggga--caatg---
                 Prairie vole  -----------caggga--ca------
              Chinese hamster  -----------catgga--tg------
                        Mouse  -----------cgtggg--ca------
                          Rat  -----------catgga--cg------
               Naked mole-rat  -----------cacggg--cc------
                       Alpaca  -----------agctag--cc------
               Bactrian camel  -----------agctag--cc------
                      Dolphin  -----------agccgg--ca------
                 Killer whale  -----------agccgg--ca------
                          Cow  -----------ggtcag--ca------
                        Sheep  -----------ggtcag--ca------
                        Horse  caggcagagaggaaagacaca------
             White rhinoceros  -----------agctggcatg------
                          Dog  -----------agtctggctg------
                      Ferret   -----------a---------------
                        Panda  -----------agcctgggtg------
               Pacific walrus  -----------agccggggtg------
                 Weddell seal  -----------agcctgggtg------
                Big brown bat  -----------gggccagctg------
                      Manatee  -----------acaccg----------
                      Opossum  ---------------------------
              Tasmanian devil  ---------------------------
             Peregrine falcon  ---------------------------
           American alligator  ---------------------------
              Green seaturtle  ---------------------------
     Chinese softshell turtle  ---------------------------
              Star-nosed mole  ===========================
                         Pika  ===========================
          Cape elephant shrew  ===========================
                     Hedgehog  ===========================
                        Shrew  ===========================
               Golden hamster  ===========================
             Black flying-fox  ===========================
                       Tenrec  ===========================
             Brush-tailed rat  ===========================
                   Chinchilla  ===========================
                   Guinea pig  ===========================
                          Pig  ===========================
                      Megabat  ===========================
                Domestic goat  ===========================
             Tibetan antelope  ===========================
         David's myotis (bat)  ===========================
                    Armadillo  ===========================
                     Elephant  ===========================
                          Cat  ===========================
                  Spotted gar  ===========================
                  Stickleback  ===========================
       Yellowbelly pufferfish  ===========================
                  Zebra mbuna  ===========================
        Burton's mouthbreeder  ===========================
                       Lizard  ===========================
               Painted turtle  ===========================
                       Turkey  ===========================
                      Chicken  ===========================
                 Mallard duck  ===========================
                   Budgerigar  ===========================
           Tibetan ground jay  ===========================
                  Zebra finch  ===========================
          Medium ground finch  ===========================
       White-throated sparrow  ===========================
          Collared flycatcher  ===========================
                 Saker falcon  ===========================
                  Rock pigeon  ===========================
                     Platypus  ===========================
                      Wallaby  ===========================
     Mexican tetra (cavefish)  ===========================
                         Fugu  ===========================
             Cape golden mole  ===========================
                     Aardvark  ===========================

Inserts between block 1 and 2 in window
B D           Naked mole-rat 7bp
B D                  Ferret  23bp

Alignment block 2 of 586 in window, 770568 - 770571, 4 bps 
B D                     Human  -------------------acca
B D                     Chimp  -------------------acta
B D                   Gorilla  -------------------acca
B D                 Orangutan  -------------------accg
B D                    Gibbon  -------------------gcca
B D                    Rhesus  -------------------accg
B D       Crab-eating macaque  -------------------accg
B D                    Baboon  -------------------accg
B D              Green monkey  -------------------acgg
B D                  Marmoset  -------------------accg
B D           Squirrel monkey  -------------------atcg
B D                  Squirrel  -------------------agca
       Lesser Egyptian jerboa  -------------------agca
B D            Naked mole-rat  ----------------------a
B D                Guinea pig  ----------------------a
B D                    Alpaca  -------------------gtca
               Bactrian camel  -------------------gtca
B D                   Dolphin  -------------------gcca
                 Killer whale  -------------------gcca
B D                       Cow  -------------------atcg
B D                     Sheep  -------------------atcg
B D                     Horse  -------------------gcca
B D          White rhinoceros  -------------------gtca
B D                       Dog  -------------------atgg
B D                     Panda  -------------------gaca
               Pacific walrus  -------------------gcca
                 Weddell seal  -------------------gcca
                Big brown bat  -------------------gtca
B D                   Manatee  -------------------acca
B D                   Opossum  -------------------acca
B D           Tasmanian devil  -------------------acca
  D          Peregrine falcon  a---c--------------ac--
B D        American alligator  a---ccgagaagtagcccagg--
  D           Green seaturtle  ggggc--------------gt--
  D  Chinese softshell turtle  a------------------gc--
             Star-nosed mole  =======================
B D                      Pika  =======================
         Cape elephant shrew  =======================
B D                  Hedgehog  =======================
B D                     Shrew  =======================
B D                     Mouse  -----------------------
                Prairie vole  -----------------------
B D                       Rat  -----------------------
B D           Chinese hamster  -----------------------
              Golden hamster  =======================
            Black flying-fox  =======================
B D                    Tenrec  =======================
            Brush-tailed rat  =======================
                  Chinchilla  =======================
B D                       Pig  =======================
B D                   Megabat  =======================
               Domestic goat  =======================
            Tibetan antelope  =======================
        David's myotis (bat)  =======================
B D                 Armadillo  =======================
B D                  Elephant  =======================
          Chinese tree shrew  -----------------------
B D                   Ferret   =======================
B D                       Cat  =======================
                 Spotted gar  =======================
B D               Stickleback  =======================
      Yellowbelly pufferfish  =======================
                 Zebra mbuna  =======================
       Burton's mouthbreeder  =======================
B D                    Lizard  =======================
  D            Painted turtle  =======================
B D                    Turkey  =======================
B D                   Chicken  =======================
  D              Mallard duck  =======================
B D                Budgerigar  =======================
          Tibetan ground jay  =======================
B D               Zebra finch  =======================
B D       Medium ground finch  =======================
  D    White-throated sparrow  =======================
  D       Collared flycatcher  =======================
  D              Saker falcon  =======================
  D               Rock pigeon  =======================
B D                  Platypus  =======================
B D                   Wallaby  =======================
    Mexican tetra (cavefish)  =======================
B D                      Fugu  =======================
            Cape golden mole  =======================
                    Aardvark  =======================
B D                  Bushbaby  -----------------------

Inserts between block 2 and 3 in window
B D           Naked mole-rat 23bp
B D               Guinea pig 3bp
B D                   Alpaca 6bp
              Bactrian camel 6bp
B D                  Dolphin 5bp
                Killer whale 5bp
B D                      Cow 6bp
B D                    Sheep 6bp
B D                    Horse 11bp
B D         White rhinoceros 6bp
B D                      Dog 6bp
B D                    Panda 8bp
              Pacific walrus 7bp
                Weddell seal 8bp
               Big brown bat 6bp
B D                  Opossum 26bp
B D          Tasmanian devil 28bp

Alignment block 3 of 586 in window, 770572 - 770587, 16 bps 
B D                     Human  ---------------------------cacgtgacaacca------gtc
B D                     Chimp  ---------------------------cacgtgacaacca------gtc
B D                   Gorilla  ---------------------------cacgtgacaacca------gtc
B D                 Orangutan  ---------------------------cacatggcaacca------gtc
B D                    Gibbon  ---------------------------cacgtggcaacca------gtc
B D                    Rhesus  ---------------------------cgcttggcaacca------gtc
B D       Crab-eating macaque  ---------------------------cgcttggcaacca------gtc
B D                    Baboon  ---------------------------cgcttggcaacca------gtc
B D              Green monkey  ---------------------------cgcttggcaacca------gtc
B D                  Marmoset  ---------------------------cacttggcaacca------gtc
B D           Squirrel monkey  ---------------------------tacttggcaacca------gtc
B D                  Bushbaby  ------------------------------------ccca------gtc
           Chinese tree shrew  ---------------------------------------a------gct
B D                  Squirrel  ---------------------------ctctgaactccaa---ccagtc
       Lesser Egyptian jerboa  ---------------------------tgcttcacaccaa---cc-att
                 Prairie vole  ----------------------------------------------att
B D           Chinese hamster  ----------------------------------------------att
B D                     Mouse  ----------------------------------------------att
B D                       Rat  ----------------------------------------------att
B D            Naked mole-rat  ------------------------------cccatagcggactcc-act
B D                Guinea pig  ------------------------------cactggccaa---cc-agc
                   Chinchilla  ------------------------------cacacaccaa---cc-agt
B D                    Alpaca  ---------------------------cttccagga-------------
               Bactrian camel  ---------------------------cttccagaa-------------
B D                   Dolphin  ---------------------------cttccagga-------------
                 Killer whale  ---------------------------cttccagga-------------
B D                       Cow  ---------------------------cttccagga-------------
B D                     Sheep  ---------------------------cttccagga-------------
B D                     Horse  ---------------------------cccc--agg-------------
B D          White rhinoceros  ---------------------------ctcctgggg-------------
B D                       Dog  ---------------------------tgtgggtga-------------
B D                     Panda  ---------------------------cagaggtga-------------
               Pacific walrus  ---------------------------cagagggga-------------
                 Weddell seal  ---------------------------cagagggga-------------
                Big brown bat  ---------------------------ctcccaggg-------------
B D                   Manatee  ---------------------------cacgtgat--------------
B D                   Opossum  ---------------------------ccgctgtc--------------
B D           Tasmanian devil  ---------------------------ctcctatc--------------
  D          Peregrine falcon  cactgaggctggga----------gggctctcagcc-------------
B D        American alligator  cgctcaaactggaacctgtcgaagggccgcgccacc-------------
  D           Green seaturtle  ccca--------------------ggcctggctgca-------------
  D  Chinese softshell turtle  ccct--------------------tgctccgacgcg-------------
             Star-nosed mole  =================================================
B D                      Pika  =================================================
         Cape elephant shrew  =================================================
B D                  Hedgehog  =================================================
B D                     Shrew  =================================================
              Golden hamster  =================================================
            Black flying-fox  =================================================
B D                    Tenrec  =================================================
            Brush-tailed rat  =================================================
B D                       Pig  =================================================
B D                   Megabat  =================================================
               Domestic goat  =================================================
            Tibetan antelope  =================================================
        David's myotis (bat)  =================================================
B D                 Armadillo  =================================================
B D                  Elephant  =================================================
B D                   Ferret   =================================================
B D                       Cat  =================================================
                 Spotted gar  =================================================
B D               Stickleback  =================================================
      Yellowbelly pufferfish  =================================================
                 Zebra mbuna  =================================================
       Burton's mouthbreeder  =================================================
B D                    Lizard  =================================================
  D            Painted turtle  =================================================
B D                    Turkey  =================================================
B D                   Chicken  =================================================
  D              Mallard duck  =================================================
B D                Budgerigar  =================================================
          Tibetan ground jay  =================================================
B D               Zebra finch  =================================================
B D       Medium ground finch  =================================================
  D    White-throated sparrow  =================================================
  D       Collared flycatcher  =================================================
  D              Saker falcon  =================================================
  D               Rock pigeon  =================================================
B D                  Platypus  =================================================
B D                   Wallaby  =================================================
    Mexican tetra (cavefish)  =================================================
B D                      Fugu  =================================================
            Cape golden mole  =================================================
                    Aardvark  =================================================

Inserts between block 3 and 4 in window
B D                   Alpaca 95bp
              Bactrian camel 95bp
B D                  Dolphin 89bp
                Killer whale 88bp
B D                      Cow 21bp
B D                    Sheep 21bp
B D                    Horse 62bp
B D         White rhinoceros 140bp
B D                      Dog 34bp
B D                    Panda 42bp
              Pacific walrus 83bp
                Weddell seal 83bp
               Big brown bat 27bp

Alignment block 4 of 586 in window, 770588 - 770623, 36 bps 
B D                     Human  -------------------------ct------cccta----------------gaaaacccagcc-tgg
B D                     Chimp  -------------------------ct------cccta----------------gaacacccagcc-tgg
B D                   Gorilla  -------------------------ct------cccta----------------gaaaacccagcc-tgg
B D                 Orangutan  -------------------------ct------cccta----------------gaaaacccagcc-tgg
B D                    Gibbon  -------------------------ct------ccccg----------------gaaaacccagcc-tgg
B D                    Rhesus  -------------------------ct------ccctg----------------gaaaacccggcc-tgg
B D       Crab-eating macaque  -------------------------ct------ccctg----------------gaaaacccggcc-tgg
B D                    Baboon  -------------------------ct------ccctg----------------gaaaacccggcc-tgg
B D              Green monkey  -------------------------ct------ccctg----------------gaaaacccggcc-tgg
B D                  Marmoset  -------------------------ct------ccctg----------------gaacacccggct-tgg
B D           Squirrel monkey  -------------------------ct------ccctg----------------gaacacccggct-tgg
B D                  Bushbaby  -------------------------cc------tgctg----------------gaa------------g
           Chinese tree shrew  -------------------------ct------ccctg----------------gtacactcggtg-cgg
B D                  Squirrel  -------------------------ct------cccag----------------ggatg--caacc-tgc
       Lesser Egyptian jerboa  -------------------------ct------cccta----------------gaacattcaac-----
                 Prairie vole  -------------------------ct------tcttg----------------gagtgttc-att-tgt
B D           Chinese hamster  -------------------------ct------tcttg----------------gaatgttcaatt-tgc
B D                     Mouse  -------------------------ct------tcttg----------------gaatcgtcaatc-tgg
B D                       Rat  -------------------------ct------tcttg----------------gcgtgttcaatc-tga
B D            Naked mole-rat  -------------------------tc------tccag----------------gaatgcaaaaca-ggg
B D                Guinea pig  -------------------------tc------tccaa----------------gaacacaaaact-agg
                   Chinchilla  -------------------------tc-------ccag----------------gaatgtaaaact-cgg
B D                       Pig  -------------------------ct------ccgtg----------------gaaca-----cg-cag
B D                    Alpaca  -------------------------ct------ctgtg----------------gaaga--------cag
               Bactrian camel  -------------------------ct------ctgtg----------------gaaga--------cag
B D                   Dolphin  -------------------------ct------ctgcg----------------gggca-----ct-cag
                 Killer whale  -------------------------ct------ctgcg----------------gggaa-----ct-cag
B D                       Cow  -------------------------cc------ccaca----------------gctga-----ctgtgg
B D                     Sheep  -------------------------cc------ccaca----------------gctga-----ctgtgg
B D                     Horse  -------------------------ct------ccgtg----------------gaacattcaacc-tgg
B D          White rhinoceros  -------------------------cc------ccagg----------------gaacactcagcc-tgg
B D                       Dog  -------------------------gg------ccacg----------------------acccca-caa
B D                   Ferret   ---------------------------------tcatg----------------c-------------gg
B D                     Panda  -------------------------c-------ccaca----------------ccaggaccccca-cgg
               Pacific walrus  -------------------------ct------ccgtg----------------ctaag-ctcaca-tgg
                 Weddell seal  -------------------------ct------ccgtg----------------ctaag-ctcacg-tgg
                Big brown bat  -------------------------cg------ccagg----------------cacag-gcagag-gga
B D                   Manatee  ------------------------------------------------------------------tcag
B D                   Opossum  -------------------------cagggaggcctgaaacccagcagcgccccagaaggcgggcc-agg
B D           Tasmanian devil  ---------------------------------cctga----------------agatggccagcc-tgt
  D          Peregrine falcon  ctc-tagggtggccctca-------cc------catgc----------------cacc----tgat-cag
B D        American alligator  cgcacagagcggtccaccagggcatcc------tccac----------------cacc----tgca-gcg
  D           Green seaturtle  tgccc---------------------------------------------------------agct-tgg
  D  Chinese softshell turtle  tgttca-------cctcccg-----cc------ctcgc----------------taacg---agcc-cag
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
            Black flying-fox  ======================================================================
B D                    Tenrec  ======================================================================
            Brush-tailed rat  ======================================================================
B D                   Megabat  ======================================================================
               Domestic goat  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================
B D                  Elephant  ======================================================================
B D                       Cat  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================

