Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 473 in window, 62812003 - 62812004, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
           Chinese tree shrew  ga
B D                  Squirrel  ga
       Lesser Egyptian jerboa  ga
                 Prairie vole  ga
B D           Chinese hamster  ga
               Golden hamster  ga
B D                     Mouse  ga
B D                       Rat  ga
B D            Naked mole-rat  ga
B D                Guinea pig  ga
                   Chinchilla  ga
             Brush-tailed rat  ga
B D                    Rabbit  ga
B D                      Pika  ga
B D                       Pig  ga
B D                    Alpaca  ga
               Bactrian camel  ga
B D                   Dolphin  ga
                 Killer whale  ga
             Tibetan antelope  ga
B D                       Cow  ga
B D                     Sheep  ga
                Domestic goat  ga
B D                     Horse  ga
B D          White rhinoceros  ga
B D                       Cat  ga
B D                       Dog  ga
B D                   Ferret   ga
B D                     Panda  ga
               Pacific walrus  ga
                 Weddell seal  ga
             Black flying-fox  gg
B D                   Megabat  gg
                Big brown bat  ga
         David's myotis (bat)  ga
B D                  Microbat  ga
B D                  Hedgehog  gt
B D                     Shrew  ga
              Star-nosed mole  ga
B D                  Elephant  ga
          Cape elephant shrew  ga
B D                   Manatee  ga
             Cape golden mole  ga
B D                    Tenrec  ga
                     Aardvark  aa
B D                 Armadillo  ga
B D                   Opossum  ga
B D           Tasmanian devil  ga
B D                  Platypus  ga
  D              Saker falcon  ga
  D          Peregrine falcon  ga
B D               Zebra finch  ga
           Tibetan ground jay  ga
  D           Green seaturtle  gg
  D            Painted turtle  ga
  D  Chinese softshell turtle  ga
  D    Spiny softshell turtle  ga
B D             X. tropicalis  ga
B D                Coelacanth  ga
B D               Stickleback  ta
B D                 Zebrafish  ta
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D                      Fugu  ==
      Yellowbelly pufferfish  ==
B D                 Tetraodon  ==
                 Zebra mbuna  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
    Mexican tetra (cavefish)  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
  D       Collared flycatcher  ==
          Southern platyfish  ==
B D                Budgerigar  ==
  D             Scarlet macaw  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D                   Chicken  ==
B D                    Lizard  ==
B D                    Medaka  ==
  D                    Parrot  ==
B D                   Wallaby  NN
  D               Rock pigeon  ==
  D              Mallard duck  ==
B D        American alligator  ==

Inserts between block 1 and 2 in window
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp

Alignment block 2 of 473 in window, 62812005 - 62812056, 52 bps 
B D                     Human  aaagtattta-tttaca----ctata---gtc-----aca-a-a----cc------atc-cattatctg-
B D                     Chimp  aaagtattta-tttaca----ctata---gtc-----aca-a-a----cc------atc-cattatctg-
B D                   Gorilla  aaagtattta-tttaca----ctata---gtc-----aca-a-a----cc------atc-catcatctg-
B D                 Orangutan  aaagtattta-tttaca----ctata---gtc-----aca-a-a----cc------atc-cattatctg-
B D                    Gibbon  aaagtattta-tttaca----ctata---gtc-----aca-a-a----cc------atc-cattatctg-
B D                    Rhesus  aaagtattta-tttaca----ctata---gtc-----aca-a-a----cc------atc-cattatctg-
B D       Crab-eating macaque  aaagtattta-tttaca----ctata---gtc-----aca-a-a----cc------atc-cattatctg-
B D                    Baboon  aaagtattta-tttaca----ctata---gtc-----aca-a-a----cc------atc-cattatctg-
B D              Green monkey  aaagtattta-tttaca----ctata---gtc-----aca-a-a----cc------atc-cattatctg-
B D                  Marmoset  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
B D           Squirrel monkey  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
B D                  Bushbaby  aaagtattta-tttaca----ctata---gtc-----ata-a-a--------------c-cattatctg-
           Chinese tree shrew  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
B D                  Squirrel  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
       Lesser Egyptian jerboa  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
                 Prairie vole  aaagtattta-tttaca----ccata---gtc-----ata-a-a----cc------atc-cagtatctg-
B D           Chinese hamster  aaagtattta-tttaca----ccata---gtc-----ata-a-a----ca------atc-cattatctg-
               Golden hamster  aaagtattta-tttaca----ccata---gtc-----ata-a-a----cc------atc-cattatctg-
B D                     Mouse  aaagtattta-tttaca----ccata---gtc---a-ata-a-g----cc------atc-cattatctg-
B D                       Rat  aaagtatttattttaca----ccatt---gcc-----ata-a-g----cc------gtc-cgatatctg-
B D            Naked mole-rat  aaagtattta-tttaca----ctatt---gtc-----ata-a-g----cc------atc-cattatttg-
B D                Guinea pig  aaagtattta-tttaca----ctata---gtc-------a-a-g----cc------att-cattatttg-
                   Chinchilla  aaagtattta-tttaca----ctata---gtc-----ata-a-g----cc------att-cattatttg-
             Brush-tailed rat  aaagtattta-tttaca----ctata---gtt-----gta-a-g----cc------att-cattatttg-
B D                    Rabbit  aaactattta-tttaca----ttata---gtc-----ata-a-a----cc------atc-cattatctg-
B D                      Pika  aagctattta-tttaca----ccata---gtt-----ata-a-a----cc------atc-cattgtctg-
B D                       Pig  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------att-ctttatctg-
B D                    Alpaca  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------a-----ttatctg-
               Bactrian camel  aaagtattta-tttaca----ctaca---gtc-----ata-a-a----cc------a-----ttatctg-
B D                   Dolphin  aaagtattta-tttaca----ccata---gtc-----ata-a-a----cc------att-ccttatctg-
                 Killer whale  aaagtattta-tttaca----ccata---gtc-----ata-a-a----cc------att-ccttatctg-
             Tibetan antelope  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------att-cattatctg-
B D                       Cow  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------att-cattatccg-
B D                     Sheep  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------att-cattatctg-
                Domestic goat  aaagtattta-tttaca----ctata---gtc-----atc-a-a----cc------att-cattatctg-
B D                     Horse  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cg------atc-cattatctg-
B D          White rhinoceros  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
B D                       Cat  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
B D                       Dog  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
B D                   Ferret   aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
B D                     Panda  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-catgatctg-
               Pacific walrus  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
                 Weddell seal  aaagtattta-tttaca----ctata---gtc-----ata-a-g----cc------ttc-cattatctg-
             Black flying-fox  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------att-catcttctg-
B D                   Megabat  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------att-catcttctg-
                Big brown bat  aaagtattta-tttaca----ctata---gtt-----ata-a-a----cc------atc-cattatctg-
         David's myotis (bat)  aaagtattta-tttaca----ctata---gtt-----ata-a-a----cc------atc-cattatc---
B D                  Microbat  aaagtattta-tttaca----ctata---gtt-----ata-a-a----cc------atc-cattatc---
B D                  Hedgehog  aaagtattta-tttaca----ttata---ttc-----ata-g-a----cc------atc-cattatctg-
B D                     Shrew  aaagtattta-tttaca----ctatc---gtc-----ata-a-a----cc------atc-cattatctg-
              Star-nosed mole  aaagtattta-tttaca----ctata---gcc-----ata-a-a----cc------atc-cattatctg-
B D                  Elephant  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
          Cape elephant shrew  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
B D                   Manatee  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
             Cape golden mole  aaagtattta-tttaca----ttata---gtc-----ata-a-a----cc------atc-cattatctg-
B D                    Tenrec  aaagtattta-tttaca----ccata---gtc-----ata-a-a--------------c-cattttctg-
                     Aardvark  aaagtattta-tttaca----ctata---gtc-----ata-a-a----cc------atc-cattatctg-
B D                 Armadillo  aaagtattta-tttaca----ctata---gtc-----aca-a-a----ct------acc-tatcatctg-
B D                   Opossum  aaaggattta-tttaca----ctagg---atc-----aca-g-a----ct------acc-catcatcca-
B D           Tasmanian devil  aaagtattta-tttaca----ctagg---atc-----aca-a-a----cc------atc-cattatcca-
B D                  Platypus  aaagtattta-tttaca----ctata---gtc-----ata-a-acaaacc------atc-tattatctg-
  D              Saker falcon  aa---gttta-tttaca----gagcg---gccagaa-aga-a-a----cc------ctc-tctccttcc-
  D          Peregrine falcon  aa---gttta-tttaca----gagcg---gccagaa-aga-a-a----cc------ctc-tctccttcc-
B D               Zebra finch  aa---attta-tttaca----gagtg---gccagaa-aga-t-a----ccccccctctc-tctctttcc-
           Tibetan ground jay  aa---tttta-tttaca----gtgtg---accagaa-agatt-a----ccccccacctc-cctccttcc-
  D           Green seaturtle  aaagtattta-tttaca----gaata---ctcataa-aga-a-a----cc------atc-tctcctttg-
  D            Painted turtle  aaagtattta-tttaca----gaata---ctcataa-aga-a-a----cc------atc-tctcctttg-
  D  Chinese softshell turtle  aaagtattta-tttaca----gaata---ctc--aa-aaa-a-a----cc------att-tctccttgg-
  D    Spiny softshell turtle  aaagtattta-tttaca----gaata---ctc--aa-ata-a-a----cc------att-tctccttgg-
B D                    Lizard  aaaacattta-tttaca----caata---ttcataacaaa-a-a----cc------acc-tttctcaagg
B D             X. tropicalis  aaagtattta-tttacagtctttgta---tct-----aag-t-a----ca------ttt-catgattc--
B D                Coelacanth  aagcttttta-ctgtct----ctaag---gaa-----aca-atg----cc------atc-----------
B D               Stickleback  -----gcact-attgtg----tgagagaggga-----aaa-a-a----ac------acgataatagacc-
B D                 Zebrafish  aaaatgtata-cttcta----ttaactatgta-----gaa-a-a----at------atg-cgatatgtg-
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                      Fugu  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
                 Zebra mbuna  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
  D       Collared flycatcher  ======================================================================
          Southern platyfish  ======================================================================
B D                Budgerigar  ======================================================================
  D             Scarlet macaw  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
B D                    Medaka  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================

                        Human  --aacttcagt
                        Chimp  --aacttcagt
                      Gorilla  --aacttcagt
                    Orangutan  --aacttcagt
                       Gibbon  --aacttcagt
                       Rhesus  --aacttcagt
          Crab-eating macaque  --aacttcagt
                       Baboon  --aacttcagt
                 Green monkey  --aacttcagt
                     Marmoset  --aacttcagt
              Squirrel monkey  --aacttcagt
                     Bushbaby  --aacttcagt
           Chinese tree shrew  --aaccttagt
                     Squirrel  --aacttcagt
       Lesser Egyptian jerboa  --aacttcagt
                 Prairie vole  --aactccagt
              Chinese hamster  --aactccagt
               Golden hamster  --aactccagt
                        Mouse  --aactccagt
                          Rat  --aactccagt
               Naked mole-rat  --aacttcagt
                   Guinea pig  --aacttcagt
                   Chinchilla  --aactt--gt
             Brush-tailed rat  --aacttcagt
                       Rabbit  --aacttcagt
                         Pika  --cacttaggt
                          Pig  --aactttagt
                       Alpaca  --aactttagt
               Bactrian camel  --aactttagt
                      Dolphin  --aactttagt
                 Killer whale  --aactttagt
             Tibetan antelope  --aacttcagt
                          Cow  --aacttgagt
                        Sheep  --aacttcagt
                Domestic goat  --aacttcagt
                        Horse  --aacttcagt
             White rhinoceros  --aacttcagt
                          Cat  --aatttcggt
                          Dog  --aacttcagt
                      Ferret   --aacttcagt
                        Panda  --aacttcagt
               Pacific walrus  --aacttcagt
                 Weddell seal  --aacttcagt
             Black flying-fox  --aacttcagt
                      Megabat  --aacttcagt
                Big brown bat  --aacttcagt
         David's myotis (bat)  ------tcagt
                     Microbat  ------tcagt
                     Hedgehog  --aacttcagt
                        Shrew  --aacttcagt
              Star-nosed mole  --aacttcagt
                     Elephant  --aaattcagt
          Cape elephant shrew  --aaattcaat
                      Manatee  --aaattcagt
             Cape golden mole  --aaattcagt
                       Tenrec  --aaattcagt
                     Aardvark  --aaattcaat
                    Armadillo  --aaattcagt
                      Opossum  --gattccagt
              Tasmanian devil  --aattccagt
                     Platypus  --aattccagt
                 Saker falcon  --agctcccgt
             Peregrine falcon  --agctcccgt
                  Zebra finch  --agcccccgt
           Tibetan ground jay  --agcccctgt
              Green seaturtle  --agctctggt
               Painted turtle  --agttctggt
     Chinese softshell turtle  --agttctggt
       Spiny softshell turtle  --agttctgat
                       Lizard  atggctccagt
                X. tropicalis  --cattccagt
                   Coelacanth  --aaattctgg
                  Stickleback  --a----taat
                    Zebrafish  --a----tagt
          Princess of Burundi  ===========
                 Nile tilapia  ===========
                         Fugu  ===========
       Yellowbelly pufferfish  ===========
                    Tetraodon  ===========
                  Zebra mbuna  ===========
                 Atlantic cod  ===========
                  Spotted gar  ===========
     Mexican tetra (cavefish)  ===========
          Pundamilia nyererei  ===========
        Burton's mouthbreeder  ===========
          Collared flycatcher  ===========
           Southern platyfish  ===========
                   Budgerigar  ===========
                Scarlet macaw  ===========
          Medium ground finch  ===========
       White-throated sparrow  ===========
                      Chicken  ===========
                       Medaka  ===========
                       Parrot  ===========
                      Wallaby  NNNNNNNNNNN
                  Rock pigeon  ===========
                 Mallard duck  ===========
           American alligator  ===========

Inserts between block 2 and 3 in window
B D              Stickleback 17bp
B D                Zebrafish 3bp

Alignment block 3 of 473 in window, 62812057 - 62812089, 33 bps 
B D                     Human  tagtgg---ttttg-c----------g---tta---gaatag-----attt-a---tttttt
B D                     Chimp  tagtgg---ttttg-c----------g---tta---gaatag-----attt-a---tttttt
B D                   Gorilla  tagtgg---ttttg-c----------g---tta---gaatag-----attt-a---tttttt
B D                 Orangutan  tagtgg---ttttg-c----------g---tta---gaatag-----attt-a---tttttt
B D                    Gibbon  tagtgg---ttttg-c----------g---tta---gaatag-----attt-a---tttttt
B D                    Rhesus  tagtgg---ttttg-c----------a---tta---gaatag-----attt-a---tttttt
B D       Crab-eating macaque  tagtgg---ttttg-c----------a---tta---gaatag-----attt-a---tttttt
B D                    Baboon  tagtgg---ttttg-c----------a---tta---gaatag-----attt-a---tttttt
B D              Green monkey  tagtgg---ttttg-c----------a---tta---gaatag-----attt-a---tttttt
B D                  Marmoset  tagtgg---ttctg-c----------g---tta---gaatag--atcatttat---tttttt
B D           Squirrel monkey  tagtgg---ttttg-c----------a---tta---gaatag--atcattt-c---tttttt
B D                  Bushbaby  tagtgg---tttta-t----------g---tta---gatc-------attt-a---tttttc
           Chinese tree shrew  tagtgg---ttttg-c----------g---tta---gatc-------attt-a---tttttc
B D                  Squirrel  tagtgg---tttgg-t----------g---tta---gaatag--gtgattt-a---tttttc
       Lesser Egyptian jerboa  tagtgg---tttta-c----------g---tta---gacta-------ttg-a---tttttc
                 Prairie vole  tagtgg---tttta-t----------g---tta---gaatag--attgttt-a--ttttttc
B D           Chinese hamster  tagtgg---tttta-t----------g---tta---gaatag--attgttt-a---tttttc
               Golden hamster  tagtgg---tttca-t----------g---tta---gaatag--attgttt-a---cttttc
B D                     Mouse  tagtggttttttta-t----------g---tta---gaatag--attgttt-c---tctctc
B D                       Rat  tagtgg---ttctg-t----------g---tta---gaatag--attgtttaa---tctttc
B D            Naked mole-rat  tagtgg--tttttg-t----------g---tta---gatca-------ttt-a---tttttc
B D                Guinea pig  tagtgg--tttttg-t----------g---tta---gatcg-------ttt-g---tttttc
                   Chinchilla  tagtgg--tttttg-t----------g---tta---gatca-------ttt-a---tttttc
             Brush-tailed rat  tagtgg--tttttg-t----------g---tta---gatca-------ttt-a---tttttc
B D                    Rabbit  tagtgg---ttctg-t----------g---tta---gaatag--atcattt-a-ttttgttc
B D                      Pika  tagtgg---ttctg-c----------a---tta---gaataa--atcattt-attttttttc
B D                       Pig  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---gatttc
B D                    Alpaca  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tatttc
               Bactrian camel  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tatttc
B D                   Dolphin  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tatttc
                 Killer whale  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tatttc
             Tibetan antelope  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tatttc
B D                       Cow  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tatttc
B D                     Sheep  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tatttc
                Domestic goat  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tatttc
B D                     Horse  tagtgg---tttcg-c----------a---tta---gaataa--atcattt-a---tatttc
B D          White rhinoceros  tagtgg---ttttg-c----------g---tta---gaataa--atcattt-a---tatttc
B D                       Cat  tagtgg---ttttg-c----------g---tta---gaataa--atcattt-c---tatttc
B D                       Dog  tagtgg---ttttg-c----------a---tta---gaataa--atcattt-a---tatttc
B D                   Ferret   tagtgg--tttttg-c----------g---tta---gaataa--atcattt-a---tagttc
B D                     Panda  tggtgg---ttttg-c----------g---tta---gaataa--atcattt-a---tatttc
               Pacific walrus  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tatttc
                 Weddell seal  tagtgg---ttttg-c----------a---tta---gaataa--atcattt-a---tatttc
             Black flying-fox  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---gatttc
B D                   Megabat  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---gatttc
                Big brown bat  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tgtttc
         David's myotis (bat)  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tgtttc
B D                  Microbat  tagtgg---ttttg-t----------g---tta---gaataa--atcattt-a---tgtttc
B D                  Hedgehog  tagtgg---ttatg-t----------g---tta---gaataa--atcactg-a---tatttt
B D                     Shrew  tagtgg----tttg-a----------g---tta---gaataa--atcattt-g---ta-ctt
              Star-nosed mole  tagtgg---ttttg-c----------g---tta---gaataa--atcattt-t---tatttt
B D                  Elephant  tagtgg---ttctg-c----------g---tta---gaatag--gtta--------tatttt
          Cape elephant shrew  tagtgg---ttctg-c----------a---tta---gaatag--attattt-t--gtatttc
B D                   Manatee  tagtgg---ttttg-c----------a---tta---gaatag--attattt-c---tatttc
             Cape golden mole  tagtgg---ttttg-c----------g---tta---gaatag--attattt-a---tatttc
B D                    Tenrec  tagtgg---ttctg-c----------a---t--------tag--attattt-a---tatttc
                     Aardvark  tagtgg---ttttt-c----------a---tta---gaatag--attattt-a---tatttc
B D                 Armadillo  tagtgg---ttttg-c----------a---tta---gaatag--a--attt-a---tatttc
B D                   Opossum  tag---------------------------tgc---tgataa--acaac-------tcaacc
B D           Tasmanian devil  tagtgg---ttgtg-t----------attatgg---tgatga--acaattt-a---tcactc
B D                  Platypus  tagtgg---ttttg-c----------attatta---gaataa--acgattt-a---tatttc
  D              Saker falcon  tagtgg---ttgtg-c----------a---ttattcgggt----------------tat---
  D          Peregrine falcon  tagtgg---ttgtg-c----------a---ttattcgggt----------------tat---
B D               Zebra finch  tagtgg---ttgtg-c----------a---ttattcgtgt----------------tac---
           Tibetan ground jay  tagtgg---ttgtg-t----------g---ttattcgtgt----------------tat---
  D           Green seaturtle  tagtgg---ttgtg-c----------a---ttattagactat--accattt-c---tat---
  D            Painted turtle  tagtgg---ttgtg-t----------a---ttattagactat--accattt-c---tat---
  D  Chinese softshell turtle  taatgg---ttgtg-c----------a---ttattagactat--cttgttt-c---tat---
  D    Spiny softshell turtle  taatgg---ttgtg-c----------a---ttattagactat--cttgttt-c---tat---
B D                    Lizard  tagtgg---ttgtg-c----------c---tcatgagattagaaatcatat-t---ta----
B D             X. tropicalis  tagtgg---ctggt-t----------a---ttaataaagtaa--actctt------------
B D                Coelacanth  aggcgg---tactacc----------a---aca---ggacac--cctatat-c---ta----
B D                    Medaka  tagtat---ttctg-g------cctaa---att---caaact--atttcta-----------
B D               Stickleback  ------------tg-g----------a---att---gaatat--tctttta-----------
B D                 Zebrafish  tattgt---tgttg-ataagtactgca---ata---acaata--tttctta-----------
         Princess of Burundi  ==============================================================
B D              Nile tilapia  ==============================================================
B D                      Fugu  ==============================================================
      Yellowbelly pufferfish  ==============================================================
B D                 Tetraodon  ==============================================================
                 Zebra mbuna  ==============================================================
B D              Atlantic cod  ==============================================================
                 Spotted gar  ==============================================================
    Mexican tetra (cavefish)  ==============================================================
         Pundamilia nyererei  ==============================================================
       Burton's mouthbreeder  ==============================================================
  D       Collared flycatcher  ==============================================================
          Southern platyfish  ==============================================================
B D                Budgerigar  ==============================================================
  D             Scarlet macaw  ==============================================================
B D       Medium ground finch  ==============================================================
  D    White-throated sparrow  ==============================================================
B D                   Chicken  ==============================================================
  D                    Parrot  ==============================================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ==============================================================
  D              Mallard duck  ==============================================================
B D        American alligator  ==============================================================

Inserts between block 3 and 4 in window
  D             Saker falcon 33bp
  D         Peregrine falcon 33bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp

Alignment block 4 of 473 in window, 62812090 - 62812099, 10 bps 
B D                     Human  cacaact---att
B D                     Chimp  cacaact---att
B D                   Gorilla  cacaact---att
B D                 Orangutan  cacaact---att
B D                    Gibbon  cacaact---att
B D                    Rhesus  cacaact---att
B D       Crab-eating macaque  cacaact---att
B D                    Baboon  cacaact---att
B D              Green monkey  cacaact---att
B D                  Marmoset  cacaact---att
B D           Squirrel monkey  cacaact---att
B D                  Bushbaby  cacaact---att
           Chinese tree shrew  cacaact---att
B D                  Squirrel  cacaact---att
       Lesser Egyptian jerboa  cacaact---att
                 Prairie vole  cacaact---att
B D           Chinese hamster  cacaact---att
               Golden hamster  cacaact---att
B D                     Mouse  cacaact---att
B D                       Rat  cacaact---att
B D            Naked mole-rat  cacaact---att
B D                Guinea pig  cacaact---att
                   Chinchilla  cacagct---att
             Brush-tailed rat  cacaact---att
B D                    Rabbit  cacaact---att
B D                      Pika  cacgact---act
B D                       Pig  cacaact---att
B D                    Alpaca  cacaact---att
               Bactrian camel  cacaact---att
B D                   Dolphin  cacaact---att
                 Killer whale  cacaact---att
             Tibetan antelope  cacaact---att
B D                       Cow  cacaact---att
B D                     Sheep  cacaact---att
                Domestic goat  cacaact---att
B D                     Horse  cacaact---att
B D          White rhinoceros  cacaact---att
B D                       Cat  cacaact---att
B D                       Dog  cacaact---att
B D                   Ferret   cacaact---att
B D                     Panda  cacaact---att
               Pacific walrus  cacaatt---att
                 Weddell seal  cacaact---att
             Black flying-fox  cacaact---att
B D                   Megabat  cacaact---att
                Big brown bat  cacgact---att
         David's myotis (bat)  cacaact---att
B D                  Microbat  cacgact---att
B D                  Hedgehog  cacaact---att
B D                     Shrew  cacaact---att
              Star-nosed mole  cacaact---att
B D                  Elephant  cacaact---att
          Cape elephant shrew  cacaact---att
B D                   Manatee  cacaact---att
             Cape golden mole  cac----------
B D                    Tenrec  cacaact---att
                     Aardvark  cacaact---att
B D                 Armadillo  cacaact---att
B D                   Opossum  tctaact---cgg
B D           Tasmanian devil  cacagct-a-tag
B D                  Platypus  cacaact---att
B D               Zebra finch  tgcggcgca-gtg
           Tibetan ground jay  tgcagcgca-ctg
  D           Green seaturtle  ttcagct---att
  D            Painted turtle  ttcagct---att
  D  Chinese softshell turtle  ttcagct---att
  D    Spiny softshell turtle  ttcagct---att
B D                    Lizard  ---agct---gtt
B D             X. tropicalis  ------------t
B D                Coelacanth  ---aatttatatt
B D                    Medaka  --cacct---t--
B D               Stickleback  ------t---t--
B D                 Zebrafish  --caatt---t--
         Princess of Burundi  =============
B D              Nile tilapia  =============
B D                      Fugu  =============
      Yellowbelly pufferfish  =============
B D                 Tetraodon  =============
                 Zebra mbuna  =============
B D              Atlantic cod  =============
                 Spotted gar  =============
    Mexican tetra (cavefish)  =============
         Pundamilia nyererei  =============
       Burton's mouthbreeder  =============
  D       Collared flycatcher  =============
          Southern platyfish  =============
B D                Budgerigar  =============
  D             Scarlet macaw  =============
B D       Medium ground finch  =============
  D    White-throated sparrow  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
B D                   Chicken  =============
  D                    Parrot  =============
B D                   Wallaby  NNNNNNNNNNNNN
  D               Rock pigeon  =============
  D              Mallard duck  =============
B D        American alligator  =============

