Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 78 in window, 3676094 - 3676147, 54 bps 
B D                     Human  ttttgtcccggttctaactcccgaagcttcggcgatttcaaacactccagaac----t
B D                     Chimp  ttttgtcccggttctaactcccgaagcttcggcgatttcaaacactccagagc----t
B D                   Gorilla  ttttgtcccggttctaactcccgaagcttcggcgatttcaaacactccagagc----t
B D                 Orangutan  ttttgtcccgattctaactcccgaagcttcggcgatttcaaacactccagagctaagt
B D                    Gibbon  ttttgtcccggttctaactcccgaagcttcggcgatttcaaacactccagagc----t
B D                    Rhesus  ttttgtcccggttctaactcctgaagcttcagcgatttcaaacactccagagc----t
B D       Crab-eating macaque  ttttgttccggttctaactcctgaagcttcagcgatttcaaacactccagagc----t
B D                    Baboon  ttttgtcccggttctaactcctgaagcttcagcgatttcaaacactccagagc----t
B D              Green monkey  ttttgtcccggttctaactcctgaagcttcagcgatttcaaacactccagagc----t
B D                  Marmoset  tttcgtcccagttctaactcccgaagcttccgcgatttcaaacgctccggagc----t
B D           Squirrel monkey  tttcgtcccagttctaactcccgaagcttccgcgatttcaaacactccggagc----t
B D                  Bushbaby  ttttgttccagttctaactcctgaagcttcagcaatttcaaatactccagagc----t
           Chinese tree shrew  tttagtcccggctctaactcctgaagcttcagcgatctcgaacactccagagc----t
B D                  Squirrel  tttggttccagttctaactcctgaagcttcagcgatttcaaacactccagagc----t
       Lesser Egyptian jerboa  tttggtcccaggtctaactcctgaagcttcagcaatttcaaacactccagagc----t
                 Prairie vole  tttggtcccaggtctgactcctgaagcttcggcaatttcaaacacgccagaac----t
B D           Chinese hamster  tttggtcccaggtctaactcctgaagcttcggcgatttcaaacactccagaac----t
               Golden hamster  tttggtcccaggtctaactcctgaagcttcggcaatttcaaacactccagaac----t
B D                     Mouse  tttggtcccaggtctaactcctgaagcttcggcaatttcaaacactccagaac----t
B D                       Rat  tttggtcccaggtctaactcctgaagcttcagcaatttcaaacactccagaac----t
B D            Naked mole-rat  tttggtcccagttctaacacctgaagcttcagcgatttcaaacactccagagc----t
B D                Guinea pig  tttggttccggttctaacacctgaagcttcagcaatttcaaacaccccagagc----t
                   Chinchilla  tttggtcccagttctaacgcctgaagcttcagcgatttcaaacactccagagc----t
             Brush-tailed rat  tttggtcccagttctaacgcctgaagcttcagcgatttcaaacactccagagc----t
B D                    Rabbit  cttggtgccagttttgactcctgatgcttcagcgacttcaaacactccagagc----t
B D                      Pika  tttggtgccgggtctgactcctgatgcttcggcaatctcaaacaccccggagc----t
B D                       Pig  tttggttcccgttctgactcctgcagcttcagcaatttcaaagacgccagagc----t
B D                    Alpaca  cttggtcccggttctcacaccggaggcttcagcaatttcaaacaccccggagc----t
               Bactrian camel  cttggtcccggttctcactccggaggcttcagcaattttaaacaccccggagc----t
B D                   Dolphin  tttggtcccggttctaactcctgaggcttcggcgatttcaaacaccccagagc----t
                 Killer whale  tttggtcccggttctaactcctgaggcttcggcgatttcaaacaccccagagc----t
             Tibetan antelope  tttcgttccagttctaactcctgaggcttcggcaacttcaaacaccccagagc----t
B D                       Cow  tttcgtcccagttctaactcccgaggcttcggcaacttcaaacaccccagagc----t
B D                     Sheep  tttcgtcccggttctaactcctgaggcttcagcaacttcaaacaccccagagc----t
                Domestic goat  tttcgtcccagttctaactcctgaggcttcggcaacttcaaacaccccagagc----t
B D                     Horse  tttggtcccagttctaacgcccgaggcttcagcgatttcaaacatcccagaac----t
B D          White rhinoceros  tttggttccggttctaactcctgaggcttcagcgatttcaaacaccccagaac----t
B D                       Cat  tttggtcccagttctcactcccgaggcttcagcgatttcaaacaccccggagc----t
B D                       Dog  tttggtcccagttctcactcctgaggcttcagcgatttcaaacaccccagagc----t
B D                   Ferret   cttggtcccggttctcactcccgaggcttcagcgatttcaaacaccccagacc----t
B D                     Panda  tttggtcccggttcttactcccgaggcttcagcgatttcaaataccccagagc----t
               Pacific walrus  tttggtcccggttctcactcccgaggcttcagcgatttcaaacaccccggaac----t
                 Weddell seal  tttggtcccagttctcactcccgaggcttcagccatttcaaacaccccggagc----t
             Black flying-fox  tttggtcccagttctaactcctgaggcttcagcgatttcgaacaccccggagc----t
B D                   Megabat  tttggtcccagttctaactcctgaggcttcagcgatttcgaacaccccggagc----t
                Big brown bat  tttggttccagttctaactcctgaagcttcggcgatttcaaataccccggagc----t
         David's myotis (bat)  tttggttccagttctaactcctgaagcttcggcgatttcaaataccccggagc----t
B D                  Microbat  tttggttccagttctaactcctgaagcttcggcgatttcaaacaccccggagc----t
B D                  Hedgehog  tttggtgccagttctaactcctgaggcttccgagatttcaaacagccccgagc----t
B D                     Shrew  tttggtcccaggtcgaacgccggaggcttccgagatctcaaacaccccagagc----t
B D                  Elephant  cttggttccaggtctgactccagaagcctcggcaatttcaaacactccagagc----t
          Cape elephant shrew  tttggtcccaggttggactccagccgcctcagcaacttcaaacactccagagc----t
B D                   Manatee  cttagtcccaggtctgactccggaagcctcggcgacttgaaacactccagagc----t
             Cape golden mole  cttggtcccaggtctgactccggaagcctcggcgatttcaaacacaccagagc----t
B D                    Tenrec  cttggtcccgggcctgactccggaggcctcggcgacttcaaacactcccgagc----t
                     Aardvark  cttggtcccaggtctgaccccagaagcctcggcgatctcgaatgctccacagc----t
B D                 Armadillo  cttggtgccggttctgactccagaagcttcggcgacttgaaacaccccagagc----t
B D                   Opossum  tttggttccagttctaacaccagaagcttctgcaagttcaaatactccagagc----t
B D           Tasmanian devil  tttggttccagttctaacacctgaagcttctgcaatttcaaatactccagagc----t
B D                  Platypus  tttggtcccggttcgtactccagaagcttcggcgatttcaaacacccctgacc----t
  D               Rock pigeon  cttagtcccagttctgacaccagatgcttctgcaatctcaaacatccctgaac----t
  D              Saker falcon  cttagtcccagttctaacaccagatgcttctgcaatctcaaacactcctgaac----t
  D          Peregrine falcon  cttagtcccagttctaacaccagatgcttctgcaatctcaaacactcctgaac----t
  D       Collared flycatcher  cttagtcccagctctgaccccagatgcttctgcaatctcaaacatccctgaac----t
  D    White-throated sparrow  cttagtcccagctctgaccccagatgcttctgcaatctcaaacatgcctgaac----t
B D       Medium ground finch  cttagtcccagctctgaccccagatgcttctgcaatctcaaacatccctgaac----t
B D               Zebra finch  tttagtcccagctctgaccccagatgcttctgcaatctcaaacatccctgaac----t
           Tibetan ground jay  cttagtcccagctctgaccccagatgcttctgcaatctcaaacatccctgaac----t
B D                Budgerigar  cttagtcccagttctgacaccagatgcttctgcaatctcaaacattcctgaac----t
  D                    Parrot  cttagtcccagttctgacaccagatgcttctgcaatctcaaacattcctgaac----t
  D             Scarlet macaw  cttagtcccagttctgacaccagatgcttctgcaatctcaaacattcctgaac----t
  D              Mallard duck  cttagtcccagttctgacaccagaagcttccgcaatctcaaacattcctgaac----t
B D                   Chicken  cttagtcccagttctgacaccagatgcttctgcgatctcaaacattcctgagc----t
B D                    Turkey  cttagtcccagttctgacaccagatgcttctgcgatctcaaacattcctgagc----t
B D        American alligator  cttagtcccagttctgacaccagaagcttcagcgatctcaaatattcctgacc----t
  D           Green seaturtle  tttggtcccaggtctgacgccagaggcttcggcgatctcaaacattcccgagc----t
  D            Painted turtle  tttggtcccaggtctgacgccagaggcttcggcgatctcgaacattcccgagc----t
  D  Chinese softshell turtle  tttggtcccagttctgacaccagaggcttctgcgatctcaaacattcctgagc----t
  D    Spiny softshell turtle  tttggtcccagttctgacaccagaggcttccgcaatctcaaacattcctgagc----t
B D                    Lizard  tttagtcccaccttggactccggaggcttcggtgatctcaaaggtgccagaac----t
B D             X. tropicalis  ctttgtccctggccggacgccactggcctctaccaactcaaagacaccagagc----t
B D                Coelacanth  tttggttcctggtctcactcctgtggcttcagcaatctcaaacatgccagaac----t
B D                 Tetraodon  cttcgttccctgctgaacgccgccggcttcagcgatttcatacagtccagagc----t
B D                      Fugu  cttggttccctgttgaacgccgctggcttcagcgatttcatacagcccagagc----t
       Yellowbelly pufferfish  cttggttccctgttgaacgccgctggcttcagcgatttcatacagcccagagc----t
B D              Nile tilapia  tttcgttccttgttgaacgccggtggcttcagcaatctcaaaaaccccagagc----t
          Princess of Burundi  ttttgttccttgttgaacgccggtggcttcagcaatctcaaaaaccccagagc----t
        Burton's mouthbreeder  ttttgttccttgttgaacgccggtggcttcagcaatctcaaaaaccccagagc----t
                  Zebra mbuna  ttttgttccttgttgaacgccggtggcttcagcaatctcaaaaaccccagagc----t
          Pundamilia nyererei  ttttgttccttgttgaacgccggtggcttcagcaatctcaaaaaccccagagc----t
B D                    Medaka  ttttgttccttgttggactccactggcttctgcaacttcaaaaagtccagagc----t
           Southern platyfish  tttagttccctgttgaacgccgctggcttcagcgatctcaaacagtccagagc----t
B D               Stickleback  ctttgttccctgctgaacgccgctggcttcagcgatctcaaaaactccagagc----t
B D              Atlantic cod  cttggtcccctgcctgacgccgctggcctccgcgatctcaaacaccccggagc----t
B D                 Zebrafish  cttggttccctgtcgaacacctgaagcttcagcgacctcaaacactccagagc----t
     Mexican tetra (cavefish)  cttagtgccctgtctcaccccactggcttctgcaatctcaaatatccctgagc----t
                  Spotted gar  cttggtgccctgtctcactcctttcgcctcggcaatctcaaataccccggagc----t
             Star-nosed mole  ==========================================================

Inserts between block 1 and 2 in window
B D                 Marmoset 3bp
      Lesser Egyptian jerboa 22bp
    Mexican tetra (cavefish) 175bp
                 Spotted gar 18bp