                        Human  ----------------aattcccgag--g----------acc
                        Chimp  ----------------aattcccgag--g----------acc
                      Gorilla  ----------------aattcccgag--g----------acc
                    Orangutan  ----------------aattcccaag--g----------acc
                       Gibbon  ----------------aattcccgag--g----------acc
                       Rhesus  ----------------aattcccgag--g----------acc
          Crab-eating macaque  ----------------aattcccgag--g----------acc
                       Baboon  ----------------aattcccgag--g----------acc
                 Green monkey  ----------------agttcccgag--g----------acc
                     Marmoset  ----------------aattcccaag--g----------acg
              Squirrel monkey  ----------------cattcccgag--g----------acc
                     Bushbaby  ----------------aacccttgag--g----------act
           Chinese tree shrew  ------------------------------------------
                     Squirrel  ----------------aattcttgag--a----------acc
       Lesser Egyptian jerboa  -----------------attttcaag--g----------acc
                 Prairie vole  ----------------agttctcaga--g----------act
              Chinese hamster  ----------------agttctcagg--g----------act
                        Mouse  ----------------agttctcagg--g----------act
                          Rat  ----------------agctctgagg--g----------act
               Naked mole-rat  ----------------aattctca-g--a----------act
                   Guinea pig  ----------------aattctca-g--g----------gct
                   Chinchilla  ----------------aattctca-g--a----------act
                          Pig  ----------------gat-ctcagg--g----------acc
                       Alpaca  ----------------aattctcaag--g----------acc
               Bactrian camel  ----------------aattctcaag--g----------acc
                      Dolphin  ----------------aatgctccag--g----------gcc
                 Killer whale  ----------------aatgctccag--g----------gcc
                          Cow  ----------------agcactcggg--g----------tgc
                        Sheep  ----------------agcactcggg--g----------tgc
                        Horse  ----------------aattcttcat--g----------acc
             White rhinoceros  ----------------acttttcagt--g----------acc
                          Dog  cacgacccccatggccggctcactgg--g----------act
                      Ferret   ----------------gattctcaga--g----------acc
                        Panda  ctgactcactcggaccagctctccgt--gct-------aagc
               Pacific walrus  ----------------aattctcagt--g----------acc
                 Weddell seal  ----------------aattctcagc--g----------acc
                Big brown bat  ----------------gacacccagt--gctggtgcaggaag
                      Manatee  ----------------gattctgcag--a----------acc
                      Opossum  ----------------gctctgctgg--g----------cct
              Tasmanian devil  ----------------ggcctgtggg--t----------agt
             Peregrine falcon  ----------------agccactcag-tg----------acc
           American alligator  ----------------agtcctgggg-ga----------agc
              Green seaturtle  ----------------agcacccacg-ca----------ggc
     Chinese softshell turtle  ----------------agctcgcccgtcc----------gcc
              Star-nosed mole  ==========================================
                         Pika  ==========================================
          Cape elephant shrew  ==========================================
                     Hedgehog  ==========================================
                        Shrew  ==========================================
               Golden hamster  ==========================================
             Black flying-fox  ==========================================
                       Tenrec  ==========================================
             Brush-tailed rat  ==========================================
                      Megabat  ==========================================
                Domestic goat  ==========================================
             Tibetan antelope  ==========================================
         David's myotis (bat)  ==========================================
                    Armadillo  ==========================================
                     Elephant  ==========================================
                          Cat  ==========================================
                  Spotted gar  ==========================================
                  Stickleback  ==========================================
       Yellowbelly pufferfish  ==========================================
                  Zebra mbuna  ==========================================
        Burton's mouthbreeder  ==========================================
                       Lizard  ==========================================
               Painted turtle  ==========================================
                       Turkey  ==========================================
                      Chicken  ==========================================
                 Mallard duck  ==========================================
                   Budgerigar  ==========================================
           Tibetan ground jay  ==========================================
                  Zebra finch  ==========================================
          Medium ground finch  ==========================================
       White-throated sparrow  ==========================================
          Collared flycatcher  ==========================================
                 Saker falcon  ==========================================
                  Rock pigeon  ==========================================
                     Platypus  ==========================================
                      Wallaby  ==========================================
     Mexican tetra (cavefish)  ==========================================
                         Fugu  ==========================================
             Cape golden mole  ==========================================
                     Aardvark  ==========================================

Alignment block 5 of 586 in window, 770624 - 770650, 27 bps 
B D                     Human  a----------cctag-------------c-ag------------ctagcacagct--ctc---------
B D                     Chimp  a----------cctag-------------c-ag------------ctagcacagct--ctc---------
B D                   Gorilla  a----------cccag-------------c-ag------------ctagcacagct--ctc---------
B D                 Orangutan  a----------cctag-------------c-ag------------ctagcacagct--ctc---------
B D                    Gibbon  a----------tctag-------------c-ag------------ctagcacagct--ctc---------
B D                    Rhesus  a----------cctag-------------c-ag------------ctagcacgcct--ccc---------
B D       Crab-eating macaque  a----------cctag-------------c-ag------------ctagcacgcct--ccc---------
B D                    Baboon  a----------cctag-------------c-ag------------ctagcacgcct--ccc---------
B D              Green monkey  a----------cctag-------------c-ag------------ctagcacgcct--ccc---------
B D                  Marmoset  a----------cctgg-------------c-ag------------ctaccacagct--ttc---------
B D           Squirrel monkey  a----------cctgg-------------c-ag------------ctaccacagcc--ttc---------
B D                  Bushbaby  c----------cctgg-------------t-gg------------ccagcacagct--ccc---------
           Chinese tree shrew  -----------cctgg-------------c-ag------------cggccgcggct--cc----------
B D                  Squirrel  a----------cccag-------------c-ag------------ccagcacagta--ccc---------
       Lesser Egyptian jerboa  a----------ccagg--c----------c-ag------------ataagaccctc--tgt---------
                 Prairie vole  g----------cctgg--c----------c-ag------------ccaagatgctc--ccc---------
B D           Chinese hamster  g----------cctga--c----------c-ag------------ccaagatgctc--cac---------
B D                     Mouse  g----------cctgg--c----------c-ag------------ccaagacac----------------
B D                       Rat  g----------cctgg--c----------c-ag------------ccaggacac----------------
B D            Naked mole-rat  a----------tctgg--c----------c-a-------------ccagcactcagggtca---------
B D                Guinea pig  c----------tctgg--c----------c-a-------------ccagctcttga--tca---------
                   Chinchilla  a----------atcag--c----------c-a-------------ccagcactcag--------------
B D                       Pig  t----------cgtgg-------------c-agccaaagcagcacctgggccctga--cac---------
B D                    Alpaca  a----------tttgg-------------c-ggt-----------ctcggcgctct--cca---------
               Bactrian camel  a----------tttgg-------------c-agt-----------ctcggcgctct--cca---------
B D                   Dolphin  a----------cccgg-------------c-cgccagcgggcc--ctcggcactcc--cca---------
                 Killer whale  a----------cccgg-------------c-cgccagcgggcc--ctcggcactcc--cca---------
B D                       Cow  t----------ccggg-------------c-ccacggacagcccgctcagcactcc--cca---------
B D                     Sheep  t----------cgggg-------------c-ccacggacagcccgctcagcactcc--c-----------
B D                     Horse  g----------cccag--ggccag-----c-ac------------ctcagcactct--cca---------
B D          White rhinoceros  g----------cctgg--ggccagtgcaac-ac------------ctcagcactgt--ctg---------
B D                       Dog  t----------gctcc-------------c-cg------------tgctaagctca--cctg---gactc
B D                   Ferret   a----------cctga-------------c-ag------------ccctgagcccc--tct---------
B D                     Panda  a----------cctga-------------c-ag------------ccctgagccct--cct---------
               Pacific walrus  a----------cctga-------------t-gg------------ccctgagcccc--cct---------
                 Weddell seal  a----------cctga-------------t-gg------------ccctgagcccc--ccc---------
                Big brown bat  a----------ccagaggggccacgacc-c-ca------------ccctgcaacgc--cccagctgattc
B D                   Manatee  c----------cctgg-------------c-ag------------c------agcc--ccc---------
B D                   Opossum  cccgggcccctcttgg-------------c-ag------------ccccccccccc--ccc---------
B D           Tasmanian devil  cc---------ccagg-------------c-ag---------------gcccgggc--cca---------
  D          Peregrine falcon  ggcagggt---tacag-------------c-tg------------tccccggc-----------------
B D        American alligator  agca-------cacag-------------c-gg------------t------------------------
  D           Green seaturtle  agggag-----gtcag-------------t--g------------ccctcggg-----------------
  D  Chinese softshell turtle  agcgag-----ctcag-------------cagg------------ttctc--------------------
B D             X. tropicalis  a----------cccaa-------------t-cc------------ctgcctgagcc--ccc---------
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
            Black flying-fox  ======================================================================
B D                    Tenrec  ======================================================================
            Brush-tailed rat  ======================================================================
B D                   Megabat  ======================================================================
               Domestic goat  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================
B D                  Elephant  ======================================================================
B D                       Cat  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================

                        Human  -cagg
                        Chimp  -cagg
                      Gorilla  -cagg
                    Orangutan  -cggg
                       Gibbon  -cggg
                       Rhesus  -cagg
          Crab-eating macaque  -cagg
                       Baboon  -caag
                 Green monkey  -cggg
                     Marmoset  -tggg
              Squirrel monkey  -cggg
                     Bushbaby  -tcag
           Chinese tree shrew  -----
                     Squirrel  -----
       Lesser Egyptian jerboa  -----
                 Prairie vole  -----
              Chinese hamster  -----
                        Mouse  -----
                          Rat  -----
               Naked mole-rat  -----
                   Guinea pig  -----
                   Chinchilla  -----
                          Pig  -----
                       Alpaca  -----
               Bactrian camel  -----
                      Dolphin  -----
                 Killer whale  -----
                          Cow  -----
                        Sheep  -----
                        Horse  -----
             White rhinoceros  -----
                          Dog  tcaag
                      Ferret   -----
                        Panda  -----
               Pacific walrus  -----
                 Weddell seal  -----
                Big brown bat  tctgg
                      Manatee  -----
                      Opossum  -cgag
              Tasmanian devil  -gaag
             Peregrine falcon  -----
           American alligator  -----
              Green seaturtle  -----
     Chinese softshell turtle  -----
                X. tropicalis  -cggg
              Star-nosed mole  =====
                         Pika  =====
          Cape elephant shrew  =====
                     Hedgehog  =====
                        Shrew  =====
               Golden hamster  =====
             Black flying-fox  =====
                       Tenrec  =====
             Brush-tailed rat  =====
                      Megabat  =====
                Domestic goat  =====
             Tibetan antelope  =====
         David's myotis (bat)  =====
                    Armadillo  =====
                     Elephant  =====
                          Cat  =====
                  Spotted gar  =====
                  Stickleback  =====
       Yellowbelly pufferfish  =====
                  Zebra mbuna  =====
        Burton's mouthbreeder  =====
                       Lizard  =====
               Painted turtle  =====
                       Turkey  =====
                      Chicken  =====
                 Mallard duck  =====
                   Budgerigar  =====
           Tibetan ground jay  =====
                  Zebra finch  =====
          Medium ground finch  =====
       White-throated sparrow  =====
          Collared flycatcher  =====
                 Saker falcon  =====
                  Rock pigeon  =====
                     Platypus  =====
                      Wallaby  =====
     Mexican tetra (cavefish)  =====
                         Fugu  =====
             Cape golden mole  =====
                     Aardvark  =====

Inserts between block 5 and 6 in window
  D         Peregrine falcon 7bp
B D       American alligator 2bp
  D          Green seaturtle 6bp
  D Chinese softshell turtle 5bp

Alignment block 6 of 586 in window, 770651 - 770698, 48 bps 
B D                     Human  cacgtggg---------gtcttttc-------t-------------ctgcct-cc---------------
B D                     Chimp  cacgtggg---------gtcttttc-------t-------------ctgcct-cc---------------
B D                   Gorilla  cacgtggg---------gtcttttc-------t-------------ctgcct-cc---------------
B D                 Orangutan  cacgtggg---------gtcttttc-------t-------------ctgcct-cc---------------
B D                    Gibbon  cacgtggg---------gtcttttc-------t-------------ctgcct-cc---------------
B D                    Rhesus  cacctggg---------gtctcttc-------t-------------ctgcct-cc---------------
B D       Crab-eating macaque  cacctggg---------gtctcttc-------t-------------ctgcct-cc---------------
B D                    Baboon  cacctggg---------gtctcttc-------t-------------ctgcct-cc---------------
B D              Green monkey  cacctggg---------gtctctcc-------t-------------ctgcct-cc---------------
B D                  Marmoset  catctggg---------gtcttttc-------t-------------ctgcct-cc---------------
B D           Squirrel monkey  catctggg---------gtcttttc-------t-------------ctgcct-cc---------------
B D                  Bushbaby  -agccagg---------gtcttgtc-------t-------------ctgcct-cc---------------
           Chinese tree shrew  ----tgga---------ggcatcac-------t------------------t-ct---------------
B D                  Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ------------------gccttaa-----------------------accg-tg---------------
                 Prairie vole  ------------------------------------------------actg-tg---------------
B D           Chinese hamster  ------------------------------------------------acta-tg---------------
B D                     Mouse  -----------------------------------------------------tg---------------
B D                       Rat  -----------------------------------------------------tg---------------
B D            Naked mole-rat  ------------------tccctgg-------g-------------ccacct-ga-------ggagac--
B D                Guinea pig  ------------------tccccga-------t-------------ccacct-gg-------ggagac--
                   Chinchilla  -----------------------gg-------t-------------cgaccc-tg-------agccac--
B D                       Pig  ----------------------------------------------cc-ccc-cc---------------
B D                    Alpaca  ----------------------------------------------cctcct-cc---------------
               Bactrian camel  ----------------------------------------------cctcct-cc---------------
B D                   Dolphin  ----------------------------------------------cc-cct-cc---------------
                 Killer whale  ----------------------------------------------cc-cct-cc---------------
B D                       Cow  ----------------------------------------------cc-cct-cc---------------
B D                     Sheep  -----------------------------------------------------cc---------------
B D                     Horse  ----------------------------------------------cctcct-cc---------------
B D          White rhinoceros  ----------------------------------------------cctctg-cc---------------
B D                       Dog  ------ac---------cccctgac-------g-------------gcccct-cg---------------
B D                   Ferret   -----------------------ac-------t-------------actctgccc---------------
B D                     Panda  -----------------------------------------------ctctg-cc---------------
               Pacific walrus  ----------------------------------------------gctccg-tc---------------
                 Weddell seal  ----------------------------------------------gctgtg-tc---------------
                Big brown bat  gtaccaac---------tccctgtg-------g-------------accgct-cc---------------
B D                   Manatee  -----aga---------gtcctggt-------c-------------tcacct-ac---------------
B D                   Opossum  tgggtgttt-----cagccccttgctccgaagc-------------agggag-ca---------------
B D           Tasmanian devil  caggtgcc---------cccctaac-----agt-------------ctggct-ca---------------
B D                  Platypus  --------cacgtgcaatctctctc-------c-------------ccgcct-tccccaagtggggtt--
  D          Peregrine falcon  gggctagg---------gctctgca-------ct------------cagggt------------------
B D        American alligator  gagcccgg---------gctctgct-------cc------------ctgcct-cc-------gcc-----
  D           Green seaturtle  cgtctcggaagcaagaattcctgcg-------tcacc---------ctgagc-ct-------ggg-----
  D  Chinese softshell turtle  agttccag---------tccccgcg-------tcgctg--------ccgcgt-ct-------gggcac--
B D             X. tropicalis  -----------------------------------ctgcagatttccctcct-cc-------gacacgct
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
            Black flying-fox  ======================================================================
B D                    Tenrec  ======================================================================
            Brush-tailed rat  ======================================================================
B D                   Megabat  ======================================================================
               Domestic goat  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================
B D                  Elephant  ======================================================================
B D                       Cat  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================

                        Human  -------------------tacca-----------gagaa---------------catgcaggaggat
                        Chimp  -------------------tacca-----------gagaa---------------catgcaggaggat
                      Gorilla  -------------------tacca-----------gagaa---------------catgcaggaggat
                    Orangutan  -------------------tacca-----------gagaa---------------catgcagggggat
                       Gibbon  -------------------tacca-----------gagaa---------------catgcagg-ggat
                       Rhesus  -------------------tacca-----------gagaa---------------catgcagggggat
          Crab-eating macaque  -------------------tacca-----------gagaa---------------catgcagggggat
                       Baboon  -------------------tacca-----------gagaa---------------catgcaggggaat
                 Green monkey  -------------------tacca-----------gagaa---------------catgcaggggggt
                     Marmoset  -------------------tacta-----------gagaa---------------catgcaggggact
              Squirrel monkey  -------------------tacta-----------gagaa---------------catgcagggggct
                     Bushbaby  -------------------tacgagag--------gagga---------------tgtgcagg-ggtc
           Chinese tree shrew  -------------------gacgg-----------gag------------------------------
                     Squirrel  ---------------------atg-----------gcacc---------------c------------
       Lesser Egyptian jerboa  -------------------tgctg-----------gggct---------------a------------
                 Prairie vole  -------------------tgctg-----------gggat---------------a------------
              Chinese hamster  -------------------ggctg-----------ggaat---------------g------------
                        Mouse  -------------------tgctg-----------ggatg---------------g------------
                          Rat  -------------------tgctg-----------ggaac---------------a------------
               Naked mole-rat  ------------ca-----tgctg-----------gggac---------------c------------
                   Guinea pig  -------------------tgctg-----------ggcac---------------t------------
                   Chinchilla  -------------------tgcca-----------ggagc---------------c------------
                          Pig  -------------------cccag-----------aaggt---------------gtggc---gtc--
                       Alpaca  -------------------ccaag-----------gagac---------------ggtgccggggt--
               Bactrian camel  -------------------ccaag-----------gagatggtccccaaggagagggtgctggggt--
                      Dolphin  -------------------ctgag-----------gagac---------------tctgcagggtg--
                 Killer whale  -------------------ctgag-----------gagac---------------tctgcagggtg--
                          Cow  -------------------ccagg-----------gagac---------------ccaccacagtc--
                        Sheep  -------------------ccagg-----------gagac---------------ccaccacaatc--
                        Horse  -------------------cc-ag-----------gagga---------------cgtgcg-------
             White rhinoceros  -------------------ccaag-----------gagga---------------cgtgct-------
                          Dog  -------------------ccgag-----------gaaag---------------gatgtgtc-cc--
                      Ferret   -------------------ccagg-----------gaagg---------------caaggggc-ct--
                        Panda  -------------------ccaag-----------gaaag---------------caaacggc-ct--
               Pacific walrus  -------------------ccaag-----------gaaag---------------caaatggc-ct--
                 Weddell seal  -------------------ccaag-----------gagag---------------caaatggc-ct--
                Big brown bat  -------------------acatg-----------gaacc---------------cgagccccacc--
                      Manatee  -------------------gtgct-----------gagaa---------------cggggtggggt--
                      Opossum  -------------------gaatgccgggtcctgggcagg---------------tctgctgggcc--
              Tasmanian devil  -------------------cagtggcacgt-----gagaa---------------tgtgtgggg----
                     Platypus  -------------------tccag-----------ggaag---------------catgaaaag----
             Peregrine falcon  -------ggtccca-----cactg-----------gagt-----------------------------
           American alligator  ----acagatgcca---agcacag-----------gggg-----------------------------
              Green seaturtle  -----------------------------------acg------------------------------
     Chinese softshell turtle  ----ccaggtgcca------atcc-----------acgc-----------------------------
                X. tropicalis  gaaagtaagtttaattacttgggg-----------gaggt---------------a------------
              Star-nosed mole  ====================================================================
                         Pika  ====================================================================
          Cape elephant shrew  ====================================================================
                     Hedgehog  ====================================================================
                        Shrew  ====================================================================
               Golden hamster  ====================================================================
             Black flying-fox  ====================================================================
                       Tenrec  ====================================================================
             Brush-tailed rat  ====================================================================
                      Megabat  ====================================================================
                Domestic goat  ====================================================================
             Tibetan antelope  ====================================================================
         David's myotis (bat)  ====================================================================
                    Armadillo  ====================================================================
                     Elephant  ====================================================================
                          Cat  ====================================================================
                  Spotted gar  ====================================================================
                  Stickleback  ====================================================================
       Yellowbelly pufferfish  ====================================================================
                  Zebra mbuna  ====================================================================
        Burton's mouthbreeder  ====================================================================
                       Lizard  ====================================================================
               Painted turtle  ====================================================================
                       Turkey  ====================================================================
                      Chicken  ====================================================================
                 Mallard duck  ====================================================================
                   Budgerigar  ====================================================================
           Tibetan ground jay  ====================================================================
                  Zebra finch  ====================================================================
          Medium ground finch  ====================================================================
       White-throated sparrow  ====================================================================
          Collared flycatcher  ====================================================================
                 Saker falcon  ====================================================================
                  Rock pigeon  ====================================================================
                      Wallaby  ====================================================================
     Mexican tetra (cavefish)  ====================================================================
                         Fugu  ====================================================================
             Cape golden mole  ====================================================================
                     Aardvark  ====================================================================

