Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 160 in window, 24505374 - 24505374, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Marmoset  t
B D         Squirrel monkey  t
B D                Bushbaby  t
         Chinese tree shrew  t
B D                Squirrel  t
     Lesser Egyptian jerboa  t
B D         Chinese hamster  t
             Golden hamster  t
B D                   Mouse  t
B D                     Rat  t
B D          Naked mole-rat  t
B D              Guinea pig  t
                 Chinchilla  t
           Brush-tailed rat  t
B D                  Rabbit  t
B D                     Pig  t
B D                 Dolphin  t
               Killer whale  t
B D                     Cow  t
B D                   Sheep  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  t
B D                     Dog  t
B D                 Ferret   t
B D                   Panda  t
             Pacific walrus  t
               Weddell seal  t
           Black flying-fox  t
B D                 Megabat  t
              Big brown bat  g
       David's myotis (bat)  t
B D                Microbat  t
B D                Hedgehog  g
B D                   Shrew  g
B D                Elephant  t
        Cape elephant shrew  t
B D                 Manatee  t
           Cape golden mole  t
B D                  Tenrec  g
                   Aardvark  t
B D               Armadillo  g
B D                 Opossum  t
B D         Tasmanian devil  t
B D                 Wallaby  g
  D         Green seaturtle  t
  D  Spiny softshell turtle  t
B D                    Pika  =
B D              Budgerigar  =
B D     Medium ground finch  -
  D                  Parrot  =

Inserts between block 1 and 2 in window
                Chinchilla 1bp
  D Spiny softshell turtle 12bp

Alignment block 2 of 160 in window, 24505375 - 24505377, 3 bps 
B D                     Human  gag
B D                     Chimp  gag
B D                   Gorilla  gag
B D                 Orangutan  gag
B D                    Gibbon  gag
B D                    Rhesus  gag
B D       Crab-eating macaque  gag
B D                    Baboon  gag
B D              Green monkey  gag
B D                  Marmoset  gag
B D           Squirrel monkey  gag
B D                  Bushbaby  gag
           Chinese tree shrew  gag
B D                  Squirrel  gac
       Lesser Egyptian jerboa  gag
B D           Chinese hamster  gac
               Golden hamster  gac
B D                     Mouse  ggc
B D                       Rat  gac
B D            Naked mole-rat  gag
B D                Guinea pig  gag
                   Chinchilla  aaa
             Brush-tailed rat  aag
B D                    Rabbit  gag
B D                       Pig  ggg
B D                   Dolphin  ggg
                 Killer whale  ggg
B D                       Cow  ggg
B D                     Sheep  ggg
B D                     Horse  gag
B D          White rhinoceros  gag
B D                       Cat  gag
B D                       Dog  gag
B D                   Ferret   gag
B D                     Panda  gag
               Pacific walrus  gag
                 Weddell seal  ggg
             Black flying-fox  gag
B D                   Megabat  gag
                Big brown bat  gag
         David's myotis (bat)  gag
B D                  Microbat  gag
B D                  Hedgehog  aag
B D                     Shrew  gag
B D                  Elephant  gag
          Cape elephant shrew  gag
B D                   Manatee  gag
             Cape golden mole  gag
B D                    Tenrec  gag
                     Aardvark  gag
B D                 Armadillo  gaa
B D                   Opossum  caa
B D           Tasmanian devil  caa
B D                   Wallaby  cag
  D           Green seaturtle  --g
  D  Chinese softshell turtle  gtg
  D    Spiny softshell turtle  gag
B D                      Pika  ===
B D                Budgerigar  ===
B D       Medium ground finch  ---
  D                    Parrot  ===

Inserts between block 2 and 3 in window
         Cape elephant shrew 214bp
B D                  Opossum 5bp
B D          Tasmanian devil 5bp
B D                  Wallaby 5bp

Alignment block 3 of 160 in window, 24505378 - 24505392, 15 bps 
B D                     Human  agt---------tc---------tgtgac--c--------tgt----------
B D                     Chimp  agt---------tc---------tgtgac--c--------tgt----------
B D                   Gorilla  agt---------tc---------tgtgac--c--------tgt----------
B D                 Orangutan  agt---------tc---------tgtgac--c--------tgt----------
B D                    Gibbon  agt---------tt---------tgtgac--c--------cgt----------
B D                    Rhesus  agt---------tc---------tgtgac--c--------tgt----------
B D       Crab-eating macaque  agt---------tc---------ggtgac--c--------tgt----------
B D                    Baboon  agt---------tc---------tgtgac--c--------tgt----------
B D              Green monkey  agt---------tc---------tgtgtc--c--------tgt----------
B D                  Marmoset  agt---------tc---------tgtgac--t--------ggt----------
B D           Squirrel monkey  agt---------tc---------tatgat--g--------gat----------
B D                  Bushbaby  agt---------tc---------tacgac--c--------taa----------
           Chinese tree shrew  acc---------tc---------tgtgac--t--------tgt----------
B D                  Squirrel  ttt--------------------------------------------------
       Lesser Egyptian jerboa  tct-----------------------gac--c--------tgt----------
B D           Chinese hamster  ctttaagaacctcc---------tgagac--a--------tgt----------
               Golden hamster  ctttaggaaccttc---------tgagac--a--------agt----------
B D                     Mouse  ttttaggaacattc---------tgtgac--t--------tgt----------
B D                       Rat  ttttaggaactttc---------tgtgac--t--------tgt----------
B D            Naked mole-rat  agt---------tg---------tgtgaa--ctggttttgtgt----------
B D                Guinea pig  agt---------tc---------tatgag--t--------tgt----------
                   Chinchilla  agt---------tc---------tgtgaa--c--------tgt----------
             Brush-tailed rat  agt---------tc---------tgtgag--c--------tgt----------
B D                    Rabbit  agt---------tc---------tgtgac--c--------tgc----------
B D                       Pig  att---------tc---------tgtgat--c--------tgg----------
B D                   Dolphin  aat---------tc---------tgtgat--c--------tgg----------
                 Killer whale  aat---------tc---------tgtgat--c--------tgg----------
B D                       Cow  aat---------tc---------tgtgac--c--------tga----------
B D                     Sheep  aat---------tc---------tatgac--c--------tga----------
B D                     Horse  aat---------tc---------tgt-ac--c--------tgg----------
B D          White rhinoceros  agt---------tc---------tgtgac--c--------tgg----------
B D                       Cat  gat---------tc---------tgtgcc--c--------tgg----------
B D                       Dog  gac---------tc---------tgtgac--c--------tgg----------
B D                   Ferret   gac---------tc---------tgtgac--c--------tgg----------
B D                     Panda  gac---------tt---------tgtgac--c--------tgg----------
               Pacific walrus  gac---------gc---------tgtgac--c--------tgg----------
                 Weddell seal  ggt---------ac---------agtcag--c--------agg----------
             Black flying-fox  agt---------tt---------tgtgac--c--------tgg----------
B D                   Megabat  agt---------tt---------tgtgac--c--------tgg----------
                Big brown bat  gat---------ac---------aatcag--c--------agg----------
         David's myotis (bat)  agt---------tt---------agtgac--c--------tag----------
B D                  Microbat  agt---------tt---------agtgat--c--------tag----------
B D                  Hedgehog  cat---------ct-------------ct--g--------tgg----------
B D                     Shrew  agt---------ct----------gtcat--c--------agg----------
B D                  Elephant  agt---------tc---------tgtaat--c--------ctc----------
          Cape elephant shrew  gga---------tc---------tgtagc--t--------ctt----------
B D                   Manatee  agc---------gc---------tgtaac--a--------ctc----------
             Cape golden mole  agc---------tc---------tgtaat--a--------tgc----------
B D                    Tenrec  agt---------tc---------tgtaac--c--------cac----------
                     Aardvark  agt---------tc---------tgtaat--a--------ctc----------
B D                 Armadillo  att---------tc---------tgtgac--c--------tgt----------
B D                   Opossum  agt---------tcaatatccattttaat--t--------ctt----------
B D           Tasmanian devil  agt---------tcaatacccagagtaac--t--------ctt----------
B D                   Wallaby  agt---------ccaaagtccagtttaacatt--------ctt----------
  D           Green seaturtle  -----------------------------ggc--------act--gcctgagc
  D  Chinese softshell turtle  -----------------------------ggc--------tttctgctccaag
  D    Spiny softshell turtle  -----------------------------ggc--------agt--------gg
B D                      Pika  =====================================================
B D                Budgerigar  =====================================================
B D       Medium ground finch  -----------------------------------------------------
  D                    Parrot  =====================================================

Inserts between block 3 and 4 in window
         Cape elephant shrew 56bp

Alignment block 4 of 160 in window, 24505393 - 24505426, 34 bps 
B D                     Human  ag----g---at-actt--------------------------c----tggag--g--------cttagg
B D                     Chimp  ag----g---at-actt--------------------------c----tggag--g--------cttagg
B D                   Gorilla  ag----g---at-actt--------------------------c----tggag--g--------cttagg
B D                 Orangutan  ag----g---at-actt--------------------------c----tggag--g--------cttagg
B D                    Gibbon  ag----g---at-actt--------------------------c----tggag--g--------cttagg
B D                    Rhesus  ag----g---at-actt--------------------------c----tggag--g--------ctcagg
B D       Crab-eating macaque  ag----g---at-actt--------------------------c----cggag--g--------ctcagg
B D                    Baboon  ag----g---at-actt--------------------------c----tggag--g--------ctcagg
B D              Green monkey  ag----g---at-actt--------------------------c----tggag--g--------ctcagg
B D                  Marmoset  ag----g---ac-actt--------------------------c----tggag--g--------ctccgg
B D           Squirrel monkey  ag----g---ac-actt--------------------------c----tgggg--g--------ctccgg
B D                  Bushbaby  gg----g---aa-cctg--------------------------g----tggag--c--------ctcaga
           Chinese tree shrew  ag----a---aa-cctg--------------------------a----cagag--a--------ctcatg
B D                  Squirrel  ag----g---aa-gttt--------------------------t----tgaaa--a--------ttcagg
       Lesser Egyptian jerboa  ag----g---aa-actt--------------------------g----tgtag--a--------ctcagg
B D           Chinese hamster  aa----g---aa--ctt--------------------------c----agaga--g--------atcaga
               Golden hamster  aa----g---aa-cctt--------------------------c----agaga--a--------atcagg
B D                     Mouse  aa----g---aa-cctt--------------------------c----tggaa--g--------ctcagg
B D                       Rat  aa----g---aa-cctt--------------------------c----tggaa--g--------ctcagg
B D            Naked mole-rat  ag----c---aa-cctt--------------------------t----tggag--t--------ctcaag
B D                Guinea pig  ag----g---ga-cttt--------------------------c----tggag--t--------ctcaag
                   Chinchilla  ag----g---ta-cctt--------------------------c----tgcag--t--------ctcagg
             Brush-tailed rat  ag----g---ga-cctt--------------------------c----tggaa--t--------ctcaag
B D                    Rabbit  ag----a---ag-cctt--------------------------c----tggag--g--------ctcagg
B D                       Pig  ag----g---ag-cctt--------------------------c----ttgaa--g--------cttagg
B D                   Dolphin  ag----g---ag-cctt--------------------------c----ctgag--g--------cttagg
                 Killer whale  ag----g---ag-cctt--------------------------c----ctgag--g--------cttagg
B D                       Cow  ag----g---gg-cctt--------------------------c----ccaag--g--------attagg
B D                     Sheep  ag----g---gg-cctt--------------------------c----ctgag--g--------attagg
B D                     Horse  ag----g---aa-actt--------------------------c----ttgag--g--------tttagg
B D          White rhinoceros  ag----g---aa-actt--------------------------c----ttgag--g--------cttagg
B D                       Cat  ag----g---gg-ccct--------------------------t----gtggg--t--------ctgagg
B D                       Dog  ag----g---ag-ccct--------------------------c----ttggg--t--------ctgagg
B D                   Ferret   ag----g---ag-ccct--------------------------c----ttgga--t--------ctaagg
B D                     Panda  ag----g---ag-acca--------------------------c----tcagg--t--------ctgagg
               Pacific walrus  ag----g---ag-gatt--------------------------c----ttggg--t--------ctgagg
                 Weddell seal  -----------g-gctt--------------------------t----gtgtgcct--------ccaaga
             Black flying-fox  ag----a---aa-actt--------------------------t----ttgaa--g--------tccagg
B D                   Megabat  ag----a---aa-actt--------------------------c----ttgaa--g--------tccagg
                Big brown bat  ggctttg---gg-tact--------------------------t----ttgg-----------------g
         David's myotis (bat)  ag----g---aa-tctt--------------------------c----ttgag--g--------atgatg
B D                  Microbat  at----g---aa-tctt--------------------------c----ttgag--g--------attatg
B D                  Hedgehog  ag----a---aa-tctt--------------------------t----ttgaa--g--------cttagg
B D                     Shrew  cc----a---aa-attg--------------------------t----ctgag--g--------tattgg
B D                  Elephant  ag----g---aa-attt--------------------------c----ttgag--g--------ctcagg
          Cape elephant shrew  ag----g---aa-gttg--------------------------c----ctgag--g--------ctcagg
B D                   Manatee  ag----g---aa-actt--------------------------c----ttgag--g--------cacagg
             Cape golden mole  ag----g---aa-actt--------------------------c----gtgag--g--------ctcagg
B D                    Tenrec  ag----g---aa-actt--------------------------c----ttgag--g--------ctcagg
                     Aardvark  ag----g---aa-gctt--------------------------c----ttgag--c--------ctcagc
B D                 Armadillo  ag----g---aa-attt--------------------------t----gggag--g--------ctcatg
B D                   Opossum  ca----ctaaat-cctt------------tcccctcctcc---ccaactttag--g--------ctctga
B D           Tasmanian devil  ca----t---at-tctt----caacctc-ttctctcctccatgc--atcttag--a--------ctctgg
B D                   Wallaby  ca----c---ct-ccttgccgcacccccattccctacccc---c--accttag--a--------ctctgg
B D                  Platypus  ag----g---at-tttt--------------------------c----cctgg--g--------cttgcg
  D           Green seaturtle  -a----g---agcgata--------------------------g----ctgtg--ggactcagccttggg
  D  Chinese softshell turtle  -g----g---at-gctg--------------------------g----ctctg--g--tccagccccagg
  D    Spiny softshell turtle  -a----g---tg-gctg--------------------------g----ctcag--a-----------ggg
B D                      Pika  ======================================================================
B D                Budgerigar  ======================================================================
B D       Medium ground finch  ----------------------------------------------------------------------
  D                    Parrot  ======================================================================

                        Human  g-tt--------gtg-------------------gctg--------------------------ag
                        Chimp  g-tt--------gtg-------------------gctg--------------------------ag
                      Gorilla  g-tt--------gtg-------------------gctg--------------------------ag
                    Orangutan  g-tt--------gtg-------------------gctg--------------------------ag
                       Gibbon  t-tt--------gtg-------------------gccg--------------------------ag
                       Rhesus  g-tt--------gtg-------------------gctg--------------------------ag
          Crab-eating macaque  g-tt--------gtg-------------------gctg--------------------------ag
                       Baboon  g-tt--------gtg-------------------gctg--------------------------ag
                 Green monkey  g-tt--------gtg-------------------gatg--------------------------ag
                     Marmoset  g-tt--------gtg-------------------gcca--------------------------ag
              Squirrel monkey  g-tt--------gtg-------------------gccg--------------------------ag
                     Bushbaby  g-ac--------gtg-------------------gcca--------------------------gg
           Chinese tree shrew  a-at--------gtg-------------------acagggct-c----------------a-gcag
                     Squirrel  g-at--------gtg-------------------acaggacttc----------------a-gctg
       Lesser Egyptian jerboa  g-ac--------cta-------------------acacgacttt----------------a-gcat
              Chinese hamster  g-ag--------atg-------------------gcagggcttcnnnnnnnnnnnnnnnnn-nnnn
               Golden hamster  g-ag--------ctg-------------------gcagggcttc----------------c-acag
                        Mouse  g-ac--------cag-------------------gcagggcttc----------------a-gcag
                          Rat  g-at--------cag-------------------gaagggcttc----------------a-gcag
               Naked mole-rat  g-at--------gtg-------------------gcaggacttc----------------a-gcag
                   Guinea pig  g-ac--------atg-------------------gctggacttc----------------a-acag
                   Chinchilla  g-at--------gtg-------------------gcaggacttc----------------a-atag
             Brush-tailed rat  g-ac--------atg-------------------gcagaacttt----------------a-gcag
                       Rabbit  g-gt--------gtt-------------------gcaggactct----------------a-gcag
                          Pig  g-ac--------ctg-------------------gcgggacgtc----------------a-gcag
                      Dolphin  g-gt--------gtg-------------------gtgggacttg----------------a-gcag
                 Killer whale  g-gt--------gtg-------------------gtgggacttg----------------a-gcag
                          Cow  gaac--------gtg-------------------acggggcttt----------------a-agag
                        Sheep  g-ac--------gtg-------------------acagggcttt----------------a-agag
                        Horse  g-at--------gtg-------------------gcaggacttc----------------a-gtag
             White rhinoceros  t-at--------gtg-------------------gcaggacttc----------------a-gtag
                          Cat  g-at--------gcg-------------------gcagggcctc----------------a-gcag
                          Dog  g-at--------gta-------------------gtggggcctc----------------a-gtag
                      Ferret   g-ac--------atg-------------------gtggggtctc----------------a-gcag
                        Panda  g-at--------gtg-------------------gcggggcctc----------------a-gcag
               Pacific walrus  g-at--------gtg-------------------gcggggcctc----------------a-gcag
                 Weddell seal  g-cc--------tcc-------------------ctggggctca----------------g-gctg
             Black flying-fox  g-at--------gtg-------------------gcaggaacc-----------------------
                      Megabat  g-at--------gtg-------------------gcaggacctc----------------a-gcag
                Big brown bat  a-gc--------ctc-------------------cctggtcttg----------------g-gctg
         David's myotis (bat)  g-gt--------gtg-------------------ccaggacttt----------------a-gcag
                     Microbat  g-gt--------gtg-------------------ccaggacttt----------------a-gcag
                     Hedgehog  g-at--------gtg-------------------gcagcatttc----------------atttaa
                        Shrew  g-at--------ggg-------------------gcagaagttc----------------a-gcag
                     Elephant  g-at--------gtg-------------------gcaaggcttc----------------a-gtag
          Cape elephant shrew  g-at--------gtg-------------------gcaagacttc----------------a-gtgg
                      Manatee  g-at--------gtg-------------------gcaagacttc----------------a-gcag
             Cape golden mole  g-at--------gtg-------------------gcaagatttc----------------a----g
                       Tenrec  g-atctgtgacggcg-------------------atggtgcctc----------------a----g
                     Aardvark  a-gt--------------------------------------------------------------
                    Armadillo  g-at--------atg-------------------gcaggatttt----------------a-gcag
                      Opossum  g-at--------ggg-------------------gctg----------------------a-gcag
              Tasmanian devil  g-at--------gaa-------------------gctg----------------------g-gcag
                      Wallaby  g-at--------gag-------------------gctg----------------------g-gcag
                     Platypus  g-tc--------ggg-------------------gctgggtttc----------------a-ccaa
              Green seaturtle  g-ga--------gctcagcccctctgtgaagcag--------------------------------
     Chinese softshell turtle  g-ca--------gtg---------------------------------------------------
       Spiny softshell turtle  g-tg--------ggg---------------------------------------------------
                         Pika  ==================================================================
                   Budgerigar  ==================================================================
          Medium ground finch  ------------------------------------------------------------------
                       Parrot  ==================================================================

Inserts between block 4 and 5 in window
  D          Green seaturtle 11bp

Alignment block 5 of 160 in window, 24505427 - 24505436, 10 bps 
B D                     Human  ---------g--gac-ca-----ag---gg
B D                     Chimp  ---------g--gac-ca-----ag---gg
B D                   Gorilla  ---------a--gac-ca-----ag---gg
B D                 Orangutan  ---------g--gac-ca-----ag---gg
B D                    Gibbon  ---------g--gac-ca-----ag---tg
B D                    Rhesus  ---------g--gac-ca-----ag---gg
B D       Crab-eating macaque  ---------g--gac-ca-----ag---gg
B D                    Baboon  ---------g--gac-ca-----ag---gg
B D              Green monkey  ---------g--gac-ca-----ag---gg
B D                  Marmoset  ---------g--gac-ca-----ag---gg
B D           Squirrel monkey  ---------g--gac-ca-----ag---gg
B D                  Bushbaby  ---------g--act-ga-----ga---gg
           Chinese tree shrew  ---------g--agc-ca-----ga---gg
B D                  Squirrel  ---------g--aac-ttggggtgg---gg
       Lesser Egyptian jerboa  ---------g--aac-c-------a---ga
B D           Chinese hamster  ---------n--aac-ta------a---ga
               Golden hamster  ---------g--aac-ta------a---ga
B D                     Mouse  ---------g--aac-ta-----ca---ga
B D                       Rat  ---------g--aac-ta-----ca---ga
B D            Naked mole-rat  ---------g--agc-ca-----ga---ga
B D                Guinea pig  ---------g--aac-ca-----ga---ga
                   Chinchilla  ---------g--aac-ca-----ga---ga
             Brush-tailed rat  ---------g--gac-aa-----ga---ta
B D                    Rabbit  ---------g--aac-ca-----ga---gg
B D                       Pig  ---------g--acc-cg-----ga---gg
B D                   Dolphin  ---------g--aac-ca-----ga---gg
                 Killer whale  ---------g--aac-ca-----ga---gg
B D                       Cow  ---------gaaaac-ca-----ga---gg
B D                     Sheep  ---------gaaaac-ca-----ga---gg
B D                     Horse  ---------g--aac-ca-----ga---gg
B D          White rhinoceros  ---------g--aac-ca-----ga---gg
B D                       Cat  ---------a--gat-ca-----ga---gg
B D                       Dog  ---------a--gac-ta-----ga---gg
B D                   Ferret   ---------a--gac-ca-----ga---gg
B D                     Panda  ---------a--gac-ca-----ga---gg
               Pacific walrus  ---------a--gac-ca-----ga---gg
                 Weddell seal  ---------g--ggc-ca-----ggccctg
             Black flying-fox  ------------aac-ca-----ga---ga
B D                   Megabat  ---------g--aac-ca-----ga---ga
                Big brown bat  ---------t--gtc-ca-----gg---ct
         David's myotis (bat)  ---------g--aac-ca-----ga---gt
B D                  Microbat  ---------g--aac-ca-----ga---gt
B D                  Hedgehog  ---------a--ggt-ca-----ga---tg
B D                     Shrew  ---------g--aac-tg-----ga---tg
B D                  Elephant  ---------g--aac-ca-----ga---gg
          Cape elephant shrew  ---------g--aac-ca-----ga---gg
B D                   Manatee  ---------g--aac-ca-----ga---gg
             Cape golden mole  ---------g--aga-aa-----ga-agga
B D                    Tenrec  ---------g--cac-ca-----ga---gg
B D                 Armadillo  ---------c--aac-ca-----ga---gg
B D                   Opossum  ---------a--cac-t------gg---gg
B D           Tasmanian devil  ---------a--cat-g------gg---aa
B D                   Wallaby  ---------a--caa-t------gg---gg
B D                  Platypus  ---------g--gacact-----ca---gg
  D           Green seaturtle  ---------g--------------------
  D            Painted turtle  ---------g--------------------
  D  Chinese softshell turtle  gagtggagtg--------------------
  D    Spiny softshell turtle  aaatcga-tg--------------------
B D                      Pika  ==============================
B D                Budgerigar  ==============================
B D       Medium ground finch  ------------------------------
  D                    Parrot  ==============================
                    Aardvark  ------------------------------

Inserts between block 5 and 6 in window
B D                 Hedgehog 2bp
  D          Green seaturtle 10bp
  D           Painted turtle 9bp
  D Chinese softshell turtle 16bp

