Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 80 in window, 86584411 - 86584415, 5 bps 
B D                     Human  gt-----------tat
B D                     Chimp  gt-----------tat
B D                   Gorilla  gt-----------tat
B D                 Orangutan  gt-----------tat
B D                    Gibbon  gt-----------tat
B D                    Rhesus  gt-----------tat
B D       Crab-eating macaque  gt-----------tat
B D                    Baboon  gt-----------tat
B D              Green monkey  gt-----------tat
B D                  Marmoset  gt-----------tgc
B D           Squirrel monkey  tt-----------tgc
           Chinese tree shrew  ga-----------tat
B D                  Squirrel  ta-----------aat
B D            Naked mole-rat  gg-----------tat
B D                Guinea pig  ga-----------tat
                   Chinchilla  ga-----------tat
             Brush-tailed rat  ga-----------tat
B D                       Pig  gg-----------cat
                 Killer whale  ggaaaggaaagcttac
             Tibetan antelope  gg-----------tac
B D                       Cow  gg-----------tac
B D                     Sheep  gg-----------ttc
                Domestic goat  gg-----------ttc
B D                     Horse  ga-----------tat
B D          White rhinoceros  ga-----------aac
B D                       Dog  ga-----------aat
B D                   Ferret   ga-----------tat
B D                     Panda  ga-----------tat
               Pacific walrus  ga-----------tat
                 Weddell seal  ga-----------tat
                Big brown bat  ga-----------tat
         David's myotis (bat)  ga-----------tat
B D                  Hedgehog  aa-----------tgt
              Star-nosed mole  gg-----------cat
              Golden hamster  ================
      Lesser Egyptian jerboa  ================
B D                       Rat  ================
                Prairie vole  ================
B D                     Mouse  ================
B D                      Pika  ================
B D                     Shrew  ================
B D                    Rabbit  ================
B D                Coelacanth  ================
                    Aardvark  ================
            Cape golden mole  ================
B D                   Megabat  ================
B D                   Dolphin  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D              Mallard duck  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
  D    White-throated sparrow  ================
B D           Tasmanian devil  ================
  D            Painted turtle  ================
B D                Budgerigar  ================
B D                   Opossum  ================
  D               Rock pigeon  ================
B D       Medium ground finch  ================
B D                    Lizard  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
B D                   Wallaby  ================
B D                   Manatee  ================
B D                  Elephant  ================
B D           Chinese hamster  ================
B D                    Tenrec  ================
  D           Green seaturtle  ================
B D                       Cat  ================
B D                  Bushbaby  ================
  D  Chinese softshell turtle  ================
  D       Collared flycatcher  ================
              Bactrian camel  ----------------
B D                    Alpaca  ----------------
            Black flying-fox  ================
B D                  Microbat  ================
B D                 Armadillo  ================

Alignment block 2 of 80 in window, 86584416 - 86584473, 58 bps 
B D                     Human  taaaggaaagagg---tatgact--gacccgctgc--tgtctc---ctccacattcccttcaccgact
B D                     Chimp  taaaggaaagagg---tatgact--gacccgctgc--tgtctc---ctccacatccccttcaccgact
B D                   Gorilla  taaaggaaagagg---tatgact--gacccgctgc--tgtctc---ctccacatgcccttcaccgact
B D                 Orangutan  taaaggaaagagg---tatgact--aacccgctgc--tgtctc---ctccacatccccttcaccgact
B D                    Gibbon  taaaggaaagcgg---tatgact--gacccactac--tgcctc---ctccacatccccttcactgact
B D                    Rhesus  taaaggaaagagg---tatgact--gatccactct--tgcctc---ctccacatccccttcaacgact
B D       Crab-eating macaque  taaaggaaagagg---tatgact--gatccactct--tgcctc---ctccacatccccttcaacgact
B D                    Baboon  taaaggaaagagg---tatgact--gatccactct--tgcctc---ctccacatccccttcaatgact
B D              Green monkey  taaaggaaagagg---tatgact--gatccactct--tgcctc---ctccacagccccttcaatgact
B D                  Marmoset  taaagggaagagg---tatgact--gaccctctcc--cacctccttctccacatccccttcaacgact
B D           Squirrel monkey  taaagtaaagagg---tgtgact--gacccactcc--tgactccttctccacatccccttcaacgaca
           Chinese tree shrew  taaacaaaagggg---tgt-act--gacccaccct--tgt------ctctacatgcccttcaactact