Inserts between block 6 and 7 in window
B D                 Squirrel 5bp
      Lesser Egyptian jerboa 7bp
                Prairie vole 6bp
B D          Chinese hamster 6bp
B D                    Mouse 6bp
B D                      Rat 6bp
B D           Naked mole-rat 10bp
B D               Guinea pig 14bp
                  Chinchilla 10bp
B D                  Opossum 9bp
B D          Tasmanian devil 4bp

Alignment block 7 of 586 in window, 770699 - 770707, 9 bps 
B D                     Human  gggggtt-------tg
B D                     Chimp  gggggtt-------tg
B D                   Gorilla  gggggtt-------tg
B D                 Orangutan  gggggct-------tg
B D                    Gibbon  gggggtt-------tg
B D                    Rhesus  gggggct-------ta
B D       Crab-eating macaque  gggggct-------ta
B D                    Baboon  gggggct-------ta
B D              Green monkey  gggggct-------ta
B D                  Marmoset  -gggggt-------tg
B D           Squirrel monkey  ggggggt-------tg
B D                  Bushbaby  agggttt-------tg
           Chinese tree shrew  -gagagc-------tg
B D                  Squirrel  -----ca-------tc
       Lesser Egyptian jerboa  gggtgct-------ca
                 Prairie vole  gagtgtt-------ca
B D           Chinese hamster  ggggttt-------ca
B D                     Mouse  gggtgcc-------ta
B D                       Rat  aggtgtc-------ta
B D            Naked mole-rat  ggaggcg-------tg
B D                Guinea pig  ----gca-------tg
                   Chinchilla  gaaggca-------gg
             Brush-tailed rat  gaaggca-------tg
B D                       Pig  aggggct-------ca
B D                    Alpaca  cggggct-------gg
               Bactrian camel  cggggct-------gg
B D                   Dolphin  gggggct-------ca
                 Killer whale  gggggct-------ca
B D                       Cow  accggct-------ca
B D                     Sheep  actggct-------cg
B D                     Horse  -ggggct-gggagccg
B D          White rhinoceros  -ggaggc-tggggccg
B D                       Dog  -ggggctgggaggccg
B D                   Ferret   gggggtggggagggcg
B D                     Panda  gggggct-ggaggtca
               Pacific walrus  gggggctgggaggccg
                 Weddell seal  gggggttgggaggtcg
                Big brown bat  cggtgcc---agtgca
B D                   Manatee  gggggtg-------ag
B D                   Opossum  tgggatg-------gg
B D           Tasmanian devil  gtgggtg-------gg
B D                  Platypus  gggggtc-------tc
  D          Peregrine falcon  ggggatg-------tg
B D        American alligator  acggctt-------tg
  D           Green seaturtle  ctgcact-------tg
  D  Chinese softshell turtle  ccgccct-------cg
B D             X. tropicalis  ggggaat-------tg
             Star-nosed mole  ================
B D                      Pika  ================
         Cape elephant shrew  ================
B D                  Hedgehog  ================
B D                     Shrew  ================
              Golden hamster  ================
            Black flying-fox  ================
B D                    Tenrec  ================
B D                   Megabat  ================
               Domestic goat  ================
            Tibetan antelope  ================
        David's myotis (bat)  ================
B D                 Armadillo  ================
B D                  Elephant  ================
B D                       Cat  ================
                 Spotted gar  ================
B D               Stickleback  ================
      Yellowbelly pufferfish  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
B D                    Lizard  ================
  D            Painted turtle  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D              Mallard duck  ================
B D                Budgerigar  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
B D       Medium ground finch  ================
  D    White-throated sparrow  ================
  D       Collared flycatcher  ================
  D              Saker falcon  ================
  D               Rock pigeon  ================
B D                   Wallaby  ================
    Mexican tetra (cavefish)  ================
B D                      Fugu  ================
            Cape golden mole  ================
                    Aardvark  ================

Inserts between block 7 and 8 in window
B D                  Opossum 6bp
B D          Tasmanian devil 703bp
  D Chinese softshell turtle 5bp

Alignment block 8 of 586 in window, 770708 - 770712, 5 bps 
B D                     Human  ---ga-c---cc
B D                     Chimp  ---ga-c---cc
B D                   Gorilla  ---ga-c---cc
B D                 Orangutan  ---ga-c---cc
B D                    Gibbon  ---ga-c---cc
B D                    Rhesus  ---ga-t---cc
B D       Crab-eating macaque  ---ga-t---cc
B D                    Baboon  ---ga-t---cc
B D              Green monkey  ---gacc---cc
B D                  Marmoset  ---ga-g---cc
B D           Squirrel monkey  ---ga-g---cc
B D                  Bushbaby  ---gc-c---cc
           Chinese tree shrew  ---gc-------
B D                  Squirrel  ---gt------c
       Lesser Egyptian jerboa  ---ga------c
                 Prairie vole  ---gt------c
B D           Chinese hamster  ---gt------c
B D                     Mouse  ---gt------c
B D                       Rat  ---gt------c
B D            Naked mole-rat  ---gc------c
B D                Guinea pig  ---gc-t---tc
                   Chinchilla  ---gc-c---tc
             Brush-tailed rat  ---tg-c---tc
B D                       Pig  ---gc-c---t-
B D                    Alpaca  ---gc-c---cg
               Bactrian camel  ---gc-c---cg
B D                   Dolphin  ---gc-c---cc
                 Killer whale  ---gc-c---cc
B D                       Cow  ---gt-c---cg
B D                     Sheep  ---gc-c---ca
B D                     Horse  ---gc-----cc
B D          White rhinoceros  ---cc-cccacc
B D                       Dog  ---ac-c---cg
B D                   Ferret   ---gc-c---cc
B D                     Panda  ---ac-c---cc
               Pacific walrus  ---ac-c---cc
                 Weddell seal  ---ac-c---cc
                Big brown bat  ---gc-a---cc
B D                   Manatee  ---gc-c---tc
B D                   Opossum  ----c-c---cc
B D           Tasmanian devil  ---gc-c---cc
B D                  Platypus  ----------t-
  D          Peregrine falcon  -------gcacc
B D        American alligator  -------gctcc
  D           Green seaturtle  -------gttcc
  D  Chinese softshell turtle  -------gtggc
B D             X. tropicalis  ggggc-------
             Star-nosed mole  ============
B D                      Pika  ============
         Cape elephant shrew  ============
B D                  Hedgehog  ============
B D                     Shrew  ============
              Golden hamster  ============
            Black flying-fox  ============
B D                    Tenrec  ============
B D                   Megabat  ============
               Domestic goat  ============
            Tibetan antelope  ============
        David's myotis (bat)  ============
B D                 Armadillo  ============
B D                  Elephant  ============
B D                       Cat  ============
                 Spotted gar  ============
B D               Stickleback  ============
      Yellowbelly pufferfish  ============
                 Zebra mbuna  ============
       Burton's mouthbreeder  ============
B D                    Lizard  ============
  D            Painted turtle  ============
B D                    Turkey  ============
B D                   Chicken  ============
  D              Mallard duck  ============
B D                Budgerigar  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
B D       Medium ground finch  ============
  D    White-throated sparrow  ============
  D       Collared flycatcher  ============
  D              Saker falcon  ============
  D               Rock pigeon  ============
B D                   Wallaby  ============
    Mexican tetra (cavefish)  ============
B D                      Fugu  ============
            Cape golden mole  ============
                    Aardvark  ============

Inserts between block 8 and 9 in window
B D                  Manatee 64bp
B D                  Opossum 2bp

Alignment block 9 of 586 in window, 770713 - 770713, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                  Squirrel  c
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                   Dolphin  t
                 Killer whale  t
B D                       Cow  t
B D                     Sheep  t
B D                     Horse  t
B D          White rhinoceros  c
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
                Big brown bat  t
B D                   Opossum  t
B D           Tasmanian devil  c
  D          Peregrine falcon  t
B D        American alligator  t
  D           Green seaturtle  a
  D  Chinese softshell turtle  t
B D             X. tropicalis  c
             Star-nosed mole  =
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
              Golden hamster  =
            Black flying-fox  =
B D                    Tenrec  =
B D                       Pig  -
B D                   Megabat  =
               Domestic goat  =
            Tibetan antelope  =
        David's myotis (bat)  =
B D                 Armadillo  =
B D                   Manatee  =
B D                  Elephant  =
              Bactrian camel  -
B D                    Alpaca  -
          Chinese tree shrew  -
B D                       Cat  =
                 Spotted gar  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                    Lizard  =
  D            Painted turtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  -
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
            Cape golden mole  =
                    Aardvark  =

Inserts between block 9 and 10 in window
               Big brown bat 14bp
B D       American alligator 4bp
  D          Green seaturtle 4bp
  D Chinese softshell turtle 4bp

Alignment block 10 of 586 in window, 770714 - 770729, 16 bps 
B D                     Human  cca--ggagagccg--aca---c
B D                     Chimp  cca--ggagagccg--aca---c
B D                   Gorilla  cca--ggagagccg--aca---c
B D                 Orangutan  cca--ggagagccg--aca---c
B D                    Gibbon  cca--ggagagccg--aca---c
B D                    Rhesus  cca--ggagagccg--aca---c
B D       Crab-eating macaque  cca--ggagagccg--aca---c
B D                    Baboon  cca--ggagagccg--aca---c
B D              Green monkey  cca--ggggagccg--aca---c
B D                  Marmoset  cca--ggaga-ctg--aca---c
B D           Squirrel monkey  ccg--ggaga-ctg--acg---c
B D                  Bushbaby  ttaccttcgagcca--cca---c
           Chinese tree shrew  cca--ggagagtgg--agg---c
B D                  Squirrel  cca--caagagttg--aca---c
       Lesser Egyptian jerboa  -------gatactg--ata---c
                 Prairie vole  ata--taagaactg--ata---c
B D           Chinese hamster  aca--ttagaactg--ata---c
B D                     Mouse  aca--ttaggactg--aca---g
B D                       Rat  aca--tgagagctg--aca----
B D            Naked mole-rat  cca--g-agggctg--aca---g
B D                Guinea pig  cca--g-agagtag---------
                   Chinchilla  cca--g-acagcag--aca---g
             Brush-tailed rat  cca--g-aaagcagacaca---a
B D                       Pig  -cc--ccagggcta--gca----
B D                    Alpaca  -cc--ccagagctg--aca----
               Bactrian camel  -cc--ccagagctg--aca----
B D                   Dolphin  ccc--ccagagcct--tca----
                 Killer whale  ccc--ccagagcct--tca----
B D                       Cow  ccc--ccgaggccg--ac-----
B D                     Sheep  ccc--ccaaggccg--ac-----
B D                     Horse  ccc--ccagagcct--acg----
B D          White rhinoceros  acc--cccgagctg--acg----
B D                       Dog  ccc--ccagcgtcg--aca----
B D                   Ferret   ccc--ccacagctg--aca----
B D                     Panda  ctc--cccaagttg--a-a----
               Pacific walrus  ccc--ccagagacg--aca----
                 Weddell seal  ccg--ccagagggg--aca----
             Black flying-fox  -----ccagtgcag-cgcatcc-
B D                   Megabat  -----ccagtgcag-cgcatcc-
                Big brown bat  -----ccaagaccc-gaca----
B D                   Opossum  ctc--gagggcacc--acg----
B D           Tasmanian devil  ctc--acaggctcc--acac---
B D                  Platypus  --------gggccg--ccg---c
  D          Peregrine falcon  ccc--atggtgccc--at-----
B D        American alligator  ccc--agggctccc--ctg---c
  D           Green seaturtle  cag--ctggggaaa--gtg---c
  D  Chinese softshell turtle  ccc--atggcagcg--ctg---g
B D             X. tropicalis  cct--gggggccca--gca---c
             Star-nosed mole  =======================
B D                      Pika  =======================
         Cape elephant shrew  =======================
B D                  Hedgehog  =======================
B D                     Shrew  =======================
              Golden hamster  =======================
B D                    Tenrec  =======================
               Domestic goat  =======================
            Tibetan antelope  =======================
        David's myotis (bat)  =======================
B D                 Armadillo  =======================
B D                   Manatee  =======================
B D                  Elephant  =======================
B D                       Cat  =======================
                 Spotted gar  =======================
B D               Stickleback  =======================
      Yellowbelly pufferfish  =======================
                 Zebra mbuna  =======================
       Burton's mouthbreeder  =======================
B D                    Lizard  =======================
  D            Painted turtle  =======================
B D                    Turkey  =======================
B D                   Chicken  =======================
  D              Mallard duck  =======================
B D                Budgerigar  =======================
          Tibetan ground jay  =======================
B D               Zebra finch  =======================
B D       Medium ground finch  =======================
  D    White-throated sparrow  =======================
  D       Collared flycatcher  =======================
  D              Saker falcon  =======================
  D               Rock pigeon  =======================
B D                   Wallaby  =======================
    Mexican tetra (cavefish)  =======================
B D                      Fugu  =======================
            Cape golden mole  =======================
                    Aardvark  =======================

Alignment block 11 of 586 in window, 770730 - 770731, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Bushbaby  c-
           Chinese tree shrew  tc
B D                  Squirrel  cc
       Lesser Egyptian jerboa  ct
                 Prairie vole  tc
B D           Chinese hamster  tc
B D                     Mouse  tc
B D                       Rat  -c
B D            Naked mole-rat  cc
                   Chinchilla  cc
             Brush-tailed rat  cc
B D                       Pig  cc
B D                    Alpaca  gc
               Bactrian camel  gc
B D                   Dolphin  cc
                 Killer whale  cc
B D                       Cow  cc
B D                     Sheep  cc
B D                     Horse  ct
B D          White rhinoceros  cc
B D                       Cat  cc
B D                       Dog  gc
B D                   Ferret   ct
B D                     Panda  ct
               Pacific walrus  ct
                 Weddell seal  ct
             Black flying-fox  tc
B D                   Megabat  tc
                Big brown bat  -c
B D           Tasmanian devil  cc
B D                  Platypus  cc
  D          Peregrine falcon  cc
B D        American alligator  cc
  D           Green seaturtle  cc
  D  Chinese softshell turtle  tc
B D             X. tropicalis  cc
             Star-nosed mole  ==
B D                      Pika  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
              Golden hamster  ==
B D                    Tenrec  ==
B D                Guinea pig  --
               Domestic goat  ==
            Tibetan antelope  ==
        David's myotis (bat)  ==
B D                 Armadillo  ==
B D                   Manatee  ==
B D                  Elephant  ==
                 Spotted gar  ==
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
B D                    Lizard  ==
  D            Painted turtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
B D                      Fugu  ==
B D                   Opossum  --
            Cape golden mole  ==
                    Aardvark  ==