Alignment block 6 of 160 in window, 24505437 - 24505459, 23 bps 
B D                     Human  taga---ccagaa--tgagtggcac----aca----------
B D                     Chimp  taga---ccagaa--tgagtggcac----aca----------
B D                   Gorilla  taga---ccagaa--tgagtggcac----aca----------
B D                 Orangutan  taga---ccagaa--tgagtggcac----aca----------
B D                    Gibbon  taga---ccagaa--tgagtggcac----aca----------
B D                    Rhesus  cagg---ccagaa--tgagtggcac----aca----------
B D       Crab-eating macaque  cagg---ccagaa--tgagtggcac----aca----------
B D                    Baboon  cagg---ccagaa--tgagtggcac----aca----------
B D              Green monkey  cagg---ccagaa--tgagtggcac----aca----------
B D                  Marmoset  cagg---ccagaa--tgagtggcac----aca----------
B D           Squirrel monkey  cagg---ctagaa--tgagtggcac----aca----------
B D                  Bushbaby  cagg---ccagaa--tgaatggcacaaagaaa----------
           Chinese tree shrew  cagg---gca------gagtgttac----a-g----------
B D                  Squirrel  tggg---ccagag--cgagtgacac----aga----------
       Lesser Egyptian jerboa  taggggccaagaa--cacatgacac----aga----------
B D           Chinese hamster  catg---cacaag--cacatggcac----aca----------
               Golden hamster  cagg---cccaag--cacatggtgc----aaa----------
B D                     Mouse  cagg---ccagat--cgcatggcac----aca----------
B D                       Rat  cagg---ccagatcccacatgtcac----aga----------
B D            Naked mole-rat  caga---ctagag--caagtagtac----aga----------
B D                Guinea pig  cagg---ccagag--taagtggtac----aga----------
                   Chinchilla  cagg---ccagag--caagtggtat----aga----------
             Brush-tailed rat  taga---ccagag--caaatagtat----aga----------
B D                    Rabbit  agag---cggagg--tgaggagcac----aga----------
B D                       Pig  caga--tccagag--tgagtggca-----gga----------
B D                   Dolphin  caga--tccagag--tgagtggcac----aga----------
                 Killer whale  caga--tccagag--tgagtggcac----aga----------
B D                       Cow  caga--tccaggg--ttagtggcag----aga----------
B D                     Sheep  caga--tccaggg--tgagtggcac----tga----------
B D                     Horse  cagc--tccagag--tgagtggtac----aga----------
B D          White rhinoceros  cagc--t-cagag--cgagtggcac----aga----------
B D                       Cat  cagc--ttgaaag--tgaggggcac----aga----------
B D                       Dog  cagc--tccagag--taagtgg--c----aga----------
B D                   Ferret   cagc--tctggag--taagtggtac----aga----------
B D                     Panda  tggc--tccggag--taagcggcac----aga----------
               Pacific walrus  cagc--tccggag--taagtggcac----aga----------
                 Weddell seal  tgga--acctggg--t---cggccc----agg----------
             Black flying-fox  cagc--tccagag--cgcatgacac----aga----------
B D                   Megabat  cagc--tccagag--cgcatgacac----aga----------
                Big brown bat  ---------------cctgtggaac----ctg----------
         David's myotis (bat)  ----------------atgtggtac----aga----------
B D                  Microbat  ----------------atgtggtac----aga----------
B D                  Hedgehog  taac--tctgatg---tgcatgtgc----aga----------
B D                     Shrew  caac--ttgaata--ctgccaacac----aga----------
B D                  Elephant  cagg--tccagag--tgagtggcac----aga----------
          Cape elephant shrew  caag--tccagag--agaatagcac----aga----------
B D                   Manatee  cagg--tccagag--tgagtggcac----aga----------
             Cape golden mole  cagg--ttcagag--tgagtggcac----aga----------
B D                    Tenrec  cagg--tagagcg--tgcagggtgc----gga----------
                     Aardvark  -------------------tagcac----aga----------
B D                 Armadillo  cagc--cccagac--tgagtggcac----aga----------
B D                   Opossum  tggt--cctactg--tgagggcatc----aa-----------
B D           Tasmanian devil  ctgt--cttagta--tgaggggtat----aga----------
B D                   Wallaby  cagt--cctagta--tgagggatag----aga----------
B D                  Platypus  gaag---ccgaga--ggagagagag----agg----------
  D           Green seaturtle  -------------------aaggaa----agacgtggcg---
  D            Painted turtle  -------------------aagaac----agaaccgatg---
  D  Chinese softshell turtle  -------------------gagctc----agactcagaggaa
B D                      Pika  ==========================================
B D                Budgerigar  ==========================================
B D       Medium ground finch  ------------------------------------------
  D                    Parrot  ==========================================

Inserts between block 6 and 7 in window
B D                  Wallaby 36bp

Alignment block 7 of 160 in window, 24505460 - 24505462, 3 bps 
B D                     Human  ctt
B D                     Chimp  ctt
B D                   Gorilla  ctt
B D                 Orangutan  ctt
B D                    Gibbon  ctt
B D                    Rhesus  ctt
B D       Crab-eating macaque  ctt
B D                    Baboon  ctt
B D              Green monkey  ctt
B D                  Marmoset  ctt
B D           Squirrel monkey  ctt
B D                  Bushbaby  ctc
           Chinese tree shrew  tgt
B D                  Squirrel  gaa
       Lesser Egyptian jerboa  gaa
B D           Chinese hamster  aaa
               Golden hamster  aga
B D                     Mouse  aaa
B D                       Rat  aaa
B D            Naked mole-rat  gaa
B D                Guinea pig  aaa
                   Chinchilla  aaa
             Brush-tailed rat  aat
B D                    Rabbit  gaa
B D                       Pig  gaa
B D                   Dolphin  gaa
                 Killer whale  gaa
B D                       Cow  gaa
B D                     Sheep  gta
B D                     Horse  gaa
B D          White rhinoceros  gaa
B D                       Cat  aag
B D                       Dog  gag
B D                   Ferret   gag
B D                     Panda  gag
               Pacific walrus  gag
                 Weddell seal  gag
             Black flying-fox  gaa
B D                   Megabat  gaa
                Big brown bat  ggg
         David's myotis (bat)  gaa
B D                  Microbat  gaa
B D                  Hedgehog  aaa
B D                     Shrew  aaa
B D                  Elephant  gaa
          Cape elephant shrew  gaa
B D                   Manatee  gaa
             Cape golden mole  gaa
B D                    Tenrec  gc-
                     Aardvark  ga-
B D                 Armadillo  gag
B D                   Opossum  gag
B D           Tasmanian devil  gag
B D                      Pika  ===
B D                Budgerigar  ===
B D       Medium ground finch  ---
  D                    Parrot  ===
B D                   Wallaby  ===
  D  Chinese softshell turtle  ---
  D            Painted turtle  ---
  D           Green seaturtle  ---
B D                  Platypus  ---

Alignment block 8 of 160 in window, 24505463 - 24505481, 19 bps 
B D                     Human  tg----ctgctc-agg------tccag-t-tc
B D                     Chimp  tg----ctcctc-agg------tccag-t-tc
B D                   Gorilla  tg----ctgctc-agg------tccag-t-tc
B D                 Orangutan  tg----ctgctc-agg------tccag-t-tc
B D                    Gibbon  tg----ctgctc-agg------tccag-t-tc
B D                    Rhesus  ta----ctggtc-agg------tccag-t-tc
B D       Crab-eating macaque  ta----ctggtc-agg------tccag-t-tc
B D                    Baboon  ta----ctggtc-agg------tccag-t-tc
B D              Green monkey  tg----ctggtc-agg------tccag-t-tc
B D                  Marmoset  tg----ctgctc-agg------tccag-t-tc
B D           Squirrel monkey  tg----ctgctc-agg------tccag-t-tc
B D                  Bushbaby  cc----ctgctt-ggg------tccaa-c-tc
           Chinese tree shrew  cc----ctgcta-tgg------tctag-t-cc
B D                  Squirrel  c-----ctgctc-atc------tgtag-t-ta
       Lesser Egyptian jerboa  a-----ctgttc-ata------tccag-t-tc
B D           Chinese hamster  c-----ctgctc-aat------ttcag-c-tt
               Golden hamster  c-----ctgctc-aat------tccag-c-tt
B D                     Mouse  c-----ctgcac-tat------tccag-t-tc
B D                       Rat  c-----ctgcac-gat------tccag-c-tc
B D            Naked mole-rat  c-----ctgttc-aga------tccag-t-tc
B D                Guinea pig  c-----ctgctc-aga------tccag-t-tc
                   Chinchilla  c-----ctgct-------------cag-a-tc
             Brush-tailed rat  c-----ccgctc-aca------tccag-t-tc
B D                    Rabbit  c-----cagcac-ggg------cgcag-t-tc
B D                       Pig  c-----cgactc-aag------tccag-t-gg
B D                   Dolphin  c-----ctgctt-ggg------tccag-t-tc
                 Killer whale  c-----ctgctt-ggg------tccag-t-tc
B D                       Cow  c-----ctgccg-gag------tcctg-c-tc
B D                     Sheep  c-----ctgccg-gag------tcctg-c-tc
B D                     Horse  g-----ctgctc-ggt------tccag-g-tc
B D          White rhinoceros  g-----ctgctc-ggg------tccag-t-tc
B D                       Cat  c-----ctgctc-agg------tctgg-t-tc
B D                       Dog  c-----ctgctc-agg------tctgg-t-tc
B D                   Ferret   c-----ctgctc-agg------tccag-----
B D                     Panda  c-----ctgctc-agg------tctgg-t-tc
               Pacific walrus  c-----ctgctc-agg------tctgg-t-tc
                 Weddell seal  g-----cc--------------tctggct-tt
             Black flying-fox  c-----ctactc-agg------tccag-a-tt
B D                   Megabat  c-----ctactc-agg------tccag-a-tt
                Big brown bat  g-----ctaccc-agggagagctctgg-cttt
         David's myotis (bat)  t-----ctgctc-aga------tttgg---tt
B D                  Microbat  t-----ctgctc-aga------tttgg---tt
B D                  Hedgehog  c-----ctgctc-agg------gtcag-a-tt
B D                     Shrew  a-----agcctt-tgg------ttcca-t-at
B D                  Elephant  ct----tggctt-gga------tccag-g-tc
          Cape elephant shrew  ct----ttgcat-g------------g-g-tt
B D                   Manatee  ct----tggctc-aag------tccag-g-ta
             Cape golden mole  gt----ttgctc-agg------ttcag-g-tc
B D                    Tenrec  -t----gggttc-agg------tgcca-g-tc
                     Aardvark  -------ggttc-agg------tccag-g-tc
B D                 Armadillo  ct-----ggctc-agg------tctgg-t-tc
B D                   Opossum  a-----atggttcagc------cctag-g-at
B D           Tasmanian devil  g-----atgctt-ggt------cctag-g-at
B D                  Platypus  -gacgatggctc-agg------ctctg-t-cg
B D        American alligator  ----------------------tgctg-c-tt
  D           Green seaturtle  -----------t-tgc------tccag-c-cc
  D            Painted turtle  -----------c-agc------tcctg-c-cc
  D  Chinese softshell turtle  --------ggtc-tga------tccca-t-tt
B D                      Pika  ================================
B D                Budgerigar  ================================
B D       Medium ground finch  --------------------------------
  D                    Parrot  ================================
B D                   Wallaby  ================================

Inserts between block 8 and 9 in window
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                 Platypus 13bp
B D       American alligator 5bp

Alignment block 9 of 160 in window, 24505482 - 24505494, 13 bps 
B D                     Human  ---cagcttccctttc
B D                     Chimp  ---cagcttcccttta
B D                   Gorilla  ---cagcttcccttta
B D                 Orangutan  ---caggttcccttta
B D                    Gibbon  ---caggttcccttta
B D                    Rhesus  ---caggttcccttta
B D       Crab-eating macaque  ---caggttcccttta
B D                    Baboon  ---caggttcccttta
B D              Green monkey  ---caggttcccttta
B D                  Marmoset  ---caggttctgttta
B D           Squirrel monkey  ---caggttcggttta
B D                  Bushbaby  ---cagatagcctctc
           Chinese tree shrew  ---cagattccctcga
B D                  Squirrel  ---cagatttcct--c
       Lesser Egyptian jerboa  ---tagatttcctt-c
B D           Chinese hamster  ---cagattaaatcac
               Golden hamster  ---cagatttaatcac
B D                     Mouse  ---cagatttcctcac
B D                       Rat  ---cagatttcctcac
B D            Naked mole-rat  ---cagatttactttt
B D                Guinea pig  ---cagatttcctttc
                   Chinchilla  ---cagatttcctttc
             Brush-tailed rat  ---cagacttcctttc
B D                    Rabbit  ---cagattcccgctc
B D                      Pika  ---cagacccctctcc
B D                       Pig  ---taggtctccactc
B D                   Dolphin  ---cagatttcccttc
                 Killer whale  ---cagatttcccttc
B D                       Cow  ---t-ggtttcccc-c
B D                     Sheep  ---t-ggtttcccctc
B D                     Horse  ---caggtttcctccc
B D          White rhinoceros  ---caggttt--tctc
B D                       Cat  ---cagatttcccctc
B D                       Dog  ---cagatttcccctc
B D                   Ferret   ------atttcccctt
B D                     Panda  ---cagatttcccctt
               Pacific walrus  ---cagatttcccctt
                 Weddell seal  ---gggactctcacac
             Black flying-fox  ---catatttccttt-
B D                   Megabat  ---catatttcctttc
                Big brown bat  ---gggatttttcctg
         David's myotis (bat)  ---cagatttcctctt
B D                  Microbat  ---cagatttcctctt
B D                  Hedgehog  ---cagg-ttcctct-
B D                     Shrew  --------ttcctctc
B D                  Elephant  ---tggattttttctc
          Cape elephant shrew  ---taagtttcttctc
B D                   Manatee  ---tgggttttttctc
             Cape golden mole  ---ttggtttcttctc
B D                    Tenrec  ---tggcatgctgctc
                     Aardvark  ---tgggtttcttctc
B D                 Armadillo  ---tggg-tccctctc
B D                   Opossum  ---gagactccttttg
B D           Tasmanian devil  ---gagattccttttt
B D                  Platypus  ---ctgactttcca--
B D        American alligator  ctgcaggggtctc---
  D           Green seaturtle  ctgcagcgattcc---
  D            Painted turtle  ctgcagcaattcc---
  D  Chinese softshell turtle  ttccaggagca-----
B D                Budgerigar  ================
B D       Medium ground finch  ----------------
  D                    Parrot  ================
B D                   Wallaby  ================

Inserts between block 9 and 10 in window
B D       American alligator 4bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 16bp

Alignment block 10 of 160 in window, 24505495 - 24505495, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  t
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                   Dolphin  a
                 Killer whale  a
B D                       Cow  a
B D                     Sheep  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
B D                   Megabat  a
                Big brown bat  c
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  t
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  t
                     Aardvark  a
B D                 Armadillo  a
            Black flying-fox  -
B D                Budgerigar  =
B D       Medium ground finch  -
  D                    Parrot  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  -
B D                   Opossum  -
B D                  Platypus  -
B D        American alligator  =

Alignment block 11 of 160 in window, 24505496 - 24505496, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  a
B D           Squirrel monkey  g
B D                  Bushbaby  t
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  c
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  g
B D                   Dolphin  g
                 Killer whale  g
B D                       Cow  g
B D                     Sheep  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Wallaby  g
B D                  Platypus  c
B D                Budgerigar  a
B D        American alligator  g
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  g
            Black flying-fox  -
B D       Medium ground finch  -
  D                    Parrot  =
B D           Tasmanian devil  -
B D                   Opossum  -

Inserts between block 11 and 12 in window
B D       American alligator 4bp

Alignment block 12 of 160 in window, 24505497 - 24505504, 8 bps 
B D                     Human  ------gctg-gct-c
B D                     Chimp  ------gctg-gct-c
B D                   Gorilla  ------gctg-gct-c
B D                 Orangutan  ------gctg-gct-c
B D                    Gibbon  ------gctg-gct-c
B D                    Rhesus  ------gctg-gct-c
B D       Crab-eating macaque  ------gctg-gct-c
B D                    Baboon  ------gctg-gct-c
B D              Green monkey  ------gctg-gct-c
B D                  Marmoset  ------gctg-gct-c
B D           Squirrel monkey  ------gctg-gct-c
B D                  Bushbaby  ------actg-gcc-c
           Chinese tree shrew  ------gctg-g----
B D                  Squirrel  ------gctg-acc-c
       Lesser Egyptian jerboa  ------tgtg-gcc-c
B D           Chinese hamster  ------gct----c-c
               Golden hamster  ------gct----c-c
B D                     Mouse  ------gctg-gca-a
B D                       Rat  ------actg-gcc-c
B D            Naked mole-rat  ------attg-gcc-c
B D                Guinea pig  ------gctg-gcc-g
                   Chinchilla  ------gctg-gtt-c
             Brush-tailed rat  ------gctg-gct-c
B D                    Rabbit  ------gctg-acc-c
B D                      Pika  ------gcc--agc-c
B D                       Pig  ------gctg-gcc-c
B D                   Dolphin  ------gctg-gcc-c
                 Killer whale  ------gctg-gcc-c
B D                       Cow  ------gctg-gtc-c
B D                     Sheep  ------gctg-gcc-c
B D                     Horse  ------gctg-tcc-t
B D          White rhinoceros  ------gcca-gcc-c
B D                       Cat  ------gccg-gcc-c
B D                       Dog  ------gctt-gcc-c
B D                   Ferret   ------gctg-gct-c
B D                     Panda  ------gctg-gcc-c
               Pacific walrus  ------gctg-gcc-c
                 Weddell seal  ------gctg-g-c-c
             Black flying-fox  -------------t-c
B D                   Megabat  ------gctg-gcc-c
                Big brown bat  ------gctg-gcc-a
         David's myotis (bat)  ------gctg-gct-c
B D                  Microbat  ------gctg-gcc-c
B D                  Hedgehog  ------gctg-gtc-c
B D                     Shrew  ------gcag-gcc-c
B D                  Elephant  ------gctg-acc-c
          Cape elephant shrew  ------attc-ttcac
B D                   Manatee  ------gctg-gcc-c
             Cape golden mole  ------gctg-gtc-c
B D                    Tenrec  ------gctg-gcc-c
                     Aardvark  ------gctg-gcc-a
B D                 Armadillo  ------gctg-gcc-c
B D                   Opossum  ------actgagcc-a
B D           Tasmanian devil  ------gctgagac-a
B D                   Wallaby  ------gctgagct-a
B D                  Platypus  ------cttg-gcc-a
B D                Budgerigar  gcaggagc--------
  D                    Parrot  gcagcctc--------
B D        American alligator  gcaa------------
  D           Green seaturtle  ------gc--------
  D            Painted turtle  ------tc--------
  D  Chinese softshell turtle  ------tc--------
  D    Spiny softshell turtle  ------tc--------
B D       Medium ground finch  ----------------

Inserts between block 12 and 13 in window
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 6bp
  D   Spiny softshell turtle 6bp

Alignment block 13 of 160 in window, 24505505 - 24505510, 6 bps 
B D                     Human  aggatc
B D                     Chimp  aggatc
B D                   Gorilla  aggatc
B D                 Orangutan  aggatc
B D                    Gibbon  aggatc
B D                    Rhesus  aggatc
B D       Crab-eating macaque  aggatc
B D                    Baboon  aagatc
B D              Green monkey  aggatc
B D                  Marmoset  aggatc
B D           Squirrel monkey  aggatc
B D                  Bushbaby  aggctc
           Chinese tree shrew  ----tt
B D                  Squirrel  aggttc
       Lesser Egyptian jerboa  aggctc
B D           Chinese hamster  aagctc
               Golden hamster  aagctc
B D                     Mouse  aagctc
B D                       Rat  gagatc
B D            Naked mole-rat  aggctc
B D                Guinea pig  aggctc
                   Chinchilla  aggctc
             Brush-tailed rat  aggctc
B D                    Rabbit  aggctc
B D                      Pika  aggctc
B D                       Pig  aggctc
B D                   Dolphin  aggttc
                 Killer whale  aggttc
B D                       Cow  aggttc
B D                     Sheep  aggttc
B D                     Horse  gggctc
B D          White rhinoceros  aggctc
B D                       Cat  aggctc
B D                       Dog  aggctc
B D                   Ferret   aggctc
B D                     Panda  aggatc
               Pacific walrus  aggctc
                 Weddell seal  aggctt
             Black flying-fox  aggctc
B D                   Megabat  aggctc
                Big brown bat  ggcttc
         David's myotis (bat)  agactc
B D                  Microbat  agactc
B D                  Hedgehog  aggctc
B D                     Shrew  aggaac
B D                  Elephant  aggctt
          Cape elephant shrew  aggctc
B D                   Manatee  agcctc
             Cape golden mole  aggcta
B D                    Tenrec  -ggcga
                     Aardvark  aggctc
B D                 Armadillo  aggcca
B D                   Opossum  aggcca
B D           Tasmanian devil  gggcca
B D                   Wallaby  aagtca
B D                  Platypus  gggatc
  D               Rock pigeon  aggctc
B D                Budgerigar  aggagc
  D                    Parrot  tggagc
B D        American alligator  --gggc
  D           Green seaturtle  -tggct
  D            Painted turtle  --ggct
  D  Chinese softshell turtle  ttgttc
  D    Spiny softshell turtle  acgtgg
B D       Medium ground finch  ------

Inserts between block 13 and 14 in window
B D       American alligator 2bp

Alignment block 14 of 160 in window, 24505511 - 24505516, 6 bps 
B D                     Human  ----------------c----aggat---
B D                     Chimp  ----------------c----aggat---
B D                   Gorilla  ----------------c----aggat---
B D                 Orangutan  ----------------c----agagt---
B D                    Gibbon  ----------------c----agggt---
B D                    Rhesus  ----------------c----agggt---
B D       Crab-eating macaque  ----------------c----agggt---
B D                    Baboon  ----------------c----agggt---
B D              Green monkey  ----------------c----agggt---
B D                  Marmoset  ----------------c----agggt---
B D           Squirrel monkey  ----------------c----agggt---
B D                  Bushbaby  ----------------c----agggt---
           Chinese tree shrew  ----------------c----agggt---
B D                  Squirrel  ----------------c----aatgt---
       Lesser Egyptian jerboa  ----------------c----aagat---
B D           Chinese hamster  ----------------c----agagc---
               Golden hamster  ----------------c----agagt---
B D                     Mouse  ----------------c----agagt---
B D                       Rat  ----------------c----agagt---
B D            Naked mole-rat  ----------------c----atggttaa
B D                Guinea pig  ----------------c----atggt---
                   Chinchilla  ----------------c----aaggt---
             Brush-tailed rat  ----------------c----aagat---
B D                    Rabbit  ----------------c----agagt---
B D                      Pika  ----------------t---gaaagc---
B D                       Pig  ----------------c-----aggc---
B D                   Dolphin  ----------------c-----aggt---
                 Killer whale  ----------------c-----aggt---
B D                       Cow  ----------------c-----aggt---
B D                     Sheep  ----------------c-----aggt---
B D                     Horse  ----------------c----agggt---
B D          White rhinoceros  ----------------t----agggt---
B D                       Cat  ----------------catcgaggct---
B D                       Dog  ----------------cattcaggct---
B D                   Ferret   ----------------cctccaggct---
B D                     Panda  ----------------cagccaggct---
               Pacific walrus  ----------------cgtgcaggct---
                 Weddell seal  ----------------c---catgac---
             Black flying-fox  ----------------t----ggggt---
B D                   Megabat  ----------------t----ggggt---
                Big brown bat  ----------------t----gtggc---
         David's myotis (bat)  ----------------c----agggt---
B D                  Microbat  ----------------c----agggt---
B D                  Hedgehog  ----------------c----tgggt---
B D                     Shrew  ----------------c----atgct---
B D                  Elephant  ----------------c---tggggt---
          Cape elephant shrew  ----------------c---caggtt---
B D                   Manatee  ----------------c---tggggt---
             Cape golden mole  ----------------g---cagggt---
B D                    Tenrec  ----------------g---cagggt---
                     Aardvark  ----------------c---tagggt---
B D                 Armadillo  ----------------c---tggagt---
B D                   Opossum  ----------------c----agagc---
B D           Tasmanian devil  ----------------c----agagc---
B D                   Wallaby  ----------------c----cgagc---
B D                  Platypus  ----------------a----gaaac---
  D               Rock pigeon  caggg--------ctgc------------
           Tibetan ground jay  cagggtc------acgc------------
B D                Budgerigar  -agggtc------aggc------------
  D                    Parrot  -cg----------cagc------------
B D        American alligator  ---gggcacta-attgc------------
  D           Green seaturtle  --------caaggcttc------------
  D            Painted turtle  --------caggactgc------------
  D  Chinese softshell turtle  --------ctagattta------------
  D    Spiny softshell turtle  --------ctagatttc------------
B D       Medium ground finch  -----------------------------

Inserts between block 14 and 15 in window
  D              Rock pigeon 5bp
          Tibetan ground jay 3bp
B D               Budgerigar 3bp
  D                   Parrot 2bp
B D       American alligator 1bp
  D           Painted turtle 5bp