Alignment block 2 of 78 in window, 3676148 - 3676150, 3 bps 
B D                     Human  aag
B D                     Chimp  aag
B D                   Gorilla  aag
B D                 Orangutan  aag
B D                    Gibbon  aag
B D                    Rhesus  aaa
B D       Crab-eating macaque  aaa
B D                    Baboon  aaa
B D              Green monkey  aaa
B D                  Marmoset  aaa
B D                  Bushbaby  aag
           Chinese tree shrew  aag
B D                  Squirrel  aag
       Lesser Egyptian jerboa  agg
                 Prairie vole  aaa
B D           Chinese hamster  aaa
               Golden hamster  aaa
B D                     Mouse  aaa
B D                       Rat  aaa
B D            Naked mole-rat  acg
B D                Guinea pig  acg
                   Chinchilla  aat
             Brush-tailed rat  ggg
B D                    Rabbit  gtg
B D                      Pika  gag
B D                       Pig  gag
B D                    Alpaca  aag
               Bactrian camel  aag
B D                   Dolphin  aag
                 Killer whale  aag
             Tibetan antelope  aag
B D                       Cow  aag
B D                     Sheep  gag
                Domestic goat  aag
B D                     Horse  aag
B D          White rhinoceros  aag
B D                       Cat  aag
B D                       Dog  agg
B D                   Ferret   aag
B D                     Panda  aag
               Pacific walrus  aag
                 Weddell seal  aag
             Black flying-fox  aag
B D                   Megabat  aag
                Big brown bat  aag
         David's myotis (bat)  aag
B D                  Microbat  aag
B D                  Hedgehog  agg
B D                     Shrew  aag
B D                  Elephant  aag
          Cape elephant shrew  aag
B D                   Manatee  gag
             Cape golden mole  gag
B D                    Tenrec  gaa
                     Aardvark  gag
B D                 Armadillo  aag
B D                   Opossum  aag
B D           Tasmanian devil  aag
B D                  Platypus  agt
  D               Rock pigeon  agg
  D              Saker falcon  agg
  D          Peregrine falcon  agg
  D       Collared flycatcher  agg
  D    White-throated sparrow  agg
B D       Medium ground finch  agg
B D               Zebra finch  agg
           Tibetan ground jay  agg
B D                Budgerigar  agg
  D                    Parrot  agg
  D             Scarlet macaw  agg
  D              Mallard duck  agg
B D                   Chicken  agg
B D                    Turkey  agg
B D        American alligator  agg
  D           Green seaturtle  agg
  D            Painted turtle  agg
  D  Chinese softshell turtle  agg
  D    Spiny softshell turtle  agg
B D                    Lizard  aga
B D                Coelacanth  aag
B D                 Tetraodon  ga-
B D                      Fugu  gaa
       Yellowbelly pufferfish  gaa
B D              Nile tilapia  gag
          Princess of Burundi  gag
        Burton's mouthbreeder  gaa
                  Zebra mbuna  gag
          Pundamilia nyererei  gag
B D                    Medaka  gac
           Southern platyfish  gaa
B D               Stickleback  gaa
B D              Atlantic cod  ggg
B D                 Zebrafish  g--
                  Spotted gar  gag
             Star-nosed mole  ===
    Mexican tetra (cavefish)  ===
B D             X. tropicalis  ---
B D           Squirrel monkey  ---

Inserts between block 2 and 3 in window
  D           Painted turtle 1549bp
B D               Coelacanth 3bp

Alignment block 3 of 78 in window, 3676151 - 3676151, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  a
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  a
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  g
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  a
B D                   Opossum  a
B D           Tasmanian devil  a
B D                  Platypus  g
B D                Coelacanth  a
B D                      Fugu  g
       Yellowbelly pufferfish  g
B D              Nile tilapia  g
          Princess of Burundi  g
        Burton's mouthbreeder  g
                  Zebra mbuna  g
          Pundamilia nyererei  g
B D                    Medaka  g
           Southern platyfish  c
B D               Stickleback  g
B D              Atlantic cod  g
                  Spotted gar  t
             Star-nosed mole  =
  D    Spiny softshell turtle  -
B D                 Tetraodon  -
B D                    Turkey  -
B D                   Chicken  -
  D              Mallard duck  -
          Tibetan ground jay  -
B D               Zebra finch  -
  D    White-throated sparrow  -
    Mexican tetra (cavefish)  =
B D                 Zebrafish  -
B D             X. tropicalis  -
  D            Painted turtle  =
B D        American alligator  -
  D             Scarlet macaw  -
B D                Budgerigar  -
  D               Rock pigeon  -
  D       Collared flycatcher  -
B D       Medium ground finch  -
B D                    Lizard  -
  D          Peregrine falcon  -
  D              Saker falcon  -
  D                    Parrot  -
  D           Green seaturtle  -
  D  Chinese softshell turtle  -
B D           Squirrel monkey  -

Inserts between block 3 and 4 in window
B D             Atlantic cod 422bp

Alignment block 4 of 78 in window, 3676152 - 3676155, 4 bps 
B D                     Human  ca---gg--
B D                     Chimp  ca---gg--
B D                   Gorilla  ca---gg--
B D                 Orangutan  ca---ga--
B D                    Gibbon  ca---gg--
B D                    Rhesus  ca---gg--
B D       Crab-eating macaque  ca---gg--
B D                    Baboon  ca---gg--
B D              Green monkey  ca---gg--
B D                  Marmoset  aa---aa--
B D                  Bushbaby  ca---ta--
           Chinese tree shrew  t--------
B D                  Squirrel  cc---ca--
       Lesser Egyptian jerboa  ga---ga--
                 Prairie vole  ca---ca--
B D           Chinese hamster  ca---tg--
               Golden hamster  ca---cg--
B D                     Mouse  ca---tg--
B D                       Rat  ca---gg--
B D            Naked mole-rat  ca---ca--
B D                Guinea pig  ca---ca--
                   Chinchilla  ca---ca--
             Brush-tailed rat  ta---ta--
B D                    Rabbit  ca---ca--
B D                      Pika  c--------
B D                       Pig  ca---ga--
B D                    Alpaca  ca---cg--
               Bactrian camel  ca---cg--
B D                   Dolphin  ca---cg--
                 Killer whale  ca---cg--
B D                     Horse  tg---ca--
B D          White rhinoceros  tg---ca--
B D                       Cat  gg---t---
B D                       Dog  gg---t---
B D                   Ferret   tg---t---
B D                     Panda  tg---t---
               Pacific walrus  cg---t---
                 Weddell seal  ca---t---
             Black flying-fox  ca---ca--
B D                   Megabat  ca---ca--
                Big brown bat  ca---ca--
         David's myotis (bat)  ca---ca--
B D                  Microbat  ca---ca--
B D                  Hedgehog  ca---cg--
B D                     Shrew  ga---gg--
B D                  Elephant  tg-------
          Cape elephant shrew  ag--t----
B D                   Manatee  tacgt----
             Cape golden mole  cc-------
B D                    Tenrec  ca-------
                     Aardvark  ca-------
B D                 Armadillo  cg--c----
B D                   Opossum  gg---aa--
B D           Tasmanian devil  aa---aa--
B D                  Platypus  cg---ag--
  D               Rock pigeon  ------a--
  D              Saker falcon  ------a--
  D          Peregrine falcon  ------a--
  D       Collared flycatcher  ------a--
  D    White-throated sparrow  ------a--
B D       Medium ground finch  ------a--
B D               Zebra finch  ------a--
           Tibetan ground jay  ------a--
B D                Budgerigar  ------a--
  D                    Parrot  ------a--
  D             Scarlet macaw  ------a--
  D              Mallard duck  ------a--
B D                   Chicken  ------a--
B D                    Turkey  ------a--
B D        American alligator  ------a--
  D           Green seaturtle  ------a--
  D  Chinese softshell turtle  ------a--
  D    Spiny softshell turtle  ------a--
B D                    Lizard  ------a--
B D             X. tropicalis  ------g--
B D                      Fugu  -----ggga
       Yellowbelly pufferfish  -----ggga
B D              Nile tilapia  -----gaga
          Princess of Burundi  -----gaga
        Burton's mouthbreeder  -----gaga
                  Zebra mbuna  -----gaga
          Pundamilia nyererei  -----gaga
B D                    Medaka  -----gaga
           Southern platyfish  -----gagg
B D               Stickleback  -----aaga
B D                 Zebrafish  -----caga
                  Spotted gar  -----gagg
             Star-nosed mole  =========
B D                     Sheep  ---------
            Tibetan antelope  ---------
B D                       Cow  ---------
               Domestic goat  ---------
B D                Coelacanth  ---------
B D              Atlantic cod  =========
B D                 Tetraodon  ---------
    Mexican tetra (cavefish)  =========
  D            Painted turtle  =========
B D           Squirrel monkey  ---------

Inserts between block 4 and 5 in window
B D                  Dolphin 1bp
                Killer whale 1bp
B D                 Hedgehog 4bp
B D                    Shrew 639bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
  D              Rock pigeon 4bp
  D             Saker falcon 4bp
  D         Peregrine falcon 4bp
  D      Collared flycatcher 4bp
  D   White-throated sparrow 4bp
B D      Medium ground finch 4bp
B D              Zebra finch 4bp
          Tibetan ground jay 4bp
B D               Budgerigar 4bp
  D                   Parrot 4bp
  D            Scarlet macaw 4bp
  D             Mallard duck 4bp
B D                  Chicken 4bp
B D                   Turkey 4bp
B D       American alligator 4bp
  D          Green seaturtle 4bp
  D Chinese softshell turtle 4bp
  D   Spiny softshell turtle 4bp
B D                   Lizard 4bp

Alignment block 5 of 78 in window, 3676156 - 3676156, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  a
B D                  Bushbaby  t
B D                   Opossum  a
B D           Tasmanian devil  c
B D                  Platypus  a
B D             X. tropicalis  c
B D                Coelacanth  t
B D                      Fugu  c
       Yellowbelly pufferfish  c
B D              Nile tilapia  c
          Princess of Burundi  c
        Burton's mouthbreeder  c
                  Zebra mbuna  c
          Pundamilia nyererei  c
B D                    Medaka  a
           Southern platyfish  a
B D               Stickleback  a
B D                 Zebrafish  c
                  Spotted gar  a
             Star-nosed mole  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                 Armadillo  -
B D                  Microbat  -
B D                    Tenrec  -
              Golden hamster  -
                Prairie vole  -
B D                  Squirrel  -
B D                       Rat  -
B D                     Mouse  -
                  Chinchilla  -
            Brush-tailed rat  -
B D                Guinea pig  -
B D            Naked mole-rat  -
      Lesser Egyptian jerboa  -
B D           Chinese hamster  -
         Cape elephant shrew  -
B D                     Sheep  -
            Cape golden mole  -
            Tibetan antelope  -
        David's myotis (bat)  -
          Chinese tree shrew  -
B D                  Elephant  -
               Big brown bat  -
B D                       Cow  -
              Pacific walrus  -
B D                     Panda  -
               Domestic goat  -
                Killer whale  =
              Bactrian camel  -
B D                    Alpaca  -
B D                    Rabbit  -
B D                       Pig  -
B D                      Pika  -
B D                       Dog  -
B D                       Cat  -
B D                   Ferret   -
B D                   Dolphin  =
                Weddell seal  -
B D                   Megabat  -
  D    Spiny softshell turtle  =
                    Aardvark  -
B D              Atlantic cod  =
B D                 Tetraodon  -
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
    Mexican tetra (cavefish)  =
  D            Painted turtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                   Manatee  -
  D           Green seaturtle  =
  D  Chinese softshell turtle  =
            Black flying-fox  -
B D          White rhinoceros  -
B D                     Horse  -
B D           Squirrel monkey  -

Inserts between block 5 and 6 in window
         Princess of Burundi 1bp
         Pundamilia nyererei 1bp

Alignment block 6 of 78 in window, 3676157 - 3676158, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  aa
B D                  Squirrel  gg
       Lesser Egyptian jerboa  ga
                 Prairie vole  ga
B D           Chinese hamster  aa
               Golden hamster  aa
B D                     Mouse  aa
B D                       Rat  ga
B D            Naked mole-rat  ag
B D                Guinea pig  aa
                   Chinchilla  aa
             Brush-tailed rat  aa
B D                    Rabbit  gc
B D                    Alpaca  -g
               Bactrian camel  -g
B D                     Horse  -g
B D          White rhinoceros  -g
             Black flying-fox  -c
B D                   Megabat  -c
                Big brown bat  -g
         David's myotis (bat)  -g
B D                  Microbat  -g
          Cape elephant shrew  ca
B D                   Manatee  gg
             Cape golden mole  -c
B D                    Tenrec  -g
                     Aardvark  -c
B D                 Armadillo  ag
B D                   Opossum  ga
B D           Tasmanian devil  ag
B D                  Platypus  ga
  D               Rock pigeon  aa
  D              Saker falcon  aa
  D          Peregrine falcon  aa
  D       Collared flycatcher  aa
  D    White-throated sparrow  aa
B D       Medium ground finch  aa
B D               Zebra finch  aa
           Tibetan ground jay  aa
B D                Budgerigar  aa
  D                    Parrot  aa
  D             Scarlet macaw  aa
  D              Mallard duck  aa
B D                   Chicken  aa
B D                    Turkey  aa
B D        American alligator  aa
  D           Green seaturtle  aa
  D  Chinese softshell turtle  aa
  D    Spiny softshell turtle  aa
B D                    Lizard  aa
B D             X. tropicalis  aa
B D                Coelacanth  aa
B D                      Fugu  -a
       Yellowbelly pufferfish  -a
B D               Stickleback  -c
B D                 Zebrafish  ac
             Star-nosed mole  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                     Sheep  --
            Tibetan antelope  --
          Chinese tree shrew  --
B D                  Elephant  --
B D                       Cow  --
              Pacific walrus  --
B D                     Panda  --
               Domestic goat  --
                Killer whale  ==
B D                       Pig  --
B D                      Pika  --
B D                       Dog  --
B D                       Cat  --
B D                   Ferret   --
B D                   Dolphin  ==
                Weddell seal  --
B D              Atlantic cod  ==
                 Spotted gar  --
          Southern platyfish  --
B D                 Tetraodon  --
    Mexican tetra (cavefish)  ==
B D                    Medaka  --
         Pundamilia nyererei  ==
                 Zebra mbuna  --
       Burton's mouthbreeder  --
         Princess of Burundi  ==
B D              Nile tilapia  --
  D            Painted turtle  ==