Inserts between block 11 and 12 in window
B D                 Platypus 1bp

Alignment block 12 of 586 in window, 770732 - 770742, 11 bps 
B D                     Human  cctcagagctg
B D                     Chimp  cctcagagctg
B D                   Gorilla  cctcagagctg
B D                 Orangutan  gctcagagctg
B D                    Gibbon  cctcagagctg
B D                    Rhesus  ccttagagctg
B D       Crab-eating macaque  ccttagagctg
B D                    Baboon  ccttagagctg
B D              Green monkey  ccttagagctg
B D                  Marmoset  cctcagagctg
B D           Squirrel monkey  ccgcggagctg
B D                  Bushbaby  -ctaagggctc
           Chinese tree shrew  c---------g
B D                  Squirrel  t-cagggc-tg
       Lesser Egyptian jerboa  cacaggac-ta
                 Prairie vole  tccaagtctta
B D           Chinese hamster  tacaagtctta
B D                     Mouse  cacaagtatta
B D                       Rat  tgcaggta-ta
B D            Naked mole-rat  ctcaggtc--a
B D                Guinea pig  ------cc--g
                   Chinchilla  ctggggcc--a
             Brush-tailed rat  cttgggct--g
B D                       Pig  cc-----gaga
B D                    Alpaca  cctcagggagg
               Bactrian camel  cctcagggacg
B D                   Dolphin  cctcagggagg
                 Killer whale  cctcagggagg
B D                       Cow  attcagggagg
B D                     Sheep  cttcagggagg
B D                     Horse  cctcagggctg
B D          White rhinoceros  cctcagggctg
B D                       Cat  cctcagggctc
B D                       Dog  cttcagggcgg
B D                   Ferret   cttcagggcta
B D                     Panda  cctcagggctg
               Pacific walrus  ccgcagggctg
                 Weddell seal  ctgcagggctg
             Black flying-fox  ccccagggctg
B D                   Megabat  ccccagggctg
                Big brown bat  ccctcaggctg
B D                   Opossum  ---agggacac
B D           Tasmanian devil  cccaggatctg
  D          Peregrine falcon  --caggagagg
B D        American alligator  --cagcagcca
  D           Green seaturtle  --ccaccccgc
  D  Chinese softshell turtle  --ccggagaga
B D             X. tropicalis  ccccagtgc-g
             Star-nosed mole  ===========
B D                      Pika  ===========
         Cape elephant shrew  ===========
B D                  Hedgehog  ===========
B D                     Shrew  ===========
              Golden hamster  ===========
B D                    Tenrec  ===========
               Domestic goat  ===========
            Tibetan antelope  ===========
        David's myotis (bat)  ===========
B D                 Armadillo  ===========
B D                   Manatee  ===========
B D                  Elephant  ===========
                 Spotted gar  ===========
B D               Stickleback  ===========
      Yellowbelly pufferfish  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
B D                    Lizard  ===========
  D            Painted turtle  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
  D              Mallard duck  ===========
B D                Budgerigar  ===========
          Tibetan ground jay  ===========
B D               Zebra finch  ===========
B D       Medium ground finch  ===========
  D    White-throated sparrow  ===========
  D       Collared flycatcher  ===========
  D              Saker falcon  ===========
  D               Rock pigeon  ===========
B D                  Platypus  ===========
B D                   Wallaby  ===========
    Mexican tetra (cavefish)  ===========
B D                      Fugu  ===========
            Cape golden mole  ===========
                    Aardvark  ===========

Alignment block 13 of 586 in window, 770743 - 770752, 10 bps 
B D                     Human  a---ttcc-a---------ggag
B D                     Chimp  a---ttcc-a---------ggag
B D                   Gorilla  a---ttcc-a---------ggag
B D                 Orangutan  a---ttcc-a---------ggag
B D                    Gibbon  a---ttcc-a---------ggag
B D                    Rhesus  a---ttcc-a---------ggag
B D       Crab-eating macaque  a---ttcc-a---------ggag
B D                    Baboon  a---ttcc-a---------ggag
B D              Green monkey  a---ttcc-a---------ggag
B D                  Marmoset  a---ttcc-a---------ggag
B D           Squirrel monkey  a---tccc-a---------ggag
B D                  Bushbaby  a---tttc-t---------gg--
           Chinese tree shrew  g---tgtc-g---------gctg
B D                  Squirrel  a---ttcc-t---------gcag
       Lesser Egyptian jerboa  a---ttcc-t---------agag
                 Prairie vole  a---ctct-t---------ggag
B D           Chinese hamster  a---ctcc-t---------ggaa
B D                     Mouse  a---tccc-t---------ggag
B D                       Rat  a---ttcc-t---------ggag
B D            Naked mole-rat  a---tcct-cgg-------agag
B D                Guinea pig  a---ttcc-cca-------aaat
                   Chinchilla  a---ttcc-cag-------acac
             Brush-tailed rat  a---ttcc-c---------acac
B D                       Pig  g---ccctcc---------agaa
B D                    Alpaca  g---tcct-c---------agcc
               Bactrian camel  g---tcct-c---------agcc
B D                   Dolphin  a---tcct-c---------agag
                 Killer whale  a---tcct-c---------agag
B D                       Cow  a---tcct-c---------agag
B D                     Sheep  a---tcct-c---------agag
B D                     Horse  a---tcct-t---------ggtg
B D          White rhinoceros  c---tcct-t---------ggag
B D                       Cat  a---gtcc-c---------ggag
B D                       Dog  a---cacg-t---------gggg
B D                   Ferret   a---ttct-c---------agag
B D                     Panda  a---ctct-t---------ggag
               Pacific walrus  a---ttct-c---------gggg
                 Weddell seal  a---ttct-t---------gggg
             Black flying-fox  a---ttcg-g---------gg--
B D                   Megabat  a---ttcg-g---------gg--
                Big brown bat  a---ctcc-t---------ggag
B D                   Opossum  g---ttct-c---------tgtg
B D           Tasmanian devil  g---tcct-caggtaggcacgag
  D          Peregrine falcon  ----ctca-g---------ggcc
B D        American alligator  ccctccca-g---------ggcc
  D           Green seaturtle  c---ccca-g---------ggac
  D  Chinese softshell turtle  g---cccg-g---------tggc
B D             X. tropicalis  a---ctct-a---------ggag
                  Spotted gar  a---ctcc-t---------gcag
             Star-nosed mole  =======================
B D                      Pika  =======================
         Cape elephant shrew  =======================
B D                  Hedgehog  =======================
B D                     Shrew  =======================
              Golden hamster  =======================
B D                    Tenrec  =======================
               Domestic goat  =======================
            Tibetan antelope  =======================
        David's myotis (bat)  =======================
B D                 Armadillo  =======================
B D                   Manatee  =======================
B D                  Elephant  =======================
B D               Stickleback  =======================
      Yellowbelly pufferfish  =======================
                 Zebra mbuna  =======================
       Burton's mouthbreeder  =======================
B D                    Lizard  =======================
  D            Painted turtle  =======================
B D                    Turkey  =======================
B D                   Chicken  =======================
  D              Mallard duck  =======================
B D                Budgerigar  =======================
          Tibetan ground jay  =======================
B D               Zebra finch  =======================
B D       Medium ground finch  =======================
  D    White-throated sparrow  =======================
  D       Collared flycatcher  =======================
  D              Saker falcon  =======================
  D               Rock pigeon  =======================
B D                  Platypus  =======================
B D                   Wallaby  =======================
    Mexican tetra (cavefish)  =======================
B D                      Fugu  =======================
            Cape golden mole  =======================
                    Aardvark  =======================

Alignment block 14 of 586 in window, 770753 - 770776, 24 bps 
B D                     Human  g-----cc-----t-ccaacaatc-ccatcagggcc
B D                     Chimp  g-----cc-----t-ccaacaatc-ccatcagggcc
B D                   Gorilla  g-----cc-----t-ccaacaatc-ccatcagggcc
B D                 Orangutan  g-----cc-----t-ccaacaatc-ccattagggcc
B D                    Gibbon  g-----cc-----t-ccaacaatc-ccatcagggcc
B D                    Rhesus  g-----cc-----t-ccaacaatc-ccatcagggcc
B D       Crab-eating macaque  g-----cc-----t-ccaacaatc-ccatcagggcc
B D                    Baboon  g-----cc-----t-ccaacaatc-ccatcagggtc
B D              Green monkey  g-----cc-----t-ccaacaatc-ccatcagggcc
B D                  Marmoset  g-----cc-----t-ccaacagtc-acattaaggcc
B D           Squirrel monkey  g-----cc-----t-ccaacagtc-ccattaaagcc
B D                  Bushbaby  -------------------------tcaccagggcc
           Chinese tree shrew  g-----gc-----t-tcgacagcc-cc--tggggct
B D                  Squirrel  g-----ca-----t---aac-agt-cccaggagc--
       Lesser Egyptian jerboa  g-----cc-----t-ccagcaatc-ccacaaggccc
                 Prairie vole  g-----cc-----t-ccagc-att-ccacagggtcc
B D           Chinese hamster  g-----cc-----t-ccagg-att-ccacaaagtcc
B D                     Mouse  g-----ct-----t-ccagc-att-ccacaaggtcc
B D                       Rat  g-----cc-----t-ccagc-att-ccacaaggccc
B D            Naked mole-rat  g-----ag-----t-ccggc-------acatggccc
B D                Guinea pig  g-----ag-----t-ccagg-------ccatggcct
                   Chinchilla  g-----ag-----t-cccgg-------acatggccc
             Brush-tailed rat  a-----ag-----t-ccagg-------acacggccc
B D                       Pig  a-----cc-------ccacc----------aggcca
B D                    Alpaca  t-----cc-----a-ccccc----------agggcc
               Bactrian camel  t-----cc-----a-ccccc----------agggcc
B D                   Dolphin  c-----cc-------ccagc----------aagcca
                 Killer whale  c-----cc-------ccagc----------aagcca
B D                       Cow  c-----cc-------cccag----------cagttc
B D                     Sheep  c-----ac-------cccag----------gagttc
B D                     Horse  c-----cc-----t-ccaacaatc-cgaccaagcca
B D          White rhinoceros  g-----cc-----t-ccaacaatc-ccactgggcca
B D                       Cat  g-----cc-----c-ccaacaacc-ccacagggtca
B D                       Dog  g-----cc-----t-ccaacagtc-ccac-ggggca
B D                   Ferret   g-----cc-----tcccaacaatc-ccgctgagtcc
B D                     Panda  g-----cc-----t-ccaacagtc-ccaccgggtca
               Pacific walrus  g-----cc-----t-ccaacaatc-ccaccgggtca
                 Weddell seal  g-----cc-----t-ccaacaatc-ccaccgggtca
             Black flying-fox  ------------------------------aggcct
B D                   Megabat  ------------------------------aggcct
                Big brown bat  g-----cc-----c-c--gcagtc-ccac-aggccc
B D                   Opossum  c-----cc-----a-gcc------------------
B D           Tasmanian devil  c-----cc-----a-gtc------------------
  D          Peregrine falcon  a-----gcg--atg-ccagcgggc-gagcacctgcc
B D        American alligator  c-----cc-----a-ccagctgcc-gcaccctccct
  D           Green seaturtle  t-----tt-----g-cccctcgcc-acatgcctgcc
  D  Chinese softshell turtle  tgaggatc-----g-ccccttacctgcctggctgtc
                  Spotted gar  --------gccagt-ccagcagcggtcagcacac--
             Star-nosed mole  ====================================
B D                      Pika  ====================================
         Cape elephant shrew  ====================================
B D                  Hedgehog  ====================================
B D                     Shrew  ====================================
              Golden hamster  ====================================
B D                    Tenrec  ====================================
               Domestic goat  ====================================
            Tibetan antelope  ====================================
        David's myotis (bat)  ====================================
B D                 Armadillo  ====================================
B D                   Manatee  ====================================
B D                  Elephant  ====================================
B D               Stickleback  ====================================
      Yellowbelly pufferfish  ====================================
                 Zebra mbuna  ====================================
       Burton's mouthbreeder  ====================================
B D                    Lizard  ====================================
  D            Painted turtle  ====================================
B D                    Turkey  ====================================
B D                   Chicken  ====================================
  D              Mallard duck  ====================================
B D                Budgerigar  ====================================
          Tibetan ground jay  ====================================
B D               Zebra finch  ====================================
B D       Medium ground finch  ====================================
  D    White-throated sparrow  ====================================
  D       Collared flycatcher  ====================================
  D              Saker falcon  ====================================
  D               Rock pigeon  ====================================
B D                  Platypus  ====================================
B D                   Wallaby  ====================================
    Mexican tetra (cavefish)  ====================================
B D                      Fugu  ====================================
            Cape golden mole  ====================================
                    Aardvark  ====================================

Inserts between block 14 and 15 in window
B D          Tasmanian devil 1bp
  D         Peregrine falcon 5bp
B D       American alligator 21bp
  D          Green seaturtle 11bp
  D Chinese softshell turtle 14bp

Alignment block 15 of 586 in window, 770777 - 770814, 38 bps 
B D                     Human  a-gaccag--gctgcca---------------tcc----------agggccctt----------gtcagg
B D                     Chimp  a-gaccag--gctgcca---------------tcc----------agggccctt----------gtcagg
B D                   Gorilla  a-gaccag--gctgcca---------------tcc----------agggccctt----------gtcagg
B D                 Orangutan  a-gaccag--gctgcca---------------tcc----------agggccctt----------gtcagg
B D                    Gibbon  a-gaccgg--gctgcca---------------tcc----------agggccctt----------gtcagg
B D                    Rhesus  a-gaccgg--gctgcca---------------tcc----------acggccctt----------gtcagg
B D       Crab-eating macaque  a-gaccgg--gctgcca---------------tcc----------acggccctt----------gtcagg
B D                    Baboon  a-gactgg--gctgcca---------------tcc----------acggccctt----------gtcagg
B D              Green monkey  a-gaccag--gctgcca---------------tcc----------acggccctt----------gtcagg
B D                  Marmoset  a-tccaag--gccacca---------------ccc----------aggttcctt----------gtcagg
B D           Squirrel monkey  a-gactgg--g-cgcca---------------tcc----------aggctcctt----------gttggg
B D                  Bushbaby  a-gactgg--a----------------------------------aggtctttt----------gtcagg
           Chinese tree shrew  g-gaccag--gctgtga---------------tgg----------agg--ccct----------gtccag
B D                  Squirrel  --agtggg--gtcctca----------------------------gag----------------------
       Lesser Egyptian jerboa  aggatggg--gccttga----------------------------gagaccctc----------atcagg
                 Prairie vole  a-aacgga--ggcttga----------------------------ggg--ccct----------gtcagg
B D           Chinese hamster  a-gatgga--ggcttga----------------------------gag--ccct----------gtcaag
B D                     Mouse  t-gatgga--ggcttga----------------------------gtg--tccc----------atcgag
B D                       Rat  c-aacgga--ggct-------------------------------gtg--tccc----------atcgag
B D            Naked mole-rat  c-tttgag--ggcc------------------------------------cctg----------gtcagg
B D                Guinea pig  c-ctc-aa--ggga------------------------------------tttc----------atcagg
                   Chinchilla  a-gtc----------------------------------------------------------------g
             Brush-tailed rat  c-accgag--ggcc------------------------------------cttt----------gtcagg
B D                       Pig  g-gccggg--at----------------------------------------------------gtcacg
B D                    Alpaca  a-ggtgag--gt----------------------------------------------------gtcgca
               Bactrian camel  a-ggtgag--gt----------------------------------------------------gtcaca
B D                   Dolphin  g-gctggg--gt----------------------------------------------------gtcgtg
                 Killer whale  g-gctggg--gt----------------------------------------------------gtcgtg
B D                       Cow  c-accagg--g-----------------------------------------------------cccagg
B D                     Sheep  c-accagg--g-----------------------------------------------------gccagg
B D                     Horse  g-gtcagg--agatctg----------------------------agagccattctcagaggctgtcaca
B D          White rhinoceros  g-gtcagg--aggtctg----------------------------aaagtcactctccgaggctgtcaca
B D                       Cat  g-gca-gg--ggccggg----------------------------aaggtcgctctcaggggcggtcgcg
B D                       Dog  g-gccggg--ggccctg----------------------------agggtca-------------tcagg
B D                   Ferret   a-gct-gg--gcatcca----------------------------gaagtcactctc--gggctgtcaag
B D                     Panda  c-gttggg--gggtctg----------------------------aaagtcactctcaggggtggtcacg
               Pacific walrus  g-gttggg--gtgtctg----------------------------agagtcactctccagggctgtcaca
                 Weddell seal  g-gttggg--gtgtctg----------------------------aaagtcactctccggggctgtcagg
             Black flying-fox  g-gtcagg--gt----------------------------------gagtc-------------------
B D                   Megabat  g-gtcagg--gt----------------------------------gagtc-------------------
                Big brown bat  g-gtcggg--tg----------------------------------aagtcagcctcaggagctgtccga
B D                   Manatee  a-ggcccg--gctgctc----------------------------tcggctct-----------------
B D                   Opossum  g-gccagggtgactcccagaaggg--------cac----------gtggccccccccagg----gtccg-
B D           Tasmanian devil  g-gccaag--gaccccc-----------------------------tgccctagcacagt----gtcag-
  D          Peregrine falcon  -cagccag--gcct-cacccagcacctaactatctac----gtaaagggta-------------------
B D        American alligator  -cacttag--gaatccgcccggcacc------tccgc--------agggtc-------------------
  D           Green seaturtle  -gggtgaa-------cactctgcaccaggcattgcac----aagaaataca-------------------
  D  Chinese softshell turtle  -tggcgag--------------------------------------------------------------
                  Spotted gar  ------------------------------agtccagctggacacatgttctct----------gtccag
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
B D                    Tenrec  ======================================================================
               Domestic goat  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================
B D                  Elephant  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================