Alignment block 15 of 160 in window, 24505517 - 24505524, 8 bps 
B D                     Human  taatttg---c
B D                     Chimp  taatttg---c
B D                   Gorilla  taatttg---c
B D                 Orangutan  taatttg---c
B D                    Gibbon  taatttg---c
B D                    Rhesus  taatttg---c
B D       Crab-eating macaque  taatttg---c
B D                    Baboon  taatttg---c
B D              Green monkey  taatttg---c
B D                  Marmoset  taatttg---c
B D           Squirrel monkey  taatttg---c
B D                  Bushbaby  taatttg---a
           Chinese tree shrew  taattgt---t
B D                  Squirrel  taattct---c
       Lesser Egyptian jerboa  taattct---t
B D           Chinese hamster  taattct---c
               Golden hamster  taattct---c
B D                     Mouse  taattct---c
B D                       Rat  taattct---c
B D            Naked mole-rat  taattct---c
B D                Guinea pig  taatttg---c
                   Chinchilla  taattcc---c
             Brush-tailed rat  taattct---c
B D                    Rabbit  taattct---c
B D                      Pika  tagttat---c
B D                       Pig  taattct---c
B D                   Dolphin  taattct---c
                 Killer whale  taattct---c
B D                       Cow  taattcc---c
B D                     Sheep  tcattct---c
B D                     Horse  tagttct---c
B D          White rhinoceros  taattct---c
B D                       Cat  taattct---g
B D                       Dog  ttattct---g
B D                   Ferret   tagttct---g
B D                     Panda  taattct---c
               Pacific walrus  taattct---c
                 Weddell seal  tatatgt---t
             Black flying-fox  tagttct---c
B D                   Megabat  tagttct---c
                Big brown bat  tacttgc---g
         David's myotis (bat)  taattct---t
B D                  Microbat  taattct---t
B D                  Hedgehog  tgattct---c
B D                     Shrew  caattct---c
B D                  Elephant  taattct---t
          Cape elephant shrew  taattct---c
B D                   Manatee  taattct---c
             Cape golden mole  taattct---c
B D                    Tenrec  taatgctcccc
                     Aardvark  taattct---c
B D                 Armadillo  taattct---t
B D                   Opossum  taatttg---a
B D           Tasmanian devil  taatttg---c
B D                   Wallaby  taatttg---a
B D                  Platypus  taattct---t
     Mexican tetra (cavefish)  tagttgt---t
B D                Budgerigar  ===========
          Tibetan ground jay  ===========
  D               Rock pigeon  ===========
B D       Medium ground finch  -----------
  D                    Parrot  ===========
  D    Spiny softshell turtle  -----------
  D  Chinese softshell turtle  -----------
  D            Painted turtle  ===========
  D           Green seaturtle  -----------
B D        American alligator  ===========

Alignment block 16 of 160 in window, 24505525 - 24505525, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  t
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                   Dolphin  t
                 Killer whale  t
B D                       Cow  t
B D                     Sheep  t
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  t
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D                   Opossum  t
B D           Tasmanian devil  t
B D                   Wallaby  t
B D                  Platypus  c
  D               Rock pigeon  c
  D              Saker falcon  c
  D          Peregrine falcon  c
  D       Collared flycatcher  c
B D       Medium ground finch  c
           Tibetan ground jay  c
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
  D              Mallard duck  c
B D        American alligator  c
  D           Green seaturtle  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
  D    Spiny softshell turtle  c
     Mexican tetra (cavefish)  c

Alignment block 17 of 160 in window, 24505526 - 24505662, 137 bps 
B D                     Human  tgcaggatctggttgatccagggccggtaatgggagattcgggtgaagacag--cagggg-gcttt----
B D                     Chimp  tgcaggatctggttgatccagggccggtaatgggagattcgggtgaagacag--cagggg-gcttt----
B D                   Gorilla  tgcaggatctggttgatccagggccggtaatgggagattcgggtgaagacag--cagggg-gcttt----
B D                 Orangutan  tgcaggatctggttgatccagggccggtaatgggagattcgggtgaagacag--cagggg-gcttt----
B D                    Gibbon  tgcaggatctggttgatccagggccggtaatgggagattcgggtgaagacag--cagggg-gcttt----
B D                    Rhesus  tgcaggatcttgttgatccagggccggtaatgggagattcgggtgaagacag--cagggg-gcttt----
B D       Crab-eating macaque  tgcaggatcttgttgatccagggccggtaatgggagattcgggtgaagacag--cagggg-gcttt----
B D                    Baboon  tgcaggatcttgttgatccagggccggtaatgggagattcgggtgaagacag--cagggg-gcttt----
B D              Green monkey  tgcaggatcttgttgatccagggccggtaatgggagattcgggtgaagacag--cagggg-gcttt----
B D                  Marmoset  tgcaggaccttgttgatccagggccggtaatgggagattcgggtgaagacag--cagggg-gcttt----
B D           Squirrel monkey  tgcaggaccttgttgatccagggccggtaatgggagattcgggtgaagacag--cggggg-gcttt----
B D                  Bushbaby  ttcaggatcttgttgatccagggccggtagggagagatccgggtgaagacag--cagggg-gctgg----
           Chinese tree shrew  ttcaagacctggttgatccagggtcggtaataggagattcgggtgaagacag--cagggg-gcttt----
B D                  Squirrel  ttcaagatcttgttgatccagggtcggtaatgggagattctggtgaagacag--caggtg-gcttt----
       Lesser Egyptian jerboa  tttaagaccttatcgatccagggccggtaatgggagattctggtgaaaacag--caggag-gcttt----
B D           Chinese hamster  ctcaagatcttattaatccagggccggtaatgggagattctggtgaagacag--cagggg-gcttt----
               Golden hamster  ctcaagatcttattgatccagggccggtaatgggagattctggtgaagacag--aagggg-gcttt----
B D                     Mouse  ctcaagatcttattgatccagggcctgtaatgggagattctggtaaagacag--cagggg-gcttt----
B D                       Rat  ctcaagatcttattgatccagggtctgtaatgggagattctggtgaagacag--cagggg-gcttt----
B D            Naked mole-rat  ttcaagatcttgttgatccagggccggtaatgggagattcgggtgaagacaa--cagggg-gtttt----
B D                Guinea pig  ttcaagatcttgttgatccacggccggtaatgggagattcgggtgaagacaa--caggag-gtttt----
                   Chinchilla  ttcaagatcttgttgatccagggccggtaatgggagattcgggtgaagacaa--cagggg-gcttt----
             Brush-tailed rat  ttcaagatcttgttgatccagggccggtaatgggagattcgggtgaagacaa--cagggg-gcttt----
B D                    Rabbit  ttcaggaccttgttgatccagggccggtagtaggaaattcgggtgaagacag--atgggg-gcatt----
B D                      Pika  tttagtactttgtgaatccagggcacatatgaggagagtcgggtgaagacca--caggtg-gctgt----
B D                       Pig  ttcaggaccttcgcagtccagggcccgtcatgggagatccgggtgaagacag--cagggg-gcttt----
B D                   Dolphin  ttcaggaccttattgatccagggccagtaatgggagatccgggtgaagatgg--cagggg-gcttt----
                 Killer whale  ttcaggaccttattgatccagggccagtaatgggagatccgggtgaagatgg--cagggg-gcttt----
B D                       Cow  ttcaggacctcatcgatccagggccggtaaggggagatccgggtgaagacgg--ccgggg-gcttt----
B D                     Sheep  tttaggacctcatcgattcagggccggtaaggggagatctgggtgaagaagg--cggtgg-gcttt----
B D                     Horse  ttgaggacctcattgatccagggccggtaatgggagatctgggtgaagacag--caggag-gcttt----
B D          White rhinoceros  ttcaggacttcattgatccagggccggtaatgggagatccgggtgaagacag--ctgggg-gcttt----
B D                       Cat  ttcaggacctcattgatccagggccggtagtgggagatcccggtgaagacag--cagggg-gcttt----
B D                       Dog  ttcagaaccttattgatccagggccggtagtgggagattcgggtgaagacag--cagggg-gcttt----
B D                   Ferret   ttcaggacctcattgatccagggccggtagtaggagattcgggtgaagacag--cagggg-gcttt----
B D                     Panda  ttcaggacctcattgatccagagccggtagtgggagattcgggtgaagacag--cagggg-gcttt----
               Pacific walrus  ttcaggacctcattgatccagggccggtagtgggagattcgggtgaagacag--aagggg-gcttt----
                 Weddell seal  tttaagcttttattaatccagggcacatatggggagattcgagtgaagacagaaaaaaaa-gcttt----
             Black flying-fox  ttcagaacctcattgatccaggaccggtagtgggagatccgggtgaagacaa--caggga-gtttt----
B D                   Megabat  ttcagaacctcattgatccaggaccggtagtgggagatccgggtgaagacaa--caggga-gtttt----
                Big brown bat  tttataattttattaatccagtgcacatatggggagattcgagtgaagacac--caggag-gcttt----
         David's myotis (bat)  ttcaggatcatatcgatccagggccggtaatgggagatccgggtgaagacag--cagggg-gtttt----
B D                  Microbat  ttcaggatcttattgatccagggccggtaatgggagatccgggtgaagacag--cagggg-gctct----
B D                  Hedgehog  ttaaggatcttattgatccaggctcggtaatgggagatgcgggtgaagacag--cagggg-gcttg----
B D                     Shrew  ttcaggattttatcaatccagggccggaaataggagatccgggtgaagactg--caggag-gcttg----
B D                  Elephant  ttcaggatctcattgatccaaggccggtaatgggagattcgagtgaagatag--ctgggg-gcttt----
          Cape elephant shrew  ttcaggactttgttgatccaagaccggaaatacgagattcgggtgaagactg--cgggag-gtttg----
B D                   Manatee  ttcaggaccttattgatccaaggctggtaatgggagattcgggtgaagacag--cagggg-gcttt----
             Cape golden mole  ttcaggaccttattgatccaaagtcgataattggagattcgggtgaagacag--cagggg-gcttt----
B D                    Tenrec  ttcaggacctcattgatccaagaccggtaagcagagatgcgagtgaacacag--cggggg-gcttt----
                     Aardvark  ttcaggaccttattgatccaaggccggtaatgggagattcgggtgaagacag--cagggg-gcttt----
B D                 Armadillo  ttcaggacctgattgatccagggccggtaaaaggagattcgggtgaagacag--cagggg-gcttg----
B D                   Opossum  tttaggacttgattgatccagtcacggtaataggaaattctagtgaagactg--caggag-gttct----
B D           Tasmanian devil  tttaggatttgattgatccaggggcggtaatgtgaaattcgtgtgaagatgc--aaggtg-gtgtt----
B D                   Wallaby  tttagaattttattgatccaggacaggtaatgggaaattcgggtgaagacct--caggag-gtgtc----
B D                  Platypus  tggagaatctccttgatccagggaagataaaaggagatgcgagtatagacgt--tgggag-gtttc----
  D               Rock pigeon  ctcagggttcttctgatccagagcaggtagttggagatgcgggtgtagacac--caggtg-ggttg----
  D              Saker falcon  ttcagggttcttctgatccagggcaggtagctggagatgtgggtgtagaccc--caggcg-ggctg----
  D          Peregrine falcon  ttcagggttcttctgatccagggcaggtagctggagatgtgggtgtagaccc--caggcg-ggctg----
  D       Collared flycatcher  ttcatgacttttttgatccagggcaggtagttggagatgcgggtgtagaccc--cgggtg-gggag----
  D    White-throated sparrow  ttcatgactcttctgatccagggcaggtagttggagatgcgggcgtagaccc--cgggtg-gggaa----
B D       Medium ground finch  ttcagctgcttacggatccagggctcaaagtgcgagatcctggtgaatatct--caggga-agaggca--
           Tibetan ground jay  ttcatgacgctgttgacccaggggaggaaaggagcgatgtgtgtgtagaagc--caggcc-agttg----
B D                Budgerigar  ttcatgacgctgttgatccaggtcaggaaaggagcaatgtgtgtgtagaacc--caggcc-atttt----
  D                    Parrot  tgcatggttttcctgatccagggcaggtagttggcgatgcgggtgtagaccc--cggggg-gggcg----
  D             Scarlet macaw  ttcatggttttcctgatccagggcaggtagttggagatgcgggtgtagaccc--cgggtg-gagcg----
  D              Mallard duck  ttcatggttttcttgatccagggcaggtagttggagatgcgggtatagaccc--cggggg-ggttg----
B D        American alligator  ttgatgacctgatggagccagtggatgtagagggaaacgcgtgtgtagatgt--cgggga-agcgg----
  D           Green seaturtle  tgcagaatgttctggatccagggaatgaaggtggagagtcttgtaaacacgc--ttggctcgcacaaa--
  D            Painted turtle  ctcatcgtcctccgtatccagggaatgaaggtggagactctcacgtagaccc--ttggggggcgccca--
  D  Chinese softshell turtle  cgcatgttggccttgatccagggcagaaagtgggaaatccgagtgaacacaa--caggag-gcgtgat--
  D    Spiny softshell turtle  ggcaggttggctttgatccagggcaggaagtgggaaatccgagtgaacacag--ccggag-gcgcgat--
     Mexican tetra (cavefish)  tgtatggtccggttgatccaggaattgtagttgcagaccttggtgtagacgc--caggac-tgttcttct

                        Human  --gcatccgaccgtc---c---------------ataggatacgatgccctgggccaccccagcacacag
                        Chimp  --gcatccgaccgtc---c---------------ataggatacgatgccctgggccaccccagcacacac
                      Gorilla  --gcatccgaccgtc---c---------------ataggatacgatgccctgggccaccccagcacacag
                    Orangutan  --gcatccgaccgtc---c---------------ataggatacgatgccctgggctaccccagcacacag
                       Gibbon  --gcatccgaccgtc---c---------------ataggatacgatgccctgggccactccagcacacac
                       Rhesus  --gcatccaaccgtc---c---------------ataggatacgatgccctgggccaccccagcacacag
          Crab-eating macaque  --gcatccaaccgtc---c---------------ataggatacgatgccctgggccaccccagcacacag
                       Baboon  --gcatccaaccgtc---c---------------ataggatatgatgccctgggccaccccagcacacag
                 Green monkey  --gcatccaaccgac---c---------------ataggatacgatgccctgggccaccccagcacacag
                     Marmoset  --gcgtccacccgtc---c---------------gtaggatacgatgccctgggccaccccagcacacag
              Squirrel monkey  --gcatccctccgtc---c---------------ataggatacgatgccctgggccactccagcacacag
                     Bushbaby  --gcgttatgccgtc---c---------------ataggacacaatgccctgggccaccccagcacacag
           Chinese tree shrew  --gcatcccctcgac---c---------------ataggacacaatgccctgagccaccccagcacacag
                     Squirrel  --gcgttcagattta---c---------------ataggatgcaatgccctgggctatcccagcacacag
       Lesser Egyptian jerboa  --gcagtccgatgta---c---------------gtaggatgcaatgccctgggctatcccagcacatag
              Chinese hamster  --gctttccaatgta---c---------------ataggatgcgatgccttgggctatcccagcacacag
               Golden hamster  --gcattccgaagta---c---------------ataggatgcgatgccttgggctatcccagcacacag
                        Mouse  --gcattccgatgta---c---------------ataggatgcaatgccttgggctatcccagcacacag
                          Rat  --gcattcggatgta---c---------------gtaggatgcaatgccttgggctatcccagcacacag
               Naked mole-rat  --gcattccaatgtg---c---------------ataggatgcaatgccctgggctatcccagcacacag
                   Guinea pig  --gcattccgatgtg---c---------------ataggatacaatgccctgggctatccctgcacacag
                   Chinchilla  --gcattccgttgtg---c---------------ataggatgcgatgccctgggctatccctgcacacag
             Brush-tailed rat  --gcattccagtgtg---c---------------ataggatgcaatgccctgggctatgcctgcacatag
                       Rabbit  --gcattcttgtgtg---c---------------ataggatgcaatgccctgggccaccctagcacacag
                         Pika  --gcatctccagttg---c---------------ataagacacaatcccttgggccactcctgcacacaa
                          Pig  --gcatccgacggtc---c---------------ataggaga-------------caccccagagcacag
                      Dolphin  --gcatcccactgtc---c---------------ataggagacaatgccctgggccaccccagcgcagag
                 Killer whale  --gcatccgactgtc---c---------------ataggagacaatgccctgggccaccccagcgcagag
                          Cow  --gcattggacagtc---c---------------ataggagacaatgccctgggccaccccagcacacag
                        Sheep  --tcattggacagtc---c---------------ataggagacaatgccctgggcca-cccagcacacag
                        Horse  --gcatccacccggc---c---------------ataggagacaatgccctgggccaccccagcacatag
             White rhinoceros  --gcattgacctggc---c---------------ataggagacaatgccctgggccacccccgcacacag
                          Cat  --gcattcttccgtc---c---------------atgggagacaatgccctgagccaccccagcacacag
                          Dog  --gcatcattctgcc---c---------------ataggacacaattccctgggctaccccagcacacag
                      Ferret   --gcatccaactgtc---c---------------ataggagacaatgccctgggccaccccagcacagag
                        Panda  --gcatccttctgtc---c---------------ataggagacaatgccctgggccaccccagcacacag
               Pacific walrus  --gcattctcctgtc---c---------------ataggagacaataccctgggccaccccagcacacag
                 Weddell seal  --gcatctccacgtc---c---------------gtaaaacacaatatgttgggccacacctgcacacaa
             Black flying-fox  --acatccttccgtc---c---------------atagaagacaatgccatgggccactccaacacacag
                      Megabat  --acatccttccgtc---c---------------atagaagacaatgccatgggccaccccaacacacag
                Big brown bat  --gcatctttacgtc---c---------------atatgacacaataccctgggccaccccagcacacag
         David's myotis (bat)  --gcagtctcctttc---c---------------ataggagacaatgccttgagctaccccagcacacag
                     Microbat  --gcagtcttctttc---c---------------ataggagacaatgccatgagccaccccagcacatag
                     Hedgehog  --ccatccagccgta---c---------------ataggacacgacaccctgggctaccccagcacacat
                        Shrew  --gcgttaaactgtc---c---------------ataggacacaatgccttgggccacaccagcacacag
                     Elephant  --gcattctgctgtc---c---------------gtaggagacaatgccctgggctaacccagcacacag
          Cape elephant shrew  --gcatcccctcgtc---c---------------ataggaaacaatgccttgggccactccagcacatag
                      Manatee  --gcattcccctgtc---c---------------ataagagacaatgccctgggccactccagcatacag
             Cape golden mole  --gcatcatgccttc---c---------------ataagagacaatgccctgggccaccccagcacacag
                       Tenrec  --gcattccacttcc---c---------------ataggagacaatgccatgggccaccccagcacacag
                     Aardvark  --gcattcccccgtc---c---------------ataggagacaatgccctgggccaccccagcacacag
                    Armadillo  --gcgtctggccgtc---c---------------ataggagacaatgccctgggccaccccagcacacag
                      Opossum  --gcatcatgtcttc---c---------------ataggagacaatgccttgtgccacaccagaacaaat
              Tasmanian devil  --gcatcatgttgtc---c---------------ataagagacaattccttgggccacaccagaacaaac
                      Wallaby  --gcatcagttcttc---c---------------ataggagacaacaccttgggccacaccagaacaaat
                     Platypus  --ccggcccatctcc---c---------------gtaggagacgatgccctgggcttgctttccacacac
                  Rock pigeon  --------ttgtacc---t---------------gaaggaaacgatgccgtgtgccaccttattgcacac
                 Saker falcon  --------ttgtacc---c---------------gaaggaaacgatgccttgtgccacgttcttgcacac
             Peregrine falcon  --------ttgtacc---c---------------gaaggaaacgatgccttgtgccatgttcttgcacac
          Collared flycatcher  --------ctgtagc---c---------------gaaggacacaaccccatgtgccactttgttacatac
       White-throated sparrow  --------tcatagc---c---------------aaaggaaacaactccttgtgccacgttattgcacac
          Medium ground finch  ----gtcttcatatc---c---------------atgagaaacaatgccatgagccttcttattgcagac
           Tibetan ground jay  --------ttgtgtc---t---------------gtaggagaagatgccataggctttgttgttgcagac
                   Budgerigar  --------tcgtgcc---g---------------gtaggagaagatgccgtaggctttgttgtcgcagac
                       Parrot  --------ttgtacc---c---------------gaaggacacgatgccttgtgccaccccattgcacac
                Scarlet macaw  --------ttgtacc---c---------------gaaggacacgatgccttgcgccaccccattgcacac
                 Mallard duck  --------tcatgcc---c---------------gaaggaaacgatgcctcgtgccaccttattgcacac
           American alligator  --------cggtccc---cgcacttctgtccggagaaggacacgacgccgcagaccctggccccgcagac
              Green seaturtle  -----tgcttgtcaa---c---------------gtatgaagcgatgccctgggccactccctcacatac
               Painted turtle  --------ttgacaggccc---------------ccaagagacgacgccctgagctgttttcccacacac
     Chinese softshell turtle  -gctgttcttgacac---c---------------aaaggagacgatgccctcggccactccaccgcacac
       Spiny softshell turtle  -gctgttactcatgc---a---------------cctggagacgatgccctcggccactccacggcacac
     Mexican tetra (cavefish)  gagcgcagccgtaac---c---------------ccaggacacgataccctgcacctccccgttacacac

                        Human  aagagggcccccagagtctccctg
                        Chimp  aagagggcccccagagtctccctg
                      Gorilla  aagagggcccccagagtctccctg
                    Orangutan  aagagggcccccagagtctccctg
                       Gibbon  aagagggcccccagagtctccctg
                       Rhesus  aagagggcccccagagtctccctg
          Crab-eating macaque  aagagggcctccagagtctccctg
                       Baboon  aagagggcccccagagtctccctg
                 Green monkey  aagagggcccccagagtctccctg
                     Marmoset  aagagggcccccggagtctccctg
              Squirrel monkey  aagagggcccccggagtctccctg
                     Bushbaby  aagagggcccccagagtctccctg
           Chinese tree shrew  aagagggcctccagagtctccctg
                     Squirrel  aagggggcccccagagtctccctg
       Lesser Egyptian jerboa  aagggggcctccagagtctccctg
              Chinese hamster  gagaggtcctccagagtctccctg
               Golden hamster  gagaggtcctccagagtctccctg
                        Mouse  cagaggtcctccagagtctccctg
                          Rat  gagaggtcctccagagtctccctg
               Naked mole-rat  gagggggcctccagagtctccctg
                   Guinea pig  gaggggacctccagagtctccctg
                   Chinchilla  gagggggcctccagagtctccctg
             Brush-tailed rat  cagtgggcctccagaatctctctg
                       Rabbit  aagaggg-ccccagagtctccctg
                         Pika  gagggggcccccagaatctccctg
                          Pig  aagagg--cccccgagtctccctg
                      Dolphin  aagagggccccctgagtctccctg
                 Killer whale  aagagggccccctgagtctccctg
                          Cow  aagagggccccccgagtctccctg
                        Sheep  aaaagggccccctgagtctccctg
                        Horse  aagaggaccccctgagtctccctg
             White rhinoceros  aagagggccccccgagtctccctg
                          Cat  aagagggccccctgaatctccctg
                          Dog  aagagggccccctgaatctccctg
                      Ferret   aagagggccccctgaatctccctg
                        Panda  aagagggccccctgaatctccctg
               Pacific walrus  aagagggccccctgaatctccctg
                 Weddell seal  cagggggcccccagaatccccctg
             Black flying-fox  aagagggccccctgagtctccctg
                      Megabat  aagagggccccctgagtctccctg
                Big brown bat  aagggggcccccagagtcaccctg
         David's myotis (bat)  aagaggacctcctgagtctccctg
                     Microbat  aagaggcccccctgagtctccctg
                     Hedgehog  tagagggcctcctgagtcgccc--
                        Shrew  aagagggccccccgagtctccctg
                     Elephant  aagagggctcccagagtctccctg
          Cape elephant shrew  aagagggccccctgaatctccctg
                      Manatee  aagagggcctccagagtctccctg
             Cape golden mole  aagcgggcccccagagtctcccta
                       Tenrec  aagagggcccccagagtctccctg
                     Aardvark  aagaggtcccccagagtctccctg
                    Armadillo  aagaggccccccagagtctccctg
                      Opossum  gaggggtcctccagagtctccctg
              Tasmanian devil  gaggggtcctccagaatctcccta
                      Wallaby  gaggggtcctccagaatctcccta
                     Platypus  catagggcctcctgaatctccctg
                  Rock pigeon  caggggcccaccggaatctccctg
                 Saker falcon  caggggccccccagaatctccctg
             Peregrine falcon  caggggccccccagaatctccctg
          Collared flycatcher  cagggggccaccggaatctccctg
       White-throated sparrow  caggggcccgccagaatctccctg
          Medium ground finch  taatgggccaccagaatcaccctg
           Tibetan ground jay  cagcggatccccagcatcaccctg
                   Budgerigar  caacgggtccccagcatcaccctg
                       Parrot  caggagcccgcctgaatctccctg
                Scarlet macaw  caggggcccacctgaatctccctg
                 Mallard duck  caggggcccaccagaatcaccctg
           American alligator  cagggggccccccgagtcaccctg
              Green seaturtle  caaggggccaccagaatcaccctg
               Painted turtle  cagggggcccccagagtcaccctg
     Chinese softshell turtle  aagagggcctccagaatcgccctg
       Spiny softshell turtle  aagggggcccccggaatcgccctg
     Mexican tetra (cavefish)  gaccgggcctccagagtctccctg

Inserts between block 17 and 18 in window
  D          Green seaturtle 919bp
  D Chinese softshell turtle 3bp
  D   Spiny softshell turtle 3bp