Inserts between block 4 and 5 in window
B D                   Medaka 4bp
B D              Stickleback 9bp
B D                Zebrafish 10209bp

Alignment block 5 of 473 in window, 62812100 - 62812102, 3 bps 
B D                     Human  a----ag-
B D                     Chimp  a----ag-
B D                   Gorilla  a----ag-
B D                 Orangutan  a----ag-
B D                    Gibbon  a----ag-
B D                    Rhesus  a----ag-
B D       Crab-eating macaque  a----ag-
B D                    Baboon  a----ag-
B D              Green monkey  a----ag-
B D                  Marmoset  a----ag-
B D           Squirrel monkey  a----ag-
B D                  Bushbaby  a----ag-
           Chinese tree shrew  a----ag-
B D                  Squirrel  a----ag-
       Lesser Egyptian jerboa  a----gg-
                 Prairie vole  a----ag-
B D           Chinese hamster  a----ag-
               Golden hamster  a----ag-
B D                     Mouse  a----ag-
B D                       Rat  a----ag-
B D            Naked mole-rat  a----ag-
B D                Guinea pig  a----ag-
                   Chinchilla  a----ag-
             Brush-tailed rat  a----ag-
B D                    Rabbit  a----ag-
B D                      Pika  a----ag-
B D                       Pig  a----aa-
B D                    Alpaca  a----ag-
               Bactrian camel  a----ag-
B D                   Dolphin  a----ag-
                 Killer whale  a----ag-
             Tibetan antelope  a----ag-
B D                       Cow  a----ag-
B D                     Sheep  a----ag-
                Domestic goat  a----ag-
B D                     Horse  a----ag-
B D          White rhinoceros  a----ag-
B D                       Cat  a----ag-
B D                       Dog  a----ag-
B D                   Ferret   a----ag-
B D                     Panda  a----ag-
               Pacific walrus  a----ag-
                 Weddell seal  a----ag-
             Black flying-fox  a----ag-
B D                   Megabat  a----ag-
                Big brown bat  a----aa-
         David's myotis (bat)  a----aa-
B D                  Microbat  a----aa-
B D                  Hedgehog  a----ag-
B D                     Shrew  a----ag-
              Star-nosed mole  a----ag-
B D                  Elephant  a----ag-
          Cape elephant shrew  a----cg-
B D                   Manatee  a----ag-
B D                    Tenrec  a----ag-
                     Aardvark  a----ag-
B D                 Armadillo  a----ag-
B D                   Opossum  g----gg-
B D           Tasmanian devil  g----ga-
B D                  Platypus  c----ag-
B D               Zebra finch  ggtc-cc-
           Tibetan ground jay  ggtc-cc-
  D           Green seaturtle  gttc-cg-
  D            Painted turtle  gttc-cg-
  D  Chinese softshell turtle  gttc-cg-
  D    Spiny softshell turtle  gttc-cg-
B D                    Lizard  gtgcgag-
B D             X. tropicalis  a----ac-
B D                Coelacanth  c----ag-
B D                    Medaka  -----act
B D               Stickleback  -----gat
B D                 Zebrafish  -----aac
         Princess of Burundi  ========
B D              Nile tilapia  ========
B D                      Fugu  ========
      Yellowbelly pufferfish  ========
B D                 Tetraodon  ========
                 Zebra mbuna  ========
B D              Atlantic cod  ========
                 Spotted gar  ========
    Mexican tetra (cavefish)  ========
         Pundamilia nyererei  ========
       Burton's mouthbreeder  ========
  D       Collared flycatcher  ========
          Southern platyfish  ========
B D                Budgerigar  ========
  D             Scarlet macaw  ========
B D       Medium ground finch  ========
  D    White-throated sparrow  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
B D                   Chicken  ========
  D                    Parrot  ========
B D                   Wallaby  NNNNNNNN
  D               Rock pigeon  ========
  D              Mallard duck  ========
            Cape golden mole  --------
B D        American alligator  ========

Inserts between block 5 and 6 in window
B D              Stickleback 1bp

Alignment block 6 of 473 in window, 62812103 - 62812119, 17 bps 
B D                     Human  agctaatg----accaaacaa
B D                     Chimp  agctaatg----accaaacaa
B D                   Gorilla  agctaatg----accaaacaa
B D                 Orangutan  agctaatg----accaaacaa
B D                    Gibbon  agctaatg----accaaacaa
B D                    Rhesus  agctaatg----actaaacaa
B D       Crab-eating macaque  agctaatg----actaaacaa
B D                    Baboon  agctaatg----accaaacaa
B D              Green monkey  agctaatg----accaaacaa
B D                  Marmoset  agctaata----accaaacaa
B D           Squirrel monkey  agctaata----accaaacaa
B D                  Bushbaby  agctaata----accaaacaa
           Chinese tree shrew  agctaata----accaaacac
B D                  Squirrel  agctaata----accaaacga
       Lesser Egyptian jerboa  agcatata----accaaacag
                 Prairie vole  agctagt--------aaacaa
B D           Chinese hamster  agctaat--------gagcaa
               Golden hamster  agctaat--------gaacag
B D                     Mouse  agctaata----accaaacaa
B D                       Rat  agctaata----accaaacaa
B D            Naked mole-rat  agctaata----accaaacaa
B D                Guinea pig  agctaata----accaaacaa
                   Chinchilla  agctaata----accaaacaa
             Brush-tailed rat  ggctaata----accaaacaa
B D                    Rabbit  agctaata----accaaacaa
B D                      Pika  agctaata----tccaaacaa
B D                       Pig  agctaata----accaaacaa
B D                    Alpaca  agctaata----accaaacaa
               Bactrian camel  agctaata----accaaacaa
B D                   Dolphin  agctaata----accaaacaa
                 Killer whale  agctaata----accaaacaa
             Tibetan antelope  agctaata----accaaacaa
B D                       Cow  agctaata----accaaacaa
B D                     Sheep  agctaata----accaaacaa
                Domestic goat  agctaata----accaaacaa
B D                     Horse  agctaata----accaaacaa
B D          White rhinoceros  agctaata----accaaacaa
B D                       Cat  agctaata----accaaacaa
B D                       Dog  agctaata----accaaacaa
B D                   Ferret   agctaata----accaaacaa
B D                     Panda  agctaata----accaaacaa
               Pacific walrus  agctaata----accaaacaa
                 Weddell seal  agctaata----accaaacaa
             Black flying-fox  agctaata----accaaacaa
B D                   Megabat  agctaata----accaaacaa
                Big brown bat  agctaata----accaaacaa
         David's myotis (bat)  agccaata----accaaacaa
B D                  Microbat  agctaata----accaaacaa
B D                  Hedgehog  agctaata----acctaacaa
B D                     Shrew  agctaata----a-caaacaa
              Star-nosed mole  agctaata----accaaacaa
B D                  Elephant  agctaata----actgaacaa
          Cape elephant shrew  agctaata----accaaacaa
B D                   Manatee  agctaata----accaaacaa
             Cape golden mole  agctaata----accaaacaa
B D                    Tenrec  agctaata----gccaaacaa
                     Aardvark  agctaata----accaaacaa
B D                 Armadillo  agctaata----accaaacaa
B D                   Opossum  agtgtagg----gccaaagga
B D           Tasmanian devil  agcttata----accgaagga
B D                  Platypus  agctaata----accgaaccg
B D               Zebra finch  ggccgacc----a--------
           Tibetan ground jay  ggccgacc----a--------
  D           Green seaturtle  aacggaca----a--------
  D            Painted turtle  agcggaca----a--------
  D  Chinese softshell turtle  agcggaca----a--------
  D    Spiny softshell turtle  agcggaca----a--------
B D                    Lizard  agccaacc----a--------
B D             X. tropicalis  actttatt----tccgagtac
B D                Coelacanth  agc----a----accc-----
B D                    Medaka  agtcaatggatcggcaccaca
           Southern platyfish  aattaatg-------------
B D               Stickleback  agtgaatg----aacaaagga
B D                 Zebrafish  aaccacag----aacaaacga
         Princess of Burundi  =====================
B D              Nile tilapia  =====================
B D                      Fugu  =====================
      Yellowbelly pufferfish  =====================
B D                 Tetraodon  =====================
                 Zebra mbuna  =====================
B D              Atlantic cod  =====================
                 Spotted gar  =====================
    Mexican tetra (cavefish)  =====================
         Pundamilia nyererei  =====================
       Burton's mouthbreeder  =====================
  D       Collared flycatcher  =====================
B D                Budgerigar  =====================
  D             Scarlet macaw  =====================
B D       Medium ground finch  =====================
  D    White-throated sparrow  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
B D                   Chicken  =====================
  D                    Parrot  =====================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  =====================
  D              Mallard duck  =====================
B D        American alligator  =====================

Inserts between block 6 and 7 in window
B D              Zebra finch 5bp
          Tibetan ground jay 5bp
B D                   Lizard 8bp
B D            X. tropicalis 4bp

Alignment block 7 of 473 in window, 62812120 - 62812121, 2 bps 
B D                     Human  at
B D                     Chimp  at
B D                   Gorilla  at
B D                 Orangutan  at
B D                    Gibbon  at
B D                    Rhesus  at
B D       Crab-eating macaque  at
B D                    Baboon  at
B D              Green monkey  at
B D                  Marmoset  at
B D           Squirrel monkey  at
B D                  Bushbaby  at
           Chinese tree shrew  at
B D                  Squirrel  at
       Lesser Egyptian jerboa  at
                 Prairie vole  at
B D           Chinese hamster  at
               Golden hamster  at
B D                     Mouse  at
B D                       Rat  gt
B D            Naked mole-rat  at
B D                    Rabbit  ag
B D                      Pika  ag
B D                       Pig  gt
B D                    Alpaca  gt
               Bactrian camel  gt
B D                   Dolphin  gt
                 Killer whale  gt
             Tibetan antelope  gt
B D                       Cow  gt
B D                     Sheep  gt
                Domestic goat  gt
B D                     Horse  gt
B D          White rhinoceros  gt
B D                       Cat  gt
B D                       Dog  gt
B D                   Ferret   gt
B D                     Panda  gt
               Pacific walrus  gt
                 Weddell seal  gt
             Black flying-fox  gt
B D                   Megabat  gt
                Big brown bat  gt
         David's myotis (bat)  gt
B D                  Microbat  gt
B D                  Hedgehog  gt
B D                     Shrew  gt
              Star-nosed mole  tt
B D                  Elephant  gt
          Cape elephant shrew  gt
B D                   Manatee  gt
             Cape golden mole  g-
B D                    Tenrec  gt
                     Aardvark  gt
B D                 Armadillo  gt
B D                   Opossum  gt
B D           Tasmanian devil  gt
B D                  Platypus  gt
  D              Saker falcon  gt
  D          Peregrine falcon  gt
B D               Zebra finch  gc
           Tibetan ground jay  gc
  D           Green seaturtle  -t
  D            Painted turtle  -t
  D  Chinese softshell turtle  -t
  D    Spiny softshell turtle  -t
B D                    Lizard  -t
B D             X. tropicalis  g-
B D                Coelacanth  -t
B D                    Medaka  at
           Southern platyfish  -t
B D               Stickleback  at
B D                 Zebrafish  ta
                  Chinchilla  --
B D                Guinea pig  --
            Brush-tailed rat  --
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D                      Fugu  ==
      Yellowbelly pufferfish  ==
B D                 Tetraodon  ==
                 Zebra mbuna  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
    Mexican tetra (cavefish)  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
  D       Collared flycatcher  ==
B D                Budgerigar  ==
  D             Scarlet macaw  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D                   Chicken  ==
  D                    Parrot  ==
B D                   Wallaby  NN
  D               Rock pigeon  ==
  D              Mallard duck  ==
B D        American alligator  ==

Inserts between block 7 and 8 in window
  D          Green seaturtle 8bp
  D           Painted turtle 8bp
  D Chinese softshell turtle 8bp
  D   Spiny softshell turtle 8bp
B D               Coelacanth 1bp
B D                   Medaka 1bp
          Southern platyfish 1bp
B D                Zebrafish 5bp

Alignment block 8 of 473 in window, 62812122 - 62812147, 26 bps 
B D                     Human  cag--ctccggtaa--catt-at----------------gtaca-ttc
B D                     Chimp  cag--ctccggtaa--catt-at----------------gtaca-ttc
B D                   Gorilla  cag--ctccagtaa--catt-at----------------gtaca-ttc
B D                 Orangutan  cag--ctccagtaa--catt-at----------------gtaca-ttc
B D                    Gibbon  cag--ctccagtaa--catt-at----------------gtaca-ttc
B D                    Rhesus  cag--ctccagtaa--catt-at----------------gtaca-ttc
B D       Crab-eating macaque  cag--ctccagtaa--catt-at----------------gtaca-ttc
B D                    Baboon  cag--ctccagtaa--catt-at----------------gtaca-ttc
B D              Green monkey  cag--ctccagtaa--catt-at----------------gtaca-ttc
B D                  Marmoset  cag--ctccagtaa--catt-at----------------gtaca-ttc
B D           Squirrel monkey  cag--ctccagtaa--catt-at----------------gtaca-ttc
B D                  Bushbaby  cag--ctccagtaa--catt-at----------------gtaca-ttc
           Chinese tree shrew  cag--ctccagtaa--catt-at----------------gtaca-ttc
B D                  Squirrel  ggg--ctccagtaa--catt-at----------------gtaca-ttc
       Lesser Egyptian jerboa  cag--ccgctgtaa--catc-------------------taaca-tcc
                 Prairie vole  cag--ctgc-gtga--cact-at----------------gcaca-ttc
B D           Chinese hamster  cag--ctgcagtga--catt-at----------------gcaca-ttc
               Golden hamster  cgg--ctgcagtga--cact-at----------------gcaca-ttc
B D                     Mouse  cag--cggcagtga--cattgaa----------------gcaca-ttc
B D                       Rat  cag--ctgcagtga--cgtt-aa----------------gcaca-ctc
B D            Naked mole-rat  cag--ct-cggtaa--catt-at----------------ttaca-ttc
B D                    Rabbit  cag--ctccagtaa--catt-at----------------ataca-ttc
B D                      Pika  cag--ctccagcaa--catt-at----------------ataca-ttc
B D                       Pig  cag--ctccagtaa--g--t-at----------------ttaca-ttc
B D                    Alpaca  cag--ctccagtaa--c----at----------------ttaca-t--
               Bactrian camel  cag--ctccagtaa--c----at----------------ttaca-t--
B D                   Dolphin  cag--ctccagtag--catt-at----------------ttaca-ttc
                 Killer whale  cag--ctccagtag--catt-at----------------ttaca-ttc
             Tibetan antelope  cag--ctccagtaa--catt-at----------------ttaca-ttc
B D                       Cow  cag--ctccagtaa--catt-at----------------ttaca-ttc
B D                     Sheep  cag--ctccagtaa--catt-at----------------ttaca-ttc
                Domestic goat  cag--ctccagtaa--catt-at----------------ttaca-ttc
B D                     Horse  cag--ctccagtaa--catt-at----------------ttaca-ttc
B D          White rhinoceros  cag--ctccagtaa--catt-at----------------ttaca-ttc
B D                       Cat  cag--ctccagtaa--tatt-at----------------ttaca-ttc
B D                       Dog  cag--ctccagtaa--tatt-at----------------ttaca-ttc
B D                   Ferret   cag--ctccagtaa--tatt-at----------------ttaca-ttc
B D                     Panda  cag--ctccagtaa--tatt-at----------------ttaca-ttc
               Pacific walrus  cag--ctccagtaa--tatt-at----------------ttaca-ttc
                 Weddell seal  cag--ctccagtaa--tatt-at----------------ttaca-ttc
             Black flying-fox  cag--ctccagtaa--catt-at----------------ttaca-ttc
B D                   Megabat  cag--ctccagtaa--catt-at----------------ttaca-ttc
                Big brown bat  cag---ttcagcaa--catt-at----------------ttaca-ttc
         David's myotis (bat)  cag---ttcagcaa--catt-at----------------ttaca-ttc
B D                  Microbat  cag---ttcagcaa--catt-at----------------ttaca-ttc
B D                  Hedgehog  cag--ctccagtac--gatt-at----------------ttaca-tct
B D                     Shrew  cag--ctccagtaa--catt-at----------------ttacatttt
              Star-nosed mole  cag--ctccagtaa--catt-at----------------gtaca-ttc
B D                  Elephant  cag--ctccagtaa--catt-at----------------ttaca-ttc
          Cape elephant shrew  cag--ctctggtaa--catt-at----------------ttaca-ttc
B D                   Manatee  cag--ctccagtaa--catt-at----------------ttaca-ttc
             Cape golden mole  -----ctccagtaa--catt-at----------------ttaca-ttc
B D                    Tenrec  caa--ctccaataa--catt-at----------------ttaca-ttc
                     Aardvark  cag--ctccaataa--catt-at----------------ttaca-ttc
B D                 Armadillo  cag--ctccattaa--c--t-at----------------ttaca-ttc
B D                   Opossum  ggg--ctccggccg--tgct-at----------------ttaca-tct
B D           Tasmanian devil  cag--ctctttgaa--tgtt-at----------------ttaca-tct
B D                  Platypus  cag--ctctggcaa--catt-at----------------ttaca-ttc
  D              Saker falcon  cgg--ttccagcca--gagt-at----------------ttaca-acc
  D          Peregrine falcon  cgg--ttccagcca--gagt-at----------------ttaca-acc
B D               Zebra finch  cgg--tcccagccc--gagt-at----------------ttaca-tcc
           Tibetan ground jay  cgg--tcccagccc--gagt-at----------------tttca-tcc
  D              Mallard duck  cgg--ctccagcgc--gagt-at----------------ttaca-tcc
  D           Green seaturtle  cag--ctctagcaa--gact-at----------------ttaca-tcc
  D            Painted turtle  caa--ctctagcaa--gatt-at----------------ttaca-tcc
  D  Chinese softshell turtle  caa--ctcgagcga--gatt-at----------------ttaca-ttc
  D    Spiny softshell turtle  caa--ctcgagcga--gatt-at----------------ttaca-ttc
B D                    Lizard  cagacctcaaaaga--tatt-at----------------ttaca-ttc
B D             X. tropicalis  cag--ccccgtcaa--tgcc-atattcttttttttttccttatt-ttt
B D                Coelacanth  ctg--ctgatgtaaattaac-at----------------tcaca-tta
B D                    Medaka  caa--ct-----aa--taat-at----------------gtact-ttc
           Southern platyfish  caa--cttc-tcca--caaa-ct----------------ttatt-tct
B D                 Zebrafish  cag--ct--------------at----------------ataca-tcc
                  Chinchilla  ------------------------------------------------
B D                Guinea pig  ------------------------------------------------
            Brush-tailed rat  ------------------------------------------------
         Princess of Burundi  ================================================
B D              Nile tilapia  ================================================
B D                      Fugu  ================================================
      Yellowbelly pufferfish  ================================================
B D                 Tetraodon  ================================================
                 Zebra mbuna  ================================================
B D              Atlantic cod  ================================================
                 Spotted gar  ================================================
B D               Stickleback  ================================================
    Mexican tetra (cavefish)  ================================================
         Pundamilia nyererei  ================================================
       Burton's mouthbreeder  ================================================
  D       Collared flycatcher  ================================================
B D                Budgerigar  ================================================
  D             Scarlet macaw  ================================================
B D       Medium ground finch  ================================================
  D    White-throated sparrow  ================================================
B D                   Chicken  ================================================
  D                    Parrot  ================================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ================================================
B D        American alligator  ================================================

Inserts between block 8 and 9 in window
B D                   Lizard 9bp
          Southern platyfish 4bp

Alignment block 9 of 473 in window, 62812148 - 62812181, 34 bps 
B D                     Human  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                     Chimp  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                   Gorilla  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                 Orangutan  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                    Gibbon  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                    Rhesus  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D       Crab-eating macaque  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                    Baboon  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D              Green monkey  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                  Marmoset  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D           Squirrel monkey  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                  Bushbaby  tt--atcag-------------------aagt-----ttaactacaaaggtaacac-tttt---------
           Chinese tree shrew  tt--atctc-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                  Squirrel  tt--atctg-------------------aaat-----ctgactacaaacataacac-tttt---------
       Lesser Egyptian jerboa  tc--atctg-------------------aaat-----ttgactaaaaaggtaacac-tttt---------
                 Prairie vole  tc--atctg-------------------aaat-----ttgactacaaaggtaacacttttt---------
B D           Chinese hamster  tc--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
               Golden hamster  tc--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                     Mouse  tc--acctg-------------------aaat-----ttggctacaaaggtaacac-tttt---------
B D                       Rat  tc--atctg-------------------aaat-----ttgactgcgaaggtaacac-tttc---------
B D            Naked mole-rat  tc--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                Guinea pig  ----atcca-------------------aaat-----ttgactacaaaggtaacac-tttt---------
                   Chinchilla  ----atcca-------------------aaat-----ttgactacaaaggtaacac-tttt---------
             Brush-tailed rat  ----attca-------------------aatt-----ttgactacaaaggtaacac-tttt---------
B D                    Rabbit  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                      Pika  tt--atctg-------------------aaat-----ctgactacaaagggaacac-tttt---------
B D                       Pig  ct--atctg-------------------caat-----tcaactacaaaggtaacac-tttt---------
B D                    Alpaca  -----tctg-------------------caat-----tcgactacaaaggtaacac-tttt---------
               Bactrian camel  -----tctg-------------------caat-----tcgactacaaaggtaacac-tttt---------
B D                   Dolphin  cc--atctg-------------------caat-----ttgactacaaaggtaacac-tttt---------
                 Killer whale  cc--atctg-------------------caat-----ttgactacaaaggtaacac-tttt---------
             Tibetan antelope  ct--atctg-------------------caat-----ttgactacaaaggtaacac-tttt---------
B D                       Cow  ct--atctg-------------------caat-----ttgactacaaaggtaacac-tttt---------
B D                     Sheep  ct--atctg-------------------caat-----ttgactacaaaggtaacac-tttt---------
                Domestic goat  ct--atctg-------------------caat-----ttgactacaaaggtaacac-tttt---------
B D                     Horse  tt--atctg-------------------caag-----tcgactacaaaggtaacac-tttt---------
B D          White rhinoceros  tt--atctg-------------------caat-----tcgactacaaaggtaacac-tttt---------
B D                       Cat  tt--atctg-------------------caat-----tcaactacaaaggtaacac-tttt---------
B D                       Dog  tt--atccg-------------------caat-----tcgactacaaaggtaacac---tt---------
B D                   Ferret   tt--atctg-------------------caat-----tcgactacaaaggtaacac-tttt---------
B D                     Panda  tt--atctg-------------------caat-----tcgactacaaaggtaacac-tttt---------
               Pacific walrus  tt--atctg-------------------caat-----tcgactacaaaggtaacac-tttt---------
                 Weddell seal  tt--atctg-------------------caat-----tcgactacaaaggtaacac---tt---------
             Black flying-fox  tt--atctg-------------------caat-----ttgactacaaaggtaacac-tttt---------
B D                   Megabat  tt--atctg-------------------caat-----ttgactacaaaggtaacac-tttt---------
                Big brown bat  tt--aactg-------------------caat-----ttgactacaaaggtaacac-tttt---------
         David's myotis (bat)  tt--aactg-------------------caat-----ttgactacaaaggtaacac-tttt---------
B D                  Microbat  tt--aactg-------------------caat-----ttgactacaaaggtaacac-tttt---------
B D                  Hedgehog  ta--acctg-------------------caat-----ttgactacaaaggtaacac-tttt---------
B D                     Shrew  tt--atctg-------------------taat-----ttgactacaaaggtaacac-tttt---------
              Star-nosed mole  tt--atcag-------------------caat-----ttgactacaaaggtaacac--ttt---------
B D                  Elephant  tt-aatctg-------------------aaat-----ttgactacaaaggtaacac-gttt---------
          Cape elephant shrew  tt-aatctg-------------------aaat-----ctgactacaaagataacac-tttt---------
B D                   Manatee  tt--atctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
             Cape golden mole  tt--acctg-------------------aaat-----ttgactacaaaggtaacac-tttt---------
B D                    Tenrec  tc--atctg-------------------aaat-----tggactacaaaggtaacac-tttt---------
                     Aardvark  tt--atctg-------------------aaat-----ttgactacaaaggtaacac--ttt---------
B D                 Armadillo  tt--atcag-------------------aaat-----ttgactacaaaggtaacac--ttt---------
B D                   Opossum  ct--gtttg-------------------agat-----tttactccaaaaggaacac-tc-----------
B D           Tasmanian devil  gt--atttg-------------------acat-----tttactccaaaagtaacac-ttta---------
B D                  Platypus  ta--atctg-------------------aaat-----tttactagaaaggtaacac-tttt---------
  D              Saker falcon  -c--gtccc-------------------aagt-----cctactacaaacgtaacac-tttt---------
  D          Peregrine falcon  -c--gtccc-------------------aagt-----cctactacaaacgtaacac-tttt---------
B D               Zebra finch  -t--gtccc-------------------aagt-----cctactacaaacggaacac-tttt---------
           Tibetan ground jay  -t--gtccc-------------------aagt-----cctactacaaacggaacac-tttt---------
  D              Mallard duck  -c--gtgcg-------------------gagt-----cctactacaaacggaacac-tttt---------
  D           Green seaturtle  tc--atctg-------------------aaat-----ctgactacaaatgtaacac-tttt---------
  D            Painted turtle  tc--atctg-------------------aaat-----ctgactacaaatgtaacac-tttt---------
  D  Chinese softshell turtle  tc--atctg-------------------aaat-----cagactacaaatgtaacat-tttt---------
  D    Spiny softshell turtle  tc--atctg-------------------aaat-----cagactacaaatgtaacat-tttt---------
B D                    Lizard  tt--tttaa-------------------aaattattatttgctacaaaagcaacac-ttaa---------
B D             X. tropicalis  tt--atcccgtattttgtatttttttgtaaac-----tcaactacaaagttaacac-tttt---------
B D                Coelacanth  tttaatcca-------------------aatt-----ttcaac-caaagttaagac-gttt---------
           Southern platyfish  ------------------------------------------------------at-gttctacagcaca
B D                 Zebrafish  ------------------------------------------------------at-gttt---------
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                      Fugu  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
                 Zebra mbuna  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                Budgerigar  ======================================================================
  D             Scarlet macaw  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
B D                    Medaka  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ======================================================================
B D        American alligator  ======================================================================