                        Human  agggaa-
                        Chimp  agggaa-
                      Gorilla  agggaa-
                    Orangutan  agggaa-
                       Gibbon  agggaa-
                       Rhesus  agggaa-
          Crab-eating macaque  agggaa-
                       Baboon  agggaa-
                 Green monkey  agggaa-
                     Marmoset  agagat-
              Squirrel monkey  agggac-
                     Bushbaby  acggaa-
           Chinese tree shrew  aggggc-
                     Squirrel  -----g-
       Lesser Egyptian jerboa  tggaga-
                 Prairie vole  taagga-
              Chinese hamster  taaggg-
                        Mouse  t----g-
                          Rat  taagga-
               Naked mole-rat  tgggga-
                   Guinea pig  caggga-
                   Chinchilla  caggga-
             Brush-tailed rat  tgggga-
                          Pig  g------
                       Alpaca  g------
               Bactrian camel  g------
                      Dolphin  a------
                 Killer whale  a------
                          Cow  c------
                        Sheep  c------
                        Horse  g------
             White rhinoceros  g------
                          Cat  g------
                          Dog  g------
                      Ferret   g------
                        Panda  g------
               Pacific walrus  g------
                 Weddell seal  g------
             Black flying-fox  -------
                      Megabat  -------
                Big brown bat  g------
                      Manatee  -------
                      Opossum  -------
              Tasmanian devil  -------
             Peregrine falcon  -------
           American alligator  -------
              Green seaturtle  -------
     Chinese softshell turtle  -------
                  Spotted gar  ggttgga
              Star-nosed mole  =======
                         Pika  =======
          Cape elephant shrew  =======
                     Hedgehog  =======
                        Shrew  =======
               Golden hamster  =======
                       Tenrec  =======
                Domestic goat  =======
             Tibetan antelope  =======
         David's myotis (bat)  =======
                    Armadillo  =======
                     Elephant  =======
                  Stickleback  =======
       Yellowbelly pufferfish  =======
                  Zebra mbuna  =======
        Burton's mouthbreeder  =======
                       Lizard  =======
               Painted turtle  =======
                       Turkey  =======
                      Chicken  =======
                 Mallard duck  =======
                   Budgerigar  =======
           Tibetan ground jay  =======
                  Zebra finch  =======
          Medium ground finch  =======
       White-throated sparrow  =======
          Collared flycatcher  =======
                 Saker falcon  =======
                  Rock pigeon  =======
                     Platypus  =======
                      Wallaby  =======
     Mexican tetra (cavefish)  =======
                         Fugu  =======
             Cape golden mole  =======
                     Aardvark  =======

Inserts between block 15 and 16 in window
B D                  Opossum 8bp
  D         Peregrine falcon 6bp
B D       American alligator 9bp
  D          Green seaturtle 6bp
  D Chinese softshell turtle 5bp

Alignment block 16 of 586 in window, 770815 - 770815, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  a
B D                  Bushbaby  g
           Chinese tree shrew  c
B D                  Squirrel  a
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                  Elephant  g
B D                   Manatee  g
                     Aardvark  g
B D           Tasmanian devil  g
                  Spotted gar  g
             Star-nosed mole  =
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
              Golden hamster  =
            Black flying-fox  -
B D                    Tenrec  =
B D                       Pig  -
B D                   Dolphin  -
                Weddell seal  -
B D                   Megabat  -
                Killer whale  -
B D                     Panda  -
               Big brown bat  -
B D                       Cow  -
               Domestic goat  =
B D                     Sheep  -
            Tibetan antelope  =
        David's myotis (bat)  =
B D                 Armadillo  =
B D          White rhinoceros  -
B D                     Horse  -
              Bactrian camel  -
B D                    Alpaca  -
B D                       Dog  -
B D                   Ferret   -
B D                       Cat  -
              Pacific walrus  -
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  =
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D                   Opossum  =
            Cape golden mole  =

Inserts between block 16 and 17 in window
B D          Tasmanian devil 10bp

Alignment block 17 of 586 in window, 770816 - 770844, 29 bps 
B D                     Human  --ag---gcggg--------------------gtccct-gaa--------------------------gc
B D                     Chimp  --ag---gcggg--------------------gtccct-gaa--------------------------gc
B D                   Gorilla  --ag---gcggg--------------------gtccct-gaa--------------------------gc
B D                 Orangutan  --ag---gcggg--------------------gtccct-gaa--------------------------gc
B D                    Gibbon  --ag---gcggg--------------------gtccct-gaa--------------------------gc
B D                    Rhesus  --ag---gcagg--------------------gtccct-gaa--------------------------gc
B D       Crab-eating macaque  --ag---gcagg--------------------gtccct-gaa--------------------------gc
B D                    Baboon  --ag---gcggg--------------------gtccct-gaa--------------------------gc
B D              Green monkey  --ag---gcggg--------------------gtccct-gaa--------------------------gc
B D                  Marmoset  --ag---gcagg--------------------gtccctggag--------------------------gc
B D           Squirrel monkey  --ag---gcgaa--------------------gtccctggag--------------------------gc
B D                  Bushbaby  --tg---gcagg--------------------gtccct-gga--------------------------gg
           Chinese tree shrew  --ag---gcagggca----------------agtctgt-gga--------------------------gg
B D                  Squirrel  --ca---gcaga---------------------------aga--------------------------ca
       Lesser Egyptian jerboa  --ca---acagg--------------------gccctc-gga--------------------------gg
                 Prairie vole  --ca---acaga---------------------------ag-----------------------------
B D           Chinese hamster  --ca---acaga---------------------------aga--------------------------ag
B D                     Mouse  --ca---gtaca---------------------------gga--------------------------ga
B D                       Rat  --ca---gaaga---------------------------aga--------------------------gg
B D            Naked mole-rat  --ca---gtgg---------------------gtcctt-gca--------------------------cc
B D                Guinea pig  --ca---gtgga--------------------atcctt-gga--------------------------gc
                   Chinchilla  --ca---atgga--------------------atcctt-gga--------------------------gc
             Brush-tailed rat  --ca---ataga--------------------atcctt-gga--------------------------gc
B D                       Pig  --ag---gcagg--------------------g-tccc-tga--------------------------gg
B D                    Alpaca  --ag---gcagg----------------------cccg-gga--------------------------gg
               Bactrian camel  --ag---gcaga----------------------ccca-gga--------------------------gg
B D                   Dolphin  --ag---acggg--------------------gttccc-gga--------------------------ag
                 Killer whale  --ag---atggg--------------------gttccc-gga--------------------------ag
B D                       Cow  --ag---gccgg--------------------gtgtca-cga--------------------------gg
B D                     Sheep  --ag---gccgg--------------------gtgtca-cga--------------------------gg
B D                     Horse  --ag---gcggg--------------------gtccct-gga--------------------------ga
B D          White rhinoceros  --a----gcggg--------------------gtccct-gga--------------------------gg
B D                       Cat  --ag---gcagg--------------------gtcccc-gga--------------------------gg
B D                       Dog  --ag---g--------------------------------------------------------------
B D                   Ferret   --ag---gtggg--------------------gtccct-gga--------------------------gg
B D                     Panda  --ag---gcagg--------------------gtccct-gga--------------------------gg
               Pacific walrus  --ag---gcggg--------------------gtccct-gga--------------------------gg
                 Weddell seal  --ag---acggg--------------------gcccct-gga--------------------------cg
                Big brown bat  --gc---tcgg-----------------------ccct-gga--------------------------gg
B D                  Hedgehog  --ag---gtggg--------------------gtgccc--------------------------------
B D                  Elephant  --ag---gtggg--------------------gtctta-gga--------------------------gg
B D                   Manatee  --ag---gtggg--------------------gtctcc-aca--------------------------gg
                     Aardvark  --ag---gtggg--------------------gtcccc-aga--------------------------aa
B D                   Opossum  --at---gcagggaaagggggggaggagccatgccgga-aaa--------------------------gg
B D           Tasmanian devil  --gt---ccagt-------------------tgttcta-aga--------------------------ag
  D          Peregrine falcon  --catctgccaa--------------------gtgcct-gca---tggtgctgctggtgcagccgtgg--
B D        American alligator  --cttgtg-cag--------------------gaagct-gcaatcagacagggctgtgtcagccccgc--
  D           Green seaturtle  --ca---gcccg--------------------gtacgg-gaa----------------------------
  D  Chinese softshell turtle  --cg---gcggg--------------------ggaggt-gga----------------------------
                  Spotted gar  gggg---gtggg--------------------ggatgg-gg-----------------------------
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
            Black flying-fox  ----------------------------------------------------------------------
B D                    Tenrec  ======================================================================
B D                   Megabat  ----------------------------------------------------------------------
               Domestic goat  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
            Cape golden mole  ======================================================================

                        Human  c--tg------------agacgggg
                        Chimp  c--tg------------agacgggg
                      Gorilla  c--tg------------agacgggg
                    Orangutan  c--t---------------------
                       Gibbon  c--tg------------agacgggg
                       Rhesus  c--tg------------agacgggg
          Crab-eating macaque  c--tg------------agacgggg
                       Baboon  c--tg------------agacgggg
                 Green monkey  c--tg------------agacgggg
                     Marmoset  c--ca------------agacaggg
              Squirrel monkey  c--cg------------agacgggg
                     Bushbaby  c--t--------------cacagag
           Chinese tree shrew  t--cc------------acacccaa
                     Squirrel  c--ag-------------agcaagt
       Lesser Egyptian jerboa  t--tg----------gtcaaagagt
                 Prairie vole  -------------------------
              Chinese hamster  c--ca------------cagtgagt
                        Mouse  c--ca------------tggtgagt
                          Rat  c--ca------------cagtgagt
               Naked mole-rat  c------------------------
                   Guinea pig  cagag-------------agtcagt
                   Chinchilla  c--ag-------------agggagt
             Brush-tailed rat  c-----------------agtgagt
                          Pig  c--ct-------------g-agagt
                       Alpaca  c--ct-------------g-agagt
               Bactrian camel  c--cc-------------g-agagt
                      Dolphin  c--ct-------------g-agagt
                 Killer whale  c--ct-------------g-agagt
                          Cow  c-------------------agggt
                        Sheep  c-------------------agggt
                        Horse  c--ct-------------gaggagt
             White rhinoceros  c--ct-------------gagga--
                          Cat  c--ct-------------gagg---
                          Dog  ---ct-------------gcggaat
                      Ferret   c--ct-------------gaggaat
                        Panda  c--ct-------------gaggaat
               Pacific walrus  c--ct-------------gaggaat
                 Weddell seal  c--ct-------------ggggaat
                Big brown bat  c--c----------------ggagt
                     Hedgehog  -------------------------
                     Elephant  c--ca------------aggagaag
                      Manatee  c--ca------------aggaggag
                     Aardvark  c--ca------------aagagcag
                      Opossum  g--gc--agcctcgctggagggggg
              Tasmanian devil  g--cccaaatgtccagggatggggg
             Peregrine falcon  -------------------------
           American alligator  -------------------------
              Green seaturtle  -------------------------
     Chinese softshell turtle  -------------------------
                  Spotted gar  -------------------------
              Star-nosed mole  =========================
                         Pika  =========================
          Cape elephant shrew  =========================
                        Shrew  =========================
               Golden hamster  =========================
             Black flying-fox  -------------------------
                       Tenrec  =========================
                      Megabat  -------------------------
                Domestic goat  =========================
             Tibetan antelope  =========================
         David's myotis (bat)  =========================
                    Armadillo  =========================
                  Stickleback  =========================
       Yellowbelly pufferfish  =========================
                  Zebra mbuna  =========================
        Burton's mouthbreeder  =========================
                       Lizard  =========================
               Painted turtle  =========================
                       Turkey  =========================
                      Chicken  =========================
                 Mallard duck  =========================
                   Budgerigar  =========================
           Tibetan ground jay  =========================
                  Zebra finch  =========================
          Medium ground finch  =========================
       White-throated sparrow  =========================
          Collared flycatcher  =========================
                 Saker falcon  =========================
                  Rock pigeon  =========================
                     Platypus  =========================
                      Wallaby  =========================
     Mexican tetra (cavefish)  =========================
                         Fugu  =========================
             Cape golden mole  =========================

Inserts between block 17 and 18 in window
B D                   Rhesus 4bp
B D      Crab-eating macaque 4bp
B D                   Baboon 4bp
B D             Green monkey 4bp
B D                 Marmoset 4bp
B D          Squirrel monkey 4bp
B D                 Squirrel 4bp
      Lesser Egyptian jerboa 4bp
B D          Chinese hamster 4bp
B D                    Mouse 4bp
B D                      Rat 4bp
B D               Guinea pig 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp
B D                      Pig 4bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                  Dolphin 4bp
                Killer whale 4bp
B D                    Horse 4bp
B D                      Dog 4bp
B D                  Ferret  4bp
B D                    Panda 4bp
              Pacific walrus 4bp
                Weddell seal 4bp
               Big brown bat 4bp
B D                 Elephant 4bp
B D                  Manatee 4bp
                    Aardvark 4bp
B D                  Opossum 4bp
B D          Tasmanian devil 3bp
  D         Peregrine falcon 5bp
B D       American alligator 6bp
  D          Green seaturtle 4bp
  D Chinese softshell turtle 4bp