Alignment block 18 of 160 in window, 24505663 - 24505671, 9 bps 
B D                     Human  ta---------------g---------------------------------------gggg-------ag
B D                     Chimp  ta---------------g---------------------------------------gggg-------ag
B D                   Gorilla  ta---------------g---------------------------------------gggg-------ag
B D                 Orangutan  ta---------------g---------------------------------------gggg-------ag
B D                    Gibbon  ta---------------g---------------------------------------gggg-------aa
B D                    Rhesus  ga---------------g---------------------------------------gggg-------ag
B D       Crab-eating macaque  ga---------------g---------------------------------------gggg-------ag
B D                    Baboon  ga---------------g---------------------------------------gggg-------ag
B D              Green monkey  ga---------------g---------------------------------------gggg-------ag
B D                  Marmoset  ta---------------g---------------------------------------gggg-------ag
B D           Squirrel monkey  ta---------------g---------------------------------------ggga-------ag
B D                  Bushbaby  tg---------------g---------------------------------------gg-----------
           Chinese tree shrew  tg---------------g---------------------------------------gatg-------ag
B D                  Squirrel  tg---------------g---------------------------------------agggggagggagg
       Lesser Egyptian jerboa  tt---------------g---------------------------------------ggta---------
B D           Chinese hamster  tt---------------g---------------------------------------ggga-------gg
               Golden hamster  tt---------------a---------------------------------------ggga-------gg
B D                     Mouse  tt---------------g---------------------------------------ggggt------gg
B D                       Rat  tt---------------g---------------------------------------ggggt------gg
B D            Naked mole-rat  tg---------------a------------------------------------------a-------gg
B D                Guinea pig  ag---------------a---------------------------------------gaga-------ag
                   Chinchilla  tg---------------aggggaaggagggggagagagagagagaaaaagagagagggaga-------gg
             Brush-tailed rat  tg---------------a------------------------------------------a-------gg
B D                    Rabbit  tt---------------g---------------------------------------gggt-------tg
B D                      Pika  t--------------------------------------------------------ggat-------t-
B D                       Pig  tg---------------g---------------------------------------ggca-------ca
B D                   Dolphin  tg---------------g---------------------------------------gaca-------ga
                 Killer whale  tg---------------g---------------------------------------gaca-------ga
B D                       Cow  tg---------------g---------------------------------------gaca-------ga
B D                     Sheep  tg---------------g---------------------------------------aa-a-------ga
B D                     Horse  tg---------------g---------------------------------------gtca-------ga
B D          White rhinoceros  tg---------------g---------------------------------------gaca-------ga
B D                       Cat  tg---------------g---------------------------------------ggca-------ga
B D                       Dog  tg---------------g---------------------------------------ggca-------ga
B D                   Ferret   tg---------------g---------------------------------------gaca-------ga
B D                     Panda  tg---------------g---------------------------------------ggca-------ga
               Pacific walrus  tg---------------g---------------------------------------gaca-------ga
                 Weddell seal  tg---------------g---------------------------------------gtta-------ga
             Black flying-fox  tgtgtgtgtaggagtggg---------------------------------------ggtg-------ga
B D                   Megabat  tgtgtgtgtaggagtggg---------------------------------------ggtg-------ga
                Big brown bat  tg-----ggttaaa--------------------------------------------------------
         David's myotis (bat)  ta-----gtaggag---g---------------------------------------agga-------ga
B D                  Microbat  tg-----ggaggagggag---------------------------------------ggga-------ga
B D                  Hedgehog  --------------taga---------------------------------------tttg-------tg
B D                     Shrew  ta--------gatatata---------------------------------------tata-------ta
B D                  Elephant  tg---------------g---------------------------------------aggg-------ac
          Cape elephant shrew  tg---------------g---------------------------------------ttgt-------gt
B D                   Manatee  tt---------------g---------------------------------------gggg-------ag
             Cape golden mole  tt---------------t---------------------------------------gggg-------ag
B D                    Tenrec  tg---------------t---------------------------------------gggg-------ag
                     Aardvark  tg---------------g---------------------------------------aggg-------gg
B D                 Armadillo  tg---------------g---------------------------------------ggca-------aa
B D                   Opossum  tt---------------a---------------------------------------gaca-------aa
B D           Tasmanian devil  tt---------------a---------------------------------------gaca-------aa
B D                   Wallaby  tt---------------a---------------------------------------gaca-------aa
B D                  Platypus  ca---------------g---------------------------------------gaca-------aa
  D               Rock pigeon  --------------------------------------------------------------------gg
  D              Saker falcon  --------------------------------------------------------------------ag
  D          Peregrine falcon  --------------------------------------------------------------------ag
  D       Collared flycatcher  --------------------------------------------------------------------gg
B D       Medium ground finch  --------------------------------------------------------------------tg
           Tibetan ground jay  --------------------------------------------------------------------tg
B D                Budgerigar  --------------------------------------------------------------------gg
  D                    Parrot  --------------------------------------------------------------------gg
  D             Scarlet macaw  --------------------------------------------------------------------gg
  D              Mallard duck  --------------------------------------------------------------------ag
B D        American alligator  --------------------------------------------------------------------ca
  D            Painted turtle  -------------------------------------------------------------------cga
  D  Chinese softshell turtle  -------------------------------------------------------------------cag
  D    Spiny softshell turtle  -------------------------------------------------------------------cgg
     Mexican tetra (cavefish)  ---------------------------------------------------------cagg-------gg
  D    White-throated sparrow  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================

                        Human  ---
                        Chimp  ---
                      Gorilla  ---
                    Orangutan  ---
                       Gibbon  ---
                       Rhesus  ---
          Crab-eating macaque  ---
                       Baboon  ---
                 Green monkey  ---
                     Marmoset  ---
              Squirrel monkey  ---
                     Bushbaby  ---
           Chinese tree shrew  ---
                     Squirrel  ---
       Lesser Egyptian jerboa  ---
              Chinese hamster  ---
               Golden hamster  ---
                        Mouse  ---
                          Rat  ---
               Naked mole-rat  ---
                   Guinea pig  ---
                   Chinchilla  ---
             Brush-tailed rat  ---
                       Rabbit  ---
                         Pika  ---
                          Pig  ---
                      Dolphin  ---
                 Killer whale  ---
                          Cow  ---
                        Sheep  ---
                        Horse  ---
             White rhinoceros  ---
                          Cat  ---
                          Dog  ---
                      Ferret   ---
                        Panda  ---
               Pacific walrus  ---
                 Weddell seal  ---
             Black flying-fox  ---
                      Megabat  ---
                Big brown bat  ---
         David's myotis (bat)  ---
                     Microbat  ---
                     Hedgehog  ---
                        Shrew  ---
                     Elephant  ---
          Cape elephant shrew  ---
                      Manatee  ---
             Cape golden mole  ---
                       Tenrec  ---
                     Aardvark  ---
                    Armadillo  ---
                      Opossum  ---
              Tasmanian devil  ---
                      Wallaby  ---
                     Platypus  ---
                  Rock pigeon  ---
                 Saker falcon  ---
             Peregrine falcon  ---
          Collared flycatcher  ---
          Medium ground finch  ---
           Tibetan ground jay  ---
                   Budgerigar  ---
                       Parrot  ---
                Scarlet macaw  ---
                 Mallard duck  ---
           American alligator  ---
               Painted turtle  ---
     Chinese softshell turtle  ---
       Spiny softshell turtle  ---
     Mexican tetra (cavefish)  ttg
       White-throated sparrow  ---
              Green seaturtle  ===

Inserts between block 18 and 19 in window
               Big brown bat 6bp
B D                 Elephant 1bp
         Cape elephant shrew 2bp
B D                  Manatee 5bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 135bp
B D                 Platypus 3bp
  D              Rock pigeon 4bp
  D             Saker falcon 4bp
  D         Peregrine falcon 4bp
  D      Collared flycatcher 4bp
B D      Medium ground finch 4bp
          Tibetan ground jay 10bp
B D               Budgerigar 8bp
  D                   Parrot 4bp
  D            Scarlet macaw 4bp
  D             Mallard duck 4bp
B D       American alligator 4bp
  D           Painted turtle 4bp
  D Chinese softshell turtle 4bp
  D   Spiny softshell turtle 4bp

Alignment block 19 of 160 in window, 24505672 - 24505674, 3 bps 
B D                     Human  gag
B D                     Chimp  gag
B D                   Gorilla  gag
B D                 Orangutan  gag
B D                    Gibbon  gag
B D                    Rhesus  gag
B D       Crab-eating macaque  gag
B D                    Baboon  gag
B D              Green monkey  gag
B D                  Marmoset  gag
B D           Squirrel monkey  gag
B D                  Bushbaby  cag
           Chinese tree shrew  ggg
B D                  Squirrel  agg
B D           Chinese hamster  cac
               Golden hamster  cac
B D                     Mouse  ggc
B D                       Rat  gga
B D            Naked mole-rat  tgg
B D                Guinea pig  gag
                   Chinchilla  ggg
             Brush-tailed rat  ggg
B D                    Rabbit  agg
B D                       Pig  gag
B D                   Dolphin  gag
                 Killer whale  gag
B D                       Cow  gaa
B D                     Sheep  gaa
B D                     Horse  gag
B D          White rhinoceros  gag
B D                       Cat  gag
B D                       Dog  gag
B D                   Ferret   ggt
B D                     Panda  cgg
               Pacific walrus  gag
                 Weddell seal  gaa
             Black flying-fox  gag
B D                   Megabat  gag
         David's myotis (bat)  gag
B D                  Microbat  gag
B D                  Hedgehog  gag
B D                     Shrew  gag
B D                  Elephant  gag
          Cape elephant shrew  tag
B D                   Manatee  gag
             Cape golden mole  gag
B D                    Tenrec  cag
                     Aardvark  gag
B D                 Armadillo  gag
B D                   Opossum  ggg
B D           Tasmanian devil  gag
B D                   Wallaby  ggg
B D                  Platypus  gag
  D               Rock pigeon  ga-
  D       Collared flycatcher  ga-
  D    White-throated sparrow  ga-
B D       Medium ground finch  ga-
           Tibetan ground jay  ga-
B D                Budgerigar  ga-
  D                    Parrot  ga-
  D             Scarlet macaw  ga-
  D              Mallard duck  ga-
B D        American alligator  ca-
  D            Painted turtle  aa-
  D  Chinese softshell turtle  ag-
  D    Spiny softshell turtle  aa-
     Mexican tetra (cavefish)  ggg
      Lesser Egyptian jerboa  ---
B D                      Pika  ---
               Big brown bat  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D           Green seaturtle  ===

Inserts between block 19 and 20 in window
  D              Rock pigeon 1239bp
  D      Collared flycatcher 45bp
          Tibetan ground jay 20bp
B D               Budgerigar 4bp
  D                   Parrot 4bp
  D            Scarlet macaw 4bp
  D             Mallard duck 4bp
B D       American alligator 6bp
  D           Painted turtle 3bp
  D Chinese softshell turtle 3bp
  D   Spiny softshell turtle 3bp

Alignment block 20 of 160 in window, 24505675 - 24505675, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                       Pig  g
B D                   Dolphin  g
                 Killer whale  g
B D                       Cow  g
B D                     Sheep  g
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   g
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
B D                  Elephant  a
          Cape elephant shrew  g
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                   Opossum  g
B D           Tasmanian devil  g
B D                   Wallaby  a
B D                  Platypus  g
B D                Budgerigar  a
  D                    Parrot  a
  D             Scarlet macaw  a
  D              Mallard duck  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  g
     Mexican tetra (cavefish)  a
      Lesser Egyptian jerboa  -
B D                      Pika  -
               Big brown bat  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  -
  D    White-throated sparrow  -
  D           Green seaturtle  =
B D        American alligator  =
  D       Collared flycatcher  =

Inserts between block 20 and 21 in window
                Weddell seal 2bp
B D               Budgerigar 11bp
  D                   Parrot 9bp
  D            Scarlet macaw 9bp
  D             Mallard duck 1bp

Alignment block 21 of 160 in window, 24505676 - 24505677, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
           Chinese tree shrew  gg
B D                  Squirrel  ga
B D           Chinese hamster  ga
               Golden hamster  ga
B D                     Mouse  ga
B D                       Rat  ga
B D            Naked mole-rat  gg
B D                Guinea pig  gg
                   Chinchilla  ga
             Brush-tailed rat  gg
B D                    Rabbit  ga
B D                       Pig  ga
B D                   Dolphin  ga
                 Killer whale  ga
B D                       Cow  ga
B D                     Sheep  ga
B D                     Horse  ga
B D          White rhinoceros  ga
B D                       Cat  ga
B D                       Dog  ga
B D                   Ferret   tg
B D                     Panda  ga
               Pacific walrus  aa
             Black flying-fox  ga
B D                   Megabat  aa
         David's myotis (bat)  ga
B D                  Microbat  ga
B D                  Hedgehog  ga
B D                     Shrew  ga
B D                  Elephant  aa
          Cape elephant shrew  aa
B D                   Manatee  aa
             Cape golden mole  ga
B D                    Tenrec  ga
                     Aardvark  ga
B D                 Armadillo  ga
B D                   Opossum  ga
B D           Tasmanian devil  ag
B D                   Wallaby  aa
B D                  Platypus  gg
  D              Saker falcon  gg
  D          Peregrine falcon  gg
  D    White-throated sparrow  ga
B D       Medium ground finch  aa
           Tibetan ground jay  aa
B D                Budgerigar  ta
  D                    Parrot  ga
  D             Scarlet macaw  ga
  D              Mallard duck  ca
B D        American alligator  gc
  D            Painted turtle  gc
  D  Chinese softshell turtle  ga
  D    Spiny softshell turtle  ga
     Mexican tetra (cavefish)  aa
      Lesser Egyptian jerboa  --
B D                      Pika  --
               Big brown bat  ==
                Weddell seal  ==
  D               Rock pigeon  ==
  D           Green seaturtle  ==
  D       Collared flycatcher  ==

Alignment block 22 of 160 in window, 24505678 - 24505681, 4 bps 
B D                     Human  -----g----------------------------------------------------aga
B D                     Chimp  -----g----------------------------------------------------aga
B D                   Gorilla  -----g----------------------------------------------------aga
B D                 Orangutan  -----g----------------------------------------------------aga
B D                    Gibbon  -----g-------------------------------------------------------
B D                    Rhesus  -----gag-----------------------------aga-----g------------aga
B D       Crab-eating macaque  -----gag-----------------------------aga-----g------------aga
B D                    Baboon  -----gag-----------------------------aga-----g------------aga
B D              Green monkey  -----gag-----------------------------aga-----g------------aga
B D                  Marmoset  -----gag-----------------------------aga--gtag------------agc
B D           Squirrel monkey  -----gag-----------------------------agag-gtag------------agc
B D                  Bushbaby  -----g----------------------------------------------------aac
           Chinese tree shrew  -----a----------------------------------------------------gga
B D                  Squirrel  -----gag-----------------------------ggagggcaggagggagagaaagag
       Lesser Egyptian jerboa  -----gag-----------------------------agaatggat------------gaa
B D           Chinese hamster  -----gag-----------------------------gaaatgtat------------gaa
               Golden hamster  -----gag-----------------------------gaaatgc----------------a
B D                     Mouse  -----gag-----------------------------gaa--acat------------gaa
B D                       Rat  -----gag-----------------------------gaaacacat------------gag
B D            Naked mole-rat  -----gag-------------------------------------a------------gag
B D                Guinea pig  -----gag------------------------------aaacaaga------------aca
                   Chinchilla  -----gagagagagagagagagagagagagagagagagagagagaa------------aca
             Brush-tailed rat  -----gag-------------------------------------a------------aca
B D                    Rabbit  -----gag-----------------------------agagagaga------------ata
B D                      Pika  ------ag-----------------------------agaaagtaa------------ata
B D                       Pig  -----ga------------------------------------------------------
B D                   Dolphin  -----aa------------------------------------------------------
                 Killer whale  -----aa------------------------------------------------------
B D                       Cow  -----aa------------------------------------------------------
B D                     Sheep  -----aa------------------------------------------------------
B D                     Horse  -----ga------------------------------------------------------
B D          White rhinoceros  -----ga------------------------------------------------------
B D                       Cat  -----ga------------------------------------------------------
B D                       Dog  -----aa------------------------------------------------------
B D                   Ferret   -----g-------------------------------------------------------
B D                     Panda  -----ga------------------------------------------------------
               Pacific walrus  -----ga------------------------------------------------------
             Black flying-fox  -----ga------------------------------------------------------
B D                   Megabat  -----gg------------------------------------------------------
         David's myotis (bat)  -----ga------------------------------------------------------
B D                  Microbat  -----ga------------------------------------------------------
B D                  Hedgehog  -----ga------------------------------------------------------
B D                     Shrew  -----ga------------------------------------------------------
B D                  Elephant  -----gag--------------------------------------------------aga
          Cape elephant shrew  -----gag--------------------------------------------------aga
B D                   Manatee  -----gag--------------------------------------------------gga
             Cape golden mole  -----aag--------------------------------------------------aaa
B D                    Tenrec  -----a-------------------------------------------------------
                     Aardvark  -----aa------------------------------------------------------
B D                 Armadillo  -----aac--------------------------------------------------aga
B D                   Opossum  agaga--------------------------------------------------------
B D                  Platypus  -----ga------------------------------------------------------
  D              Saker falcon  -----gg------------------------------------------------------
  D          Peregrine falcon  -----gg------------------------------------------------------
  D    White-throated sparrow  -----ga------------------------------------------------------
B D       Medium ground finch  -----gg------------------------------------------------------
           Tibetan ground jay  -----gg------------------------------------------------------
B D                Budgerigar  -----ga------------------------------------------------------
  D                    Parrot  -----ga------------------------------------------------------
  D             Scarlet macaw  -----ga------------------------------------------------------
  D              Mallard duck  -----gt------------------------------------------------------
B D        American alligator  -----gg------------------------------------------------------
  D            Painted turtle  -----ca------------------------------------------------------
  D  Chinese softshell turtle  -----ga------------------------------------------------------
  D    Spiny softshell turtle  -----ga------------------------------------------------------
               Big brown bat  =============================================================
                Weddell seal  =============================================================
  D               Rock pigeon  =============================================================
B D                   Wallaby  -------------------------------------------------------------
  D           Green seaturtle  =============================================================
B D           Tasmanian devil  -------------------------------------------------------------
  D       Collared flycatcher  =============================================================

Inserts between block 22 and 23 in window
B D                      Pig 7bp
B D                  Dolphin 7bp
                Killer whale 7bp
B D                      Cow 7bp
B D                    Sheep 7bp
B D                    Horse 26bp
B D         White rhinoceros 8bp
B D                      Cat 48bp
B D                      Dog 18bp
B D                  Ferret  16bp
B D                    Panda 19bp
              Pacific walrus 25bp
            Black flying-fox 150bp
B D                  Megabat 162bp
        David's myotis (bat) 41bp
B D                 Microbat 79bp
B D                 Hedgehog 2bp
B D                    Shrew 3bp
B D                 Elephant 8bp
         Cape elephant shrew 2bp
B D                  Manatee 18bp
            Cape golden mole 8bp
B D                   Tenrec 1bp
                    Aardvark 2bp
B D                Armadillo 2bp
B D                 Platypus 6167bp

Alignment block 23 of 160 in window, 24505682 - 24505683, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  ac
           Chinese tree shrew  ag
B D                  Squirrel  ag
       Lesser Egyptian jerboa  tg
B D           Chinese hamster  tg
               Golden hamster  tg
B D                     Mouse  tg
B D                       Rat  tg
B D            Naked mole-rat  ag
B D                Guinea pig  ag
                   Chinchilla  ag
             Brush-tailed rat  ag
B D                    Rabbit  tg
B D                   Opossum  ag
B D                  Platypus  ag
  D              Saker falcon  ag
  D          Peregrine falcon  ag
  D    White-throated sparrow  ga
B D       Medium ground finch  ag
           Tibetan ground jay  ag
B D                Budgerigar  tg
  D                    Parrot  gg
  D             Scarlet macaw  gg
  D              Mallard duck  tg
B D        American alligator  ag
  D            Painted turtle  ca
  D  Chinese softshell turtle  aa
  D    Spiny softshell turtle  cg
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                      Pika  --
B D                       Dog  ==
B D                     Panda  ==
B D                   Ferret   ==
        David's myotis (bat)  ==
B D                   Manatee  ==
B D                  Microbat  ==
               Big brown bat  ==
B D                       Cow  ==
B D                     Sheep  ==
                Killer whale  ==
B D                 Armadillo  ==
            Black flying-fox  ==
B D                       Cat  ==
B D                  Elephant  ==
              Pacific walrus  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D                       Pig  ==
                Weddell seal  ==
B D                   Dolphin  ==
  D               Rock pigeon  ==
B D                   Wallaby  --
                    Aardvark  ==
            Cape golden mole  ==
B D                   Megabat  ==
  D           Green seaturtle  ==
B D           Tasmanian devil  --
  D       Collared flycatcher  ==

Inserts between block 23 and 24 in window
          Chinese tree shrew 2bp
  D           Painted turtle 4bp
  D Chinese softshell turtle 2393bp

Alignment block 24 of 160 in window, 24505684 - 24505700, 17 bps 
B D                     Human  ----------------a-----aggtg--------agcccgg-gaa-g
B D                     Chimp  ----------------a-----aggtg--------agcccgg-gaa-g
B D                   Gorilla  ----------------a-----aggtg--------agcccgg-gaa-g
B D                 Orangutan  ----------------a-----aggtg--------agcctgg-gaa-g
B D                    Gibbon  ----------------a-----aggtg--------agcccgg-gaa-g
B D                    Rhesus  ----------------a-----aggta--------agcccag-gaa-g
B D       Crab-eating macaque  ----------------a-----aggta--------agcccag-gaa-g
B D                    Baboon  ----------------a-----aggta--------agcccag-gaa-g
B D              Green monkey  ----------------a-----aggta--------agcccag-gaa-g
B D                  Marmoset  ----------------a-----aggtg--------agcccgg-gaa-g
B D           Squirrel monkey  ----------------a-----aggtg--------agcccgg-gaa-g
B D                  Bushbaby  ----------------a-----aagtg--------atccagg-gaa-g
           Chinese tree shrew  ----------------a-----aggtg--------agccagg-aaa-g
B D                  Squirrel  ----------------aataggtggtt--------agtcagg--aa-g
       Lesser Egyptian jerboa  ----------------aggaggaattg--------agccaac--aa-a
B D           Chinese hamster  ----------------aat-----------------gc----------
               Golden hamster  ----------------aat-----------------gc----------
B D                     Mouse  ----------------gataggagggc--------agc----------
B D                       Rat  ----------------cataggaggg---------aac----------
B D            Naked mole-rat  ----------------aataagaggtg--------agctagg--aa-g
B D                Guinea pig  ----------------gacaa-aagtg--------agctaag--aa-g
                   Chinchilla  ----------------gataagaggtg--------agctagg--aa-a
             Brush-tailed rat  ----------------aacaagaggta--------agctggg--aa-a
B D                    Rabbit  ----------------aacac-aggtg--------agccagg-gaa-g
B D                      Pika  ------------------------atg--------agcc-----aa-g
B D                       Pig  -------------------a---agtg--------agccagg-gac-a
B D                   Dolphin  -------------------agagagaggaaaggtgagccagg-ga--a
                 Killer whale  -------------------agagagaggaaaggtgagccagg-ga--a
B D                       Cow  -------------------agaaggtg--------agccagg-ga--a
B D                     Sheep  -------------------aaggggag---------------------
B D                     Horse  -------------------agaaggtg--------agccagg-gaa-g
B D          White rhinoceros  -------------------agaaagtg--------agccagg-gaa-g
B D                       Cat  -------------------agaaggtg--------ag-ctgg-gaa-g
B D                       Dog  -------------------agaaggtc--------ag-caga-gaa-g
B D                   Ferret   -------------------agaaggtg--------ag-cagg-gaa-t
B D                     Panda  -------------------agaaggtg--------ag-cagg-gaa-g
               Pacific walrus  -------------------agaaggtg--------ag-cagg-gaa-g
                 Weddell seal  -------------------agatcgtg--------ag-cagg-gaatg
             Black flying-fox  -------------------agaaggtg--------agccagg-gaa-a
B D                   Megabat  -------------------agaaggtg--------agccagg-gaa-a
                Big brown bat  -------------------agatcatg--------agcagag-att-a
         David's myotis (bat)  -------------------agaaggtg--------agtcagg-aaa-c
B D                  Microbat  -------------------aaacggtg--------agtcagg-aaa-g
B D                  Hedgehog  -------------------agaagatg--------aatgaag-gat-g
B D                     Shrew  -------------------agaaaaag--------agagaga-ga--g
B D                  Elephant  -------------------agaaggtg--------agttaag-gaa-g
          Cape elephant shrew  -------------------aaaatgtg--------agttaagagaa-g
B D                   Manatee  -------------------agaaagtg--------agttaag-gaa-g
             Cape golden mole  -------------------ataaggtg--------agtttaa-aaa-g
B D                    Tenrec  -------------------agaaagcg--------agttaag-cca-g
                     Aardvark  -------------------agaaggtg--------agttaaa-gaa-g
B D                 Armadillo  -------------------cgaaggtg--------agcgagc-aga-g
B D                   Opossum  -------------------------ta--------agcaaga-aag-g
B D           Tasmanian devil  -------------------------ta--------agcaaga-aag-g
B D                  Platypus  ---------------------aggata--------agctggg---c-t
  D              Saker falcon  ---------------tg-------------------------------
  D          Peregrine falcon  ---------------ag-------------------------------
  D    White-throated sparrow  ---------------tg-------------------------------
B D       Medium ground finch  ---------------tg-------------------------------
           Tibetan ground jay  ---------------tg-------------------------------
B D                Budgerigar  ---------------gg-------------------------------
  D                    Parrot  ---------------cc-------------------------------
  D             Scarlet macaw  ---------------cc-------------------------------
  D              Mallard duck  ---------------tc-------------------------------
B D        American alligator  ---------------gg-------------------------------
  D            Painted turtle  aagaaatgctcagtgag-------------------------------
  D  Chinese softshell turtle  --gaa------aacggc-------------------------------
  D    Spiny softshell turtle  -------------catg-------------------------------
  D               Rock pigeon  ================================================
B D                   Wallaby  ------------------------------------------------
  D           Green seaturtle  ================================================
  D       Collared flycatcher  ================================================