B D                  Squirrel  taaaga--aagga---tatgact--gatttatccc--tgactctt-ctccaaatattctt--------
B D            Naked mole-rat  taaagg--aagtg---tgtggct--acg---------------------catcccagcttcagtcac-
B D                Guinea pig  gacagg--agggg---agtggct--cat--ttctc--tgcccctt-ctccagctaccctcccaccac-
                   Chinchilla  tatagg--agggg---tgtggct--cag-tatcac--tgcttctt-ctccacctacctttcaaccgc-
             Brush-tailed rat  agcagg--agggg---tgtggct--cag--attgc--tgctgctt-ctccacctccccttcaaccac-
B D                       Pig  taaagaaaagctg---tgtga--ctgatgcc-ctc--tgc--ctctcaccatatacccttctgccact
                 Killer whale  taaaggaaagctg---tgtgattctgaccca-ccc--tgtctctctctccacatactcttcaacaact
             Tibetan antelope  taaaggaaagcta---tgtaactctgaccca-ctc--cgtctctctctccacacattcttcaaccact
B D                       Cow  taaaggaaagcta---tgtgactctgaccca-ctc--cgtctctctctccacacactcttcaaccact
B D                     Sheep  taaaggaaagcta---tgtgactctgaccca-ctc--cgcctctctctccacacacacttcaaccact
                Domestic goat  taaaggaaagcta---tgtgactctgaccca-ctc--cgcctctctctccacacactcttcaaccact
B D                     Horse  gaaaggagagagg---tggggct------ca-ccc--tggccacttctccacattcgcttcaactgtt
B D          White rhinoceros  gaaaggaaagaggtgttgaggct--caccca-ccc--tgcctccttctccacattcgcttcaactact
B D                       Dog  taaagaataaggg---taagact-tcactcacccc--tacctccttgtccacatatccttcaatgact
B D                   Ferret   taaagaaaag-gg---taagact-tcacttactcc--tacctccttgtccacatactcttcaatgact
B D                     Panda  taaagaacag-gg---taagact-tcactcatccc--tacctccttatctacatacccttcaatgact
               Pacific walrus  taaagaacaaggg---taagact-tcattcacccc--tacctccttgtctacatacccttcaatgact
                 Weddell seal  taaagaacaa-gg---taagact-tcactcacccc--tacctccctgtctacgtacccttcaatgact
                Big brown bat  taaagaaaagggg---gatagac-taaccca-ctc--tacctccttctccaaataccctt-gaccact
         David's myotis (bat)  taaaagaaagggg---gatagac-taaccca-ccc--tacctccttttccaaatatcctg-aaccact
B D                  Microbat  taaaagaaagggg---gatagac-taaccca-ccc--taccttcttctccaaatatcctg-aaccact
B D                  Hedgehog  ta----aaagaac---agagaat--aattca-cttactcactcactttcttcatattcttcatttact
              Star-nosed mole  tagtggaaagaac---a-agact--ga-cca-cct--tccctcctcttcctcatactttttagcatct
              Golden hamster  ====================================================================
      Lesser Egyptian jerboa  ====================================================================
B D                       Rat  ====================================================================
                Prairie vole  ====================================================================
B D                     Mouse  ====================================================================
B D                      Pika  ====================================================================
B D                     Shrew  ====================================================================
B D                    Rabbit  ====================================================================
B D                Coelacanth  ====================================================================
                    Aardvark  ====================================================================
            Cape golden mole  ====================================================================
B D                   Megabat  ====================================================================
B D                   Dolphin  ====================================================================
B D                    Turkey  ====================================================================
B D                   Chicken  ====================================================================
  D              Mallard duck  ====================================================================
          Tibetan ground jay  ====================================================================
B D               Zebra finch  ====================================================================
  D    White-throated sparrow  ====================================================================
B D           Tasmanian devil  ====================================================================
  D            Painted turtle  ====================================================================
B D                Budgerigar  ====================================================================
B D                   Opossum  ====================================================================
  D               Rock pigeon  ====================================================================
B D       Medium ground finch  ====================================================================
B D                    Lizard  ====================================================================