Inserts between block 6 and 7 in window
B D                   Alpaca 4bp
              Bactrian camel 4bp
            Black flying-fox 2bp
B D                  Megabat 2bp
B D       American alligator 2656bp
  D          Green seaturtle 1526bp
  D Chinese softshell turtle 2401bp
B D                   Lizard 2bp

Alignment block 7 of 78 in window, 3676159 - 3676159, 1 bps 
B D                     Human  a
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  a
B D           Squirrel monkey  g
B D                  Bushbaby  g
B D                  Squirrel  a
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  a
             Brush-tailed rat  g
B D                    Rabbit  a
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  a
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  a
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  g
B D                  Platypus  g
  D               Rock pigeon  a
  D              Saker falcon  a
  D          Peregrine falcon  a
  D       Collared flycatcher  a
  D    White-throated sparrow  a
B D       Medium ground finch  a
B D               Zebra finch  a
           Tibetan ground jay  a
B D                Budgerigar  a
  D                    Parrot  a
  D             Scarlet macaw  a
  D              Mallard duck  a
B D                   Chicken  a
B D                    Turkey  a
B D                    Lizard  a
B D             X. tropicalis  a
B D                Coelacanth  a
B D                      Fugu  a
       Yellowbelly pufferfish  a
B D               Stickleback  a
B D                 Zebrafish  a
                  Spotted gar  g
             Star-nosed mole  =
B D                     Shrew  =
          Chinese tree shrew  -
               Big brown bat  -
B D                      Pika  -
B D              Atlantic cod  =
          Southern platyfish  -
B D                 Tetraodon  -
    Mexican tetra (cavefish)  =
B D                    Medaka  -
         Pundamilia nyererei  =
                 Zebra mbuna  -
       Burton's mouthbreeder  -
         Princess of Burundi  =
B D              Nile tilapia  -
  D            Painted turtle  =
B D        American alligator  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =

Inserts between block 7 and 8 in window
B D                     Fugu 1bp
      Yellowbelly pufferfish 1bp
B D              Stickleback 1bp
B D                Zebrafish 2880bp
                 Spotted gar 2bp

Alignment block 8 of 78 in window, 3676160 - 3676161, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  aa
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  gg
           Chinese tree shrew  -g
B D                  Squirrel  ga
       Lesser Egyptian jerboa  ag
                 Prairie vole  aa
B D           Chinese hamster  ga
               Golden hamster  ga
B D                     Mouse  ga
B D                       Rat  ga
B D            Naked mole-rat  gg
B D                Guinea pig  ga
                   Chinchilla  ga
             Brush-tailed rat  ga
B D                    Rabbit  ga
B D                       Pig  ca
B D                    Alpaca  gg
               Bactrian camel  gg
B D                   Dolphin  gg
                 Killer whale  gg
             Tibetan antelope  gg
B D                       Cow  gg
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   gg
B D                     Panda  gg
               Pacific walrus  gg
                 Weddell seal  gg
             Black flying-fox  ga
B D                   Megabat  ga
                Big brown bat  -g
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                  Hedgehog  ga
B D                  Elephant  ag
          Cape elephant shrew  ga
B D                   Manatee  ga
             Cape golden mole  tg
B D                    Tenrec  ag
                     Aardvark  cg
B D                 Armadillo  ga
B D                   Opossum  gg
B D           Tasmanian devil  gg
B D                  Platypus  aa
  D               Rock pigeon  ca
  D              Saker falcon  ca
  D          Peregrine falcon  ca
  D       Collared flycatcher  aa
  D    White-throated sparrow  ca
B D       Medium ground finch  ca
B D               Zebra finch  ca
           Tibetan ground jay  ca
B D                Budgerigar  ca
  D                    Parrot  ca
  D             Scarlet macaw  ca
  D              Mallard duck  ca
B D                   Chicken  ca
B D                    Turkey  ca
B D                    Lizard  ca
B D             X. tropicalis  gg
B D                Coelacanth  ta
B D                      Fugu  ga
       Yellowbelly pufferfish  ga
B D                    Medaka  -a
           Southern platyfish  -a
B D               Stickleback  ga
                  Spotted gar  ga
             Star-nosed mole  ==
B D                     Shrew  ==
B D                      Pika  --
B D              Atlantic cod  ==
B D                 Tetraodon  --
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  --
       Burton's mouthbreeder  --
         Princess of Burundi  ==
B D              Nile tilapia  --
  D            Painted turtle  ==
B D        American alligator  ==
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==

Inserts between block 8 and 9 in window
B D                     Fugu 45bp
      Yellowbelly pufferfish 45bp
          Southern platyfish 5bp
                 Spotted gar 1bp

Alignment block 9 of 78 in window, 3676162 - 3676162, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  g
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  g
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                  Platypus  a
  D               Rock pigeon  g
  D              Saker falcon  g
  D          Peregrine falcon  g
  D       Collared flycatcher  a
  D    White-throated sparrow  a
B D       Medium ground finch  a
B D               Zebra finch  a
           Tibetan ground jay  a
B D                Budgerigar  g
  D                    Parrot  g
  D             Scarlet macaw  g
  D              Mallard duck  g
B D                   Chicken  g
B D                    Turkey  g
B D                    Lizard  a
B D             X. tropicalis  a
B D                Coelacanth  a
B D                 Tetraodon  a
          Princess of Burundi  a
          Pundamilia nyererei  a
           Southern platyfish  a
B D               Stickleback  a
                  Spotted gar  a
             Star-nosed mole  =
B D                     Shrew  =
B D                      Pika  -
B D              Atlantic cod  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D           Tasmanian devil  -
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  -
                 Zebra mbuna  -
       Burton's mouthbreeder  -
B D              Nile tilapia  -
  D            Painted turtle  =
B D        American alligator  =
B D                   Opossum  -
  D           Green seaturtle  =
  D  Chinese softshell turtle  =

Inserts between block 9 and 10 in window
B D                      Pig 3bp
B D                   Alpaca 1bp
              Bactrian camel 253bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                Tetraodon 1bp
         Princess of Burundi 1bp
         Pundamilia nyererei 1bp
          Southern platyfish 59bp
B D              Stickleback 1bp

Alignment block 10 of 78 in window, 3676163 - 3676163, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                       Pig  g
B D                    Alpaca  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  a
B D                 Armadillo  a
B D                   Opossum  a
B D           Tasmanian devil  a
B D                  Platypus  a
  D               Rock pigeon  a
  D              Saker falcon  a
  D          Peregrine falcon  a
  D       Collared flycatcher  a
  D    White-throated sparrow  a
B D       Medium ground finch  a
B D               Zebra finch  a
           Tibetan ground jay  a
B D                Budgerigar  a
  D                    Parrot  a
  D             Scarlet macaw  a
  D              Mallard duck  a
B D                   Chicken  a
B D                    Turkey  a
B D                    Lizard  g
B D             X. tropicalis  a
B D                Coelacanth  a
             Star-nosed mole  =
B D                     Shrew  =
              Bactrian camel  =
B D                      Pika  -
B D              Atlantic cod  =
                 Spotted gar  -
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  -
         Pundamilia nyererei  =
                 Zebra mbuna  -
       Burton's mouthbreeder  -
         Princess of Burundi  =
B D              Nile tilapia  -
  D            Painted turtle  =
B D        American alligator  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =

Inserts between block 10 and 11 in window
B D                   Alpaca 2bp
B D                   Lizard 499bp

Alignment block 11 of 78 in window, 3676164 - 3676164, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  a
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                       Pig  g
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  a
B D                  Elephant  a
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  a
B D                    Tenrec  g
                     Aardvark  a
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  a
B D                  Platypus  a
  D               Rock pigeon  c
  D              Saker falcon  c
  D          Peregrine falcon  c
  D       Collared flycatcher  a
  D    White-throated sparrow  c
B D       Medium ground finch  c
B D               Zebra finch  t
           Tibetan ground jay  c
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
  D              Mallard duck  a
B D                   Chicken  a
B D                    Turkey  a
B D             X. tropicalis  a
B D                Coelacanth  t
B D                 Tetraodon  g
          Princess of Burundi  g
          Pundamilia nyererei  g
B D                    Medaka  a
B D               Stickleback  g
                  Spotted gar  a
             Star-nosed mole  =
B D                     Shrew  =
              Bactrian camel  =
B D                    Alpaca  =
B D                      Pika  -
B D              Atlantic cod  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
                 Zebra mbuna  -
       Burton's mouthbreeder  -
B D              Nile tilapia  -
  D            Painted turtle  =
B D        American alligator  =
B D                    Lizard  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =

Inserts between block 11 and 12 in window
B D                      Pig 2bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 7bp
B D                      Cow 307bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D            X. tropicalis 2bp
         Princess of Burundi 37bp
B D              Stickleback 646bp

Alignment block 12 of 78 in window, 3676165 - 3676165, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  a
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  t
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  g
B D                       Pig  g
B D                    Alpaca  a
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  a
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  a
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  c
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  a
B D           Tasmanian devil  a
B D                  Platypus  a
  D               Rock pigeon  c
  D              Saker falcon  a
  D          Peregrine falcon  c
  D       Collared flycatcher  a
  D    White-throated sparrow  a
B D       Medium ground finch  a
B D               Zebra finch  g
           Tibetan ground jay  a
B D                Budgerigar  t
  D                    Parrot  c
  D             Scarlet macaw  c
  D              Mallard duck  g
B D                   Chicken  c
B D                    Turkey  c
B D                Coelacanth  a
B D                 Tetraodon  g
B D                    Medaka  c
             Star-nosed mole  =
B D                     Shrew  =
B D                       Cow  =
              Bactrian camel  =
B D                      Pika  -
B D              Atlantic cod  =
                 Spotted gar  -
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
         Pundamilia nyererei  -
                 Zebra mbuna  -
       Burton's mouthbreeder  -
         Princess of Burundi  =
B D              Nile tilapia  -
B D             X. tropicalis  =
  D            Painted turtle  =
B D        American alligator  =
B D                    Lizard  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =

Inserts between block 12 and 13 in window
B D                 Hedgehog 372bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 2bp
B D                Armadillo 1bp
B D          Tasmanian devil 1bp
B D                 Platypus 1bp
  D              Rock pigeon 2bp
  D             Saker falcon 2bp
  D         Peregrine falcon 2bp
  D      Collared flycatcher 4bp
  D   White-throated sparrow 2bp
B D      Medium ground finch 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 2bp
B D               Budgerigar 2bp
  D                   Parrot 2bp
  D            Scarlet macaw 2bp
  D             Mallard duck 2bp
B D                  Chicken 2bp
B D                   Turkey 2bp
B D               Coelacanth 1bp

Alignment block 13 of 78 in window, 3676166 - 3676167, 2 bps 
B D                     Human  aa-
B D                     Chimp  aa-
B D                   Gorilla  aa-
B D                 Orangutan  aa-
B D                    Gibbon  aa-
B D                    Rhesus  aa-
B D       Crab-eating macaque  aa-
B D                    Baboon  aa-
B D              Green monkey  aa-
B D                  Marmoset  aa-
B D           Squirrel monkey  aa-
B D                  Bushbaby  aa-
           Chinese tree shrew  ga-
B D                  Squirrel  a--
       Lesser Egyptian jerboa  c--
                 Prairie vole  a--
B D           Chinese hamster  a--
               Golden hamster  a--
B D                     Mouse  a--
B D                       Rat  a--
B D            Naked mole-rat  at-
B D                Guinea pig  ac-
                   Chinchilla  ac-
             Brush-tailed rat  ac-
B D                    Rabbit  c--
B D                   Dolphin  a--
                 Killer whale  a--
             Tibetan antelope  a--
B D                     Sheep  g--
                Domestic goat  g--
B D                     Horse  a--
B D          White rhinoceros  a--
B D                       Cat  a--
B D                       Dog  a--
B D                   Ferret   a--
B D                     Panda  a--
               Pacific walrus  a--
                 Weddell seal  a--
             Black flying-fox  a--
B D                   Megabat  a--
                Big brown bat  a--
         David's myotis (bat)  a--
B D                  Microbat  a--
B D                  Elephant  a--
          Cape elephant shrew  a--
B D                   Manatee  a--
             Cape golden mole  a--
B D                    Tenrec  a--
                     Aardvark  a--
B D                 Armadillo  g--
B D           Tasmanian devil  a--
B D                  Platypus  a--
B D             X. tropicalis  g--
B D                Coelacanth  a--
B D                 Tetraodon  -ga
B D                    Medaka  -aa
             Star-nosed mole  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                       Cow  ===
              Bactrian camel  ===
B D                    Alpaca  ---
B D                       Pig  ---
B D                      Pika  ---
B D              Atlantic cod  ===
                 Spotted gar  ---
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
         Pundamilia nyererei  ---
                 Zebra mbuna  ---
       Burton's mouthbreeder  ---
         Princess of Burundi  ===
B D              Nile tilapia  ---
  D            Painted turtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ---
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
  D           Green seaturtle  ===
  D  Chinese softshell turtle  ===