Inserts between block 24 and 25 in window
  D             Saker falcon 16bp
  D         Peregrine falcon 16bp
  D   White-throated sparrow 9bp
B D      Medium ground finch 15bp
          Tibetan ground jay 29bp
B D               Budgerigar 18bp
  D                   Parrot 18bp
  D            Scarlet macaw 18bp
  D             Mallard duck 15bp
B D       American alligator 13bp

Alignment block 25 of 160 in window, 24505701 - 24505713, 13 bps 
B D                     Human  t-c--ctcca-ctcctg
B D                     Chimp  t-c--ctcca-ctcctg
B D                   Gorilla  t-c--ctcca-ctcctg
B D                 Orangutan  t-c--ctcca-ctcctg
B D                    Gibbon  t-c--ctcca-ctcctg
B D                    Rhesus  t-c--ctcca-ctcctg
B D       Crab-eating macaque  t-c--ctcca-ctcctg
B D                    Baboon  t-c--ttcca-ctcctg
B D              Green monkey  t-c--ctcca-ctcctg
B D                  Marmoset  t-c--ctcca-ctcctg
B D           Squirrel monkey  t-c--ctcca-ctcctg
B D                  Bushbaby  t-c--ctggt-ctcctg
           Chinese tree shrew  t-c--ctcca-gtccaa
B D                  Squirrel  t-t--cttca-ctcctg
       Lesser Egyptian jerboa  t-g--ctttc-tctctg
B D           Chinese hamster  -----ctcta-cctct-
               Golden hamster  -----ctcta-cctct-
B D                     Mouse  -----ctcta-cctcta
B D                       Rat  -----ctcta-cctctg
B D            Naked mole-rat  t-c--ctcca-cccctg
B D                Guinea pig  t-c--ctcca-accctg
                   Chinchilla  t-c--ctcca-accc-a
             Brush-tailed rat  t-c--ctcca-accctg
B D                    Rabbit  t-c--tacca-ctcctg
B D                      Pika  a-t--tgccc-ttccat
B D                       Pig  c-c--acaca-ctcctt
B D                   Dolphin  c-c--accca-ctcctc
                 Killer whale  c-c--accca-ctcctc
B D                       Cow  a-c--caccacctcctc
B D                     Sheep  -----------ctcctc
B D                     Horse  t-a--atcca-ctcctg
B D          White rhinoceros  t-c--atcca-ctcctg
B D                       Cat  t-c--atcta-ctcc--
B D                       Dog  t-c--atcca-cttctg
B D                   Ferret   t-c--atcca-ttcctt
B D                     Panda  t-c--atcca-ctaccg
               Pacific walrus  t-c--atcca-ctcctg
                 Weddell seal  t-c--cttct-cttcct
             Black flying-fox  t-c--attca-ctcatg
B D                   Megabat  t-c--attca-ctcatg
                Big brown bat  c-t--tccta-ctatta
         David's myotis (bat)  t-c--atcta-ctcctg
B D                  Microbat  t-c--atcta-ctcctg
B D                  Hedgehog  t-t--actcc-gtcttg
B D                     Shrew  a-g--agtgt-gtcagg
B D                  Elephant  t-c--ctcca-cttctg
          Cape elephant shrew  c-t--attca-ttggag
B D                   Manatee  t-c--ctcca-ctcctg
             Cape golden mole  t-c--ctcca-ctccta
B D                    Tenrec  g-c--tgcca-gtcctg
                     Aardvark  tcc--cccca-ttcctg
B D                 Armadillo  t-c--ttcta-ctcctg
B D                   Opossum  t-tgattcta-ctttgc
B D           Tasmanian devil  c-tgatccta-ccttgc
B D                  Platypus  t-c--cccca-gtttcc
  D              Saker falcon  ------tttt-ccctgc
  D          Peregrine falcon  ------tctt-ccctgc
  D       Collared flycatcher  ------cctg-ccccat
B D       Medium ground finch  ------gcca-cagctc
           Tibetan ground jay  ------acca-gcacag
B D                Budgerigar  ------g----gcattt
  D                    Parrot  ------gctt-cccctt
  D             Scarlet macaw  ------gctt-cccctt
  D              Mallard duck  ------tcag-gtccta
B D        American alligator  ------gcat-c-----
  D            Painted turtle  ------tcat-ttcccg
  D  Chinese softshell turtle  ------tcat-ttcctg
  D    Spiny softshell turtle  ------ttaa-tgccca
  D               Rock pigeon  =================
B D                   Wallaby  -----------------
  D    White-throated sparrow  =================
  D           Green seaturtle  =================

Inserts between block 25 and 26 in window
  D             Saker falcon 20bp
  D         Peregrine falcon 84bp
  D      Collared flycatcher 3bp
B D      Medium ground finch 3bp
          Tibetan ground jay 3bp
B D               Budgerigar 3bp
  D                   Parrot 3bp
  D            Scarlet macaw 3bp
  D           Painted turtle 3bp

Alignment block 26 of 160 in window, 24505714 - 24505723, 10 bps 
B D                     Human  ---------t----ct--gcc---a----g--c-----c
B D                     Chimp  ---------t----ct--gcc---a----g--c-----c
B D                   Gorilla  ---------t----ct--gcc---a----g--c-----c
B D                 Orangutan  ---------t----ct--gcc---a----g--c-----c
B D                    Gibbon  ---------t----ct--gcc---a----g--c-----c
B D                    Rhesus  ---------t----ct--gcc---a----g--c-----c
B D       Crab-eating macaque  ---------t----ct--gcc---a----g--c-----c
B D                    Baboon  ---------t----ct--gcc---a----g--c-----c
B D              Green monkey  ---------t----ct--gcc---a----g--c-----c
B D                  Marmoset  ---------c----ct--gct---a----g--c-----c
B D           Squirrel monkey  ---------c----ct--gcc---a----g--c-----c
B D                  Bushbaby  ---------c----cc--ttg---g----gtcc-----c
           Chinese tree shrew  ---------c----cc--atg---g----g--t-----c
B D                  Squirrel  ---------t----cc--atg---g----gccc-----c
       Lesser Egyptian jerboa  ---------t----tt--atg---g----gctc-----c
B D           Chinese hamster  ---------c----cc--acc---c----cttt-----c
               Golden hamster  ---------c----cc--gcc---c----attt-----c
B D                     Mouse  ---------c----cc--acc---c----attt-----c
B D                       Rat  ---------c----cc--acc---c----attt-----c
B D            Naked mole-rat  ---------c----cc--atg---g----gtcc-----c
B D                Guinea pig  ---------c----cc--ata---g----gtcc-----c
                   Chinchilla  ---------c----cc--ata---g----gtcc-----c
             Brush-tailed rat  ---------c----cc--gta---g----gacc-----a
B D                    Rabbit  ---------c----ct--gta---g----gtcc-----c
B D                      Pika  ---------c----ccaaata---t----tccc-----c
B D                       Pig  ---------c----cc--ac----g----gccc-----c
B D                   Dolphin  ---------c----cc--at----g----g-ac-----g
                 Killer whale  ---------c----cc--at----g----g-ac-----c
B D                       Cow  ---------c----ct--gt----g----gtcc-----c
B D                     Sheep  ---------c----ct--gt----g----gtcc-----c
B D                     Horse  ---------c----ct--gta---g----gtcc-----c
B D          White rhinoceros  ---------c----ct--gta---g----gtcc-----c
B D                       Dog  ---------c----ct--gtg---g----gttc-----c
B D                   Ferret   ---------c----ct--gtg---g----gtcc-----c
B D                     Panda  ---------c----ct--gtg---g----gtcc-----c
               Pacific walrus  ---------c----ct--gtg---g----gttc-----c
                 Weddell seal  ---------a----ct--gtc---acctcatcc-----t
             Black flying-fox  ---------c----tt--gtg---g----gtcc-----c
B D                   Megabat  ---------c----tt--gtg---g----gtcc-----c
                Big brown bat  ---------cttcatc--ct----g----gttc-----t
         David's myotis (bat)  ---------c----cc--at----g----gttc-----c
B D                  Microbat  ---------c----cc--at----g----gttc-----c
B D                  Hedgehog  ---------g----tc--ttgactg----attc-----a
B D                     Shrew  ---------g--------------a----agtc-----a
B D                  Elephant  ---------c----ct--gtg---g----gacc-----c
          Cape elephant shrew  ---------a----------g---g----gtca-----t
B D                   Manatee  ---------c----ct--gtg---t----gtcc-----c
             Cape golden mole  ---------c----ct--gtg---g----gtcc-----c
B D                    Tenrec  ---------c----ct--gtg---a----gagc-----c
                     Aardvark  ---------c----tt--gtg---a----gtcc-----c
B D                 Armadillo  ---------c----ct--gcg---g----gtcc-----c
B D                   Opossum  ---------c----cc--tct---c----agcc------
B D           Tasmanian devil  ---------c----cc--act---t----agccctgat-
B D                  Platypus  ---------t----cc--caa---t----cccc-----a
  D              Saker falcon  tccccc-ccc----t------------------------
  D       Collared flycatcher  -----c-cac----c------------------------
B D       Medium ground finch  -----t-ctc----c------------------------
           Tibetan ground jay  -----t-ccc----c------------------------
B D                Budgerigar  -----t-ctg----c------------------------
  D                    Parrot  -----c-cct----c------------------------
  D             Scarlet macaw  -----c-cat----c------------------------
  D              Mallard duck  -------cct----c------------------------
B D        American alligator  ----ac-agg----c------------------------
  D            Painted turtle  -----ttctt----c------------------------
  D  Chinese softshell turtle  -------ctt----c------------------------
  D    Spiny softshell turtle  -------gat----c------------------------
B D                       Cat  ---------------------------------------
  D          Peregrine falcon  =======================================
  D               Rock pigeon  =======================================
B D                   Wallaby  ---------------------------------------
  D    White-throated sparrow  =======================================
  D           Green seaturtle  =======================================

Inserts between block 26 and 27 in window
  D      Collared flycatcher 32bp
B D      Medium ground finch 490bp
          Tibetan ground jay 39bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
  D             Mallard duck 4bp
B D       American alligator 22bp
  D           Painted turtle 4bp
  D Chinese softshell turtle 4bp
  D   Spiny softshell turtle 4bp

Alignment block 27 of 160 in window, 24505724 - 24505732, 9 bps 
B D                     Human  ag--cttgg----------ag------
B D                     Chimp  ag--cttgg----------ag------
B D                   Gorilla  ag--cttgg----------ag------
B D                 Orangutan  ag--cttgg----------ag------
B D                    Gibbon  ag--cttga----------ag------
B D                    Rhesus  ag--cttgg----------ag------
B D       Crab-eating macaque  ag--cttgg----------ag------
B D                    Baboon  ag--cttgg----------ag------
B D              Green monkey  ag--cttgg----------ag------
B D                  Marmoset  ag--cttag----------ag------
B D           Squirrel monkey  ag--cttag----------ag------
B D                  Bushbaby  ag--ctcag----------gg------
           Chinese tree shrew  ----ttt--------------------
B D                  Squirrel  ag--cttgg----------ag------
       Lesser Egyptian jerboa  ac--attgg----------gg------
B D           Chinese hamster  ac--cttgg----------ag------
               Golden hamster  tc--cttgg----------ag------
B D                     Mouse  at--c----------------------
B D                       Rat  aa--c----------------------
B D            Naked mole-rat  at--cttgg----------ag------
B D                Guinea pig  ag--tttgg----------ag------
                   Chinchilla  ag--cttgg----------ag------
             Brush-tailed rat  ag--c-tgg----------ag------
B D                    Rabbit  gg--cttgg------------------
B D                      Pika  at--cctgg------------------
B D                       Pig  aa--ctctg----------ag------
B D                   Dolphin  aa--ctctg----------ag------
                 Killer whale  aa--ctctg----------ag------
B D                       Cow  aa--ctctg----------ag------
B D                     Sheep  aa--ctctg----------ag------
B D                     Horse  ac--ctctg----------ag------
B D          White rhinoceros  ac--gtctg----------ag------
B D                       Dog  aa--ttccg----------ag------
B D                   Ferret   ag--tcctg----------ag------
B D                     Panda  ag--ctctg----------ag------
               Pacific walrus  ag--ttctg----------ag------
                 Weddell seal  gg--ttctatcaacaccctag------
             Black flying-fox  aa--ctctg----------aa------
B D                   Megabat  aa--ctctg----------aa------
                Big brown bat  at--cagca------------------
         David's myotis (bat)  aa--atgtg----------ag------
B D                  Microbat  aa--ctctg----------ag------
B D                  Hedgehog  cagtctcag----------ag------
B D                     Shrew  ----ctcag----------ag------
B D                  Elephant  aa--ttcct----------ag------
          Cape elephant shrew  tg--tgctt----------gg------
B D                   Manatee  aa--ttcct----------ag------
             Cape golden mole  aa--ctcct----------gg------
B D                    Tenrec  aa--ctcct----------ag------
                     Aardvark  aa--cccct----------tg------
B D                 Armadillo  ta--ctctg----------ag------
B D                  Platypus  aa--cctaa----------cg------
  D            Painted turtle  --------------------a------
  D  Chinese softshell turtle  --------------------gcctcgc
  D    Spiny softshell turtle  --------------------g------
B D                       Cat  ---------------------------
  D             Scarlet macaw  ===========================
B D                Budgerigar  ===========================
          Tibetan ground jay  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ---------------------------
  D               Rock pigeon  ===========================
B D       Medium ground finch  ===========================
  D              Mallard duck  ===========================
  D                    Parrot  ===========================
B D                   Wallaby  ---------------------------
  D    White-throated sparrow  ===========================
  D           Green seaturtle  ===========================
B D           Tasmanian devil  ---------------------------
B D                   Opossum  ---------------------------
B D        American alligator  ===========================
  D       Collared flycatcher  ===========================

Inserts between block 27 and 28 in window
         Cape elephant shrew 182bp
B D                 Platypus 2bp

Alignment block 28 of 160 in window, 24505733 - 24505736, 4 bps 
B D                     Human  tca------------------------c---
B D                     Chimp  tca------------------------c---
B D                   Gorilla  tca------------------------c---
B D                 Orangutan  tca------------------------c---
B D                    Gibbon  tca------------------------c---
B D                    Rhesus  tca------------------------c---
B D       Crab-eating macaque  tca------------------------c---
B D                    Baboon  tca------------------------c---
B D              Green monkey  tca------------------------c---
B D                  Marmoset  tca------------------------c---
B D           Squirrel monkey  tca------------------------c---
B D                  Bushbaby  tca------------------------t---
B D                  Squirrel  tca------------------------c---
       Lesser Egyptian jerboa  tca------------------------a---
B D           Chinese hamster  ttg------------------------c---
               Golden hamster  ttg------------------------c---
B D                     Mouse  ttg------------------------c---
B D                       Rat  ttg------------------------t---
B D            Naked mole-rat  tca------------------------t---
B D                Guinea pig  tca------------------------t---
                   Chinchilla  tca------------------------g---
             Brush-tailed rat  tca------------------------t---
B D                    Rabbit  acc------------------------c---
B D                      Pika  ttc------------------------t---
B D                       Pig  c--------------------------t---
B D                   Dolphin  t--------------------------t---
                 Killer whale  t--------------------------t---
B D                       Cow  c--------------------------t---
B D                     Sheep  t--------------------------t---
B D                     Horse  tca------------------------t---
B D          White rhinoceros  tca------------------------c---
B D                       Cat  ---------------------------c---
B D                       Dog  tca------------------------c---
B D                   Ferret   tca------------------------c---
B D                     Panda  tca----------------------------
               Pacific walrus  tca------------------------c---
                 Weddell seal  ccagct---------------------c---
             Black flying-fox  tca------------------------a---
B D                   Megabat  tca------------------------a---
                Big brown bat  -cc------------------------c---
         David's myotis (bat)  tca------------------------c---
B D                  Microbat  tca------------------------c---
B D                  Hedgehog  t--------------------------g---
B D                  Elephant  tta------------------------c---
B D                   Manatee  tca------------------------c---
             Cape golden mole  cca------------------------c---
B D                    Tenrec  -ca------------------------c---
                     Aardvark  tca------------------------c---
B D                 Armadillo  --c------------------------c---
B D                  Platypus  -----tggaaaggagaagtagagtagcc---
  D            Painted turtle  ---------------------------ctga
  D  Chinese softshell turtle  ---------------------------ccat
  D    Spiny softshell turtle  ---------------------------ccag
         Cape elephant shrew  ===============================
B D                     Shrew  -------------------------------
          Chinese tree shrew  -------------------------------
  D             Scarlet macaw  ===============================
B D                Budgerigar  ===============================
          Tibetan ground jay  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  -------------------------------
  D               Rock pigeon  ===============================
B D       Medium ground finch  ===============================
  D              Mallard duck  ===============================
  D                    Parrot  ===============================
B D                   Wallaby  -------------------------------
  D    White-throated sparrow  ===============================
  D           Green seaturtle  ===============================
B D           Tasmanian devil  -------------------------------
B D                   Opossum  -------------------------------
B D        American alligator  ===============================
  D       Collared flycatcher  ===============================

Inserts between block 28 and 29 in window
  D           Painted turtle 19bp
  D Chinese softshell turtle 1438bp
  D   Spiny softshell turtle 29bp

