Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 193 in window, 76993589 - 76993603, 15 bps 
B D                   Human  tttg-caagactgggg
B D                   Chimp  tttg-caagactgggg
B D                 Gorilla  tttg-caagactgagg
B D               Orangutan  tttg-ca--actgggg
B D                  Gibbon  tttg-caagactgggg
B D                  Rhesus  tttg-taagactggag
B D     Crab-eating macaque  tttg-taagactggag
B D                  Baboon  tttg-taagactggag
B D            Green monkey  tttg-taagactggag
B D                Marmoset  tttgttaaaactaggg
B D         Squirrel monkey  tttg-taggactaggg
     Lesser Egyptian jerboa  tgtg-caggactgggg
B D        White rhinoceros  tttg-catgactatga
B D                  Tenrec  ================
B D                Hedgehog  ================
B D              Guinea pig  ----------------
B D                     Rat  ================
B D                   Mouse  ================
            Golden hamster  ================
B D         Chinese hamster  ================
              Prairie vole  ================
B D                Elephant  ================
          Tibetan antelope  ================
       Cape elephant shrew  ================
      David's myotis (bat)  ================
B D                   Horse  ----------------
             Domestic goat  ----------------
B D                   Sheep  ================
B D                     Cow  ----------------
B D                  Alpaca  ================
           Star-nosed mole  ================
B D                Squirrel  ================
B D                    Pika  ================
B D                  Rabbit  ================
B D               Armadillo  ================
B D                 Manatee  ================
                Chinchilla  ----------------
          Brush-tailed rat  ================
        Chinese tree shrew  ================
            Pacific walrus  ================
B D                     Dog  ================
B D                     Cat  ================
B D                Bushbaby  ================
             Big brown bat  ================
B D          Naked mole-rat  ----------------
              Killer whale  ================
            Bactrian camel  ================
B D                   Panda  ================
          Black flying-fox  ================
B D                 Ferret   ================
          Cape golden mole  ================
B D                 Dolphin  ================
              Weddell seal  ================
                  Aardvark  ================
B D                  Turkey  ================
  D            Mallard duck  ================
B D              Budgerigar  ================
  D        Peregrine falcon  ================
  D             Rock pigeon  ================
  D          Painted turtle  ================
B D                 Chicken  ================
B D                Platypus  ================
  D     Collared flycatcher  ================
B D             Zebra finch  ================
  D            Saker falcon  ================
  D         Green seaturtle  ================
B D     Medium ground finch  ================
B D      American alligator  ================
  D  White-throated sparrow  ================
        Tibetan ground jay  ================
B D                 Megabat  ================
B D                     Pig  ================

Inserts between block 1 and 2 in window
    Lesser Egyptian jerboa 707bp

Alignment block 2 of 193 in window, 76993604 - 76993604, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  c
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D        White rhinoceros  a
B D                  Tenrec  =
B D                Hedgehog  =
B D              Guinea pig  -
B D                     Rat  =
B D                   Mouse  =
            Golden hamster  =
B D         Chinese hamster  =
              Prairie vole  =
B D                Elephant  =
          Tibetan antelope  =
       Cape elephant shrew  =
      David's myotis (bat)  =
B D                   Horse  -
             Domestic goat  -
B D                   Sheep  =
B D                     Cow  -
B D                  Alpaca  =
           Star-nosed mole  =
B D                Squirrel  =
B D                    Pika  =
B D                  Rabbit  =
B D               Armadillo  =
B D                 Manatee  =
                Chinchilla  -
    Lesser Egyptian jerboa  =
          Brush-tailed rat  =
        Chinese tree shrew  =
            Pacific walrus  =
B D                     Dog  =
B D                     Cat  =
B D                Bushbaby  =
             Big brown bat  =
B D          Naked mole-rat  -
              Killer whale  =
            Bactrian camel  =
B D                   Panda  =
          Black flying-fox  =
B D                 Ferret   =
          Cape golden mole  =
B D                 Dolphin  =
              Weddell seal  =
                  Aardvark  =
B D                  Turkey  =
  D            Mallard duck  =
B D              Budgerigar  =
  D        Peregrine falcon  =
  D             Rock pigeon  =
  D          Painted turtle  =
B D                 Chicken  =
B D                Platypus  =
  D     Collared flycatcher  =
B D             Zebra finch  =
  D            Saker falcon  =
  D         Green seaturtle  =
B D     Medium ground finch  =
B D      American alligator  =
  D  White-throated sparrow  =
        Tibetan ground jay  =
B D                 Megabat  =
B D                     Pig  =

Inserts between block 2 and 3 in window
B D       White rhinoceros 984bp

Alignment block 3 of 193 in window, 76993605 - 76993664, 60 bps 
B D                   Human  ctgggtgaggtggtacatgcctgtaatcccagcactttgggaggctgaggcaggaggatc
B D                   Chimp  ctgggtgaggtggttcatgcctgtaatcccagcactttgggaggctgaggcaggaggatc
B D                 Gorilla  ctgggtgaggtggttcatgcctgtaatcccagcactttgggaggctgaggcaggaggatc
B D               Orangutan  ctgggtgaggtggttcatgcctgtaatcccagcactttgggaggctgaggcaggaggatc
B D                  Gibbon  ctaggtgaggtggttcatgcctgtaatcctagcactttgggaggctgaggcaggaggatc
B D                  Rhesus  ctgggtgaggtggttcatacctgtaatcccagcacttcaggatgctgaggcaggaggatc
B D     Crab-eating macaque  ctgggtgaggtggttcatacctgtaatcccagcacttcaggatgctgaggcaggaggatc
B D                  Baboon  ctgggtgaggtggttcatacctgtaatcccagcacttcaggacgctgaggcaggaggatc
B D            Green monkey  ctgggtgaggtggttcatacctgtaatcccagcacttcaggacgctgaggcaggaggatc
B D                Marmoset  ctgggcgcggtggttgacccctgtaatcccagcactttgggaagctaagacaggaggatc
B D         Squirrel monkey  ctgggtgcggtggttcacccctgtaatcccagcactttgggaagctgaggcaggaggatt
B D          Naked mole-rat  ---------------------------------------aggggctgaggtagaaggat-
B D              Guinea pig  ---------------------------------------ggaggctgaggcagaaggatc
                 Chinchilla  ---------------------------------------agagggtgaggcaaaaggatc
B D                  Tenrec  ============================================================
B D                Hedgehog  ============================================================
B D                     Rat  ============================================================
B D                   Mouse  ============================================================
            Golden hamster  ============================================================
B D         Chinese hamster  ============================================================
              Prairie vole  ============================================================
B D                Elephant  ============================================================
          Tibetan antelope  ============================================================
       Cape elephant shrew  ============================================================
      David's myotis (bat)  ============================================================
B D                   Horse  ------------------------------------------------------------
             Domestic goat  ------------------------------------------------------------
B D                   Sheep  ============================================================
B D                     Cow  ------------------------------------------------------------
B D                  Alpaca  ============================================================
           Star-nosed mole  ============================================================
B D                Squirrel  ============================================================
B D                    Pika  ============================================================
B D                  Rabbit  ============================================================
B D               Armadillo  ============================================================
B D                 Manatee  ============================================================
    Lesser Egyptian jerboa  ============================================================
B D        White rhinoceros  ============================================================
          Brush-tailed rat  ============================================================
        Chinese tree shrew  ============================================================
            Pacific walrus  ============================================================
B D                     Dog  ============================================================
B D                     Cat  ============================================================
B D                Bushbaby  ============================================================
             Big brown bat  ============================================================
              Killer whale  ============================================================
            Bactrian camel  ============================================================
B D                   Panda  ============================================================
          Black flying-fox  ============================================================
B D                 Ferret   ============================================================
          Cape golden mole  ============================================================
B D                 Dolphin  ============================================================
              Weddell seal  ============================================================
                  Aardvark  ============================================================
B D                  Turkey  ============================================================
  D            Mallard duck  ============================================================
B D              Budgerigar  ============================================================
  D        Peregrine falcon  ============================================================
  D             Rock pigeon  ============================================================
  D          Painted turtle  ============================================================
B D                 Chicken  ============================================================
B D                Platypus  ============================================================
  D     Collared flycatcher  ============================================================
B D             Zebra finch  ============================================================
  D            Saker falcon  ============================================================
  D         Green seaturtle  ============================================================
B D     Medium ground finch  ============================================================
B D      American alligator  ============================================================
  D  White-throated sparrow  ============================================================
        Tibetan ground jay  ============================================================
B D                 Megabat  ============================================================
B D                     Pig  ============================================================

Inserts between block 3 and 4 in window
B D             Guinea pig 66bp

Alignment block 4 of 193 in window, 76993665 - 76993701, 37 bps 
B D                   Human  acttgagcccaggagtttgagaccagcttgggcaac----------------------a
B D                   Chimp  acctgagcccaggagtttgagaccagcttgggcaac----------------------a
B D                 Gorilla  acttgagcccaggagtttgagaccagcttgggcaac----------------------a
B D               Orangutan  acttgagcccaggagtttgagactagcctgggcaac----------------------a
B D                  Gibbon  acttgagcccaggagtttgagaccagcctgggcaac----------------------a
B D                  Rhesus  acttgagcccaggaatttgagaccagcctgggcaac----------------------a
B D     Crab-eating macaque  acttgagcccaggaatttgagaccagcctgggcaac----------------------a
B D                  Baboon  acttgagcccaggaatttgagaccagcctgggcaac----------------------a
B D            Green monkey  acttgagcccaggaatttgagaccagcctgggcaac----------------------a
B D                Marmoset  gcttgagcccaggag-tcgagaccagcctgggcagc----------------------a
B D         Squirrel monkey  gcttgagcccaggag-ttgagaccagcctgggcaacatctctattataaatttttttta
B D          Naked mole-rat  ---------ttgaagttcgagtccagcctgggcaat----------------------t
                 Chinchilla  ----------ccaagttcgagcccagcctgggcaac----------------------t
B D                  Tenrec  ===========================================================
B D                Hedgehog  ===========================================================
B D              Guinea pig  ===========================================================
B D                     Rat  ===========================================================
B D                   Mouse  ===========================================================
            Golden hamster  ===========================================================
B D         Chinese hamster  ===========================================================
              Prairie vole  ===========================================================
B D                Elephant  ===========================================================
          Tibetan antelope  ===========================================================
       Cape elephant shrew  ===========================================================
      David's myotis (bat)  ===========================================================
B D                   Horse  -----------------------------------------------------------
             Domestic goat  -----------------------------------------------------------
B D                   Sheep  ===========================================================
B D                     Cow  -----------------------------------------------------------
B D                  Alpaca  ===========================================================
           Star-nosed mole  ===========================================================
B D                Squirrel  ===========================================================
B D                    Pika  ===========================================================
B D                  Rabbit  ===========================================================
B D               Armadillo  ===========================================================
B D                 Manatee  ===========================================================
    Lesser Egyptian jerboa  ===========================================================
B D        White rhinoceros  ===========================================================
          Brush-tailed rat  ===========================================================
        Chinese tree shrew  ===========================================================
            Pacific walrus  ===========================================================
B D                     Dog  ===========================================================
B D                     Cat  ===========================================================
B D                Bushbaby  ===========================================================
             Big brown bat  ===========================================================
              Killer whale  ===========================================================
            Bactrian camel  ===========================================================
B D                   Panda  ===========================================================
          Black flying-fox  ===========================================================
B D                 Ferret   ===========================================================
          Cape golden mole  ===========================================================
B D                 Dolphin  ===========================================================
              Weddell seal  ===========================================================
                  Aardvark  ===========================================================
B D                  Turkey  ===========================================================
  D            Mallard duck  ===========================================================
B D              Budgerigar  ===========================================================
  D        Peregrine falcon  ===========================================================
  D             Rock pigeon  ===========================================================
  D          Painted turtle  ===========================================================
B D                 Chicken  ===========================================================
B D                Platypus  ===========================================================
  D     Collared flycatcher  ===========================================================
B D             Zebra finch  ===========================================================
  D            Saker falcon  ===========================================================
  D         Green seaturtle  ===========================================================
B D     Medium ground finch  ===========================================================
B D      American alligator  ===========================================================
  D  White-throated sparrow  ===========================================================
        Tibetan ground jay  ===========================================================
B D                 Megabat  ===========================================================
B D                     Pig  ===========================================================

Inserts between block 4 and 5 in window
B D         Naked mole-rat 170bp
                Chinchilla 2bp

Alignment block 5 of 193 in window, 76993702 - 76993713, 12 bps 
B D                   Human  -----acggca-agacac
B D                   Chimp  ------tggca-agacac
B D                 Gorilla  ------tggca-agacac
B D               Orangutan  ------tggca-agacac
B D                  Gibbon  ------tagca-agacac
B D                  Rhesus  ------cagcg-agatac
B D     Crab-eating macaque  ------cagcg-agatac
B D                  Baboon  ------cagcg-agatac
B D            Green monkey  ------tagcg-agatac
B D                Marmoset  ------tagta-agaccc
B D         Squirrel monkey  ------taatagagatcc
                 Chinchilla  atgacttagca-agaccc
B D                  Tenrec  ==================
B D                Hedgehog  ==================
B D              Guinea pig  ==================
B D                     Rat  ==================
B D                   Mouse  ==================
            Golden hamster  ==================
B D         Chinese hamster  ==================
              Prairie vole  ==================
B D                Elephant  ==================
          Tibetan antelope  ==================
       Cape elephant shrew  ==================
      David's myotis (bat)  ==================
B D                   Horse  ------------------
             Domestic goat  ------------------
B D                   Sheep  ==================
B D                     Cow  ------------------
B D                  Alpaca  ==================
           Star-nosed mole  ==================
B D                Squirrel  ==================
B D                    Pika  ==================
B D                  Rabbit  ==================
B D               Armadillo  ==================
B D                 Manatee  ==================
    Lesser Egyptian jerboa  ==================
B D        White rhinoceros  ==================
          Brush-tailed rat  ==================
        Chinese tree shrew  ==================
            Pacific walrus  ==================
B D                     Dog  ==================
B D                     Cat  ==================
B D                Bushbaby  ==================
             Big brown bat  ==================
B D          Naked mole-rat  ==================
              Killer whale  ==================
            Bactrian camel  ==================
B D                   Panda  ==================
          Black flying-fox  ==================
B D                 Ferret   ==================
          Cape golden mole  ==================
B D                 Dolphin  ==================
              Weddell seal  ==================
                  Aardvark  ==================
B D                  Turkey  ==================
  D            Mallard duck  ==================
B D              Budgerigar  ==================
  D        Peregrine falcon  ==================
  D             Rock pigeon  ==================
  D          Painted turtle  ==================
B D                 Chicken  ==================
B D                Platypus  ==================
  D     Collared flycatcher  ==================
B D             Zebra finch  ==================
  D            Saker falcon  ==================
  D         Green seaturtle  ==================
B D     Medium ground finch  ==================
B D      American alligator  ==================
  D  White-throated sparrow  ==================
        Tibetan ground jay  ==================
B D                 Megabat  ==================
B D                     Pig  ==================

Inserts between block 5 and 6 in window
                Chinchilla 195bp

Alignment block 6 of 193 in window, 76993714 - 76993730, 17 bps 
B D                   Human  catctc---tataagt-aat---t
B D                   Chimp  catctc---tataagt-aat---t
B D                 Gorilla  catctc---tataagt-aat---t
B D               Orangutan  catctc---tataaat-aatacat
B D                  Gibbon  catctc---tgtaaat-ata---t
B D                  Rhesus  catctc---tataaat-aat---t
B D     Crab-eating macaque  catctc---tataaat-aat---t
B D                  Baboon  catctc---tataaat-aat---t
B D            Green monkey  cgtctc---tagaaat-aat---t
B D                Marmoset  catctc---tataaat--------
B D         Squirrel monkey  catctctattataaatt-------
B D                  Tenrec  ========================
B D                Hedgehog  ========================
B D              Guinea pig  ========================
B D                     Rat  ========================
B D                   Mouse  ========================
            Golden hamster  ========================
B D         Chinese hamster  ========================
              Prairie vole  ========================
B D                Elephant  ========================
          Tibetan antelope  ========================
       Cape elephant shrew  ========================
      David's myotis (bat)  ========================
B D                   Horse  ------------------------
             Domestic goat  ------------------------
B D                   Sheep  ========================
B D                     Cow  ------------------------
B D                  Alpaca  ========================
           Star-nosed mole  ========================
B D                Squirrel  ========================
B D                    Pika  ========================
B D                  Rabbit  ========================
B D               Armadillo  ========================
B D                 Manatee  ========================
                Chinchilla  ========================
    Lesser Egyptian jerboa  ========================
B D        White rhinoceros  ========================
          Brush-tailed rat  ========================
        Chinese tree shrew  ========================
            Pacific walrus  ========================
B D                     Dog  ========================
B D                     Cat  ========================
B D                Bushbaby  ========================
             Big brown bat  ========================
B D          Naked mole-rat  ========================
              Killer whale  ========================
            Bactrian camel  ========================
B D                   Panda  ========================
          Black flying-fox  ========================
B D                 Ferret   ========================
          Cape golden mole  ========================
B D                 Dolphin  ========================
              Weddell seal  ========================
                  Aardvark  ========================
B D                  Turkey  ========================
  D            Mallard duck  ========================
B D              Budgerigar  ========================
  D        Peregrine falcon  ========================
  D             Rock pigeon  ========================
  D          Painted turtle  ========================
B D                 Chicken  ========================
B D                Platypus  ========================
  D     Collared flycatcher  ========================
B D             Zebra finch  ========================
  D            Saker falcon  ========================
  D         Green seaturtle  ========================
B D     Medium ground finch  ========================
B D      American alligator  ========================
  D  White-throated sparrow  ========================
        Tibetan ground jay  ========================
B D                 Megabat  ========================
B D                     Pig  ========================

Inserts between block 6 and 7 in window
B D        Squirrel monkey 332bp

Alignment block 7 of 193 in window, 76993731 - 76993751, 21 bps 
B D                   Human  ttttttttt-aa---acccaggctt
B D                   Chimp  tttttttt--aa---acccaggctt
B D                 Gorilla  tttttttttaaa---acccaggctt
B D               Orangutan  attttttt--aa---acccaggctt
B D                  Gibbon  gtatatttt-aa---acccaggctt
B D                  Rhesus  tttttaaa--aaattacccaggctt
B D     Crab-eating macaque  ttttttaa--aaattacccaggctt
B D                  Baboon  tttttttt--aaattacccaggctt
B D            Green monkey  tttttttt--aaattacccaggctt
B D                Marmoset  tttttttt--aaattagccaggctt
B D         Squirrel monkey  tttttttt--taactagccaggctg
B D                  Tenrec  =========================
B D                Hedgehog  =========================
B D              Guinea pig  =========================
B D                     Rat  =========================
B D                   Mouse  =========================
            Golden hamster  =========================
B D         Chinese hamster  =========================
              Prairie vole  =========================
B D                Elephant  =========================
          Tibetan antelope  =========================
       Cape elephant shrew  =========================
      David's myotis (bat)  =========================
B D                   Horse  -------------------------
             Domestic goat  -------------------------
B D                   Sheep  =========================
B D                     Cow  -------------------------
B D                  Alpaca  =========================
           Star-nosed mole  =========================
B D                Squirrel  =========================
B D                    Pika  =========================
B D                  Rabbit  =========================
B D               Armadillo  =========================
B D                 Manatee  =========================
                Chinchilla  =========================
    Lesser Egyptian jerboa  =========================
B D        White rhinoceros  =========================
          Brush-tailed rat  =========================
        Chinese tree shrew  =========================
            Pacific walrus  =========================
B D                     Dog  =========================
B D                     Cat  =========================
B D                Bushbaby  =========================
             Big brown bat  =========================
B D          Naked mole-rat  =========================
              Killer whale  =========================
            Bactrian camel  =========================
B D                   Panda  =========================
          Black flying-fox  =========================
B D                 Ferret   =========================
          Cape golden mole  =========================
B D                 Dolphin  =========================
              Weddell seal  =========================
                  Aardvark  =========================
B D                  Turkey  =========================
  D            Mallard duck  =========================
B D              Budgerigar  =========================
  D        Peregrine falcon  =========================
  D             Rock pigeon  =========================
  D          Painted turtle  =========================
B D                 Chicken  =========================
B D                Platypus  =========================
  D     Collared flycatcher  =========================
B D             Zebra finch  =========================
  D            Saker falcon  =========================
  D         Green seaturtle  =========================
B D     Medium ground finch  =========================
B D      American alligator  =========================
  D  White-throated sparrow  =========================
        Tibetan ground jay  =========================
B D                 Megabat  =========================
B D                     Pig  =========================