Inserts between block 13 and 14 in window
B D                  Dolphin 581bp
                Killer whale 581bp
            Tibetan antelope 322bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D          Tasmanian devil 23798bp
B D               Coelacanth 1bp

Alignment block 14 of 78 in window, 3676168 - 3676168, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -g
B D           Squirrel monkey  -g
B D                  Bushbaby  -a
           Chinese tree shrew  -g
B D                  Squirrel  -a
       Lesser Egyptian jerboa  -a
                 Prairie vole  -a
B D           Chinese hamster  -a
               Golden hamster  -a
B D                     Mouse  -a
B D                       Rat  -a
B D            Naked mole-rat  -c
B D                Guinea pig  -c
                   Chinchilla  -c
             Brush-tailed rat  -c
B D                       Pig  -a
B D                    Alpaca  -a
B D                     Sheep  -a
                Domestic goat  -a
B D                     Horse  -a
B D          White rhinoceros  -a
B D                       Cat  -a
B D                       Dog  -g
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
                 Weddell seal  -a
             Black flying-fox  -a
B D                   Megabat  -a
                Big brown bat  -g
         David's myotis (bat)  -g
B D                  Microbat  -g
B D                  Elephant  -a
          Cape elephant shrew  -a
B D                   Manatee  -a
             Cape golden mole  -g
B D                    Tenrec  -a
                     Aardvark  -a
B D                 Armadillo  -g
B D                   Opossum  -a
B D                  Platypus  -a
  D               Rock pigeon  -a
  D              Saker falcon  -g
  D          Peregrine falcon  -g
  D       Collared flycatcher  -g
  D    White-throated sparrow  -g
B D       Medium ground finch  -g
B D               Zebra finch  -g
           Tibetan ground jay  -g
B D                Budgerigar  -g
  D                    Parrot  -g
  D             Scarlet macaw  -g
  D              Mallard duck  -a
B D                   Chicken  -a
B D                    Turkey  -a
B D             X. tropicalis  -a
B D                 Tetraodon  c-
B D                    Medaka  c-
             Star-nosed mole  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
            Tibetan antelope  ==
B D                       Cow  ==
                Killer whale  ==
              Bactrian camel  ==
B D                    Rabbit  --
B D                      Pika  --
B D                   Dolphin  ==
B D                Coelacanth  ==
B D              Atlantic cod  ==
                 Spotted gar  --
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
         Pundamilia nyererei  --
                 Zebra mbuna  --
       Burton's mouthbreeder  --
         Princess of Burundi  ==
B D              Nile tilapia  --
  D            Painted turtle  ==
B D        American alligator  ==
B D                    Lizard  ==
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==

Inserts between block 14 and 15 in window
B D                   Alpaca 247bp

Alignment block 15 of 78 in window, 3676169 - 3676172, 4 bps 
B D                     Human  agcc
B D                     Chimp  agcc
B D                   Gorilla  agcc
B D                 Orangutan  agcc
B D                    Gibbon  agcc
B D                    Rhesus  agcc
B D       Crab-eating macaque  agcc
B D                    Baboon  agcc
B D              Green monkey  agcc
B D                  Marmoset  agcc
B D           Squirrel monkey  aacc
B D                  Bushbaby  agcc
           Chinese tree shrew  ggcg
B D                  Squirrel  ggca
       Lesser Egyptian jerboa  agcc
                 Prairie vole  gatc
B D           Chinese hamster  agtt
               Golden hamster  agtt
B D                     Mouse  agcc
B D                       Rat  accc
B D            Naked mole-rat  agcc
B D                Guinea pig  agcc
                   Chinchilla  agcc
             Brush-tailed rat  agcc
B D                    Rabbit  -gcc
B D                      Pika  --cc
B D                       Pig  ---g
B D                     Sheep  agtg
                Domestic goat  agtg
B D                     Horse  agcc
B D          White rhinoceros  agcc
B D                       Cat  agcc
B D                       Dog  agtg
B D                   Ferret   agcc
B D                     Panda  agcc
               Pacific walrus  agcc
                 Weddell seal  agcc
             Black flying-fox  agcc
B D                   Megabat  agcc
                Big brown bat  agcc
         David's myotis (bat)  agcc
B D                  Microbat  agcc
B D                  Elephant  ggcc
          Cape elephant shrew  ggcc
B D                   Manatee  ggcc
             Cape golden mole  gaga
B D                    Tenrec  ggct
                     Aardvark  ggcc
B D                 Armadillo  ggcc
B D                   Opossum  a---
B D                  Platypus  --cc
  D               Rock pigeon  tgtc
  D              Saker falcon  tgtc
  D          Peregrine falcon  tgtc
  D       Collared flycatcher  agtc
  D    White-throated sparrow  tgtc
B D       Medium ground finch  tgtc
B D               Zebra finch  tgtc
           Tibetan ground jay  tgtc
B D                Budgerigar  tgtc
  D                    Parrot  tgtc
  D             Scarlet macaw  tgtc
  D              Mallard duck  agtc
B D                   Chicken  tgtc
B D                    Turkey  tgtc
B D                Coelacanth  agca
B D                 Tetraodon  agcc
B D                    Medaka  atca
                  Spotted gar  --ga
             Star-nosed mole  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
            Tibetan antelope  ====
B D                       Cow  ====
                Killer whale  ====
              Bactrian camel  ====
B D                    Alpaca  ====
B D                   Dolphin  ====
B D              Atlantic cod  ====
B D               Stickleback  ====
          Southern platyfish  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
         Pundamilia nyererei  ----
                 Zebra mbuna  ----
       Burton's mouthbreeder  ----
         Princess of Burundi  ====
B D              Nile tilapia  ----
B D             X. tropicalis  ----
  D            Painted turtle  ====
B D        American alligator  ====
B D                    Lizard  ====
  D           Green seaturtle  ====
  D  Chinese softshell turtle  ====

Inserts between block 15 and 16 in window
B D                      Pig 410bp
B D                 Platypus 2bp

Alignment block 16 of 78 in window, 3676173 - 3676173, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Elephant  a
          Cape elephant shrew  c
B D                   Manatee  a
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  a
B D                 Armadillo  g
B D                  Platypus  a
  D               Rock pigeon  a
  D              Saker falcon  a
  D          Peregrine falcon  a
  D       Collared flycatcher  a
  D    White-throated sparrow  a
B D       Medium ground finch  a
B D               Zebra finch  a
           Tibetan ground jay  a
B D                Budgerigar  a
  D                    Parrot  a
  D             Scarlet macaw  a
  D              Mallard duck  a
B D                   Chicken  a
B D                    Turkey  a
B D                Coelacanth  a
B D                 Tetraodon  a
B D                    Medaka  a
                  Spotted gar  a
             Star-nosed mole  =
B D                  Hedgehog  =
B D                     Shrew  =
            Tibetan antelope  =
B D                       Cow  =
                Killer whale  =
              Bactrian camel  =
B D                    Alpaca  =
B D                       Pig  =
B D                   Dolphin  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
         Pundamilia nyererei  -
                 Zebra mbuna  -
       Burton's mouthbreeder  -
         Princess of Burundi  =
B D              Nile tilapia  -
B D             X. tropicalis  -
  D            Painted turtle  =
B D        American alligator  =
B D                   Opossum  -
B D                    Lizard  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =

Inserts between block 16 and 17 in window
B D                 Squirrel 1bp
                    Aardvark 1444bp
B D               Coelacanth 3519bp

Alignment block 17 of 78 in window, 3676174 - 3676174, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  c
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  t
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  a
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
  D               Rock pigeon  g
  D              Saker falcon  g
  D          Peregrine falcon  g
  D       Collared flycatcher  g
  D    White-throated sparrow  g
B D       Medium ground finch  a
B D               Zebra finch  g
           Tibetan ground jay  g
B D                Budgerigar  t
  D                    Parrot  t
  D             Scarlet macaw  t
  D              Mallard duck  g
B D                   Chicken  g
B D                    Turkey  g
B D                 Tetraodon  g
B D                    Medaka  g
                  Spotted gar  g
             Star-nosed mole  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                 Armadillo  -
B D                    Tenrec  -
B D                  Squirrel  =
         Cape elephant shrew  -
B D                     Sheep  -
            Cape golden mole  -
            Tibetan antelope  =
B D                  Elephant  -
B D                       Cow  =
                Killer whale  =
              Bactrian camel  =
B D                    Alpaca  =
B D                       Pig  =
B D                       Dog  -
B D                   Dolphin  =
B D                Coelacanth  =
                    Aardvark  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
         Pundamilia nyererei  -
                 Zebra mbuna  -
       Burton's mouthbreeder  -
         Princess of Burundi  =
B D              Nile tilapia  -
B D             X. tropicalis  -
  D            Painted turtle  =
B D        American alligator  =
B D                   Opossum  -
B D                    Lizard  =
B D                   Manatee  -
  D           Green seaturtle  =
  D  Chinese softshell turtle  =

Inserts between block 17 and 18 in window
               Domestic goat 809bp

Alignment block 18 of 78 in window, 3676175 - 3676177, 3 bps 
B D                     Human  gtg--
B D                     Chimp  gtg--
B D                   Gorilla  gtg--
B D                 Orangutan  gtg--
B D                    Gibbon  gtg--
B D                    Rhesus  gtg--
B D       Crab-eating macaque  gtg--
B D                    Baboon  gtg--
B D              Green monkey  gtg--
B D                  Marmoset  ctg--
B D           Squirrel monkey  ctg--
B D                  Bushbaby  ttc--
           Chinese tree shrew  gag--
       Lesser Egyptian jerboa  ttc--
                 Prairie vole  ctc--
B D           Chinese hamster  ctc--
               Golden hamster  ctc--
B D                     Mouse  ttg--
B D                       Rat  ttc--
B D            Naked mole-rat  ttc--
B D                Guinea pig  ttc--
                   Chinchilla  ttc--
             Brush-tailed rat  ttc--
B D                    Rabbit  ggc--
B D                      Pika  gga--
B D                     Sheep  gtc--
B D                     Horse  tgc--
B D          White rhinoceros  tgc--
B D                       Cat  tcg--
B D                   Ferret   ctg--
B D                     Panda  ttg--
               Pacific walrus  ctg--
                 Weddell seal  cta--
             Black flying-fox  ttc--
B D                   Megabat  ttc--
                Big brown bat  ttc--
         David's myotis (bat)  ttc--
B D                  Microbat  ttc--
B D                  Elephant  --g--
          Cape elephant shrew  --g--
B D                   Manatee  --g--
             Cape golden mole  --g--
B D                    Tenrec  --g--
B D                 Armadillo  --g--
B D                   Opossum  atg--
  D               Rock pigeon  tc---
  D              Saker falcon  ct---
  D          Peregrine falcon  ct---
  D       Collared flycatcher  tt---
  D    White-throated sparrow  tt---
B D       Medium ground finch  tt---
B D               Zebra finch  tt---
           Tibetan ground jay  tt---
B D                Budgerigar  tt---
  D                    Parrot  tt---
  D             Scarlet macaw  tt---
  D              Mallard duck  ct---
B D                   Chicken  ct---
B D                    Turkey  cc---
B D                 Tetraodon  --gag
          Pundamilia nyererei  ----t
B D                    Medaka  --gca
                  Spotted gar  --gaa
             Star-nosed mole  =====
B D                  Hedgehog  =====
B D                     Shrew  =====
B D                  Squirrel  =====
            Tibetan antelope  =====
B D                       Cow  =====
               Domestic goat  =====
                Killer whale  =====
              Bactrian camel  =====
B D                    Alpaca  =====
B D                       Pig  =====
B D                       Dog  -----
B D                   Dolphin  =====
B D                Coelacanth  =====
                    Aardvark  =====
B D              Atlantic cod  =====
B D               Stickleback  =====
          Southern platyfish  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D           Tasmanian devil  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
                 Zebra mbuna  -----
       Burton's mouthbreeder  -----
         Princess of Burundi  =====
B D              Nile tilapia  -----
B D             X. tropicalis  -----
  D            Painted turtle  =====
B D        American alligator  =====
B D                    Lizard  =====
  D           Green seaturtle  =====
  D  Chinese softshell turtle  =====