Alignment block 18 of 586 in window, 770845 - 770896, 52 bps 
B D                     Human  c-------------tgcctc--t-ggagac---------acctgggctgt--------------------
B D                     Chimp  c-------------tgtctc--t-ggagac---------acctgggctgt--------------------
B D                   Gorilla  c-------------tgcctc--t-ggagac---------acctgggctgt--------------------
B D                 Orangutan  -------------------------gagac---------acctgggctgt--------------------
B D                    Gibbon  c-------------tgcctc--t-ggagac---------acctgggctgt--------------------
B D                    Rhesus  c-------------tgcctc--t-ggagac---------acctgggctgt--------------------
B D       Crab-eating macaque  c-------------tgcctc--t-ggagac---------acctgggctgt--------------------
B D                    Baboon  c-------------tgcctc--t-ggagac---------acctgggctgt--------------------
B D              Green monkey  c-------------tgcctc--t-ggagac---------acctgggctgt--------------------
B D                  Marmoset  c-------------tgcctc--t-ggagac---------acatgggctat--------------------
B D           Squirrel monkey  c-------------tgcctc--t-ggagac---------acgtgggctgt--------------------
B D                  Bushbaby  -------------------------gagac---------actcaggctat--------------------
           Chinese tree shrew  c-------------tgcctc--g-agagcc---------gc-tgggccat--------------------
B D                  Squirrel  c-------------tgcttt--g-ggggat---------gcccagatgaa--------------------
       Lesser Egyptian jerboa  c-------------tgcctc----tgggcc---------acctgggtggt--------------------
                 Prairie vole  -------------------------aggcc---------accaggatca---------------------
B D           Chinese hamster  c----------tgttgtctc----taggcc---------accaggatca---------------------
B D                     Mouse  t----------ccttgtctc----taggcc---------acca---------------------------
B D                       Rat  t----------ccttgtctc----tagacc---------acca---------------------------
B D            Naked mole-rat  -------------------------------------------aggccac--------------------
B D                Guinea pig  c-------------tgcctct-t-gaggac---------acctggaccat--------------------
                   Chinchilla  c-------------tgcctc--t-gaggac---------acctgggccac--------------------
             Brush-tailed rat  c-------------tgcctc--t-gaggac---------a-ctgggccac--------------------
B D                       Pig  c-------------tg-ccc--g-gggggc---------gtccaggatgt--------------------
B D                    Alpaca  c-------------tgcctc--t-ggggac---------acccgggacgc--------------------
               Bactrian camel  c-------------tgcctc--t-ggggac---------acccgggatgc--------------------
B D                   Dolphin  c-------------tgcctc--t-ggggac---------acccgggacat--------------------
                 Killer whale  c-------------tgcctc--t-ggggac---------acccgggacat--------------------
B D                       Cow  -----------------ctc--g-ggggac---------acccaggacat--------------------
B D                     Sheep  -----------------ctc--g-ggggac---------acccaggacat--------------------
B D                     Horse  c-------------tacctc--tggggaac---------acctgggccgt--------------------
B D          White rhinoceros  ------------------------gggcac---------acctgggccgt--------------------
B D                       Cat  ----------------------------------------------------------------------
B D                       Dog  ---------------aggct--g-gcgggc---------atctgggc-at--------------------
B D                   Ferret   t-------------c---------------------------------gt--------------------
B D                     Panda  c-------------catgtc--c-ggggac---------acccgggccat--------------------
               Pacific walrus  c-------------catctc--c-agggac---------acttgggcggt--------------------
                 Weddell seal  c-------------cgtctc--c-agggac---------gcctgggcggt--------------------
             Black flying-fox  ---------------gctct--t-gcgga---------------ggccat--------------------
B D                   Megabat  ---------------gctct--t-gcgga---------------ggccat--------------------
                Big brown bat  c-------------tgcctc--t-ggggac------------tgggccct--------------------
B D                  Hedgehog  ------------------------ggagac---------ccccaccaagc--------------------
B D                  Elephant  tgaagcaggcccacttcctc--t-gtggac---------atctgggccaa--------------------
B D                   Manatee  cgcagcaggcccacttcctc--t-gtggcc---------acctggaccgt--------------------
                     Aardvark  catgacagaactgcatcttc--t-gtggat---------gcccacgccat--------------------
B D                   Opossum  c-------------cacccccaa-ggggctcc-------gccggggctgc--------------------
B D           Tasmanian devil  ----------------------a-gagcacgt-------gccagggat----------------------
  D          Peregrine falcon  ------------------------------ctggggcagacccccgctca--------cactc-------
B D        American alligator  ------------------------------ctgctcctggcacccgctcggtgcagctccctcccgtg--
  D           Green seaturtle  ------------------------------ctgcgct--gctccggttgg--------ccatc-------
  D  Chinese softshell turtle  ------------------------------ct---------tttggctgg--------------------
B D                    Lizard  -------------------------------------------ccactta--------tgatgacatggt
                  Spotted gar  -------------------------gagac---------agacgggtccc--------------------
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
B D                    Tenrec  ======================================================================
               Domestic goat  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
  D            Painted turtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ----------------ctc------------------aggg---ggt----g-c-----------at-c-
                        Chimp  ----------------ctc------------------aggg---ggt----g-c-----------at-c-
                      Gorilla  ----------------ctc------------------aggg---ggt----g-c-----------at-c-
                    Orangutan  ----------------ctc------------------aggg---ggt----g-c-----------at-c-
                       Gibbon  ----------------ctc-------------------ggg---ggt----g-c-----------at-c-
                       Rhesus  ----------------ctc-------------------ggg---ggt----g-c-----------at-c-
          Crab-eating macaque  ----------------ctc-------------------ggg---ggt----g-c-----------at-c-
                       Baboon  ----------------ctc-------------------ggg---ggt----g-c-----------at-c-
                 Green monkey  ----------------ctc------------------aggg---ggt----g-c-----------at-c-
                     Marmoset  ----------------ctc------------------aggg---ggt----g-c-----------at-c-
              Squirrel monkey  ----------------ctc------------------aggg---ggt----g-c-----------at-c-
                     Bushbaby  ----------------ct--------------------gga---ggtggcag-c-----------at-c-
           Chinese tree shrew  ----------------cttg-----------------aggt---ggt----gcc-----------at-c-
                     Squirrel  ----------------tgcaa----------------agag---gca----g-t-----------gt-c-
       Lesser Egyptian jerboa  ----------------gttga----------------tggg---gca----g-c-----------at-c-
                 Prairie vole  --------------------------------------agg---aca----g-c-----------at-c-
              Chinese hamster  --------------------------------------ggg---aca----g-c-----------at-c-
                        Mouse  ---------------------------------------gg---act----g-c-----------at-c-
                          Rat  ---------------------------------------gg---aca----g-c-----------at-c-
               Naked mole-rat  ----------------gtcac----------------aggg---gca----g-c-----------at-c-
                   Guinea pig  ----------------gtcgc-------------------g---gta----g-t-----------gt-c-
                   Chinchilla  ----------------atcac----------------aggg---gca----g-t-----------gt-c-
             Brush-tailed rat  ----------------atcata---------------aggg---gca----g-t-----------gt-c-
                          Pig  ----------------gtgca----------------ggtg---gc------------------------
                       Alpaca  ----------------ctgga----------------ggtg---gca----g-c-----------ac-c-
               Bactrian camel  ----------------ctgga----------------ggtg---gca----g-c-----------ac-c-
                      Dolphin  ----------------ctgga----------------ggtg---gtg----g-c-----------at-c-
                 Killer whale  ----------------ctgga----------------ggtg---gtg----g-c-----------at-c-
                          Cow  ----------------ctgga----------------ggtg---gtg----g-c-----------at-c-
                        Sheep  ----------------ctgga----------------ggtg---gcg----g-c-----------at-c-
                        Horse  ----------------ctgga----------------ggtg---g-------------------------
             White rhinoceros  ----------------ctgga----------------ggtg---g-------------------------
                          Cat  -----------------tggc----------------agcg-------------------------t-c-
                          Dog  ----------------ctggg----------------ggcg---gca----g-c-----------gg-cg
                      Ferret   ----------------ctaga----------------gggg---gca----g-t-----------gt-c-
                        Panda  ----------------ccaga----------------ggtg---gca----g-c-----------ct-c-
               Pacific walrus  ----------------ctaga----------------ggcg---gcg----g-c-----------gt-c-
                 Weddell seal  ----------------ctgga----------------ggcg---gcg----g-c-----------at-c-
             Black flying-fox  ----------------c-gga----------------ggtg---gtg----g-t-----------gt-c-
                      Megabat  ----------------c-gga----------------ggtg---gtg----g-t-----------gt-c-
                Big brown bat  ----------------c-gga----------------ggtg---gtg----g-c-----------at-c-
                     Hedgehog  ----------------ctggg----------------gtga---gcg----a-c----------------
                     Elephant  ----------------c--------------------agcg---ctg----g-ctgcttggtgcagt-c-
                      Manatee  ----------------c--------------------ggca---ctg----g-ccacaggccacagt-c-
                     Aardvark  ----------------c--------------------ggtg---gtg----g-ctacttggtgtagt-c-
                      Opossum  ----------------ttctggccagggtggtccacgggcgtccgga----g-c-----------ctac-
              Tasmanian devil  -------------------------------------ggggcccaga----g-c-----------ac-c-
             Peregrine falcon  gcagcggagcccctgc------------------------------------------------------
           American alligator  gcagggggaagcgtgg------------------------------------------------------
              Green seaturtle  -----agggaccgaga------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
                       Lizard  gtgtcacaaagtaatt------------------------------------------------------
                  Spotted gar  -------------------------------------gagg---gcg----g-c-----------at-c-
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
             Tibetan antelope  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                  Stickleback  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
               Painted turtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                         Fugu  ======================================================================
             Cape golden mole  ======================================================================

                        Human  -taccc-----------------ag--------cag------------------------gt
                        Chimp  -taccc-----------------ag--------cag------------------------gt
                      Gorilla  -taccc-----------------ag--------cag------------------------gt
                    Orangutan  -gaccc-----------------ag--------cag------------------------gt
                       Gibbon  -taccc-----------------ag--------cag------------------------gt
                       Rhesus  -taccc-----------------ag--------cag------------------------gt
          Crab-eating macaque  -taccc-----------------ag--------cag------------------------gt
                       Baboon  -taccc-----------------ag--------cag------------------------gt
                 Green monkey  -taccc-----------------ag--------cag------------------------gt
                     Marmoset  -taccc-----------------ag--------gag------------------------gt
              Squirrel monkey  -taccc-----------------ag--------cag------------------------gt
                     Bushbaby  -cgcct-----------------aa--------caa------------------------gc
           Chinese tree shrew  -caccc-----------------ag--------cag------------------------gc
                     Squirrel  -cacc------------------tg--------cag------------------------gc
       Lesser Egyptian jerboa  -catc-------------------a--------cag------------------------gc
                 Prairie vole  ---------------------------------caa------------------------a-
              Chinese hamster  ---------------------------------caa------------------------g-
                        Mouse  ---------------------------------caa------------------------gc
                          Rat  ---------------------------------caa------------------------gc
               Naked mole-rat  -tgtt------------------gg--------cag------------------------ac
                   Guinea pig  -tgct------------------gg--------cag------------------------at
                   Chinchilla  -tgct------------------gg--------cag------------------------ac
             Brush-tailed rat  -cact------------------gg--------t-g------------------------ac
                          Pig  ----------------------------------ag--------gctcagttcagggccgcc
                       Alpaca  -tgct------------------gc--------cag--------gctgctcc---ggccgcc
               Bactrian camel  -tgct------------------gc--------cag--------gctgctcc---ggccgcc
                      Dolphin  -cgct------------------gg--------cgg--------gctcagttcggggccacc
                 Killer whale  -cgct------------------gg--------cgg--------gctcagttcggggccacc
                          Cow  -tgct------------------cg---------gg--------gcctggcccggggcctcc
                        Sheep  -tgct------------------cg---------gg--------gcctg------------c
                        Horse  -catt------------------gg--------caggtgggctggctcagcaggaaaccacc
             White rhinoceros  -cgct------------------gg--------caggcgggctggctcag----------cc
                          Cat  -cacc------------------gg--------caggccggctggctccgcgggaagccatg
                          Dog  tcact------------------ag--------cagg-cggccggctcagcgggaagccatg
                      Ferret   -cgct------------------gg--------cag-------------gtgggaagccatc
                        Panda  -cacg------------------gg--------cag-------------gcgggtaaccatc
               Pacific walrus  -cact------------------gg--------cgg-------------gcgggaagccatc
                 Weddell seal  -cact------------------gg--------cgg-------------gcgggaagccatc
             Black flying-fox  ------------------------g--------caggcaggcaggctcagcggggaa-cgcc
                      Megabat  ------------------------g--------caggcaggcaggctcagcggggaa-cgcc
                Big brown bat  -cact------------------gg--------caggcaggctggctcagcggggac-cgcg
                     Hedgehog  -tcct------------------gg--------cgt-------------tccgggggccgcc
                     Elephant  -cacc---------------------------------------------------------
                      Manatee  -cgcc---------------------------------------------------------
                     Aardvark  -aacc---------------------------------------------------------
                      Opossum  -ggcca-----------------aggcctcctc-----------------------------
              Tasmanian devil  -tgcca-----------------gg-------------------------------------
             Peregrine falcon  --------------------------------------------------------------
           American alligator  --------------------------------------------------------------
              Green seaturtle  --------------------------------------------------------------
     Chinese softshell turtle  --------------------------------------------------------------
                       Lizard  --------------------------------------------------------------
                  Spotted gar  -acttcctgcaaatgcagagcagag-------------------------------------
              Star-nosed mole  ==============================================================
                         Pika  ==============================================================
          Cape elephant shrew  ==============================================================
                        Shrew  ==============================================================
               Golden hamster  ==============================================================
                       Tenrec  ==============================================================
                Domestic goat  ==============================================================
             Tibetan antelope  ==============================================================
         David's myotis (bat)  ==============================================================
                    Armadillo  ==============================================================
                  Stickleback  ==============================================================
       Yellowbelly pufferfish  ==============================================================
                  Zebra mbuna  ==============================================================
        Burton's mouthbreeder  ==============================================================
               Painted turtle  ==============================================================
                       Turkey  ==============================================================
                      Chicken  ==============================================================
                 Mallard duck  ==============================================================
                   Budgerigar  ==============================================================
           Tibetan ground jay  ==============================================================
                  Zebra finch  ==============================================================
          Medium ground finch  ==============================================================
       White-throated sparrow  ==============================================================
          Collared flycatcher  ==============================================================
                 Saker falcon  ==============================================================
                  Rock pigeon  ==============================================================
                     Platypus  ==============================================================
                      Wallaby  ==============================================================
     Mexican tetra (cavefish)  ==============================================================
                         Fugu  ==============================================================
             Cape golden mole  ==============================================================

Inserts between block 18 and 19 in window
  D Chinese softshell turtle 12bp

Alignment block 19 of 586 in window, 770897 - 770901, 5 bps 
B D                     Human  -----tcatt
B D                     Chimp  -----tcatt
B D                   Gorilla  -----tcatt
B D                 Orangutan  -----tcatt
B D                    Gibbon  -----tcatt
B D                    Rhesus  -----tcatt
B D       Crab-eating macaque  -----tcatt
B D                    Baboon  -----tcatt
B D              Green monkey  -----tcatt
B D                  Marmoset  -----tcatt
B D           Squirrel monkey  -----tcatt
B D                  Bushbaby  -----tcatt
           Chinese tree shrew  -----tcact
B D                  Squirrel  -----ttatt
       Lesser Egyptian jerboa  -----tcact
                 Prairie vole  -----ttact
B D           Chinese hamster  -----ttact
B D                     Mouse  -----ttact
B D                       Rat  -----ttact
B D            Naked mole-rat  -----ttatt
B D                Guinea pig  -----ttatt
                   Chinchilla  -----ttatt
             Brush-tailed rat  -----ttatt
B D                       Pig  -----tcact
B D                    Alpaca  -----tcact
               Bactrian camel  -----tcact
B D                   Dolphin  -----tcact
                 Killer whale  -----tcact
B D                       Cow  -----tcact
B D                     Sheep  -----tcact
B D                     Horse  -----tcact
B D          White rhinoceros  -----tcact
B D                       Cat  -----tcact
B D                       Dog  -----tcact
B D                   Ferret   -----tcatt
B D                     Panda  -----tcact
               Pacific walrus  -----tcact
                 Weddell seal  -----tcact
             Black flying-fox  -----tcact
B D                   Megabat  -----tcact
                Big brown bat  -----tcact
B D                  Hedgehog  -----tcact
B D                  Elephant  -----tcatt
          Cape elephant shrew  -----tcatt
B D                   Manatee  -----tcatt
             Cape golden mole  -----tcatt
                     Aardvark  -----tcatt
B D                   Opossum  -----tcact
  D          Peregrine falcon  -----tcccc
B D        American alligator  -----accct
  D           Green seaturtle  -----accag
B D                    Lizard  -----ttctt
                  Spotted gar  gagag-----
             Star-nosed mole  ==========
B D                      Pika  ==========
B D                     Shrew  ==========
              Golden hamster  ==========
B D                    Tenrec  ==========
               Domestic goat  ==========
            Tibetan antelope  ==========
        David's myotis (bat)  ==========
B D                 Armadillo  ==========
B D               Stickleback  ==========
      Yellowbelly pufferfish  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
  D  Chinese softshell turtle  ==========
  D            Painted turtle  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D              Mallard duck  ==========
B D                Budgerigar  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
B D       Medium ground finch  ==========
  D    White-throated sparrow  ==========
  D       Collared flycatcher  ==========
  D              Saker falcon  ==========
  D               Rock pigeon  ==========
B D                  Platypus  ==========
B D                   Wallaby  ==========
    Mexican tetra (cavefish)  ==========
B D                      Fugu  ==========
B D           Tasmanian devil  ----------

Inserts between block 19 and 20 in window
  D         Peregrine falcon 18bp
B D       American alligator 12bp
  D          Green seaturtle 13bp
B D                   Lizard 12bp