Alignment block 8 of 193 in window, 76993752 - 76993823, 72 bps 
B D                   Human  ggtggtgcacacttgtagttccagctacttgagaagctg-aggtgggaggatcacc-tgagcc-tagaag
B D                   Chimp  ggtgatgcacacttgtagttccagctacttgagaagctg-aggtgggaggatcacc-tgagcc-gggaaa
B D                 Gorilla  ggtggtgcacatttgtagttccagctacttgagaagctg-aggtgggaggatcacc-tgagcc-tggaag
B D               Orangutan  ggtggtgcacacttgtagttccagctacttgggaagctg-aggtgggaggatcacc-tgagcc-tagaag
B D                  Gibbon  ggtggcgcacacttgtagttccagctacttgggaagctg-aggtgggagggtcacc-tgagcc-tagaag
B D                  Rhesus  ggtggtgcacacttatagttccagctacttgggaagctg-aagtgggaggatcacc-tgagcc-tggaag
B D     Crab-eating macaque  ggtggtgcacacttatagttccagctacttgggaagctg-aagtgggaggatcacc-tgagcc-tggaag
B D                  Baboon  ggtggtgcacacttatagttccagctacttgggaagctg-aagtgggaggatcacc-tgagcc-tggaag
B D            Green monkey  ggtggtgcacacttgtagttccagctacttgggaagctg-aagtgggaggatcacc-tgagcc-tggaag
B D                Marmoset  gatggtgcacacctgtagttctggctgcttgtgaggct-----------gatcacc-cgagccttgggag
B D         Squirrel monkey  gatggtgcacacttgtatttccggctactcgggaggctg-aggtgggaggatcacc-tgagcc-tgggag
           Brush-tailed rat  gggggcgtgtgcctgtaatcccagct-cttgggaggctgtaaacaggcggctcactacaagtc-tca---
B D                  Tenrec  ======================================================================
B D                Hedgehog  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
              Prairie vole  ======================================================================
B D                Elephant  ======================================================================
          Tibetan antelope  ======================================================================
       Cape elephant shrew  ======================================================================
      David's myotis (bat)  ======================================================================
B D                   Horse  ----------------------------------------------------------------------
             Domestic goat  ----------------------------------------------------------------------
B D                   Sheep  ======================================================================
B D                     Cow  ----------------------------------------------------------------------
B D                  Alpaca  ======================================================================
           Star-nosed mole  ======================================================================
B D                Squirrel  ======================================================================
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D               Armadillo  ======================================================================
B D                 Manatee  ======================================================================
                Chinchilla  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D        White rhinoceros  ======================================================================
        Chinese tree shrew  ======================================================================
            Pacific walrus  ======================================================================
B D                     Dog  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
             Big brown bat  ======================================================================
B D          Naked mole-rat  ======================================================================
              Killer whale  ======================================================================
            Bactrian camel  ======================================================================
B D                   Panda  ======================================================================
          Black flying-fox  ======================================================================
B D                 Ferret   ======================================================================
          Cape golden mole  ======================================================================
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
                  Aardvark  ======================================================================
B D                  Turkey  ======================================================================
  D            Mallard duck  ======================================================================
B D              Budgerigar  ======================================================================
  D        Peregrine falcon  ======================================================================
  D             Rock pigeon  ======================================================================
  D          Painted turtle  ======================================================================
B D                 Chicken  ======================================================================
B D                Platypus  ======================================================================
  D     Collared flycatcher  ======================================================================
B D             Zebra finch  ======================================================================
  D            Saker falcon  ======================================================================
  D         Green seaturtle  ======================================================================
B D     Medium ground finch  ======================================================================
B D      American alligator  ======================================================================
  D  White-throated sparrow  ======================================================================
        Tibetan ground jay  ======================================================================
B D                 Megabat  ======================================================================
B D                     Pig  ======================================================================

                      Human  atcaa
                      Chimp  atcaa
                    Gorilla  atcaa
                  Orangutan  atcaa
                     Gibbon  atcaa
                     Rhesus  atcaa
        Crab-eating macaque  atcaa
                     Baboon  atcaa
               Green monkey  atcaa
                   Marmoset  gtcaa
            Squirrel monkey  gtcaa
           Brush-tailed rat  -----
                     Tenrec  =====
                   Hedgehog  =====
                 Guinea pig  =====
                        Rat  =====
                      Mouse  =====
             Golden hamster  =====
            Chinese hamster  =====
               Prairie vole  =====
                   Elephant  =====
           Tibetan antelope  =====
        Cape elephant shrew  =====
       David's myotis (bat)  =====
                      Horse  -----
              Domestic goat  -----
                      Sheep  =====
                        Cow  -----
                     Alpaca  =====
            Star-nosed mole  =====
                   Squirrel  =====
                       Pika  =====
                     Rabbit  =====
                  Armadillo  =====
                    Manatee  =====
                 Chinchilla  =====
     Lesser Egyptian jerboa  =====
           White rhinoceros  =====
         Chinese tree shrew  =====
             Pacific walrus  =====
                        Dog  =====
                        Cat  =====
                   Bushbaby  =====
              Big brown bat  =====
             Naked mole-rat  =====
               Killer whale  =====
             Bactrian camel  =====
                      Panda  =====
           Black flying-fox  =====
                    Ferret   =====
           Cape golden mole  =====
                    Dolphin  =====
               Weddell seal  =====
                   Aardvark  =====
                     Turkey  =====
               Mallard duck  =====
                 Budgerigar  =====
           Peregrine falcon  =====
                Rock pigeon  =====
             Painted turtle  =====
                    Chicken  =====
                   Platypus  =====
        Collared flycatcher  =====
                Zebra finch  =====
               Saker falcon  =====
            Green seaturtle  =====
        Medium ground finch  =====
         American alligator  =====
     White-throated sparrow  =====
         Tibetan ground jay  =====
                    Megabat  =====
                        Pig  =====

Alignment block 9 of 193 in window, 76993824 - 76993871, 48 bps 
B D                   Human  ggctgaggtgaaccacgattg---cgccgctgcactctagc--ctgagcaaca
B D                   Chimp  ggctgaggtgaaccacgattg---caccgctgctctctagc--ctgagcaaca
B D                 Gorilla  ggctgaggtgaaccacgattg---cgccgctgcactctagc--ctgagcaaca
B D               Orangutan  gactgaggtgaaccacgattg---cgctgctgcactctagc--ctgagcaaca
B D                  Gibbon  ggctgaggtgagccacgattg---cgccgctgcactctagc--ctgagcgaca
B D                  Rhesus  ggctgaggtgaaccacgattg---caccactgcactctagc--ctgagcaatg
B D     Crab-eating macaque  ggctgaggtgaaccacgattg---caccactgcactctagc--ctgagcaatg
B D                  Baboon  ggctgaggtgaaccacgattg---caccactgcactctagc--ctgagcaacg
B D            Green monkey  ggctgaggtgaaccacgattg---caccactgcactctagc--ctgagcaacg
B D                Marmoset  ggctgaggtgaaccacggttg---cgccgctacactccagc--ctgggcaata
B D         Squirrel monkey  ggctgaggtgaacattggtcg---cgccactgcactccagc--ctgggcaaca
B D              Guinea pig  ggctgagggtgtaccgcagtgtgtgggccctgggttctatctaatggact---
           Brush-tailed rat  -----------tctagtaatg---agaccctgaacacc-----ctgtaca---
B D                  Tenrec  =====================================================
B D                Hedgehog  =====================================================
B D                     Rat  =====================================================
B D                   Mouse  =====================================================
            Golden hamster  =====================================================
B D         Chinese hamster  =====================================================
              Prairie vole  =====================================================
B D                Elephant  =====================================================
          Tibetan antelope  =====================================================
       Cape elephant shrew  =====================================================
      David's myotis (bat)  =====================================================
B D                   Horse  -----------------------------------------------------
             Domestic goat  -----------------------------------------------------
B D                   Sheep  =====================================================
B D                     Cow  -----------------------------------------------------
B D                  Alpaca  =====================================================
           Star-nosed mole  =====================================================
B D                Squirrel  =====================================================
B D                    Pika  =====================================================
B D                  Rabbit  =====================================================
B D               Armadillo  =====================================================
B D                 Manatee  =====================================================
                Chinchilla  =====================================================
    Lesser Egyptian jerboa  =====================================================
B D        White rhinoceros  =====================================================
        Chinese tree shrew  =====================================================
            Pacific walrus  =====================================================
B D                     Dog  =====================================================
B D                     Cat  =====================================================
B D                Bushbaby  =====================================================
             Big brown bat  =====================================================
B D          Naked mole-rat  =====================================================
              Killer whale  =====================================================
            Bactrian camel  =====================================================
B D                   Panda  =====================================================
          Black flying-fox  =====================================================
B D                 Ferret   =====================================================
          Cape golden mole  =====================================================
B D                 Dolphin  =====================================================
              Weddell seal  =====================================================
                  Aardvark  =====================================================
B D                  Turkey  =====================================================
  D            Mallard duck  =====================================================
B D              Budgerigar  =====================================================
  D        Peregrine falcon  =====================================================
  D             Rock pigeon  =====================================================
  D          Painted turtle  =====================================================
B D                 Chicken  =====================================================
B D                Platypus  =====================================================
  D     Collared flycatcher  =====================================================
B D             Zebra finch  =====================================================
  D            Saker falcon  =====================================================
  D         Green seaturtle  =====================================================
B D     Medium ground finch  =====================================================
B D      American alligator  =====================================================
  D  White-throated sparrow  =====================================================
        Tibetan ground jay  =====================================================
B D                 Megabat  =====================================================
B D                     Pig  =====================================================

Alignment block 10 of 193 in window, 76993872 - 76993873, 2 bps 
B D                   Human  ga
B D                   Chimp  ga
B D                 Gorilla  ga
B D               Orangutan  ga
B D                  Gibbon  ga
B D                  Rhesus  ga
B D     Crab-eating macaque  ga
B D                  Baboon  ga
B D            Green monkey  ga
B D                Marmoset  ga
B D         Squirrel monkey  ga
B D                 Manatee  gg
B D                  Tenrec  ==
B D                Hedgehog  ==
B D              Guinea pig  --
B D                     Rat  ==
B D                   Mouse  ==
            Golden hamster  ==
B D         Chinese hamster  ==
              Prairie vole  ==
B D                Elephant  ==
          Tibetan antelope  ==
       Cape elephant shrew  ==
      David's myotis (bat)  ==
B D                   Horse  --
             Domestic goat  --
B D                   Sheep  ==
B D                     Cow  --
B D                  Alpaca  ==
           Star-nosed mole  ==
B D                Squirrel  ==
B D                    Pika  ==
B D                  Rabbit  ==
B D               Armadillo  ==
                Chinchilla  ==
    Lesser Egyptian jerboa  ==
B D        White rhinoceros  ==
          Brush-tailed rat  --
        Chinese tree shrew  ==
            Pacific walrus  ==
B D                     Dog  ==
B D                     Cat  ==
B D                Bushbaby  ==
             Big brown bat  ==
B D          Naked mole-rat  ==
              Killer whale  ==
            Bactrian camel  ==
B D                   Panda  ==
          Black flying-fox  ==
B D                 Ferret   ==
          Cape golden mole  ==
B D                 Dolphin  ==
              Weddell seal  ==
                  Aardvark  ==
B D                  Turkey  ==
  D            Mallard duck  ==
B D              Budgerigar  ==
  D        Peregrine falcon  ==
  D             Rock pigeon  ==
  D          Painted turtle  ==
B D                 Chicken  ==
B D                Platypus  ==
  D     Collared flycatcher  ==
B D             Zebra finch  ==
  D            Saker falcon  ==
  D         Green seaturtle  ==
B D     Medium ground finch  ==
B D      American alligator  ==
  D  White-throated sparrow  ==
        Tibetan ground jay  ==
B D                 Megabat  ==
B D                     Pig  ==

Inserts between block 10 and 11 in window
B D                Manatee 5bp

Alignment block 11 of 193 in window, 76993874 - 76993877, 4 bps 
B D                   Human  gtga
B D                   Chimp  gcga
B D                 Gorilla  gcga
B D               Orangutan  gcga
B D                  Gibbon  gcga
B D                  Rhesus  gcga
B D     Crab-eating macaque  gcga
B D                  Baboon  gcga
B D            Green monkey  gcga
B D                Marmoset  gtga
B D         Squirrel monkey  gtga
B D                Elephant  gttt
B D                 Manatee  gttt
B D                  Tenrec  ====
B D                Hedgehog  ====
B D              Guinea pig  ----
B D                     Rat  ====
B D                   Mouse  ====
            Golden hamster  ====
B D         Chinese hamster  ====
              Prairie vole  ====
          Tibetan antelope  ====
       Cape elephant shrew  ====
      David's myotis (bat)  ====
B D                   Horse  ----
             Domestic goat  ----
B D                   Sheep  ====
B D                     Cow  ----
B D                  Alpaca  ====
           Star-nosed mole  ====
B D                Squirrel  ====
B D                    Pika  ====
B D                  Rabbit  ====
B D               Armadillo  ====
                Chinchilla  ====
    Lesser Egyptian jerboa  ====
B D        White rhinoceros  ====
          Brush-tailed rat  ----
        Chinese tree shrew  ====
            Pacific walrus  ====
B D                     Dog  ====
B D                     Cat  ====
B D                Bushbaby  ====
             Big brown bat  ====
B D          Naked mole-rat  ====
              Killer whale  ====
            Bactrian camel  ====
B D                   Panda  ====
          Black flying-fox  ====
B D                 Ferret   ====
          Cape golden mole  ====
B D                 Dolphin  ====
              Weddell seal  ====
                  Aardvark  ====
B D                  Turkey  ====
  D            Mallard duck  ====
B D              Budgerigar  ====
  D        Peregrine falcon  ====
  D             Rock pigeon  ====
  D          Painted turtle  ====
B D                 Chicken  ====
B D                Platypus  ====
  D     Collared flycatcher  ====
B D             Zebra finch  ====
  D            Saker falcon  ====
  D         Green seaturtle  ====
B D     Medium ground finch  ====
B D      American alligator  ====
  D  White-throated sparrow  ====
        Tibetan ground jay  ====
B D                 Megabat  ====
B D                     Pig  ====

Alignment block 12 of 193 in window, 76993878 - 76993878, 1 bps 
B D                   Human  -g
B D                   Chimp  -g
B D                 Gorilla  -g
B D               Orangutan  -g
B D                  Gibbon  -g
B D                  Rhesus  -g
B D     Crab-eating macaque  -g
B D                  Baboon  -g
B D            Green monkey  -g
B D                Marmoset  -g
B D         Squirrel monkey  -g
B D                     Cat  -g
B D                Elephant  t-
B D                 Manatee  t-
B D                  Tenrec  ==
B D                Hedgehog  ==
B D              Guinea pig  --
B D                     Rat  ==
B D                   Mouse  ==
            Golden hamster  ==
B D         Chinese hamster  ==
              Prairie vole  ==
          Tibetan antelope  ==
       Cape elephant shrew  ==
      David's myotis (bat)  ==
B D                   Horse  --
             Domestic goat  --
B D                   Sheep  ==
B D                     Cow  --
B D                  Alpaca  ==
           Star-nosed mole  ==
B D                Squirrel  ==
B D                    Pika  ==
B D                  Rabbit  ==
B D               Armadillo  ==
                Chinchilla  ==
    Lesser Egyptian jerboa  ==
B D        White rhinoceros  ==
          Brush-tailed rat  --
        Chinese tree shrew  ==
            Pacific walrus  ==
B D                     Dog  ==
B D                Bushbaby  ==
             Big brown bat  ==
B D          Naked mole-rat  ==
              Killer whale  ==
            Bactrian camel  ==
B D                   Panda  ==
          Black flying-fox  ==
B D                 Ferret   ==
          Cape golden mole  ==
B D                 Dolphin  ==
              Weddell seal  ==
                  Aardvark  ==
B D                  Turkey  ==
  D            Mallard duck  ==
B D              Budgerigar  ==
  D        Peregrine falcon  ==
  D             Rock pigeon  ==
  D          Painted turtle  ==
B D                 Chicken  ==
B D                Platypus  ==
  D     Collared flycatcher  ==
B D             Zebra finch  ==
  D            Saker falcon  ==
  D         Green seaturtle  ==
B D     Medium ground finch  ==
B D      American alligator  ==
  D  White-throated sparrow  ==
        Tibetan ground jay  ==
B D                 Megabat  ==
B D                     Pig  ==

Inserts between block 12 and 13 in window
B D                    Cat 1bp

Alignment block 13 of 193 in window, 76993879 - 76993885, 7 bps 
B D                   Human  gccttgt
B D                   Chimp  gccttgt
B D                 Gorilla  gccttgt
B D               Orangutan  gccttgt
B D                  Gibbon  gccttgt
B D                  Rhesus  gccttgt
B D     Crab-eating macaque  gccttgt
B D                  Baboon  gccttgt
B D            Green monkey  gccttgt
B D                Marmoset  accttgt
B D         Squirrel monkey  accttgt
B D              Guinea pig  gcttttt
           Brush-tailed rat  cccttcc
B D                  Alpaca  gcttggt
             Bactrian camel  gcttggt
           Tibetan antelope  gctttgc
B D                     Cow  gctttgc
B D                   Sheep  gctttgc
B D                     Cat  cctcttc
B D                 Megabat  gctttgc
B D                Elephant  gcctcat
B D                 Manatee  gcctcat
           Cape golden mole  gcctcat
B D                  Tenrec  =======
B D                Hedgehog  =======
B D                     Rat  =======
B D                   Mouse  =======
            Golden hamster  =======
B D         Chinese hamster  =======
              Prairie vole  =======
       Cape elephant shrew  =======
      David's myotis (bat)  =======
B D                   Horse  -------
             Domestic goat  -------
           Star-nosed mole  =======
B D                Squirrel  =======
B D                    Pika  =======
B D                  Rabbit  =======
B D               Armadillo  =======
                Chinchilla  =======
    Lesser Egyptian jerboa  =======
B D        White rhinoceros  =======
        Chinese tree shrew  =======
            Pacific walrus  =======
B D                     Dog  =======
B D                Bushbaby  =======
             Big brown bat  =======
B D          Naked mole-rat  =======
              Killer whale  =======
B D                   Panda  =======
          Black flying-fox  =======
B D                 Ferret   =======
B D                 Dolphin  =======
              Weddell seal  =======
                  Aardvark  =======
B D                  Turkey  =======
  D            Mallard duck  =======
B D              Budgerigar  =======
  D        Peregrine falcon  =======
  D             Rock pigeon  =======
  D          Painted turtle  =======
B D                 Chicken  =======
B D                Platypus  =======
  D     Collared flycatcher  =======
B D             Zebra finch  =======
  D            Saker falcon  =======
  D         Green seaturtle  =======
B D     Medium ground finch  =======
B D      American alligator  =======
  D  White-throated sparrow  =======
        Tibetan ground jay  =======
B D                     Pig  =======

Alignment block 14 of 193 in window, 76993886 - 76993887, 2 bps 
B D                   Human  ct
B D                   Chimp  ct
B D                 Gorilla  ct
B D               Orangutan  cc
B D                  Gibbon  ct
B D                  Rhesus  ct
B D     Crab-eating macaque  ct
B D                  Baboon  ct
B D            Green monkey  ct
B D                Marmoset  tt
B D         Squirrel monkey  ta
B D              Guinea pig  tt
           Brush-tailed rat  ct
B D                     Pig  ct
B D                  Alpaca  ct
             Bactrian camel  ct
           Tibetan antelope  ct
B D                     Cow  ct
B D                   Sheep  ct
B D                     Cat  ct
B D                 Megabat  gt
B D                Elephant  ct
B D                 Manatee  ct
           Cape golden mole  cc
B D                  Tenrec  ==
B D                Hedgehog  ==
B D                     Rat  ==
B D                   Mouse  ==
            Golden hamster  ==
B D         Chinese hamster  ==
              Prairie vole  ==
       Cape elephant shrew  ==
      David's myotis (bat)  ==
B D                   Horse  --
             Domestic goat  --
           Star-nosed mole  ==
B D                Squirrel  ==
B D                    Pika  ==
B D                  Rabbit  ==
B D               Armadillo  ==
                Chinchilla  ==
    Lesser Egyptian jerboa  ==
B D        White rhinoceros  ==
        Chinese tree shrew  ==
            Pacific walrus  ==
B D                     Dog  ==
B D                Bushbaby  ==
             Big brown bat  ==
B D          Naked mole-rat  ==
              Killer whale  ==
B D                   Panda  ==
          Black flying-fox  ==
B D                 Ferret   ==
B D                 Dolphin  ==
              Weddell seal  ==
                  Aardvark  ==
B D                  Turkey  ==
  D            Mallard duck  ==
B D              Budgerigar  ==
  D        Peregrine falcon  ==
  D             Rock pigeon  ==
  D          Painted turtle  ==
B D                 Chicken  ==
B D                Platypus  ==
  D     Collared flycatcher  ==
B D             Zebra finch  ==
  D            Saker falcon  ==
  D         Green seaturtle  ==
B D     Medium ground finch  ==
B D      American alligator  ==
  D  White-throated sparrow  ==
        Tibetan ground jay  ==

Inserts between block 14 and 15 in window
B D             Guinea pig 2bp
          Brush-tailed rat 23bp
          Tibetan antelope 10bp
B D                    Cow 10bp
B D                  Sheep 10bp

Alignment block 15 of 193 in window, 76993888 - 76993889, 2 bps 
B D                   Human  -ca
B D                   Chimp  -ca
B D                 Gorilla  -ca
B D               Orangutan  -ca
B D                  Gibbon  -ca
B D                  Rhesus  -ca
B D     Crab-eating macaque  -ca
B D                  Baboon  -ca
B D            Green monkey  -ca
B D                Marmoset  -ca
B D         Squirrel monkey  -ga
B D                     Pig  -ca
B D                  Alpaca  -ca
             Bactrian camel  -ca
           Tibetan antelope  -ta
B D                     Cow  -ta
B D                   Sheep  -ta
              Domestic goat  -ca
B D                     Cat  -ca
B D                 Megabat  -ca
B D                Elephant  tc-
B D                 Manatee  tc-
           Cape golden mole  tt-
B D                  Tenrec  ===
B D                Hedgehog  ===
B D              Guinea pig  ===
B D                     Rat  ===
B D                   Mouse  ===
            Golden hamster  ===
B D         Chinese hamster  ===
              Prairie vole  ===
       Cape elephant shrew  ===
      David's myotis (bat)  ===
B D                   Horse  ---
           Star-nosed mole  ===
B D                Squirrel  ===
B D                    Pika  ===
B D                  Rabbit  ===
B D               Armadillo  ===
                Chinchilla  ===
    Lesser Egyptian jerboa  ===
B D        White rhinoceros  ===
          Brush-tailed rat  ===
        Chinese tree shrew  ===
            Pacific walrus  ===
B D                     Dog  ===
B D                Bushbaby  ===
             Big brown bat  ===
B D          Naked mole-rat  ===
              Killer whale  ===
B D                   Panda  ===
          Black flying-fox  ===
B D                 Ferret   ===
B D                 Dolphin  ===
              Weddell seal  ===
                  Aardvark  ===
B D                  Turkey  ===
  D            Mallard duck  ===
B D              Budgerigar  ===
  D        Peregrine falcon  ===
  D             Rock pigeon  ===
  D          Painted turtle  ===
B D                 Chicken  ===
B D                Platypus  ===
  D     Collared flycatcher  ===
B D             Zebra finch  ===
  D            Saker falcon  ===
  D         Green seaturtle  ===
B D     Medium ground finch  ===
B D      American alligator  ===
  D  White-throated sparrow  ===
        Tibetan ground jay  ===