Inserts between block 18 and 19 in window
B D                 Elephant 2bp
         Cape elephant shrew 2bp
B D                  Manatee 2bp
            Cape golden mole 6bp
B D                   Tenrec 409bp
B D                Armadillo 3bp

Alignment block 19 of 78 in window, 3676178 - 3676179, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ta
B D                    Gibbon  ga
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ca
           Chinese tree shrew  gt
       Lesser Egyptian jerboa  ta
                 Prairie vole  ca
B D           Chinese hamster  ca
               Golden hamster  ca
B D                     Mouse  ca
B D                       Rat  ca
B D            Naked mole-rat  ca
B D                Guinea pig  ca
                   Chinchilla  ca
             Brush-tailed rat  ca
B D                    Rabbit  cc
B D                      Pika  ga
B D                     Sheep  ca
B D                     Horse  ca
B D          White rhinoceros  ca
B D                       Cat  ca
B D                       Dog  ca
B D                   Ferret   ca
B D                     Panda  -a
               Pacific walrus  ca
                 Weddell seal  ca
             Black flying-fox  ca
B D                   Megabat  ca
                Big brown bat  c-
         David's myotis (bat)  cg
B D                  Microbat  cg
B D                  Elephant  ca
          Cape elephant shrew  ca
B D                   Manatee  ga
             Cape golden mole  ga
B D                 Armadillo  ca
B D                   Opossum  -a
B D             X. tropicalis  -g
B D                 Tetraodon  ga
          Pundamilia nyererei  ga
B D                    Medaka  ga
                  Spotted gar  ga
             Star-nosed mole  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                    Tenrec  ==
B D                  Squirrel  ==
            Tibetan antelope  ==
B D                       Cow  ==
               Domestic goat  ==
                Killer whale  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                       Pig  ==
B D                   Dolphin  ==
B D                Coelacanth  ==
                    Aardvark  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                    Turkey  --
B D                   Chicken  --
  D              Mallard duck  --
          Tibetan ground jay  --
B D               Zebra finch  --
  D    White-throated sparrow  --
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
                 Zebra mbuna  --
       Burton's mouthbreeder  --
         Princess of Burundi  ==
B D              Nile tilapia  --
  D            Painted turtle  ==
B D        American alligator  ==
  D             Scarlet macaw  --
B D                Budgerigar  --
  D               Rock pigeon  --
  D       Collared flycatcher  --
B D       Medium ground finch  --
B D                    Lizard  ==
  D          Peregrine falcon  --
  D              Saker falcon  --
  D                    Parrot  --
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==

Inserts between block 19 and 20 in window
            Cape golden mole 836bp
B D                  Opossum 1bp
B D            X. tropicalis 1bp

Alignment block 20 of 78 in window, 3676180 - 3676180, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -c
B D                    Gibbon  -t
B D                    Rhesus  -c
B D       Crab-eating macaque  -c
B D                    Baboon  -c
B D              Green monkey  -c
B D                  Marmoset  -c
B D           Squirrel monkey  -c
B D                  Bushbaby  -c
           Chinese tree shrew  -c
       Lesser Egyptian jerboa  -t
                 Prairie vole  -c
B D           Chinese hamster  -c
               Golden hamster  -c
B D                     Mouse  -t
B D                       Rat  -c
B D            Naked mole-rat  -c
B D                Guinea pig  -c
                   Chinchilla  -c
             Brush-tailed rat  -c
B D                    Rabbit  -c
B D                      Pika  -a
B D                     Sheep  -t
B D                     Horse  -c
B D          White rhinoceros  -c
B D                       Cat  -c
B D                       Dog  -c
B D                   Ferret   -c
B D                     Panda  -c
               Pacific walrus  -c
                 Weddell seal  -c
             Black flying-fox  -c
B D                   Megabat  -c
                Big brown bat  -c
         David's myotis (bat)  -c
B D                  Microbat  -c
B D                  Elephant  -c
          Cape elephant shrew  -c
B D                   Manatee  -c
B D                   Opossum  -t
  D               Rock pigeon  -t
  D              Saker falcon  -t
  D          Peregrine falcon  -t
  D       Collared flycatcher  -t
  D    White-throated sparrow  -t
B D       Medium ground finch  -t
B D               Zebra finch  -t
           Tibetan ground jay  -t
B D                Budgerigar  -t
  D                    Parrot  -t
  D             Scarlet macaw  -t
  D              Mallard duck  -t
B D                   Chicken  -t
B D                    Turkey  -t
B D             X. tropicalis  -t
B D                 Tetraodon  c-
B D                    Medaka  g-
                  Spotted gar  g-
             Star-nosed mole  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                 Armadillo  --
B D                    Tenrec  ==
B D                  Squirrel  ==
            Cape golden mole  ==
            Tibetan antelope  ==
B D                       Cow  ==
               Domestic goat  ==
                Killer whale  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                       Pig  ==
B D                   Dolphin  ==
B D                Coelacanth  ==
                    Aardvark  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
         Pundamilia nyererei  --
                 Zebra mbuna  --
       Burton's mouthbreeder  --
         Princess of Burundi  ==
B D              Nile tilapia  --
  D            Painted turtle  ==
B D        American alligator  ==
B D                    Lizard  ==
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==

Inserts between block 20 and 21 in window
      Lesser Egyptian jerboa 2bp
                Prairie vole 2bp
B D          Chinese hamster 2bp
              Golden hamster 2bp
B D                    Mouse 3902bp
B D                      Rat 2bp
B D           Naked mole-rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
B D                   Rabbit 2bp
B D                     Pika 2bp
B D                  Opossum 3bp

Alignment block 21 of 78 in window, 3676181 - 3676182, 2 bps 
B D                     Human  gt
B D                     Chimp  gt
B D                   Gorilla  gc
B D                 Orangutan  gt
B D                    Gibbon  gc
B D                    Rhesus  ac
B D       Crab-eating macaque  ac
B D                    Baboon  ac
B D              Green monkey  ac
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ac
           Chinese tree shrew  tg
B D                     Sheep  tc
B D                     Horse  ac
B D          White rhinoceros  ac
B D                       Cat  aa
B D                       Dog  ac
B D                   Ferret   ac
B D                     Panda  ac
               Pacific walrus  ac
                 Weddell seal  ac
             Black flying-fox  ac
B D                   Megabat  ac
                Big brown bat  ac
         David's myotis (bat)  ac
B D                  Microbat  ac
B D                  Elephant  ac
          Cape elephant shrew  ac
B D                   Manatee  gc
B D                   Opossum  at
B D                 Tetraodon  at
B D                    Medaka  gt
                  Spotted gar  gt
             Star-nosed mole  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                 Armadillo  --
B D                    Tenrec  ==
              Golden hamster  ==
                Prairie vole  ==
B D                  Squirrel  ==
B D                       Rat  ==
B D                     Mouse  ==
                  Chinchilla  ==
            Brush-tailed rat  ==
B D                Guinea pig  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
B D           Chinese hamster  ==
            Cape golden mole  ==
            Tibetan antelope  ==
B D                       Cow  ==
               Domestic goat  ==
                Killer whale  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                    Rabbit  ==
B D                       Pig  ==
B D                      Pika  ==
B D                   Dolphin  ==
B D                Coelacanth  ==
                    Aardvark  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                    Turkey  --
B D                   Chicken  --
  D              Mallard duck  --
          Tibetan ground jay  --
B D               Zebra finch  --
  D    White-throated sparrow  --
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
         Pundamilia nyererei  --
                 Zebra mbuna  --
       Burton's mouthbreeder  --
         Princess of Burundi  ==
B D              Nile tilapia  --
B D             X. tropicalis  --
  D            Painted turtle  ==
B D        American alligator  ==
  D             Scarlet macaw  --
B D                Budgerigar  --
  D               Rock pigeon  --
  D       Collared flycatcher  --
B D       Medium ground finch  --
B D                    Lizard  ==
  D          Peregrine falcon  --
  D              Saker falcon  --
  D                    Parrot  --
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==

Inserts between block 21 and 22 in window
B D                Tetraodon 29bp
                 Spotted gar 6bp

Alignment block 22 of 78 in window, 3676183 - 3676184, 2 bps 
B D                     Human  ga-
B D                     Chimp  ga-
B D                   Gorilla  ga-
B D                 Orangutan  gc-
B D                    Gibbon  ga-
B D                    Rhesus  ga-
B D       Crab-eating macaque  ga-
B D                    Baboon  ga-
B D              Green monkey  ga-
B D                  Marmoset  aa-
B D           Squirrel monkey  aa-
B D                  Bushbaby  at-
           Chinese tree shrew  cc-
B D                  Squirrel  gt-
       Lesser Egyptian jerboa  gt-
                 Prairie vole  cc-
B D           Chinese hamster  ct-
               Golden hamster  ct-
B D                       Rat  ct-
B D            Naked mole-rat  at-
B D                Guinea pig  at-
                   Chinchilla  gt-
             Brush-tailed rat  at-
B D                    Rabbit  gt-
B D                      Pika  gt-
B D                     Sheep  gt-
B D                     Horse  at-
B D          White rhinoceros  at-
B D                       Cat  ag-
B D                       Dog  ag-
B D                   Ferret   ag-
B D                     Panda  gg-
               Pacific walrus  ag-
                 Weddell seal  ag-
             Black flying-fox  at-
B D                   Megabat  at-
                Big brown bat  gt-
         David's myotis (bat)  gt-
B D                  Microbat  gt-
B D                  Elephant  at-
          Cape elephant shrew  ac-
B D                   Manatee  gt-
B D                   Opossum  at-
  D               Rock pigeon  -g-
  D              Saker falcon  -t-
  D          Peregrine falcon  -t-
  D       Collared flycatcher  -g-
  D    White-throated sparrow  -g-
B D       Medium ground finch  -c-
B D               Zebra finch  -g-
           Tibetan ground jay  -g-
B D                Budgerigar  -g-
  D                    Parrot  -g-
  D             Scarlet macaw  -g-
  D              Mallard duck  -g-
B D                   Chicken  -g-
B D                    Turkey  -g-
B D             X. tropicalis  at-
          Pundamilia nyererei  --a
B D                    Medaka  -ta
                  Spotted gar  --a
             Star-nosed mole  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                 Armadillo  ---
B D                    Tenrec  ===
B D                     Mouse  ===
            Cape golden mole  ===
            Tibetan antelope  ===
B D                       Cow  ===
               Domestic goat  ===
                Killer whale  ===
              Bactrian camel  ===
B D                    Alpaca  ===
B D                       Pig  ===
B D                   Dolphin  ===
B D                Coelacanth  ===
                    Aardvark  ===
B D              Atlantic cod  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                 Tetraodon  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
                 Zebra mbuna  ---
       Burton's mouthbreeder  ---
         Princess of Burundi  ===
B D              Nile tilapia  ---
  D            Painted turtle  ===
B D        American alligator  ===
B D                    Lizard  ===
  D           Green seaturtle  ===
  D  Chinese softshell turtle  ===

Inserts between block 22 and 23 in window
         Pundamilia nyererei 1bp
B D                   Medaka 152bp
                 Spotted gar 1bp

Alignment block 23 of 78 in window, 3676185 - 3676187, 3 bps 
B D                     Human  cac
B D                     Chimp  cac
B D                   Gorilla  cac
B D                 Orangutan  cac
B D                    Gibbon  cac
B D                    Rhesus  cac
B D       Crab-eating macaque  cac
B D                    Baboon  cac
B D              Green monkey  cac
B D                  Marmoset  tgc
B D           Squirrel monkey  cgc
B D                  Bushbaby  cgc
           Chinese tree shrew  cag
B D                  Squirrel  cat
       Lesser Egyptian jerboa  cac
                 Prairie vole  agc
B D           Chinese hamster  tgc
               Golden hamster  tgc
B D                       Rat  tgc
B D            Naked mole-rat  cac
B D                Guinea pig  tac
                   Chinchilla  cac
             Brush-tailed rat  ca-
B D                    Rabbit  cac
B D                      Pika  cac
B D                     Sheep  cag
B D                     Horse  cac
B D          White rhinoceros  cgc
B D                       Cat  caa
B D                       Dog  tga
B D                   Ferret   tga
B D                     Panda  tgg
               Pacific walrus  cga
                 Weddell seal  cga
             Black flying-fox  cac
B D                   Megabat  cac
                Big brown bat  cac
         David's myotis (bat)  tac
B D                  Microbat  tac
B D                  Elephant  tgc
          Cape elephant shrew  cac
B D                   Manatee  tac
B D                   Opossum  cag
  D               Rock pigeon  tgc
  D              Saker falcon  tac
  D          Peregrine falcon  tac
  D       Collared flycatcher  tga
  D    White-throated sparrow  tgc
B D       Medium ground finch  tgc
B D               Zebra finch  tgc
           Tibetan ground jay  tgc
B D                Budgerigar  tgc
  D                    Parrot  tgc
  D             Scarlet macaw  tgc
  D              Mallard duck  tgc
B D                   Chicken  tgc
B D                    Turkey  tgc
B D             X. tropicalis  tat
          Pundamilia nyererei  tat
             Star-nosed mole  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                 Armadillo  ---
B D                    Tenrec  ===
B D                     Mouse  ===
            Cape golden mole  ===
            Tibetan antelope  ===
B D                       Cow  ===
               Domestic goat  ===
                Killer whale  ===
              Bactrian camel  ===
B D                    Alpaca  ===
B D                       Pig  ===
B D                   Dolphin  ===
B D                Coelacanth  ===
                    Aardvark  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                 Tetraodon  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
                 Zebra mbuna  ---
       Burton's mouthbreeder  ---
         Princess of Burundi  ===
B D              Nile tilapia  ---
  D            Painted turtle  ===
B D        American alligator  ===
B D                    Lizard  ===
  D           Green seaturtle  ===
  D  Chinese softshell turtle  ===