Alignment block 20 of 586 in window, 770902 - 770935, 34 bps 
B D                     Human  tcctgcag---gacag----------------------------ac--gt--gtggt-----caaagctt
B D                     Chimp  tcctgcag---gacag----------------------------ac--gt--gtggt-----caaggctt
B D                   Gorilla  tcctgcag---gacag----------------------------ac--at--gtggt-----caaggctt
B D                 Orangutan  tcctgcag---gacag----------------------------ac--gt--gtggt-----caaggctt
B D                    Gibbon  tcctgcag---gacag----------------------------ac--gt--gcggt-----caaggctt
B D                    Rhesus  tcctgcag---gacag----------------------------ac--gt--gtggt-----cagggctt
B D       Crab-eating macaque  tcctgcag---gacag----------------------------ac--gt--gtggt-----cagggctt
B D                    Baboon  tcctgcag---gacag----------------------------ac--gt--gtggt-----cagggctt
B D              Green monkey  tcctgcag---gacag----------------------------ac--gt--gtggt-----cagggctt
B D                  Marmoset  tcctgcag-------g----------------------------ac--gt--gtggt-----aaaggctt
B D           Squirrel monkey  tcctgcag---gacag----------------------------ac--gt--ggggt-----caaggctt
B D                  Bushbaby  tcctatgg---gaagg----------------------------a----t--gtagt-----caaggctc
           Chinese tree shrew  tcctgcag---gaggg----------------------------ac--gc---tggt-----caaggcgt
B D                  Squirrel  tcctaggg---gacag----------------------------at------gtggt-----tgagtctt
       Lesser Egyptian jerboa  tcctatgg---gatgg----------------------------ac--aa--gtggc-----acaggctc
                 Prairie vole  tcctatag---gatga----------------------------ac--ac--atggtccagactcaacac
B D           Chinese hamster  tcctatag---gatga----------------------------ac--ac--agggt-----ccagactc
B D                     Mouse  tcctatag---gatga----------------------------at--ac--atggt-----ccaggctc
B D                       Rat  tcctacagagtaataa----------------------------at--ac--atgtt-----cgaggctc
B D            Naked mole-rat  tcctgcag---gatgg----------------------------ac--ac--gtggt-----caaggctt
B D                Guinea pig  tcctgcag---gatgg----------------------------ac--ac--atagt-----caaggctc
                   Chinchilla  tcctgtgg---gatgg----------------------------ac--ac--atggt-----caaggctc
             Brush-tailed rat  tcctgcag---gatgg----------------------------ac--ac--atggt-----caaggctc
B D                       Pig  tcctgcag---gacag----------------------------aa--gc--cagat-----caag----
B D                    Alpaca  tcctgtag---gacgg----------------------------ac--gc--caggt-----caaggctt
               Bactrian camel  tcctgtag---gacgg----------------------------at--gc--caggt-----caaggctt
B D                   Dolphin  tcctgcga---gacgg----------------------------ag--gc--caggt-----caag----
                 Killer whale  tcctgcgg---gatgg----------------------------ag--gc--caggt-----caag----
B D                       Cow  tcctgcgg---ggtag----------------------------at--gc--cagtt-----c-ag----
B D                     Sheep  tcctgcgg---ggtag----------------------------at--gc--cagtt-----c-ag----
B D                     Horse  tcctgcag---gacag----------------------------gc--gc--cgggt-----caaagctc
B D          White rhinoceros  tcctgcag---gacag----------------------------gc--gc--cgggt-----caaggctc
B D                       Cat  tcctgcag---aacgg--------------------------------gt--caggc-----caggggtc
B D                       Dog  tcctgcag---gacgg----------------------------------------------------cc
B D                   Ferret   tcctacag---gacag--------------------------------gc--caggt-----cgaggctc
B D                     Panda  tcctgcag---gatgg--------------------------------gt--caggt-----caaggctc
               Pacific walrus  tcctgtag---cacag--------------------------------gt--caggt-----cacggctc
                 Weddell seal  tcctgcag---gacgg--------------------------------gt--caggt-----caaggccc
             Black flying-fox  tcctgcag---gacgg--------------------------------ac-ccaggt-----cagggctc
B D                   Megabat  tcctgcag---gacgg--------------------------------ac-ccaggt-----cagggctc
                Big brown bat  tcctgtgg---gacgg--------------------------------ataccaggt-----ca------
B D                  Hedgehog  tcctgcag---gatgg--------------------------------gt-gcgggt-----caaggctg
B D                  Elephant  tcctgtgg---gacaa----------------------------ac--ac--tcagt-----cacggatg
          Cape elephant shrew  tcctgcag---ggcag----------------------------ac--ac--ttggt-----cacagcta
B D                   Manatee  tcctgtgg---gccag----------------------------gc--ac--tcggt-----cacggctg
             Cape golden mole  tcctgtgg---gatac----------------------------ac--ac--ttggt-----cacggctg
                     Aardvark  tcctgcaa---gacag----------------------------ac--ac--tt-gt-----cacagctg
B D                   Opossum  tcctgtggaaagatgg------------------------------------cgggg-----cggggt--
B D           Tasmanian devil  -----------gatgg------------------------------------gggcc-----cagagc--
  D          Peregrine falcon  ---ggcag---ggtgggcatggtggcacctgcc--tcaccccacag--gt--aagta-----ca------
B D        American alligator  ---cccag---cactgccacgtgtacacttgt----------------gt--gaaga-----cg------
  D           Green seaturtle  ---cctgg---caggg---------cacacga--------gctgca--ag--gagcc-----ca------
  D            Painted turtle  ---tccgg---ggtgg---------cagccgc--------gcgcag--cg--gagct-----aa------
  D  Chinese softshell turtle  -----tga---tg--------------------------------g--at--gagtg-----ca------
B D                    Lizard  --------------------------acctgaaagacagaatttac--ct--aaata-----ca------
                  Spotted gar  tccagtga---gcaga----------------------------accgac--ccggc-------aggctt
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
B D                    Tenrec  ======================================================================
               Domestic goat  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================

                        Human  gggc
                        Chimp  gggc
                      Gorilla  gggc
                    Orangutan  gggc
                       Gibbon  gggc
                       Rhesus  gggc
          Crab-eating macaque  gggc
                       Baboon  gggc
                 Green monkey  gggc
                     Marmoset  -ggc
              Squirrel monkey  -ggc
                     Bushbaby  agtc
           Chinese tree shrew  gggc
                     Squirrel  aggt
       Lesser Egyptian jerboa  a-gc
                 Prairie vole  ----
              Chinese hamster  a-gt
                        Mouse  a-gc
                          Rat  a-ga
               Naked mole-rat  g---
                   Guinea pig  a---
                   Chinchilla  a---
             Brush-tailed rat  a---
                          Pig  ----
                       Alpaca  gggc
               Bactrian camel  gggc
                      Dolphin  ----
                 Killer whale  ----
                          Cow  ----
                        Sheep  ----
                        Horse  aggc
             White rhinoceros  aggc
                          Cat  aggc
                          Dog  gggt
                      Ferret   aggt
                        Panda  aggt
               Pacific walrus  aggt
                 Weddell seal  aggc
             Black flying-fox  tggg
                      Megabat  tggg
                Big brown bat  ----
                     Hedgehog  ga--
                     Elephant  gggc
          Cape elephant shrew  aggt
                      Manatee  gggc
             Cape golden mole  gggt
                     Aardvark  gggc
                      Opossum  -gag
              Tasmanian devil  ----
             Peregrine falcon  ----
           American alligator  ----
              Green seaturtle  ----
               Painted turtle  ----
     Chinese softshell turtle  ----
                       Lizard  ----
                  Spotted gar  gtgc
              Star-nosed mole  ====
                         Pika  ====
                        Shrew  ====
               Golden hamster  ====
                       Tenrec  ====
                Domestic goat  ====
             Tibetan antelope  ====
         David's myotis (bat)  ====
                    Armadillo  ====
                  Stickleback  ====
       Yellowbelly pufferfish  ====
                  Zebra mbuna  ====
        Burton's mouthbreeder  ====
                       Turkey  ====
                      Chicken  ====
                 Mallard duck  ====
                   Budgerigar  ====
           Tibetan ground jay  ====
                  Zebra finch  ====
          Medium ground finch  ====
       White-throated sparrow  ====
          Collared flycatcher  ====
                 Saker falcon  ====
                  Rock pigeon  ====
                     Platypus  ====
                      Wallaby  ====
     Mexican tetra (cavefish)  ====
                         Fugu  ====

Alignment block 21 of 586 in window, 770936 - 770942, 7 bps 
B D                     Human  aaaagca---
B D                     Chimp  aaaagca---
B D                   Gorilla  aaaagca---
B D                 Orangutan  aaaagca---
B D                    Gibbon  aaaagca---
B D                    Rhesus  aaaagca---
B D       Crab-eating macaque  aaaagca---
B D                    Baboon  aaaagca---
B D              Green monkey  aaaagca---
B D                  Marmoset  acccgca---
B D           Squirrel monkey  acccgca---
B D                  Bushbaby  tctggca---
           Chinese tree shrew  accagca---
B D                  Squirrel  agctgta---
       Lesser Egyptian jerboa  gccagca---
                 Prairie vole  --cagca---
B D           Chinese hamster  accagca---
B D                     Mouse  accagca---
B D                       Rat  accagca---
B D            Naked mole-rat  ----gca---
B D                Guinea pig  ----gca---
                   Chinchilla  ----gca---
             Brush-tailed rat  ----gca---
B D                    Alpaca  agcagtg---
               Bactrian camel  agcaatg---
B D                     Horse  accagca---
B D          White rhinoceros  accggca---
B D                       Cat  tccggca---
B D                       Dog  tccggtg---
B D                   Ferret   tccagca---
B D                     Panda  tccggca---
               Pacific walrus  tccagca---
                 Weddell seal  tcccgca---
             Black flying-fox  cccggct---
B D                   Megabat  cccggct---
                Big brown bat  ---agca---
B D                  Elephant  cccagca---
          Cape elephant shrew  accttca---
B D                   Manatee  cccggta---
             Cape golden mole  gccctcg---
                     Aardvark  accag-a---
B D                   Opossum  gcttgcc---
B D           Tasmanian devil  acctgcc---
B D             X. tropicalis  tcc-------
                  Spotted gar  ---tgcagct
             Star-nosed mole  ==========
B D                      Pika  ==========
B D                  Hedgehog  ----------
B D                     Shrew  ==========
              Golden hamster  ==========
B D                    Tenrec  ==========
B D                       Pig  ----------
B D                   Dolphin  ----------
                Killer whale  ----------
B D                       Cow  ----------
               Domestic goat  ==========
B D                     Sheep  ----------
            Tibetan antelope  ==========
        David's myotis (bat)  ==========
B D                 Armadillo  ==========
B D               Stickleback  ==========
      Yellowbelly pufferfish  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
B D                    Lizard  ----------
  D  Chinese softshell turtle  ----------
  D            Painted turtle  ----------
  D           Green seaturtle  ----------
B D                    Turkey  ==========
B D                   Chicken  ==========
  D              Mallard duck  ==========
B D                Budgerigar  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
B D       Medium ground finch  ==========
  D    White-throated sparrow  ==========
  D       Collared flycatcher  ==========
  D          Peregrine falcon  ----------
  D              Saker falcon  ==========
  D               Rock pigeon  ==========
B D                  Platypus  ==========
B D                   Wallaby  ==========
    Mexican tetra (cavefish)  ==========
B D                      Fugu  ==========
B D        American alligator  ----------

Inserts between block 21 and 22 in window
          Chinese tree shrew 2170bp
B D                 Squirrel 38bp
      Lesser Egyptian jerboa 26bp
                Prairie vole 29bp
B D          Chinese hamster 29bp
B D                    Mouse 29bp
B D                      Rat 27bp
B D           Naked mole-rat 8bp
B D               Guinea pig 6bp
                  Chinchilla 6bp
            Brush-tailed rat 5bp
B D                   Alpaca 27bp
              Bactrian camel 27bp
B D                    Horse 27bp
B D         White rhinoceros 27bp
            Black flying-fox 8bp
B D                  Megabat 8bp
               Big brown bat 7bp

Alignment block 22 of 586 in window, 770943 - 770971, 29 bps 
B D                     Human  cc-gggtgcagctctg---a--tgtggcag------------gaatg
B D                     Chimp  cc-gggtgcagctctgctga--tgtggcag------------gaatg
B D                   Gorilla  cc-gggtgcagctctgctga--tgtggcag------------gaatg
B D                 Orangutan  cc-aggtgcagctctgctga--tgtggcag------------gaatg
B D                    Gibbon  cc-cggtgcagctctgctga--tgtggcag------------gaatg
B D                    Rhesus  cc-gggtgcagctctgctga--tatggcag------------gaatg
B D       Crab-eating macaque  cc-gggtgcagctctgctga--tatggcag------------gaatg
B D                    Baboon  cc-gggtgcagctctgctga--tatggcag------------gaatg
B D              Green monkey  cc-gggtgcagctctgctga--tatggcaa------------gaagg
B D                  Marmoset  cc-tggagcagctctgcgga--tgtggcag------------gaatg
B D           Squirrel monkey  cc-tggagcggctctgcgga--tgtggcag------------gaatg
B D                  Bushbaby  tg-cagctcattactgccca--tgtggcagtggccccgtgaagaacc
B D                  Squirrel  -t-agaggg---gccagt----caaggcag------------gaatc
       Lesser Egyptian jerboa  -c-aaaggg---gcaggtca--caaggcgg------------gaatc
                 Prairie vole  -c-agaggga--gccagtca--caaagcag------------gaatc
B D           Chinese hamster  -c-agaggga--gccagtca--caaagca-------------gaatc
B D                     Mouse  -c-agaggga--gccagtca--caaagcgg------------gaacc
B D                       Rat  -c-aggggca--gccagtca--caaagcag------------taatc
B D            Naked mole-rat  -c-agagg----agcagtca--tggggcag------------g--tg
B D                Guinea pig  -c-aaagg----agcagtca--cagggcag------------g--tc
                   Chinchilla  -c-agagg----agcagtta--ca-ggcag------------a--tc
             Brush-tailed rat  -c-agagg----agtggtca--cagggcag------------c--tc
B D                       Pig  ----gctgggccatcggt-------ggcag------------gatcc
B D                    Alpaca  ----gcaaagggcttgctca--caagccag------------gaacc
               Bactrian camel  ----gcaaagggcttgctca--caagccag------------gaacc
B D                   Dolphin  ----gcaaaggggccagtca--caaggcag------------cgtcc
                 Killer whale  ----gcaaaggggccagtca--caaggcag------------cgtcc
B D                       Cow  ----acaaaggggctgggca--ccaggcgg------------ggtcc
B D                     Sheep  ----acacaggggccgggca--ccaggc-g------------ggccc
B D                     Horse  ----gcagaagggcc-tgta--cgagccag------------g----
B D          White rhinoceros  ----gcaacagggccgctta--tgagccag------------gaacc
B D                       Cat  --------aagggcctgcga--ggagccag------------gagcc
B D                       Dog  --------aagggccagtca--ggaagcag------------aagcc
B D                   Ferret   --------aaaggctggtca--ggaaccag------------gaccc
B D                     Panda  --------aaggggtggtca--ggagccag------------gatca
               Pacific walrus  --------aagggctggtca--gcagccag------------tatcc
                 Weddell seal  --------aagggctggtca--gcagccca------------catcc
             Black flying-fox  ----gcggaggagctacgca--cgtgccgg------------aaccc
B D                   Megabat  ----gcggaggagctgcgca--cgtgccgg------------aaccc
                Big brown bat  ----tcacagggaccgtg-----gcccagc------------agccc
B D                  Hedgehog  ----gcgtgaggacc---cg--cgagcccc------------cagcc
B D                  Elephant  -------------------------cccag------------gcccc
          Cape elephant shrew  -------------------------ctaag------------gcctc
B D                   Manatee  -------------------------cccag------------cccca
             Cape golden mole  -------------------------cccag------------g----
                     Aardvark  -------------------------cccag------------gccct
B D                   Opossum  -c-ggccgggctcctgaggc--tgggccac------------aagcg
B D           Tasmanian devil  -agggatggggcccagagta--cgtgccag------------ggatg
  D          Peregrine falcon  -----------------------ggggcag------------aggtg
B D        American alligator  -------------------g--cgtggcgc------------aggtg
  D           Green seaturtle  -----------------------gtggccc------------tgggc
  D            Painted turtle  -----------------------gg-----------------caggc
  D  Chinese softshell turtle  -----------------------gggccct------------cggcc
B D                    Lizard  -----------------------aaatccc------------agctt
B D             X. tropicalis  ----ccggattacctgctct--gatattat------------gagac
                  Spotted gar  -------tctggactggacagtcctggccg------------gaacg
             Star-nosed mole  ===============================================
B D                      Pika  ===============================================
B D                     Shrew  ===============================================
              Golden hamster  ===============================================
B D                    Tenrec  ===============================================
               Domestic goat  ===============================================
            Tibetan antelope  ===============================================
        David's myotis (bat)  ===============================================
B D                 Armadillo  ===============================================
          Chinese tree shrew  ===============================================
B D               Stickleback  ===============================================
      Yellowbelly pufferfish  ===============================================
                 Zebra mbuna  ===============================================
       Burton's mouthbreeder  ===============================================
B D                    Turkey  ===============================================
B D                   Chicken  ===============================================
  D              Mallard duck  ===============================================
B D                Budgerigar  ===============================================
          Tibetan ground jay  ===============================================
B D               Zebra finch  ===============================================
B D       Medium ground finch  ===============================================
  D    White-throated sparrow  ===============================================
  D       Collared flycatcher  ===============================================
  D              Saker falcon  ===============================================
  D               Rock pigeon  ===============================================
B D                  Platypus  ===============================================
B D                   Wallaby  ===============================================
    Mexican tetra (cavefish)  ===============================================
B D                      Fugu  ===============================================

Inserts between block 22 and 23 in window
B D                    Horse 4bp
               Big brown bat 7bp
B D       American alligator 3bp
  D          Green seaturtle 6bp
  D           Painted turtle 4bp
  D Chinese softshell turtle 9bp
B D                   Lizard 25bp
B D            X. tropicalis 1bp

Alignment block 23 of 586 in window, 770972 - 770972, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  -t
B D                  Squirrel  -c
       Lesser Egyptian jerboa  -c
                 Prairie vole  -c
B D           Chinese hamster  -c
B D                     Mouse  -c
B D                       Rat  -c
B D            Naked mole-rat  -c
B D                Guinea pig  -c
                   Chinchilla  -c
             Brush-tailed rat  -c
B D                       Pig  -c
B D                    Alpaca  -c
               Bactrian camel  -c
B D                   Dolphin  -c
                 Killer whale  -c
B D                       Cow  -c
B D                     Sheep  -c
B D          White rhinoceros  -g
B D                       Cat  -c
B D                       Dog  -g
B D                   Ferret   -t
B D                     Panda  -t
               Pacific walrus  -c
                 Weddell seal  -c
B D                  Hedgehog  -c
B D                  Elephant  -a
          Cape elephant shrew  -g
B D                   Manatee  -c
                     Aardvark  -g
  D           Green seaturtle  -t
  D            Painted turtle  -t
  D  Chinese softshell turtle  -t
B D                    Lizard  -t
                  Spotted gar  g-
             Star-nosed mole  ==
B D                      Pika  ==
B D                     Shrew  ==
              Golden hamster  ==
            Black flying-fox  --
B D                    Tenrec  ==
B D                   Megabat  --
               Big brown bat  ==
               Domestic goat  ==
            Tibetan antelope  ==
        David's myotis (bat)  ==
B D                 Armadillo  ==
B D                     Horse  ==
          Chinese tree shrew  ==
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
B D             X. tropicalis  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  --
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                  Platypus  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
B D                      Fugu  ==
B D        American alligator  ==
B D                   Opossum  --
B D           Tasmanian devil  --
            Cape golden mole  --