                        Human  --------------
                        Chimp  --------------
                      Gorilla  --------------
                    Orangutan  --------------
                       Gibbon  --------------
                       Rhesus  --------------
          Crab-eating macaque  --------------
                       Baboon  --------------
                 Green monkey  --------------
                     Marmoset  --------------
              Squirrel monkey  --------------
                     Bushbaby  --------------
           Chinese tree shrew  --------------
                     Squirrel  --------------
       Lesser Egyptian jerboa  --------------
                 Prairie vole  --------------
              Chinese hamster  --------------
               Golden hamster  --------------
                        Mouse  --------------
                          Rat  --------------
               Naked mole-rat  --------------
                   Guinea pig  --------------
                   Chinchilla  --------------
             Brush-tailed rat  --------------
                       Rabbit  --------------
                         Pika  --------------
                          Pig  --------------
                       Alpaca  --------------
               Bactrian camel  --------------
                      Dolphin  --------------
                 Killer whale  --------------
             Tibetan antelope  --------------
                          Cow  --------------
                        Sheep  --------------
                Domestic goat  --------------
                        Horse  --------------
             White rhinoceros  --------------
                          Cat  --------------
                          Dog  --------------
                      Ferret   --------------
                        Panda  --------------
               Pacific walrus  --------------
                 Weddell seal  --------------
             Black flying-fox  --------------
                      Megabat  --------------
                Big brown bat  --------------
         David's myotis (bat)  --------------
                     Microbat  --------------
                     Hedgehog  --------------
                        Shrew  --------------
              Star-nosed mole  --------------
                     Elephant  --------------
          Cape elephant shrew  --------------
                      Manatee  --------------
             Cape golden mole  --------------
                       Tenrec  --------------
                     Aardvark  --------------
                    Armadillo  --------------
                      Opossum  --------------
              Tasmanian devil  --------------
                     Platypus  --------------
                 Saker falcon  --------------
             Peregrine falcon  --------------
                  Zebra finch  --------------
           Tibetan ground jay  --------------
                 Mallard duck  --------------
              Green seaturtle  --------------
               Painted turtle  --------------
     Chinese softshell turtle  --------------
       Spiny softshell turtle  --------------
                       Lizard  --------------
                X. tropicalis  --------------
                   Coelacanth  --------------
           Southern platyfish  gaaccagaacatct
                    Zebrafish  --------------
          Princess of Burundi  ==============
                 Nile tilapia  ==============
                         Fugu  ==============
       Yellowbelly pufferfish  ==============
                    Tetraodon  ==============
                  Zebra mbuna  ==============
                 Atlantic cod  ==============
                  Spotted gar  ==============
                  Stickleback  ==============
     Mexican tetra (cavefish)  ==============
          Pundamilia nyererei  ==============
        Burton's mouthbreeder  ==============
          Collared flycatcher  ==============
                   Budgerigar  ==============
                Scarlet macaw  ==============
          Medium ground finch  ==============
       White-throated sparrow  ==============
                      Chicken  ==============
                       Medaka  ==============
                       Parrot  ==============
                      Wallaby  NNNNNNNNNNNNNN
                  Rock pigeon  ==============
           American alligator  ==============

Inserts between block 9 and 10 in window
  D             Saker falcon 27bp
  D         Peregrine falcon 27bp
B D              Zebra finch 27bp
          Tibetan ground jay 27bp
  D             Mallard duck 21bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp
B D                   Lizard 2bp
          Southern platyfish 1bp

Alignment block 10 of 473 in window, 62812182 - 62812221, 40 bps 
B D                     Human  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D                     Chimp  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D                   Gorilla  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D                 Orangutan  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D                    Gibbon  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D                    Rhesus  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D       Crab-eating macaque  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D                    Baboon  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D              Green monkey  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D                  Marmoset  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D           Squirrel monkey  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D                  Bushbaby  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
           Chinese tree shrew  ----aagt------ca-caaa---------------ac---agc------atacaaaaatatactttct-
B D                  Squirrel  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
       Lesser Egyptian jerboa  ----aagt------ca-caaa---------------ac---agc------atacaaaaatatactttct-
                 Prairie vole  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D           Chinese hamster  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
               Golden hamster  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                     Mouse  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                       Rat  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D            Naked mole-rat  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                Guinea pig  ----aagt------ca-caaa---------------acaagagc------atacaaaaatatactttct-
                   Chinchilla  ----aagt------ca-caaa---------------acaagagc------atacaaaaatatactttct-
             Brush-tailed rat  ----aagt------ca-caaa---------------acaagagc------atacaaaaatatactttct-
B D                    Rabbit  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                      Pika  ----cagt------ca-caaa---------------ac---agc------atacaaaaatatactttct-
B D                       Pig  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatattttct-
B D                    Alpaca  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
               Bactrian camel  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                   Dolphin  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatagactttct-
                 Killer whale  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
             Tibetan antelope  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                       Cow  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                     Sheep  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
                Domestic goat  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                     Horse  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D          White rhinoceros  ----aagt------ca-caaa---------------ac-ggagc------atacaaaaatatactttct-
B D                       Cat  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                       Dog  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                   Ferret   ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                     Panda  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
               Pacific walrus  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
                 Weddell seal  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
             Black flying-fox  ----aagt------ca-caaa---------------ac---agc------atacaaaaatatactttct-
B D                   Megabat  ----aagt------ca-caaa---------------ac---agc------atacaaaaatatactttct-
                Big brown bat  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
         David's myotis (bat)  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                  Microbat  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                  Hedgehog  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                     Shrew  ----aagt------ca-caaa---------------ac---agc------atacaaaaatatactttct-
              Star-nosed mole  ----aagt------ca-caaa---------------ac---agc------atacaaaaatatactttct-
B D                  Elephant  ----aagt------ca-cgaa---------------ac-agagc------atacaaaaatatactttcta
          Cape elephant shrew  ----aagt------ca-caaa---------------ac-agagc------atataaaaatatactttct-
B D                   Manatee  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
             Cape golden mole  ----aagt------ca-caaa---------------ac-aaagc------atacaaaaatatactttct-
B D                    Tenrec  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
                     Aardvark  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                 Armadillo  ----aagt------ca-caaa---------------ac-agagc------atacaaaaatatactttct-
B D                   Opossum  ----gagt------ca-caaa---------------ac---agc------gtacaaaaatagagtttct-
B D           Tasmanian devil  ----aagt------ca-caaa---------------ac---agc------gtacaaaaatatagtttct-
B D                  Platypus  ----aagt------ca-caaa---------------ac-agagt------gtacaaaaatatagtttct-
  D              Saker falcon  ----aaac------cc-caag---------------cc-agtgc------gtacaaaaatatagtctct-
  D          Peregrine falcon  ----aaac------cc-caag---------------cc-agtgc------gtacaaaaatatagtctct-
  D       Collared flycatcher  ----aaac------cc-caaa---------------cc-agtgc------gtacaaaaatatagtctct-
B D               Zebra finch  ----aaac------cc-caaa---------------cc-agtgc------gtacaaaaatatagtctcta
           Tibetan ground jay  ----aaac------cc-cgaa---------------cc-agtgc------gtacaaaaatatagtctct-
  D              Mallard duck  ----aaac---aaaaa-caaa---------------cc-agtgc------gtacaaaaatatagtctct-
  D           Green seaturtle  ----agtc------acaaaaa---------------ac-agtgc------gtacaaaaatatagtttct-
  D            Painted turtle  ----agtc------ac-aaaa---------------ac-agtgc------gtacaaaaatatagtttct-
  D  Chinese softshell turtle  ----agtc------ac-aaaa---------------ac-agtgc------gtacaaaaatagactttct-
  D    Spiny softshell turtle  ----agtc------ac-aaaa---------------ac-agtgc------gtacaaaaatagactttct-
B D                    Lizard  ----agtc------ac-aggaaacaaaaggaaaatgcc-agtgc------atacaaaaatagagtttct-
B D             X. tropicalis  ----gggt------ca-caaa---------------ac-agtgcgtttgggtacaaaaatagaaattct-
B D                Coelacanth  ----aagtattagaca-caaa---------------ac-agtac------gtacaaaaatatattttct-
           Southern platyfish  gagtagaa------ca-caaa---------------cc-agagc------tcacatgaataca--atca-
B D                 Zebrafish  aagcacga------ca-caaa---------------ac-agttt------gtacaaaaatatatcttcc-
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                      Fugu  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
                 Zebra mbuna  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                Budgerigar  ======================================================================
  D             Scarlet macaw  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
B D                    Medaka  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ======================================================================
B D        American alligator  ======================================================================

                        Human  -----aaaa
                        Chimp  -----aaaa
                      Gorilla  -----aaaa
                    Orangutan  -----aaaa
                       Gibbon  -----aaaa
                       Rhesus  -----aaaa
          Crab-eating macaque  -----aaaa
                       Baboon  -----aaaa
                 Green monkey  -----aaaa
                     Marmoset  -----aaaa
              Squirrel monkey  -----aaaa
                     Bushbaby  -----aaaa
           Chinese tree shrew  -----aaaa
                     Squirrel  -----aaaa
       Lesser Egyptian jerboa  -----aaaa
                 Prairie vole  -----aaaa
              Chinese hamster  ------aaa
               Golden hamster  ------aaa
                        Mouse  ------aaa
                          Rat  ------aaa
               Naked mole-rat  ----aaaaa
                   Guinea pig  -----aaaa
                   Chinchilla  -----aaaa
             Brush-tailed rat  -----aaaa
                       Rabbit  -----aaaa
                         Pika  -----aaaa
                          Pig  -----aaaa
                       Alpaca  -----aaaa
               Bactrian camel  -----aaaa
                      Dolphin  -----aaaa
                 Killer whale  -----aaaa
             Tibetan antelope  -----aaaa
                          Cow  -----aaaa
                        Sheep  -----aaaa
                Domestic goat  -----aaaa
                        Horse  -----aaaa
             White rhinoceros  -----aaaa
                          Cat  ----aaaaa
                          Dog  ----aaaaa
                      Ferret   -aaaaaaaa
                        Panda  ----aaaaa
               Pacific walrus  -aaaaaaaa
                 Weddell seal  -aaaaaaaa
             Black flying-fox  -----aaaa
                      Megabat  -----aaaa
                Big brown bat  --aaaaaaa
         David's myotis (bat)  -aaaaaaaa
                     Microbat  ----aaaaa
                     Hedgehog  ----aaaaa
                        Shrew  -----aaaa
              Star-nosed mole  -----aaaa
                     Elephant  aaaaaaaaa
          Cape elephant shrew  ------aaa
                      Manatee  ----aaaaa
             Cape golden mole  -----aaaa
                       Tenrec  -----aaaa
                     Aardvark  ----aaaaa
                    Armadillo  ------aaa
                      Opossum  -----aaaa
              Tasmanian devil  aaaaaaaaa
                     Platypus  -----aaaa
                 Saker falcon  aaaaaaaaa
             Peregrine falcon  aaaaaaaaa
          Collared flycatcher  --aaaaaaa
                  Zebra finch  aaaaaaaaa
           Tibetan ground jay  aagaaaaaa
                 Mallard duck  ---aaaaaa
              Green seaturtle  --------a
               Painted turtle  --------a
     Chinese softshell turtle  --------a
       Spiny softshell turtle  -------aa
                       Lizard  -------ag
                X. tropicalis  -----agaa
                   Coelacanth  --------a
           Southern platyfish  -----gaaa
                    Zebrafish  -----aaaa
          Princess of Burundi  =========
                 Nile tilapia  =========
                         Fugu  =========
       Yellowbelly pufferfish  =========
                    Tetraodon  =========
                  Zebra mbuna  =========
                 Atlantic cod  =========
                  Spotted gar  =========
                  Stickleback  =========
     Mexican tetra (cavefish)  =========
          Pundamilia nyererei  =========
        Burton's mouthbreeder  =========
                   Budgerigar  =========
                Scarlet macaw  =========
          Medium ground finch  =========
       White-throated sparrow  =========
                      Chicken  =========
                       Medaka  =========
                       Parrot  =========
                      Wallaby  NNNNNNNNN
                  Rock pigeon  =========
           American alligator  =========

Inserts between block 10 and 11 in window
          Southern platyfish 2bp
B D                Zebrafish 504bp

Alignment block 11 of 473 in window, 62812222 - 62812244, 23 bps 
B D                     Human  aaaa---ttccaaatatt--aataggca
B D                     Chimp  aaaa---ttccaaatatt--aataggca
B D                   Gorilla  aaaa---ttccaaatatt--aataggca
B D                 Orangutan  aaaa---ttccaaatatt--aataggca
B D                    Gibbon  aaaa---ttccaaatatt--aataggca
B D                    Rhesus  aaaa---ttccaaatatt--aataggca
B D       Crab-eating macaque  aaaa---ttccaaatatt--aataggca
B D                    Baboon  aaaa---ttccaaatatt--aataggca
B D              Green monkey  aaaa---ttccaaatatt--aataggca
B D                  Marmoset  aaaa---ttccaaatatt--aataggca
B D           Squirrel monkey  aaaa---ttccaaatatt--aataggca
B D                  Bushbaby  aaaa---ttccaaatatt--aataagca
           Chinese tree shrew  aaaa---ttccaaatatt--aataggca
B D                  Squirrel  aaaa---ttccaaatatt--aataggca
       Lesser Egyptian jerboa  aaaa---ttccaaatatt--aataggca
                 Prairie vole  aaaa---atccaaatatt--aataggca
B D           Chinese hamster  aaaa---ttccaaatatt--aataggca
               Golden hamster  aaaa---ttccaaatatt--aataggca
B D                     Mouse  aaaa---ttccaaatatt--aataggca
B D                       Rat  aaaa---ttccaaatatt--aataggca
B D            Naked mole-rat  aaaa---ttccaaatatt--aataggca
B D                Guinea pig  aaaa---ttccaaatatt--aataggca
                   Chinchilla  aaaa---ttccaaatatt--aataggca
             Brush-tailed rat  aaaa---ttccaaatatt--aataagca
B D                    Rabbit  aaaa---ttacaaatatt--aataggca
B D                      Pika  aaaa---ttccaaatatt--aataggca
B D                       Pig  aaaaaaaatccaaatatt--aataggca
B D                    Alpaca  aaaa--attccaaatatt--aataggca
               Bactrian camel  aaaa--attccaaatatt--aataggca
B D                   Dolphin  aaaa---ttccaaatatt--aataggca
                 Killer whale  aaaa---ttccaaatatt--aataggca
             Tibetan antelope  aaaa----tccaaatatt--aataggca
B D                       Cow  aaaa---ttccaaatatt--aataggca
B D                     Sheep  aaaa----tccaaatatt--aataggca
                Domestic goat  aaaa----tccaaatatt--aataggca
B D                     Horse  aaaa---ttccaaatatt--aataggca
B D          White rhinoceros  aaaa---ttccaaatatt--aataggca
B D                       Cat  aaaa---atccaaatatt--aataggca
B D                       Dog  aaaa---atccaaatatt--aataggca
B D                   Ferret   aaaa---atccaaatatt--aataggca
B D                     Panda  aaaa---atccaaatatt--aataggca
               Pacific walrus  aaaa---atccaaatatt--aataggca
                 Weddell seal  aaaa---atccaaatatt--aataggca
             Black flying-fox  aaaa---tttcaaatatt--aataggca
B D                   Megabat  aaaa---tttcaaatatt--aataggca
                Big brown bat  aaaa---ttccaaatatt--aataggca
         David's myotis (bat)  aaaa---ttcgaaatatt--aataggca
B D                  Microbat  aaaa---ttccaaatatt--aataggca
B D                  Hedgehog  aaaa---ttccaaatatt--aatatgca
B D                     Shrew  aaaa---ttacaaatatt--aataggca
              Star-nosed mole  aaaa---gtccaaatatt--aataggca
B D                  Elephant  aaaa---atccaaatatt--aataggca
          Cape elephant shrew  aaaa---ttccaaatatt--aataggca
B D                   Manatee  aaaa---ttccaaatatt--aataggca
             Cape golden mole  aaaa---ttccaaatatt--aataggca
B D                    Tenrec  aaaa---atccaaatatt--aataggca
                     Aardvark  aaaa---ttccaaatatt--aataggca
B D                 Armadillo  aaaa---ttccaaatatt--aataggca
B D                   Opossum  aaaa---atccaaatatt--aataggca
B D           Tasmanian devil  aaaa---atccaaatatt--aataggca
B D                  Platypus  aaaa----tccaaatatt--aataggca
  D              Saker falcon  aaaa---atcccaatatt--aataggca
  D          Peregrine falcon  aaaa---atcccaatatt--aataggca
  D       Collared flycatcher  aaaa---atcccaatatt--aataggca
B D               Zebra finch  aaaa---atcccaatatt--aataggca
           Tibetan ground jay  aaaa---atcccaatatt--aataggca
  D              Mallard duck  aaaa---atcccaatatt--aataggca
  D           Green seaturtle  aaaa---atccaaatatt--aatgggca
  D            Painted turtle  aaaa---atacaaatatt--aatgggca
  D  Chinese softshell turtle  aaaa---atccaaatatt--aatgggca
  D    Spiny softshell turtle  aaaa---atccaaatatt--aatgggca
B D                    Lizard  aaaa---attcaaatatt--aataggca
B D             X. tropicalis  aaaa---ttccaaatatt--aattggca
B D                Coelacanth  gaaa---ttccggagatt--aattcgca
           Southern platyfish  taga---tgctaaatattagaacaggca
         Princess of Burundi  ============================
B D              Nile tilapia  ============================
B D                      Fugu  ============================
      Yellowbelly pufferfish  ============================
B D                 Tetraodon  ============================
                 Zebra mbuna  ============================
B D                 Zebrafish  ============================
B D              Atlantic cod  ============================
                 Spotted gar  ============================
B D               Stickleback  ============================
    Mexican tetra (cavefish)  ============================
         Pundamilia nyererei  ============================
       Burton's mouthbreeder  ============================
B D                Budgerigar  ============================
  D             Scarlet macaw  ============================
B D       Medium ground finch  ============================
  D    White-throated sparrow  ============================
B D                   Chicken  ============================
B D                    Medaka  ============================
  D                    Parrot  ============================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ============================
B D        American alligator  ============================

Alignment block 12 of 473 in window, 62812245 - 62812277, 33 bps 
B D                     Human  gaaatatacag--ccatacta-aa-------ctcaggg-agtga
B D                     Chimp  gaaatatacag--ccatacta-aa-------ctcaggg-agtga
B D                   Gorilla  gaaatatacag--ccatacta-aa-------ctcaggg-agtga
B D                 Orangutan  gaaatatacag--ccatacta-aa-------ctcaggg-agtga
B D                    Gibbon  gaaatatacag--ccatacta-aa-------ctcaggg-agtga
B D                    Rhesus  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D       Crab-eating macaque  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D                    Baboon  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D              Green monkey  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D                  Marmoset  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D           Squirrel monkey  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D                  Bushbaby  gaaatatacag--ccatacta-aa-------cccaggg-cgtaa
           Chinese tree shrew  gaaatatacag--ccatacta-aa-------cccaggg-aatga
B D                  Squirrel  gaaatatacag--ccatactt-aa-------cccaggg-agtga
       Lesser Egyptian jerboa  gaaatatacag--ccatactttaa-------cccaggg-agtga
                 Prairie vole  gaaatatacag--ccatacttcaa-------cccaggg-aatga
B D           Chinese hamster  gaaatatacag--ccatacttaaa-------cccaggg-aatga
               Golden hamster  gaaatatacag--ccatacttaaa-------cccaggg-aatga
B D                     Mouse  gaaatatacag--ccatacttaaa-------cccaagg-agtga
B D                       Rat  gaaatatacag--ccatacttaaa-------cccaggg-agtga
B D            Naked mole-rat  gaaatatacag--ccatactt-aa-------cccaggg-agtga
B D                Guinea pig  gaaatatacag--ccatactt-aa-------cctcagg-agtca
                   Chinchilla  gaaatatacag--ccatactt-aa-------cccaggg-agtga
             Brush-tailed rat  gaaatatacag--ccatactt-aa-------cccaggg-agtga
B D                    Rabbit  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D                      Pika  gaactatacag--ccatacta-aa-------cccaggg-agtga
B D                       Pig  gaaatgtacag--ccatacta-aa-------cccaggg-agtga
B D                    Alpaca  gaagtatacag--ccatacta-aa-------cccaggg-agtga
               Bactrian camel  gaagtatacag--ccatacta-aa-------cccaggg-agtga
B D                   Dolphin  gaaatatacag--ccatacta-aa-------cccaggg-aatga
                 Killer whale  gaaatatacag--ccatacta-aa-------cccaggg-aataa
             Tibetan antelope  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D                       Cow  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D                     Sheep  gaaatatacag--ccatacta-aa-------cccaggg-agtga
                Domestic goat  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D                     Horse  gaaatatacag--ccataata-aa-------cccaggg-agtga
B D          White rhinoceros  gaaatatacag--ccataata-aa-------cccaggg-agtga
B D                       Cat  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D                       Dog  gaaatatacag--caatact--aa-------cccaggg-aatga
B D                   Ferret   gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D                     Panda  gaaatatacag--ccatacta-aa-------cccaggg-agtga
               Pacific walrus  gaaatatacag--ccatacta-aa-------cccaggg-agtga
                 Weddell seal  gaaatatacag--ccatacta-aa-------cccaggg-agtga
             Black flying-fox  gaaatttacag--ccatacta-aa-------ctgaggg-agtga
B D                   Megabat  gaaatttacag--ccatacta-aa-------ctgaggg-agtga
                Big brown bat  gatatatacag--ccatacta-aa-------cccaggg-agtga
         David's myotis (bat)  gatatatacag--ccatacta-aa-------cccaggg-agtga
B D                  Microbat  gatatatacag--ccatacta-aa-------cccaggg-agtga
B D                  Hedgehog  gaaatatacag--ccatacta-aa-------gccaagg-agtta
B D                     Shrew  gaaatatacag--ccatacta-aa-------cccaagg-agtga
              Star-nosed mole  gaaatatacag--ccatacta-aa-------cccaggg-agtga
B D                  Elephant  gaaatatacag--ccatacta-aa-------cccaggg-tgtga
          Cape elephant shrew  gaaatatacag--ccgtacta-aa-------ccgaggg-catga
B D                   Manatee  gaaatatacag--ccatacga-aa-------cccaagg-tgtga
             Cape golden mole  gaaatatacag--ccatacta-aa-------tccaggg-cgtga
B D                    Tenrec  gaaatatacag--ccggacta-aa-------tccagag-tgtga
                     Aardvark  gaaatatacag--ccgtacta-aa-------cccaggg-tgtga
B D                 Armadillo  gaaatatacag--ccatccta-aa-------cccaggg-aatga
B D                   Opossum  gaaatgtacag--ctatccta-aa-------accaggg-agtga
B D           Tasmanian devil  gaaatgtacaggcatatacta-aa-------accaggg-agtga
B D                  Platypus  gaaatatacag--ccataata-aa-------accaggg-ggtga
  D              Saker falcon  gaaatgtacag--ccatacta-aa-------accaggg-aggga
  D          Peregrine falcon  gaaatgtacag--ccatacta-aa-------accaggg-aggga
  D       Collared flycatcher  gaaatgtacag--ccatacta-aa-------accaggg-aggaa
B D               Zebra finch  gaaatgtacag--ccatacta-aa-------accaggg-aggga
           Tibetan ground jay  gaaatgtacag--ccatacta-aa-------accaggg-aggga
  D              Mallard duck  gaaatgtacag--ccatacta-aa-------accaggg-aggga
  D           Green seaturtle  gaaatgtacag--ccatacta-ag-------atcaggg-actga
  D            Painted turtle  gaaatgtacag--ccatacta-ag-------atcaggg-actga
  D  Chinese softshell turtle  gaaatgtacag--ccatacta-ag-------agcaggg-actga
  D    Spiny softshell turtle  gaaatgtacag--ccatacta-ag-------agcaggg-actga
B D                    Lizard  gaaatatacag--ctata-gg-ag-------accagggcattga
B D             X. tropicalis  gtaatgtacag--ctatgtta-aacggtggcccccggg-cca--
B D                Coelacanth  ggaatgtacag--cattacta-aa-------gccaaag-gagaa
         Princess of Burundi  ============================================
B D              Nile tilapia  ============================================
B D                      Fugu  ============================================
      Yellowbelly pufferfish  ============================================
B D                 Tetraodon  ============================================
                 Zebra mbuna  ============================================
B D                 Zebrafish  ============================================
B D              Atlantic cod  ============================================
                 Spotted gar  ============================================
B D               Stickleback  ============================================
    Mexican tetra (cavefish)  ============================================
         Pundamilia nyererei  ============================================
       Burton's mouthbreeder  ============================================
          Southern platyfish  ============================================
B D                Budgerigar  ============================================
  D             Scarlet macaw  ============================================
B D       Medium ground finch  ============================================
  D    White-throated sparrow  ============================================
B D                   Chicken  ============================================
B D                    Medaka  ============================================
  D                    Parrot  ============================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ============================================
B D        American alligator  ============================================