Inserts between block 23 and 24 in window
  D              Rock pigeon 1bp
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
  D      Collared flycatcher 738bp
  D   White-throated sparrow 1bp
B D      Medium ground finch 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
  D             Mallard duck 1bp
B D                  Chicken 1bp
B D                   Turkey 1bp
B D            X. tropicalis 2bp

Alignment block 24 of 78 in window, 3676188 - 3676192, 5 bps 
B D                     Human  tg--gga--
B D                     Chimp  tg--gga--
B D                   Gorilla  tg--gga--
B D                 Orangutan  tg--gga--
B D                    Gibbon  tg--gga--
B D                    Rhesus  tg--gga--
B D       Crab-eating macaque  tg--gga--
B D                    Baboon  tg--gga--
B D              Green monkey  tg--gga--
B D                  Marmoset  tg--gga--
B D           Squirrel monkey  tg--gga--
B D                  Bushbaby  tgcttac--
           Chinese tree shrew  tg--gct--
B D                  Squirrel  tgtaggg--
       Lesser Egyptian jerboa  tgtcggc--
                 Prairie vole  tgggggt--
B D           Chinese hamster  tgcagac--
               Golden hamster  tgcagac--
B D                       Rat  tgtggcc--
B D            Naked mole-rat  taccta---
B D                Guinea pig  tacctac--
                   Chinchilla  tagctag--
             Brush-tailed rat  ---gcac--
B D                    Rabbit  tgctgcc--
B D                      Pika  tgctcac--
B D                     Sheep  ccc-tga--
B D                     Horse  tgc-tgc--
B D          White rhinoceros  tgc-tga--
B D                       Cat  agc-tga--
B D                       Dog  agc-cga--
B D                   Ferret   ggc-tga--
B D                     Panda  agc-tga--
               Pacific walrus  agc-tga--
                 Weddell seal  agc-tga--
             Black flying-fox  tgt-tga--
B D                   Megabat  tgt-tga--
                Big brown bat  cac-cga--
         David's myotis (bat)  tgc-tga--
B D                  Microbat  tac-cga--
B D                  Elephant  tgc-aca--
          Cape elephant shrew  tgc-cca--
B D                   Manatee  tgc-gca--
B D                 Armadillo  ----cct--
B D                   Opossum  ta-------
  D               Rock pigeon  ----tca--
  D              Saker falcon  ----tca--
  D          Peregrine falcon  ----tca--
  D    White-throated sparrow  ----tca--
B D       Medium ground finch  ----tca--
B D               Zebra finch  ----tca--
           Tibetan ground jay  ----tca--
B D                Budgerigar  ----tca--
  D                    Parrot  ----tca--
  D             Scarlet macaw  ----tca--
  D              Mallard duck  ----tca--
B D                   Chicken  ----tca--
B D                    Turkey  ----tca--
B D             X. tropicalis  ---ttta--
          Pundamilia nyererei  ----tgagg
                  Spotted gar  -----gagg
             Star-nosed mole  =========
B D                  Hedgehog  =========
B D                     Shrew  =========
B D                    Tenrec  =========
B D                     Mouse  =========
            Cape golden mole  =========
            Tibetan antelope  =========
B D                       Cow  =========
               Domestic goat  =========
                Killer whale  =========
              Bactrian camel  =========
B D                    Alpaca  =========
B D                       Pig  =========
B D                   Dolphin  =========
B D                Coelacanth  =========
                    Aardvark  =========
B D              Atlantic cod  =========
B D               Stickleback  =========
          Southern platyfish  =========
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
B D                 Tetraodon  =========
B D           Tasmanian devil  =========
    Mexican tetra (cavefish)  =========
B D                 Zebrafish  =========
B D                    Medaka  =========
                 Zebra mbuna  ---------
       Burton's mouthbreeder  ---------
         Princess of Burundi  =========
B D              Nile tilapia  ---------
  D            Painted turtle  =========
B D        American alligator  =========
  D       Collared flycatcher  =========
B D                    Lizard  =========
  D           Green seaturtle  =========
  D  Chinese softshell turtle  =========

Inserts between block 24 and 25 in window
B D                  Opossum 6998bp
  D              Rock pigeon 2bp
  D             Saker falcon 2bp
  D         Peregrine falcon 2bp
  D   White-throated sparrow 2bp
B D      Medium ground finch 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 2bp
B D               Budgerigar 2bp
  D                   Parrot 2bp
  D            Scarlet macaw 2bp
  D             Mallard duck 2bp
B D                  Chicken 2bp
B D                   Turkey 2bp
B D            X. tropicalis 1bp

Alignment block 25 of 78 in window, 3676193 - 3676209, 17 bps 
B D                     Human  --cataccctg-c-atgg------gac
B D                     Chimp  --cataccctg-c-atgg------gac
B D                   Gorilla  --cataccctg-c-atgg------gac
B D                 Orangutan  --cacactctg-c-atgg------gac
B D                    Gibbon  --catgtcctg-c-atgg------gac
B D                    Rhesus  --cacaccctg-c-gtgg------gac
B D       Crab-eating macaque  --cacaccctg-c-atgg------gac
B D                    Baboon  --cacgccctg-c-atgg------gac
B D              Green monkey  --cacaccctg-c-atgg------gac
B D                  Marmoset  --tgcctccca-a-gtgg------gac
B D           Squirrel monkey  --tgcctccca-a-atgg------gac
B D                  Bushbaby  --aaaatcctg-t-gtgg------cac
           Chinese tree shrew  --cgcacacc-----ttg------gcc
B D                  Squirrel  --caaa------g-gtag------ttg
       Lesser Egyptian jerboa  --caag---tg-t-gcag------aaa
                 Prairie vole  --cacatcctg-t-gtgg------cag
B D           Chinese hamster  --caagccctg-t-gtgg------cag
               Golden hamster  --caagccatg-t-gtag------cag
B D                       Rat  --caagccctg-t-gcag------ctg
B D            Naked mole-rat  --aaacccttg-t-atgg------taa
B D                Guinea pig  --aaacctttg-t-at-g------taa
                   Chinchilla  --agacttttg-t-atgg------taa
             Brush-tailed rat  --aaacctttg-t-ctgg------taa
B D                    Rabbit  --acactcgcc-t-gggg------gct
B D                      Pika  --acaacctcg-tggggg------gca
B D                     Sheep  --caaggcccg-t-gtgg------c--
B D                     Horse  --caaacccca-c-gcgg------cag
B D          White rhinoceros  --cagacccca-c-acgg------cag
B D                       Cat  --agagtcctc-c-a------------
B D                       Dog  --tggctccca-c-gccg------ccc
B D                   Ferret   --cgggtcctc-c-accg------cac
B D                     Panda  --cggctccta-c-gctg-------cc
               Pacific walrus  --caggtccta-c-actg------ccc
                 Weddell seal  --cgagtccta-c-gctg------ccc
             Black flying-fox  --caaagccta-t-atgg------cag
B D                   Megabat  --caaagccta-t-atgg------cag
                Big brown bat  --caaatccca-c-c--g------cag
         David's myotis (bat)  --caaacccca-c-ct-g------cag
B D                  Microbat  --caaacccca-c-cc-g------cag
B D                  Elephant  --caaaccctcga-gcag------cag
          Cape elephant shrew  --caaaccctc-a-gcag------tca
B D                   Manatee  --caaaccctc-g-gcag------caa
B D                 Armadillo  --caaatgccc-------------cga
B D                   Opossum  ----cgtcctg-c-ggga------gag
  D               Rock pigeon  --tacatccat-g-atgg------gac
  D              Saker falcon  --tacatccat-g-atga------gac
  D          Peregrine falcon  --tacatccat-g-atga------gac
  D    White-throated sparrow  --tacactcat-g-atag---------
B D       Medium ground finch  --tacactcat-g-atag---------
B D               Zebra finch  --tacactcat-g-atagcac------
           Tibetan ground jay  --tacacccat-g-atgg---gac---
B D                Budgerigar  --tacacctat-t-atag------gac
  D                    Parrot  --tacacccat-g-atag------gac
  D             Scarlet macaw  --tacacctat-g-atag------gac
  D              Mallard duck  --tacagccat-g-atga------gac
B D                   Chicken  --cacatccac-t-acag------gac
B D                    Turkey  --cacatctta-t-atgg------gac
B D             X. tropicalis  --catcccctt-c-atga------tc-
          Pundamilia nyererei  attacacttcg-g-att----------
                  Spotted gar  ggacaagtgtg-t-agg----------
             Star-nosed mole  ===========================
B D                  Hedgehog  ===========================
B D                     Shrew  ===========================
B D                    Tenrec  ===========================
B D                     Mouse  ===========================
            Cape golden mole  ===========================
            Tibetan antelope  ===========================
B D                       Cow  ===========================
               Domestic goat  ===========================
                Killer whale  ===========================
              Bactrian camel  ===========================
B D                    Alpaca  ===========================
B D                       Pig  ===========================
B D                   Dolphin  ===========================
B D                Coelacanth  ===========================
                    Aardvark  ===========================
B D              Atlantic cod  ===========================
B D               Stickleback  ===========================
          Southern platyfish  ===========================
      Yellowbelly pufferfish  ===========================
B D                      Fugu  ===========================
B D                 Tetraodon  ===========================
B D           Tasmanian devil  ===========================
    Mexican tetra (cavefish)  ===========================
B D                 Zebrafish  ===========================
B D                    Medaka  ===========================
                 Zebra mbuna  ---------------------------
       Burton's mouthbreeder  ---------------------------
         Princess of Burundi  ===========================
B D              Nile tilapia  ---------------------------
  D            Painted turtle  ===========================
B D        American alligator  ===========================
  D       Collared flycatcher  ===========================
B D                    Lizard  ===========================
  D           Green seaturtle  ===========================
  D  Chinese softshell turtle  ===========================

Inserts between block 25 and 26 in window
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
B D                Armadillo 1bp
  D              Rock pigeon 1bp
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
  D   White-throated sparrow 5bp
B D      Medium ground finch 5bp
B D              Zebra finch 735bp
          Tibetan ground jay 769bp
B D               Budgerigar 1107bp
  D                   Parrot 1bp
  D            Scarlet macaw 1105bp
  D             Mallard duck 1066bp
B D                  Chicken 1007bp
B D                   Turkey 22bp