Alignment block 29 of 160 in window, 24505737 - 24505791, 55 bps 
B D                     Human  ag-t----gagacct-----------aa------------------------------------------
B D                     Chimp  ag-t----gagacct-----------aa------------------------------------------
B D                   Gorilla  ag-t----gagacct-----------aa------------------------------------------
B D                 Orangutan  ag-t----gagacct-----------aa------------------------------------------
B D                    Gibbon  ag-t----gagacct-----------aa------------------------------------------
B D                    Rhesus  ag-t----gagacct-----------aa------------------------------------------
B D       Crab-eating macaque  ag-t----gagacct-----------aa------------------------------------------
B D                    Baboon  ag-t----gagacct-----------aa------------------------------------------
B D              Green monkey  ag-t----gagacct-----------aa------------------------------------------
B D                  Marmoset  ag-t----gagacct-----------aa------------------------------------------
B D           Squirrel monkey  ag-t----gagacct-----------aa------------------------------------------
B D                  Bushbaby  ag--------------------------------------------------------------------
           Chinese tree shrew  -----------acct-----------at------------------------------------------
B D                  Squirrel  ---------agatca-----------ag------------------------------------------
       Lesser Egyptian jerboa  at-t----caggtct-----------ga------------------------------------------
B D           Chinese hamster  aa-t----tagatct-----------ag------------------------------------------
               Golden hamster  aa-t----taggtct-----------ag------------------------------------------
B D                     Mouse  ag-t----taggtct-----------a-------------------------------------------
B D                       Rat  ag-t----taggtca-----------a-------------------------------------------
B D            Naked mole-rat  ca-c----caggttt-----------ag------------------------------------------
B D                Guinea pig  cagc----caggtct-----------ag------------------------------------------
                   Chinchilla  ca--------ggtct-----------tg------------------------------------------
             Brush-tailed rat  ca-c----ctggact-----------ag------------------------------------------
B D                    Rabbit  cg-t----caggcct-----------gg------------------------------------------
B D                      Pika  at-t----ccaccct-----------ag----ttggcgctaagaaatgtaaaggc---------------
B D                       Pig  ga-t----cagaccc-----------ag------------------------------------------
B D                   Dolphin  gg-t----cagacct-----------attgggttagccaaaaagtttgttcagatttttccataacatct
                 Killer whale  gg-t----cagacct-----------attgggttagccaaaaagttcgttcagatttttccataatatct
B D                       Cow  gg-t----cggacct-----------gc------------------------------------------
B D                     Sheep  ga-t----cgaacct-----------gc------------------------------------------
B D                     Horse  gg-c----cagaccg-----------ag------------------------------------------
B D          White rhinoceros  ag-t----cagaccg-----------ag------------------------------------------
B D                       Cat  ag-t----gagacct-----------gg------------------------------------------
B D                       Dog  ag-t----gagacct-----------ca------------------------------------------
B D                   Ferret   ag-t----gagacct-----------tg------------------------------------------
B D                     Panda  ag-g----gagacct-----------tg------------------------------------------
               Pacific walrus  ag-a----gagacct-----------ct------------------------------------------
                 Weddell seal  ct-a----gataccc-----------ca------------------------------------------
             Black flying-fox  ag-t----ctgacct-----------ag------------------------------------------
B D                   Megabat  ag-t----ctgacct-----------ag------------------------------------------
                Big brown bat  ag-g----ctggcctcaagataccccag------------------------------------------
         David's myotis (bat)  ag-t----cagacct-----------ag------------------------------------------
B D                  Microbat  ag-t----cagacct-----------ag------------------------------------------
B D                  Hedgehog  ag-t----gaaccct-----------ga------------------------------------------
B D                     Shrew  -------------ct-----------gc------------------------------------------
B D                  Elephant  aa-t----cagacct-----------ag------------------------------------------
B D                   Manatee  ag-g----cagacct-----------ag------------------------------------------
             Cape golden mole  aa-t----cagacct-----------aa------------------------------------------
B D                    Tenrec  aa-g----cagacc--------------------------------------------------------
                     Aardvark  ag-t----cagactt-----------aa------------------------------------------
B D                 Armadillo  tg-c----cagccct-----------gg------------------------------------------
B D                   Opossum  --------gtgggct-----------ca------------------------------------------
B D           Tasmanian devil  ---tctttctgagct-----------gg------------------------------------------
B D                  Platypus  gg-c----gctgccc-----------aa------------------------------------------
  D              Saker falcon  ----------------------------------------------------------------------
  D       Collared flycatcher  ----------------------------------------------------------------------
  D    White-throated sparrow  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
  D          Peregrine falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  ---------------------------------------a------------------------------
                        Chimp  ---------------------------------------a------------------------------
                      Gorilla  ---------------------------------------a------------------------------
                    Orangutan  ---------------------------------------a------------------------------
                       Gibbon  ---------------------------------------a------------------------------
                       Rhesus  ---------------------------------------a------------------------------
          Crab-eating macaque  ---------------------------------------a------------------------------
                       Baboon  ---------------------------------------a------------------------------
                 Green monkey  ---------------------------------------a------------------------------
                     Marmoset  ---------------------------------------a------------------------------
              Squirrel monkey  ---------------------------------------a------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ---------------------------------------a------------------------------
                     Squirrel  ---------------------------------------a------------------------------
       Lesser Egyptian jerboa  ---------------------------------------a------------------------------
              Chinese hamster  ---------------------------------------a------------------------------
               Golden hamster  ---------------------------------------a------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  ---------------------------------------actcagacc----------------------
                   Guinea pig  ---------------------------------------a------------------------------
                   Chinchilla  ---------------------------------------a------------------------------
             Brush-tailed rat  ---------------------------------------a------------------------------
                       Rabbit  ---------------------------------------a------------------------------
                         Pika  ---------------------------------------a------------------------------
                          Pig  ---------------------------------------c------------------------------
                      Dolphin  atggaaaatcccgaatgaactttttggccaacccaatagc------------------------------
                 Killer whale  atggaaaatcccgaatgaactttttggccaacccaatagc------------------------------
                          Cow  ---------------------------------------c------------------------------
                        Sheep  ---------------------------------------c------------------------------
                        Horse  ---------------------------------------g------------------------------
             White rhinoceros  ---------------------------------------g------------------------------
                          Cat  ---------------------------------------g------------------------------
                          Dog  ---------------------------------------g------------------------------
                      Ferret   ---------------------------------------g------------------------------
                        Panda  ---------------------------------------g------------------------------
               Pacific walrus  ---------------------------------------g------------------------------
                 Weddell seal  ---------------------------------------g-------a----------------------
             Black flying-fox  ---------------------------------------g------------------------------
                      Megabat  ---------------------------------------g------------------------------
                Big brown bat  ---------------------------------------a------------------------------
         David's myotis (bat)  ---------------------------------------g------------------------------
                     Microbat  ---------------------------------------g------------------------------
                     Hedgehog  ---------------------------------------g------------------------------
                        Shrew  ---------------------------------------a------------------------------
                     Elephant  ---------------------------------------a------------------------------
                      Manatee  ---------------------------------------a------------------------------
             Cape golden mole  ---------------------------------------a------------------------------
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  ---------------------------------------a------------------------------
                    Armadillo  ---------------------------------------c------------------------------
                      Opossum  ---------------------------------------t------------------------------
              Tasmanian devil  ---------------------------------------t------------------------------
                     Platypus  ---------------------------------------t------------------------------
                 Saker falcon  -----------------------------------------------------------g----------
          Collared flycatcher  -----------------------------------------------acccctggtgctg----------
       White-throated sparrow  ----------------------------------------------------------------------
           Tibetan ground jay  -----------------------------------------------gcctcca----------------
                   Budgerigar  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                Scarlet macaw  ----------------------------------------------------------------------
                 Mallard duck  ------------------------------------------------------ctcctg----------
           American alligator  -----------------------------------------------gctgccgtgttag----------
               Painted turtle  -----------------------------------------------cccctgctatcca----------
       Spiny softshell turtle  -----------------------------------------------accaagatgctcaagatggggga
          Cape elephant shrew  ======================================================================
             Peregrine falcon  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  --g-----tcaga----------------------------cgcagga-ggtggagc----tcc-----t
                        Chimp  --g-----tcaga----------------------------cccagaa-ggtggagc----tcc-----t
                      Gorilla  --g-----tcaga----------------------------cccagga-ggtggagc----tcc-----t
                    Orangutan  --g-----tcaga----------------------------cccaggagggtggggc----tcc-----t
                       Gibbon  --g-----tcaga----------------------------cccagga-ggtgggcc----tcc-----t
                       Rhesus  --gtcaaatcaca----------------------------cccggga-gctggggc----tcc-----t
          Crab-eating macaque  --gtcaaatcaga----------------------------cccggga-gctggggc----tcc-----t
                       Baboon  --gtcaaatcaga----------------------------cccggga-gctggggc----tcc-----t
                 Green monkey  --g-----tcaga----------------------------cccggga-gctggggc----tcc-----t
                     Marmoset  --g-----tcaaa----------------------------cctggga-gctggggc----tcc-----t
              Squirrel monkey  --a-----tcaga----------------------------cctggga-gctggggc----tcc-----t
                     Bushbaby  --------tcaga----------------------------cccagga-gcactggc----ttc-----t
           Chinese tree shrew  --g-----tcagg----------------------------cccagaa-accctggc----tcc-----t
                     Squirrel  --t-----tcata----------------------------ccg--------------------------
       Lesser Egyptian jerboa  --g--ggtgtagt----------------------------aca--------------------------
              Chinese hamster  --g-----tcagc----------------------------cca--------------------------
               Golden hamster  --g-----tcaga----------------------------gga--------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  --c-----tcaga----------------------------cccagga-gccctggc----tcc-----t
                   Guinea pig  ----------gga----------------------------ccccaga-gccctgga----tcc-----t
                   Chinchilla  --c-----tcaga----------------------------cccagga-gccctgga----tcc-----t
             Brush-tailed rat  --c-----tcaga----------------------------ccc-gga-gccttgga----tcc-----t
                       Rabbit  --a-----tcagg----------------------------g-------gtctgggc----tgc-----t
                         Pika  --g-----gtagg----------------------------gac-----acctggtt----tg------t
                          Pig  --a-----tccga----------------------------tctggga-gccctcat----tcc-----t
                      Dolphin  --a-----tcagc----------------------------ggcgaga-accctggt----tcc-----t
                 Killer whale  --a-----tcagc----------------------------ggcgaga-accctggt----tcc-----t
                          Cow  --a-----tcagg----------------------------ctcagga-acactggc----tcc-----t
                        Sheep  --a-----tcagg----------------------------ctcagga-acacgggc----ttc-----t
                        Horse  --g-----tcaga----------------------------ctcagga-gccctggc----ttc-----t
             White rhinoceros  --g-----tcagc----------------------------ctcagga-gccctggc----tcc-----t
                          Cat  --g-----tcaga----------------------------cccagca-gccctggt----tcc-----t
                          Dog  --g-----tcaga----------------------------cccagca-gccctggc----tcc-----t
                      Ferret   --g-----tcaga----------------------------cccagca-accctggc----ttc-----t
                        Panda  --a-----ccaga----------------------------cccagca-gccctggc----ttc-----c
               Pacific walrus  --g-----tcaga----------------------------cccagca-gccctggc----ttc-----t
                 Weddell seal  --g-----tcaga----------------------------tcagg---atcctggt----tcc-----t
             Black flying-fox  --g-----tcaga----------------------------cccagga-gtcctggc----tcc-----t
                      Megabat  --g-----tcaga----------------------------cccagga-gtcctggc----tcc-----t
                Big brown bat  --g-----tcagg-----------------------------ccagga-atcttgac----acc-----c
         David's myotis (bat)  --t-----ttata----------------------------cccagga-gccctg---------------
                     Microbat  --g-----ttaga----------------------------cccagga-gccctg---------------
                     Hedgehog  ---------------------------------------------------cctgac----tcc-----t
                        Shrew  ---------------------------------------------------catggg----cca-----t
                     Elephant  --g-----ttaga----------------------------cccagga-gccttgat----tcc-----t
                      Manatee  --g-----tcagg----------------------------ccttgga-gcccagac----tac-----t
             Cape golden mole  --c-----tcagt----------------------------cccagca-gccttgac----tcc-----t
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  --g-----tcagg----------------------------cc-aaga-gccctgac----tcc-----t
                    Armadillo  --g-----tcagg----------------------------cccaggg-gccctgac-----cc-----t
                      Opossum  --a-----tca------------------------------tccagc-----------------------
              Tasmanian devil  --t-----tcagaaatcctaaatcttcctgagttcctaagttccagca----------------------
                     Platypus  --c-----tcagg----------------------------tccagtg-ggcct----------------
                 Saker falcon  --c-----ccagg----------------------------cactgct-agcagggc----tgtg-gtt-
          Collared flycatcher  --t-----gcagg----------------------------ggctgtg-ggtgg-------tgt------
       White-throated sparrow  --------ttaga----------------------------gac--------------------------
           Tibetan ground jay  --------caagg----------------------------gactggt-ggcagctt----tgt------
                   Budgerigar  --a-----acagg----------------------------ga--ggc-tgcagagc----tcc---cc-
                       Parrot  --c-----ttggg----------------------------gaatgcc-agcagggt----tgtg-gct-
                Scarlet macaw  --c-----ttggg----------------------------gaatgcc-ggcagggt----tgta-gct-
                 Mallard duck  --c-----ccagc----------------------------ctctgcc-attagagt----cag------
           American alligator  --a-----tggag----------------------------gattcct-cacagacc----tctgcgtc-
               Painted turtle  --c-----atggt----------------------------ctctgct-tgtgcccc----cca------
       Spiny softshell turtle  ttc-----attga----------------------------ctctaag-ggtgcgtctagacta------
          Cape elephant shrew  ======================================================================
             Peregrine falcon  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  ca----cttat--------------ac-atc--------t-a-------------g----------tt
                        Chimp  ca----cttat--------------ac-atc--------t-a-------------g----------tt
                      Gorilla  ga----cttat--------------ac-atc--------t-a-------------g----------tt
                    Orangutan  cg----cttat--------------ac-atc--------t-a-------------g----------tt
                       Gibbon  ca----cttat--------------aa-atc--------t-a-------------g----------tt
                       Rhesus  ca----cttac--------------ac-atc--------t-a-------------g----------tt
          Crab-eating macaque  ca----cttac--------------ac-atc--------t-a-------------g----------tt
                       Baboon  ca----cttac--------------ac-atc--------t-a-------------g----------tt
                 Green monkey  ca----cttac--------------ac-atc--------t-a-------------g----------tt
                     Marmoset  cg----tttat--------------ac-atc--------t-a-------------g----------tt
              Squirrel monkey  ca----tttat--------------ac-atc--------t-a-------------g----------tt
                     Bushbaby  ca---ggttac--------------ac-gtc--------t-g-------------a----------ct
           Chinese tree shrew  tagggggttac--------------at-gtc--------t-a-------------g----------gt
                     Squirrel  -----------------------------------------g-------------g----------gc
       Lesser Egyptian jerboa  -----------------------------tt--------t-a-------------g----------gt
              Chinese hamster  ---------------------------------------g-g-------------a----------gc
               Golden hamster  ---------------------------------------g-g-------------a----------gc
                        Mouse  -----------------------------------------g-------------a----------gc
                          Rat  -----------------------------------------g-------------a----------gc
               Naked mole-rat  catgcagttat--------------at-atc--------t-a-------------g----------gt
                   Guinea pig  catggggttat--------------gt-atc--------t-a-------------g----------gt
                   Chinchilla  catgccattgt--------------gt-atc--------t-a-------------g----------gt
             Brush-tailed rat  catggggttac--------------at---------------------------------------gc
                       Rabbit  cctggggttgt--------------at-atc--------t-a-------------g----------tt
                         Pika  catgtagttgt--------------aa-gtt--------a-aagatttagtgaatg----------tt
                          Pig  catggggtcct--------------gt-gtc--------t-c-------------t----------gt
                      Dolphin  catgaggttct--------------at-gtc--------t-c-------------t----------gt
                 Killer whale  catgaggttct--------------at-gtc--------t-c-------------t----------gt
                          Cow  cataaggtgat--------------at-gtc------------------------------------t
                        Sheep  catgaggtgat--------------at-gtc--------t-c-------------t----------gt
                        Horse  catggggtcat--------------ac-atc--------t-c-------------a----------gt
             White rhinoceros  catggggtcat--------------ac-gtc--------t-c-------------t----------gt
                          Cat  catggggttat--------------ac-atc--------t-c-------------g----------gt
                          Dog  catggggttat--------------at-gtc--------t-c-------------a----------gt
                      Ferret   catgagattat--------------ac-atc--------t-c-------------g----------gt
                        Panda  catagggttct--------------ac-gtc--------t-t-------------g----------gt
               Pacific walrus  catggggttat--------------at-atc--------t-c-------------a----------gt
                 Weddell seal  caaggaatcctaagttaggagattaat-gtc--------t-t-------------attcctctctggc
             Black flying-fox  catggggttat--------------ac-atc--------t-t-------------a----------gt
                      Megabat  catggggttat--------------ac-atc--------t-t-------------a----------gt
                Big brown bat  gatggagtcat--------------aa-atcaggagtcat-a-------------a----------tt
         David's myotis (bat)  gatagagttat--------------gt-atc--------t-t-------------g----------tt
                     Microbat  gatagagttat--------------gt-atc--------t-t-------------g----------tt
                     Hedgehog  aatgagctc----------------gt-gcc--------t-t-------------g----------gc
                        Shrew  aa-gagctc-t--------------gt-gtc--------tat-------------t----------gt
                     Elephant  catggggttgt--------------acattt--------t-a-------------g----------gt
                      Manatee  catggggttgc--------------ac-ttc--------c-a-------------g----------gt
             Cape golden mole  catggggttgt--------------ac-atc--------t-g-------------a----------gt
                       Tenrec  --------------------------------------------------------------------
                     Aardvark  aatggagttgt--------------ac-ttc--------t-a-------------g----------gt
                    Armadillo  catgggcttat--------------aggttc--------t-a-------------c----------gt
                      Opossum  --------------------------------------------------------------------
              Tasmanian devil  --------------------------------------------------------------------
                     Platypus  --------------------------------------------------------------------
                 Saker falcon  --------------------------------------------------------------------
          Collared flycatcher  --------------------------------------------------------------------
       White-throated sparrow  --------------------------------------------------------------------
           Tibetan ground jay  --------------------------------------------------------------------
                   Budgerigar  --------------------------------------------------------------------
                       Parrot  --------------------------------------------------------------------
                Scarlet macaw  --------------------------------------------------------------------
                 Mallard duck  --------------------------------------------------------------------
           American alligator  --------------------------------------------------------------------
               Painted turtle  --------------------------------------------------------------------
       Spiny softshell turtle  --------------------------------------------------------------------
          Cape elephant shrew  ====================================================================
             Peregrine falcon  ====================================================================
                  Rock pigeon  ====================================================================
          Medium ground finch  ====================================================================
                      Wallaby  --------------------------------------------------------------------
     Chinese softshell turtle  ====================================================================
              Green seaturtle  ====================================================================

Inserts between block 29 and 30 in window
B D                 Bushbaby 29bp
B D                 Squirrel 2bp
  D   White-throated sparrow 34bp

Alignment block 30 of 160 in window, 24505792 - 24505795, 4 bps 
B D                     Human  ctga
B D                     Chimp  ctga
B D                   Gorilla  ctga
B D                 Orangutan  ctga
B D                    Gibbon  ctga
B D                    Rhesus  ctga
B D       Crab-eating macaque  ctga
B D                    Baboon  ctga
B D              Green monkey  ctga
B D                  Marmoset  ctga
B D           Squirrel monkey  ctga
           Chinese tree shrew  ctga
B D                  Squirrel  ctca
       Lesser Egyptian jerboa  ctaa
B D           Chinese hamster  ctga
               Golden hamster  ctga
B D                     Mouse  ctga
B D                       Rat  ctga
B D            Naked mole-rat  ctaa
B D                Guinea pig  ctga
                   Chinchilla  ctga
             Brush-tailed rat  ctga
B D                    Rabbit  ctca
B D                      Pika  ctcc
B D                       Pig  ctga
B D                   Dolphin  ctga
                 Killer whale  ctga
B D                       Cow  ctga
B D                     Sheep  ctga
B D                     Horse  ctga
B D          White rhinoceros  ctga
B D                       Cat  gtga
B D                       Dog  gtga
B D                   Ferret   ttga
B D                     Panda  atga
               Pacific walrus  atga
                 Weddell seal  atgg
             Black flying-fox  ctga
B D                   Megabat  ctga
                Big brown bat  taaa
         David's myotis (bat)  ctga
B D                  Microbat  ctga
B D                  Hedgehog  ctga
B D                     Shrew  ctaa
B D                  Elephant  ccaa
B D                   Manatee  ctga
             Cape golden mole  ctga
                     Aardvark  ctga
B D                 Armadillo  ctga
B D                  Platypus  caca
  D              Saker falcon  ctgc
  D       Collared flycatcher  cagg
           Tibetan ground jay  cagg
B D                Budgerigar  cagg
  D                    Parrot  ctgg
  D             Scarlet macaw  ccgg
  D              Mallard duck  cc--
B D        American alligator  cagg
B D                    Tenrec  ----
         Cape elephant shrew  ====
B D                  Bushbaby  ====
  D          Peregrine falcon  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                   Wallaby  ----
  D    White-throated sparrow  ====
  D    Spiny softshell turtle  ----
  D  Chinese softshell turtle  ====
  D            Painted turtle  ----
  D           Green seaturtle  ====
B D           Tasmanian devil  ----
B D                   Opossum  ----

Inserts between block 30 and 31 in window
  D             Saker falcon 22bp
  D      Collared flycatcher 43bp
          Tibetan ground jay 33bp
B D               Budgerigar 14bp
  D                   Parrot 18bp
  D            Scarlet macaw 18bp
B D       American alligator 3bp

Alignment block 31 of 160 in window, 24505796 - 24505825, 30 bps 
B D                     Human  tg-------cc-----------------------------------------cctt---------ctt-c
B D                     Chimp  tg-------cc-----------------------------------------cctt---------ctt-c
B D                   Gorilla  tg-------cc-----------------------------------------cctt---------ctt-c
B D                 Orangutan  tg-------cc-----------------------------------------cctt---------ctt-c
B D                    Gibbon  tg-------cc-----------------------------------------cctt---------ctt-c
B D                    Rhesus  ta-------cc-----------------------------------------cctt---------ctt-c
B D       Crab-eating macaque  ta-------cc-----------------------------------------cctt---------ctt-c
B D                    Baboon  tg-------cc-----------------------------------------cctt---------ctt-c
B D              Green monkey  tg-------cc-----------------------------------------cctt---------ctt-c
B D                  Marmoset  tg-------cc-----------------------------------------cctt---------ctt-c
B D           Squirrel monkey  tg-------cc-----------------------------------------cctt---------ctt-c
           Chinese tree shrew  tg-------cc-----------------------------------------cttt---------act-c
B D                  Squirrel  tggggta-tct-----------------------------------------aggt---------ctt-c
       Lesser Egyptian jerboa  tg-------tc-----------------------------------------acat---------gtt-c
B D           Chinese hamster  tg-------ct------------gcgg-------------------------gcat---------cat-t
               Golden hamster  ta-------ct-----------------------------------------gcat---------ctt-t
B D                     Mouse  tg-------cc-----------------------------------------acat---------cat-t
B D                       Rat  tg--------------------------------------------------------------------
B D            Naked mole-rat  tg-------ct-----------------------------------------cctc---------ctt-c
B D                Guinea pig  ta-------ct-----------------------------------------cctc---------ctt-c
                   Chinchilla  tg-------ct-----------------------------------------cctc---------ctt-c
             Brush-tailed rat  ca-------ct-----------------------------------------cttg---------ctt-c
B D                    Rabbit  t---------------------------------------------------------------------
B D                      Pika  ttgcgtcttcc-----------------------------------------cccc---------atc-c
B D                       Pig  tg-------ct-----------------------------------------gctc---------ctg-c
B D                   Dolphin  tg-------ct-----------------------------------------gctt---------ctt-g
                 Killer whale  tg-------ct-----------------------------------------gctt---------ctt-g
B D                       Cow  tg-------ct-----------------------------------------gt------------tc-c
B D                     Sheep  tg-------gg-----------------------------------------gtat---------ctt-c
B D                     Horse  tg-------cc-----------------------------------------cctt---------ctt-t
B D          White rhinoceros  ca-------cc-----------------------------------------cctt---------ctt-t
B D                       Cat  tg-------cc-----------------------------------------cctt---------ttc-t
B D                       Dog  tg-------cc-----------------------------------------cctt---------ctc-c
B D                   Ferret   tg-------gc-----------------------------------------cctt---------ttc-c
B D                     Panda  tg-------cc-----------------------------------------ccct---------ttc-c
               Pacific walrus  tg-------cc------------------------------------------cct---------ttc-c
                 Weddell seal  ag-------ccacaaccctaggtcctg-------------------------tccc---------ttc-c
             Black flying-fox  tg-------cc-----------------------------------------tctt---------ctt-c
B D                   Megabat  tg-------cc-----------------------------------------tctt---------ctt-c
                Big brown bat  tg------tct-----------------------------------------tctt---------tct-c
         David's myotis (bat)  tg-------cc-----------------------------------------cctt---------ctt-c
B D                  Microbat  tg-------cc-----------------------------------------cctt---------ctt-c
B D                  Hedgehog  tg-------cc-----------------------------------------tcgc---------ct---
B D                     Shrew  tg-------ct-----------------------------------------cctt---------at---
B D                  Elephant  tg--------------------------------------------------ccct---------ctt-c
B D                   Manatee  tg--------------------------------------------------ccct---------ctt-c
             Cape golden mole  gg--------------------------------------------------tccc---------ctt-c
B D                    Tenrec  -a--------------------------------------------------cgcc---------ctt-c
                     Aardvark  tg--------------------------------------------------cctt---------ctt-c
B D                 Armadillo  ag--------------------------------------------------ccct---------cttgc
B D                   Opossum  ----------------------------------------------------ttca---------tct-t
B D           Tasmanian devil  ------------------------cagattcttttcttggctcatatccagagcca---------ctt-t
B D                  Platypus  tg-------ct-----------------------------------------cctttcttcattcctt-c
  D              Saker falcon  -------------------------------------------------------------------t-g
  D          Peregrine falcon  -------------------------------------------------------------------t-g
  D       Collared flycatcher  -------------------------------------------------------------------t-g
  D    White-throated sparrow  -------------------------------------------------------------------t-g
           Tibetan ground jay  -------------------------------------------------------------------t-g
B D                Budgerigar  -------------------------------------------------------------------t-g
  D                    Parrot  -------------------------------------------------------------------t-a
  D             Scarlet macaw  -------------------------------------------------------------------t-a
  D              Mallard duck  -------------------------------------------------------------------t-g
B D        American alligator  -------------------------------------------------------------------t-c
  D            Painted turtle  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
B D                  Bushbaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  ctt-----------------tcttgggaccgtcat------------------------------
                        Chimp  ctt-----------------tcttgggaccatcat------------------------------
                      Gorilla  ctt-----------------tcttgggaccgtcat------------------------------
                    Orangutan  ctt-----------------tcttgggactgtcat------------------------------
                       Gibbon  ctt-----------------tcttgggactgtcat------------------------------
                       Rhesus  ctt-----------------tcttgggacagtcac------------------------------
          Crab-eating macaque  ctt-----------------tcttgggacagtcac------------------------------
                       Baboon  ctt-----------------tcttgggacagtcac------------------------------
                 Green monkey  ctt-----------------tcttgggacagtcac------------------------------
                     Marmoset  ctt-----------------tcttgggacagtcat------------------------------
              Squirrel monkey  ctt-----------------tcttgggacagtcat------------------------------
           Chinese tree shrew  ctt-----------------tcctgggacagccaa------------------------------
                     Squirrel  ctt-----------------tcttagagtgtcc--------------------------------
       Lesser Egyptian jerboa  ttt-----------------tcttggggcagccca------------------------------
              Chinese hamster  ctt-----------------tcccggggcagccac------------------------------
               Golden hamster  ctt-----------------tcctggggcag----------------------------------
                        Mouse  gcc-----------------ttggggggcagccta------------------------------
                          Rat  --t-----------------ttggcgggtagccac------------------------------
               Naked mole-rat  ctt-----------------ccctggggcagtcac------------------------------
                   Guinea pig  ctt-----------------tcttggggcagtcac------------------------------
                   Chinchilla  ctt-----------------tcctggggcagtcac------------------------------
             Brush-tailed rat  ctc-----------------tcctgaggcagtcac------------------------------
                       Rabbit  -----------------------------------------------------------------
                         Pika  cca-----------------atctggatccacagc------------------------------
                          Pig  ctc-----------------tc-------------------------------------------
                      Dolphin  ctt-----------------tc-------------------------------------------
                 Killer whale  ctt-----------------tc-------------------------------------------
                          Cow  ctt-----------------tc-------------------------------------------
                        Sheep  ctt-----------------tc-------------------------------------------
                        Horse  ctt-----------------tc-------------------------------------------
             White rhinoceros  ttt-----------------tc-------------------------------------------
                          Cat  gtt-----------------tc-------------------------------------------
                          Dog  ctt-----------------tc-------------------------------------------
                      Ferret   ctt-----------------tc-------------------------------------------
                        Panda  ctt-----------------tc-------------------------------------------
               Pacific walrus  ctt-----------------tc-------------------------------------------
                 Weddell seal  att-----------------tc-------------------------------------------
             Black flying-fox  ctt-----------------tc-------------------------------------------
                      Megabat  ctt-----------------tc-------------------------------------------
                Big brown bat  tctctagcatagaacatagatc-------------------------------------------
         David's myotis (bat)  ttt-----------------tc-------------------------------------------
                     Microbat  ttt-----------------tc-------------------------------------------
                     Hedgehog  --------------------tc-------------------------------------------
                        Shrew  --------------------tc-------------------------------------------
                     Elephant  ctt-----------------ccctgggacagctac------------------------------
                      Manatee  ctt-----------------tcctgggacagccgc------------------------------
             Cape golden mole  ctt-----------------ctctgggacaatcac------------------------------
                       Tenrec  ----------------------caaggacaggctc------------------------------
                     Aardvark  ttt-----------------ccctgggaca-ccac------------------------------
                    Armadillo  ttt-----------------ccccagggcagccac------------------------------
                      Opossum  ccc-----------------acccaagacacattc------------------------------
              Tasmanian devil  cct-----------------actcaggctaccttc------------------------------
                     Platypus  ctt-----------------ccttcat--------------------------------------
                 Saker falcon  ccc-----------------cc-------------cgcccagc---------tggagg-----ag
             Peregrine falcon  ccc-----------------cc-------------cgcccagc---------tggagg-----ag
          Collared flycatcher  tca-----------------cc------------------tgc---------cctgggtaa-cag
       White-throated sparrow  ttc-----------------cc--------------tccttgc---------cctggg------g
           Tibetan ground jay  ccc-----------------tt-------------ctgctggc---------ttcagatac-gaa
                   Budgerigar  cca-----------------ga---------------agggaccagttaaagcatcacttc-tgc
                       Parrot  ccc-----------------ac---------------acggac---------cgtggtgtc-cgg
                Scarlet macaw  ccc-----------------cc---------------acggac---------catggtgtc-tgg
                 Mallard duck  ctc-----------------ct---------------gcttgc---------cccgatgcaggag
           American alligator  ctc-----------------ctt------------ctcccagc---------cagcattaaccag
               Painted turtle  --------------------------------------------------------------cag
       Spiny softshell turtle  --------------------------------------------------------------cac
          Cape elephant shrew  =================================================================
                     Bushbaby  =================================================================
                  Rock pigeon  =================================================================
          Medium ground finch  =================================================================
                      Wallaby  -----------------------------------------------------------------
     Chinese softshell turtle  =================================================================
              Green seaturtle  =================================================================