Inserts between block 15 and 16 in window
B D                 Alpaca 7bp
            Bactrian camel 7bp

Alignment block 16 of 193 in window, 76993890 - 76993890, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                     Pig  g
B D                  Alpaca  a
             Bactrian camel  a
               Killer whale  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                     Cat  g
B D                 Megabat  g
B D                Elephant  a
B D                 Manatee  a
           Cape golden mole  a
B D                  Tenrec  =
B D                Hedgehog  =
B D              Guinea pig  =
B D                     Rat  =
B D                   Mouse  =
            Golden hamster  =
B D         Chinese hamster  =
              Prairie vole  =
       Cape elephant shrew  =
      David's myotis (bat)  =
B D                   Horse  -
           Star-nosed mole  =
B D                Squirrel  =
B D                    Pika  =
B D                  Rabbit  =
B D               Armadillo  =
                Chinchilla  =
    Lesser Egyptian jerboa  =
B D        White rhinoceros  =
          Brush-tailed rat  =
        Chinese tree shrew  =
            Pacific walrus  =
B D                     Dog  =
B D                Bushbaby  =
             Big brown bat  =
B D          Naked mole-rat  =
B D                   Panda  =
          Black flying-fox  =
B D                 Ferret   =
B D                 Dolphin  =
              Weddell seal  =
                  Aardvark  =
B D                  Turkey  =
  D            Mallard duck  =
B D              Budgerigar  =
  D        Peregrine falcon  =
  D             Rock pigeon  =
  D          Painted turtle  =
B D                 Chicken  =
B D                Platypus  =
  D     Collared flycatcher  =
B D             Zebra finch  =
  D            Saker falcon  =
  D         Green seaturtle  =
B D     Medium ground finch  =
B D      American alligator  =
  D  White-throated sparrow  =
        Tibetan ground jay  =

Inserts between block 16 and 17 in window
B D                    Pig 8bp
B D                 Alpaca 7bp
            Bactrian camel 7bp
          Tibetan antelope 4bp
B D                    Cow 4bp
B D                  Sheep 4bp
             Domestic goat 4bp

Alignment block 17 of 193 in window, 76993891 - 76993901, 11 bps 
B D                   Human  a--aacagaa-------------------------------aaa-----
B D                   Chimp  a--aacaaaa----------------------g--------aaa-----
B D                 Gorilla  a--aacaaaa---------------------aa--------aaa-----
B D               Orangutan  a--aacaaag--------------------aaa--------aaa-----
B D                  Gibbon  a--aacaaac--------------------aaa--------aaa-----
B D                  Rhesus  a--attaaaacaaaataaaaaaataataataaa--------aaa-----
B D     Crab-eating macaque  a--attaaaacaaaat-aaaaaataataataaa--------aaa-----
B D                  Baboon  a--attaa---aaaattaaaaaataataataaa--------aaa-----
B D            Green monkey  a--attaaaaaataaataaataataataataat--------aaa-----
B D                Marmoset  aacaacaaaaca-------------------aa--------aaa-----
B D         Squirrel monkey  aacagcaaaacaaaac---------------aa--------aaa-----
B D          Naked mole-rat  ------------------------------------------aa-----
B D              Guinea pig  ------------------------------------------aa-----
                 Chinchilla  ------------------------------------------ca-----
           Brush-tailed rat  ------------------------------------------aa-----
B D                     Pig  -----------------------------------------aaa-----
B D                  Alpaca  -----------------------------------------aaa-----
             Bactrian camel  -----------------------------------------aaa-----
B D                 Dolphin  -----------------------------------------aaa-----
               Killer whale  -----------------------------------------aaa-----
           Tibetan antelope  -----------------------------------------aaa-----
B D                     Cow  -----------------------------------------aaa-----
B D                   Sheep  -----------------------------------------aaa-----
              Domestic goat  -----------------------------------------aaa-----
B D                     Cat  --------------------------------aggccagg-aaa-----
B D                 Megabat  --------------------------------a----agg-aaa-----
B D                Elephant  --------------------------------------ggttaaaaaga
B D                 Manatee  --------------------------------------ga-taaaaggt
           Cape golden mole  --------------------------------------aa-taaaagga
B D                  Tenrec  =================================================
B D                Hedgehog  =================================================
B D                     Rat  =================================================
B D                   Mouse  =================================================
            Golden hamster  =================================================
B D         Chinese hamster  =================================================
              Prairie vole  =================================================
       Cape elephant shrew  =================================================
      David's myotis (bat)  =================================================
B D                   Horse  -------------------------------------------------
           Star-nosed mole  =================================================
B D                Squirrel  =================================================
B D                    Pika  =================================================
B D                  Rabbit  =================================================
B D               Armadillo  =================================================
    Lesser Egyptian jerboa  =================================================
B D        White rhinoceros  =================================================
        Chinese tree shrew  =================================================
            Pacific walrus  =================================================
B D                     Dog  =================================================
B D                Bushbaby  =================================================
             Big brown bat  =================================================
B D                   Panda  =================================================
          Black flying-fox  =================================================
B D                 Ferret   =================================================
              Weddell seal  =================================================
                  Aardvark  =================================================
B D                  Turkey  =================================================
  D            Mallard duck  =================================================
B D              Budgerigar  =================================================
  D        Peregrine falcon  =================================================
  D             Rock pigeon  =================================================
  D          Painted turtle  =================================================
B D                 Chicken  =================================================
B D                Platypus  =================================================
  D     Collared flycatcher  =================================================
B D             Zebra finch  =================================================
  D            Saker falcon  =================================================
  D         Green seaturtle  =================================================
B D     Medium ground finch  =================================================
B D      American alligator  =================================================
  D  White-throated sparrow  =================================================
        Tibetan ground jay  =================================================

Inserts between block 17 and 18 in window
B D                    Pig 8bp
B D                 Alpaca 8bp
            Bactrian camel 8bp
B D                Dolphin 8bp
              Killer whale 8bp
          Tibetan antelope 8bp
B D                    Cow 8bp
B D                  Sheep 8bp
             Domestic goat 8bp
B D                Megabat 8bp

Alignment block 18 of 193 in window, 76993902 - 76993902, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D          Naked mole-rat  a
B D              Guinea pig  a
                 Chinchilla  a
           Brush-tailed rat  a
B D                     Pig  a
B D                  Alpaca  a
             Bactrian camel  a
B D                 Dolphin  a
               Killer whale  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D                     Cat  a
B D                 Megabat  g
B D                Elephant  a
B D                 Manatee  a
           Cape golden mole  a
B D                  Tenrec  =
B D                Hedgehog  =
B D                     Rat  =
B D                   Mouse  =
            Golden hamster  =
B D         Chinese hamster  =
              Prairie vole  =
       Cape elephant shrew  =
      David's myotis (bat)  =
           Star-nosed mole  =
B D                Squirrel  =
B D                    Pika  =
B D                  Rabbit  =
B D               Armadillo  =
    Lesser Egyptian jerboa  =
B D        White rhinoceros  =
        Chinese tree shrew  =
            Pacific walrus  =
B D                     Dog  =
B D                Bushbaby  =
             Big brown bat  =
B D                   Panda  =
          Black flying-fox  =
B D                 Ferret   =
              Weddell seal  =
                  Aardvark  =
B D                  Turkey  =
  D            Mallard duck  =
B D              Budgerigar  =
  D        Peregrine falcon  =
  D             Rock pigeon  =
  D          Painted turtle  =
B D                 Chicken  =
B D                Platypus  =
  D     Collared flycatcher  =
B D             Zebra finch  =
  D            Saker falcon  =
  D         Green seaturtle  =
B D     Medium ground finch  =
B D      American alligator  =
  D  White-throated sparrow  =
        Tibetan ground jay  =

Inserts between block 18 and 19 in window
B D                    Cat 8bp

Alignment block 19 of 193 in window, 76993903 - 76993903, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  c
B D         Squirrel monkey  a
B D          Naked mole-rat  t
B D              Guinea pig  a
                 Chinchilla  a
           Brush-tailed rat  g
B D                     Pig  g
B D                  Alpaca  a
             Bactrian camel  a
B D                 Dolphin  a
               Killer whale  a
           Tibetan antelope  g
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D                     Cat  a
B D                     Dog  a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                 Megabat  a
B D                Elephant  a
B D                 Manatee  a
           Cape golden mole  a
B D                  Tenrec  =
B D                Hedgehog  =
B D                     Rat  =
B D                   Mouse  =
            Golden hamster  =
B D         Chinese hamster  =
              Prairie vole  =
       Cape elephant shrew  =
      David's myotis (bat)  =
           Star-nosed mole  =
B D                Squirrel  =
B D                    Pika  =
B D                  Rabbit  =
B D               Armadillo  =
    Lesser Egyptian jerboa  =
B D        White rhinoceros  =
        Chinese tree shrew  =
B D                Bushbaby  =
             Big brown bat  =
B D                 Ferret   =
                  Aardvark  =
B D                  Turkey  =
  D            Mallard duck  =
B D              Budgerigar  =
  D        Peregrine falcon  =
  D             Rock pigeon  =
  D          Painted turtle  =
B D                 Chicken  =
B D                Platypus  =
  D     Collared flycatcher  =
B D             Zebra finch  =
  D            Saker falcon  =
  D         Green seaturtle  =
B D     Medium ground finch  =
B D      American alligator  =
  D  White-throated sparrow  =
        Tibetan ground jay  =

Alignment block 20 of 193 in window, 76993904 - 76993905, 2 bps 
B D                   Human  gt
B D                   Chimp  gt
B D                 Gorilla  gt
B D               Orangutan  gt
B D                  Gibbon  gt
B D                  Rhesus  gt
B D     Crab-eating macaque  gt
B D                  Baboon  gt
B D            Green monkey  gt
B D                Marmoset  gt
B D         Squirrel monkey  gt
B D          Naked mole-rat  tc
B D              Guinea pig  gc
                 Chinchilla  gc
           Brush-tailed rat  ac
B D                     Pig  gc
B D                  Alpaca  gc
             Bactrian camel  gc
B D                 Dolphin  gt
               Killer whale  gt
           Tibetan antelope  gt
B D                     Cow  gt
B D                   Sheep  gt
              Domestic goat  gt
B D                   Horse  gt
B D                     Cat  gt
B D                     Dog  gt
B D                 Ferret   gt
B D                   Panda  gt
             Pacific walrus  gt
               Weddell seal  gt
           Black flying-fox  gt
B D                 Megabat  gt
B D                Elephant  at
B D                 Manatee  at
           Cape golden mole  at
B D                  Tenrec  ==
B D                Hedgehog  ==
B D                     Rat  ==
B D                   Mouse  ==
            Golden hamster  ==
B D         Chinese hamster  ==
              Prairie vole  ==
       Cape elephant shrew  ==
      David's myotis (bat)  ==
           Star-nosed mole  ==
B D                Squirrel  ==
B D                    Pika  ==
B D                  Rabbit  ==
B D               Armadillo  ==
    Lesser Egyptian jerboa  ==
B D        White rhinoceros  ==
        Chinese tree shrew  ==
B D                Bushbaby  ==
             Big brown bat  ==
                  Aardvark  ==
B D                  Turkey  ==
  D            Mallard duck  ==
B D              Budgerigar  ==
  D        Peregrine falcon  ==
  D             Rock pigeon  ==
  D          Painted turtle  ==
B D                 Chicken  ==
B D                Platypus  ==
  D     Collared flycatcher  ==
B D             Zebra finch  ==
  D            Saker falcon  ==
  D         Green seaturtle  ==
B D     Medium ground finch  ==
B D      American alligator  ==
  D  White-throated sparrow  ==
        Tibetan ground jay  ==

Inserts between block 20 and 21 in window
B D         Naked mole-rat 11bp
B D             Guinea pig 11bp
                Chinchilla 13bp
          Brush-tailed rat 3bp
B D               Elephant 10bp
B D                Manatee 11bp
          Cape golden mole 11bp

Alignment block 21 of 193 in window, 76993906 - 76993909, 4 bps 
B D                   Human  tttg
B D                   Chimp  tttg
B D                 Gorilla  tttg
B D               Orangutan  tttg
B D                  Gibbon  tttg
B D                  Rhesus  tttg
B D     Crab-eating macaque  tttg
B D                  Baboon  tttg
B D            Green monkey  tttg
B D                Marmoset  tttg
B D         Squirrel monkey  tttg
B D                Bushbaby  tttg
B D          Naked mole-rat  tttg
B D              Guinea pig  tttg
                 Chinchilla  tttg
           Brush-tailed rat  tttg
B D                     Pig  tctg
B D                  Alpaca  tttg
             Bactrian camel  tttg
B D                 Dolphin  tctg
               Killer whale  tctg
           Tibetan antelope  tctg
B D                     Cow  tctg
B D                   Sheep  tctg
              Domestic goat  tctg
B D                   Horse  tttg
B D                     Cat  tttg
B D                     Dog  tttg
B D                 Ferret   tttg
B D                   Panda  tttg
             Pacific walrus  tttg
               Weddell seal  tttg
           Black flying-fox  tttg
B D                 Megabat  tttg
B D                Elephant  ttgg
B D                 Manatee  ttgg
           Cape golden mole  ttgg
B D               Armadillo  tttg
B D                  Tenrec  ====
B D                Hedgehog  ====
B D                     Rat  ====
B D                   Mouse  ====
            Golden hamster  ====
B D         Chinese hamster  ====
              Prairie vole  ====
       Cape elephant shrew  ====
      David's myotis (bat)  ====
           Star-nosed mole  ====
B D                Squirrel  ====
B D                    Pika  ====
B D                  Rabbit  ====
    Lesser Egyptian jerboa  ====
B D        White rhinoceros  ====
        Chinese tree shrew  ====
             Big brown bat  ====
                  Aardvark  ====
B D                  Turkey  ====
  D            Mallard duck  ====
B D              Budgerigar  ====
  D        Peregrine falcon  ====
  D             Rock pigeon  ====
  D          Painted turtle  ====
B D                 Chicken  ====
B D                Platypus  ====
  D     Collared flycatcher  ====
B D             Zebra finch  ====
  D            Saker falcon  ====
  D         Green seaturtle  ====
B D     Medium ground finch  ====
B D      American alligator  ====
  D  White-throated sparrow  ====
        Tibetan ground jay  ====

Alignment block 22 of 193 in window, 76993910 - 76993934, 25 bps 
B D                   Human  caagactg---tgaaggcagacaggtgg
B D                   Chimp  caagactg---tgaaggcaggcaggtgg
B D                 Gorilla  caagactg---tgaaggcaggcaggtgg
B D               Orangutan  caagactg---tgaaggcaggcaggtgg
B D                  Gibbon  cgagactg---tgaaggcaggcaggtgg
B D                  Rhesus  caagactg---tgaaggcaggcaggtgg
B D     Crab-eating macaque  caagactg---tgaaggcaggcaggtgg
B D                  Baboon  caagactg---tgaaggcaggcaggtgg
B D            Green monkey  caagactg---tgaaggcaggcaggtgg
B D                Marmoset  caagactg---tgaaggcagacgggtgg
B D         Squirrel monkey  caagactg---tgaaggcaggcaggtgg
B D                Bushbaby  caggactg---ggaaggcag-caggtgg
         Chinese tree shrew  cgagacta---ggaaggcaggctcctgt
B D          Naked mole-rat  cacgactgccatcatggcgggtc-----
B D              Guinea pig  cacaactg---tgcaggcaggct-----
                 Chinchilla  caccccta---tccaggcaggcc-----
           Brush-tailed rat  cacgactg---cacaggtaggca-----
B D                     Pig  cctgacag---tgaaggcagctaa----
B D                  Alpaca  cccgacta---ggaaggcagctga----
             Bactrian camel  cctgacta---ggaaggcagctaa----
B D                 Dolphin  cctgactg---tgaaggcagctca----
               Killer whale  cctgactg---tgaaggcagctca----
           Tibetan antelope  cctgactg---tgaaggcagctaa----
B D                     Cow  cctgactg---tgaaggcagctaa----
B D                   Sheep  cctggctg---tgaaggcagctaa----
              Domestic goat  cctgactg---tgaagacagctaa----
B D                   Horse  c-tgactg---tggaggc----------
B D                     Cat  cataactg---tgaaggca---gc----
B D                     Dog  cagaactg---tgaaggc----tc----
B D                 Ferret   cataactg---tgaaggc----tc----
B D                   Panda  cctaaccg---tgaaggc----tc----
             Pacific walrus  cataactg---tgaagcc----tc----
               Weddell seal  cataactg---tgaagcc----tc----
           Black flying-fox  catggccg---cgaaggcagc-ta----
B D                 Megabat  catggctg---cgaaggcagc-ta----
B D                Elephant  catgactg---tgaagccagatacactg
B D                 Manatee  catggctg---tgaaaccagatacactg
           Cape golden mole  catgactg---ccaagccagatacactg
B D               Armadillo  cagggctg---tgaattcagggacgccg
B D                  Tenrec  ============================
B D                Hedgehog  ============================
B D                     Rat  ============================
B D                   Mouse  ============================
            Golden hamster  ============================
B D         Chinese hamster  ============================
              Prairie vole  ============================
       Cape elephant shrew  ============================
      David's myotis (bat)  ============================
           Star-nosed mole  ============================
B D                Squirrel  ============================
B D                    Pika  ============================
B D                  Rabbit  ============================
    Lesser Egyptian jerboa  ============================
B D        White rhinoceros  ============================
             Big brown bat  ============================
                  Aardvark  ============================
B D                  Turkey  ============================
  D            Mallard duck  ============================
B D              Budgerigar  ============================
  D        Peregrine falcon  ============================
  D             Rock pigeon  ============================
  D          Painted turtle  ============================
B D                 Chicken  ============================
B D                Platypus  ============================
  D     Collared flycatcher  ============================
B D             Zebra finch  ============================
  D            Saker falcon  ============================
  D         Green seaturtle  ============================
B D     Medium ground finch  ============================
B D      American alligator  ============================
  D  White-throated sparrow  ============================
        Tibetan ground jay  ============================

Inserts between block 22 and 23 in window
B D                    Pig 2bp
B D                 Alpaca 2bp
            Bactrian camel 2bp
B D                Dolphin 2bp
              Killer whale 2bp
          Tibetan antelope 2bp
B D                    Cow 2bp
B D                  Sheep 2bp
             Domestic goat 2bp
B D                  Horse 8bp
B D                    Cat 5bp
B D                    Dog 4bp
B D                Ferret  5bp
B D                  Panda 5bp
            Pacific walrus 5bp
              Weddell seal 5bp
          Black flying-fox 4bp
B D                Megabat 4bp

Alignment block 23 of 193 in window, 76993935 - 76993935, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  g
B D         Squirrel monkey  a
B D                Bushbaby  a
         Chinese tree shrew  a
B D                     Pig  a
B D                  Alpaca  a
             Bactrian camel  a
B D                 Dolphin  a
               Killer whale  a
           Tibetan antelope  g
B D                     Cow  g
B D                   Sheep  g
              Domestic goat  g
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                 Ferret   t
B D                   Panda  t
             Pacific walrus  t
               Weddell seal  c
B D                Elephant  a
B D                 Manatee  a
           Cape golden mole  a
B D               Armadillo  a
B D                  Tenrec  =
B D                Hedgehog  =
B D              Guinea pig  -
B D                     Rat  =
B D                   Mouse  =
            Golden hamster  =
B D         Chinese hamster  =
              Prairie vole  =
       Cape elephant shrew  =
      David's myotis (bat)  =
           Star-nosed mole  =
B D                Squirrel  =
B D                    Pika  =
B D                  Rabbit  =
                Chinchilla  -
    Lesser Egyptian jerboa  =
          Brush-tailed rat  -
             Big brown bat  =
B D          Naked mole-rat  -
          Black flying-fox  =
                  Aardvark  =
B D                  Turkey  =
  D            Mallard duck  =
B D              Budgerigar  =
  D        Peregrine falcon  =
  D             Rock pigeon  =
  D          Painted turtle  =
B D                 Chicken  =
B D                Platypus  =
  D     Collared flycatcher  =
B D             Zebra finch  =
  D            Saker falcon  =
  D         Green seaturtle  =
B D     Medium ground finch  =
B D      American alligator  =
  D  White-throated sparrow  =
        Tibetan ground jay  =
B D                 Megabat  =