Alignment block 26 of 78 in window, 3676210 - 3676222, 13 bps 
B D                     Human  tc---------cag-cggttc---c-c
B D                     Chimp  tc---------cag-cggttc---c-c
B D                   Gorilla  tc---------cag-tggttc---c-c
B D                 Orangutan  tc---------cag-cggttc---c-c
B D                    Gibbon  tc---------cag-cggttc---c-c
B D                    Rhesus  tc---------cag-cggttc---c-c
B D       Crab-eating macaque  tc---------cag-cggttc---c-c
B D                    Baboon  tc---------cag-cggttc---c-c
B D              Green monkey  tc---------cag-cggttc---c-c
B D                  Marmoset  tc---------cag-tggttc---c-c
B D           Squirrel monkey  tc---------cag-tggttc---c-c
B D                  Bushbaby  ac---------tggtcagttt---g-c
           Chinese tree shrew  gg---------cag-ctgttg---c-c
       Lesser Egyptian jerboa  tt---------cag-tcactt-tct-t
                 Prairie vole  cc---------caa-tcactc-cct--
B D           Chinese hamster  tt---------caa-ttacac-cct-t
               Golden hamster  tt---------caa-ttac-------t
B D                       Rat  ct---------caa-ccgctt-ccg-t
B D            Naked mole-rat  tc---------cag-tgctat-tgt-t
B D                Guinea pig  tc---------tag-t-tta----c-t
                   Chinchilla  tc---------cag-tccta----c-t
             Brush-tailed rat  tc---------cag-tccta----t-t
B D                    Rabbit  cc---------ctg-ccacttcccc-t
B D                      Pika  cc---------cag-ccgctttccc-t
B D                     Sheep  -----------------------cc-c
B D                     Horse  tg---------cag-tcactcttcctt
B D          White rhinoceros  tg---------cat-tcactgttcctt
B D                       Cat  -----------------------cc-t
B D                       Dog  tc---------cgg-tcactcctcc-t
B D                   Ferret   tc---------cag-tcactcttcc-t
B D                     Panda  tc---------cag-tcactcttcc-t
               Pacific walrus  tc---------cag-tcacccttcc-t
                 Weddell seal  tc---------cag-tcacccttcc-t
             Black flying-fox  tt---------cag-tcactctttctt
B D                   Megabat  tt---------cag-tcactctttctt
                Big brown bat  -g---------cag-tgacgcccct--
         David's myotis (bat)  -t---------cag-tgactctccct-
B D                  Microbat  -t---------cag-tgacgctcct--
B D                  Elephant  cc---------tag-tcgctcttct-t
          Cape elephant shrew  tc-------tatag-tcacttcccc-t
B D                   Manatee  cc---------tag-tcactcttcc-t
B D                 Armadillo  ccatgtggtcacgg-ccactttcct-c
B D                   Opossum  ac---------ggg-cggcgtcagc-t
          Pundamilia nyererei  ---------cacag-cagccc------
                  Spotted gar  ---------tccag-cgtcct------
             Star-nosed mole  ===========================
B D                  Hedgehog  ===========================
B D                     Shrew  ===========================
B D                    Tenrec  ===========================
B D                  Squirrel  ---------------------------
B D                     Mouse  ===========================
            Cape golden mole  ===========================
            Tibetan antelope  ===========================
B D                       Cow  ===========================
               Domestic goat  ===========================
                Killer whale  ===========================
              Bactrian camel  ===========================
B D                    Alpaca  ===========================
B D                       Pig  ===========================
B D                   Dolphin  ===========================
B D                Coelacanth  ===========================
                    Aardvark  ===========================
B D              Atlantic cod  ===========================
B D               Stickleback  ===========================
          Southern platyfish  ===========================
      Yellowbelly pufferfish  ===========================
B D                      Fugu  ===========================
B D                 Tetraodon  ===========================
B D                    Turkey  ===========================
B D                   Chicken  ===========================
  D              Mallard duck  ===========================
          Tibetan ground jay  ===========================
B D               Zebra finch  ===========================
  D    White-throated sparrow  ===========================
B D           Tasmanian devil  ===========================
    Mexican tetra (cavefish)  ===========================
B D                 Zebrafish  ===========================
B D                    Medaka  ===========================
                 Zebra mbuna  ---------------------------
       Burton's mouthbreeder  ---------------------------
         Princess of Burundi  ===========================
B D              Nile tilapia  ---------------------------
B D             X. tropicalis  ---------------------------
  D            Painted turtle  ===========================
B D        American alligator  ===========================
  D             Scarlet macaw  ===========================
B D                Budgerigar  ===========================
  D               Rock pigeon  ===========================
  D       Collared flycatcher  ===========================
B D       Medium ground finch  ===========================
B D                    Lizard  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ===========================
  D                    Parrot  ===========================
  D           Green seaturtle  ===========================
  D  Chinese softshell turtle  ===========================

Inserts between block 26 and 27 in window
B D                  Manatee 1bp
         Pundamilia nyererei 2bp

Alignment block 27 of 78 in window, 3676223 - 3676238, 16 bps 
B D                     Human  g-------agg-gtttcata-----ggca
B D                     Chimp  g-------agg-gtttcaca-----ggca
B D                   Gorilla  g-------agg-gtttcaca-----ggca
B D                 Orangutan  a-------agg-gtttcaca-----ggca
B D                    Gibbon  g-------agg-gtttcaca-----ggca
B D                    Rhesus  t-------agg-gtttcaca-----ggca
B D       Crab-eating macaque  t-------agg-gtttcaca-----ggca
B D                    Baboon  t-------agg-gtttcaca-----ggca
B D              Green monkey  t-------aga-gtttcaca-----ggca
B D                  Marmoset  t-------atg-gtttcaca-----ggca
B D           Squirrel monkey  t-------atg-gttttaca-----ggca
B D                  Bushbaby  ------------atttaacacc---agca
           Chinese tree shrew  tttcctgcagc-ctggcttg-----ggcg
B D                  Squirrel  ------------ctttcctg-----agca
       Lesser Egyptian jerboa  g-------gca-ttttcaca-----agca
                 Prairie vole  ---------aa-tattcaaa-----agtg
B D           Chinese hamster  g-------ggatttttcaca-----agtg
               Golden hamster  g-------gga-ttttcaca-----agtt
B D                       Rat  g-------ggg-ttttcaca-----agag
B D            Naked mole-rat  g-------gaa-ttttccca-----aggt
B D                Guinea pig  g-------gaa-ttttccca-----agat
                   Chinchilla  g-------gaa-ttttctca-----aggc
             Brush-tailed rat  g-------gaa-ttttccca-----aggc
B D                    Rabbit  c-------agg-accccaca-----ggca
B D                      Pika  c-------ggg-atcccaca-----agca
B D                     Sheep  a-------gga-ctcgaataga---aagg
B D                     Horse  g-------gga-ttttcaca-----agca
B D          White rhinoceros  g-------gga-ttttcaca-----agca
B D                       Cat  g-------gga-ccgtcg-----------
B D                       Dog  g-------gga-ctgtggca-----agcg
B D                   Ferret   g-------gga-ctgtcgca-----agca
B D                     Panda  g-------gga-ctgtcgca-----agca
               Pacific walrus  a-------gga-ctgtcgca-----agca
                 Weddell seal  a-------gga-ctgtcgca-----agca
             Black flying-fox  g-------gga-ttttcaca-----ggca
B D                   Megabat  g-------gga-ttttcaca-----ggca
                Big brown bat  --------ggg-ttttcaca------gca
         David's myotis (bat)  --------ggg-ttttcaca------gca
B D                  Microbat  ---------gg-gtttcata------gca
B D                  Elephant  g-------gga-tttccaaa-----ggca
          Cape elephant shrew  --------caa-cttccaaa-----ttca
B D                   Manatee  g-------gga-tttccaaa-----ggca
B D                 Armadillo  --------gtg-tttccaga-----agca
B D                   Opossum  c-------ggg--------a-----ggaa
  D               Rock pigeon  ---ttaaaata-ttttatta-----aact
  D              Saker falcon  ---taaaaagg-ttttatta-----aact
  D          Peregrine falcon  ---taaaaagg-ttttatta-----aact
  D    White-throated sparrow  ---agaaactg-ttc----------aact
B D       Medium ground finch  ---agaaattg-ttc----------aact
  D                    Parrot  ---taaaaccg-ttttatta-----aatt
B D                    Turkey  ----cacaacg-cttcagcaccaagagga
B D             X. tropicalis  ----tgcagcc-cttaccca-----agga
                  Spotted gar  ------gcagg-ctggca-----------
             Star-nosed mole  =============================
B D                  Hedgehog  =============================
B D                     Shrew  =============================
B D                    Tenrec  =============================
B D                     Mouse  =============================
            Cape golden mole  =============================
            Tibetan antelope  =============================
B D                       Cow  =============================
               Domestic goat  =============================
                Killer whale  =============================
              Bactrian camel  =============================
B D                    Alpaca  =============================
B D                       Pig  =============================
B D                   Dolphin  =============================
B D                Coelacanth  =============================
                    Aardvark  =============================
B D              Atlantic cod  =============================
B D               Stickleback  =============================
          Southern platyfish  =============================
      Yellowbelly pufferfish  =============================
B D                      Fugu  =============================
B D                 Tetraodon  =============================
B D                   Chicken  =============================
  D              Mallard duck  =============================
          Tibetan ground jay  =============================
B D               Zebra finch  =============================
B D           Tasmanian devil  =============================
    Mexican tetra (cavefish)  =============================
B D                 Zebrafish  =============================
B D                    Medaka  =============================
         Pundamilia nyererei  =============================
                 Zebra mbuna  -----------------------------
       Burton's mouthbreeder  -----------------------------
         Princess of Burundi  =============================
B D              Nile tilapia  -----------------------------
  D            Painted turtle  =============================
B D        American alligator  =============================
  D             Scarlet macaw  =============================
B D                Budgerigar  =============================
  D       Collared flycatcher  =============================
B D                    Lizard  =============================
  D           Green seaturtle  =============================
  D  Chinese softshell turtle  =============================

Inserts between block 27 and 28 in window
B D            X. tropicalis 87bp

Alignment block 28 of 78 in window, 3676239 - 3676245, 7 bps 
B D                     Human  g-agccc----------a-------
B D                     Chimp  g-agccc----------a-------
B D                   Gorilla  g-agccc----------a-------
B D                 Orangutan  g-agccc----------a-------
B D                    Gibbon  g-agccc----------a-------
B D                    Rhesus  g-agccc----------a-------
B D       Crab-eating macaque  g-agccc----------a-------
B D                    Baboon  g-agccc----------a-------
B D              Green monkey  g-agccc----------a-------
B D                  Marmoset  g-agccc----------a-------
B D           Squirrel monkey  g-agccc----------a-------
B D                  Bushbaby  g-agccc----------c-------
           Chinese tree shrew  g-gaccc----------a-------
B D                  Squirrel  g-agccc----------a-------
       Lesser Egyptian jerboa  g-agccc----------a-------
                 Prairie vole  g-aacac----------a-------
B D           Chinese hamster  g-agccc----------a-------
               Golden hamster  g-agccc----------a-------
B D                       Rat  a-agccc----------a-------
B D            Naked mole-rat  ggaatac----------a-------
B D                Guinea pig  a-catgc----------a-------
                   Chinchilla  accatgc----------a-------
             Brush-tailed rat  atcatgg----------a-------
B D                    Rabbit  g-a----------------------
B D                      Pika  g-a----------------------
B D                     Sheep  g-agcca----------g-------
B D                     Horse  g-agccc----------a-------
B D          White rhinoceros  g-agccc----------a-------
B D                       Cat  a-tgccc----------a-------
B D                       Dog  g-ggccc----------a-------
B D                   Ferret   g-ggccc----------a-------
B D                     Panda  g-ggccc----------a-------
               Pacific walrus  g-agccc----------a-------
                 Weddell seal  g-agccc----------a-------
             Black flying-fox  g-agcccaacagtttgaa-------
B D                   Megabat  g-agcccaacagtttgaa-------
                Big brown bat  g-agccc------------------
         David's myotis (bat)  g-agccc----------a-------
B D                  Microbat  g-agccc----------a-------
B D                  Elephant  g-acccc----------a-------
          Cape elephant shrew  g-agccc----------a-------
B D                   Manatee  g-agccc----------a-------
B D                 Armadillo  g-agtcc----------a-------
B D                   Opossum  a-ggccg----------g-------
  D               Rock pigeon  a-agagc----------a-------
  D              Saker falcon  a-agagc----------a-------
  D          Peregrine falcon  a-agagc----------a-------
  D    White-throated sparrow  t-agagc----------a-------
B D       Medium ground finch  g-agagc----------a-------
  D                    Parrot  a-agagc----------a-------
B D                    Turkey  a-aaggc----------a-------
                  Spotted gar  g-tgcca----------agtgcgcc
             Star-nosed mole  =========================
B D                  Hedgehog  =========================
B D                     Shrew  =========================
B D                    Tenrec  =========================
B D                     Mouse  =========================
            Cape golden mole  =========================
            Tibetan antelope  =========================
B D                       Cow  =========================
               Domestic goat  =========================
                Killer whale  =========================
              Bactrian camel  =========================
B D                    Alpaca  =========================
B D                       Pig  =========================
B D                   Dolphin  =========================
B D                Coelacanth  =========================
                    Aardvark  =========================
B D              Atlantic cod  =========================
B D               Stickleback  =========================
          Southern platyfish  =========================
      Yellowbelly pufferfish  =========================
B D                      Fugu  =========================
B D                 Tetraodon  =========================
B D                   Chicken  =========================
  D              Mallard duck  =========================
          Tibetan ground jay  =========================
B D               Zebra finch  =========================
B D           Tasmanian devil  =========================
    Mexican tetra (cavefish)  =========================
B D                 Zebrafish  =========================
B D                    Medaka  =========================
         Pundamilia nyererei  =========================
                 Zebra mbuna  -------------------------
       Burton's mouthbreeder  -------------------------
         Princess of Burundi  =========================
B D              Nile tilapia  -------------------------
B D             X. tropicalis  =========================
  D            Painted turtle  =========================
B D        American alligator  =========================
  D             Scarlet macaw  =========================
B D                Budgerigar  =========================
  D       Collared flycatcher  =========================
B D                    Lizard  =========================
  D           Green seaturtle  =========================
  D  Chinese softshell turtle  =========================