Inserts between block 12 and 13 in window
B D                   Alpaca 1bp
B D                  Dolphin 3bp
                Killer whale 3bp
B D                    Horse 1bp
B D                      Dog 2bp
B D                    Panda 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
        David's myotis (bat) 2bp
B D                 Microbat 1bp
B D                 Elephant 5bp
         Cape elephant shrew 5bp
B D                  Manatee 5bp
            Cape golden mole 20bp
  D             Saker falcon 4bp
  D         Peregrine falcon 4bp
  D      Collared flycatcher 5bp
B D              Zebra finch 320bp
          Tibetan ground jay 5bp
  D             Mallard duck 4bp
  D          Green seaturtle 5bp
  D           Painted turtle 5bp
  D Chinese softshell turtle 5bp
  D   Spiny softshell turtle 5bp
B D                   Lizard 4bp
B D            X. tropicalis 4bp

Alignment block 13 of 473 in window, 62812278 - 62812286, 9 bps 
B D                     Human  ttttt--t--tt----------c-
B D                     Chimp  ttttt--t--tt------------
B D                   Gorilla  ttttt--t--ttt---------t-
B D                 Orangutan  ttttt--t--tt------------
B D                    Gibbon  ttttt--t--tt------------
B D                    Rhesus  ttttt--c--tt------------
B D       Crab-eating macaque  ttttt--c--tt------------
B D                    Baboon  ttttt--c--tt------------
B D              Green monkey  -tttg--c--tt------------
B D                  Marmoset  ttttt--t--tt------------
B D           Squirrel monkey  ttttt--t--tt------------
B D                  Bushbaby  ttatt--t--tt----------t-
           Chinese tree shrew  ttttt--t--tt----------t-
B D                  Squirrel  tttta--t--tt------------
       Lesser Egyptian jerboa  ttttt--tt-tt------------
                 Prairie vole  tttct--t--tt------------
B D           Chinese hamster  ttttt--t--tt------------
               Golden hamster  --ttt--t--tt------------
B D                     Mouse  ttttt--ctgtt------------
B D                       Rat  ttttt-----tt------------
B D            Naked mole-rat  attttt-t--tt------------
B D                Guinea pig  atctta-t--tt------------
                   Chinchilla  attta--t--tt------------
             Brush-tailed rat  atttat-t--tt------------
B D                    Rabbit  --tttt-t--tt------------
B D                      Pika  tttttt-t--tt------------
B D                       Pig  ttttt--t--t-------------
B D                    Alpaca  ttttt--t--tt------------
               Bactrian camel  ttttt--t--tt------------
B D                   Dolphin  ttttt--t--tt------------
                 Killer whale  ttttt--t--tt------------
             Tibetan antelope  ttttt--t--tc------------
B D                       Cow  -tttt--t--tc------------
B D                     Sheep  ttttt--t--tc------------
                Domestic goat  ttttt--t--tc------------
B D                     Horse  ttttt--t--tt------------
B D          White rhinoceros  -tttt--t--tt------------
B D                       Cat  ttttt--t--tt------------
B D                       Dog  ttttt--t--tt------------
B D                   Ferret   -tttt--t--tt------------
B D                     Panda  ttttt--t--tt------------
               Pacific walrus  ttttt--t--tt------------
                 Weddell seal  ttttt--t--tt------------
             Black flying-fox  ttttt--t--tt------------
B D                   Megabat  ttttt--t--tt------------
                Big brown bat  ttttt--t--tt------------
         David's myotis (bat)  ttttt--t--tt------------
B D                  Microbat  ttttt--t--tt------------
B D                  Hedgehog  -tttc--t--tt------------
B D                     Shrew  ttttt--t--tt------------
              Star-nosed mole  -tttt--t--ct------------
B D                  Elephant  t------t--ct------------
          Cape elephant shrew  tttctcct--tc------------
B D                   Manatee  ttttt--t--tt------------
             Cape golden mole  ttttt--t--tt------------
B D                    Tenrec  tttta--t--tt------------
                     Aardvark  ttttc--c--cc------------
B D                 Armadillo  --ttt--t--tt------------
B D                   Opossum  ttttt--c--ag------------
B D           Tasmanian devil  ttttt--c--ag------------
B D                  Platypus  gttct--t--tttcgttggtcgt-
  D              Saker falcon  tttc--------------------
  D          Peregrine falcon  tttc--------------------
  D       Collared flycatcher  tttc--------------------
           Tibetan ground jay  tttc--------------------
  D              Mallard duck  tttc--------------------
  D           Green seaturtle  tttc--------------------
  D            Painted turtle  tttc--------------------
  D  Chinese softshell turtle  tttc--------------------
  D    Spiny softshell turtle  tttc--------------------
B D                    Lizard  tttc--------------------
B D             X. tropicalis  tgtg--------------------
B D                Coelacanth  tattt--c--tc-----------a
         Princess of Burundi  ========================
B D              Nile tilapia  ========================
B D                      Fugu  ========================
      Yellowbelly pufferfish  ========================
B D                 Tetraodon  ========================
                 Zebra mbuna  ========================
B D                 Zebrafish  ========================
B D              Atlantic cod  ========================
                 Spotted gar  ========================
B D               Stickleback  ========================
    Mexican tetra (cavefish)  ========================
         Pundamilia nyererei  ========================
       Burton's mouthbreeder  ========================
          Southern platyfish  ========================
B D                Budgerigar  ========================
  D             Scarlet macaw  ========================
B D       Medium ground finch  ========================
  D    White-throated sparrow  ========================
B D                   Chicken  ========================
B D                    Medaka  ========================
B D               Zebra finch  ========================
  D                    Parrot  ========================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ========================
B D        American alligator  ========================

Inserts between block 13 and 14 in window
  D             Saker falcon 19bp
  D         Peregrine falcon 19bp
  D      Collared flycatcher 19bp
          Tibetan ground jay 19bp
  D             Mallard duck 11766bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp
B D                   Lizard 35bp

Alignment block 14 of 473 in window, 62812287 - 62812381, 95 bps 
B D                     Human  tcc-at-----------aataaggcaaccca-------tttacatgcagaccttg-t----aacattgtc
B D                     Chimp  tcc-at-----------aataaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                   Gorilla  tcc-at-----------aataaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                 Orangutan  -cc-at-----------aataaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                    Gibbon  tcc-at-----------aataaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                    Rhesus  tcc---------------ataaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D       Crab-eating macaque  tcc---------------ataaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                    Baboon  tcc---------------ataaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D              Green monkey  tcc---------------ataaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                  Marmoset  -cc-at-----------aataaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D           Squirrel monkey  -cc-at-----------aataaggcaaccca-------tttacatgcagaccctg-c----aacattgtc
B D                  Bushbaby  tcc-at-----------agtaaggcaatcca-------tttacatgcagaccctg-t----cacattgtc
           Chinese tree shrew  tcc-at-----------agtaaggcagccca-------tttacatgcagaccctg-t----aacattgtc
B D                  Squirrel  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
       Lesser Egyptian jerboa  tcc-ag-----------agtaaggcgtccta-------tttacatgcagaccctg-t----aacattgtc
                 Prairie vole  tcctat-----------agtaaggcctcctg-------catacatgcagaccctg-t----aacactgcc
B D           Chinese hamster  tcc-at-----------tgtaaggcatcttg-------tatacatgcagaccctg-t----aacactgcc
               Golden hamster  tcc-at-----------agtaaggcatcttg-------tatacatgcagaccctg-t----aacactgcc
B D                     Mouse  ccc-at-----------agtaaggcatcctg-------tacacatgcagaccctgtt----aacactgcc
B D                       Rat  ttc-at-----------agtaaggcatcctg-------tacacatgcagaccctg-t----aacactgcc
B D            Naked mole-rat  tcc-at-----------agtaaggcaacccg-------tttacatgcagaccctg-t----aacattgtc
B D                Guinea pig  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacactgtc
                   Chinchilla  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
             Brush-tailed rat  tcc-at-----------tgtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                    Rabbit  tcc-at-----------agtaaggcaaccca-------tttacatgcagacactg-t----aacattgtc
B D                      Pika  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacatcgtc
B D                       Pig  --c-at-----------agtaaggcaaccca-------tttacatgcaga-cctg-t----aacattgtc
B D                    Alpaca  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
               Bactrian camel  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                   Dolphin  tcc-at-----------agtaaggcaatcca-------tttacatgcagaccctg-t----aacattgtc
                 Killer whale  tcc-at-----------agtaaggcaatcca-------tttacatgcagaccctg-t----aacattgtc
             Tibetan antelope  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                       Cow  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                     Sheep  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
                Domestic goat  tcc-ac-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacactgtc
B D                     Horse  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D          White rhinoceros  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-c----aacattgtc
B D                       Cat  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctt-t----aacattgtc
B D                       Dog  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                   Ferret   ttc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                     Panda  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
               Pacific walrus  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
                 Weddell seal  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
             Black flying-fox  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                   Megabat  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
                Big brown bat  ttc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
         David's myotis (bat)  ttc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                  Microbat  ttc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                  Hedgehog  ttc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                     Shrew  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
              Star-nosed mole  tcc-at-----------agtaaggcaaccca-------tttacatgcagaccctg-t----aacattgtc
B D                  Elephant  tcc-at-----------agtaaggcaaccca-------tttacatgcagacactg-t----aacactgtc
          Cape elephant shrew  tcc-at-----------agtaaggcaaccct-------ttaacatgcagacactg-t----aacattgtc
B D                   Manatee  tcc-at-----------agtaaggcaaccca-------tttacatgcagacactg-t----aacattgtc
             Cape golden mole  ccc-gt-----------aataaggcaaccca-------tttacatgcagacactg-taacaaacactgtc
B D                    Tenrec  tcc-at-----------agtaaggcagccca-------tttacatgcagacactg-t----aacattgtc
                     Aardvark  tcc-at-----------agtaaggcaaccca-------tttacatgcagacactg-t----aacattgtc
B D                 Armadillo  ttc-at-----------agtaaggcaaccca-------tttacatgcagacactg-t----accattgtc
B D                   Opossum  tca-tt-----------cataaggcaaccca-------ttgacatgcagacgcgg-c----aacgttgtc
B D           Tasmanian devil  taa-tt-----------aataaggcaaccca-------tttacatgcagacactg-c----aacattgtc
B D                  Platypus  tcg-tt-----------aataaggcaaccca-------tttacatgcagacactg-a----gacattgtc
  D              Saker falcon  gtc-gtcggagcggatcggtaaggcacccc---------ccacatgcagacaggg-g----accgggctc
  D          Peregrine falcon  gtc-gtcggagcggatcggtaaggcacccc---------ccacatgcagacaggg-g----accgggctc
  D       Collared flycatcher  gtc-gtcggagcggatcggtaaggcacccc---------ccacatgcagacggga-g----acggggctc
           Tibetan ground jay  gtc-atcggagcggatcggtaaggcacccc---------ccacatgcagacaggg-g----accgggctc
  D           Green seaturtle  gtc-gt-------aattaataaggcaaccca-------tttacatgcagacactg-a----aacattgtc
  D            Painted turtle  gtc-gt-------aattaataaggcaaccca-------tttacatgcagacactg-a----aacactgtc
  D  Chinese softshell turtle  gcc-gt-------aattaataaggcaaccca-------tttacatgcagacactg-a----aacatggtc
  D    Spiny softshell turtle  gcc-gt-------aattaataaggcaaccca-------tttacatgcagacactg-a----aacatggtc
B D                    Lizard  atc-ct-------gatcagtaaggcaacagat------ttaacatgcagccacgc-a----accattgtc
B D             X. tropicalis  ------------tcgtggataaggcaacctata-----tatacatgcagacaggg-c---gagaattgtc
B D                Coelacanth  -------------------tatatcattccaaagagtgtctatttacaaacgttg-a----agcattgtc
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                      Fugu  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
          Southern platyfish  ======================================================================
B D                Budgerigar  ======================================================================
  D             Scarlet macaw  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
B D                    Medaka  ======================================================================
B D               Zebra finch  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================

                        Human  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                        Chimp  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                      Gorilla  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                    Orangutan  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                       Gibbon  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                       Rhesus  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
          Crab-eating macaque  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                       Baboon  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                 Green monkey  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                     Marmoset  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
              Squirrel monkey  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                     Bushbaby  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
           Chinese tree shrew  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                     Squirrel  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
       Lesser Egyptian jerboa  ttcac-----cacacagggcacc-aaggacacttc-caatac------------a-----gttgcatgca
                 Prairie vole  cacat-----cacacaaggctca-ggggacatttc-cagcac------------a-----actgcatgca
              Chinese hamster  cacat-----cacaaaaggcaca-gaggacacttc-caacac------------a-----actgcatgca
               Golden hamster  cacat-----cacacaaggcaca-gaggacacttc-caacac------------a-----actgcatgca
                        Mouse  cacat-----cacacaaggcaca-gaggacacttg-caacaccact--------c-----actgcatgca
                          Rat  cacat-----cacacaaggcaca-gaggacacttg-caacac------------c-----actgcatgca
               Naked mole-rat  tacat-----cacacaaggcacc-aaggacacttc-cgacac------------a-----attgcatgca
                   Guinea pig  tacat-----tacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                   Chinchilla  tacat-----cacacaaggcacc-aaggacacttc-aa-cac------------a-----attgcatgca
             Brush-tailed rat  tacat-----cacacaaggcacc-aaggacacttc-catcac------------a-----actgcatgca
                       Rabbit  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                         Pika  tacat-----cacacaaggca-c-aaggacacttc-caacac------------a-----actgcatgca
                          Pig  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                       Alpaca  tacat-----cacacaaggcacc-aaggacacttt-cgacac------------a-----actgcatgca
               Bactrian camel  tacat-----cacacaaggcacc-aaggacacttt-cgacac------------a-----actgcatgca
                      Dolphin  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                 Killer whale  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
             Tibetan antelope  tacat-----cacacaaggcacc-aaggacacgtc-caacac------------a-----attgcatgca
                          Cow  tacat-----cacacaaggcacc-agggacacgtc-caacac------------a-----actgcatgca
                        Sheep  tacat-----cacacaaggcacc-aaggacacgtc-caacac------------a-----attgcatgca
                Domestic goat  tacat-----cacacaaggcacc-aaggacacgtc-caacac------------a-----attgcatgca
                        Horse  tacat-----cacacaaggcacc-aaggacatttc-caacac------------a-----attgcatgca
             White rhinoceros  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                          Cat  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----actgcatgca
                          Dog  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----actgcatgca
                      Ferret   cacat-----cacacaaggcacc-gaggacacttc-caacac------------g-----actgcatgca
                        Panda  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----actgcatgca
               Pacific walrus  tacat-----cacacaaggcacc-aagtacacttc-caacac------------a-----actgcatgca
                 Weddell seal  tacat-----cacacaaggcacc-aaggacacttc-cgacac------------a-----actgcatgca
             Black flying-fox  tacat-----cacacaaggcacc-aaggacacttt-caacac------------a-----attgcatgca
                      Megabat  tacat-----cacacaaggcacc-aaggacacttt-caacac------------a-----attgcatgca
                Big brown bat  tacat-----cacacaaggcacc-aagaacacttc-caacac------------a-----attgcatgca
         David's myotis (bat)  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                     Microbat  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                     Hedgehog  tacat-----cacacaaggcaccaaaggacacttt-caacac------------a-----actgcatgca
                        Shrew  tacat-----cacacaaggcaccaaaggacacgtc-caacac------------a-----attacatgca
              Star-nosed mole  tacat-----cacacaaggcaccaaaggacacttc-tgacac------------a-----attgcatgca
                     Elephant  tacat-----cacgcaaggcacc-aaggacactt--cgacac------------a-----attgcatgca
          Cape elephant shrew  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
                      Manatee  tacat-----cacgcaaggcacc-aaggacacttc-caacac------------a-----attgcatgca
             Cape golden mole  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----actgcatgca
                       Tenrec  tacat-----cacacaaggcacc-aaggacacttt-caatac------------a-----attgcatgca
                     Aardvark  tacat-----cacacaaggcacc-aaggacacttc-caacac------------a-----a-tgcatgca
                    Armadillo  tacat-----cacacaaggcacc-aaggacactt--caacac------------a-----attgcatgca
                      Opossum  tacat-----cacacaaggcacc--aggacacgcc---acac------------g-----atcgcatgca
              Tasmanian devil  tacat-----cacacaaggcacc-gaggacacgtc--aacac------------a-----atcgcatgca
                     Platypus  tacat-----cacacaaggcacc-aaggacactt--caacac------------a-----attgcatgca
                 Saker falcon  tacac-----cacacaaggcacc-aaggacacct--caccac------------gacggcactgcatgca
             Peregrine falcon  tacac-----cacacaaggcacc-aaggacacct--caccac------------gacggcactgcatgca
          Collared flycatcher  tacac-----cacacaaggcacc-aaggacacct--caccac------------gacggcactacatgca
           Tibetan ground jay  tacac-----cacacaaggcacc-aaggacacct--caccac------------gacggcactgcatgca
              Green seaturtle  tacat-----cacacaaggcacc-aaggacactt--caacac------------g-----tttgcatgca
               Painted turtle  tacat-----cacacaaggcacc-aaggacactt--caacac------------g-----tttgcatgca
     Chinese softshell turtle  tacat-----cacacaaggcacc-aaggacactt--caacac------------a-----tttgcatgca
       Spiny softshell turtle  tacat-----cacacaaggcacc-aaggacactt--caacac------------g-----tttgcatgca
                       Lizard  tacacatccaaataaaaggcacc-aaggacatttc-caacac------------a-----attgcatgca
                X. tropicalis  cacat-----cacacaaggcacc-atgaacactgagtagcag------------a-----gaggcatgca
                   Coelacanth  ta--------cacacaaggcacc-aggaacacata-caacttctatcatgcaggg-----aaaatataca
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                         Fugu  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                    Tetraodon  ======================================================================
                  Zebra mbuna  ======================================================================
                    Zebrafish  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
           Southern platyfish  ======================================================================
                   Budgerigar  ======================================================================
                Scarlet macaw  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
                      Chicken  ======================================================================
                       Medaka  ======================================================================
                  Zebra finch  ======================================================================
                       Parrot  ======================================================================
                      Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================

                        Human  ----tcc
                        Chimp  ----tcc
                      Gorilla  ----tcc
                    Orangutan  ----tcc
                       Gibbon  ----tcc
                       Rhesus  ----tcc
          Crab-eating macaque  ----tcc
                       Baboon  ----tcc
                 Green monkey  ----tcc
                     Marmoset  ----tcc
              Squirrel monkey  ----tcc
                     Bushbaby  ----tcc
           Chinese tree shrew  ----tcc
                     Squirrel  ----tcc
       Lesser Egyptian jerboa  ----gct
                 Prairie vole  ----ccc
              Chinese hamster  ----tcc
               Golden hamster  ----taa
                        Mouse  ----tcc
                          Rat  ----tcc
               Naked mole-rat  ----ttt
                   Guinea pig  ----ttc
                   Chinchilla  ----tgc
             Brush-tailed rat  ----ttc
                       Rabbit  ----tcg
                         Pika  ----tcc
                          Pig  ----tcc
                       Alpaca  ----tcc
               Bactrian camel  ----tcc
                      Dolphin  ----tcc
                 Killer whale  ----tcc
             Tibetan antelope  ----tcc
                          Cow  ----tcc
                        Sheep  ----tcc
                Domestic goat  ----tcc
                        Horse  ----tcc
             White rhinoceros  ----tcc
                          Cat  ----tcc
                          Dog  ----tcc
                      Ferret   ----tcc
                        Panda  ----tcc
               Pacific walrus  ----tcc
                 Weddell seal  ----tcc
             Black flying-fox  ----tcc
                      Megabat  ----tcc
                Big brown bat  ----tcc
         David's myotis (bat)  ----tcc
                     Microbat  ----tcc
                     Hedgehog  ----tcc
                        Shrew  ----tcc
              Star-nosed mole  ----tcc
                     Elephant  ----tcc
          Cape elephant shrew  ----tcc
                      Manatee  ----tcc
             Cape golden mole  ----tcc
                       Tenrec  ----tcc
                     Aardvark  ----tcc
                    Armadillo  ----tcc
                      Opossum  cccgtcc
              Tasmanian devil  ----tcc
                     Platypus  ----tcc
                 Saker falcon  ----tcc
             Peregrine falcon  ----tcc
          Collared flycatcher  ----tcc
           Tibetan ground jay  ----tcc
              Green seaturtle  ----tcc
               Painted turtle  ----tcc
     Chinese softshell turtle  ----tct
       Spiny softshell turtle  ----tct
                       Lizard  ----ccc
                X. tropicalis  ----atc
                   Coelacanth  ----tct
          Princess of Burundi  =======
                 Nile tilapia  =======
                         Fugu  =======
       Yellowbelly pufferfish  =======
                    Tetraodon  =======
                  Zebra mbuna  =======
                    Zebrafish  =======
                 Atlantic cod  =======
                  Spotted gar  =======
                  Stickleback  =======
     Mexican tetra (cavefish)  =======
          Pundamilia nyererei  =======
        Burton's mouthbreeder  =======
           Southern platyfish  =======
                   Budgerigar  =======
                Scarlet macaw  =======
          Medium ground finch  =======
       White-throated sparrow  =======
                      Chicken  =======
                       Medaka  =======
                  Zebra finch  =======
                       Parrot  =======
                      Wallaby  NNNNNNN
                  Rock pigeon  =======
                 Mallard duck  =======
           American alligator  =======

Inserts between block 14 and 15 in window
  D             Saker falcon 4bp
  D      Collared flycatcher 4bp
          Tibetan ground jay 4bp