Inserts between block 31 and 32 in window
          Chinese tree shrew 1bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 7bp
B D          Chinese hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
B D                     Pika 17bp
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                  Opossum 2bp
B D          Tasmanian devil 2bp

Alignment block 32 of 160 in window, 24505826 - 24505828, 3 bps 
B D                     Human  cca
B D                     Chimp  cca
B D                   Gorilla  cca
B D                 Orangutan  cca
B D                    Gibbon  cca
B D                    Rhesus  cca
B D       Crab-eating macaque  cca
B D                    Baboon  cca
B D              Green monkey  cta
B D                  Marmoset  cca
B D           Squirrel monkey  cca
B D                  Bushbaby  cca
           Chinese tree shrew  cca
B D                  Squirrel  ccc
       Lesser Egyptian jerboa  cca
B D           Chinese hamster  ata
B D                     Mouse  tta
B D                       Rat  aca
B D            Naked mole-rat  cca
B D                Guinea pig  cca
B D                    Rabbit  gtc
B D                      Pika  ttc
B D                  Elephant  atg
B D                   Manatee  atg
             Cape golden mole  gtg
B D                    Tenrec  agg
                     Aardvark  aag
B D                 Armadillo  -gg
B D                  Platypus  tca
  D              Saker falcon  cca
  D          Peregrine falcon  cca
  D       Collared flycatcher  gtt
  D    White-throated sparrow  ctc
           Tibetan ground jay  gca
B D                Budgerigar  cct
  D                    Parrot  gca
  D             Scarlet macaw  gca
  D              Mallard duck  ctg
B D        American alligator  gtg
  D            Painted turtle  ccc
  D    Spiny softshell turtle  tcc
         Cape elephant shrew  ===
B D                  Hedgehog  ---
B D                     Shrew  ---
              Golden hamster  ---
B D                       Dog  ---
B D                     Panda  ---
B D                   Ferret   ---
        David's myotis (bat)  ---
B D                  Microbat  ---
               Big brown bat  ---
B D                       Cow  ---
B D                     Sheep  ---
                Killer whale  ---
            Black flying-fox  ---
B D                       Cat  ---
            Brush-tailed rat  ---
                  Chinchilla  ---
              Pacific walrus  ---
B D          White rhinoceros  ---
B D                     Horse  ---
B D                       Pig  ---
                Weddell seal  ---
B D                   Dolphin  ---
  D               Rock pigeon  ===
B D       Medium ground finch  ===
B D                   Wallaby  ---
B D                   Megabat  ---
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===

Inserts between block 32 and 33 in window
B D                 Platypus 360bp
  D           Painted turtle 2bp

Alignment block 33 of 160 in window, 24505829 - 24505833, 5 bps 
B D                     Human  cattc
B D                     Chimp  cattc
B D                   Gorilla  cattc
B D                 Orangutan  cattc
B D                    Gibbon  cattc
B D                    Rhesus  cattc
B D       Crab-eating macaque  cattc
B D                    Baboon  cattc
B D              Green monkey  cattc
B D                  Marmoset  cattc
B D           Squirrel monkey  cattc
B D                  Bushbaby  ctttc
           Chinese tree shrew  tctcc
B D                  Squirrel  cccca
       Lesser Egyptian jerboa  cctta
B D           Chinese hamster  cctac
               Golden hamster  -ctac
B D                     Mouse  tcttc
B D                       Rat  tctcc
B D            Naked mole-rat  ccttt
B D                Guinea pig  cctta
B D                    Rabbit  ccttc
B D                      Pika  ccttc
B D                       Pig  ----c
B D                   Dolphin  ----c
                 Killer whale  ----c
B D                       Cow  ----c
B D                     Sheep  ----c
B D                     Horse  ----c
B D          White rhinoceros  ----c
B D                       Cat  ----c
B D                       Dog  ----c
B D                   Ferret   ----c
B D                     Panda  ----c
               Pacific walrus  ----c
                 Weddell seal  ----t
             Black flying-fox  ----c
B D                   Megabat  ----c
                Big brown bat  ----c
         David's myotis (bat)  ----c
B D                  Microbat  ----c
B D                  Hedgehog  ----c
B D                     Shrew  ----c
B D                  Elephant  ccttt
B D                   Manatee  ccttc
             Cape golden mole  gcttc
B D                    Tenrec  ccttg
                     Aardvark  acttc
B D                 Armadillo  ccttc
B D                   Opossum  --ttc
B D           Tasmanian devil  --ttc
B D                  Platypus  --ggc
  D              Saker falcon  tccag
  D          Peregrine falcon  tccag
  D       Collared flycatcher  tctcc
  D    White-throated sparrow  cattc
           Tibetan ground jay  cactc
B D                Budgerigar  tctgc
  D                    Parrot  tccgc
  D             Scarlet macaw  tccgc
  D              Mallard duck  cccac
B D        American alligator  a----
  D            Painted turtle  cctgt
  D    Spiny softshell turtle  tcttt
         Cape elephant shrew  =====
            Brush-tailed rat  -----
                  Chinchilla  -----
  D               Rock pigeon  =====
B D       Medium ground finch  =====
B D                   Wallaby  -----
  D  Chinese softshell turtle  =====
  D           Green seaturtle  =====

Inserts between block 33 and 34 in window
  D             Saker falcon 9bp
  D         Peregrine falcon 9bp
  D      Collared flycatcher 4bp
  D   White-throated sparrow 4bp
          Tibetan ground jay 65bp
B D               Budgerigar 3bp
  D             Mallard duck 9bp
B D       American alligator 4bp
  D           Painted turtle 49bp
  D   Spiny softshell turtle 33bp

Alignment block 34 of 160 in window, 24505834 - 24505887, 54 bps 
B D                     Human  t-----------------ccac--------------------atca------------------------
B D                     Chimp  t-----------------ccac--------------------atca------------------------
B D                   Gorilla  t-----------------ccac--------------------atca------------------------
B D                 Orangutan  t-----------------tcac--------------------atca------------------------
B D                    Gibbon  t-----------------tcac--------------------atca------------------------
B D                    Rhesus  t-----------------tcat--------------------gtca------------------------
B D       Crab-eating macaque  t-----------------tcat--------------------gtca------------------------
B D                    Baboon  t-----------------tcat--------------------gtca------------------------
B D              Green monkey  t-----------------tcac--------------------gtca------------------------
B D                  Marmoset  t-----------------tcac--------------------gtta------------------------
B D           Squirrel monkey  t-----------------tcac--------------------gtta------------------------
B D                  Bushbaby  t-----------------tcat--------------------gtca------------------------
           Chinese tree shrew  t-----------------taat--------------------gtca------------------------
B D                  Squirrel  c-----------------catt--------------------atta------------------------
       Lesser Egyptian jerboa  t-----------------taat--------------------atca------------------------
B D           Chinese hamster  c-----------------tcac--------------------atca------------------------
               Golden hamster  t-----------------tcac--------------------at-a------------------------
B D                     Mouse  c-----------------tcat--------------------atca------------------------
B D                       Rat  c-----------------tcac--------------------atca------------------------
B D            Naked mole-rat  t-----------------tcat--------------------a---------------------------
B D                Guinea pig  t-----------------tcac--------------------acca-----------------------c
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
B D                    Rabbit  c-----------------ttgt--------------------atta------------------------
B D                      Pika  t-----------------tcct--------------------tttt------------------------
B D                       Pig  t-----------------tcct--------------------gtca------------------------
B D                   Dolphin  t-----------------tcct--------------------ggca------------------------
                 Killer whale  t-----------------tcct--------------------ggca------------------------
B D                       Cow  t-----------------tcctggcaccccctgaccctgggcggca------------------------
B D                     Sheep  t-----------------tcct--------------------taca------------------------
B D                     Horse  t-----------------tctt--------------------gtca------------------------
B D          White rhinoceros  t-----------------tctt--------------------gtca------------------------
B D                       Cat  t-----------------tctg--------------------gcca------------------------
B D                       Dog  t-----------------tctt--------------------gcca------------------------
B D                   Ferret   t-----------------tctt--------------------gcca------------------------
B D                     Panda  t-----------------tctt--------------------gcca------------------------
               Pacific walrus  t-----------------tctt--------------------gcta------------------------
                 Weddell seal  t-----------------cctt--------------------tctc------------------------
             Black flying-fox  t-----------------tctt--------------------gtta------------------------
B D                   Megabat  t-----------------tctt--------------------gtca------------------------
                Big brown bat  tgcccccccaacatcttatttt--------------------tttc------------------------
         David's myotis (bat)  t-----------------tctt--------------------gtta------------------------
B D                  Microbat  t-----------------tctt--------------------gtta------------------------
B D                  Hedgehog  c-----------------------------------------gtca------------------------
B D                     Shrew  c-----------------t-tt--------------------gtca------------------------
B D                  Elephant  t-----------------tcat--------------------gttg------------------------
B D                   Manatee  t-----------------ttat--------------------gttg------------------------
             Cape golden mole  t-----------------tcct--------------------gttg------------------------
B D                    Tenrec  t-----------------tcat--------------------gttg------------------------
                     Aardvark  t-----------------tcat--------------------cttg------------------------
B D                 Armadillo  t-----------------tcag--------------------ctca------------------------
B D                   Opossum  t-----------------tcat--------------------atca-------------------gcatc
B D           Tasmanian devil  t-----------------ttct--------------------atca-------------------gtatt
B D                  Platypus  t-----------------ctct--------------------cccg------------------------
  D              Saker falcon  -------------------gct--------------------gggg------------------------
  D          Peregrine falcon  -------------------gct--------------------gggg------------------------
  D       Collared flycatcher  -------------------ccc--------------------atat------------------------
  D    White-throated sparrow  -------------------cct--------------------gttt------------------------
B D                Budgerigar  ---------------------t--------------------gcag------------------------
  D                    Parrot  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
  D              Mallard duck  -------------------gct--------------------gggg------------------------
B D        American alligator  -------------------cac--------------------tggg------------------------
  D            Painted turtle  -------------------atc--------------------agat------------------------
  D    Spiny softshell turtle  -------------------acc--------------------agacacaccactgtcattatctagtctg
         Cape elephant shrew  ======================================================================
          Tibetan ground jay  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  ccccatgccccc----a--g-tgcagta-----------------gact-----------gga-------
                        Chimp  ccccatgccgcc----a--g-tgcagta-----------------gact-----------gga-------
                      Gorilla  ccccatgcccgc----a--t-tgcagta-----------------gact-----------gga-------
                    Orangutan  ccccatgcccct----a--g-tgcagta-----------------gact-----------gga-------
                       Gibbon  ccgcatgccccc----g--g-tgcagta-----------------gact-----------gga-------
                       Rhesus  ccccatgccccc----a--g-tgcagta-----------------gact-----------gga-------
          Crab-eating macaque  ccccatgccccc----a--g-tgcagta-----------------gact-----------gga-------
                       Baboon  ccccatgccccc----a--g-tgcagta-----------------gact-----------gga-------
                 Green monkey  ccccatgccccc----a--g-tgcagta-----------------gact-----------gga-------
                     Marmoset  ccccattccccc----a--g-tgcagta-----------------gact-----------gga-------
              Squirrel monkey  ccccattccccc----a--g-tgcagta-----------------gact-----------gga-------
                     Bushbaby  ccccatccaccc----t--g-cacagca-----------------gatg-----------gga-------
           Chinese tree shrew  cc-catgtgccc----t--a-ggcagca-----------------gact-----------ggg-------
                     Squirrel  ctctgtgtg-------t--g-tagactg-----------------gaat-----------ggg-------
       Lesser Egyptian jerboa  ccccataaaccc----t--g-tgtagca-----------------gact-----------aggatgggtg
              Chinese hamster  ccccatgttctc----t--g-cacagca-----------------ga-----------------------
               Golden hamster  acccacattctc----t--g-cacagct-----------------aa-----------------------
                        Mouse  ccccatgttctctgtct--g-aacagca-----------------gaag-----------agg-------
                          Rat  ccccatgtt-------t--g-cacagagt----------------gaac-----------tga-------
               Naked mole-rat  tcccatgtgccc----t--g-tgctgca-----------------gact-----------ggg-------
                   Guinea pig  ccccatgtgccc----t--g-tgttttt-----------------gact-----------ggg-------
                   Chinchilla  ---------ccc----t--g-tgctata-----------------gact-----------ggg-------
             Brush-tailed rat  ---------ccc----t--g-tgctata-----------------gact-----------aag-------
                       Rabbit  ctccatgtgccc----t--g-tgcagca-----------------gaca-----------ggg-------
                         Pika  ctcctggaaccc----t--c-tat-gca-----------------gact-----------ggg-------
                          Pig  tcccaggagccc----c--a-tgccgca-----------------gcct-----------ggg-------
                      Dolphin  ccccatga-ccc----t--g-tgtagca-----------------gcct-----------ggg-------
                 Killer whale  ccccgtga-ccc----t--g-tgtagca-----------------gcct-----------ggg-------
                          Cow  ccccctga-ccc----t--g-agcag-a-----------------ccct-----------g---------
                        Sheep  acccctga-ccc----t--g-agcag-a-----------------ccct-----------g---------
                        Horse  cccc-tgtgccc----t--g-ggcagca-----------------gcct-----------ggg-------
             White rhinoceros  ccccatgtgccc----tggg-ggcagta-----------------gcct-----------ggg-------
                          Cat  cctcatgtgccc----t--g-tgcagca-----------------gcct-----------ggg-------
                          Dog  ccctgtgtgccc----t--g-tgccgca-----------------gcct------------gg-------
                      Ferret   ccccatgtgtgc----t--g-tgcagca-----------------gtct-----------agg-------
                        Panda  cgccacgtgcac----t--g-tgcagca-----------------gctt-----------ggg-------
               Pacific walrus  ccctgtgtgcgc----t--g-ggcagca-----------------gcct-----------ggg-------
                 Weddell seal  tcctg-gagtcc----t--g-ttcagga-----------------gact-----------aga-------
             Black flying-fox  ccccttgtatcc----t--a-tttagca-----------------gact-----------gag-------
                      Megabat  ccccttgtatcc----t--a-tttagca-----------------gact-----------gag-------
                Big brown bat  tctcctggagcc----c--a-gtatgca-----------------gact-----------aga-------
         David's myotis (bat)  tcccatgtgtcc----t--g-tttagca-----------------aact-----------gag-------
                     Microbat  tctcatgtgtcc----t--g-tttagca-----------------gact-----------aag-------
                     Hedgehog  ccccctgcaccc----g--g-tgtggtg-----------------gcct-----------ggt-------
                        Shrew  ccccctgtgccc----t--c-tgtag----------------------t-----------ggt-------
                     Elephant  ct-cacatgctc----t--a-tacagca-----------------gact-----------ggg-------
                      Manatee  ct-cacatgccc----t--g-tgcagca-----------------gact-----------ggg-------
             Cape golden mole  tt-catgttccc----t--g-tgcaaca-----------------gact-----------aac-------
                       Tenrec  ct-cacctcccc----t--a-tgctccg-----------------gg-----------------------
                     Aardvark  ct-tactttctc----t--g-tgcagca-----------------gact-----------ggg-------
                    Armadillo  ctgcacatgccc----t--g-ggcagtg-----------------gact-----------ggg-------
                      Opossum  cctttgaaactc----t--g-agtagga-----------------gtct-----------tgg-------
              Tasmanian devil  cccctgaaattc----t--g-agtagga-----------------tcta-----------tgg-------
                     Platypus  cccaccgggtcc----t--gactctgct-----------------gtcc-----------ggg-------
                 Saker falcon  ct-------ctg----c--c-cccaggac--------tgtgcatggacc-----------gtg-------
             Peregrine falcon  ct-------ctg----c--c-cccaggac--------tgtgcatggacc-----------gtg-------
          Collared flycatcher  cc-------cac----c--c-agc---------------tgaaggggctgtcccgagctgggg-------
       White-throated sparrow  cc-------caa----c--t------------------------gggct-----------gat-------
                   Budgerigar  ag-------cac----c--a-------------------caggatggtt-----------ggg-------
                       Parrot  -----------------------------------------------at-----------ggg-------
                Scarlet macaw  -----------------------------------------------tt-----------ggg-------
                 Mallard duck  ct-------ctg----c--c-cccgggac--------cgcacatggatc-----------agg-------
           American alligator  ca-------ctg----t--t-acagggaagttcgcagcctcgggggttt-----------gag-------
               Painted turtle  at-------ttt----c--c-cattggt------------------------------------------
       Spiny softshell turtle  ac-------ttc----c--t-ctttggt------------------------------------------
          Cape elephant shrew  ======================================================================
           Tibetan ground jay  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  atggat-ggtcagagg------------------------------------------------------
                        Chimp  gtggat-ggtcagaag------------------------------------------------------
                      Gorilla  atggat-ggtcagagg------------------------------------------------------
                    Orangutan  atggac-ggtcagagg------------------------------------------------------
                       Gibbon  atggac-ggtcagagg------------------------------------------------------
                       Rhesus  atggat-ggtcagagg------------------------------------------------------
          Crab-eating macaque  atggat-ggtcagagg------------------------------------------------------
                       Baboon  atggat-ggtcagagg------------------------------------------------------
                 Green monkey  atggat-ggtcagagg------------------------------------------------------
                     Marmoset  atggac-gatcagagg------------------------------------------------------
              Squirrel monkey  atggac-gatcagagg------------------------------------------------------
                     Bushbaby  atgaat-ggttagaca------------------------------------------------------
           Chinese tree shrew  atagat-ggtcacaga------------------------------------------------------
                     Squirrel  -----t-tgtcagaga------------------------------------------------------
       Lesser Egyptian jerboa  gtcaga-gaccatggg------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----tg-acccaggat------------------------------------------------------
                          Rat  ----ga-aacccgagt------------------------------------------------------
               Naked mole-rat  ttggat-ggtcacaga------------------------------------------------------
                   Guinea pig  ttgggt-ggtcagaga------------------------------------------------------
                   Chinchilla  ttggat-gcccagaga------------------------------------------------------
             Brush-tailed rat  ttaggt-ggtcagagg------------------------------------------------------
                       Rabbit  -----------atgga------------------------------------------------------
                         Pika  taaaaa-gcttaaagg------------------------------------------------------
                          Pig  tggggt-ggtcagaga------------------------------------------------------
                      Dolphin  agggat-agtcagaga------------------------------------------------------
                 Killer whale  agggat-agtcagaga------------------------------------------------------
                          Cow  --------gtcagaga------------------------------------------------------
                        Sheep  --------gtcagaga------------------------------------------------------
                        Horse  agggat-ggtcagaga------------------------------------------------------
             White rhinoceros  agggat-ggtcagaga------------------------------------------------------
                          Cat  aggggt-gcccagaga------------------------------------------------------
                          Dog  agggat-ggttagaga------------------------------------------------------
                      Ferret   agggat-ggtcagagc------------------------------------------------------
                        Panda  agggat-ggtcagaga------------------------------------------------------
               Pacific walrus  agggat-ggtcagaga------------------------------------------------------
                 Weddell seal  agggag-ggttagaa-------------------------------------------------------
             Black flying-fox  agggat-ggtcagaga------------------------------------------------------
                      Megabat  agggat-ggtcagaga------------------------------------------------------
                Big brown bat  tgggaa-tattagagg------------------------------------------------------
         David's myotis (bat)  agggat-ggttagaga------------------------------------------------------
                     Microbat  agggat-ggttagaga------------------------------------------------------
                     Hedgehog  cggggt-ggtcaggga------------------------------------------------------
                        Shrew  caggga-tggca----------------------------------------------------------
                     Elephant  aggaaa-ggtcagaga------------------------------------------------------
                      Manatee  agggaa-agtcagaaa------------------------------------------------------
             Cape golden mole  atgaaa-ggccagaga------------------------------------------------------
                       Tenrec  atggca-ggtctaagg------------------------------------------------------
                     Aardvark  atgaaa-ggtcagaaa------------------------------------------------------
                    Armadillo  agggaa-ggtctgaag------------------------------------------------------
                      Opossum  gaggatggggtagagg------------------------------------------------------
              Tasmanian devil  gtgga--gggcagagaatgtatcttctaccctactttgggaaaatgagaattggattggggatttggaat
                     Platypus  gtgggg-gtttggtgg------------------------------------------------------
                 Saker falcon  gtg-------------------------------------------------------------------
             Peregrine falcon  gtg-------------------------------------------------------------------
          Collared flycatcher  ctc-------------------------------------------------------------------
       White-throated sparrow  ctc-------------------------------------------------------------------
                   Budgerigar  act-------------------------------------------------------------------
                       Parrot  atc-------------------------------------------------------------------
                Scarlet macaw  atc-------------------------------------------------------------------
                 Mallard duck  atg-------------------------------------------------------------------
           American alligator  ctt-------------------------------------------------------------------
               Painted turtle  ----------------------------------------------------------------------
       Spiny softshell turtle  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
           Tibetan ground jay  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  -------ct
                        Chimp  -------ct
                      Gorilla  -------ct
                    Orangutan  -------ct
                       Gibbon  -------ct
                       Rhesus  -------ct
          Crab-eating macaque  -------ct
                       Baboon  -------ct
                 Green monkey  -------ct
                     Marmoset  -------ct
              Squirrel monkey  -------ct
                     Bushbaby  -------ct
           Chinese tree shrew  -------cc
                     Squirrel  -------tt
       Lesser Egyptian jerboa  -------ag
              Chinese hamster  ---------
               Golden hamster  ---------
                        Mouse  ---------
                          Rat  ---------
               Naked mole-rat  -------ct
                   Guinea pig  -------cc
                   Chinchilla  -------ct
             Brush-tailed rat  -------ct
                       Rabbit  -------tg
                         Pika  -------tg
                          Pig  -------ct
                      Dolphin  -------ct
                 Killer whale  -------ct
                          Cow  -------cc
                        Sheep  -------tg
                        Horse  -------ct
             White rhinoceros  -------ct
                          Cat  -------tt
                          Dog  -------ct
                      Ferret   -------ct
                        Panda  -------ct
               Pacific walrus  -------ct
                 Weddell seal  ---------
             Black flying-fox  -------ct
                      Megabat  -------ct
                Big brown bat  -------ca
         David's myotis (bat)  -------ct
                     Microbat  -------ct
                     Hedgehog  -------ct
                        Shrew  ---------
                     Elephant  -------ct
                      Manatee  -------ct
             Cape golden mole  -------ct
                       Tenrec  -------cc
                     Aardvark  -------ct
                    Armadillo  -------ct
                      Opossum  -------tt
              Tasmanian devil  attttcttt
                     Platypus  -------ct
                 Saker falcon  ---------
             Peregrine falcon  ---------
          Collared flycatcher  ---------
       White-throated sparrow  ---------
                   Budgerigar  ---------
                       Parrot  ---------
                Scarlet macaw  ---------
                 Mallard duck  ---------
           American alligator  ---------
               Painted turtle  ---------
       Spiny softshell turtle  ---------
          Cape elephant shrew  =========
           Tibetan ground jay  =========
                  Rock pigeon  =========
          Medium ground finch  =========
                      Wallaby  ---------
     Chinese softshell turtle  =========
              Green seaturtle  =========

Inserts between block 34 and 35 in window
  D             Saker falcon 15bp
  D         Peregrine falcon 15bp
  D      Collared flycatcher 55bp
  D   White-throated sparrow 31bp
B D               Budgerigar 17bp
  D                   Parrot 3bp
  D            Scarlet macaw 3bp
  D             Mallard duck 9bp