Inserts between block 28 and 29 in window
B D          Chinese hamster 2766bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                  Opossum 1bp
  D              Rock pigeon 2bp
  D             Saker falcon 2bp
  D         Peregrine falcon 2bp
  D   White-throated sparrow 2bp
B D      Medium ground finch 2bp
  D                   Parrot 2bp
B D                   Turkey 2bp

Alignment block 29 of 78 in window, 3676246 - 3676248, 3 bps 
B D                     Human  aa-c
B D                     Chimp  aa-c
B D                   Gorilla  aacc
B D                 Orangutan  aacc
B D                    Gibbon  aacc
B D                    Rhesus  aacc
B D       Crab-eating macaque  aacc
B D                    Baboon  aacc
B D              Green monkey  aacc
B D                  Marmoset  aaac
B D           Squirrel monkey  aaac
B D                  Bushbaby  aacc
           Chinese tree shrew  aacc
B D                  Squirrel  ggc-
       Lesser Egyptian jerboa  agc-
                 Prairie vole  tac-
               Golden hamster  cac-
B D                       Rat  cac-
B D            Naked mole-rat  ag--
B D                Guinea pig  aa--
                   Chinchilla  ag--
             Brush-tailed rat  ag--
B D                     Sheep  agc-
B D                     Horse  aac-
B D          White rhinoceros  aac-
B D                       Cat  gaa-
B D                       Dog  aac-
B D                   Ferret   agc-
B D                     Panda  aac-
               Pacific walrus  cat-
                 Weddell seal  cat-
             Black flying-fox  agc-
B D                   Megabat  agc-
                Big brown bat  -gc-
         David's myotis (bat)  agc-
B D                  Microbat  agc-
B D                  Elephant  ---c
          Cape elephant shrew  ---c
B D                   Manatee  ---c
B D                 Armadillo  ---a
B D                   Opossum  gg--
  D               Rock pigeon  cac-
  D              Saker falcon  cac-
  D          Peregrine falcon  cac-
  D    White-throated sparrow  cac-
B D       Medium ground finch  cac-
  D                    Parrot  aac-
B D                    Turkey  aac-
                  Spotted gar  agc-
             Star-nosed mole  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
B D                    Tenrec  ====
B D                     Mouse  ====
B D           Chinese hamster  ====
            Cape golden mole  ====
            Tibetan antelope  ====
B D                       Cow  ====
               Domestic goat  ====
                Killer whale  ====
              Bactrian camel  ====
B D                    Alpaca  ====
B D                    Rabbit  ----
B D                       Pig  ====
B D                      Pika  ----
B D                   Dolphin  ====
B D                Coelacanth  ====
                    Aardvark  ====
B D              Atlantic cod  ====
B D               Stickleback  ====
          Southern platyfish  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                 Tetraodon  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ----
       Burton's mouthbreeder  ----
         Princess of Burundi  ====
B D              Nile tilapia  ----
B D             X. tropicalis  ====
  D            Painted turtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
  D       Collared flycatcher  ====
B D                    Lizard  ====
  D           Green seaturtle  ====
  D  Chinese softshell turtle  ====

Inserts between block 29 and 30 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 2034bp
                Prairie vole 3753bp
              Golden hamster 2495bp
B D                      Rat 3410bp
B D                    Sheep 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Elephant 3bp
         Cape elephant shrew 2bp
B D                  Manatee 3bp
B D                Armadillo 3bp

Alignment block 30 of 78 in window, 3676249 - 3676253, 5 bps 
B D                     Human  aacac-
B D                     Chimp  aacag-
B D                   Gorilla  aacac-
B D                 Orangutan  aacac-
B D                    Gibbon  aacac-
B D                    Rhesus  aacac-
B D       Crab-eating macaque  aacac-
B D                    Baboon  aacac-
B D              Green monkey  aacac-
B D                  Marmoset  aacac-
B D           Squirrel monkey  aacac-
B D                  Bushbaby  aatag-
           Chinese tree shrew  aacac-
B D                  Squirrel  aacat-
B D                     Sheep  t-----
B D                     Horse  aacac-
B D          White rhinoceros  aatgc-
B D                       Cat  gaca--
B D                       Dog  aacac-
B D                   Ferret   caccc-
B D                     Panda  aacac-
               Pacific walrus  cacac-
                 Weddell seal  cacac-
             Black flying-fox  cacat-
B D                   Megabat  cacat-
                Big brown bat  gacac-
         David's myotis (bat)  gacac-
B D                  Microbat  gacac-
B D                  Elephant  cgcac-
          Cape elephant shrew  tacac-
B D                   Manatee  cgcac-
B D                 Armadillo  agtgt-
B D                   Opossum  ggcgc-
  D               Rock pigeon  aacac-
  D              Saker falcon  aacac-
  D          Peregrine falcon  aacac-
  D    White-throated sparrow  agcac-
B D       Medium ground finch  aacac-
  D                    Parrot  aatac-
B D                    Turkey  aaaac-
                  Spotted gar  atcacc
             Star-nosed mole  ======
B D                  Hedgehog  ======
B D                     Shrew  ======
B D                    Tenrec  ======
              Golden hamster  ======
                Prairie vole  ======
B D                       Rat  ======
B D                     Mouse  ======
                  Chinchilla  ------
            Brush-tailed rat  ------
B D                Guinea pig  ------
B D            Naked mole-rat  ------
      Lesser Egyptian jerboa  ======
B D           Chinese hamster  ======
            Cape golden mole  ======
            Tibetan antelope  ======
B D                       Cow  ======
               Domestic goat  ======
                Killer whale  ======
              Bactrian camel  ======
B D                    Alpaca  ======
B D                    Rabbit  ------
B D                       Pig  ======
B D                      Pika  ------
B D                   Dolphin  ======
B D                Coelacanth  ======
                    Aardvark  ======
B D              Atlantic cod  ======
B D               Stickleback  ======
          Southern platyfish  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                 Tetraodon  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
B D                    Medaka  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ------
       Burton's mouthbreeder  ------
         Princess of Burundi  ======
B D              Nile tilapia  ------
B D             X. tropicalis  ======
  D            Painted turtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
  D       Collared flycatcher  ======
B D                    Lizard  ======
  D           Green seaturtle  ======
  D  Chinese softshell turtle  ======

Inserts between block 30 and 31 in window
  D              Rock pigeon 991bp
  D             Saker falcon 1293bp
  D         Peregrine falcon 20bp
  D   White-throated sparrow 26bp
B D      Medium ground finch 29bp
  D                   Parrot 1101bp
B D                   Turkey 5bp

Alignment block 31 of 78 in window, 3676254 - 3676256, 3 bps 
B D                     Human  aca
B D                     Chimp  aca
B D                   Gorilla  aca
B D                 Orangutan  aca
B D                    Gibbon  aca
B D                    Rhesus  atg
B D       Crab-eating macaque  atg
B D                    Baboon  atg
B D              Green monkey  acg
B D                  Marmoset  aga
B D           Squirrel monkey  aga
B D                  Bushbaby  gca
           Chinese tree shrew  gag
B D                  Squirrel  gtg
B D            Naked mole-rat  --a
B D                Guinea pig  --a
                   Chinchilla  --a
             Brush-tailed rat  --a
B D                     Horse  gga
B D          White rhinoceros  aga
B D                       Dog  caa
B D                   Ferret   gca
B D                     Panda  aca
               Pacific walrus  gca
                 Weddell seal  gca
             Black flying-fox  aga
B D                   Megabat  aga
                Big brown bat  gca
         David's myotis (bat)  aca
B D                  Microbat  aca
B D                  Elephant  aca
          Cape elephant shrew  act
B D                   Manatee  aca
B D                 Armadillo  gtg
B D                   Opossum  gga
B D                    Turkey  --a
                  Spotted gar  aca
             Star-nosed mole  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                    Tenrec  ===
              Golden hamster  ===
                Prairie vole  ===
B D                       Rat  ===
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
B D           Chinese hamster  ===
B D                     Sheep  ---
            Cape golden mole  ===
            Tibetan antelope  ===
B D                       Cow  ===
               Domestic goat  ===
                Killer whale  ===
              Bactrian camel  ===
B D                    Alpaca  ===
B D                    Rabbit  ---
B D                       Pig  ===
B D                      Pika  ---
B D                       Cat  ---
B D                   Dolphin  ===
B D                Coelacanth  ===
                    Aardvark  ===
B D              Atlantic cod  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ---
       Burton's mouthbreeder  ---
         Princess of Burundi  ===
B D              Nile tilapia  ---
B D             X. tropicalis  ===
  D            Painted turtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
  D           Green seaturtle  ===
  D  Chinese softshell turtle  ===

Inserts between block 31 and 32 in window
B D                    Horse 5bp
B D         White rhinoceros 5bp
B D                      Dog 2bp
B D                  Ferret  3bp
B D                    Panda 244bp
              Pacific walrus 5bp
                Weddell seal 5bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp
B D                 Elephant 5bp
         Cape elephant shrew 5bp
B D                  Manatee 5bp
B D                Armadillo 5bp
B D                   Turkey 2bp

Alignment block 32 of 78 in window, 3676257 - 3676261, 5 bps 
B D                     Human  ac---aca
B D                     Chimp  ac---aca
B D                   Gorilla  ac---aca
B D                 Orangutan  ac---aca
B D                    Gibbon  ac---aca
B D                    Rhesus  ac---aca
B D       Crab-eating macaque  ac---aca
B D                    Baboon  ac---aca
B D              Green monkey  ac---aca
B D                  Marmoset  gc---aca
B D           Squirrel monkey  gc---aca
B D                  Bushbaby  aa---aag
           Chinese tree shrew  gagggaaa
B D                  Squirrel  gg---gaa
B D            Naked mole-rat  ag---gca
B D                Guinea pig  gg---gca
                   Chinchilla  gg---gca
             Brush-tailed rat  gg---gca
B D                     Horse  -g---gaa
B D          White rhinoceros  -g---gaa
B D                       Cat  -------a
B D                       Dog  -a---caa
B D                   Ferret   -a---caa
               Pacific walrus  -a---caa
                 Weddell seal  -a---caa
             Black flying-fox  ga---aaa
B D                   Megabat  ga---aaa
                Big brown bat  ag---aga
         David's myotis (bat)  ag---gga
B D                  Microbat  ag---gga
B D                  Elephant  gg---aaa
          Cape elephant shrew  gg------
B D                   Manatee  gg---aag
B D                 Armadillo  gg----gg
  D          Peregrine falcon  -----gca
B D                    Turkey  -----aca
                  Spotted gar  ---ccgcg
             Star-nosed mole  ========
B D                  Hedgehog  ========
B D                     Shrew  ========
B D                    Tenrec  ========
              Golden hamster  ========
                Prairie vole  ========
B D                       Rat  ========
B D                     Mouse  ========
      Lesser Egyptian jerboa  ========
B D           Chinese hamster  ========
B D                     Sheep  --------
            Cape golden mole  ========
            Tibetan antelope  ========
B D                       Cow  ========
B D                     Panda  ========
               Domestic goat  ========
                Killer whale  ========
              Bactrian camel  ========
B D                    Alpaca  ========
B D                    Rabbit  --------
B D                       Pig  ========
B D                      Pika  --------
B D                   Dolphin  ========
B D                Coelacanth  ========
                    Aardvark  ========
B D              Atlantic cod  ========
B D               Stickleback  ========
          Southern platyfish  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D                 Tetraodon  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
  D    White-throated sparrow  ========
B D           Tasmanian devil  ========
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  ========
B D                    Medaka  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  --------
       Burton's mouthbreeder  --------
         Princess of Burundi  ========
B D              Nile tilapia  --------
B D             X. tropicalis  ========
  D            Painted turtle  ========
B D        American alligator  ========
  D             Scarlet macaw  ========
B D                Budgerigar  ========
B D                   Opossum  --------
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D       Medium ground finch  ========
B D                    Lizard  ========
  D              Saker falcon  ========
  D                    Parrot  ========
  D           Green seaturtle  ========
  D  Chinese softshell turtle  ========

Inserts between block 32 and 33 in window
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
  D         Peregrine falcon 5bp
B D                   Turkey 913bp

Alignment block 33 of 78 in window, 3676262 - 3676280, 19 bps 
B D                     Human  cctcaaatgcc---ccatttct--
B D                     Chimp  cctcaaatgcc---ccatttct--
B