Alignment block 15 of 473 in window, 62812382 - 62812406, 25 bps 
B D                     Human  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                     Chimp  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                   Gorilla  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                 Orangutan  taatttc--agaga--a-ta---------tatgtaca-t-c---
B D                    Gibbon  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                    Rhesus  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D       Crab-eating macaque  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                    Baboon  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D              Green monkey  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                  Marmoset  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D           Squirrel monkey  tagtttc--aaaga--a-ta---------tatgtaca-t-c---
B D                  Bushbaby  tagtttc--agagaata-ta---------tatataca-t-c---
           Chinese tree shrew  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                  Squirrel  tagtttc--agaga--a-ta---------tatgtaca-t-c---
       Lesser Egyptian jerboa  tacattc--agaga--a-ta---------tatgtaca-a-c---
                 Prairie vole  -----------------------------tatgtaca-t-c---
B D           Chinese hamster  -----------------------------tatgtaca-c-c---
               Golden hamster  -----------------------------tatgtaca-t-c---
B D                     Mouse  -----------------------------tatgtacg-t-c---
B D                       Rat  -----------------------------tatgtaca-c-c---
B D            Naked mole-rat  tagtttt--agaga--a-ta---------tatgtaca-t-c---
B D                Guinea pig  tagtttt--agaga--atta---------tatttaca-t-c---
                   Chinchilla  tagtttt--agaga--atta---------tatgtaca-t-c---
             Brush-tailed rat  taggttt--agaga--atta---------tatgtaca-t-c---
B D                    Rabbit  tagttta--agaga--a-ta---------tatgtaca-t-c---
B D                      Pika  tagtttc--agaga--a-ta---------tatgtacatt-t---
B D                       Pig  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                    Alpaca  tagtttc--agaga--a-ta---------tatgtaca-t-c---
               Bactrian camel  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                   Dolphin  tagtttc--agaga--a-ta---------tatgtaca-t-c---
                 Killer whale  tagtttc--agaga--a-ta---------tatgtaca-t-c---
             Tibetan antelope  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                       Cow  tagcttc--agaga--a-ta---------tatgtaca-t-c---
B D                     Sheep  tagtttc--agaga--a-ta---------tatgtaca-t-c---
                Domestic goat  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                     Horse  tagtttc----aga--c-ta---------tatgtaca-t-c---
B D          White rhinoceros  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                       Cat  tagtttc--agaga--a-ta---------tatgtaca-t-----
B D                       Dog  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                   Ferret   tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                     Panda  tagtttc--agaga--a-ta---------tatgtaca-t-c---
               Pacific walrus  tagtttc--agaga--a-ta---------tatgtaca-t-c---
                 Weddell seal  tagtttc--agaga--a-ta---------tatgtaca-t-c---
             Black flying-fox  tagtttc--agaga--a-ta---------tatgtaca-c-c---
B D                   Megabat  tagtttc--agaga--a-ta---------tatgtaca-c-c---
                Big brown bat  tagttcc--agaga--a-ta---------tatgtaca-t-----
         David's myotis (bat)  tagtttc--agaga--a-ta---------tatgtaca-t-c---
B D                  Microbat  tagattc--agaga--a-ta---------tatgtaca-t-c---
B D                  Hedgehog  aagtttg--agaca--a-ta---------tatttaca-tcc---
B D                     Shrew  aagttcc--agaga--a-ta---------tatgtaca-tac---
              Star-nosed mole  aagtttc--agaga--a-tc---------tatgtaca-t-----
B D                  Elephant  taatttc--agaga--a-ta---------tatgtaca-t-c---
          Cape elephant shrew  taatttc--agaga--a-ta---------tatgtaca-t-c---
B D                   Manatee  taatttc--agaga--a-ta---------tatgtaca-t-c---
             Cape golden mole  gaatttc--ataga--a-ta---------tatgtaca-t-t---
B D                    Tenrec  taa--tc--ataga--a-ta---------tatgtaca-t-c---
                     Aardvark  taatttc--agaga--a-ta---------tatgtaca-t-c---
B D                 Armadillo  tactttc--agaga--a-ta---------tatgtaca-t-c---
B D                   Opossum  cag-gtt--cggag--a-tc---------tatgtaca-t-c---
B D           Tasmanian devil  taa-ttc--agaga--a-ta---------tatgtaca-t-c---
B D                  Platypus  tagtatc--tgaga--a-tc---------tatgtaca-t-c---
  D              Saker falcon  tcccgcc--gcagc--c-cc---------tatgtaca-c-c---
  D       Collared flycatcher  tcccacc--gcaga--c-cc---------tatgtaca-c-c---
           Tibetan ground jay  tcccgcc--gcagc--c-cc---------tatgtaca-c-c---
  D           Green seaturtle  taacagc--agaga--a-ta---------tacgtaca-t-c---
  D            Painted turtle  taacagc--agaga--a-ta---------tacgtaca-t-c---
  D  Chinese softshell turtle  taacagc---------------------------aca-t-c---
  D    Spiny softshell turtle  taacagc---------------------------aca-t-c---
B D                    Lizard  -----------aga--a-tccgagcaggttatgtaca-a-t---
B D             X. tropicalis  taacgtcgtacaca--a-ac---------tatataca-t-----
B D                Coelacanth  ----------tagt--t-tt---------taaataca-a-taat
         Princess of Burundi  ============================================
B D              Nile tilapia  ============================================
B D                      Fugu  ============================================
      Yellowbelly pufferfish  ============================================
B D                 Tetraodon  ============================================
                 Zebra mbuna  ============================================
B D                 Zebrafish  ============================================
B D              Atlantic cod  ============================================
                 Spotted gar  ============================================
B D               Stickleback  ============================================
    Mexican tetra (cavefish)  ============================================
         Pundamilia nyererei  ============================================
       Burton's mouthbreeder  ============================================
          Southern platyfish  ============================================
B D                Budgerigar  ============================================
  D             Scarlet macaw  ============================================
B D       Medium ground finch  ============================================
  D    White-throated sparrow  ============================================
  D          Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Chicken  ============================================
B D                    Medaka  ============================================
B D               Zebra finch  ============================================
  D                    Parrot  ============================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ============================================
  D              Mallard duck  ============================================
B D        American alligator  ============================================

Inserts between block 15 and 16 in window
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp

Alignment block 16 of 473 in window, 62812407 - 62812410, 4 bps 
B D                     Human  cc-cc---
B D                     Chimp  cc-cc---
B D                   Gorilla  cc-cc---
B D                 Orangutan  cc-cc---
B D                    Gibbon  cc-cc---
B D                    Rhesus  cc-cc---
B D       Crab-eating macaque  cc-cc---
B D                    Baboon  cc-cc---
B D              Green monkey  cc-cc---
B D                  Marmoset  cc-cc---
B D           Squirrel monkey  cc-ca---
B D                  Bushbaby  cc-tc---
           Chinese tree shrew  cc-cc---
B D                  Squirrel  cc-cc---
       Lesser Egyptian jerboa  cc-ac---
                 Prairie vole  cc-cc---
B D           Chinese hamster  cc-cc---
               Golden hamster  cc-cc---
B D                     Mouse  cc-cc---
B D                       Rat  cc-cc---
B D            Naked mole-rat  cc-tc---
B D                Guinea pig  ac-tc---
                   Chinchilla  ac-tc---
             Brush-tailed rat  ac-tc---
B D                    Rabbit  cc-cc---
B D                      Pika  cc-tc---
B D                       Pig  cc-tc---
B D                    Alpaca  cc-cc---
               Bactrian camel  cc-cc---
B D                   Dolphin  cc-cc---
                 Killer whale  cc-cc---
             Tibetan antelope  cc-cc---
B D                       Cow  cc-cc---
B D                     Sheep  cc-cc---
                Domestic goat  cc-cc---
B D                     Horse  cc-cc---
B D          White rhinoceros  cc-cc---
B D                       Cat  cc-cc---
B D                       Dog  cc-cc---
B D                   Ferret   cc-cc---
B D                     Panda  cc-cc---
               Pacific walrus  cc-cc---
                 Weddell seal  cc-cc---
             Black flying-fox  cc-ct---
B D                   Megabat  cc-ct---
                Big brown bat  tc-ct---
         David's myotis (bat)  cc-ct---
B D                  Microbat  cc-ct---
B D                  Hedgehog  cc-ct---
B D                     Shrew  cc-ct---
              Star-nosed mole  cc-ct---
B D                  Elephant  cc-cc---
          Cape elephant shrew  cc-ct---
B D                   Manatee  cc-cc---
             Cape golden mole  cc-cc---
B D                    Tenrec  ct-cc---
                     Aardvark  cc-cc---
B D                 Armadillo  cc-cc---
B D                   Opossum  cc-cc---
B D           Tasmanian devil  cc-cc---
B D                  Platypus  tcatt---
  D       Collared flycatcher  cc-cc---
           Tibetan ground jay  cg-cc---
  D           Green seaturtle  ca-cc---
  D            Painted turtle  ca-cc---
  D  Chinese softshell turtle  ca-cc---
  D    Spiny softshell turtle  ca-cc---
B D                    Lizard  ct-tc---
B D             X. tropicalis  cc------
B D                Coelacanth  ----tggt
         Princess of Burundi  ========
B D              Nile tilapia  ========
B D                      Fugu  ========
      Yellowbelly pufferfish  ========
B D                 Tetraodon  ========
                 Zebra mbuna  ========
B D                 Zebrafish  ========
B D              Atlantic cod  ========
                 Spotted gar  ========
B D               Stickleback  ========
    Mexican tetra (cavefish)  ========
         Pundamilia nyererei  ========
       Burton's mouthbreeder  ========
          Southern platyfish  ========
B D                Budgerigar  ========
  D             Scarlet macaw  ========
B D       Medium ground finch  ========
  D    White-throated sparrow  ========
  D          Peregrine falcon  NNNNNNNN
  D              Saker falcon  NNNNNNNN
B D                   Chicken  ========
B D                    Medaka  ========
B D               Zebra finch  ========
  D                    Parrot  ========
B D                   Wallaby  NNNNNNNN
  D               Rock pigeon  ========
  D              Mallard duck  ========
B D        American alligator  ========

Inserts between block 16 and 17 in window
          Chinese tree shrew 1bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                 Platypus 1bp
  D      Collared flycatcher 92bp
          Tibetan ground jay 114bp

Alignment block 17 of 473 in window, 62812411 - 62812438, 28 bps 
B D                     Human  tt--------aaata----agtt-aac---------ctct----------------gagat-------ca
B D                     Chimp  tt--------aaata----agtt-aac---------ctct----------------gagat-------ca
B D                   Gorilla  tt--------aaata----agtt-aac---------ctct----------------gagat-------ca
B D                 Orangutan  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D                    Gibbon  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D                    Rhesus  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D       Crab-eating macaque  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D                    Baboon  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D              Green monkey  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D                  Marmoset  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D           Squirrel monkey  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D                  Bushbaby  tt--------aaata----agtt-aat---------ctctgac--ccat--ttcaagagat-------ca
           Chinese tree shrew  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D                  Squirrel  tt--------aaata----aatt-aac---------ctctgac--tcat--ttcaagagat-------ca
       Lesser Egyptian jerboa  tt--------aaata----agtt-aac---------c--tgac--tcat--tgcaagagat-------ca
                 Prairie vole  tt--------aaata----agtt-aac---------ctttgac--tcat--ttcaagagat-------ca
B D           Chinese hamster  tt--------aaata----agtt-aac---------cactgac--tcat--ttcaagagat-------ca
               Golden hamster  tt--------aaata----agtt-aac---------cactgac--tcat--ttcaagagat-------ca
B D                     Mouse  tt--------aaataagttagtt-aac---------ctttgac--tcat--ttcaagagat-------ca
B D                       Rat  tt--------aaata----agtt-aac---------ttttgac--tcga--ttcaagagat-------ca
B D            Naked mole-rat  tt--------aaata----agtt-aat---------ctctgac--tcat--ttcaagagat-------ca
B D                Guinea pig  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
                   Chinchilla  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
             Brush-tailed rat  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D                    Rabbit  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D                      Pika  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D                       Pig  tt--------aaata----agtt-aag---------ctctgac--tcaa--ttcaagagat-------ca
B D                    Alpaca  tt--------aaata----agtt-aac---------atctgac--tcat--ttcaagagat-------ca
               Bactrian camel  tt--------aaata----agtt-aac---------atctgac--tcat--ttcaagagat-------ca
B D                   Dolphin  tt--------aaata----agtt-aac---------ctctgac--tcat--tttgagat---------ca
                 Killer whale  tt--------aaata----agtt-aac---------ctctgac--tcat--tttgagat---------ca
             Tibetan antelope  tt--------aaata----agtt-aac---------ctctgac--tcac--tgcaagagat-------ca
B D                       Cow  tt--------aaata----agtt-aac---------ctctgac--tcat--tgcaagagat-------ca
B D                     Sheep  tt--------aaata----agtt-aac---------ctctgac--tcac--tgcaagag----------a
                Domestic goat  tt--------aaata----agtt-aac---------ctctgac--tcac--tgcaagag----------a
B D                     Horse  tt--------aaata----agtt-aac---------ctctgac--ttat--ttcaagagat-------ca
B D          White rhinoceros  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D                       Cat  tt--------aaata----agtt-aat---------ctctgac--tcat--ttcaggagat-------ca
B D                       Dog  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaagagat-------ca
B D                   Ferret   tt--------aaata----agtt-aac---------ctctgac--tcat--tgcgagagat-------ca
B D                     Panda  tt--------aaata----agtt-aat---------ctctgac--tcat--ttcaagagat-------ca
               Pacific walrus  tt--------aaata----agtt-aac---------ttctgac--tcat--ttcaagagat-------ca
                 Weddell seal  tt--------aaata----agtt-aac---------ttctgac--tcat--ttcaagagat-------ca
             Black flying-fox  tt--------aaata----agtt-aac---------ctttgac--tcat--ttcaagagat-------ca
B D                   Megabat  tt--------aaata----agtt-aac---------ctttgac--tcat--ttcaagagat-------ca
                Big brown bat  tt--------aaata----agtt-aac---------ctcctac--tcat--ttcaagaggt-------ca
         David's myotis (bat)  tt--------aaata----agtt-aac---------ctctgac--tcgt--ttcaagagat-------ca
B D                  Microbat  tt--------aaata----agtt-aac---------ctctgac--tcgt--ttcaagagat-------ca
B D                  Hedgehog  tt--------aaata----agtt-aac---------ctctgac--tcac--ttcaagagat-------ca
B D                     Shrew  tt--------aaata----agtt-aac---------ctctgac--taat--ttcaagagat-------ca
              Star-nosed mole  tt--------aaata----agtt-aac---------ctctgac----at--ttcaagaaat-------ca
B D                  Elephant  tt---------aata----agtt-aac---------ctcagat--tcat--ttcaagggat-------ca
          Cape elephant shrew  tt--------aaata----agtt-aac---------ctctgtc--tcat--ttcaagaaat-------ca
B D                   Manatee  tt--------aaata----agtt-acc---------ctctgac--tcat--gtcaagagat-------ca
             Cape golden mole  tt--------aaata----agtt-aac---------ctctgac--tcat----------tt-------ca
B D                    Tenrec  tt--------aaata----agtt-aac---------ctctgac--tcat--ttcaaaagtt-------ca
                     Aardvark  tt--------aaata----agtt-aac---------ctctaac--tcat--ctcaagagat-------aa
B D                 Armadillo  tt--------aaata----agtt-aac---------ctctgat--tcat--ctcaagagat-------ca
B D                   Opossum  tc---------aata----agtt-atc-----------ctgat--tcctgctccag--------------
B D           Tasmanian devil  ccccccttttaaata----aact-atc---------ctctgat--tcttggtccaatagat-------ca
B D                  Platypus  tt--------aaataagttagtt-aac---------ctcggactttcaa--ttcaatagat-------ca
  D           Green seaturtle  tt--------caata----aatt-aactt-------ctctgacgctcat--tttgatggat-------ca
  D            Painted turtle  tt--------caata----aatt-aactt-------ctctgacgctcat--tttgatagat-------ca
  D  Chinese softshell turtle  tt--------caata----agtt-aacgt-------ctctgactctcac--ttcgatagat-------ca
  D    Spiny softshell turtle  tt--------caata----agtt-aacgt-------ctctgactct--c--tttgatagat-------ca
B D                    Lizard  aa--------aaata----agttaaacct-------ctcca-------------gtcggtc-------ca
B D             X. tropicalis  tt--------aaata----aatt-agg---------ctctctg--gcgc--ttctatatta-------ca
B D                Coelacanth  ------------ata----aatt-agctcctctgtgccctgat--caag--tattagaaatcgtgttcca
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                      Fugu  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
  D       Collared flycatcher  ======================================================================
          Southern platyfish  ======================================================================
B D                Budgerigar  ======================================================================
  D             Scarlet macaw  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Chicken  ======================================================================
B D                    Medaka  ======================================================================
B D               Zebra finch  ======================================================================
          Tibetan ground jay  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================

                        Human  taa
                        Chimp  taa
                      Gorilla  taa
                    Orangutan  taa
                       Gibbon  taa
                       Rhesus  taa
          Crab-eating macaque  taa
                       Baboon  taa
                 Green monkey  taa
                     Marmoset  taa
              Squirrel monkey  taa
                     Bushbaby  taa
           Chinese tree shrew  taa
                     Squirrel  taa
       Lesser Egyptian jerboa  taa
                 Prairie vole  taa
              Chinese hamster  taa
               Golden hamster  taa
                        Mouse  taa
                          Rat  taa
               Naked mole-rat  taa
                   Guinea pig  taa
                   Chinchilla  taa
             Brush-tailed rat  taa
                       Rabbit  taa
                         Pika  taa
                          Pig  taa
                       Alpaca  taa
               Bactrian camel  taa
                      Dolphin  taa
                 Killer whale  taa
             Tibetan antelope  taa
                          Cow  tac
                        Sheep  taa
                Domestic goat  taa
                        Horse  taa
             White rhinoceros  taa
                          Cat  taa
                          Dog  taa
                      Ferret   taa
                        Panda  taa
               Pacific walrus  taa
                 Weddell seal  taa
             Black flying-fox  taa
                      Megabat  taa
                Big brown bat  taa
         David's myotis (bat)  taa
                     Microbat  taa
                     Hedgehog  taa
                        Shrew  taa
              Star-nosed mole  taa
                     Elephant  taa
          Cape elephant shrew  taa
                      Manatee  taa
             Cape golden mole  taa
                       Tenrec  taa
                     Aardvark  taa
                    Armadillo  taa
                      Opossum  ---
              Tasmanian devil  taa
                     Platypus  tct
              Green seaturtle  cat
               Painted turtle  cat
     Chinese softshell turtle  cag
       Spiny softshell turtle  cag
                       Lizard  ca-
                X. tropicalis  tac
                   Coelacanth  taa
          Princess of Burundi  ===
                 Nile tilapia  ===
                         Fugu  ===
       Yellowbelly pufferfish  ===
                    Tetraodon  ===
                  Zebra mbuna  ===
                    Zebrafish  ===
                 Atlantic cod  ===
                  Spotted gar  ===
                  Stickleback  ===
     Mexican tetra (cavefish)  ===
          Pundamilia nyererei  ===
        Burton's mouthbreeder  ===
          Collared flycatcher  ===
           Southern platyfish  ===
                   Budgerigar  ===
                Scarlet macaw  ===
          Medium ground finch  ===
       White-throated sparrow  ===
             Peregrine falcon  NNN
                 Saker falcon  NNN
                      Chicken  ===
                       Medaka  ===
                  Zebra finch  ===
           Tibetan ground jay  ===
                       Parrot  ===
                      Wallaby  NNN
                  Rock pigeon  ===
                 Mallard duck  ===
           American alligator  ===

Alignment block 18 of 473 in window, 62812439 - 62812522, 84 bps 
B D                     Human  a------tgc--ttta--c---------------a--t-t---t--ttt-ccc------aaagattcaga
B D                     Chimp  a------cgc--ttta--c---------------a--t-t---t--ttt-ccc------aaagattcaga
B D                   Gorilla  a------tgc--ttta--c---------------a--t-t---t--ttt-ccc------aaagattcaga
B D                 Orangutan  a------tgc--ttta--c---------------a--t-t---t--ttt-ccc------aaagattcaga
B D                    Gibbon  a------tgc--ttta--c---------------a--t-t---t--ttt-ccc------aaagattcaga
B D                    Rhesus  a------tgc--ttta--c---------------a--t-t---t--ttt-ccc------aaagattcaga
B D       Crab-eating macaque  a------tgc--ttta--c---------------a--t-t---t--ttt-ccc------aaagattcaga
B D                    Baboon  a------tgc--ttta--c---------------a--t-t---t--ttt-ccc------aaagattcaga
B D              Green monkey  a------tgc--ttta--c---------------a--t-t---t--ttt-ccc------aaagattcaga
B D                  Marmoset  a------tgc--ttta--c---------------a--t-t---t--tttcccc------aaagattcaga
B D           Squirrel monkey  a------tgc--ttta--c---------------a--t-t---t--tttcccc------aaagattcaga
B D                  Bushbaby  a------tgc--tcta--a---------------a--t-t---t--ttt-ccc------aaaggttctga
           Chinese tree shrew  a------tgc--ttta--c---------------a--t-t---t--ttttccc------aaaggttcaga
B D                  Squirrel  a------tgcttttta--c---------------a--t-t---t--ttt-ccc------gaaggttcaga
       Lesser Egyptian jerboa  a------tgc-tttta--c---------------attt-t---t--ttt-ccc------aaaggttcaga
                 Prairie vole  a------tgc--ttta--c---------------a-tt-t---t--ttt-ccc------gaaggttcaga
B D           Chinese hamster  a------tgc--ttta--c---------------a-tt-t---t--ttt-ccc------gaaggttcaga
               Golden hamster  a------tgc--ttta--c---------------a-tt-t---t--ttt-ccc------gaaggttcaga
B D                     Mouse  a------tgc--ttta--c---------------a-tt-t---t--ttt-ccc------gaaggttcaga
B D                       Rat  a------tgt--ttta--c---------------a-ct-t---t--ttt-ccc------aaaggttcaga
B D            Naked mole-rat  a------agc--ttta--c---------------g-tt-t---t--ttt-ccc------aaaggttcaga
B D                Guinea pig  a------tgc--ttta--c---------------aatt-t---t--ttt-ccc------aaaggttcaga
                   Chinchilla  a------tgc--ttta--c---------------a--t-t---t--ttt-ccc------aaaggttcaga
             Brush-tailed rat  a------tgc--ttta--c---------------g--t-t---t--ttt-ccc------aaaggttcaga
B D                    Rabbit  a------tgc--ttta--c---------------a-at-t---t--ttt-ccc------aaaggttcaga
B D                      Pika  a------tgc--ttta--c---------------a-tt-g---g--ttt-ccc------aaagggccaga
B D                       Pig  a------tgc--ttta--c---------------t--t-t---t--ttt-ccc------aaaggttcaga
B D                    Alpaca  a------tgc--ttta--c---------------t--t-tt--t--ttt-ccc------gaaggttcaga
               Bactrian camel  at-----tgc--ttta--c---------------t--t-tt--t--ttt-ccc------gaaggttcaga
B D                   Dolphin  a------tgc--ttta--c---------------t--t-t---t--ttt-ccc------aaaggttcaga
                 Killer whale  a------tgc--ttta--c---------------t--t-t---t--ttt-ccc------aaaggttcaga
             Tibetan antelope  a------tgt--ttta--c---------------t--t-tttct--ttt-ccc------aaaggttcaga
B D                       Cow  a------tgt--ttta--c---------------t--t-tttct--ttt-ccc------aaaggttcaga
B D                     Sheep  a------tgt--ttta--c---------------t--t-tttct--ttt-ccc------aaaggttcaga
                Domestic goat  a------tgt--ttta--c---------------t--t-tttct--ttt-ccc------aaaggttcaga
B D                     Horse  a------tgc------------------------t--t-t---t--ttt-ccc------aaaggttcaga
B D          White rhinoceros  a------tgc--ttta--ct--------------t--t-t---t--ttt-ccc------aaaggttcaga
B D                       Cat  a------tgc------------------------t--t-t---t--ttt-ccc------gaaggttcaga
B D                       Dog  a------tgc--ttta--ctt-----------ttt--t-t---t--ttt-ccc------aaaggttcaga
B D                   Ferret   a------tgc--ttta--c---------------t--t-t---t--ctt-ccc------aaaggttcaga
B D                     Panda  a------tgc--ttta--c---------------t--t-t---t--ttt-ccc------aaaggttcaga
               Pacific walrus  a------ttc--ttta--c---------------t--t-t---t--ttt-ccc------aaaggttcaga
                 Weddell seal  a------tgc--ttta--c---------------t--t-t---t--ttt-ccc------aaaggttcaga
             Black flying-fox  a------tgc--ttta--c--------------tt--t-t---t--ttt-ccc------aaaggtttaga
B D                   Megabat  a------tgc--ttta--c-------------ttt--t-t---t--ttt-ccc------aaaggtttaga
                Big brown bat  a------tgc--ttta--c-------------ttt--t-t---t--ctt-ccc------aaaggttcaga
         David's myotis (bat)  a------tgc--ttta--c-t-----------ttt--t-t---t--ttt-ccc------aaaggttcaga
B D                  Microbat  a------tgc--ttta--ctt-----------ttt--t-t---t--ttt-ccc------aaaggttcaga
B D                  Hedgehog  a------tgc--ttt-------------------t--t-t---t--ttt-ccc------aaaggttcaga
B D                     Shrew  a------tgc--t---------------------t--t-t---t--ttt-ccc------aaaggttcaaa
              Star-nosed mole  a------cgc--ttta--c---------------t--t-t---t--ttt-ccc------aaaggttcaga
B D                  Elephant  a------tgc--ttta--c---------------t--t-c---t--ttt-ccc------aaaggttcaga
          Cape elephant shrew  a------tgc--tt----c---------------c--c-c---c--ata-cac------aaaagttcaga
B D                   Manatee  a------tgc--tt-------------------------t---t--ttt-ccc------aaaggttcaga
             Cape golden mole  a------tgt--ttta--c---------------t--t-c---t--ttt-ccc------aaaggttcaga
B D                    Tenrec  a------tgc--ttta--ctt-----------ttt--t-t---t--ttt-ccc------aaaggttcaga
                     Aardvark  a------tgc--ttaa--c------------------t-t---t--ttt-ccc------aaaggtttaga
B D                 Armadillo  a------tgc--ttta--c--------------tt--t-t---t--ttt-ccc------aaaggttcaga
B D                   Opossum  --------gc--cgtc--c---------------t--c-t---cggctt-ccc---------------ta
B D           Tasmanian devil  a------cgt--tttc--c---------------t--t-t---ttcttt-ccc------aaaagttgaga
B D                  Platypus  a------ggc--ttgg--cttctttttctttcttt--t-t---t--ttg-tcc------aaagattgaga
  D           Green seaturtle  aaa----tgc--tttg--c---------------c--t-ccccc--ttc-ccc------aaaggctgaga
  D            Painted turtle  aaa----tgc--tttg--c---------------c--tcccccc--ttc-ccc------aaaggctgaga
  D  Chinese softshell turtle  att----tgc--tttg--c---------------c--t-tcccc--ctc-ccc------aaaggctgaga
  D    Spiny softshell turtle  att----tgc--tttg--c---------------c--t-tcccc--ctc-ccc------aaaggctgaga
B D                    Lizard  -------tga--tgtgaac---------------c--t-tcctc--ctc-attctgagagaaggctgag-
B D             X. tropicalis  agagtcctgt--ttca--c------------------t-c---c--aac-caa------aaaggtctgga
B D                Coelacanth  t------cat--ttga--c---------------tgcc-a---t--att-tga------aaaagtcta--
B D                 Zebrafish  a------tgc--tcta--t---------------g--g-t---c--ttg-tgc------aatgattcagg
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                      Fugu  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
                 Zebra mbuna  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
  D       Collared flycatcher  ======================================================================
          Southern platyfish  ======================================================================
B D                Budgerigar  ======================================================================
  D             Scarlet macaw  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Chicken  ======================================================================
B D                    Medaka  ======================================================================
B D               Zebra finch  ======================================================================
          Tibetan ground jay  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================