Inserts between block 23 and 24 in window
B D              Armadillo 2bp

Alignment block 24 of 193 in window, 76993936 - 76993970, 35 bps 
B D                   Human  tactgagaaatccctc----------------------agagg-cctcccacccca-cc
B D                   Chimp  tactgagaaatccctc----------------------agagg-cctcccacccca-cc
B D                 Gorilla  tactgagaaatccctc----------------------agagg-cctcccacccca-cc
B D               Orangutan  tactgagaaatccctc----------------------agagg-cctcccacccca-cc
B D                  Gibbon  taccgagaaatccctc----------------------agagg-cctcccaccccaccc
B D                  Rhesus  tactgagaaatccctc----------------------agagg-cctcctacccca-cc
B D     Crab-eating macaque  tactgagaaatccctc----------------------agagg-cctcccacccca-cc
B D                  Baboon  tactgagaaatccctc----------------------agagg-cctcccacccca-cc
B D            Green monkey  tactgagaaatccctc----------------------agagg-cctcccacccca-cc
B D                Marmoset  tactgagaagtccctc----------------------agagg-cctcccagccca-cc
B D         Squirrel monkey  tactgagaagtccctc----------------------ggagg-cctcccagccca-cc
B D                Bushbaby  gga-gaggcgcccctc----------------------ggagg-cctctggcccgc-tc
         Chinese tree shrew  tacc-agaaatccctc----------------------ggtgg-ctccccaac----cc
B D          Naked mole-rat  --------------------------------------------ccacccacc------
B D              Guinea pig  --------------------------------------------ctgcccgcc------
                 Chinchilla  --------------------------------------------ccacccacc------
           Brush-tailed rat  --------------------------------------------ccgcccacc------
B D                     Pig  taccaggggctcgctc--------------------------------ccatgcta-cc
B D                  Alpaca  tgccagcacgtgcccc---------------------------------------a-cc
             Bactrian camel  tgccaggacgtgcccc---------------------------------------g-cc
B D                 Dolphin  taccaggaaatccctc--------------------------------ccatccca-cc
               Killer whale  taccaggaaattcctc--------------------------------ccatccca-cc
           Tibetan antelope  taccaggaagtctctc----------------------------ccacccatcctg-tc
B D                     Cow  taccaggaagtccctc----------------------------ccatccatcccg-tc
B D                   Sheep  taccaggaagtctctc----------------------------ccatccatcctg-tc
              Domestic goat  taccaggaagtctctc----------------------------ccatccatcctg-tc
B D                   Horse  taccaggaaatcccac----------------------ggagg-cctccctatccc-ac
B D        White rhinoceros  taccaggaaatcctgc----------------------agagg-cctccctatccc-gc
B D                     Cat  tgcctggaaatccctc----------------------tgagg-cctcccatccac--c
B D                     Dog  tgccagaaaatccctc----------------------cgagg-ccgcccagctcc--c
B D                 Ferret   tgctagaaaatccctc----------------------tgagg-ccttctatccc---c
B D                   Panda  tgccagaaaagccctc----------------------tgagg-cctcccatcc----c
             Pacific walrus  tgccagaaaatccctt----------------------tgagg-cctcccaccccc-tc
               Weddell seal  tgccagaaaatccctc----------------------tgagg-cctcccacccct-tc
           Black flying-fox  --ccagggaatgcctc----------------------tccgg-ccttcccatccc-ac
B D                 Megabat  --ccagggaatgcctc----------------------tcggg-ccttcccatccc-ac
B D                Elephant  tatcaagaaatcccttaaatcccttaaaaaaaaaaaaaaaagggccccttatccca-ac
B D                 Manatee  tgtcaagaaatctctt----------------------ggaggcctccttatccca-ac
           Cape golden mole  tagcgagaaactcctc----------------------agagaccttcttagccca-ac
                   Aardvark  tatcaagaaatccctt----------------------ggagg----------------
B D               Armadillo  aatcaggatgccgctt----------------------ggaga-ccccccattcca-cc
B D                  Tenrec  ===========================================================
B D                Hedgehog  ===========================================================
B D                     Rat  ===========================================================
B D                   Mouse  ===========================================================
            Golden hamster  ===========================================================
B D         Chinese hamster  ===========================================================
              Prairie vole  ===========================================================
       Cape elephant shrew  ===========================================================
      David's myotis (bat)  ===========================================================
           Star-nosed mole  ===========================================================
B D                Squirrel  ===========================================================
B D                    Pika  ===========================================================
B D                  Rabbit  ===========================================================
    Lesser Egyptian jerboa  ===========================================================
             Big brown bat  ===========================================================
B D                  Turkey  ===========================================================
  D            Mallard duck  ===========================================================
B D              Budgerigar  ===========================================================
  D        Peregrine falcon  ===========================================================
  D             Rock pigeon  ===========================================================
  D          Painted turtle  ===========================================================
B D                 Chicken  ===========================================================
B D                Platypus  ===========================================================
  D     Collared flycatcher  ===========================================================
B D             Zebra finch  ===========================================================
  D            Saker falcon  ===========================================================
  D         Green seaturtle  ===========================================================
B D     Medium ground finch  ===========================================================
B D      American alligator  ===========================================================
  D  White-throated sparrow  ===========================================================
        Tibetan ground jay  ===========================================================

Inserts between block 24 and 25 in window
          Black flying-fox 1bp
B D                Megabat 1bp

Alignment block 25 of 193 in window, 76993971 - 76994023, 53 bps 
B D                   Human  ctc---ccc-cagggccttgccctgggaagctgttt----t------------------c--tttaccag
B D                   Chimp  ctc---ccc-caaggccttgccctgggaagctgttt----t------------------c--tttaccag
B D                 Gorilla  ctc---ccc-caaggccttgccctgggaagctgttt----t------------------c--tttaccag
B D               Orangutan  ctc---ccc-caagaccttgccctgggaagctgttt----t------------------c--tttaccag
B D                  Gibbon  ctc---ccc-caaggccttgccctgggaagctgttt----t------------------c--tttaccag
B D                  Rhesus  ctc---ccc-caaggccttgccctgggaatctgttt----t------------------c--tttaccag
B D     Crab-eating macaque  ctc---ccc-caaggccttgccctgggaatctgttt----t------------------c--tttaccag
B D                  Baboon  ctc---cct-caaggccttgccctgggaatctgttt----t------------------c--tttaccag
B D            Green monkey  ctc---cct-caa---------ctgggaatctgttt----t------------------c--tttaccag
B D                Marmoset  ctt---ccc-caaggccttgccctgggaagctgttt----t------------------c--tttaccag
B D         Squirrel monkey  ctc---ccc-caaggccttgccctgggaagctgttt----t------------------c--tttaccag
B D                Bushbaby  tgc---tcc-c--gcccttgacttggagagcttttt----c------------------c--ttcgcgag
         Chinese tree shrew  ctc---cc----agcccatgccttgggga-------------------------------------ccag
B D                Squirrel  ccc---ctc-ccagcccgtgccgtggggagcgggct----c------------------c--tg------
B D          Naked mole-rat  ttcctaccc-ccgggccctgcc-tcgggagctgttt----c------------------c--ttttcc--
B D              Guinea pig  ct----ctc-ccagccc--gtc-tccagagccgatt----c------------------c--tttcccag
                 Chinchilla  ctc---ctc-ccaggccttgcc-tccagagctgttt----c------------------c--ttttcc--
           Brush-tailed rat  tgc---ctc-ccagccctggcc-------------t----c------------------c--ttttccca
B D                     Pig  ctc---ttt-ccagcccctgccttaggaagccgttt----c------------------c--tt--ccga
B D                  Alpaca  ctc---ctc-ccagcccttgccctaggaagctgttt----c------------------c--tc--ccaa
             Bactrian camel  ctc---ctc-ccagccctcgccctaggaagctgttt----c------------------c--tc--ccaa
B D                 Dolphin  ctc---ctc-ccagcccttgccctgagaagctgttt-----------------------c--tc--ccaa
               Killer whale  ctc---ctc-ccagcccttgccctgagaagctgttt-----------------------c--tc--ccaa
           Tibetan antelope  ctc---ctc-ccagccctggccttgggaagctgtct----g------------------c--tc--ccaa
B D                     Cow  ctc---ctc-ccagccctggccttgggaggctgtct----g------------------c--tc--ccaa
B D                   Sheep  ctc---ctc-ccagccctggccttgggaagctgtct----g------------------c--tc--ccag
              Domestic goat  ctc---ctc-ccagccctggccttgggcagctgtct----g------------------c--tc--ccag
B D                   Horse  ccc---ctc-tcagcgcttgccccc-ggagcgggtt----c------------------c--tc--ccag
B D        White rhinoceros  ctc---ctc-ccagcccttgccctagggagctgttt----c------------------c--tc--ccaa
B D                     Cat  ctc---ctc-ccagcctcag------ggacctggct----c------------------c--tc--ccag
B D                     Dog  ctc---ctc-ccagccttag------ggagctagtc----cgtctccccaccccatccac--cc--ccag
B D                 Ferret   ctc---ctc-tcagccttag------ggagctgccc----c------------------cctcc--ccag
B D                   Panda  caa---ccc-ccagccttag------ggagcttgtt----c------------------c--cc--ccag
             Pacific walrus  ctc---ctc-ccagccttag------ggagctggtt----c------------------c--cc--ccag
               Weddell seal  ctc---ctc-ccagccttag------ggagctggtt----c------------------c--cc--ccag
           Black flying-fox  ctc---ctc-cccgcccttgccctaggcagctggccgttgc------------------c--tc--ccaa
B D                 Megabat  ctc---ctc-cccgcccttgccctaggcagctggccgttcc------------------c--tc--ccaa
B D                Elephant  ctc---ctt-ccaacccttgccttggggagctattt----g------------------c--ttcatcag
B D                 Manatee  ctc---ctt-ccaacccttgccttgggaaactgttt----g------------------c--tttaccta
           Cape golden mole  ctc---ctt-ccaatcctggcccaggtgacttct------------------------------------
                   Aardvark  ------ctt-cctgcctctgccttggggacctgttg----g------------------c--tttaccag
B D               Armadillo  ctg---ctcaccagcccttgccttggggagctgttt----g------------------c--tttaagag
B D                  Tenrec  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
              Prairie vole  ======================================================================
       Cape elephant shrew  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Big brown bat  ======================================================================
B D                  Turkey  ======================================================================
  D            Mallard duck  ======================================================================
B D              Budgerigar  ======================================================================
  D        Peregrine falcon  ======================================================================
  D             Rock pigeon  ======================================================================
  D          Painted turtle  ======================================================================
B D                 Chicken  ======================================================================
B D                Platypus  ======================================================================
  D     Collared flycatcher  ======================================================================
B D             Zebra finch  ======================================================================
  D            Saker falcon  ======================================================================
  D         Green seaturtle  ======================================================================
B D     Medium ground finch  ======================================================================
B D      American alligator  ======================================================================
  D  White-throated sparrow  ======================================================================
        Tibetan ground jay  ======================================================================

                      Human  gcatctccgga
                      Chimp  gcatctccgga
                    Gorilla  gcatctccgga
                  Orangutan  gcatctccgga
                     Gibbon  gcatctctgga
                     Rhesus  gcatctccgga
        Crab-eating macaque  gcatctccgga
                     Baboon  gcatctccgga
               Green monkey  gcatctccgga
                   Marmoset  gcatctcccaa
            Squirrel monkey  gcatctcccga
                   Bushbaby  gaaactccag-
         Chinese tree shrew  gctgctcagg-
                   Squirrel  -----------
             Naked mole-rat  -----------
                 Guinea pig  c----------
                 Chinchilla  -----------
           Brush-tailed rat  g----------
                        Pig  -----------
                     Alpaca  -----------
             Bactrian camel  -----------
                    Dolphin  -----------
               Killer whale  -----------
           Tibetan antelope  -----------
                        Cow  -----------
                      Sheep  -----------
              Domestic goat  -----------
                      Horse  -----------
           White rhinoceros  -----------
                        Cat  -----------
                        Dog  -----------
                    Ferret   -----------
                      Panda  -----------
             Pacific walrus  -----------
               Weddell seal  -----------
           Black flying-fox  -----------
                    Megabat  -----------
                   Elephant  gcaaatgccaa
                    Manatee  gcgactcccaa
           Cape golden mole  --------cag
                   Aardvark  gccactccca-
                  Armadillo  gccatttccgc
                     Tenrec  ===========
                   Hedgehog  ===========
                        Rat  ===========
                      Mouse  ===========
             Golden hamster  ===========
            Chinese hamster  ===========
               Prairie vole  ===========
        Cape elephant shrew  ===========
       David's myotis (bat)  ===========
            Star-nosed mole  ===========
                       Pika  ===========
                     Rabbit  ===========
     Lesser Egyptian jerboa  ===========
              Big brown bat  ===========
                     Turkey  ===========
               Mallard duck  ===========
                 Budgerigar  ===========
           Peregrine falcon  ===========
                Rock pigeon  ===========
             Painted turtle  ===========
                    Chicken  ===========
                   Platypus  ===========
        Collared flycatcher  ===========
                Zebra finch  ===========
               Saker falcon  ===========
            Green seaturtle  ===========
        Medium ground finch  ===========
         American alligator  ===========
     White-throated sparrow  ===========
         Tibetan ground jay  ===========

Alignment block 26 of 193 in window, 76994024 - 76994048, 25 bps 
B D                   Human  tttgtcctt-tggg-gttgatggagat
B D                   Chimp  tttgtcctt-tggg-gttgatggagat
B D                 Gorilla  tttgtcctt-tggg-gttgatggagat
B D               Orangutan  tttgtcctt-tggg-gttgatggagat
B D                  Gibbon  tttgtcctt-tggg-gttgatggagat
B D                  Rhesus  tttgtcctt-tggg-gttgatggagat
B D     Crab-eating macaque  tttgtcctt-tggg-gttgatggagat
B D                  Baboon  tttgtcctt-tggg-gttgatggagat
B D            Green monkey  tttgtcctt-tggg-gttgatggagat
B D                Marmoset  tttgtcctt-tgagggctgatggagat
B D         Squirrel monkey  tttgtcctt-tgggtgttgatggagat
B D                Bushbaby  cttgttctg-tggg-gttgc---agat
         Chinese tree shrew  ------------gg-gctg--------
B D                Squirrel  -ggagtcag-ggga-ggttgtgtaa--
B D          Naked mole-rat  -aggtacct-t----------------
B D              Guinea pig  tacgatctt-tggg-tctgaagggg--
                 Chinchilla  -aagttctt-tgga-gctggcgggg--
           Brush-tailed rat  gaagctttt-tggg-gctggtgggg--
B D                     Pig  ---gttctt-tggg-ga-ggtggacat
B D                  Alpaca  tttgtcctt-tggg-ga-ggtggatga
             Bactrian camel  tctgtcctt-tggg-gc-ggtggatta
B D                 Dolphin  tttgttctt-tggg-gt-ggtggatgt
               Killer whale  tttgttctt-tggg-gt-ggtggatgt
           Tibetan antelope  tctgttttg-gggg-at-ggtggatag
B D                     Cow  tctgttttt-gggg-gt-ggtggatag
B D                   Sheep  tctgtttta-gggg-gt-ggtggatgg
              Domestic goat  tctgttttg-gggg-at-ggtggatag
B D                   Horse  tttgttctt-tggg-gtgagtggatgt
B D        White rhinoceros  tttgttctt-tggg-gttggtggacgt
B D                     Cat  tctgttcttgggaa-gttggtggatgt
B D                     Dog  tttgttctt-cgga-gttggtggatgt
B D                 Ferret   tttgttctt-cgga-gtcggtggatgt
B D                   Panda  tttgttctg-ggga-gttggtgggtgt
             Pacific walrus  tttgttc----gga-gttggtggaggt
               Weddell seal  tttgttc----gga-gttggtggatgt
           Black flying-fox  tttgtcctt-tggg-gttggtggccgg
B D                 Megabat  tttatcctt-tggg-gtcggtggccgg
B D                Hedgehog  tttgttctt-tggg-attggtgggtgc
B D                Elephant  tttgttctt-tggg-gtgggtggatat
B D                 Manatee  tttgttctt-tggg-gt-ggtggatat
           Cape golden mole  tttgctctt-tggg-gtgggtggatat
                   Aardvark  tttgttctt-tgga-gtaggtgaatat
B D               Armadillo  ggtgttctt-tggg-gttggtgg----
B D                  Tenrec  ===========================
B D                     Rat  ===========================
B D                   Mouse  ===========================
            Golden hamster  ===========================
B D         Chinese hamster  ===========================
              Prairie vole  ===========================
       Cape elephant shrew  ===========================
      David's myotis (bat)  ===========================
           Star-nosed mole  ===========================
B D                    Pika  ===========================
B D                  Rabbit  ===========================
    Lesser Egyptian jerboa  ===========================
             Big brown bat  ===========================
B D                  Turkey  ===========================
  D            Mallard duck  ===========================
B D              Budgerigar  ===========================
  D        Peregrine falcon  ===========================
  D             Rock pigeon  ===========================
  D          Painted turtle  ===========================
B D                 Chicken  ===========================
B D                Platypus  ===========================
  D     Collared flycatcher  ===========================
B D             Zebra finch  ===========================
  D            Saker falcon  ===========================
  D         Green seaturtle  ===========================
B D     Medium ground finch  ===========================
B D      American alligator  ===========================
  D  White-throated sparrow  ===========================
        Tibetan ground jay  ===========================

Inserts between block 26 and 27 in window
                  Aardvark 163bp

Alignment block 27 of 193 in window, 76994049 - 76994058, 10 bps 
B D                   Human  ttatttattt
B D                   Chimp  ttatttattt
B D                 Gorilla  ttatttattt
B D               Orangutan  ttatttattt
B D                  Gibbon  ttatttattt
B D                  Rhesus  ttatttattt
B D     Crab-eating macaque  ttatttattt
B D                  Baboon  ttatttattt
B D            Green monkey  ttatttattt
B D                Marmoset  ttatttattt
B D         Squirrel monkey  ttatttattt
B D                Bushbaby  tcacgtgtgc
         Chinese tree shrew  ----tggttt
B D                     Pig  tt----gttc
B D                  Alpaca  tgctttgttt
             Bactrian camel  tgctttgttt
B D                 Dolphin  ttatctgttc
               Killer whale  ttatctgttc
           Tibetan antelope  ttacacgttt
B D                     Cow  ttataagttt
B D                   Sheep  ttataagttt
              Domestic goat  ttataagttt
B D                   Horse  ttattcgttg
B D        White rhinoceros  ttatttgttt
B D                     Cat  ttatttgttt
B D                     Dog  ttgtttgttt
B D                 Ferret   ttatttgttt
B D                   Panda  ttatttgttt
             Pacific walrus  ttatttgttt
               Weddell seal  ttatttgttt
           Black flying-fox  ttatttgttt
B D                 Megabat  ttatttgttc
B D                Hedgehog  ttatttgttg
B D                Elephant  ttatttgttt
B D                 Manatee  ttatttgttt
           Cape golden mole  ttatctgttt
B D               Armadillo  ctatttcttc
B D                  Tenrec  ==========
B D              Guinea pig  ----------
B D                     Rat  ==========
B D                   Mouse  ==========
            Golden hamster  ==========
B D         Chinese hamster  ==========
              Prairie vole  ==========
       Cape elephant shrew  ==========
      David's myotis (bat)  ==========
           Star-nosed mole  ==========
B D                Squirrel  ----------
B D                    Pika  ==========
B D                  Rabbit  ==========
                Chinchilla  ----------
    Lesser Egyptian jerboa  ==========
          Brush-tailed rat  ----------
             Big brown bat  ==========
B D          Naked mole-rat  ----------
                  Aardvark  ==========
B D                  Turkey  ==========
  D            Mallard duck  ==========
B D              Budgerigar  ==========
  D        Peregrine falcon  ==========
  D             Rock pigeon  ==========
  D          Painted turtle  ==========
B D                 Chicken  ==========
B D                Platypus  ==========
  D     Collared flycatcher  ==========
B D             Zebra finch  ==========
  D            Saker falcon  ==========
  D         Green seaturtle  ==========
B D     Medium ground finch  ==========
B D      American alligator  ==========
  D  White-throated sparrow  ==========
        Tibetan ground jay  ==========

Inserts between block 27 and 28 in window
          Black flying-fox 2bp
B D                Megabat 2bp