Inserts between block 23 and 24 in window
B D                      Pig 13bp
B D                   Alpaca 13bp
              Bactrian camel 13bp
B D                  Dolphin 12bp
                Killer whale 12bp
B D                      Cow 10bp
B D                    Sheep 8bp
B D         White rhinoceros 12bp
B D                      Cat 48bp
B D                      Dog 26bp
B D                  Ferret  19bp
B D                    Panda 14bp
              Pacific walrus 12bp
                Weddell seal 12bp
B D                 Hedgehog 15bp
B D                 Elephant 9bp
         Cape elephant shrew 11bp
B D                  Manatee 2bp
                    Aardvark 15bp

Alignment block 24 of 586 in window, 770973 - 770973, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
B D                     Mouse  g
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  a
B D                   Dolphin  g
                 Killer whale  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  c
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  g
  D          Peregrine falcon  g
  D           Green seaturtle  g
  D            Painted turtle  g
  D  Chinese softshell turtle  g
                  Spotted gar  g
             Star-nosed mole  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
              Golden hamster  =
B D                    Tenrec  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D                 Armadillo  =
          Chinese tree shrew  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D             X. tropicalis  =
B D                    Lizard  -
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  =
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D                   Opossum  -
B D           Tasmanian devil  -

Inserts between block 24 and 25 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                 Elephant 4bp
         Cape elephant shrew 4bp
B D                  Manatee 4bp
            Cape golden mole 4bp
                    Aardvark 4bp
  D         Peregrine falcon 563bp

Alignment block 25 of 586 in window, 770974 - 770974, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  g
                   Chinchilla  c
             Brush-tailed rat  c
B D                       Pig  c
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
B D                       Cow  g
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  c
B D                   Opossum  c
  D               Rock pigeon  t
  D              Saker falcon  c
  D          Peregrine falcon  c
  D       Collared flycatcher  c
  D    White-throated sparrow  c
B D       Medium ground finch  c
B D               Zebra finch  c
  D           Green seaturtle  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
B D                    Lizard  t
                  Spotted gar  c
             Star-nosed mole  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
              Golden hamster  =
B D                    Tenrec  =
B D                  Marmoset  -
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D                 Armadillo  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D                  Platypus  =
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D           Tasmanian devil  -

Alignment block 26 of 586 in window, 770975 - 770975, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  t
                 Prairie vole  c
B D           Chinese hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
B D                       Cow  c
B D                     Sheep  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Hedgehog  c
B D                  Elephant  g
          Cape elephant shrew  t
B D                   Manatee  c
             Cape golden mole  c
                     Aardvark  c
B D                   Opossum  c
  D               Rock pigeon  c
  D              Saker falcon  c
  D          Peregrine falcon  c
  D       Collared flycatcher  c
  D    White-throated sparrow  c
B D       Medium ground finch  c
B D               Zebra finch  c
           Tibetan ground jay  c
  D           Green seaturtle  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
B D                    Lizard  c
                  Spotted gar  c
             Star-nosed mole  =
B D                      Pika  =
B D                     Shrew  =
              Golden hamster  =
B D                    Tenrec  =
               Domestic goat  =
            Tibetan antelope  =
B D                 Armadillo  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                  Platypus  =
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D           Tasmanian devil  -

Inserts between block 26 and 27 in window
  D              Rock pigeon 3bp
B D                   Lizard 1bp

Alignment block 27 of 586 in window, 770976 - 770977, 2 bps 
B D                     Human  ca
B D                     Chimp  ca
B D                   Gorilla  ca
B D                 Orangutan  ca
B D                    Gibbon  ca
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D                    Baboon  ca
B D              Green monkey  ca
B D                  Marmoset  ca
B D           Squirrel monkey  ca
B D                  Bushbaby  tg
           Chinese tree shrew  ag
B D                  Squirrel  aa
       Lesser Egyptian jerboa  ta
                 Prairie vole  aa
B D           Chinese hamster  -a
B D                     Mouse  aa
B D                       Rat  aa
B D            Naked mole-rat  ca
B D                Guinea pig  ca
                   Chinchilla  ca
             Brush-tailed rat  cg
B D                       Pig  ca
B D                    Alpaca  cc
               Bactrian camel  cc
B D                   Dolphin  ca
                 Killer whale  ca
B D                       Cow  cg
B D                     Sheep  cg
B D                     Horse  tg
B D          White rhinoceros  ca
B D                       Cat  ca
B D                       Dog  cc
B D                   Ferret   ca
B D                     Panda  cc
               Pacific walrus  ca
                 Weddell seal  ca
             Black flying-fox  cg
B D                   Megabat  cg
                Big brown bat  ca
         David's myotis (bat)  ca
B D                  Hedgehog  cg
B D                  Elephant  ag
          Cape elephant shrew  cg
B D                   Manatee  tg
             Cape golden mole  cg
                     Aardvark  cg
B D                   Opossum  cc
B D           Tasmanian devil  -g
  D               Rock pigeon  cc
  D              Saker falcon  ca
  D          Peregrine falcon  ca
  D       Collared flycatcher  ca
  D    White-throated sparrow  ca
B D       Medium ground finch  ca
B D               Zebra finch  ca
           Tibetan ground jay  ca
B D                Budgerigar  ca
  D                    Parrot  ca
  D             Scarlet macaw  ca
B D        American alligator  ct
  D           Green seaturtle  tg
  D            Painted turtle  tg
  D  Chinese softshell turtle  tc
B D                    Lizard  c-
                  Spotted gar  t-
B D                   Lamprey  ca
             Star-nosed mole  ==
B D                      Pika  ==
B D                     Shrew  ==
              Golden hamster  ==
B D                    Tenrec  ==
               Domestic goat  ==
            Tibetan antelope  ==
B D                 Armadillo  ==
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
B D             X. tropicalis  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                  Platypus  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
B D                      Fugu  ==

Inserts between block 27 and 28 in window
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp

Alignment block 28 of 586 in window, 770978 - 770979, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Bushbaby  cc
           Chinese tree shrew  cc
B D                  Squirrel  ag
       Lesser Egyptian jerboa  gc
                 Prairie vole  ac
B D           Chinese hamster  at
B D                     Mouse  ac
B D                       Rat  a-
B D            Naked mole-rat  gg
B D                Guinea pig  gg
                   Chinchilla  gg
             Brush-tailed rat  gg
B D                       Pig  ag
B D                    Alpaca  aa
               Bactrian camel  aa
B D                   Dolphin  ag
                 Killer whale  ag
B D                       Cow  cg
B D                     Sheep  cg
B D                     Horse  cc
B D          White rhinoceros  cc
B D                       Cat  cg
B D                       Dog  ca
B D                   Ferret   cg
B D                     Panda  ag
               Pacific walrus  cg
                 Weddell seal  cg
             Black flying-fox  cc
B D                   Megabat  cc
                Big brown bat  tc
         David's myotis (bat)  tc
B D                  Hedgehog  cc
B D                  Elephant  cc
          Cape elephant shrew  gc
B D                   Manatee  cc
             Cape golden mole  cc
                     Aardvark  ct
B D                   Opossum  gg
B D           Tasmanian devil  gg
B D                   Lamprey  cg
             Star-nosed mole  ==
B D                      Pika  ==
B D                     Shrew  ==
              Golden hamster  ==
B D                    Tenrec  ==
B D                    Baboon  --
               Domestic goat  ==
            Tibetan antelope  ==
B D                 Armadillo  ==
                 Spotted gar  --
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
B D             X. tropicalis  ==
B D                    Lizard  --
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
  D             Scarlet macaw  --
  D                    Parrot  --
B D                Budgerigar  --
          Tibetan ground jay  --
B D               Zebra finch  --
B D       Medium ground finch  --
  D    White-throated sparrow  --
  D       Collared flycatcher  --
  D          Peregrine falcon  --
  D              Saker falcon  --
  D               Rock pigeon  --
B D                  Platypus  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
B D                      Fugu  ==
B D        American alligator  --
B D              Green monkey  --
B D       Crab-eating macaque  --
B D                    Rhesus  --

Alignment block 29 of 586 in window, 770980 - 770981, 2 bps 
B D                     Human  ct-
B D                     Chimp  ct-
B D                   Gorilla  ct-
B D                 Orangutan  ct-
B D                    Gibbon  ct-
B D                  Marmoset  ct-
B D           Squirrel monkey  ct-
B D                  Bushbaby  cc-
           Chinese tree shrew  cc-
B D                  Squirrel  cc-
       Lesser Egyptian jerboa  cc-
                 Prairie vole  cc-
B D           Chinese hamster  cc-
B D                     Mouse  cc-
B D                       Rat  cc-
B D            Naked mole-rat  cc-
B D                Guinea pig  tc-
                   Chinchilla  tc-
             Brush-tailed rat  tc-
B D                       Pig  gg-
B D                    Alpaca  aa-
               Bactrian camel  ag-
B D                   Dolphin  gc-
                 Killer whale  gc-
B D                       Cow  gc-
B D                     Sheep  gc-
B D                     Horse  gc-
B D          White rhinoceros  gc-
B D                       Cat  gc-
B D                       Dog  tc-
B D                   Ferret   gc-
B D                     Panda  gt-
               Pacific walrus  gc-
                 Weddell seal  gc-
             Black flying-fox  gc-
B D                   Megabat  gc-
                Big brown bat  ac-
         David's myotis (bat)  gc-
B D                  Hedgehog  tc-
B D                  Elephant  c--
          Cape elephant shrew  t--
B D                   Manatee  c--
             Cape golden mole  c--
                     Aardvark  c--
B D                   Opossum  c--
B D           Tasmanian devil  c--
  D               Rock pigeon  -t-
  D              Saker falcon  -c-
  D          Peregrine falcon  -c-
  D       Collared flycatcher  -t-
  D    White-throated sparrow  -t-
B D       Medium ground finch  -t-
B D               Zebra finch  -t-
           Tibetan ground jay  -t-
B D                Budgerigar  -t-
  D                    Parrot  -c-
  D             Scarlet macaw  -c-
  D              Mallard duck  -t-
B D        American alligator  -c-
  D           Green seaturtle  -c-
  D            Painted turtle  -c-
  D  Chinese softshell turtle  -c-
B D                    Lizard  -c-
B D                Coelacanth  -c-
B D                   Lamprey  -tt
             Star-nosed mole  ===
B D                      Pika  ===
B D                     Shrew  ===
              Golden hamster  ===
B D                    Tenrec  ===
B D                    Baboon  ---
               Domestic goat  ===
            Tibetan antelope  ===
B D                 Armadillo  ===
                 Spotted gar  ---
B D               Stickleback  ===
      Yellowbelly pufferfish  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
B D             X. tropicalis  ===
B D                    Turkey  ===
B D                   Chicken  ===
B D                  Platypus  ===
B D                   Wallaby  ===
    Mexican tetra (cavefish)  ===
B D                      Fugu  ===
B D              Green monkey  ---
B D       Crab-eating macaque  ---
B D                    Rhesus  ---

Inserts between block 29 and 30 in window
B D                      Dog 3bp
            Black flying-fox 4bp
B D                  Megabat 4bp
               Big brown bat 4bp
        David's myotis (bat) 4bp
B D                 Hedgehog 4bp
  D              Rock pigeon 3bp
  D             Saker falcon 3bp
  D         Peregrine falcon 3bp
  D      Collared flycatcher 3bp
  D   White-throated sparrow 3bp
B D      Medium ground finch 3bp
B D              Zebra finch 3bp
          Tibetan ground jay 3bp
B D               Budgerigar 3bp
  D                   Parrot 3bp
  D            Scarlet macaw 3bp
  D             Mallard duck 3bp
B D       American alligator 3bp
  D          Green seaturtle 24bp
  D           Painted turtle 24bp
  D Chinese softshell turtle 206bp
B D                   Lizard 3bp
B D               Coelacanth 1bp

Alignment block 30 of 586 in window, 770982 - 770984, 3 bps 
B D                     Human  ggt-
B D                     Chimp  ggt-
B D                   Gorilla  ggt-
B D                 Orangutan  ggt-
B D                    Gibbon  ggt-
B D                  Marmoset  ggt-
B D           Squirrel monkey  ggt-
B D                  Bushbaby  agg-
           Chinese tree shrew  agc-
B D                  Squirrel  ctt-
       Lesser Egyptian jerboa  cat-
                 Prairie vole  ctt-
B D           Chinese hamster  ctt-
B D                     Mouse  ttg-
B D                       Rat  tca-
B D            Naked mole-rat  -tt-
B D                Guinea pig  --t-
                   Chinchilla  --t-
             Brush-tailed rat  --t-
B D                    Lizard  --c-
B D             X. tropicalis  --t-
B D                Coelacanth  --t-
B D                   Lamprey  -gtc
             Star-nosed mole  ====
B D                      Pika  ====
         Cape elephant shrew  ----
B D                  Hedgehog  ====
B D                     Shrew  ====
              Golden hamster  ====
            Black flying-fox  ====
B D                    Tenrec  ====
B D                    Baboon  ----
B D                       Pig  ----
B D                   Dolphin  ----
                Weddell seal  ----
B D                   Megabat  ====
                Killer whale  ----
B D                     Panda  ----
               Big brown bat  ====
B D                       Cow  ----
               Domestic goat  ====
B D                     Sheep  ----
            Tibetan antelope  ====
        David's myotis (bat)  ====
B D                 Armadillo  ====
B D                   Manatee  ----
B D                  Elephant  ----
B D          White rhinoceros  ----
B D                     Horse  ----
              Bactrian camel  ----
B D                    Alpaca  ----
B D                       Dog  ====
B D                   Ferret   ----
B D                       Cat  ----
              Pacific walrus  ----
                 Spotted gar  ----
B D               Stickleback  ====
      Yellowbelly pufferfish  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
  D             Scarlet macaw  ====
  D                    Parrot  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D       Collared flycatcher  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D                  Platypus  ====
B D                   Wallaby  ====
    Mexican tetra (cavefish)  ====
B D                      Fugu  ====
B D        American alligator  ====
B D                   Opossum  ----
B D           Tasmanian devil  ----
            Cape golden mole  ----
                    Aardvark  ----
B D              Green monkey  ----
B D       Crab-eating macaque  ----
B D                    Rhesus  ----

Inserts between block 30 and 31 in window
B D                   Lizard 4bp
B D               Coelacanth 3bp

Alignment block 31 of 586 in window, 770985 - 770985, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  a
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  t
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  g
         David's myotis (bat)  g
B D                  Elephant  a
          Cape elephant shrew  g
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  g
B D                   Opossum  a
B D           Tasmanian devil  a
  D               Rock pigeon  g
  D              Saker falcon  g
  D          Peregrine falcon  g
  D       Collared flycatcher  g
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D               Zebra finch  g
           Tibetan ground jay  g
B D                Budgerigar  a
  D                    Parrot  a
  D             Scarlet macaw  a
  D              Mallard duck  g
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  g
B D             X. tropicalis  g
B D                   Lamprey  a
             Star-nosed mole  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
              Golden hamster  =
B D                    Tenrec  =
B D                       Pig  -
B D                   Dolphin  -
                Weddell seal  -
                Killer whale  -
B D                     Panda  -
B D                       Cow  -
               Domestic goat  =
B D                     Sheep  -
            Tibetan antelope  =
B D                 Armadillo  =
B D          White rhinoceros  -
B D                     Horse  -
              Bactrian camel  -
B D                    Alpaca  -
B D                       Dog  =
B D                   Ferret   -
B D                       Cat  -
              Pacific walrus  -
                 Spotted gar  -
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
B D                    Turkey  =
B D                   Chicken  =
B D                  Platypus  =
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =

Inserts between block 31 and 32 in window
               Big brown bat 1bp
B D                 Elephant 16bp
         Cape elephant shrew 21bp
B D                  Manatee 16bp
            Cape golden mole 17bp
                    Aardvark 35bp
B D       American alligator 17bp
  D          Green seaturtle 433bp
  D           Painted turtle 8bp

Alignment block 32 of 586 in window, 770986 - 770986, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  g
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  t
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
B D                       Cow  c
B D                     Sheep  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Hedgehog  g
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  a
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                   Opossum  c
B D             X. tropicalis  t
B D                Coelacanth  c
     Mexican tetra (cavefish)  c
                  Spotted gar  c
B D                   Lamprey  t
B D                      Pika  =
B D                     Shrew  =
              Golden hamster  =
               Domestic goat  =
            Tibetan antelope  =
B D                 Armadillo  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  -
  D             Scarlet macaw  -
  D                    Parrot  -
B D                Budgerigar  -
          Tibetan ground jay  -
B D               Zebra finch  -
B D       Medium ground finch  -
  D    White-throated sparrow  -
  D       Collared flycatcher  -
  D          Peregrine falcon  -
  D              Saker falcon  -
  D               Rock pigeon  -
B D                  Platypus  =
B D                   Wallaby  =
B D                      Fugu  =
B D        American alligator  =
B D           Tasmanian devil  -

Inserts between block 32 and 33 in window
B D            X. tropicalis 1bp
B D               Coelacanth 1bp

Alignment block 33 of 586 in window, 770987 - 770987, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B