                        Human  att-taga--gaacagtgtacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                        Chimp  att-taga--gaacagtgtacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                      Gorilla  att-taga--gaacagtgtacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                    Orangutan  att-taga--gaacagtgtacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                       Gibbon  att-taga--gaacagtgtacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                       Rhesus  attgtaga--gaacagtgtacatc--------aaaaata--cac----gaaatc-tgagtggatat--ac
          Crab-eating macaque  attgtaga--gaacagtgtacatc--------aaaaata--cac----gaaatc-tgagtggatat--ac
                       Baboon  attgtaga--gaacagtgtacatc--------aaaaata--cac----gaaatc-tgagtggatat--ac
                 Green monkey  attgtaga--gaacagtgtacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                     Marmoset  att-taga--gaacagtgtacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
              Squirrel monkey  att-taga--gaacagtgtacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                     Bushbaby  act-tgga--gaacagtgtacatc--------aaaaata--cac----aaaata-tgagtggatat--ac
           Chinese tree shrew  act-tgga--gcacagtgcacatc--------aaaaata--cgc----aaaatc-tgagccaatat--aa
                     Squirrel  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
       Lesser Egyptian jerboa  act-tgga--gaacagtgcacatc--------agaaata--agc---aaaaatcttgagtggatat--ac
                 Prairie vole  act-cggagtgaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
              Chinese hamster  act-cgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
               Golden hamster  act-cgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
                        Mouse  act-cgga--gagcagtgcacatc--------aaaaata--cac----aaaatc-taaatggatat--ac
                          Rat  act-cgga--gaacagtgcacatcaaaaaaaaaaaaata--cac---aaaaatc-taaatggatat--ac
               Naked mole-rat  act-tgga--gaacagtgtacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                   Guinea pig  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                   Chinchilla  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
             Brush-tailed rat  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaactc-tgagtggatat--ac
                       Rabbit  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-t-agtggatat--ac
                         Pika  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-t-agtggatag--ac
                          Pig  act-tgga--gaacagtgcacatc--------aaaaata--cac----gaaatc-taaatggatat--ac
                       Alpaca  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
               Bactrian camel  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
                      Dolphin  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
                 Killer whale  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
             Tibetan antelope  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
                          Cow  aat-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
                        Sheep  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
                Domestic goat  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
                        Horse  act-tgct--taacagtgcacatc--------aaaaata--cac----aatatc-tgagtagatat--ac
             White rhinoceros  act-tggt--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                          Cat  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                          Dog  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                      Ferret   act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                        Panda  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
               Pacific walrus  act-tgga--gaacagtgcacatc-------aaaaaata--cac----aaaatc-tgagtggatat--ac
                 Weddell seal  act-tgga--gaacagtgcacatc-------aaaaaata--cac----aaaatc-tgagtggatat--ac
             Black flying-fox  act-tgga--gaacagtgcacata--------aaaaata--cac----aaaatc-tgagtggatat--ac
                      Megabat  act-tgga--gaacagtgcacata--------aaaaata--cac----aaaatc-tgagtggatat--ac
                Big brown bat  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
         David's myotis (bat)  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                     Microbat  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
                     Hedgehog  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
                        Shrew  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgaatggatat--ac
              Star-nosed mole  act-tgga--gaacagtgcacatc--------aaaaata--cac----aatatc-tgagttgatat--ac
                     Elephant  act-tgga--gaacagtgcacatc--------aaaaata--cac----caactc-tgagtggacct--ac
          Cape elephant shrew  act-tgca--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgagtagatct--ac
                      Manatee  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-tgagtggatat--ac
             Cape golden mole  act-tgaa--gaacagtgcacttc--------aaaaata--cac----aaaatc-tgagtggctat--ac
                       Tenrec  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaactc-tgagtggatat--ac
                     Aardvark  act-tgga--gaacagtgcacatc--------aaaaata--cac----aaaatc-t-agtggatat--ac
                    Armadillo  act-tgga--gaacagtgcacatc--------aaaaata--cac----caaatc-tgagtgaatatacac
                      Opossum  tcc-ggga--gaacagtgcacata-----cgaagaaata--ctcagtgagtatc-ggagggaaaag--ac
              Tasmanian devil  tct-tgga--gaacagtgcacata------aaaaaaata--cac---taatatc-tgagtgaatat--ac
                     Platypus  act-ctga--gaacagtgcacatc------aaaaaaata--cac----aaaatc-tgaatgaatat--ac
              Green seaturtle  act-------caacagtgcacat-------caaaaaata--cac----aaaatc-ggagtgaatat--ac
               Painted turtle  act-------caacagtgcacat-------caaaaaata--cac----aaaatc-ggagtgaatat--ac
     Chinese softshell turtle  act-------caacagtgcacatc------caaagaata--cac----aaaagc-cgagtgactat--ac
       Spiny softshell turtle  act-------caacagtgcacatc------caaagaata--cac----aaaagc-cgagtgactat--ag
                       Lizard  -----------aacagtgcacatcggtttttaaagaataatcac----aaaaag-agaggggaagt--gg
                X. tropicalis  actctgta--aaacagtgcagatc--------aacatta--ttg----acagtc---ggtggatgt--ct
                   Coelacanth  ----caaa--aaccactgtagata--------aaac-----tgc----aatccc-tg-----------gc
                    Zebrafish  att-tctg--gaaaagagttcata--------aa-------cac-------att-tgctcagtttt--ag
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                         Fugu  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                    Tetraodon  ======================================================================
                  Zebra mbuna  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Collared flycatcher  ======================================================================
           Southern platyfish  ======================================================================
                   Budgerigar  ======================================================================
                Scarlet macaw  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Saker falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                      Chicken  ======================================================================
                       Medaka  ======================================================================
                  Zebra finch  ======================================================================
           Tibetan ground jay  ======================================================================
                       Parrot  ======================================================================
                      Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================

                        Human  actg
                        Chimp  actg
                      Gorilla  actg
                    Orangutan  actg
                       Gibbon  actg
                       Rhesus  actg
          Crab-eating macaque  actg
                       Baboon  actg
                 Green monkey  actg
                     Marmoset  actg
              Squirrel monkey  actg
                     Bushbaby  actg
           Chinese tree shrew  actg
                     Squirrel  actg
       Lesser Egyptian jerboa  actg
                 Prairie vole  actg
              Chinese hamster  actg
               Golden hamster  actg
                        Mouse  actg
                          Rat  actg
               Naked mole-rat  actg
                   Guinea pig  actg
                   Chinchilla  actg
             Brush-tailed rat  actg
                       Rabbit  actg
                         Pika  actg
                          Pig  actg
                       Alpaca  actg
               Bactrian camel  actg
                      Dolphin  actg
                 Killer whale  actg
             Tibetan antelope  actg
                          Cow  actg
                        Sheep  actg
                Domestic goat  actg
                        Horse  actg
             White rhinoceros  actg
                          Cat  actg
                          Dog  actg
                      Ferret   actg
                        Panda  actg
               Pacific walrus  actg
                 Weddell seal  actg
             Black flying-fox  actg
                      Megabat  actg
                Big brown bat  actg
         David's myotis (bat)  actg
                     Microbat  actg
                     Hedgehog  actg
                        Shrew  actg
              Star-nosed mole  actg
                     Elephant  actg
          Cape elephant shrew  actg
                      Manatee  actg
             Cape golden mole  actg
                       Tenrec  actg
                     Aardvark  actg
                    Armadillo  actg
                      Opossum  gctg
              Tasmanian devil  actg
                     Platypus  actg
              Green seaturtle  gctg
               Painted turtle  gctg
     Chinese softshell turtle  gcgg
       Spiny softshell turtle  gctg
                       Lizard  ggag
                X. tropicalis  gctg
                   Coelacanth  aatg
                    Zebrafish  actt
          Princess of Burundi  ====
                 Nile tilapia  ====
                         Fugu  ====
       Yellowbelly pufferfish  ====
                    Tetraodon  ====
                  Zebra mbuna  ====
                 Atlantic cod  ====
                  Spotted gar  ====
                  Stickleback  ====
     Mexican tetra (cavefish)  ====
          Pundamilia nyererei  ====
        Burton's mouthbreeder  ====
          Collared flycatcher  ====
           Southern platyfish  ====
                   Budgerigar  ====
                Scarlet macaw  ====
          Medium ground finch  ====
       White-throated sparrow  ====
             Peregrine falcon  NNNN
                 Saker falcon  NNNN
                      Chicken  ====
                       Medaka  ====
                  Zebra finch  ====
           Tibetan ground jay  ====
                       Parrot  ====
                      Wallaby  NNNN
                  Rock pigeon  ====
                 Mallard duck  ====
           American alligator  ====

Inserts between block 18 and 19 in window
B D                   Baboon 1bp
      Lesser Egyptian jerboa 4bp
                Prairie vole 1bp
                    Aardvark 1bp
B D            X. tropicalis 1437bp

Alignment block 19 of 473 in window, 62812523 - 62812537, 15 bps 
B D                     Human  -----a-aaa-aat-ag-cc----ta--c--a
B D                     Chimp  -----a-aaa-aat-ag-cc----ta--c--a
B D                   Gorilla  -----a-aaa-aat-ag-cc----ta--c--a
B D                 Orangutan  -----a-aaa-aat-ag-cc----ta--c--a
B D                    Gibbon  -----a-aaa-aat-ag-cc----ta--c--a
B D                    Rhesus  -----a-aaa-aat-ag-tc----ta--c--a
B D       Crab-eating macaque  -----a-aaa-aat-ag-tc----ta--c--a
B D                    Baboon  -----a-aaa-aat-ag-tc----ta--c--a
B D              Green monkey  -----a-aaa-aat-ag-tc----ta--c--a
B D                  Marmoset  -----a-aaa-aat-ag-tt----ta--c--a
B D           Squirrel monkey  -----a-aaa-aat-ag-tc----ta--c--a
B D                  Bushbaby  -----a-aaa-aat-ag-tc----ta--c--a
           Chinese tree shrew  -----a-aaa-aat-ag-tc--ttta--c--g
B D                  Squirrel  -----a-aaa-tat-ag-tc----tt--ttca
       Lesser Egyptian jerboa  -----a-aaa-aat-ag-tc----ctaat--g
                 Prairie vole  -----a-aaa-aat-aa-cc----tt--t--g
B D           Chinese hamster  -----a-aaa-aat-aa-tc----tt--t--g
               Golden hamster  -----a-aaa-aat-aa-tc----tt--t--g
B D                     Mouse  -----a-aaa-aat-aa-tc----tt--t--g
B D                       Rat  -----g-aaa-aat-aa-tc----tt--t--g
B D            Naked mole-rat  -----a-aaa-aat-ag-tc----ta--c--a
B D                Guinea pig  -----a-aaa-aat-ag-tc----ta--c--a
                   Chinchilla  -----c-aaa-aat-ag-tc----ta--c--a
             Brush-tailed rat  -----a-aaa-aataag-tc----ta--c--a
B D                    Rabbit  -----a-aaa-aat-ag-tc----tg--tacg
B D                      Pika  -----a-aaa-aat-ag-tc----tt--tacg
B D                       Pig  -----a-aaa-aat-ag-tct-ttta--c--g
B D                    Alpaca  -----a-aaa-aat-ag-tc--ttta--t--g
               Bactrian camel  -----a-aaa-aat-ag-tc--ttta--t--g
B D                   Dolphin  -----a-aaa-aat-ag-tc--ttta--c--a
                 Killer whale  -----a-aaa-aat-ag-tc--ttta--c--a
             Tibetan antelope  -----a-aaa-aat-ag-tc--ttta--c--g
B D                       Cow  -----a-aaa-aat-ag-tc--ttta--c--g
B D                     Sheep  -----a-aaa-aat-ag-tc--ttta--c--g
                Domestic goat  -----a-aaa-aat-ag-tc--ttta--c--g
B D                     Horse  -----a-aaa-aat-ag-tc--ttta--c--g
B D          White rhinoceros  -----a-aaa-aat-ag-tc--ttta--c--a
B D                       Cat  -----a-aaa-aat-ag-tc--ttta--c--a
B D                       Dog  -----a-aaa-aat-ag-tc--ttta-----g
B D                   Ferret   -----a-aaa-aat-ag-cc--tctc--t--g
B D                     Panda  -----a-aaa-aat-ag-tc--ttta--c--g
               Pacific walrus  -----a-aaa-aat-ag-tc--ttta--c--a
                 Weddell seal  -----a-aaa-aat-ag-tc--ttta--c--g
             Black flying-fox  -----c-aaa-aat-ag-cc--ttta--c--a
B D                   Megabat  -----c-aaa-aat-ag-cc--ttta--c--a
                Big brown bat  -----c-aaa-aat-aa-tc--ttta--c--g
         David's myotis (bat)  -----c-aaa-aat-aa-tc--ttta--c--g
B D                  Microbat  -----c-aaa-aat-aa-tc--ttta--c--g
B D                  Hedgehog  -----a-aaa-aat-ag-tc--ttta--c--a
B D                     Shrew  -----g-aaa-aat-ag-tc--t--a--c--a
              Star-nosed mole  -----a-aaa-aat-ag-tc--ttaa--c--g
B D                  Elephant  -----a-aaa-aat-ag-----tctg--c--a
          Cape elephant shrew  -----g-aaa-aat-aagtc--tttg--t--a
B D                   Manatee  -----a-aaa-aat-ag-----tctg--c--g
             Cape golden mole  -----a-aaa-aat-ag-tc--tctg--c--a
B D                    Tenrec  -----a-aaa-aat-ag-----tctg--c--g
                     Aardvark  -----a-aaa-aat-ag-tt--tttg--c--g
B D                 Armadillo  -----a-aaa-aat-ag-tc--ttta--t--g
B D                   Opossum  -----a-aaa-aat-ag-cca-ttta--c--a
B D           Tasmanian devil  -----g-aaa-aat-ag-cca-ttta--c--a
B D                  Platypus  -----a-aaa-aat-ag-ccatttta--a--a
  D           Green seaturtle  -------aaa-aat-ag-cc-attta--a--a
  D            Painted turtle  -------aaa-aat-ag-cc-attta--a--a
  D  Chinese softshell turtle  -----acaaa-acc-ag-tc-attta--a--a
  D    Spiny softshell turtle  -----acaaa-acc-ag-tc-attta--a--a
B D                    Lizard  -----ggaagtaat-aa-tc-gtcta--a--a
B D                Coelacanth  ------caag-tat-aa-gt----ca--g--a
B D                 Zebrafish  gtccta-gac-cac-a----------------
         Princess of Burundi  ================================
B D              Nile tilapia  ================================
B D                      Fugu  ================================
      Yellowbelly pufferfish  ================================
B D                 Tetraodon  ================================
                 Zebra mbuna  ================================
B D              Atlantic cod  ================================
                 Spotted gar  ================================
B D               Stickleback  ================================
    Mexican tetra (cavefish)  ================================
         Pundamilia nyererei  ================================
       Burton's mouthbreeder  ================================
  D       Collared flycatcher  ================================
          Southern platyfish  ================================
B D             X. tropicalis  ================================
B D                Budgerigar  ================================
  D             Scarlet macaw  ================================
B D       Medium ground finch  ================================
  D    White-throated sparrow  ================================
  D          Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Chicken  ================================
B D                    Medaka  ================================
B D               Zebra finch  ================================
          Tibetan ground jay  ================================
  D                    Parrot  ================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ================================
  D              Mallard duck  ================================
B D        American alligator  ================================

Inserts between block 19 and 20 in window
B D               Guinea pig 1bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp

Alignment block 20 of 473 in window, 62812538 - 62812603, 66 bps 
B D                     Human  --tttc------tcaaacaactc------ga-------aaaggag--caga------t-attgc-tatg-
B D                     Chimp  --tttc------tcaaacaactc------ga-------aaaggag--caga------t-attgc-tatg-
B D                   Gorilla  --tttc------tcaaacaactc------ga-------aaaggag--caga------t-attgc-tatg-
B D                 Orangutan  --tttc------tcaaacaactc------ga-------aaaggag--caga------t-attgc-tatg-
B D                    Gibbon  --tttc------tcaaacaactc------ga-------aaaggag--caga------t-attgc-tatg-
B D                    Rhesus  --tttc------t----caactc------ga-------aaaggag--caga------t-attgc-tatg-
B D       Crab-eating macaque  --tttc------t----caactc------ga-------aaaggag--caga------t-attgc-tatg-
B D                    Baboon  --tttc------t----caactc------ga-------aaaggag--caga------t-attgc-tatg-
B D              Green monkey  --tttc------t----caactc------ga-------aaaggag--caga------t-attgc-tatg-
B D                  Marmoset  --tttc------tcaaacaactc------ga-------aaaggag--caga------t-attgc-tatg-
B D           Squirrel monkey  --tttc------tcaaacaactc------ga-------aaaggag--cgga------t-attgc-tatg-
B D                  Bushbaby  --tttc------t----caactc------at-------aaaggag--caga------t-attgc-tatg-
           Chinese tree shrew  --tttg------tcaaacaactc------aa-------aaaggat--cagc------t-attgc-tatg-
B D                  Squirrel  --tttc------t----caactc------aa-------aaaggag--caga------t-attgc-tatg-
       Lesser Egyptian jerboa  --ttta------a----caac--------ac-------gaaggagctctca------t-attgc-cgtg-
                 Prairie vole  --tttc------t----caac--------aa-------aaagaag--ccaa------t-attgc-tttg-
B D           Chinese hamster  --tttc------t----caac--------aa-------aaaggag--ccaa------t-attgc-tttgc
               Golden hamster  --tttc------t----caac--------aa-------aaaggag--ccaa------t-attgc-tttg-
B D                     Mouse  --ttcc------t----caactacaacaaaa-------aaaggag--ccaa------t-attgc-tttg-
B D                       Rat  --tttc------t----caac--------aa-------aaaggag--ccaa------t-attgc-tttg-
B D            Naked mole-rat  --tttt------t----caactc------aa-------aaaggag--caga------t-attgc-tatg-
B D                Guinea pig  --tttt------t----caactc------aa-------aaaggag--caga------t-attgc-tatg-
                   Chinchilla  --tttt------t----caactc------aa-------aaaggag--cagg------t-attgc-tatg-
             Brush-tailed rat  --tttt------t----caactc----------------aagaag--caga------t-attgc-tagg-
B D                    Rabbit  --tttc------t----caactc------aa-------aaaggag--caga------t-attgc-tatg-
B D                      Pika  --tttc------tccaacaactc------aa-------aaaggag--cagg------t-attgc-tatg-
B D                       Pig  --tttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-tatg-
B D                    Alpaca  --tttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-tatg-
               Bactrian camel  --tttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-tagg-
B D                   Dolphin  --tttc------tcaagccactc------aa-------aaaggag--caga------t-attgc-tatg-
                 Killer whale  --tttc------tcaagccactc------aa-------aaaggag--caga------t-attgc-tatg-
             Tibetan antelope  --tttc------tcaaaccactc------aa-------aaaggag--cagg------t-attgc-tata-
B D                       Cow  --tttc------tcaaaccactc------aa-------aaagaag--cagg------t-attgc-tatg-
B D                     Sheep  --tttc------tcaaaccactc------aa-------aaaggag--cagg------t-attgc-tata-
                Domestic goat  --tttc------tcaaaccactc------aa-------aaaggag--cagg------t-attgc-tata-
B D                     Horse  --tttc------tcagacaactc------aa-------aaaggag--caga------t-attgc-tatg-
B D          White rhinoceros  --tttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-tatg-
B D                       Cat  --cttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-tatg-
B D                       Dog  --tttc------tcaaacgactc------aa-------aaaggag--caga------t-attgc-tatg-
B D                   Ferret   --tttc------t----caactc------aa-------aaaggag--caga------t-actgc-tatg-
B D                     Panda  --tttc------tcaaacaactc------aa-------aa---ag--caga------t-attgc-tatg-
               Pacific walrus  --tttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-tatg-
                 Weddell seal  --tttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-taag-
             Black flying-fox  --tttt------tcaaacaactc------aa-------aaaggag--caga------t-attgc-tatg-
B D                   Megabat  --tttt------tcaaacaactc------aa-------aaaggag--caga------t-attgc-tatg-
                Big brown bat  --tttc------tcaaacaattc------aa-------aaaggag--cagg------t-attgc-tatg-
         David's myotis (bat)  --tttc------tcaaacaactc------aa-------aaaggag--cagg------t-attgc-tatg-
B D                  Microbat  --tttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-tatg-
B D                  Hedgehog  --tttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-tatg-
B D                     Shrew  --tttc------t----caactc------aa-------aaaggag--caga------t-attgc-taca-
              Star-nosed mole  --tttt------tcaaacaattc------aa-------aaaggag--caga------t-attgc-tatg-
B D                  Elephant  --tttc------tcaaacaactc------aa-------aaaggag--cagg------t-attgc-catg-
          Cape elephant shrew  --tttc------t----caactc------agt------aaaggag--taga------taattgc-catg-
B D                   Manatee  --tttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-catg-
             Cape golden mole  --ttgc------tccaacaaccc------aaa------aaaggag--caga------t-attgc-caag-
B D                    Tenrec  --attc------tcaaacaactca-----aaa------aaaggag--caga------t-attgc-cgtg-
                     Aardvark  --tttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-catg-
B D                 Armadillo  --tttc------tcaaacaactc------aa-------aaaggag--caga------t-attgc-catg-
B D                   Opossum  --ttt-----------cagactc------ct-------gaaaaag--gaga------g-atggc-cgag-
B D           Tasmanian devil  --attt------ccaactaacta------ct-------gaaaaag--catc------a-gttgc-caag-
B D                  Platypus  --tttc------tcgaactactt------aa-------aaaggag--caga------t-attgc-catg-
B D               Zebra finch  --ttccacaaatagcagctgccc------a--------gaaaaat--ctgt------a-attat-caag-
  D           Green seaturtle  --ctct------ggagaccacct---------------------------------------------g-
  D            Painted turtle  --ctct------ggaaaccacct---------------------------------------------g-
  D  Chinese softshell turtle  --ctcc------gggagcccctc------t--------agcggag--tcgc------t-ccggc-cagg-
  D    Spiny softshell turtle  --ctcc------aggagcccctc------t--------agcggag--tcgc------t-cccgc-cagg-
B D                    Lizard  ---tct------ggaatgtaccg------------------ggac--cagt------c-attgc-cggg-
B D                Coelacanth  -------------------------------ttagtttaacggag---aca------t-atcacagatt-
B D                 Zebrafish  ggtgtc------aaactcagttc------ca-------caagggc--cggagctctgc-acagt-ttag-
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                      Fugu  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
                 Zebra mbuna  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
  D       Collared flycatcher  ======================================================================
          Southern platyfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                Budgerigar  ======================================================================
  D             Scarlet macaw  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Chicken  ======================================================================
B D                    Medaka  ======================================================================
          Tibetan ground jay  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================