Alignment block 28 of 193 in window, 76994059 - 76994092, 34 bps 
B D                   Human  a---------------------------------------a---aca----cacagctgacacttgtgcc
B D                   Chimp  a---------------------------------------a---aca----aacagctgacgcttgtgcc
B D                 Gorilla  a---------------------------------------a---aca----cacagctgacacttgtgcc
B D               Orangutan  a---------------------------------------a---aca----cacagctgacacttgtgcc
B D                  Gibbon  a---------------------------------------a---aca----cacagctgacacttgtgcc
B D                  Rhesus  a---------------------------------------a---aca----cacagctgacacttgtacc
B D     Crab-eating macaque  a---------------------------------------a---aca----cacagctgacacttgtacc
B D                  Baboon  a---------------------------------------a---aca----cacagctgacacttgtacc
B D            Green monkey  a---------------------------------------a---aca----cacagctgacacttgtacc
B D                Marmoset  a---------------------------------------a---aca----cacagctgatacttgttcc
B D         Squirrel monkey  g---------------------------------------a---aca----cacagctgacacttgttcc
B D                Bushbaby  g---------------------------------------acacacagctgcacagttgacacgtgtgtg
         Chinese tree shrew  a---------------------------------------a---atg----ttcggcctgcacctgtgcc
B D                Squirrel  --------------------------------------------atg----tgcagcccccgccgtgc--
B D          Naked mole-rat  --------------------------------------------------------ccttcacaagggtg
B D              Guinea pig  --------------------------------------------atg----cacagctctcgccaggcca
                 Chinchilla  --------------------------------------------ata----cacagctctcacaaggctg
           Brush-tailed rat  --------------------------------------------acg----cacagctccctcaaggctg
B D                     Pig  c---------------------------------------a---gtg----cacggcctacacctgtgca
B D                  Alpaca  a---------------------------------------a---atg----cactgcctacacgtgtgca
             Bactrian camel  a---------------------------------------a---atg----cactgcctacacgtgtgca
B D                 Dolphin  a---------------------------------------a---atg----cacagcctacacttgtgca
               Killer whale  a---------------------------------------a---atg----cacagcctacacttgtgca
           Tibetan antelope  a---------------------------------------a---atg----cacaggctacacttgtgcg
B D                     Cow  a---------------------------------------a---acg----cacaggttacacttctgca
B D                   Sheep  a---------------------------------------a---atg----cacaggctacacttgtgca
              Domestic goat  a---------------------------------------a---atg----cacaggctacacttgtgca
B D                   Horse  a---------------------------------------c---agg----cacagcctacacaggtgtg
B D        White rhinoceros  a---------------------------------------a---atg----cacagcctacacctgtgtg
B D                     Cat  a---------------------------------------a---atg----cacagctc-tacacgtgct
B D                     Dog  aaacgcacagcctctaaaaaataaaaattttttaaaaatga---acg----cacagcccccacatgtgcc
B D                 Ferret   a---------------------------------------a---atg----cacagcccacacgtgtacg
B D                   Panda  a---------------------------------------a---agg----cacagcccacacatgtgca
             Pacific walrus  a---------------------------------------a---atg----cacagcctacacatgtgcg
               Weddell seal  a---------------------------------------a---gtg----cacagcctacacatgggcg
B D                Hedgehog  a---------------------------------------a---atg----cacagcctacacatgtgca
B D                Elephant  a---------------------------------------a---atg----tacagcttataaaagcacg
B D                 Manatee  c---------------------------------------a---atg----cacagcttataaaggtgtg
           Cape golden mole  a---------------------------------------a---aca----cacagtttataaaagcaca
                   Aardvark  a---------------------------------------a---atg----tacagcttataaa--cacg
B D               Armadillo  a---------------------------------------a---gcg----catggcctgtgaaagcacg
B D                  Tenrec  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
              Prairie vole  ======================================================================
       Cape elephant shrew  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ======================================================================
B D                  Turkey  ======================================================================
  D            Mallard duck  ======================================================================
B D              Budgerigar  ======================================================================
  D        Peregrine falcon  ======================================================================
  D             Rock pigeon  ======================================================================
  D          Painted turtle  ======================================================================
B D                 Chicken  ======================================================================
B D                Platypus  ======================================================================
  D     Collared flycatcher  ======================================================================
B D             Zebra finch  ======================================================================
  D            Saker falcon  ======================================================================
  D         Green seaturtle  ======================================================================
B D     Medium ground finch  ======================================================================
B D      American alligator  ======================================================================
  D  White-throated sparrow  ======================================================================
        Tibetan ground jay  ======================================================================
B D                 Megabat  ======================================================================

                      Human  tc-------------ttgttttc
                      Chimp  tc-------------ttgttttc
                    Gorilla  tc-------------ttgttttc
                  Orangutan  cc-------------ttgttttc
                     Gibbon  cc-------------ttgttttc
                     Rhesus  cc-------------ttgttttt
        Crab-eating macaque  cc-------------ttgttttt
                     Baboon  cc-------------ttgttttt
               Green monkey  cc-------------ttgttttt
                   Marmoset  cc-------------ttgtcttc
            Squirrel monkey  cc-------------ttgtcgtc
                   Bushbaby  cg-------------tc-tcctg
         Chinese tree shrew  ct-------------c--ttccg
                   Squirrel  ---------------gtccccca
             Naked mole-rat  ct-------------gtccccaa
                 Guinea pig  cc-------------accaccca
                 Chinchilla  ct-------------acctccca
           Brush-tailed rat  ct-------------atctccca
                        Pig  ct-------------ctctgc--
                     Alpaca  ct-------------gtttcc--
             Bactrian camel  ct-------------gtttcc--
                    Dolphin  cc-------------acctcc--
               Killer whale  cc-------------acctcc--
           Tibetan antelope  acctgctccagtattccttcc--
                        Cow  acctgctccagtattccttcc--
                      Sheep  ccctgctccagtattccttcc--
              Domestic goat  ccctgctccagtattccttcc--
                      Horse  cc-------------gtctcc--
           White rhinoceros  cc-------------atctcc--
                        Cat  cc-------------gcctcc--
                        Dog  gc-------------ggctcc--
                    Ferret   ca-------------gcctcc--
                      Panda  ca-------------gcctcc--
             Pacific walrus  ca-------------gcctcc--
               Weddell seal  ca-------------gcctcc--
                   Hedgehog  ---------------gtttcc--
                   Elephant  cc-------------acttccca
                    Manatee  cc-------------atttccca
           Cape golden mole  cc-------------atatccca
                   Aardvark  cc-------------atgtccca
                  Armadillo  ct-------------ctctccca
                     Tenrec  =======================
                        Rat  =======================
                      Mouse  =======================
             Golden hamster  =======================
            Chinese hamster  =======================
               Prairie vole  =======================
        Cape elephant shrew  =======================
       David's myotis (bat)  =======================
            Star-nosed mole  =======================
                       Pika  =======================
                     Rabbit  =======================
     Lesser Egyptian jerboa  =======================
              Big brown bat  =======================
           Black flying-fox  =======================
                     Turkey  =======================
               Mallard duck  =======================
                 Budgerigar  =======================
           Peregrine falcon  =======================
                Rock pigeon  =======================
             Painted turtle  =======================
                    Chicken  =======================
                   Platypus  =======================
        Collared flycatcher  =======================
                Zebra finch  =======================
               Saker falcon  =======================
            Green seaturtle  =======================
        Medium ground finch  =======================
         American alligator  =======================
     White-throated sparrow  =======================
         Tibetan ground jay  =======================
                    Megabat  =======================

Inserts between block 28 and 29 in window
B D                    Pig 2bp
B D                 Alpaca 2bp
            Bactrian camel 2bp
B D                Dolphin 2bp
              Killer whale 2bp
          Tibetan antelope 2bp
B D                    Cow 2bp
B D                  Sheep 2bp
             Domestic goat 2bp
B D                  Horse 2bp
B D       White rhinoceros 2bp
B D                    Cat 2bp
B D                    Dog 2bp
B D                Ferret  1bp
B D                  Panda 2bp
            Pacific walrus 2bp
              Weddell seal 2bp
B D               Hedgehog 2bp

Alignment block 29 of 193 in window, 76994093 - 76994110, 18 bps 
B D                   Human  ggagagt---cg---gggacagga
B D                   Chimp  ggagagt---cg---gggacagga
B D                 Gorilla  ggagagt---cg---gggacagga
B D               Orangutan  agagagt---cg---gggacagga
B D                  Gibbon  ggagagt---ca---gggacagga
B D                  Rhesus  ggagggt---cg---ggaacagga
B D     Crab-eating macaque  ggagagt---cg---ggaacagga
B D                  Baboon  ggagagt---cg---ggaacagga
B D            Green monkey  ggagagt---cg---ggaacagga
B D                Marmoset  ggagagt---ca---ggaacagga
B D         Squirrel monkey  ggagagt---ca---ggaacagga
B D                Bushbaby  ggagagt---tg---gaaacagga
         Chinese tree shrew  ggcgagc---tg---ggagcgg--
B D                Squirrel  ggagagc---tg---ggaa-gggg
B D          Naked mole-rat  ggagagt---tg---ggaactgca
B D              Guinea pig  ggtgagt---tg---ggaactgga
                 Chinchilla  ggagagt---tg---gaaactgga
           Brush-tailed rat  ggagcgt---tg---ggacctgga
B D                     Pig  ggaacgc---tg---ggcacaa--
B D                  Alpaca  ggagagc---tg---gaagggg--
             Bactrian camel  ggagagc---tg---gaagggg--
B D                 Dolphin  ggagagc---tg---cacgggg--
               Killer whale  ggagagc---tg---gacgggg--
           Tibetan antelope  ggaaatcccatg---gacagag--
B D                     Cow  ggaaatcccatg---gacagag--
B D                   Sheep  ggaaatcccatg---gacagag--
              Domestic goat  ggaaatcccatg---ggcagag--
B D                   Horse  ggagagt---tggtagggaacgga
B D        White rhinoceros  ggagagt---tggtgggaacggga
B D                     Cat  ggagagc---tg---gaaacagga
B D                     Dog  ggagagc---tg---caaacggga
B D                 Ferret   -gggagc---tg---gaaacgggg
B D                   Panda  ggagagc---tg---gaa-tggga
             Pacific walrus  ggagagc---ta---gaaacggga
               Weddell seal  acagagc---tg---gaagcggga
           Black flying-fox  aaagagc---cg---gagccggc-
B D                 Megabat  aaagagc---cg---gagctggc-
              Big brown bat  ggagagc---tg---ggacagac-
B D                Hedgehog  aaagagc---tg---gaaacaggc
B D                Elephant  ggcggtt---tg---ggaatgggg
B D                 Manatee  ggagggt---gg---ggcatggga
           Cape golden mole  gaagggt---ta---ggaatgggg
                   Aardvark  tgagggt---tg---ggaacagga
B D               Armadillo  ggagtgc---tg---ggagcggga
B D                  Tenrec  ========================
B D                     Rat  ========================
B D                   Mouse  ========================
            Golden hamster  ========================
B D         Chinese hamster  ========================
              Prairie vole  ========================
       Cape elephant shrew  ========================
      David's myotis (bat)  ========================
           Star-nosed mole  ========================
B D                    Pika  ========================
B D                  Rabbit  ========================
    Lesser Egyptian jerboa  ========================
B D                  Turkey  ========================
  D            Mallard duck  ========================
B D              Budgerigar  ========================
  D        Peregrine falcon  ========================
  D             Rock pigeon  ========================
  D          Painted turtle  ========================
B D                 Chicken  ========================
B D                Platypus  ========================
  D     Collared flycatcher  ========================
B D             Zebra finch  ========================
  D            Saker falcon  ========================
  D         Green seaturtle  ========================
B D     Medium ground finch  ========================
B D      American alligator  ========================
  D  White-throated sparrow  ========================
        Tibetan ground jay  ========================

Inserts between block 29 and 30 in window
B D                    Pig 7bp
B D                 Alpaca 9bp
            Bactrian camel 9bp
B D                Dolphin 8bp
              Killer whale 8bp
          Tibetan antelope 109bp
B D                    Cow 112bp
B D                  Sheep 112bp
             Domestic goat 112bp
B D                  Horse 7bp
B D       White rhinoceros 7bp
B D                    Cat 7bp
B D                    Dog 7bp
B D                Ferret  7bp
B D                  Panda 7bp
            Pacific walrus 7bp
              Weddell seal 7bp
             Big brown bat 7bp
B D               Hedgehog 7bp

Alignment block 30 of 193 in window, 76994111 - 76994111, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Marmoset  t
B D         Squirrel monkey  t
B D                Bushbaby  t
B D                Squirrel  t
B D          Naked mole-rat  t
B D              Guinea pig  t
                 Chinchilla  t
           Brush-tailed rat  g
B D                     Pig  t
B D                  Alpaca  g
             Bactrian camel  g
B D                 Dolphin  t
               Killer whale  t
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  c
B D                     Dog  t
B D                 Ferret   t
B D                   Panda  t
             Pacific walrus  t
               Weddell seal  t
              Big brown bat  t
B D                Hedgehog  t
B D                Elephant  t
B D                 Manatee  t
           Cape golden mole  t
                   Aardvark  t
B D               Armadillo  c
B D                  Tenrec  =
B D                     Rat  =
B D                   Mouse  =
            Golden hamster  =
B D         Chinese hamster  =
              Prairie vole  =
       Cape elephant shrew  =
      David's myotis (bat)  =
           Star-nosed mole  =
B D                    Pika  =
B D                  Rabbit  =
    Lesser Egyptian jerboa  =
        Chinese tree shrew  -
          Black flying-fox  -
B D                  Turkey  =
  D            Mallard duck  =
B D              Budgerigar  =
  D        Peregrine falcon  =
  D             Rock pigeon  =
  D          Painted turtle  =
B D                 Chicken  =
B D                Platypus  =
  D     Collared flycatcher  =
B D             Zebra finch  =
  D            Saker falcon  =
  D         Green seaturtle  =
B D     Medium ground finch  =
B D      American alligator  =
  D  White-throated sparrow  =
        Tibetan ground jay  =
B D                 Megabat  -

Inserts between block 30 and 31 in window
B D               Squirrel 7bp
B D         Naked mole-rat 7bp
B D             Guinea pig 7bp
                Chinchilla 7bp
          Brush-tailed rat 7bp

Alignment block 31 of 193 in window, 76994112 - 76994118, 7 bps 
B D                   Human  -------at-------aaac-a
B D                   Chimp  -------ac-------aaac-a
B D                 Gorilla  -------at-------aaac-a
B D               Orangutan  -------at-------aaac-a
B D                  Gibbon  -------at-------aaac-a
B D                  Rhesus  -------at-------aaac-a
B D     Crab-eating macaque  -------at-------aaac-a
B D                  Baboon  -------at-------aaac-a
B D            Green monkey  -------at-------aaac-a
B D                Marmoset  -------at-------aaac-a
B D         Squirrel monkey  -------at-------aaac-a
B D                Bushbaby  -------gtgtcctgcaaac-a
         Chinese tree shrew  ----------------aggc--
B D                Squirrel  -------gg-------aaatg-
B D                     Rat  -------ac-------aaac--
B D          Naked mole-rat  -------gc-------aaac-a
B D              Guinea pig  -------gc-------aaac-a
                 Chinchilla  -------gc-------aa---a
           Brush-tailed rat  -------gc-------aaat-a
B D                     Pig  -------gc-------cagc-a
B D                  Alpaca  -------gc-------aaac-a
             Bactrian camel  -------gc-------aaac-a
B D                 Dolphin  -------gca------aaac-a
               Killer whale  -------gca------aaac-a
           Tibetan antelope  -------gc-------acac-a
B D                     Cow  -------gc-------aaac-a
B D                   Sheep  -------gc-------aaac-a
              Domestic goat  -------gc-------aaac-a
B D                   Horse  -------gc-------aagc-a
B D        White rhinoceros  -------gc-------aagc-a
B D                     Cat  -------gc-------aagc-a
B D                     Dog  -------gc-------aaac-a
B D                 Ferret   -------gc-------aaac-a
B D                   Panda  -------gc-------aaac-g
             Pacific walrus  -------ac-------aaac-a
               Weddell seal  -------gc-------aaac-a
           Black flying-fox  -----------------gac-a
B D                 Megabat  -----------------gac-a
              Big brown bat  -------gc-------aaac-a
B D                Hedgehog  -------gc-------aaac-a
B D                Elephant  gcatcatgt-------aaac-a
B D                 Manatee  gcatcatgc-------aaac-a
           Cape golden mole  atattatgc-------caac-a
                   Aardvark  acattatgc-------aaac-a
B D               Armadillo  gcattgtgg-------aaac-a
B D                  Tenrec  ======================
B D                   Mouse  ======================
            Golden hamster  ======================
B D         Chinese hamster  ======================
              Prairie vole  ======================
       Cape elephant shrew  ======================
      David's myotis (bat)  ======================
           Star-nosed mole  ======================
B D                    Pika  ======================
B D                  Rabbit  ======================
    Lesser Egyptian jerboa  ======================
B D                  Turkey  ======================
  D            Mallard duck  ======================
B D              Budgerigar  ======================
  D        Peregrine falcon  ======================
  D             Rock pigeon  ======================
  D          Painted turtle  ======================
B D                 Chicken  ======================
B D                Platypus  ======================
  D     Collared flycatcher  ======================
B D             Zebra finch  ======================
  D            Saker falcon  ======================
  D         Green seaturtle  ======================
B D     Medium ground finch  ======================
B D      American alligator  ======================
  D  White-throated sparrow  ======================
        Tibetan ground jay  ======================

Alignment block 32 of 193 in window, 76994119 - 76994119, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Marmoset  t
B D         Squirrel monkey  t
B D                Bushbaby  t
B D                Squirrel  t
               Prairie vole  t
B D                   Mouse  t
B D                     Rat  t
B D          Naked mole-rat  t
B D              Guinea pig  c
                 Chinchilla  c
           Brush-tailed rat  t
B D                     Pig  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  t
               Killer whale  t
           Tibetan antelope  c
B D                     Cow  c
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  c
B D        White rhinoceros  c
B D                     Cat  c
B D                     Dog  c
B D                 Ferret   c
B D                   Panda  t
             Pacific walrus  c
               Weddell seal  c
           Black flying-fox  c
B D                 Megabat  c
              Big brown bat  c
B D                Hedgehog  c
B D                Elephant  c
B D                 Manatee  c
                   Aardvark  t
B D               Armadillo  c
B D                  Tenrec  =
            Golden hamster  =
B D         Chinese hamster  =
       Cape elephant shrew  =
      David's myotis (bat)  =
           Star-nosed mole  =
B D                    Pika  =
B D                  Rabbit  =
    Lesser Egyptian jerboa  =
        Chinese tree shrew  -
          Cape golden mole  -
B D                  Turkey  =
  D            Mallard duck  =
B D              Budgerigar  =
  D        Peregrine falcon  =
  D             Rock pigeon  =
  D          Painted turtle  =
B D                 Chicken  =
B D                Platypus  =
  D     Collared flycatcher  =
B D             Zebra finch  =
  D            Saker falcon  =
  D         Green seaturtle  =
B D     Medium ground finch  =
B D      American alligator  =
  D  White-throated sparrow  =
        Tibetan ground jay  =

Alignment block 33 of 193 in window, 76994120 - 76994166, 47 bps 
B D                   Human  atttggaaagaa-gccgga-gcagggga----cattgacgaaccaggg-gc-------------------
B D                   Chimp  atttggaaagaa-gccgga-gcagggga----cattgaggaaccaggg-gc-------------------
B D                 Gorilla  atttggaaagaa-gccgga-gcagggga----cattgacgaaccaggg-gc-------------------
B D               Orangutan  atttggaaagaa-gacgga-gcagggga----cattgacgaaccaggg-gc-------------------
B D                  Gibbon  atttggaaagaa-gccgga-acagggga----cattgatgaaccaggg-gc-------------------
B D                  Rhesus  atttggaaagaa-gccaga-gcagcgga----cattgacgaaccaggg-gc-------------------
B D     Crab-eating macaque  atttggaaagaa-gccaga-gcagcgga----cattgacgaaccaggg-gc-------------------
B D                  Baboon  atttggaaagaa-gccaga-gcagcaga----cattgacgaaccaggg-gc-------------------
B D            Green monkey  atttggaaagaa-gccaga-gcagggga----cattgacgaaccaggg-gc-------------------
B D                Marmoset  atttggaaagaa-gctgga-gcaggggg----cattgatgaaccaggg-gc-------------------
B D         Squirrel monkey  atttgcaaagaa-gctgga-gcaggggg----catggatgaaccaggg-gc-------------------
B D                Bushbaby  atttggaaagaa-gccaga-gcagggg-----cctcaccaaaccgggg-cccca----------------
         Chinese tree shrew  -cttgg---gaa-gtcgga-gcacgggg----cgtcacccgaccaagg--c-------------------
B D                Squirrel  gtttggaaagaa-acccga-gcagggag----cactgccaag-------ac-------------------
     Lesser Egyptian jerboa  atcaggcaagga-gcc-ga-gca--ttg----ccaaagaagg-------gg-------------------
               Prairie vole  atttcgagagga-gactga-gca--ggg----ccttggaggg-------gg-------------------
B D                   Mouse  atttggagagga-gtctga-aca--tag----cgcagcaggg-------gc-------------------
B D                     Rat  atttggagagaa-gcctga-gca--cag----cgcagcaggg-------gc-------------------
B D          Naked mole-rat  acttggaaagaa-gccag-----------------tgcccag-------gc-------------------
B D              Guinea pig  attc----------ctagg-ccaggaaa----taacaccaaa-------gc-------------------
                 Chinchilla  atttggaaagaa-gccgga-tcaggaag----taatgccaaaacccag-gc-------------------
           Brush-tailed rat  atctggaaagaa-gccaga-tgaggaag----caaccccaaagtcggg-gc-------------------
B D                     Pig  atttggaaagaagcagggc-gcag-gaa----tgtcacc-atccaggg-ctg------------------
B D                  Alpaca  atttggaaagaa-gcggga-gcag-cag----tgctgcc-aaccagggccc-------------------
             Bactrian camel  atttggaaagaa-ccggga-gcag-gag----tgctgcc-aaccaggg-cc-------------------
B D                 Dolphin  attaggaaagaa-ctggga-gcgg-aga----catcgcc-atccaggg-cc-------------------
               Killer whale  attaggaaagaa-ctggga-gcgg-aga----catcgcc-atccaggg-cc-------------------
           Tibetan antelope  atttggaaagaa-ccggaa-gcag-aaa----tgtcacc-atccgggg-cc-------------------
B D                     Cow  atttggaaagaa-ctagaa-gcag-aaa----tgttacc-atccgggg-cc-------------------
B D                   Sheep  atttggaaagaa-ccggaa-gcag-aaa----tgtcacc-atccaggg-cc-------------------
              Domestic goat  atttggaaagaa-ccggaa-gcag-aaa----tgtcacc-atccaggg-cc-------------------
B D                   Horse  atttggaaagaa-ctgagc-ccca---------------------gga-acatcaccaaacca-gggc--
B D        White rhinoceros  atttggaaagaa-ctgggt-gcag---------------------gga-acatcgccaatccaggggc--
B D                     Cat  atttggaaagaa-ccggga-gccg---------------------gga-acagcaccaatctg-ggaccc
B D                     Dog  atttggagagaa-ctagga-gcag---------------------gga-a--------------------
B D                 Ferret   gtctgcagagaa-ccggga-gcag---------------------gga-a--------------------
B D                   Panda  gtctagagagaa-ctgcga-gcag---------------------gga-g--------------------
             Pacific walrus  gtctggagacac-ctggga-gcag---------------------gga-a--------------------
               Weddell seal  gtctggagagac-ctggga-gcag---------------------ggg-a--------------------
           Black flying-fox  ctcc----aaac-c----a-gctg-------------------------tc-------------------
B D                 Megabat  ctcc----aaac-c----a-gctg-------------------------cc-------------------
              Big brown bat  gtttggaaagac-ccagga-gctg---------------------gga-gc-------------------
B D                Hedgehog  agtcagaaaaaa-ctgagaggcag-gaaacagagccaaa-gcgggggg-gc-------------------
B D                Elephant  atttgggaagaa-ccagcaagtggggaa----cttcaccaaaccaggg-gc-------------------
B D                 Manatee  atttggaaggaa-ccaggaagcggagaa----cttcaccaaatgaggg-ga-------------------
           Cape golden mole  --tcagaaagaa-tcagaacatggggga----cttggccagaccaggg-at-------------------
                   Aardvark  atttggaaagaa-ccaggaagcggggag----ctttg-caaaccacgg-ag-------------------
B D               Armadillo  atttggaaagaa-ccggga-gcggggaa----cgtggtcacacc--------------------------
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                  Turkey  ======================================================================
  D            Mallard duck  ======================================================================
B D              Budgerigar  ======================================================================
  D        Peregrine falcon  ======================================================================
  D             Rock pigeon  ======================================================================
  D          Painted turtle  ======================================================================
B D                 Chicken  ======================================================================
B D                Platypus  ======================================================================
  D     Collared flycatcher  ======================================================================
B D             Zebra finch  ======================================================================
  D            Saker falcon  ======================================================================
  D         Green seaturtle  ======================================================================
B D     Medium ground finch  ======================================================================
B D      American alligator  ======================================================================
  D  White-throated sparrow  ======================================================================
        Tibetan ground jay  ======================================================================