  D          Peregrine falcon  ====================================================================
  D              Saker falcon  ====================================================================
B D                   Wallaby  ====================================================================
B D                   Manatee  ====================================================================
B D                  Elephant  ====================================================================
B D           Chinese hamster  ====================================================================
B D                    Tenrec  ====================================================================
  D           Green seaturtle  ====================================================================
B D                       Cat  ====================================================================
B D                  Bushbaby  ====================================================================
  D  Chinese softshell turtle  ====================================================================
  D       Collared flycatcher  ====================================================================
              Bactrian camel  --------------------------------------------------------------------
B D                    Alpaca  --------------------------------------------------------------------
            Black flying-fox  ====================================================================
B D                 Armadillo  ====================================================================

Alignment block 3 of 80 in window, 86584474 - 86584504, 31 bps 
B D                     Human  tgttttttctggacttt-tcatctc------------agctcag
B D                     Chimp  tgttttttctggacttt-tcatctc------------agctcag
B D                   Gorilla  tgttttttctggacttt-tcatctc------------agctcag
B D                 Orangutan  tgttttttctggacttt-tcatctc------------agctcag
B D                    Gibbon  tgttttttctggacttc-tcatctc------------agctcag
B D                    Rhesus  tgttttttctggacttt-tcatctc------------aactcag
B D       Crab-eating macaque  tgttttttctggacttt-tcatctc------------aactcag
B D                    Baboon  tgttttttctggacttt-tcatctc------------aactcag
B D              Green monkey  tgttttttctgaacttt-tcatctc------------aactcag
B D                  Marmoset  tgttttttctggacgct-tcccctc------------aacttag
B D           Squirrel monkey  tattttttct-gatgct-tcccctc------------aacttag
           Chinese tree shrew  tgccctttctaaatgtt-tcctttc------------agtccag
B D                  Squirrel  --ctttttctggatttt-tctgttt------------aacccag
B D            Naked mole-rat  tgctccttccgatcttt-ccctttt------------ggtccta
B D                Guinea pig  tgctcctg-tggtcttt-ccttccc------------agtccca
                   Chinchilla  tgctccttctggcctct-ccctctc------------agtcctg
             Brush-tailed rat  tgctccttctggcctct-ccctcactgatgcagtcatatcccag
B D                       Pig  tgctgtttccctacttt-tcctccc------------agcccag
B D                    Alpaca  tgctctttccctacttt-tccttcc------------agcccag
               Bactrian camel  tgctctttccctaattt-ccctccc------------agcccag
                 Killer whale  tgctgtttccctactct-tcctccc------------agcccag
             Tibetan antelope  tgctatttccatgcttc-tcctccc------------agccatg
B D                       Cow  tgctatttccatgcttc-tcctccc------------agccatg
B D                     Sheep  tgctatttccatgtttc-tcctccc------------agccatg
                Domestic goat  tgctatttccatgcttc-tcctccc------------agccatg
B D                     Horse  ggctctttctggacttg-ccctccc------------agcccag
B D          White rhinoceros  tgctctttctggactgg-tcctccc------------agcccag
B D                       Dog  tgctttttctggacttt-tcctccc------------aactgag
B D                   Ferret   tgctttttctgtatttt-tcctccc------------agctgaa
B D                     Panda  tggtttttctggatttt-tcctccc------------agctggg
               Pacific walrus  tgctctttctggatttt-tcctccc------------agctgag
                 Weddell seal  tgctcttcctggatttt-tcctccc------------agctgag
                Big brown bat  tgt---ttctgaatgtt-tcctccc------------agcccag
         David's myotis (bat)  tgctgatcctgaatgtt-tcctccc------------agcccag
B D                  Microbat  tgctgattctgaatgtt-tcctccc------------agcccag
B D                  Hedgehog  tgttctttctgaacttt-tcttccc------------agtccag
              Star-nosed mole  tgttcttgctggactttcccctctc------------agtccat
              Golden hamster  ============================================
      Lesser Egyptian jerboa  ============================================
B D                       Rat  ============================================
                Prairie vole  ============================================
B D                     Mouse  ============================================
B D                      Pika  ============================================