                        Human  -ttcc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                        Chimp  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                      Gorilla  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                    Orangutan  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                       Gibbon  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                       Rhesus  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
          Crab-eating macaque  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                       Baboon  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                 Green monkey  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                     Marmoset  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
              Squirrel monkey  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                     Bushbaby  -tctc----t--------cc-ca------acaca-----ttgcacttc----tg-ttc
           Chinese tree shrew  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                     Squirrel  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
       Lesser Egyptian jerboa  -tccc----t--------ccatc--------aca-----ttgcac-tc----tg-ttc
                 Prairie vole  -tccc----t--------cc-cg--------tca-----ttgcacttt----cg-ttc
              Chinese hamster  ccccc----c--------cc-ca--------cca-----ttgcacttc----tg-ttc
               Golden hamster  -tccc----t--------cc-ca--------tca-----ttgcacttc----cg-ttc
                        Mouse  -tcct----g--------cc-cg--------aca-----ttgcacttc----ca-ttc
                          Rat  -tcct----t--------cc-cg--------aca-----ttgcacttccgttcg-ttc
               Naked mole-rat  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                   Guinea pig  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                   Chinchilla  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttg
             Brush-tailed rat  -tccc-------------cc-ca------tcaca-----ttgcacttc----tg-ttc
                       Rabbit  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                         Pika  -tccc----t--------cc-tg------tcaca-----ttgcacttc----tg-ttc
                          Pig  -tccc----t--------cc-cc------tcaca-----ttgcacttc----tg-ttc
                       Alpaca  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
               Bactrian camel  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                      Dolphin  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                 Killer whale  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
             Tibetan antelope  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                          Cow  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                        Sheep  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                Domestic goat  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                        Horse  -gccc----t--------cc-ca------tcaca-----ttgcactta----ca-ttc
             White rhinoceros  -tccc----t--------cc-ca------tcaca-----ttgcactct----tg-ttc
                          Cat  -tccc----t--------cc-ca------tcaca-----ttgcacttc----cg-ttc
                          Dog  -tccc----t--------cc-ca------tcaca-----ttgcacttc----ca-ttc
                      Ferret   -tccc----t--------cc-ca------tcaca-----ttgcacttc----cg-ttc
                        Panda  -tccc----t--------cc-ca------tcaca-----ttgcacttc----cg-ttc
               Pacific walrus  -tccc----t--------cc-ca------tcaca-----ttgcacttc----ca-ttc
                 Weddell seal  -tccc----t--------cc-ca------tcaca-----ttgcacttc----cg-ttc
             Black flying-fox  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                      Megabat  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                Big brown bat  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
         David's myotis (bat)  -tccc----t--------cc-tg------tcaca-----ttgcacttc----tg-ttc
                     Microbat  -tccc----t--------cc-tg------tcaca-----ttgcacttc----tg-ttc
                     Hedgehog  -tccc----t--------ct-ca------tcgca-----ttgcacttc----tg-ttc
                        Shrew  -tccc----t--------cc-cg------tcaca-----ttgcacgtc----tg-ttc
              Star-nosed mole  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                     Elephant  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tc-ttc
          Cape elephant shrew  -tccc----t--------cc-ca------tcaca-----ttgcacgtc----tg-ttc
                      Manatee  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
             Cape golden mole  -tccc----t--------gc-ca------t--ca-----ttgcacttc----tc-tg-
                       Tenrec  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-tac
                     Aardvark  -tccc----t--------cc-ct------tcaca-----ttgcacttc----tg-t-c
                    Armadillo  -tccc----t--------cc-ca------tcaca-----ttgcacttc----tg-ttc
                      Opossum  -tccg----t--------ct-cg------tcgga-----ttgcacgtc----tg-ttc
              Tasmanian devil  -tcagtctat--------ct-ca------tcaga-----ttgcacttc----tg-ttc
                     Platypus  -tcca----t--------cc-ca------gcaga-----ttgcacttc----tg-ttc
                  Zebra finch  -tccc----t---cctatat-tt------tcagagcttttcccaaaac----tg-tgt
              Green seaturtle  -tcca----ttggcccgtcc-ca------tcaga-----ttgcacttc----tg-tgc
               Painted turtle  -tccc----ttgtcccgtcc-ca------tcaga-----ttgcacttc----tg-tgc
     Chinese softshell turtle  -ccca----ttgtcccggcc-ca------gcaga-----ttgcacgtc----tg-ggc
       Spiny softshell turtle  -cccg----ttgtcccggcc-ca------gcaga-----gtgcacgtc----tg-ggc
                       Lizard  -caca----t---ctcttct-cacttcatcccca-----ttgaacctc----tgttat
                   Coelacanth  -ttgg----c--------aa-ca------tgaca-----gtatatctt----ag-aat
                    Zebrafish  -ttcc----a--------ac-cc------taatt-----aaacacacc----tg-atc
          Princess of Burundi  ==========================================================
                 Nile tilapia  ==========================================================
                         Fugu  ==========================================================
       Yellowbelly pufferfish  ==========================================================
                    Tetraodon  ==========================================================
                  Zebra mbuna  ==========================================================
                 Atlantic cod  ==========================================================
                  Spotted gar  ==========================================================
                  Stickleback  ==========================================================
     Mexican tetra (cavefish)  ==========================================================
          Pundamilia nyererei  ==========================================================
        Burton's mouthbreeder  ==========================================================
          Collared flycatcher  ==========================================================
           Southern platyfish  ==========================================================
                X. tropicalis  ==========================================================
                   Budgerigar  ==========================================================
                Scarlet macaw  ==========================================================
          Medium ground finch  ==========================================================
       White-throated sparrow  ==========================================================
             Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Saker falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                      Chicken  ==========================================================
                       Medaka  ==========================================================
           Tibetan ground jay  ==========================================================
                       Parrot  ==========================================================
                      Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rock pigeon  ==========================================================
                 Mallard duck  ==========================================================
           American alligator  ==========================================================

Alignment block 21 of 473 in window, 62812604 - 62812639, 36 bps 
B D                     Human  t------c-tg--agttt----ataatac--atattgcttcaagggttgag
B D                     Chimp  t------c-tg--agttt----ataatac--atattgcttcaagggttgag
B D                   Gorilla  t------c-tg--agttt----ataatac--atattgcttcaagggttgag
B D                 Orangutan  t------c-tg--agttt----ataatac--atattgcttcaagggttgag
B D                    Gibbon  t------c-tg--agttt----ataatac--atattgcttcaagggttgag
B D                    Rhesus  t------c-tg--agttt----ataatac--atattgcttcaagggttgag
B D       Crab-eating macaque  t------c-tg--agttt----ataatac--atattgcttcaagggttgag
B D                    Baboon  t------c-tg--agttt----ataatac--atattgcttcaagggttgag
B D              Green monkey  t------c-tg--agttt----ataatac--atattgcttcaagggttgag
B D                  Marmoset  t------c-tg--agttt----ataatac--atattgcttcaagggttgag
B D           Squirrel monkey  t------c-tg--agttt----ataatac--atattgcttcaagggttgag
B D                  Bushbaby  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
           Chinese tree shrew  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
B D                  Squirrel  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
       Lesser Egyptian jerboa  t------c-cg--agttt----ctaagac----cttgcttccagggccggg
                 Prairie vole  t------c-tg--agttt----ttagtac--atattgctc-aagggttgag
B D           Chinese hamster  t------c-tg--agttt----ttagtac--atattgctt-aagggttgag
               Golden hamster  t------c-tg--agttt----ttagtac--atattgctt-aagggttgag
B D                     Mouse  t------cttg--agttt----ctaggac--atattgctt-aagggttgag
B D                       Rat  t------cttg--agttt----ataggac--atattgctt-aagggctgag
B D            Naked mole-rat  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
B D                Guinea pig  t------c-tg--acttt----ataatac--atattgcttaaagggttgag
                   Chinchilla  t------c-tg--agttt----ataatac--atattgctcaaagggttgag
             Brush-tailed rat  t------c-tg--agttt----ataatac--atattgctcaaagggtcgag
B D                    Rabbit  t------c-tg--agttt----ataatac--atattgctt-cagggttgag
B D                      Pika  t------c-tg--agttt----ataatac--atattgctt-cagggctgag
B D                       Pig  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
B D                    Alpaca  t------c-tg--agttt----ataataa--at-ttgcttaaagggtcgag
               Bactrian camel  t------c-tg--agttt----ataatac--at-ttgcttaaagggtcgag
B D                   Dolphin  t------c-gg--agttt----ataatac--atattgcttaaagggttgag
                 Killer whale  t------c-gg--agttt----ataatac--atattgcttaaagggttgag
             Tibetan antelope  t------c-ta--agttt----ataatac--atattgcttaaagggttgag
B D                       Cow  t------c-ta--agttt----ataatac--atattgcttaaagggttgag
B D                     Sheep  t------c-ta--agttt----ataatac--atattgcttaaagggttgag
                Domestic goat  t------c-ta--agttt----ataatac--atattgcttaaagggttgag
B D                     Horse  t------c-tg--agatt----ataatac--atattgcttaaagggttgag
B D          White rhinoceros  t------c-tg--agttt----ataatac--atattgcttaaagggttgcg
B D                       Cat  t------c-tg--agttt----ataatac--atattgcttaaagggttgga
B D                       Dog  t------c-tg--agttt----ataatac--atattgcttagagggttgga
B D                   Ferret   t------c-tg--agttt----ataatac--atactgcttaaaggggtgga
B D                     Panda  t------c-tg--agttt----ataatac--atattgcttaaagggttgga
               Pacific walrus  t------t-tg--agttt----ataatac--atattgcttaaagggttaga
                 Weddell seal  t------t-tg--agttt----ataatac--atattgcttaaagggttaga
             Black flying-fox  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
B D                   Megabat  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
                Big brown bat  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
         David's myotis (bat)  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
B D                  Microbat  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
B D                  Hedgehog  t------c-ta--ggttt----ataatac--atattgctcaaagggttaag
B D                     Shrew  t------c-tg--ag--t----ataatac--atattgcttaaagggttgag
              Star-nosed mole  t------c-tg--agttt----ataatac--atattgctgaaagggctgag
B D                  Elephant  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
          Cape elephant shrew  t------c-tg--agttg----agaatac--atattgcttaaagggttgag
B D                   Manatee  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
             Cape golden mole  -------c-tg--agttg----ataacac--atattgcttaaagggttgag
B D                    Tenrec  t------c-tg--agttg----ataacac--atattgcttaaagggttgag
                     Aardvark  t------c-tg--agttg----aca------atattgcttaaagggttgag
B D                 Armadillo  t------c-tg--agttt----ataatac--atattgcttaaagggttgag
B D                   Opossum  t------c-tgttcgttc-------tgac--atattgctcaaagggctgag
B D           Tasmanian devil  t------c-tgttagttt----atactac--atattgctcaaagggctgaa
B D                  Platypus  t------c-ta--cattttaggctactcc--atattgcttcaagggcggag
B D               Zebra finch  ttatagcc-ca--tgtta----actcatggagtattagt------------
  D           Green seaturtle  t------c-ca--cgtta----gttgcactgatattgctgaaaggatttag
  D            Painted turtle  t------c-ca--agtta----gttgcactgatattgctgaaaggatttac
  D  Chinese softshell turtle  t------c-ct--agtcc----gctgctgtagcattgctg-----------
  D    Spiny softshell turtle  t------c-ct--agtcc----gctgctgtcgcattgctg-----------
B D                    Lizard  t------t-ct--tgtgt----ccaaatacaggttgag-------------
B D                Coelacanth  t------t-ac--acctg----cttttgc--tttttgttcaaa--------
         Princess of Burundi  ===================================================
B D              Nile tilapia  ===================================================
B D                      Fugu  ===================================================
      Yellowbelly pufferfish  ===================================================
B D                 Tetraodon  ===================================================
                 Zebra mbuna  ===================================================
B D                 Zebrafish  ===================================================
B D              Atlantic cod  ===================================================
                 Spotted gar  ===================================================
B D               Stickleback  ===================================================
    Mexican tetra (cavefish)  ===================================================
         Pundamilia nyererei  ===================================================
       Burton's mouthbreeder  ===================================================
  D       Collared flycatcher  ===================================================
          Southern platyfish  ===================================================
B D             X. tropicalis  ===================================================
B D                Budgerigar  ===================================================
  D             Scarlet macaw  ===================================================
B D       Medium ground finch  ===================================================
  D    White-throated sparrow  ===================================================
  D          Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Chicken  ===================================================
B D                    Medaka  ===================================================
          Tibetan ground jay  ===================================================
  D                    Parrot  ===================================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ===================================================
  D              Mallard duck  ===================================================
B D        American alligator  ===================================================

Inserts between block 21 and 22 in window
      Lesser Egyptian jerboa 2bp
B D                   Lizard 6324bp

Alignment block 22 of 473 in window, 62812640 - 62812740, 101 bps 
B D                     Human  a-caactagatatg----ctctga-t-tcaccatttt-----agggc--cacagag-tgtggc---a-ta
B D                     Chimp  a-caactagatatg----ctctga-t-tcaccatttt-----agggc--cacagag-tgtggc---a-ta
B D                   Gorilla  a-caactagatatg----ctctga-t-tcaccattct-----agggc--cacagag-tgtggc---a-ta
B D                 Orangutan  a-caactagatatg----ctctga-t-tcgccattct-----agggc--cacaaag-tgtggc---a-ta
B D                    Gibbon  a-caactagatagg----ctctga-t-tcgccattct-----agggc--cacagag-tgcggc---a-ta
B D                    Rhesus  a-caactagatatg----ctctga-t-tcgccattct-----agggc--cacagag-tgcggc---a-ta
B D       Crab-eating macaque  a-caactagatatg----ctctga-t-tcgccattct-----agggc--cacagag-tgcggc---a-ta
B D                    Baboon  a-caactagatatg----ctctga-t-tcgccattct-----agggc--cacagag-tgcggc---a-ta
B D              Green monkey  a-caactagatatg----ctctga-t-tcgccattct-----agggc--cacagag-tgcggc---a-ta
B D                  Marmoset  a-caactagatatg----ctctga-t-ttgccattca-----agggc--cacagag-tgtggc---a-tt
B D           Squirrel monkey  a-caactagatatg----ctctga-t-tcgccattca-----agggc--cacagag-tgcggc---a-tt
B D                  Bushbaby  a-cgactagataag----ctttga-t-tcattgttct-----agggc--catggaa-tgcagc---a-ta
           Chinese tree shrew  a-cgactagataag----ctttga-t-tcactgttct-----agggc--cacagag--gcagc---a-ta
B D                  Squirrel  a-caactaaataag----ctttga-t-tcactgttct-----agggc--cacagaa-cgtggc---a-tg
       Lesser Egyptian jerboa  a-catccacgtaag----ctttgc-t-ttgctgttgg-----agggc--cacacag-tg--gc---agga
                 Prairie vole  a-cggctagatacc----cttcag-t-tcactgttct-----agtgc-------------tgc---agcc
B D           Chinese hamster  a-cggctagataca----catcaa-t-tcactgttct-----ggggctacacagaa-taccgc---agcc
               Golden hamster  a-cggctagataca----catcaatt-tcactgttct-----ggggc--cacagaa-tgtggc---agcc
B D                     Mouse  a-tggccagagaaa----cctcca-t-tcactgctct-----agggc----cagag-tgcagc---agcc
B D                       Rat  a-tggctcgagaaa----cttcca-t-tcactgttct-----agggc--cacagag-tgctgc---ggcc
B D            Naked mole-rat  a-tgactagataag----ctttga-t-tggctgttct-----agggc--cactaaa-tgtggg---t-ta
B D                Guinea pig  a-tgactagataag----ctttga-t-tcgctgttct-----agggc--catcagt-cgcaga---a-ca
                   Chinchilla  a-tgactagataag----ctttga-t-tcgctgttct-----agggc--caccagc-tgc-aa---a-ca
             Brush-tailed rat  a-tgactagatacg----ctccga-t-ttgctgttct-----agggc--caccaga-tgctaa---a-cg
B D                    Rabbit  a-cgactaggtaag----ctttga-c-tcactgttct-----tggac--cacagaaatgtggc---a-ta
B D                      Pika  c-caaccagataca----ctgtga-c-tcactgttctgcttctagga--cacagaa--------------
B D                       Pig  a-tgactagataag----ctttaa-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
B D                    Alpaca  a-tgactagataag----ctttga-t-ttactgttct-----agcgc--cacagaa-tgcagc---a-ta
               Bactrian camel  a-tgactagataag----ctttga-t-tcactgttct-----agcgc--cacagaa-tgcagc---a-ta
B D                   Dolphin  a-tgactagataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagcttta-ta
                 Killer whale  a-tgactagataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagcttta-ta
             Tibetan antelope  a-tgactagataag----ctttga-t-tcac--ttct-----agggc--aacagaa-tgcagc---g-ta
B D                       Cow  a-tgactagataag----ctttga-t-tcac--tgct-----agggc--aacagaa-tgcagc---g-ta
B D                     Sheep  a-tgactagataag----ctttga-t-tcac--ttct-----agggc--aacagaa-tgcagc---g-ta
                Domestic goat  a-tgactagataag----ctttga-t-tcac--ttct-----agggc--aacagaa-tgcagc---g-ta
B D                     Horse  a-cgactagataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
B D          White rhinoceros  a-cgactagataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
B D                       Cat  a-cgactagataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
B D                       Dog  a-cgactagacaag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
B D                   Ferret   a-caactagataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
B D                     Panda  a-cgactagataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
               Pacific walrus  a-cgactagataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
                 Weddell seal  a-cgactagatgag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
             Black flying-fox  a-cgactagataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
B D                   Megabat  a-cgactagataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
                Big brown bat  a-ggactagacaca----ctttga-t-tcactgttct-----agggc--cacacaa-tgcagc---a-ta
         David's myotis (bat)  a-ggactagataca----cttgga-t-taactgttcc-----agggc--cacacaa-tgcagc---a-ta
B D                  Microbat  a-ggactaggtaca----cttgga-t-tcactgttcc-----agggc--cacacaa-tgcagc---a-ta
B D                  Hedgehog  a-cgactagatgag----cttcga-t-tcactgttct-----agg----------------gc---a-ta
B D                     Shrew  a-cgactagataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
              Star-nosed mole  a-cgactagataag----ctttga-c-tcactgttct-----agggc--cacagaa-tgcagc---a-ta
B D                  Elephant  a-cgactacataag----ctttga-t-tcgctgttct-----acggc--cacagaa-cgcagc---a-ca
          Cape elephant shrew  a-ggactagattag----gtctgc-t-tcactgttct-----agggt--cacagaa-tgtgcc---a-ca
B D                   Manatee  a-cgactacataag----ctttga-t-tcactgttct-----agggc--cacagaa-tgtggc---a-ca
             Cape golden mole  a-cgactagacaag----ctttca-t-tcactgctct-----acggc--cagagca-ttcagc---t-ca
B D                    Tenrec  a-cgactagagaag----ctttga-t-tcactgttct-----agggc--cagagaa-tgcgac---a-ca
                     Aardvark  a-cgactagataag----ctttga-t-tcactgctct-----agggt--cagagaa-cgtggc---a-ca
B D                 Armadillo  a-cgacaagata------ctttga-c-tcactgttct-----aggac--cactaaa-tgcggc---a-ta
B D                   Opossum  ----gccgg-------------------------tca-----agggt--ccccg----------------
B D           Tasmanian devil  ----accagatgag----ctctga---tcactgttca-----aggct--cccagaa-ctggat---t-tt
B D                  Platypus  atttcccaaaggcg----ctccgt-t-gcaccgttca-----cgggc--ctcggaa-gg--gc---a-gt
B D               Zebra finch  -----ttaaagatgagctgttta-----------------------------agag-gaaagg---c-tc
  D           Green seaturtle  ---gctgacacacg-accgcttgg-a-ctactagtca-----agggc--cccagag-cgtgtg---c-cc
  D            Painted turtle  ---atttacacgca-accacttgg-a-ttcctagtca-----agggc--cccagag-cgtgtg---c-cc
  D  Chinese softshell turtle  -----ctatacacacactgctcgg-c-tcactgggcc-----c-ggc--cccggag-c----g---c-cc
  D    Spiny softshell turtle  -----ctatacgcacagtgctcgg-c-tcactggtcc-----c-ggg--cccagag-c----g---c-cc
B D                Coelacanth  -gtccttaaatagg----aaacgg-cagtaacgttta-----aaaaa--aacaga--tttagg---a-tt
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                      Fugu  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
  D       Collared flycatcher  ======================================================================
          Southern platyfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                Budgerigar  ======================================================================
  D             Scarlet macaw  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Chicken  ======================================================================
B D                    Lizard  ======================================================================
B D                    Medaka  ======================================================================
          Tibetan ground jay  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================

                        Human  aaggc-----------------------------tatactt-----cactcact---gtacaatgt-cc-
                        Chimp  aaggc-----------------------------tatactt-----cactcact---gtacaatgt-cc-
                      Gorilla  aaggc-----------------------------cgtactt-----cactcact---gtacaatgt-cc-
                    Orangutan  aaggc-----------------------------catactt-----cactcact---gtacaatgt-cc-
                       Gibbon  aaggc-----------------------------catactt-----cactcact---gtacaatgt-cc-
                       Rhesus  aaggc-----------------------------catactt-----cactcact---gtacaacat-gc-
          Crab-eating macaque  aaggc-----------------------------catactt-----cactcact---gtacaacat-gc-
                       Baboon  aaggc-----------------------------catactt-----cactcact---gtacaacat-gc-
                 Green monkey  aaggc-----------------------------catactt-----cactcact---gtacagcat-gc-
                     Marmoset  caggc-----------------------------catgctt-----cactcact---gtacaatgt-cc-
              Squirrel monkey  caggc-----------------------------catgctt-----cgctcact---gtacaacgt-cc-
                     Bushbaby  aaggc-----------------------------catgctt-----cacttatt---gtacagcat-cc-
           Chinese tree shrew  aaggc-----------------------------catgctt-----cactcact---gtacagcgc-cc-
                     Squirrel  aaggc-----------------------------catgctt-----tactcact---gtacagtgt-cc-
       Lesser Egyptian jerboa  aaggc-----------------------------cagcctc-----tgctcacc---ggacgcctc-tc-
                 Prairie vole  gaaac-----------------------------caggctc-----ctctcact---ggacagctt-cc-
              Chinese hamster  cagac-----------------------------caggctc-----ctctaact---gtacaattt-tc-
               Golden hamster  cagcc-----------------------------caggctc-----ctctcact---gtacaactt-tc-
                        Mouse  aggat-----------------------------gaggctc-----tgctcact---gtacaactc-ccc
                          Rat  aggcc-----------------------------agggctaaactgtgctcact---gtacaaccc-ccc
               Naked mole-rat  taggcggcggcagcgactgctgcggaactgctgccatgctt-----tgctcact---gtacagcat-cc-
                   Guinea pig  aaggc-----------------------------catgttg-----tgctcact---gtacagcat-cc-
                   Chinchilla  aaggc-------------------------------tgttt-----gg-tcact---gtacagcgc-cc-
             Brush-tailed rat  aaggc-------------------------------tgttt-----tgctcact---gcacagca-----
                       Rabbit  aaggc-----------------------------catgctt-----cactcact---gtacagcgt-cc-
                         Pika  -------------------------------------------------------------ggcat-cc-
                          Pig  aaggc-----------------------------catgctt-----cacccact---gtacagcat-cc-
                       Alpaca  aaggc-----------------------------catgctt-----cactcact---gtacagcat-cc-
               Bactrian camel  aaggc-----------------------------catgctt-----cactcact---gtacagcat-cc-
                      Dolphin  aaggc-----------------------------catgctt-----cacccact---gtacagcat-cc-
                 Killer whale  aaggc-----------------------------catgctt-----cacccact---gtacagcat-cc-
             Tibetan antelope  aaggc-----------------------------catgctt-----cgcccact---gtacagcat-cc-
                          Cow  aaggc-----------------------------catgctt-----cgcccact---gtacagcat-cc-
                        Sheep  aaggc-----------------------------catgctt-----cgcccact---gtacagcat-cc-
                Domestic goat  aaggc-----------------------------catgctt-----cgcccact---gtacagcat-cc-
                        Horse  aaggc-----------------------------catgctt-----cactcact---gtacagcgt-cc-
             White rhinoceros  aaggc-----------------------------catgctt-----cactcact---gtacagcgt-cc-
                          Cat  aaggc-----------------------------catgctt-----cattcact---gtacagcat--c-
                          Dog  aaggc-----------------------------catgctt-----cattcact---gtacaccat--t-
                      Ferret   aaggc-----------------------------catgctt-----cattcact---gtacagaat--c-
                        Panda  aaggc-----------------------------catgctt-----cattcact---gtacagcac--c-
               Pacific walrus  aaggc-----------------------------catgctt-----cattcact---gtacagcat--c-
                 Weddell seal  aaggc-----------------------------catgctt-----cattcact---gtacaccat--c-
             Black flying-fox  aagat-----------------------------catgctt-----cactcact---gtacagcgt-cc-
                      Megabat  aagat-----------------------------catgctt-----cactcact---gtacagcgt-cc-
                Big brown bat  aagac-----------------------------catgctt-----tgctcgtt---gtacagcgt-cc-
         David's myotis (bat)  aagac-----------------------------catgctt-----tactcgtt---gtacagcgt-cc-
                     Microbat  aagac-----------------------------catgctt-----tactcgtt---gtacagcgt-cc-
                     Hedgehog  aaggt-----------------------------cctgctc-----cattcact---gtacagcat--c-
                        Shrew  caggc-----------------------------catgctt-----cactctct---gtacagcgc-cc-
              Star-nosed mole  aaggc-----------------------------catgctt-----cact---t---gtacagcat-cc-
                     Elephant  aaggc-----------------------------aatgctt-----cactcact---gtaca--gt--c-
          Cape elephant shrew  aaggc-----------------------------cacgctt-----cactcact---gtacagcgt--c-
                      Manatee  aaggc-----------------------------catgctt-----cactcact---gtacagtgt--c-
             Cape golden mole  aaggc-----------------------------cctgctt-----ccagtaag---gttcggcat--c-
                       Tenrec  aaggc-----------------------------catgctt-----cactcact---atacagcgt--c-
                     Aardvark  aagac-----------------------------catgctt-----cactcact---gtacagcgt--c-
                    Armadillo  aaggc-----------------------------catgctt-----cactca-t---gtactgtgt-cc-
                      Opossum  -----------------------------------------------------------acagccg-cc-
              Tasmanian devil  gagtc-----------------------------tgtgttt-----ggctcacc---atacagccc-cc-
                     Platypus  cagtt-----------------------------cacgctt-------ctcact---tcaccgggt-cc-
                  Zebra finch  --------------------------------------tct-----tcatctctgg-gaacagagg--t-
              Green seaturtle  gtccc-----------------------------cgcttcc-----tcctcact-----------g--c-
               Painted turtle  gtccc-----------------------------cgcttcc-----tcctcacg---gcacatcag--c-
     Chinese softshell turtle  atccc-----------------------------cgcgtcc-----tcctctcgct-gcgtagcgg--c-
       Spiny softshell turtle  atccc-----------------------------cgcgtcc-----tcctcgcgct-gcacggcgg--c-
                   Coelacanth  aaagt-----------------------------aaaactt-----gtttaactctggcataatctacc-
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                         Fugu  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                    Tetraodon  ======================================================================
                  Zebra mbuna  ======================================================================
                    Zebrafish  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Collared flycatcher  ======================================================================
           Southern platyfish  ======================================================================
                X. tropicalis  ======================================================================
                   Budgerigar  ======================================================================
                Scarlet macaw  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Saker falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                      Chicken  ======================================================================
                       Lizard  ======================================================================
                       Medaka  ======================================================================
           Tibetan ground jay  ======================================================================
                       Parrot  ======================================================================
                      Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================