                      Human  -ctc-
                      Chimp  -ctc-
                    Gorilla  -ctc-
                  Orangutan  -ctc-
                     Gibbon  -ctt-
                     Rhesus  -ctt-
        Crab-eating macaque  -ctt-
                     Baboon  -ctc-
               Green monkey  -ctc-
                   Marmoset  -ctc-
            Squirrel monkey  -ctc-
                   Bushbaby  -ccc-
         Chinese tree shrew  -ctc-
                   Squirrel  -ccc-
     Lesser Egyptian jerboa  -tcc-
               Prairie vole  -at--
                      Mouse  -tgg-
                        Rat  -cgg-
             Naked mole-rat  -tcc-
                 Guinea pig  -ctc-
                 Chinchilla  -ccc-
           Brush-tailed rat  -ccc-
                        Pig  -ccc-
                     Alpaca  -ccc-
             Bactrian camel  -ccc-
                    Dolphin  -ccc-
               Killer whale  -ccc-
           Tibetan antelope  -ccc-
                        Cow  -ccc-
                      Sheep  -ccc-
              Domestic goat  -ccc-
                      Horse  -ccc-
           White rhinoceros  -ctc-
                        Cat  cccc-
                        Dog  -ccc-
                    Ferret   -ccc-
                      Panda  -ccc-
             Pacific walrus  -ccc-
               Weddell seal  -ccc-
           Black flying-fox  -ccc-
                    Megabat  -ccc-
              Big brown bat  -atc-
                   Hedgehog  -ccc-
                   Elephant  -ccct
                    Manatee  -cctt
           Cape golden mole  -ccct
                   Aardvark  -ccct
                  Armadillo  -----
                     Tenrec  =====
             Golden hamster  =====
            Chinese hamster  =====
        Cape elephant shrew  =====
       David's myotis (bat)  =====
            Star-nosed mole  =====
                       Pika  =====
                     Rabbit  =====
                     Turkey  =====
               Mallard duck  =====
                 Budgerigar  =====
           Peregrine falcon  =====
                Rock pigeon  =====
             Painted turtle  =====
                    Chicken  =====
                   Platypus  =====
        Collared flycatcher  =====
                Zebra finch  =====
               Saker falcon  =====
            Green seaturtle  =====
        Medium ground finch  =====
         American alligator  =====
     White-throated sparrow  =====
         Tibetan ground jay  =====

Inserts between block 33 and 34 in window
B D               Squirrel 3bp
    Lesser Egyptian jerboa 2bp
B D                  Mouse 6bp
B D                    Rat 6bp
B D         Naked mole-rat 1bp
B D             Guinea pig 1bp
                Chinchilla 1bp
          Brush-tailed rat 1bp

Alignment block 34 of 193 in window, 76994167 - 76994250, 84 bps 
B D                   Human  ggaggttct---------g---g--------------ataatt-ctctta-ttctggt-ccagtgc-tga
B D                   Chimp  ggaggttct---------g---g--------------ataatt-ctctta-ttctggt-ccagcgc-tga
B D                 Gorilla  ggaggttct---------g---g--------------ataatt-ctctta-ttctggt-ccagtgc-tga
B D               Orangutan  ggaggttct---------g---g--------------ataatt-ctctta-ttctggt-ccagtgc-tga
B D                  Gibbon  ggaggttct---------g---g--------------ataatt-ctctta-ttctggt-ccagtgc-tga
B D                  Rhesus  ggaggttct---------g---g--------------ataatt-ctctta-tcctggt-ccagtgc-tga
B D     Crab-eating macaque  ggaggttct---------g---g--------------ataatt-ctctta-tcctggt-ccagtgc-tga
B D                  Baboon  ggaggttct---------g---g--------------ataatt-ctctta-tcctggt-ccagtgc-tga
B D            Green monkey  ggaggttct---------g---g--------------ataatt-ctctta-tcctggt-ccagtgc-tga
B D                Marmoset  agaggttct---------g---a--------------gtaatt-ttctta-ttatggt-ccagcac-tga
B D         Squirrel monkey  agaggttct---------g---a--------------gtgatt-ctctta-ttatggt-cccgtgc-tga
B D                Bushbaby  ggaggtctt---------g---g--------------gcgatt-gtctta-ttc-----------c-tga
         Chinese tree shrew  cgaggtctc---------c---g--------------cggatt-ttct-----ctgag-ccggcac-tga
B D                Squirrel  ------cca---------gctcg--------------gcagcc-ttcctg-tcccgtg-cccacac-tgg
     Lesser Egyptian jerboa  agggctctc---------g---g--------------gaaatt-ttctta-ttttgca--gtgtac-tga
               Prairie vole  -agggtctg---------g---g--------------t---aa-cactta-ttctgca-tttgcac-tga
             Golden hamster  gagggtctg---------g---g--------------gtaaga-ctctta-ctctgca-tttccac----
B D                   Mouse  gggtgtcta---------a---g--------------gtaa-------ta-ttctgca-tttgcac-tga
B D                     Rat  gggtgtctg---------a---g--------------gtaa-------ta-ttctgcgttttgtac-tga
B D          Naked mole-rat  agaagtctc---------a---g--------------gcgatt-ttccag-tcctcca-tttgcgc-tga
B D              Guinea pig  agaagtctt---------g---g--------------gcaatt-tttctgattctgca-tt--------g
                 Chinchilla  agaagtctt---------t---g--------------gcaatt-attctgattctgca-tttgcac-tga
           Brush-tailed rat  ggaagtctc---------g---g--------------gcaatg-ttcctgatgctgca-tttgcct-tga
B D                     Pig  agggcgggg---------g---g--------------gcagtt-ttctgg-tcccgag-tttgaag-tga
B D                  Alpaca  cgaggcctc---------g---g--------------gcggtc-ttctta-ccctgtg-tttgcat-gga
             Bactrian camel  tgaggcctg---------g---g--------------gagatc-ttctta-ccctgtg-tttgcat-gga
B D                 Dolphin  agacatctc---------a---g--------------gcaatt-ttctta-tcctgcg-cttgcgc-taa
               Killer whale  agacatctt---------a---g--------------gcaatt-ttctta-tcctgcg-cttgcgc-taa
           Tibetan antelope  agaggtctt---------g---g--------------gcaatttttctta-tcctgcc-cttgatc-caa
B D                     Cow  agaggtctt---------g---g--------------gcaattgttctta-tcctgcc-cttgatc-caa
B D                   Sheep  agaggtctt---------g---g--------------gcaatttttctta-tcctgcc-cttgatc-caa
              Domestic goat  agaggtctt---------g---g--------------gcaatttttctca-tcctgcc-cttgatc-caa
B D                   Horse  agagatctt---------g---g--------------gcaatt-ttctca-tcctgag-cttgcac-gga
B D        White rhinoceros  agagatctt---------g---g--------------gcagtt-ttcttt-ccctgag-cttgcac-tgt
B D                     Cat  agaggtctt---------g---g--------------gcgatt-ttctca-tcctgcg-cctgcgc-cgg
B D                     Dog  acaggtccccagaggtcgg---g--------------gcaatt-ttctta-cctcgcg-ctggcac-cga
B D                 Ferret   aaaggtcct---------g---g--------------gtaatt-ttct--------------gcac-agt
B D                   Panda  agaggtcct---------g---g--------------gcaact-gccc--------------gcac-tga
             Pacific walrus  agaggtcct---------g---g--------------gcaatt-ttct--------------gcac-tgt
               Weddell seal  agaggtcct---------g---g--------------gcaatt-ttct--------------gcac-tgt
           Black flying-fox  acaggcctc---------g---g--------------gcagtt-tcctta-ccctgca-ctggcac-cta
B D                 Megabat  acaggcctc---------g---g--------------gcagtt-tcctta-ccctgca-ctggcac-cta
              Big brown bat  accggccgc---------g---gccc-----------ccgatt-ttctca-tcctgca-c-agcac-tca
B D                Hedgehog  acaggtctg---------g---a--------------gccatt-ttctta-ctctgtc-tacacaagtga
B D                Elephant  ggaggtctt---------g---g--------------gtagtt-tttta-------------acac-tga
B D                 Manatee  ggaggtctt---------g---gcagttttgttttgttttgtt-ttttct-ggg------ttgcgc-tga
           Cape golden mole  ggaggtctc---------a---g--------------gcagtt-ttcttt-tctc----ctggcat-tga
                   Aardvark  ggaggtctt---------g---g--------------gcagtt-ttcttt-ctctga--gttgcac-tga
B D               Armadillo  --aggtttg---------g---g--------------gcaggt-gcctag-accgcg--ctggcac-tga
B D                  Tenrec  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                  Turkey  ======================================================================
  D            Mallard duck  ======================================================================
B D              Budgerigar  ======================================================================
  D        Peregrine falcon  ======================================================================
  D             Rock pigeon  ======================================================================
  D          Painted turtle  ======================================================================
B D                 Chicken  ======================================================================
B D                Platypus  ======================================================================
  D     Collared flycatcher  ======================================================================
B D             Zebra finch  ======================================================================
  D            Saker falcon  ======================================================================
  D         Green seaturtle  ======================================================================
B D     Medium ground finch  ======================================================================
B D      American alligator  ======================================================================
  D  White-throated sparrow  ======================================================================
        Tibetan ground jay  ======================================================================

                      Human  ccacacaggtttatt-tttcccttgctc--agagat---gat----------gggaggag
                      Chimp  ccacacaggtttatt-tttcccttgctc--agagat---gat----------gggaggag
                    Gorilla  ccacacaggtttatt-tttcccttgctc--agagat---gat----------gggaggag
                  Orangutan  ccacacaggtttatt-tctcccttgctc--agagat---gat----------ggctggag
                     Gibbon  ccacacaggtttatt-tctcccttgctc--agagat---gat----------gggaggag
                     Rhesus  ccacgtaggtttatt-tctcccttgctc--agagat---gat----------gggaggag
        Crab-eating macaque  ccacgtaggtttatt-tctcccttgctc--agagat---gat----------gggaggag
                     Baboon  ccacgtaggtttatg-tctcccttgctc--agagat---gat----------gggaggag
               Green monkey  cctcgtagg-ttatg-tctcccttgctc--agagat---gag----------gggaggag
                   Marmoset  ccaccca-gtccatt-tctcccttgctc--agagat---gac----------gggaggag
            Squirrel monkey  ccacgca-gtccatt-tcgcccttgctc--agagat---gac----------aggaggag
                   Bushbaby  gcacacagattcagt-tctctcactct---ggagat---gat----------ggcaggag
         Chinese tree shrew  ccacaggagctcact-tctccctcctgt--ggagag---gaa----------gggcgggg
                   Squirrel  acgcacgggtcctct--gtcctccactc--ggagat---gaccacagggcggag------
     Lesser Egyptian jerboa  ccacacaggtgctct-gctctcccattt--agatgtttggag----------ag------
               Prairie vole  ctacagaagctctct-cgtcttccattt--aaatgt---ga-------------------
             Golden hamster  ------acgctcttt-catcctccattt--a-----------------------------
                      Mouse  ccacataaactcact-cagcctcccttt--aaatgt---gac----------ag------
                        Rat  ccacataagctccct-cagcctccgttt--aaatgt---gac----------ag------
             Naked mole-rat  ccacatgggttcttt-cctcttccactcagagagac---ggg----------aggaa---
                 Guinea pig  ctacctgggttcttt-tctctcccactc--agaaac---ggg----------aaaaa---
                 Chinchilla  ccacatgggttcttt-cctctcccactc--agagat---ggg----------aggaa---
           Brush-tailed rat  tcacgt-ggtgcttt-cctctcccactc--agagat---agg----------aggga---
                        Pig  ccaggtgggttcatt-tctccctccccc--agccat---gac----------ggag-gag
                     Alpaca  ccacgtgggttcatt-tctccctcactc--ggagat---ggg----------ggtg---a
             Bactrian camel  ccacgtgggttcatt-cctccctcaccc--agagat---ggg----------gggg-gta
                    Dolphin  ccctgtgggtccact-tct------ccc--aa----------------------------
               Killer whale  ccctgtgggtccact-tct------ccc--aa----------------------------
           Tibetan antelope  ccttgtgggttcatt-tctctctcaccc--agagat---gat----------gggg-gag
                        Cow  ccttgtgggttcatt-tctctctcaccc--agagat---gac----------ggga-gag
                      Sheep  ccttgtgggttcatt-tctctctcaccc--agagat---gat----------ggg-----
              Domestic goat  ccttgtgggttcatt-tctctctcaccc--agagat---gat----------ggg-----
                      Horse  ccaaacaggcttatc-tctccctgaccc--ggagat---------------------gac
           White rhinoceros  ccacacaggcttatt-cctccctcaccc--ggagat---aat----------tggaggag
                        Cat  ccgggcatccatgtg-tccccctcacct--ggaaat---ggc----------gggaggag
                        Dog  ctgggccc-cccatg-gccccatcaccg--ggacag---ggc----------gggagggg
                    Ferret   ctgcgtgcgcccatc-tccccctcaccc--ggaaac---agg----------gggccgag
                      Panda  ctgcgca--cccatg-cccccctcaccc--ggaaat---ggt----------gggaggag
             Pacific walrus  ctgcacacgcccatc-tccccctcaccc--cgaaat---ggt----------gggagggg
               Weddell seal  ctgcacacgcccatc-tccccctcaccc--tgaaat---ggt----------gggagggg
           Black flying-fox  ccccacgggctcatt-tctgcctcact---ggggat---gat----------gggaggaa
                    Megabat  ccccacgggctcatt-tctgcctcacc---ggggat---gat----------gggaggag
              Big brown bat  ccgccccggtctgct-tctgcccacac---ggagct---gat----------gggggg--
                   Hedgehog  ccacacaagttcattgcctcccccatcc--acacac---act----------tttg-cag
                   Elephant  tcaccaagg--------ctttctccctc--cgagat---gat----------gggaagag
                    Manatee  ccaccagggtcactt-tctccctccctc--cgagac---gat----------ggggagag
           Cape golden mole  cccccagag--cctc-tctccctccctc--agagat---gat----------gggaggag
                   Aardvark  ccaccaaggctcctt-tctccctccctc--tgacat---gtt----------gggaagag
                  Armadillo  ccacagagg-gccgt-ttcccctccctc--tgggat---gac----------tgcaagag
                     Tenrec  ============================================================
            Chinese hamster  ============================================================
        Cape elephant shrew  ============================================================
       David's myotis (bat)  ============================================================
            Star-nosed mole  ============================================================
                       Pika  ============================================================
                     Rabbit  ============================================================
                     Turkey  ============================================================
               Mallard duck  ============================================================
                 Budgerigar  ============================================================
           Peregrine falcon  ============================================================
                Rock pigeon  ============================================================
             Painted turtle  ============================================================
                    Chicken  ============================================================
                   Platypus  ============================================================
        Collared flycatcher  ============================================================
                Zebra finch  ============================================================
               Saker falcon  ============================================================
            Green seaturtle  ============================================================
        Medium ground finch  ============================================================
         American alligator  ============================================================
     White-throated sparrow  ============================================================
         Tibetan ground jay  ============================================================

Inserts between block 34 and 35 in window
    Lesser Egyptian jerboa 3bp

Alignment block 35 of 193 in window, 76994251 - 76994373, 123 bps 
B D                   Human  aatcagagaaacaatgg-------tcatgcc--gacctcaggcttcc-----------------------
B D                   Chimp  aatcggagaaacgatgg-------tcatgcc--gacctcaggcttcc-----------------------
B D                 Gorilla  aatcggagaaacaatgg-------tcatgcc--gacctcaggcttcc-----------------------
B D               Orangutan  aatcggagaaacaatgg-------tcatgcc--gacctcaggcttcc-----------------------
B D                  Gibbon  aatcggagaaacaatgg-------tcatgcc--gacctcaggcttcc-----------------------
B D                  Rhesus  aatcagagaaacaatgg-------tcatgct--gacctcaggcttcc-----------------------
B D     Crab-eating macaque  aatcagagaaacaatgg-------tcatgct--gacctcaggcttcc-----------------------
B D                  Baboon  aatcggagaaacaatgg-------tcatgct--gacctcaggcttcc-----------------------
B D            Green monkey  aaccggagaaacaatgg-------tcatgct--gacctcaggcttcc-----------------------
B D                Marmoset  aatcagagaaacaatgg-------gcatgcc--aacctcaggcttcc-----------------------
B D         Squirrel monkey  aatcagagaaacaatgg-------tcatgcc--aacctcaggctgcc-----------------------
B D                Bushbaby  aattcaagaacc-acgg-------tcacgcc--aacctcagacttcc-----------------------
         Chinese tree shrew  aatgggagagac-------------catccc--gacctcaggcttcc-----------------------
B D                Squirrel  agtgggagagacaatgg-------tcattcc--aaccccagacttcc-----------------------
     Lesser Egyptian jerboa  aacatgtg--ctaatgg-------tcattgcaaaacttcacacttcc-----------------------
               Prairie vole  --------agacaatgg-------ttactgc--agcctcggacttcc-----------------------
B D         Chinese hamster  aatgggagagacaatgg-------tcattgc--aacctcagacttcc-----------------------
             Golden hamster  aacgggacagacaatgg-------tcattgc--aacctcagacttcc-----------------------
B D                   Mouse  ----------ataatgg-------tcactgt--aatctcaggcttcc-----------------------
B D                     Rat  ----------ataatgg-------tcactgt--gatctcaggcttcc-----------------------
B D          Naked mole-rat  aatgtgagagacaatgg-------tcattcc--aaccccaggcttcc-----------------------
B D              Guinea pig  aatatgagagacaatga-------tcatgcc--agcctcaggctccc-----------------------
                 Chinchilla  aatgtgagagacaatgg-------tcattcc--aacctcaggcttct-----------------------
           Brush-tailed rat  aacgtgagagacaatgg-------ccatccc--aaccccaggcttcc-----------------------
B D                     Pig  tctgccagagacagtga-------tgggttc--agcctcaggcttcc-----------------------
B D                  Alpaca  gtt-tgagagacaatgg-------tcatttc--aacctcaggcttcc-----------------------
             Bactrian camel  gtt-tgagagacaatgg-------tcatttc--aacctcaggcttcc-----------------------
B D                 Dolphin  ------tgagacaatgg-------tcatttc--aagctcagacttcc-----------------------
               Killer whale  ------tgagacaatgg-------tcatttc--aagctcagacttcc-----------------------
           Tibetan antelope  aac-tcggagacaatgg-------ccgtttc--aacttaaggcttcctttttctttttttttcaacttaa
B D                     Cow  aac-tcggagacaatgg-------ccatttc--aacttaaggcttcc-----------------------
B D                   Sheep  ------ggagacaatgg-------ccgtttc--aacttaaggcttcc-----ttttttttttcaacttaa
              Domestic goat  ------ggagccaatgg-------ccgtttc--aacttaaggcttcc---ttttttttttttcaacttaa
B D                   Horse  actgcgagagacaatgg-------tcatttc--agcctcaggcttcc-----------------------
B D        White rhinoceros  aatgtaagagacaatgg-------tcatttc--aacctcaggcttcc-----------------------
B D                     Cat  actgggagagacaatgg-------tcatttg--agcctcagtcttcc-----------------------
B D                     Dog  aatgggagagaccttgg-------tcatttc--aacctgggacttcc-----------------------
B D                 Ferret   aacgggagagaccacgg-------tcattcc--aaccggagacttcc-----------------------
B D                   Panda  aatgggagagaccgtgg-------tcatttg--aacctgagactggc-----------------------
             Pacific walrus  aatgcgagagaccatgg-------tcatttc--aacctgagacttcc-----------------------
               Weddell seal  aatgcgagaggccatgg-------tcatttc--aacctgagacttcc-----------------------
           Black flying-fox  aatgggagacactgcgg-------tcatttg--aaccccaagcttcc-----------------------
B D                 Megabat  aatgggagacaccgcgg-------tcatttg--aaccccaggcttcc-----------------------
              Big brown bat  aatgcgaggccctgtgg-------tcatttc--agcctcagacttcc-----------------------
B D                Hedgehog  aatgccaaagacaatgg-------tcatttc--aaccccaggtttcc-----------------------
B D                Elephant  gattagagagacaatag-------tcattct--atcctcaggcttcc-----------------------
B D                 Manatee  aattcaggagacaatag-------tcattct--atcgtcaggcttcc-----------------------
           Cape golden mole  aattaagg-gacagtgg-------tctctc----------------------------------------
                   Aardvark  aaatttagagacaatagaatttgagaattct--gttgccaggcttcc-----------------------
B D               Armadillo  agcacgagagaca-cag-------gggtgcc--atcctcc-gcttcc-----------------------
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                  Turkey  ======================================================================
  D            Mallard duck  ======================================================================
B D              Budgerigar  ======================================================================
  D        Peregrine falcon  ======================================================================
  D             Rock pigeon  ======================================================================
  D          Painted turtle  ======================================================================
B D                 Chicken  ======================================================================
B D                Platypus  ======================================================================
  D     Collared flycatcher  ======================================================================
B D             Zebra finch  ======================================================================
  D            Saker falcon  ======================================================================
  D         Green seaturtle  ======================================================================
B D     Medium ground finch  ======================================================================
B D      American alligator  ======================================================================
  D  White-throated sparrow  ======================================================================
        Tibetan ground jay  ======================================================================