Alignment block 35 of 160 in window, 24505888 - 24505959, 72 bps 
B D                     Human  g-----t--ct-------------tg---gaccacggg--------------aggac-------------
B D                     Chimp  g-----t--ct-------------tg---ggccacggg--------------aggac-------------
B D                   Gorilla  g-----t--ct-------------tg---ggccatggg--------------aggac-------------
B D                 Orangutan  g-----t--ct-------------tg---ggccatggg--------------aggac-------------
B D                    Gibbon  g-----t--ct-------------tg---ggccatggg--------------aggac-------------
B D                    Rhesus  g-----t--ct-------------tg---ggccatggg--------------aggac-------------
B D       Crab-eating macaque  g-----t--ct-------------tg---ggccatggg--------------aggac-------------
B D                    Baboon  g-----t--ct-------------tg---ggccatagg--------------aggac-------------
B D              Green monkey  g-----t--ct-------------tg---ggccatggg--------------aggac-------------
B D                  Marmoset  g-----t--ct-------------tg---ggccatggg--------------aggac-------------
B D           Squirrel monkey  g-----t--ct-------------tg---ggccatggg--------------aggac-------------
B D                  Bushbaby  g-----t--cc-------------tg---ggccatggg--------------aggat-------------
           Chinese tree shrew  a-----t--cc------gggggcgtg---ggccatggg--------------aggac-------------
B D                  Squirrel  g-----t--cc-------------tg---ggccacagg--------------aggag-------------
       Lesser Egyptian jerboa  a-----g--ac-------------ca---ggccatagg--------------aggat-------------
B D           Chinese hamster  -----------------------------------tgg--------------aagat-------------
               Golden hamster  -----------------------------------tgg--------------aagat-------------
B D                     Mouse  -----------------------------agccctggg--------------aagat-------------
B D                       Rat  -----------------------------ggccctggg--------------aagac-------------
B D            Naked mole-rat  t-----c--cc-------------tg---ggcaaaaag--------------aggat-------------
B D                Guinea pig  a-----t--cc-------------tg---agcactgag--------------aagat-------------
                   Chinchilla  g-----t--tc-------------tg---ggcaatgag--------------aggat-------------
             Brush-tailed rat  g-----t--cc-------------tg---ggcaatgag--------------aggat-------------
B D                    Rabbit  g-----gcacc-------------ct---ggcc-tggg---ccagagg----aaggt-------------
B D                      Pika  g-----g--gt-------------tt---ggctgtgggatcccagaatccacgagga-------------
B D                       Pig  g-----c--at-------------cg---ggccgcagg--------------aggcc-agtctgcag---
B D                   Dolphin  g-----c--ct-------------gg---ggccgcggg--------------aggat-gatcagccc---
                 Killer whale  g-----c--ct-------------gg---ggccgcggg--------------aggat-gatcagccc---
B D                       Cow  c-----c--ac-------------gg---ggccgaggg--------------aggag-gatctgcag---
B D                     Sheep  c-----c--at-------------gg---ggccgaggg--------------aggag-gatctgaag---
B D                     Horse  g-----c--ct-------------gg---ggccatagg--------------aggacagacctgcag---
B D          White rhinoceros  g-----t--gt-------------gg---ggccatagg--------------aagacagacctgcag---
B D                       Cat  g-----c--atgtggccatgggtgggg--gaggagcag--------------ggaacggatctgcag---
B D                       Dog  g-----t--at-------------ggg--tggg-------------------gggatagatctggag---
B D                   Ferret   a-----c--at-------------ggc--aggg--tgg--------------ggggtagatctgcag---
B D                     Panda  g-----c--at-------------ggg--gggt-------------------gggatagatgtgcaa---
               Pacific walrus  g-----c--at-------------ggc--ggggagagg--------------gggatagatctgcag---
                 Weddell seal  g-----c--ag-------------ggcttgagtatgtg--------------aggatggaacc-ccg---
             Black flying-fox  g-----c--ac-------------ag---ggctaaggg--------------agaatagatcctcag---
B D                   Megabat  g-----c--ac-------------ag---ggctaaggg--------------agaatagatcctcag---
                Big brown bat  g-----g--ac-------------tt---gagtatgaa--------------aggatggaacc-cgg---
         David's myotis (bat)  g-----c--aa-------------ag---ggccatggg--------------agaatggattcacag---
B D                  Microbat  g-----c--ac-------------ag---ggccatggg--------------agaatgaattcacag---
B D                  Hedgehog  t-----c--cc-------------at---ggccttgga--------------agaaggtttctgcag---
B D                     Shrew  ------c--ct-------------gg---ggccatggg--------------agaagg-agccacag---
B D                  Elephant  g-----t--ac-------------tg---gaccatggg--------------aggagggatctgcaa---
B D                   Manatee  g-----t--ac-------------tg---gaccatagg--------------agga-ggatctgcag---
             Cape golden mole  g-----t--ac-------------ca---caccatgtg--------------aagaaggatctcag----
B D                    Tenrec  g-----t--ac-------------ca---gactgtggg--------------gggtaggggttgggagca
                     Aardvark  g-----t--ac-------------ca---gacaatggg--------------aggagggatatgcag---
B D                 Armadillo  g-----t--ac-------------tg---ggccatggg--------------a-gaggtaagtacag---
B D                   Opossum  g-----c--tt-------------ac--------------------------a-----------------
B D           Tasmanian devil  t-----c--tc-------------ac--------------------------agacc-------------
B D                  Platypus  gacaccc--cc-------------ga---gatccgatg--------------acgaa-------------
  D              Saker falcon  ----------------------------------------------------------------------
  D          Peregrine falcon  ----------------------------------------------------------------------
  D       Collared flycatcher  ----------------------------------------------------------------------
  D    White-throated sparrow  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  ---------a----g-caat---------------tc---------------------------------
                        Chimp  ---------a----ggcaat---------------tc---------------------------------
                      Gorilla  ---------a----ggcaat---------------tc---------------------------------
                    Orangutan  ---------a----gacaat---------------tc---------------------------------
                       Gibbon  ---------a----gacaat---------------cc---------------------------------
                       Rhesus  ---------a----gacaat---------------cc---------------------------------
          Crab-eating macaque  ---------a----gacaat---------------cc---------------------------------
                       Baboon  ---------a----gacaat---------------cc---------------------------------
                 Green monkey  ---------a----gacaat---------------cc---------------------------------
                     Marmoset  ---------a----gacagt---------------tc---------------------------------
              Squirrel monkey  ---------a----gacaat---------------tc---------------------------------
                     Bushbaby  ---------g----gacaatgccagttttctcag-tc---------------------------------
           Chinese tree shrew  ---------a----gagaattccaactttctcagttc---------------------------------
                     Squirrel  ---------g----gacact---------------ttc-----------agtttt--------ctcact-
       Lesser Egyptian jerboa  ---------g----gacact---------------ca-------------gtttt--------ctcacc-
              Chinese hamster  ---------g----gatact---------------tt-------------gtttc--------ctcact-
               Golden hamster  ---------g----gatact---------------tt-------------gtttc--------ctagcg-
                        Mouse  ---------g----gatact---------------tt-------------gtttc--------ctcact-
                          Rat  ---------c----gatact---------------tt-------------gtttc--------ctcagt-
               Naked mole-rat  ---------g--cccacggt---------------ttc-----------aggttc--------ctcaca-
                   Guinea pig  ---------g--ctcgcact---------------ttc-----------aggtt---------cttaca-
                   Chinchilla  ---------g--ctcacact---------------ttc-----------aggttc--------ctcaca-
             Brush-tailed rat  ---------g--ctcacact---------------ttc-----------aggttc--------ctcata-
                       Rabbit  ---------g----gacaat---------------tc---------------------------------
                         Pika  ---------t----gccagt---------------gt---------------------------------
                          Pig  -------aggcacagacagt---------------tcc-----------ag-ctc--------ctcagt-
                      Dolphin  -------agg----gacagt---------------tcc-----------ag-ctc--------ctcagt-
                 Killer whale  -------agg----gacagt---------------tcc-----------ag-ctc--------ctcagt-
                          Cow  -------agg----gacagt---------------ccc-----------ag-ctc--------ctcaga-
                        Sheep  -------agg----gatagt---------------ccc-----------ag-ctc--------ctcaga-
                        Horse  -------agg----agcaat---------------tcc-----------agattc--------ctcagt-
             White rhinoceros  -------agg----agcaat---------------tcc-----------accttc--------ctcagt-
                          Cat  -------agg----ggtgat---------------tcc-----------ag-ttc--------cttagg-
                          Dog  -------agg----ggtgat---------------tcc-----------ag-ttc--------cttagg-
                      Ferret   -------agg----ggcaat---------------tcc-----------ag-ttc--------cttagg-
                        Panda  -------agg----gccaat---------------tcc-----------ag-ttc--------tttcgg-
               Pacific walrus  -------agg----ggcaat---------------tcc-----------ag-ttc--------cttagg-
                 Weddell seal  -------agg----gaggat---------------tcc-----------ag-ttcccgggttgctaaaa-
             Black flying-fox  -------aag----gacaat---------------tcc-----------agtttc--------ctcagt-
                      Megabat  -------aag----gacaat---------------tcc-----------agtttc--------ttcagt-
                Big brown bat  -------aag----gaggat---------------tcc-----------agttcc--------catagtt
         David's myotis (bat)  -------agg----gacaat---------------tcc-----------agattc--------ctcagc-
                     Microbat  -------agg----gacaat---------------tcc-----------agattc--------ctcagc-
                     Hedgehog  -------ggg----gaca-------------------------------actttt--------cagact-
                        Shrew  -------agg----gacaag---------------gcc-----------agtttc--------ctcagt-
                     Elephant  -------agg----gacagt---------------tct-----------agtttt--------ctctgt-
                      Manatee  -------agg----gacagt---------------tct-----------agtttt--------ctcagt-
             Cape golden mole  -------agg----gag--------------------------------agtttc--------ctcagt-
                       Tenrec  tctgctcagg----gaactt---------------tct-----------agtttc--------ctcagt-
                     Aardvark  -------agg----gtaggc---------------t-------------ggtttc--------ctcagt-
                    Armadillo  -------agg----gacaaa---------------tcc-----------aatttc--------ctctgt-
                      Opossum  -------tca----accccc---------------acc------------------------------c-
              Tasmanian devil  -------tca----attcct---------------tccctcctagccccactttc--------caatac-
                     Platypus  -------ggg----ggcagg-----------------------------aggggc---------------
                 Saker falcon  ----------------------------------------------------gag--------ctagtc-
             Peregrine falcon  ----------------------------------------------------gag--------ctagtc-
          Collared flycatcher  -----------------------------------------------------cc--------cttgtg-
       White-throated sparrow  ------------------------------------------------------------------gag-
           Tibetan ground jay  -----------------------------------------------------gt--------cctgtg-
                   Budgerigar  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                Scarlet macaw  ----------------------------------------------------------------------
                 Mallard duck  -----------------------------------tcc-----------cgggag--------cccgtc-
           American alligator  ---------------------------------------------------gggt--------tggatg-
               Painted turtle  ------------------------------------------------------t--------tgtaca-
       Spiny softshell turtle  -----------------------------------------------------gt--------tttata-
          Cape elephant shrew  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  --------c--tgtgat---------gct-c-a--------------c-cct-gtca--------c-tg-
                        Chimp  --------c--tgtgat---------gcc-c-a--------------c-cct-gtca--------c-tg-
                      Gorilla  --------c--tgtgat---------gcc-c-a--------------c-cct-gtca--------c-tg-
                    Orangutan  --------c--tgtgat---------gcc-c-a--------------c-cct-gtca--------c-tg-
                       Gibbon  --------c--tgtgat---------gcc-c-a--------------c-cct-gtca--------c-tg-
                       Rhesus  --------c--tgtgat---------gcc-a-a--------------c-tct-gtca--------c-tg-
          Crab-eating macaque  --------c--tgtgat---------gcc-a-a--------------c-tct-gtca--------c-tg-
                       Baboon  --------c--tgtgat---------gcc-a-a--------------c-tct-gtca--------c-tg-
                 Green monkey  --------c--tgtgat---------gcc-a-a--------------c-tct-gtca--------c-tg-
                     Marmoset  --------c--tgtgat---------gcc-a-a--------------c-cct-gtca--------c-tg-
              Squirrel monkey  --------c--tgtgat---------gcc-a-a--------------c-cct-ttca--------c-tg-
                     Bushbaby  --------c--tgtgat---------ctcaa-a--------------c-cct-gatg--------c-tg-
           Chinese tree shrew  --------c--tgtgac---------tccac-a--------------c-cat-gt------------tg-
                     Squirrel  -------cc--tgctat---------tcc-a-a--------------actcg-atca--------t-tg-
       Lesser Egyptian jerboa  -------ct--tgtaat---------ccc-a-c--------------atatt-gtca--------c-ta-
              Chinese hamster  -------cc--tgagat---------tcc-t-a--------------a-act-gtga--------t-ta-
               Golden hamster  -------cc--tgtgat---------ccc-t-a--------------a-act-gtga--------t-ta-
                        Mouse  --------t--ggtgat---------tcc-taa--------------acact-atga--------t-ta-
                          Rat  --------t--ggtgat---------tcc-t-a--------------acact-gtga--------t-tg-
               Naked mole-rat  -------tc--tatgat---------ccc-a-a--------------a-cct-gtca--------c-tg-
                   Guinea pig  -------ct--tttgat---------ccc-a-a--------------a-cct-gtca--------c-ta-
                   Chinchilla  -------ct--catgac---------ccc-a-a--------------a-ctt-gtca--------c-ta-
             Brush-tailed rat  -------cc--aaggat---------ctc-a-a--------------a-cct-gtca--------g-ta-
                       Rabbit  --------c--tgtgag---------ccc-a-g--------------a-cct-gtcc--------c-tg-
                         Pika  --------c--cacgac---------cct-a-ggagcacacccagaca-ctg-gtcc--------c-agt
                          Pig  -------cc--tgtgaa---------ctc-a-a--------------actct-gtca--------c-tg-
                      Dolphin  -------cc--tatgat---------ctc-a-a--------------acttt-gtca--------c-tg-
                 Killer whale  -------cc--tatgat---------ctc-a-a--------------acttt-gtca--------c-tg-
                          Cow  -------cc--tgaggt---------ctc-a-c--------------acttt-gtca--------c-tg-
                        Sheep  -------cc--tgaggt---------ctc-a-c--------------acttt-gcca--------c-tg-
                        Horse  -------cc--tatcat---------ctc-a-a--------------acccc-gttg--------c-tg-
             White rhinoceros  -------cc--tatcat---------ctc-a-a--------------accct-gtcg--------c-tg-
                          Cat  -------cc--catgat---------ctg-a-a--------------accct-gtcg--------c-tg-
                          Dog  -------cc--tatgat---------ctg-a-a--------------accct-gtgg--------c-ca-
                      Ferret   -------cccttatgat---------ctg-a-g--------------accct-gtca--------c-tg-
                        Panda  -------cc--tatgat---------ctg-a-a--------------accct-gtca--------c-tg-
               Pacific walrus  -------cc--tatgat---------ctg-a-a--------------accct-gcta--------c-tg-
                 Weddell seal  -------cc--cacaga---------ctc-a-g--------------acactagtca--------c-tg-
             Black flying-fox  -------cc--tatgac---------ttc-a-a--------------accct-ggca--------t-tg-
                      Megabat  -------cc--attgac---------ttc-a-a--------------accct-ggca--------t-tg-
                Big brown bat  ctagaaacc--catgaa---------tgc-a-g--------------acact-ggta--------a-ct-
         David's myotis (bat)  -------cc--tttgat---------ctc-a-a--------------accct-gtca--------t-tt-
                     Microbat  -------cc--tttggt---------ctc-a-a--------------accct-gtca--------t-tt-
                     Hedgehog  -------ct--cacaat---------cac-a-a--------------accct-gtca--------c-cg-
                        Shrew  -------cc--cacggg---------ctc-a-t--------------a-cct-gtca--------c-ct-
                     Elephant  -------cc--ttcaat---------ccc-a-a--------------accct-ctca--------c-tg-
                      Manatee  -------cc--tgcaat---------ccc-a-a--------------acctg-ttca--------c-tg-
             Cape golden mole  -------cc--tgtgat---------ccc-a-a--------------acctt-ctca--------c-tg-
                       Tenrec  -------cc--tg---------------c-a-a--------------ctcct-acca--------c-ta-
                     Aardvark  -------cc--tgtgat---------acc-a-a--------------a-ctt-ctca--------c-tg-
                    Armadillo  -------cc--tgttat---------ccc-a-a--------------agact-gtca--------c-ta-
                      Opossum  -------cc--tg-------------ccc-a-a--------------g-tcc-agga--------ctca-
              Tasmanian devil  -------cc--tg-------------ccc-a-a--------------g-tcc-tgga--------c-ca-
                     Platypus  -------ct--ggagac---------gtt-t-c--------------cagct-gcca--------c-cg-
                 Saker falcon  -------ca--catggg----agc--tac-a-a--------------a-tcg-aaca--------c-tt-
             Peregrine falcon  -------ca--catggg----agc--tac-a-a--------------a-tcg-aaca--------c-tt-
          Collared flycatcher  -------gg--aa-------------ctg-c-g--------------a-cca-aatg--------c-tt-
       White-throated sparrow  -------cc--aa--------acc--ctg-t-g--------------c-tca-aaca--------c-tt-
           Tibetan ground jay  --------------------------cca-c-g--------------g-caa-gacaaggttcctc-tt-
                   Budgerigar  ----------------------------t-t-t--------------t-ccc-actg-ggtggatt-ct-
                       Parrot  ----------------------------g-c-a--------------t-cca-attg--------c-ct-
                Scarlet macaw  ----------------------------a-c-a--------------t-cca-atcg--------c-ct-
                 Mallard duck  -------ca--cgcggg----ca---cag-g-a--------------a-ctg-catt--------c-ta-
           American alligator  -------gc--cctgcc----agct-ggg-t-g--------------g-gca-gctg--------c-tt-
               Painted turtle  -------gc--acttag----agcagcag-g-a--------------c-ctg-atct--------c-tg-
       Spiny softshell turtle  -------ag--aagaaagattagttgcag-t-a--------------a-ctc-acca--------a-ag-
          Cape elephant shrew  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  a----ct--ga--------------caac-cttc-tg-acccca--------------------------
                        Chimp  g----ct--ga--------------caac-ctac-tg-acccca--------------------------
                      Gorilla  g----ct--ga--------------caac-cttc-tg-acccca--------------------------
                    Orangutan  g----ct--ga--------------caac-cttc-tg-acccca--------------------------
                       Gibbon  g----ct--ga--------------caac-cttc-tg-acccca--------------------------
                       Rhesus  g----ct--ga--------------caac-cttc-tg-acccaa--------------------------
          Crab-eating macaque  g----ct--ga--------------caac-cttc-tg-acccaa--------------------------
                       Baboon  g----ct--ga--------------caac-cttc-tg-acccaa--------------------------
                 Green monkey  g----ct--ga--------------caac-cttc-tg-acccaa--------------------------
                     Marmoset  g----ct--ga--------------tagg-cttc-tg-acccca--------------------------
              Squirrel monkey  g----ct--ca--------------tagc-cttc-tg-acccct--------------------------
                     Bushbaby  g----ct--ga--------------caa--------g-acccca--------------------------
           Chinese tree shrew  g----ct--ga--------------cagt-cttt-tg-acccca--------------------------
                     Squirrel  a----ct--ga--------------caat-ct--------------------------------------
       Lesser Egyptian jerboa  -----ct--ga--------------caat-cttc-tg-ccccta--------------------------
              Chinese hamster  a----ct--ga--------------cagt-cttc-tg-tcccgc--------------------------
               Golden hamster  a----ct--ga--------------caat-cttc-tg-ccccgc--------------------------
                        Mouse  g----ct--ga--------------caat-cttc-ca-ccccac--------------------------
                          Rat  g----ct--gg--------------caat-cttc-tg-ccctac--------------------------
               Naked mole-rat  g----ct--ga--------------cagt-cttc-tg-gctcta--------------------------
                   Guinea pig  g----ct--ga--------------caat-catc-tg-attcca--------------------------
                   Chinchilla  g----cc--aa--------------cagt-catc-tg-attcca--------------------------
             Brush-tailed rat  ggtgtca--aa--------------taat-catc-ca-attcca--------------------------
                       Rabbit  g----ct--aa--------------cgct-cttc-tg-atgcca--------------------------
                         Pika  g----tt--ag--------------gaca-cttcttg-acctct--------------------------
                          Pig  g----ct--ga--------------cacg-cttc-tg-actccg--------------------------
                      Dolphin  g----ct--ga--------------cact-ctgc-tg-actcca--------------------------
                 Killer whale  g----ct--ga--------------cact-cttc-tg-actcca--------------------------
                          Cow  g----ct--ga--------------cact-g--t-ga-actccg--------------------------
                        Sheep  g----tt--ga--------------cact-c--c-ta-actccg--------------------------
                        Horse  a----ct--ga--------------caat-cttc-tg-acctca--------------------------
             White rhinoceros  g----ct--ga--------------caat-cttc-tg-acccca--------------------------
                          Cat  g----ct--ga--------------caac-cttc-cc-acccca--------------------------
                          Dog  c----ct--ga--------------cagt-ctac-cc-accccc--------------------------
                      Ferret   g----ct--ga--------------tagt-cttc-cc-acccca--------------------------
                        Panda  g----ct--ga--------------cagt-cttc-cc-acccca--------------------------
               Pacific walrus  c----ct--ga--------------cagt-cttc-cc-acccca--------------------------
                 Weddell seal  ta---ct--ag--------------ggga-cttc-ctgacccca--------------------------
             Black flying-fox  c----ct--ga--------------caat-tttc-tg-acccca--------------------------
                      Megabat  c----ct--ga--------------caat-tttc-tg-acccca--------------------------
                Big brown bat  gaac-ca--gg--------------ggac-ttcc-tg-atccac--------------------------
         David's myotis (bat)  g----tt--ga--------------caac-cttc-tg-acccca--------------------------
                     Microbat  g----tt--ga--------------caac-cttc-tg-acccca--------------------------
                     Hedgehog  a----cg--aa--------------caat-ttcc-tg-gcctca--------------------------
                        Shrew  a----tg--ac--------------cctt-ctac-tt-attcca--------------------------
                     Elephant  g----cc--ga--------------caac-ctcc-tg-acccta--------------------------
                      Manatee  g----gt--gg--------------caat-ctct-tg-acccca--------------------------
             Cape golden mole  g----tt--ga--------------caat-cttc-tg-acccct--------------------------
                       Tenrec  g----tt--ga--------------caaa-cccc-tg-acaccg--------------------------
                     Aardvark  g----tt--ga--------------caat-tttc-tg-accctg--------------------------
                    Armadillo  a----gt--gg--------------caat-cttc-ca-acccca--------------------------
                      Opossum  g----tg--ga--------------aagt-ct---tg-acctct--------------------------
              Tasmanian devil  a----ct--ga--------------aagc-tt---tt-atctca--------------------------
                     Platypus  c----cctggg--------------gtat-ctcc-tg-ccccaa--------------------------
                 Saker falcon  g----tc--ac--------------ctct-cctg-gg-gaccagccgag---------------------
             Peregrine falcon  g----tc--ac--------------ctct-cctg-gg-gaccagccgag---------------------
          Collared flycatcher  g----tc--ac--------------ctgc-cctg-gc-acctggctgtg---------------------
       White-throated sparrow  g----tc--ac-----------------------------------------------------------
           Tibetan ground jay  c----tc--cc--------------ttgtgcttt-gc-gcctgggtaaa---------------------
                   Budgerigar  c----tg--ct--------------cagatgctc-tc-agatcaatgagg--------------------
                       Parrot  c----ta--tt--------------ggga-gcca-gc-atctcc--------------------------
                Scarlet macaw  c----ta--tt--------------gaga-gcca-gc-atctcc--------------------------
                 Mallard duck  g----tc--ac--------------ctct-cctg-gc-gtcctaccgag---------------------
           American alligator  g----tt-----------------------tctg-gc-accaggctgcaatctcatgccagcctcataac
               Painted turtle  a----tc--tt--------------tgct-tata-gg-ccca----------------------------
       Spiny softshell turtle  c----tt--ctgcgagagacagacatgcc-tctg-tc-tcca----------------------------
          Cape elephant shrew  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  --------
                        Chimp  --------
                      Gorilla  --------
                    Orangutan  --------
                       Gibbon  --------
                       Rhesus  --------
          Crab-eating macaque  --------
                       Baboon  --------
                 Green monkey  --------
                     Marmoset  --------
              Squirrel monkey  --------
                     Bushbaby  --------
           Chinese tree shrew  --------
                     Squirrel  --------
       Lesser Egyptian jerboa  --------
              Chinese hamster  --------
               Golden hamster  --------
                        Mouse  --------
                          Rat  --------
               Naked mole-rat  --------
                   Guinea pig  --------
                   Chinchilla  --------
             Brush-tailed rat  --------
                       Rabbit  --------
                         Pika  --------
                          Pig  --------
                      Dolphin  --------
                 Killer whale  --------
                          Cow  --------
                        Sheep  --------
                        Horse  --------
             White rhinoceros  --------
                          Cat  --------
                          Dog  --------
                      Ferret   --------
                        Panda  --------
               Pacific walrus  --------
                 Weddell seal  --------
             Black flying-fox  --------
                      Megabat  --------
                Big brown bat  --------
         David's myotis (bat)  --------
                     Microbat  --------
                     Hedgehog  --------
                        Shrew  --------
                     Elephant  --------
                      Manatee  --------
             Cape golden mole  --------
                       Tenrec  --------
                     Aardvark  --------
                    Armadillo  --------
                      Opossum  --------
              Tasmanian devil  --------
                     Platypus  --------
                 Saker falcon  ----cctg
             Peregrine falcon  ----cctg
          Collared flycatcher  ----cccg
       White-throated sparrow  --------
           Tibetan ground jay  ----acct
                   Budgerigar  ----ccat
                       Parrot  ----cctg
                Scarlet macaw  ----cctg
                 Mallard duck  ----cctg
           American alligator  ccaccctg
               Painted turtle  --------
       Spiny softshell turtle  --------
          Cape elephant shrew  ========
                  Rock pigeon  ========
          Medium ground finch  ========
                      Wallaby  --------
     Chinese softshell turtle  ========
              Green seaturtle  ========

Inserts between block 35 and 36 in window
  D           Painted turtle 1bp
  D   Spiny softshell turtle 6372bp

Alignment block 36 of 160 in window, 24505960 - 24505968, 9 bps 
B D                     Human  tctccttct
B D                     Chimp  tctccttct
B D                   Gorilla  tctccttct
B D                 Orangutan  tctccttcc
B D