                        Human  --------cc-c-aaatcagtccc--aagcc-----
                        Chimp  --------cc-c-aaatcagtccc--aagcc-----
                      Gorilla  --------cc-c-aaatcagtccc--aagcc-----
                    Orangutan  --------cc-c-aaatcagtccc--aagcc-----
                       Gibbon  --------cc-c-aaatcagtccc--aagcc-----
                       Rhesus  --------cc-t-aaatcagtccc--aagcc-----
          Crab-eating macaque  --------cc-t-aaatcagtccc--aagcc-----
                       Baboon  --------cc-t-aaatcagtccc--aagcc-----
                 Green monkey  --------cc-t-aaatcagtccc--aagcc-----
                     Marmoset  --------cc-c-aaatcagtcgc--aagcc-----
              Squirrel monkey  --------cc-c-aaatcagttgc--aagcc-----
                     Bushbaby  --------cc-c-aaatcagtccc--aagcc-----
           Chinese tree shrew  --------gc-c-aaattagtccc--aagcc-----
                     Squirrel  --------cc-c-aaatcagtccc--aagcc-----
       Lesser Egyptian jerboa  --------ccaccaaaccagtccc--ccgct-----
                 Prairie vole  --------cc-c-aaattagttcc--aagcc-----
              Chinese hamster  --------cc---acatcagtccc--aagcc-----
               Golden hamster  --------cc-ctacatcaatccc--aagcc-----
                        Mouse  acccccaccc-ccaagtcagtccc--aagcc-----
                          Rat  accccta-cc-ccaagtccgtccc--aagcc-----
               Naked mole-rat  --------cc-c-aaatcagtccc--aagcc-----
                   Guinea pig  --------ct-c-aaatcagtccc--aagcc-----
                   Chinchilla  --------cc-c-aaatcagtccc--aagcc-----
             Brush-tailed rat  --------cc-c-aaatcagtccc--aagca-----
                       Rabbit  --------cc-c-aaatcagtccc--gagcc-----
                         Pika  --------cc-c-aagtcaatccc--aagcc-----
                          Pig  --------ct-c-aaatcagtccc--aagcc-----
                       Alpaca  --------cc-c-aaatcagtccc--aagcc-----
               Bactrian camel  --------cc-c-aaatcagtccc--aagcc-----
                      Dolphin  --------cc-c-aaatcagtccc--aagcc-----
                 Killer whale  --------cc-c-aaatcagtccc--aagcc-----
             Tibetan antelope  --------cc-c-atatcagtccc--aggcc-----
                          Cow  --------cc-t-gaatcagtccc--aggcc-----
                        Sheep  --------cc-c-aaatcagtccc--aggcc-----
                Domestic goat  --------cc-c-acatcagtccc--aggcc-----
                        Horse  --------cc-c-aaatcaggccc--aagcc-----
             White rhinoceros  --------cc-c-aaatcaggccc--aagcc-----
                          Cat  --------cc-c-aaatcagtccc--aagcc-----
                          Dog  --------cc-c-cgatcagtccc--aagcc-----
                      Ferret   --------cc-c-aaatcagtccc--aagcc-----
                        Panda  --------cc-c-acatcagtccc--aagcc-----
               Pacific walrus  --------cc-c-aaatcagtccc--aagcc-----
                 Weddell seal  --------cc-c-aaatgagtccc--aagcc-----
             Black flying-fox  --------cc-c-aaatcggctcc--aagcc-----
                      Megabat  --------cc-c-aaattggctcc--aagcc-----
                Big brown bat  --------cc-c-aaatcaatccc--aagtc-----
         David's myotis (bat)  --------cc-c-aaatcaatccc--aagcc-----
                     Microbat  --------cc-c-aaatcaatccc--aagcc-----
                     Hedgehog  --------cc-c-aaatcagtccc--aagcc-----
                        Shrew  --------cc-c-acattagtccc--aagcc-----
              Star-nosed mole  --------cc-c-aaatcagtccc--aagac-----
                     Elephant  --------cc-c-caatcagtccc--aagcc-----
          Cape elephant shrew  --------cc-c-agaccagcctc--cagcc-----
                      Manatee  --------cc-c-caatcagtccc--aagcc-----
             Cape golden mole  --------cc-c-aaatccatccc--aagcc-----
                       Tenrec  --------cc-c-aaatcagtccc--aagcc-----
                     Aardvark  --------cc-c-aaatcagtccc--aagcc-----
                    Armadillo  --------cc-c-aaatcagtccc--aagcc-----
                      Opossum  --------cc-c------------------------
              Tasmanian devil  --------cc-c-aaagcagccac--catgc-----
                     Platypus  --------cc-c-cggtttccccc--cgggg-----
                  Zebra finch  --------ct-t-----ctctccctgagggc-----
              Green seaturtle  --------cc-c-agagcagccaacgaagct-----
               Painted turtle  --------cc-c-aaggcagtgaacgaagct-----
     Chinese softshell turtle  --------cc-c-ggagcagtccctgaagct-----
       Spiny softshell turtle  --------cc-c-ggagcagtccctggagct-----
                   Coelacanth  --------tc-c-aagtacagcag--aggtccagct
          Princess of Burundi  ====================================
                 Nile tilapia  ====================================
                         Fugu  ====================================
       Yellowbelly pufferfish  ====================================
                    Tetraodon  ====================================
                  Zebra mbuna  ====================================
                    Zebrafish  ====================================
                 Atlantic cod  ====================================
                  Spotted gar  ====================================
                  Stickleback  ====================================
     Mexican tetra (cavefish)  ====================================
          Pundamilia nyererei  ====================================
        Burton's mouthbreeder  ====================================
          Collared flycatcher  ====================================
           Southern platyfish  ====================================
                X. tropicalis  ====================================
                   Budgerigar  ====================================
                Scarlet macaw  ====================================
          Medium ground finch  ====================================
       White-throated sparrow  ====================================
             Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Saker falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                      Chicken  ====================================
                       Lizard  ====================================
                       Medaka  ====================================
           Tibetan ground jay  ====================================
                       Parrot  ====================================
                      Wallaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rock pigeon  ====================================
                 Mallard duck  ====================================
           American alligator  ====================================

Inserts between block 22 and 23 in window
B D          Tasmanian devil 3bp

Alignment block 23 of 473 in window, 62812741 - 62812743, 3 bps 
B D                     Human  a-ta
B D                     Chimp  a-ta
B D                   Gorilla  a-ta
B D                 Orangutan  a-ta
B D                    Gibbon  a-ta
B D                    Rhesus  a-ta
B D       Crab-eating macaque  a-ta
B D                    Baboon  a-ta
B D              Green monkey  a-ta
B D                  Marmoset  a-ta
B D           Squirrel monkey  a-ta
B D                  Bushbaby  g-ta
           Chinese tree shrew  a-ta
B D                  Squirrel  a-ta
       Lesser Egyptian jerboa  a-ta
                 Prairie vole  a-ta
B D           Chinese hamster  a-ta
               Golden hamster  a-ta
B D                     Mouse  atta
B D                       Rat  atta
B D            Naked mole-rat  a-ta
B D                Guinea pig  a-ta
                   Chinchilla  a-ta
             Brush-tailed rat  a-ta
B D                    Rabbit  a-ta
B D                      Pika  g-ta
B D                       Pig  a-ta
B D                    Alpaca  a-ta
               Bactrian camel  a-ta
B D                   Dolphin  a-ta
                 Killer whale  a-ta
             Tibetan antelope  atta
B D                       Cow  atta
B D                     Sheep  atta
                Domestic goat  atta
B D                     Horse  a-ta
B D          White rhinoceros  a-ta
B D                       Cat  a-ta
B D                       Dog  a-ta
B D                   Ferret   a-ta
B D                     Panda  a-ta
               Pacific walrus  a-ta
                 Weddell seal  a-ta
             Black flying-fox  a-ta
B D                   Megabat  a-ta
                Big brown bat  a-ta
         David's myotis (bat)  a-ta
B D                  Microbat  a-ta
B D                  Hedgehog  a-ta
B D                     Shrew  a-ta
              Star-nosed mole  a-ta
B D                  Elephant  a-ta
          Cape elephant shrew  a-ta
B D                   Manatee  a-ta
             Cape golden mole  a-ta
B D                    Tenrec  a-ta
                     Aardvark  a-ta
B D                 Armadillo  a-ta
B D                   Opossum  a-ta
B D           Tasmanian devil  a-ta
B D                   Wallaby  a-ta
B D                  Platypus  a-ta
B D               Zebra finch  a-ca
  D           Green seaturtle  a-ta
  D            Painted turtle  a-ta
  D  Chinese softshell turtle  a-ta
  D    Spiny softshell turtle  a-ta
B D                Coelacanth  a-ta
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D                      Fugu  ====
      Yellowbelly pufferfish  ====
B D                 Tetraodon  ====
                 Zebra mbuna  ====
B D                 Zebrafish  ====
B D              Atlantic cod  ====
                 Spotted gar  ====
B D               Stickleback  ====
    Mexican tetra (cavefish)  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
  D       Collared flycatcher  ====
          Southern platyfish  ====
B D             X. tropicalis  ====
B D                Budgerigar  ====
  D             Scarlet macaw  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D          Peregrine falcon  NNNN
  D              Saker falcon  NNNN
B D                   Chicken  ====
B D                    Lizard  ====
B D                    Medaka  ====
          Tibetan ground jay  ====
  D                    Parrot  ====
  D               Rock pigeon  ====
  D              Mallard duck  ====
B D        American alligator  ====

Inserts between block 23 and 24 in window
B D                 Platypus 5711bp

Alignment block 24 of 473 in window, 62812744 - 62812747, 4 bps 
B D                     Human  aagt
B D                     Chimp  aagt
B D                   Gorilla  aagt
B D                 Orangutan  aagt
B D                    Gibbon  aagt
B D                    Rhesus  aagt
B D       Crab-eating macaque  aagt
B D                    Baboon  aagt
B D              Green monkey  aagt
B D                  Marmoset  aagt
B D           Squirrel monkey  aagt
B D                  Bushbaby  aagt
           Chinese tree shrew  aagt
B D                  Squirrel  aagt
       Lesser Egyptian jerboa  aagt
                 Prairie vole  aagt
B D           Chinese hamster  aagt
               Golden hamster  aagt
B D                     Mouse  aagt
B D                       Rat  aagt
B D            Naked mole-rat  aagt
B D                Guinea pig  aagt
                   Chinchilla  aagt
             Brush-tailed rat  aagt
B D                    Rabbit  aagt
B D                      Pika  aagt
B D                       Pig  aagt
B D                    Alpaca  aagt
               Bactrian camel  aagt
B D                   Dolphin  aagt
                 Killer whale  aagt
             Tibetan antelope  aagt
B D                       Cow  aagt
B D                     Sheep  aagt
                Domestic goat  aagt
B D                     Horse  aagt
B D          White rhinoceros  aagt
B D                       Cat  aagt
B D                       Dog  aagt
B D                   Ferret   aagt
B D                     Panda  aagt
               Pacific walrus  aagt
                 Weddell seal  aagt
             Black flying-fox  aagt
B D                   Megabat  aagt
                Big brown bat  aagt
         David's myotis (bat)  aagt
B D                  Microbat  aagt
B D                  Hedgehog  aagt
B D                     Shrew  aagt
              Star-nosed mole  aagt
B D                  Elephant  aagt
          Cape elephant shrew  aagt
B D                   Manatee  aagt
             Cape golden mole  aagt
B D                    Tenrec  aagt
                     Aardvark  aagt
B D                 Armadillo  aagt
B D                   Opossum  aagt
B D           Tasmanian devil  aagt
B D                   Wallaby  aagt
B D                  Platypus  aagt
B D               Zebra finch  gggt
  D           Green seaturtle  aagt
  D            Painted turtle  aagt
  D  Chinese softshell turtle  aagt
  D    Spiny softshell turtle  aagt
B D                Coelacanth  aagt
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D                      Fugu  ====
      Yellowbelly pufferfish  ====
B D                 Tetraodon  ====
                 Zebra mbuna  ====
B D                 Zebrafish  ====
B D              Atlantic cod  ====
                 Spotted gar  ====
B D               Stickleback  ====
    Mexican tetra (cavefish)  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
  D       Collared flycatcher  ====
          Southern platyfish  ====
B D             X. tropicalis  ====
B D                Budgerigar  ====
  D             Scarlet macaw  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D          Peregrine falcon  NNNN
  D              Saker falcon  NNNN
B D                   Chicken  ====
B D                    Lizard  ====
B D                    Medaka  ====
          Tibetan ground jay  ====
  D                    Parrot  ====
  D               Rock pigeon  ====
  D              Mallard duck  ====
B D        American alligator  ====

Alignment block 25 of 473 in window, 62812748 - 62812751, 4 bps 
B D                     Human  gc-ac
B D                     Chimp  gc-ac
B D                   Gorilla  gc-ac
B D                 Orangutan  gc-ac
B D                    Gibbon  gc-ac
B D                    Rhesus  gc-ac
B D       Crab-eating macaque  gc-ac
B D                    Baboon  gc-ac
B D              Green monkey  gc-ac
B D                  Marmoset  gc-ac
B D           Squirrel monkey  gc-ac
B D                  Bushbaby  gc-at
           Chinese tree shrew  gc-ac
B D                  Squirrel  gc-ac
       Lesser Egyptian jerboa  gc-ac
                 Prairie vole  gcaat
B D           Chinese hamster  gcaat
               Golden hamster  gcaat
B D                     Mouse  gccac
B D                       Rat  gccac
B D            Naked mole-rat  gc-ac
B D                Guinea pig  gc-ac
                   Chinchilla  gc-ac
             Brush-tailed rat  gc-ac
B D                    Rabbit  gc-ac
B D                      Pika  gc-ac
B D                       Pig  gc-at
B D                    Alpaca  gc-ac
               Bactrian camel  gc-ac
B D                   Dolphin  gc-ac
                 Killer whale  gc-ac
             Tibetan antelope  gc-ac
B D                       Cow  gc-ac
B D                     Sheep  gc-ac
                Domestic goat  gc-ac
B D                     Horse  gc-ac
B D          White rhinoceros  gc-ac
B D                       Cat  gc-ac
B D                       Dog  gc-ac
B D                   Ferret   gc-ac
B D                     Panda  gc-ac
               Pacific walrus  gc-ac
                 Weddell seal  gc-ac
             Black flying-fox  gc-ac
B D                   Megabat  gc-at
                Big brown bat  gc-at
         David's myotis (bat)  gc-ac
B D                  Microbat  gc-ac
B D                  Hedgehog  gc-ac
B D                     Shrew  gc-ac
              Star-nosed mole  gc-ac
B D                  Elephant  gc-ac
          Cape elephant shrew  gc-ac
B D                   Manatee  gc-ac
             Cape golden mole  gc-ac
B D                    Tenrec  gc-ac
                     Aardvark  gc-ac
B D                 Armadillo  gc-ac
B D                   Opossum  gc-gc
B D           Tasmanian devil  gc-ac
B D                   Wallaby  gc-ac
B D                  Platypus  gc-ac
B D               Zebra finch  -c-tc
  D           Green seaturtle  gc-ac
  D            Painted turtle  gc-ac
  D    Spiny softshell turtle  gc-ac
B D                Coelacanth  gc-at
         Princess of Burundi  =====
B D              Nile tilapia  =====
B D                      Fugu  =====
      Yellowbelly pufferfish  =====
B D                 Tetraodon  =====
                 Zebra mbuna  =====
B D                 Zebrafish  =====
B D              Atlantic cod  =====
                 Spotted gar  =====
B D               Stickleback  =====
    Mexican tetra (cavefish)  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
  D  Chinese softshell turtle  NNNNN
  D       Collared flycatcher  =====
          Southern platyfish  =====
B D             X. tropicalis  =====
B D                Budgerigar  =====
  D             Scarlet macaw  =====
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
  D          Peregrine falcon  NNNNN
  D              Saker falcon  NNNNN
B D                   Chicken  =====
B D                    Lizard  =====
B D                    Medaka  =====
          Tibetan ground jay  =====
  D                    Parrot  =====
  D               Rock pigeon  =====
  D              Mallard duck  =====
B D        American alligator  =====

Inserts between block 25 and 26 in window
  D          Green seaturtle 5bp
  D           Painted turtle 5bp

Alignment block 26 of 473 in window, 62812752 - 62812769, 18 bps 
B D                     Human  atcag----ttttgc------t----t-gtc------------tt
B D                     Chimp  atcag----ttttgc------t----t-gtc------------tt
B D                   Gorilla  atcag----ttttgc------t----t-gtc------------tt
B D                 Orangutan  atcag----ttttgc------t----t-gtc------------tt
B D                    Gibbon  atcag----ttttgc------t----t-gtc------------tt
B D                    Rhesus  atcag----ttttgc------t----t-gtc------------tt
B D       Crab-eating macaque  atcag----ttttgc------t----t-gtc------------tt
B D                    Baboon  atcag----ttttgc------t----t-gtc------------tt
B D              Green monkey  atcag----ttttgc------t----t-gtc------------tt
B D                  Marmoset  atcag----ttttgc------t----t-gtc------------tt
B D           Squirrel monkey  atcag----ttttgc------t----t-gtc------------tt
B D                  Bushbaby  atcag----ttttgc------a----t-gtc------------tt
           Chinese tree shrew  atcag----tttcgc------t----t-gtc------------tt
B D                  Squirrel  atcag----ttttgc------t----t-gtc------------tt
       Lesser Egyptian jerboa  attca----ttttgc------c----t-gtc------------ct
                 Prairie vole  gtcag----ttttcc------t----tagtc------------tt
B D           Chinese hamster  gtcag----tttttc------t----tagtc------------tt
               Golden hamster  gtcag----tttttc------t----tagtc------------tt
B D                     Mouse  atcag----ttttgctttaatt----tagtc------------tt
B D                       Rat  atcgg----ttttgctttaatt----tagtc------------tt
B D            Naked mole-rat  atcag----ttttgc------t----t-gtc------------tt
B D                Guinea pig  atcag-----tttgc------t----t-ttc------------tt
                   Chinchilla  atcag----ttttgc------t----t-gtc------------tt
             Brush-tailed rat  atcag----ttttgc------t----t-gtc------------tt
B D                    Rabbit  atcag----ctttgc------t----t-gtc------------tt
B D                      Pika  atcag----ttgtct------t----t----------------tt
B D                       Pig  atcag----ttttgc------t----t-ctg---------tc-tc
B D                    Alpaca  a-cag----tttcac------t----t-ctg---------tc-tt
               Bactrian camel  atcag----tttcgc------t----t-ctg---------tc-tt
B D                   Dolphin  atcag----ttttgc------t----t-ctg---------ccttt
                 Killer whale  atcag----ttttgc------t----t-ctg---------ccttt
             Tibetan antelope  atcag----ctttgc------t----t-ctg---------cc-tt
B D                       Cow  atcag----ctttgc------t----t-ctg---------cc-tt
B D                     Sheep  atcag----ctttgc------t----t-ctg---------cc-tt
                Domestic goat  atcag----ctttgc------t----t-ctg---------cc-tt
B D                     Horse  atcag----ttttgc------ttctgt-c--------------tt
B D          White rhinoceros  atcag----ttttgc------t----t-c--------------tt
B D                       Cat  atcag----ctttgc------t----t-c--------------tt
B D                       Dog  atcag----ctttgc------t----t-c--------------tt
B D                   Ferret   atcag----ctttcc------t----t-c--------------tt
B D                     Panda  atcag----ctttgc------t----t-c--------------tt
               Pacific walrus  atcag----ctttgc------t----t-c--------------tt
                 Weddell seal  atcag----ctttgc------t----t-c--------------tt
             Black flying-fox  gtcag----ttttgc------t----t-ctg------------tc
B D                   Megabat  gtcag----ttttgc------t----t-ctg------------tc
                Big brown bat  gtcag----ttttgc------t----t-ctg------------tc
         David's myotis (bat)  gtcag----ttttgc------t----t-ctg------------tc
B D                  Microbat  gtcag----ttttgc------t----t-ctg------------tc
B D                  Hedgehog  atcag----tttggc------t----t-ctg---------tc-tt
B D                     Shrew  gtcag----ttttgc------t----g-ct----------cc-tt
              Star-nosed mole  atcag----tttcgc------t----t-ctg---------tc-tt
B D                  Elephant  atcag----ttttgc------ttc--t-gtc------------tt
          Cape elephant shrew  atgag----cttcgc------t-------gc------------tt
B D                   Manatee  atcag----ttttgc------t----t-gtc------------tt
             Cape golden mole  atcag----ctttgc------ttc--t----------------tt
B D                    Tenrec  atcag----ttttgc------ttc--t-gtc------------tt
                     Aardvark  atcag----ttttgc------t-------tc------------tt
B D                 Armadillo  atcag----ttttcc------ttc--t-gtc------------tt
B D                   Opossum  cttgg----tttggg------t----c------------------
B D           Tasmanian devil  atcag----tttggg------t----c----------------tt
B D                   Wallaby  atcag----tttggg------g----c----------------tt
B D                  Platypus  atcagtcgatttttc------t----g-gtcctgccgcggtc-gt
B D               Zebra finch  atcag----tctttc------t----t------------------
  D           Green seaturtle  ctcag----ccagcc------g----a------------------
  D            Painted turtle  ttcag----cccgcc------g----c------------------
B D                Coelacanth  -----atgttcttgt------t----t-t----------------
         Princess of Burundi  =============================================
B D              Nile tilapia  =============================================
B D                      Fugu  =============================================
      Yellowbelly pufferfish  =============================================
B D                 Tetraodon  =============================================
                 Zebra mbuna  =============================================
B D                 Zebrafish  =============================================
B D              Atlantic cod  =============================================
                 Spotted gar  =============================================
B D               Stickleback  =============================================
    Mexican tetra (cavefish)  =============================================
         Pundamilia nyererei  =============================================
       Burton's mouthbreeder  =============================================
  D  Chinese softshell turtle  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D       Collared flycatcher  =============================================
          Southern platyfish  =============================================
B D             X. tropicalis  =============================================
B D                Budgerigar  =============================================
  D             Scarlet macaw  =============================================
B D       Medium ground finch  =============================================
  D    White-throated sparrow  =============================================
  D          Peregrine falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Chicken  =============================================