                      Human  -------tgt-gag----------------ggtcag-gacatcca----tc-attgttcctctacaaatt
                      Chimp  -------tgt-gag----------------ggtcaa-gacatcca----tc-attgttcctctacaaatt
                    Gorilla  -------tgt-gag----------------ggtcag-gacatcca----tc-attgttcctctacaaatt
                  Orangutan  -------tgt-gag----------------ggtcag-gacatcca----tc-attgttcctctacaaatt
                     Gibbon  -------tgt-gag----------------ggtcag-gacatcca----tc-attgttcctctacaaatt
                     Rhesus  -------tgt-gag----------------ggtcag-gacatcca----tc-attgttcccctacaaact
        Crab-eating macaque  -------tgt-gag----------------ggtcag-gacatcca----tc-attgttcccctacaaatt
                     Baboon  -------tgt-gag----------------ggtcag-gacatcca----tc-attgttcccctacaaatt
               Green monkey  -------tgt-gag----------------ggtcag-gacatcca----tc-attgttcccctacaaatt
                   Marmoset  -------tgt-gag----------------ggtcag-gacatcca----tc-attgttcttctacaaatt
            Squirrel monkey  -------tgt-gag----------------ggtcag-gacatcca----tc-attgttctactacaaatt
                   Bushbaby  -------tgtagag----------------ggtcaa-gacatccg----tc-attgttcctccacagatt
         Chinese tree shrew  -------tgcccag----------------ggccaa-cacacccacctgtc-agttttcctatacagatg
                   Squirrel  -------ggc-cga----------------gggtcgggacatccc----tc-attgttcctgtacaaatt
     Lesser Egyptian jerboa  -------tgc-tggatggga----------tgtcaatgacaccaa----tc-attgttcctgtaaaaatt
               Prairie vole  -------tgcaggg----------------ggtcaatgacattca----tc-attgttcttgtacagatt
            Chinese hamster  -------tac-tgg----------------ggtcaacgacatcca----tc-attgttcttgtacaaatt
             Golden hamster  -------tgc-tgg----------------ggtcaaggacaccca----tc-attgttcttgtacaaatt
                      Mouse  -------tgc-tggg---------------ggtcagtgacatcct----tc-attgttcttgtacaaatt
                        Rat  -------tgc-tggggggggggggggaggaggtcagtgacatcct----tc-attgttcttgtacaaatt
             Naked mole-rat  -------tgc-cgag---------------ggtcagtgacatcca----tc-attgttcctgtacaaatt
                 Guinea pig  -------tgc-cgag---------------ggtcagtgacatcca----tc-attgttcctgcacaaatt
                 Chinchilla  -------tgc-cgag---------------ggtcagtgacatcca----tcaattgttcctgcacaaatt
           Brush-tailed rat  -------tgc-tgag---------------ggtcggtgacatcca----tc-attgttcctgtacaaatg
                        Pig  -------tgc-cgag---------------ggtcagagactttc-----tc-attgttcctctacaaatt
                     Alpaca  -------tgc-agag---------------ggtcagcgacttca-----tc-attgttcctctgcaaatt
             Bactrian camel  -------tgc-agag---------------ggtcagcgacttca-----tc-attgttcctctgcaaatt
                    Dolphin  -------tgc-tgag---------------ggtcagcgacttcc-----tc-atggttcctctgcagatt
               Killer whale  -------tgc-tgag---------------ggtcagcgacttcc-----tc-atggttcctctgaagatt
           Tibetan antelope  ggcctcctgc-tgag---------------ggtcagagacttcc-----tc-attgttcctctgcaaatt
                        Cow  -------tgc-tgag---------------ggtcagcgacttcc-----tc-attgttcctctgcaaatt
                      Sheep  ggtttcctgc-tgag---------------ggtcagagacttcc-----tc-attgttcctctgcaaatt
              Domestic goat  ggtttcctgc-tgag---------------ggtcagagacttcc-----tc-attgttcctctgcaaatt
                      Horse  -------cgc-cgag---------------ggtcag-gacagccg----tc-attgttcctccacaaatt
           White rhinoceros  -------tgc-tgag---------------ggtcagcgacatccg----tc-attgttcctctataaatt
                        Cat  -------tgc-tgag---------------gaccagcgacgtcca----tc-attgttcc-ctacaaatt
                        Dog  -------tgc-cgcg---------------ggtcagcgacctcca----cc-atccttcc-ctataaatt
                    Ferret   -------tgc-cgag---------------ggtcagcgacatcca----cc-atccttcc-ctacagatt
                      Panda  -------tgc-cga----------------tgtcagccccatcca----tc-atccttcc-ctacaaatt
             Pacific walrus  -------tgc-cgag---------------ggtcagtgatgtcca----cc-atccttcc-ctacaaatt
               Weddell seal  -------tgc-caag---------------ggtcagcgacgtcca----cc-atccttcc-cta-aaatt
           Black flying-fox  -------tgc-cgag---------------ggtcagccacatcca----tc-attgttccgctacgaatt
                    Megabat  -------tgc-cgag---------------ggtcagccacatcca----tc-attgttccgctacaaatt
              Big brown bat  -------tgc-cgag---------------ggttggcggcatcca----tc-atggttcctctccaaatt
                   Hedgehog  -------tgc-cgag---------------ggtc-gtgacacaca----tc-attgttcttcaacaaatt
                   Elephant  -------tgc-tgag---------------ggtcaccgacaccca----cc-attgttcctctacaaatt
                    Manatee  -------tgc-agag---------------ggtcaccaacaccca----cc-gctgttcctctacaaatt
           Cape golden mole  -------------------------------actactgacaccca----gc-attgttgctttgcaaatt
                   Aardvark  -------tac-agag---------------ggtcacctacacccg----cc-attgttcctctacaaatt
                  Armadillo  -------tgc-ccgg---------------ggtcaaaggcatcca----tc-actgctcttctacaaatt
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
       David's myotis (bat)  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                     Turkey  ======================================================================
               Mallard duck  ======================================================================
                 Budgerigar  ======================================================================
           Peregrine falcon  ======================================================================
                Rock pigeon  ======================================================================
             Painted turtle  ======================================================================
                    Chicken  ======================================================================
                   Platypus  ======================================================================
        Collared flycatcher  ======================================================================
                Zebra finch  ======================================================================
               Saker falcon  ======================================================================
            Green seaturtle  ======================================================================
        Medium ground finch  ======================================================================
         American alligator  ======================================================================
     White-throated sparrow  ======================================================================
         Tibetan ground jay  ======================================================================

                      Human  aataga-ctggccca-tccc----tgg-ttgctacggcaac---tg----------cc-cc-c-a-----
                      Chimp  aataga-ctggccca-tccc----tgg-ttgctatggcaac---tg----------cc-cc-cca-----
                    Gorilla  aataga-ctggccca-t-cc----tgg-ttgctatggcaac---tg----------cc-cc-c-a-----
                  Orangutan  aataga-ctggccca-tccc----tgg-ttgctatggcaac---tg----------cc-cc-c-a-----
                     Gibbon  aataga-ctggccca-tccc----tgg-ttgctatggcaac---tg----------cc-cc-c-a-----
                     Rhesus  aacaga-ctggccca-tccc----tgg-ttgctatggcaac---tg----------cc-cc-c-a-----
        Crab-eating macaque  aacaga-ctggccca-tccc----tgg-ttgctatggcaac---tg----------cc-cc-c-a-----
                     Baboon  aacaga-ctggccca-tccc----tgg-ttgctatggcaac---tg----------cc-cc-c-c-----
               Green monkey  aacaga-ctggccca-tccc----tgg-ttgctatggcaac---tgcccccccccccc-cc-c-c-----
                   Marmoset  aataga-ctggccca-tccc----tgg-ttgctatgccaac---ct----------cc-cc-c-a-----
            Squirrel monkey  aataga-ctggccca-tccc----tgg-ttgctatggcaac---ca----------cc-cc-c-a-----
                   Bushbaby  aataga-gtgtccca-ttcc----cgg-tctctatgacaac---tg----------cc-cc-c-g-----
         Chinese tree shrew  aatag---tggctca-cccctggttgg-ttgttatgacgac---ca----------cc-cc-cca-----
                   Squirrel  aatagt-gtgaccca-cccc----tgg-tcgccatggcaac---cg----------cc-cc-c-a-----
     Lesser Egyptian jerboa  aatgacagtagccca-tccc----tgg-tagctatgacaac---cg----------ct-tc-c-t-----
               Prairie vole  aatagc-gtgggcca-tccc----tgg-tcgctatgacaac---gg----------cc-ctcc-c-----
            Chinese hamster  aatagt-gtggccca-cccc----tgg-ttgctatgacaac---gg----------tc-ct-c-c-----
             Golden hamster  aatagc-gtggccca-cccc----tgg-ttgctatgacaac---gg----------cc-ct-c-c-----
                      Mouse  aatagt-gtggccca-tccc----tgg-tcactatgacaac---gg----------cc-ct-c-c-----
                        Rat  aatagt-gtggccca-cctc----tgg-tcactatgacaac---ag----------tc-ct-c-c-----
             Naked mole-rat  agtaga-gtgtccca-tccc----tgg-tcactatggcaac---cg----------cc-cc-c-a-----
                 Guinea pig  aatgga-gtggccca-cccc----tgg-tcactatagcaac---tg----------cc-cc-c-a-----
                 Chinchilla  aataga-gtggccca-tccc----tgg-tcactatggcaac---ca----------cc-cc-c-a-----
           Brush-tailed rat  aacgga-atggccca-tccc----tgg-tcactatgacaac---ca----------cc-cc-c-a-----
                        Pig  aatgga-gtggcc----ccc----cca-tcactatggcaac---c-----------cc-cc-c-t-----
                     Alpaca  a--aga-gtggccca--ccc----tgg-tcactatagcaac---ca----------cc-cc-t-c-----
             Bactrian camel  aataga-gtggccca--ccc----tgg-tcactatagcaac---cg----------cc-cc-t-c-----
                    Dolphin  aataga-gtggccca--ccc----ccagtcactatagcaac---cg----------cc-ct-c-cccc--
               Killer whale  aataga-gtggccca--ccc----ccagtcactatagcaac---cg----------cc-ct-c-cccc--
           Tibetan antelope  aagagg-gtggccca--ccc----cca-tcactatagcaac---cg----------cc-tc-c-c-----
                        Cow  aagagg-gtggccca--ccc----cca-ttactatagcaac---cg----------cc-tc-c-c-----
                      Sheep  aagagg-gtggccca--ccc----cca-tcactatagcaac---cg----------cc-tc-c-c-----
              Domestic goat  aagagg-gtggccca--ccc----cca-tcactatagcaac---cg----------cc-tc-c-c-----
                      Horse  aataga-gcggcccc-cccc----nnn-n-----------------------------------------
           White rhinoceros  aataga-gcggccca-tccc----cgg-ttgctatagtaac---ct----------cc-cc---------
                        Cat  aatagt-gtggc-cc-atcc----ctg-tcgctgtagcaac---cc----------ca-cc-c-------
                        Dog  aatagt-gcgacccc-atcc----ctg-tcaccgtagcaac---ca----------ca-cc-c-t-----
                    Ferret   aatagt-gtggcccc--tcc----ctg-tcgccgtagcaac---ca----------ct-cc-c-c-----
                      Panda  aatagt-gcggcccc-atcc----ctg-tcaccgtagcaac---ca----------cc-cc-c-c-----
             Pacific walrus  aatagt-gcggcacc-atcc----ctg-tcaccatagcaac---ca----------ca-tc-c-c-----
               Weddell seal  aataga-gcagcccc-atcc----ctg-tcactgtagcaac---ca----------ca-tc-c-c-----
           Black flying-fox  aataga-gcggtcca-tcgc----cgg-tcactatagcaac---cg----------cc-cc-c-g-----
                    Megabat  aataga-gtggccca-tcgc----cgg-tcactatagcaac---cg----------cc-cc-c-g-----
              Big brown bat  aattga-gtggccca-tccc----tgg-tcgctatagcaac---cc----------cctcc-c-a-----
                   Hedgehog  aataga-gtggcccggctct----tag-ttgctatagcaacaaaca----------cc-cc-c-c---cc
                   Elephant  aataga-gtgtcccc-tttc----tgg-ttgctatagcaac---cg----------cc-cc-c-c-----
                    Manatee  aataga-gtgtccca-tttc----tgg-ttgctatagcaac---cg----------cc-cc-c-c-----
           Cape golden mole  attagc-gtgtccca-tccc----tgg-ttgctatagtaac---tg----------cc-cc-c-c-----
                   Aardvark  aata---gtgtccca-tccc----tgg-tcgctatagcaac---aa----------cc-cc-c-c-----
                  Armadillo  agcagc-gtgcctca-tccc----tgg-ttgctatggcaac---cg----------cc-cc-c-c-----
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
       David's myotis (bat)  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                     Turkey  ======================================================================
               Mallard duck  ======================================================================
                 Budgerigar  ======================================================================
           Peregrine falcon  ======================================================================
                Rock pigeon  ======================================================================
             Painted turtle  ======================================================================
                    Chicken  ======================================================================
                   Platypus  ======================================================================
        Collared flycatcher  ======================================================================
                Zebra finch  ======================================================================
               Saker falcon  ======================================================================
            Green seaturtle  ======================================================================
        Medium ground finch  ======================================================================
         American alligator  ======================================================================
     White-throated sparrow  ======================================================================
         Tibetan ground jay  ======================================================================

                      Human  ----------------gtg--------
                      Chimp  ----------------gtg--------
                    Gorilla  ----------------gtg--------
                  Orangutan  ----------------ggg--------
                     Gibbon  ----------------gtg--------
                     Rhesus  ----------------gtg--------
        Crab-eating macaque  ----------------gtg--------
                     Baboon  ----------------gtg--------
               Green monkey  ----------------gtg--------
                   Marmoset  ----------------gcg--------
            Squirrel monkey  ----------------ggg--------
                   Bushbaby  ----------------gtg--------
         Chinese tree shrew  ----------------gtg--------
                   Squirrel  ----------------gcg--------
     Lesser Egyptian jerboa  -------cctcccccagtg--------
               Prairie vole  -------cctcccct-gtg--------
            Chinese hamster  -------cctcccct-gtg--------
             Golden hamster  -------cctcccct-gtg--------
                      Mouse  -------cctccccc-gca--------
                        Rat  -------cctccccc-gag--------
             Naked mole-rat  ----------------gtg--------
                 Guinea pig  ----------------gtg--------
                 Chinchilla  ----------------gtg--------
           Brush-tailed rat  ----------------ctg--------
                        Pig  ---------------------------
                     Alpaca  ---------------------------
             Bactrian camel  ---------------------------
                    Dolphin  ---------------------------
               Killer whale  ---------------------------
           Tibetan antelope  ---------------------------
                        Cow  ---------------------------
                      Sheep  ---------------------------
              Domestic goat  ---------------------------
                      Horse  ---------------------------
           White rhinoceros  ---------------------------
                        Cat  ---------------------------
                        Dog  ---------------------------
                    Ferret   ---------------------------
                      Panda  ---------------------------
             Pacific walrus  ---------------------------
               Weddell seal  ---------------------------
           Black flying-fox  ---------------------------
                    Megabat  ---------------------------
              Big brown bat  ---------------------------
                   Hedgehog  cccagca--------------------
                   Elephant  -------------------aat----g
                    Manatee  -------------------agt----g
           Cape golden mole  -------------------tat----g
                   Aardvark  -------------------catcaccg
                  Armadillo  -------------------caa----g
                     Tenrec  ===========================
        Cape elephant shrew  ===========================
       David's myotis (bat)  ===========================
            Star-nosed mole  ===========================
                       Pika  ===========================
                     Rabbit  ===========================
                     Turkey  ===========================
               Mallard duck  ===========================
                 Budgerigar  ===========================
           Peregrine falcon  ===========================
                Rock pigeon  ===========================
             Painted turtle  ===========================
                    Chicken  ===========================
                   Platypus  ===========================
        Collared flycatcher  ===========================
                Zebra finch  ===========================
               Saker falcon  ===========================
            Green seaturtle  ===========================
        Medium ground finch  ===========================
         American alligator  ===========================
     White-throated sparrow  ===========================
         Tibetan ground jay  ===========================

Inserts between block 35 and 36 in window
B D                    Pig 8bp
B D                 Alpaca 13bp
            Bactrian camel 13bp
B D                Dolphin 9bp
              Killer whale 9bp
          Tibetan antelope 8bp
B D                    Cow 8bp
B D                  Sheep 8bp
             Domestic goat 8bp
B D                  Horse 176bp
B D       White rhinoceros 6bp
B D                    Cat 6bp
B D                    Dog 12bp
B D                Ferret  13bp
B D                  Panda 5bp
            Pacific walrus 9bp
              Weddell seal 9bp
          Black flying-fox 9bp
B D                Megabat 9bp
             Big brown bat 13bp
B D               Hedgehog 1bp

Alignment block 36 of 193 in window, 76994374 - 76994402, 29 bps 
B D                   Human  cttttgtga--tcgtaaaatggaat------tca-ct-g
B D                   Chimp  cttttgtga--tcgtaaaatggaat------tca-tt-g
B D                 Gorilla  cttttgtga--tcgtaaaatggaat------tca-tt-g
B D               Orangutan  cttttgtga--tcgtaaaatggaat------tca-ct-g
B D                  Gibbon  cttttgtga--tcgtaaaatggaat------tca-tt-g
B D                  Rhesus  cttttgtg-------------------------a-tt-g
B D     Crab-eating macaque  cttttgtg-------------------------a-tt-g
B D                  Baboon  cttttggga--ttgtaaaatggaat------tca-tt-g
B D            Green monkey  cttttgtga--ttgtaaaacggaat------tca-tt-g
B D                Marmoset  cttttgtaa--tggtgaaatggaat------tca-tt-g
B D         Squirrel monkey  cttttgtga--tggtgaaatggaat------tca-tt-g
B D                Bushbaby  cttctgtaa--tcatgaaatggaat------tca-tt-g
         Chinese tree shrew  ctt-tgtga--tccggaaatggaat------cca-tc-a
B D                Squirrel  cttctgcga--tcaggaaatggaat------tca-gt-g
     Lesser Egyptian jerboa  cttttgtga--tcatgaaacggaat------tta-tt-g
               Prairie vole  cttttgtga--gcatgaaatagaat------tga-tc-a
B D         Chinese hamster  cttttgtga--gcatgaaatggaat------tga-tc-g
             Golden hamster  cttttgtga--gcatgaaatggaat------tga-tc-g
B D                   Mouse  cttttgtga--gcatgaaatggaat------tta-tc-g
B D                     Rat  ctcttgtga--gcatgaaatggaat------tta-tc-g
B D          Naked mole-rat  cctctgtga--tggtgaactggaat------tca-tc-g
B D              Guinea pig  cctctg-ga--tcatgggctggaat------cca-tc-g
                 Chinchilla  cctctgtga--tcatgaactggaat------tca-tc-a
           Brush-tailed rat  cctctgtga--tcctgaagtggaat------tca-tc-g
B D                     Pig  cttttgtca--tcccgaaaaggaat------tca-tt--
B D                  Alpaca  cttttgtca--t---------------------------
             Bactrian camel  cttttgtca--t---------------------------
B D                 Dolphin  cttttgtca--ccgggaaatggaat------tca-tc--
               Killer whale  cttttgtca--ctgggaaatggaat------tca-tc--
           Tibetan antelope  gttttgtca--ctgagaaatggaat------tca-tt--
B D                     Cow  gttttgtca--ctgagaaatggaat------tca-tt--
B D                   Sheep  gttttgtca--ctgagaaatggaat------tca-tt--
              Domestic goat  gttttgtca--ctgagaaatggaat------tca-tt--
B D                   Horse  cttttgtga--tcatg-aatggaat------tcagca--
B D        White rhinoceros  cttttgtga--tcatgaaatggaat------tcattg--
B D                     Cat  ctcttgcga--ccatggaatggaat------tta-cg--
B D                     Dog  tttttgtga--ttcc--------at------tta-tg--
B D                 Ferret   tttttgtgatctctcgaaaaggaat------tta-tg--
B D                   Panda  tttttgtga--tcacgaaatggaat------tta-tg--
             Pacific walrus  tttttgtga--tcacaaaatggaat------tta-tg--
               Weddell seal  tttttgtga--tcactaaatggaat------tta-tg--
           Black flying-fox  cttttgtga--tcaagaaatggaat------tca-tg--
B D                 Megabat  cttttgtga--tcaagaaatggaat------tca-tg--
              Big brown bat  cttttgtga--tcaagaaatggaat------tca-tc--
B D                Hedgehog  tttttgtga--tcaggaaatggaat------tca-tcg-
B D                Elephant  cttttgtga--atgtgaaatggaat--------------
B D                 Manatee  cttttgtga--ttgtgaaatggaat--------------
           Cape golden mole  gttttgtga--tcctgaaatgaaa---------------
                   Aardvark  cttttgc-a--tcacataagaaaa---------------
B D               Armadillo  ctttcgtga--tcatgaaaaggaattcatca--------
B D                  Tenrec  =======================================
       Cape elephant shrew  =======================================
      David's myotis (bat)  =======================================
           Star-nosed mole  =======================================
B D                    Pika  =======================================
B D                  Rabbit  =======================================
B D                  Turkey  =======================================
  D            Mallard duck  =======================================
B D              Budgerigar  =======================================
  D        Peregrine falcon  =======================================
  D             Rock pigeon  =======================================
  D          Painted turtle  =======================================
B D                 Chicken  =======================================
B D                Platypus  =======================================
  D     Collared flycatcher  =======================================
B D             Zebra finch  =======================================
  D            Saker falcon  =======================================
  D         Green seaturtle  =======================================
B D     Medium ground finch  =======================================
B D      American alligator  =======================================
  D  White-throated sparrow  =======================================
        Tibetan ground jay  =======================================

Inserts between block 36 and 37 in window
B D                    Pig 163bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D               Hedgehog 2bp

Alignment block 37 of 193 in window, 76994403 - 76994533, 131 bps 
B D                   Human  gaagtccttttcaag-tga---------------actcttctccagacaaacgg---att-gaggaagga
B D                   Chimp  gaagtccttttcaag-tga---------------actcttctccagacaaacgg---att-gaggaagga
B D                 Gorilla  gaagtccttttcaag-tga---------------actcttctccagacaaacgg---att-gaggaagga
B D               Orangutan  gaagtccttttcaag-tga---------------actcttctccagacaaacgg---gtt-gaggaagga
B D                  Gibbon  aaagtccttttcaag-tga---------------acttttctccagacaaacgc---att-gaggaagga
B D                  Rhesus  gaagtgcttttcaag-tga---------------actctcctccagacaaacgg---att-gaggaagga
B D     Crab-eating macaque  gaagtgcttttcaag-tga---------------actctcctccagacaaacgg---att-gaggaagga
B D                  Baboon  gaagtgcttttcaag-tga---------------actctcctccagacaaacgg---att-gaggaagga
B D            Green monkey  gaagtgcttttcaag-tga---------------actctcctccagacaaacgg---att-gaggaagga
B D                Marmoset  gaagtgcttttcaag-tga---------------actctcctccagacaaatgg---att-gaggaagga
B D         Squirrel monkey  caagtgcttttcaag-tga---------------actctcctccagacaaacgg---att-gaggaagga
B D                Bushbaby  caagtgttattc-ag-tga---------------actcttctccagacaaacag---gct-gaggaagga
         Chinese tree shrew  gaaa-gcttttcagg--ga---------------gctcttct-----caaacag---att-gagccagga
B D                Squirrel  gacgcacttccc-ag-tga---------------actcctctccagacaa-caa---aac-caagaaaga
     Lesser Egyptian jerboa  gaggtgtctcct-agttga---------------a-----ctccaaatgagagg---aac-gaagaaggt
               Prairie vole  gaaacgcttcct-cg-tga---------------a-----ctccagataagcgg---acc-agagagaga
B D         Chinese hamster  gaaatgcttcct-cg-tga---------------a-----ctccagataagcgg---aac-agagagaga
             Golden hamster  gaaatgcttcct-cg-tga---------------a-----ctccagataagcg---------gagagaga
B D                   Mouse  gaaatgctttcg-at-cga---------------a-----ccccagataagcag---aac-agagagcga
B D                     Rat  gaaaggctttct-ag-cga---------------a-----ccccagataagcag---aac-agagagcga
B D          Naked mole-rat  gaagtgcctctc-cg-caa---------------actcttctccagacaagcag---aat-agggaagga
B D              Guinea pig  gcaatgcttctc-at-cga---------------actcttttccagatgagcaa---aac-agagaagga
                 Chinchilla  gaaatgcctttc-at-tga---------------actcttctctagacaaacag---aacaggggaagga
           Brush-tailed rat  gcaatgcctctc-ct-cga---------------actcttt--------------------ggggaagga
B D                  Alpaca  ------ccattc-ag-tga---------------actcttctccagacaaagag---atg-gaggaaaga
             Bactrian camel  ------ccattc-ag-tga---------------actcttctccagacaaagag---gtg-gaggaaaga
B D                 Dolphin  gacctgccattc-ag-tgc---------------actcttctccagacaaagag---atg-gaagaaaga
               Killer whale  gacctgccattc-ag-tgc---------------actcttttccagacaaagag---atg-gaagaaaga
           Tibetan antelope  gacacgccattc-ag-tga---------------actcttctccagacaatgag---gtg-gaggaaaga
B D                     Cow  gacacgccattc-ag-tga---------------actcttctccagacaaagag---gtg-gaggaaaga
B D                   Sheep  gacacgccattc-ag-tga---------------actcttctccagacaatgag---gtg-gaggaaaga
              Domestic goat  gacacgccattc-ag-tga---------------actcttctccagacaaagag---gtg-gaggaaaga
B D                   Horse  caagtgccgttc-gg-tga---------------agtcttctctagacaaattg---atg-gaggaaaga
B D        White rhinoceros  caagtgccattc-ag-tga---------------agtcttctccagacaaattg---atg-gaggaaaga
B D                     Cat  gacatgccattc-ag-tga---------------actcttctccagacaaatag---atc-tgggaaaga
B D                     Dog  tatgtgccgttc-ag-tgg---------------actcttctccagacaaatag---atc-ctggaaaga
B D                 Ferret   gatgtaccattc-ag-tga---------------gctcttctccagacaaacag---atc-ttggaaaga
B D                   Panda  gatgtaccattc-ag-tga---------------actcttttccagacaaatag---atc-ttggaaaga
             Pacific walrus  gatgtaccattc-cg-tga---------------actcttctccagacaaatag---atc-ttgggaaga
               Weddell seal  gatgtaccattc-cg-tga---------------actcttctccagacaaatag---atc-ttgggaaga
           Black flying-fox  caagtgccgttc-ag-ggg---------------acccctctccagacaaacgg---atg-gaggagaga
B D                 Megabat  caagtgccgttc-ag-ggg---------------acccctctccagacaaaccg---atg-gaggagaga
              Big brown bat  acagcgccaggc-gg-tga---------------actcttctgcagacacatgg---agg-gaggaacga
B D                Hedgehog  agcacgctgctc-ac-taa---------------actcttctccaggctaatag---gtg-aaagaa--a
B D                Elephant  ----------------------------------gtttgtctccagacaaagag---att-gaggaaaga
B D                 Manatee  ----------------------------------gtttgtctccagacaaacag---atc-caggaaaga
           Cape golden mole  -----------------------------------ctccactccagacaaacagatcatc-aagtaagga
                   Aardvark  -----------------------------------ctcttctccagacaaagag---acg-gagaagaga
B D               Armadillo  -----------------gaggtgccgttcagtgaaccagtctccacacagacag---atc-cggggaaga
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                  Turkey  ======================================================================
  D            Mallard duck  ======================================================================
B D              Budgerigar  ======================================================================
  D        Peregrine falcon  ======================================================================
  D             Rock pigeon  ======================================================================
  D          Painted turtle  ======================================================================
B D                 Chicken  ======================================================================
B D                Platypus  ======================================================================
  D     Collared flycatcher  ======================================================================
B D             Zebra finch  ======================================================================
  D            Saker falcon  ======================================================================
  D         Green seaturtle  ======================================================================
B D     Medium ground finch  ======================================================================
B D      American alligator  ======================================================================
  D  White-throated sparrow  ======================================================================
        Tibetan ground jay  ======================================================================
B D                     Pig  ======================================================================

                      Human  aattaccag-aaggcc-c-------agcacctc--tgaa----c--aggt-ctttgtttc---c---agg
                      Chimp  aattaccag-aaggcc-c-------agcacctc--tgaa----c--aggt-ctttgtttc---c---agg
                    Gorilla  aattaccag-aaggcc-c-------agcacccc--tgaa----c--aggt-ctttgtttc---c---agg
                  Orangutan  aattaccag-aaggcc-c-------agcacctc--tgaa----c--aggt-ctttgtttc---c---agg
                     Gibbon  aattaccag-aaggcc-c-------agcacctc--tgaa----c--aggt-ctttgtttc---c---aag
                     Rhesus  aattaccag-aaggcc-c-------agcacctc--tgaa----c--aggt-ctttgtttc---c---agg
        Crab-eating macaque  aattaccag-aaggcc-c-------agcacctc--tgaa----c--aggt-ctttgtttc---c---agg
                     Baboon  aattaccag-aaggcc-c-------agcacctc--tgaa----c--aggt-ctttgtttc---c---agg
               Green monkey  aattaccag-aaggcc-c-------agcacctc--tgaa----c--aggt-ctttgtttc---c---agg
                   Marmoset  aattaccag-aaggcc-c-------agcacctc--tgaa----t--gggt-ctttatttc---c---agg
            Squirrel monkey  aattaccag-aagacc-c-------ggcacctc--tgaa----t--gggt-ctttatttc---c---agg
                   Bushbaby  aattaccgg-aagccc-c-------agcacctc--tgaa----c--gggt-ctttgtttc---c---agg
         Chinese tree shrew  aatggtcag-agaccc-c-------agcagctcagtggc----c--ttgg-cctcgtttc---c---cgg
                   Squirrel  aaacgcccg-aaaccc-c-------cgcccccc--cgaa----a-----------------------a--
     Lesser Egyptian jerboa  aattaccag-aagtcc-c-------agcacctc--tgaa----c--aggt-ctttgtctc---t---aga
               Prairie vole  aattaccag-aatcc--c-------agcgcctc--caag----c--gggt-ttttgtttt---t---aga
            Chinese hamster  aattaccag-aatcct-c-------agcacctc--tcag----c--gggt-ctttgtttt---t---aga
             Golden hamster  aattgccag-aacctt-t-------agcacctc--taag----ccggggt-cttcgcttt---t---aga
                      Mouse  aattaccag-aatcct-c-------agcacctc--tgag----ggagggt-ctttgtttt---t---aga
                        Rat  aattaccag-aaccct-c-------agcacctc--tgag----agagggc-ctttgtttt---ta--agg
             Naked mole-rat  aattaccag-cagctc-c-------agcacctt--taaa----c--cggt-ctttgtttc---caagaga
                 Guinea pig  aattaccag-cagccc-c-------agcacctt--tgaa----c--gggc-atttgtttc---caggaga
                 Chinchilla  aattaccag-cagtct-c-------agcacctt--tgaa----c--gggt-ctttgtttc---cacaaga
           Brush-tailed rat  aattaccag-ctgccc-c-------agcacctt--tgaa----c--aggt-ctttgtttc---cacgaga
                     Alpaca  aattactgg-aag-cg-c-------ggcacttc--agaa----c--aggt-ctttgtttc---c---aag
             Bactrian camel  aattactgg-aag-ca-c-------ggcacctc--ggaa----c--aggt-ctttgtttc---c---aag
                    Dolphin  aattaccggaaag-tc-c-------agcacctc--caaa----c--aggt-ctttgtttc---c---agg
               Killer whale  aattaccggaaag-tc-c-------agcacctc--caaa----c--aggt-ctttgtttc---c---agg
           Tibetan antelope  aattactgg-aag-ca-c-------agcacctc--cgaa----c--gggt-ctttgtttc---c---agg
                        Cow  aattactgg-aag-cg-c-------agcacctc--ctga----c--gggt-ctttgtttc---c---agg
                      Sheep  aattactgg-aag-ca-c-------agcacctc--cgaa----c--gggt-ctttgtttc---c---aga
              Domestic goat  aattactgg-aag-ca-c-------agcacctc--tgaa----c--gggt-ctttgtttc---c---agg
                      Horse  aattaccgg-aag-cc-c-------agcacctc--tgat----c--aggt-ctttgtttc---c---agg
           White rhinoceros  aattaccgg-aag-cc-c-------agcacctc--cgat----c--gggt-ctttgtttc---c---agg
                        Cat  aattaccag-aag-cc-c-------ggcacctc--cgag----c--gagt-ctttgtttc---c---agg
                        Dog  aattactgg-aag-cc-c-------agcacctc--caaa----c--gagt-ctttgtttc---c---agg
                    Ferret   aactactgg-aag-cc-c-------agggcctc--caaa----c-agagt-ctttgtttc---c---agg
                      Panda  aattactgg-aag-cc-c-------agcacctc--caaa----t--gagt-ctttgtttc---c---agg
             Pacific walrus  aattactgg-aag-cc-c-------agcacctc--cgaa----c--gagt-ctttgtttc---c---agg
               Weddell seal  aattactgg-aag-cc-c-------agcacctc--cgaa----c--gagt-ctttgtttc---c---agg
           Black flying-fox  aagcgccgg-aag--c-c-------agcaccta--cgaa----a--ggct-ctttgtttc---c---a--
                    Megabat  aagcaccgg-aag--c-c-------agcaccta--caaa----a--ggct-ctttgtttc---c---a--
              Big brown bat  agctaccgg-aaa-cc-c-------agcaccta--caaa----g--ggc--ctttgttcc---c---a--
                   Hedgehog  aattaccgg-aag-ccaa-------agcacctc--cgaa----t--aggt-ctttgtttc---c---agg
                   Elephant  aattatcca-agc-ct-ccggtcttggcacttc--tgaa----c--aggt-ctttgtttc---t---aga
                    Manatee  aattatggg-agc-ct-c-------agcacctc--cgaa----t--gggt-ctttgtgtc---t---aga
           Cape golden mole  aatgctcag-agg-ta---------ggtgcctc--tgaattctc--agat-ctttg-------t---aga
                   Aardvark  aatgatggg-agc-cc-c-------agcacccg--cggaggagc--gggt-ctttgtttc---t---gga
                  Armadillo  aattatcgc-agg-cc-cc------agcacctc--agga----t--gggtcctttgtttccagg---aga
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
       David's myotis (bat)  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                     Turkey  ======================================================================
               Mallard duck  ======================================================================
                 Budgerigar  ======================================================================
           Peregrine falcon  ======================================================================
                Rock pigeon  ======================================================================
             Painted turtle  ======================================================================
                    Chicken  ======================================================================
                   Platypus  ======================================================================
        Collared flycatcher  ======================================================================
                Zebra finch  ======================================================================
               Saker falcon  ======================================================================
            Green seaturtle  ======================================================================
        Medium ground finch  ======================================================================
         American alligator  ======================================================================
     White-throated sparrow  ======================================================================
         Tibetan ground jay  ======================================================================
                        Pig  ======================================================================

                      Human  ag---------a---------tgggcctgatgagagg-c-------------------tgagaagccact
                      Chimp  ag---------a---------tgggcctgatgagagg-c-------------------tgagaagccact
                    Gorilla  ag---------a---------tgggcctgatgagaga-c-------------------tgagaagccact
                  Orangutan  at---------t---------tgggcctgatgagagg-c-------------------cgagaagccact
                     Gibbon  ag---------a---------tgggcctgatgagagg-c-------------------cga---------
                     Rhesus  ag---------a---------taggcctgaggagagg-c-------------------cga---------
        Crab-eating macaque  ag---------a---------taggcctgaggagagg-c-------------------cga---------
                     Baboon  ag---------a---------tgggcctgaggagagg-c-------------------caa---------
               Green monkey  ag---------a---------tgggcctgaggagagg-c-------------------cga---------
                   Marmoset  ag---------a---------tgggcctgatgagatg-c-------------------cga---------
            Squirrel monkey  ag---------a---------tgggcctgatgagatg-c-------------------cga---------
                   Bushbaby  agaagagttcaa---------tcagcctgatgagata-c-------------------cc----------
         Chinese tree shrew  ag---------agcggggcagtcagcctgctgagaga-c-------------------gca---------
                   Squirrel  -----------------------agccccaagaaaaa-a-------------------ccccaagacact
     Lesser Egyptian jerboa  ac---agttcaa---------tcaattcagtgagaga-c-------------------ccagaagccaca
               Prairie vole  ag---ggttcag---------tcggtcgcacgaggga-c-------------------ccagaagccacc
            Chinese hamster  ag---ggctcag---------tctgttccacgagaga-c-------------------ccagaagccacc
             Golden hamster  ag---ggttcag---------tcagttccacgagaga-c-------------------ccagaagccacc
                      Mouse  cc---ggttcag---------tcagtcccatgagaga-c-------------------ccagaagcctcc
                        Rat  ct---ggttcag---------tccgtctcatgagaga-c-------------------ccggaagccacc
             Naked mole-rat  ac---agttcaa---------tcagcctgatgagagaga-------------------tcaggaaccaat
                 Guinea pig  ac---agttcaa---------tcagcc------------------------------------------t
                 Chinchilla  ac---agttcaa---------tcagcctgatgagagaga-------------------tcaggaaccaat
           Brush-tailed rat  ac---agttcaa---------tcagcctgatgacagaga-------------------taaggaaccagt
                     Alpaca  agaacagttcaa---------ttgg-ctgatgagaga-c-------------------ccagaaaccaca
             Bactrian camel  agaacagttcaa---------ttgg-ctgatgagaga-c-------------------ccagaaaccaca
                    Dolphin  agaacagttcaa---------ttgg-ctgatgagaga-c-------------------ccagaaaccact
               Killer whale  agaacagttcaa---------ttgg-ctgatgagaga-c-------------------ccagaaaccact
           Tibetan antelope  agaacagttcaa---------ttgg-ctgatgagaga-c-------------------ccagaaaccaca
                        Cow  agaacagttcaa---------ttgg-ctgatgagaga-c-------------------ccagaaaccaca
                      Sheep  agaacagttcaa---------ttgg-ctgatgagaga-c-------------------ccagaaaccaca
              Domestic goat  agaacagttcaa---------ttgg-ctgatgagaga-c-------------------ccagaaaccaca
                      Horse  agaacagttcaa---------ttgg-ctgatgagaga-c-------------------ccagaaaccaca
           White rhinoceros  agaacagttcaa---------ctgg-ctgatgagaga-c-------------------ccagaagccact
                        Cat  agaaccgttcga---------ttgg-ctgatgaggga-c-------------------ccagaaaccacc
                        Dog  agaacatttcaa---------ttgt-ctgatcaggga-c-------------------ccggaaaccact
                    Ferret   agaacatttcaa---------ctgg-ccgatgagggg-c-------------------ccggaaaccacg
                      Panda  agaacgtttcag---------ttgg-ctgatgaggga-c-------------------ttggaaaccact
             Pacific walrus  agaacatttcaa---------ttgg-ctgatgaggga-c-------------------ccggaaaccact
               Weddell seal  agaacatttcaa---------ttgg-ctgatgaggga-c-------------------ccggaaaccact
           Black flying-fox  --gacagttcag---------ttga-cag----gaga-c-------------------ccggacgccact
                    Megabat  --gacagttcag---------ttga-cag----gaga-c-------------------ccggacgccact
              Big brown bat  -ggacagttcac---------gtgg-cgg----gaga-c-------------------ccagacgccact
                   Hedgehog  agaagagttcag---------tggg-ctgatgagag--c-------------------ccagcagccctg
                   Elephant  ac---aattctg---------tctgcctggtgagtga-c-------------------cc----------
                    Manatee  ac---aattcag---------tctgcctggtgagtga-c-------------------cc----------
           Cape golden mole  ac---agtttca---------tctgcctggtcagtga-ccgcccccccacccctcccaca----------
                   Aardvark  at---agctcag---------gctggctgatgagtga-ccccccccccatgagtga--cc----------
                  Armadillo  ac---agttcaa---------ccagcctcatgagtga-cc------------------ga----------
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
       David's myotis (bat)  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                     Turkey  ======================================================================
               Mallard duck  ======================================================================
                 Budgerigar  ======================================================================
           Peregrine falcon  ======================================================================
                Rock pigeon  ======================================================================
             Painted turtle  ======================================================================
                    Chicken  ======================================================================
                   Platypus  ======================================================================
        Collared flycatcher  ======================================================================
                Zebra finch  ======================================================================
               Saker falcon  ======================================================================
            Green seaturtle  ======================================================================
        Medium ground finch  ======================================================================
         American alligator  ======================================================================
     White-throated sparrow  ======================================================================
         Tibetan ground jay  ======================================================================
                        Pig  ======================================================================

                      Human  acc
                      Chimp  acc
                    Gorilla  acc
                  Orangutan  acc
                     Gibbon  ---
                     Rhesus  ---
        Crab-eating macaque  ---
                     Baboon  ---
               Green monkey  ---
                   Marmoset  ---
            Squirrel monkey  ---
                   Bushbaby  ---
         Chinese tree shrew  ---
                   Squirrel  gca
     Lesser Egyptian jerboa  gca
               Prairie vole  atg
            Chinese hamster  cca
             Golden hamster  gca
                      Mouse  acc
                        Rat  aca
             Naked mole-rat  gtg
                 Guinea pig  aca
                 Chinchilla  gca
           Brush-tailed rat  gca