B D                     Shrew  ============================================
B D                    Rabbit  ============================================
B D                Coelacanth  ============================================
                    Aardvark  ============================================
            Cape golden mole  ============================================
B D                   Megabat  ============================================
B D                   Dolphin  ============================================
B D                    Turkey  ============================================
B D                   Chicken  ============================================
  D              Mallard duck  ============================================
          Tibetan ground jay  ============================================
B D               Zebra finch  ============================================
  D    White-throated sparrow  ============================================
B D           Tasmanian devil  ============================================
  D            Painted turtle  ============================================
B D                Budgerigar  ============================================
B D                   Opossum  ============================================
  D               Rock pigeon  ============================================
B D       Medium ground finch  ============================================
B D                    Lizard  ============================================
  D          Peregrine falcon  ============================================
  D              Saker falcon  ============================================
B D                   Wallaby  ============================================
B D                   Manatee  ============================================
B D                  Elephant  ============================================
B D           Chinese hamster  ============================================
B D                    Tenrec  ============================================
  D           Green seaturtle  ============================================
B D                       Cat  ============================================
B D                  Bushbaby  ============================================
  D  Chinese softshell turtle  ============================================
  D       Collared flycatcher  ============================================
            Black flying-fox  ============================================
B D                 Armadillo  ============================================

Inserts between block 3 and 4 in window
          Chinese tree shrew 458bp

Alignment block 4 of 80 in window, 86584505 - 86584567, 63 bps 
B D                     Human  aa--tgacc------ttattttttttcttttcttagctttact------tccatgaaactgttggaggga
B D                     Chimp  aa--tgccc------ttattttttttcttttcttagctttact------tccatgaaactgttggaggga
B D                   Gorilla  aa--tgccc------ttattttttttcttttcttagctttact------tccatgaaactgttgga-gga
B D                 Orangutan  aa--tgccc------tta-tttttttattttcttagctttact------tccatgaaactgttggaggga
B D                    Gibbon  aa--tgccc------tta-tttttttcttttcttagctttact------tccatgaaactgttggaggga
B D                    Rhesus  aa--tatcc------tta-tttttttcttttcttagctgtact------tccatgaaactgttggaggga
B D       Crab-eating macaque  aa--tatcc------tta-tttttttcttttcttagctgtact------tccatgaaactgttggaggga
B D                    Baboon  aa--tatcc------tta-tttttttcttttcttagctgtact------tccatgaaactgttggaggga
B D              Green monkey  aa--tatcc------tta-tttttttcttttcttagctgtact------tccatgaaactgttggaggga
B D                  Marmoset  aa--gaccc------ttg-ttcttttcttttcttagctttact------tccatgaa-------------
B D           Squirrel monkey  aa--tgccc------ttg-ttcttttattttcttagctttact------ttcatgaaattgttggaggga
           Chinese tree shrew  aa--tgccc------tca-ttttaattatatcttagttttact------tccatgagatttttggagtga
B D                  Squirrel  aa--cgtcc------tca-ttttgtctcag-------cttact------tcgatgaaattgttggaggga
B D            Naked mole-rat  gtgaagctcaccttatca-ctttatataatcttgagctttgct------cccataaagttgttggagaga
B D                Guinea pig  ac--agccc------tca-cttt-----------------------------atgaaattgttggaggga
                   Chinchilla  ac--agccg------tca-ctttctctaatcttcag-tttgct------tccatgaaattgttggaggga
             Brush-tailed rat  ag--agcct------tca-ctttatctaatcttgagctttgct------tccatgaaattgttggaggga
B D                       Pig  aa--catcc------tca-tttgcatc-----tcagtttcaca------tccatgaatttgttggaggaa
B D                    Alpaca  aa--catct------tca-ttttcatc-----ttagctttact------ttcttgaaattgttgagggga
               Bactrian camel  aa--cgtct------tca-ttttcatc-----ttagctttact------ttcttgaaattgttgagggga
                 Killer whale  aa--tgtcc------tca-ttttcatc-----tcagctttacatccatgtccatgaaattgttggaggga
             Tibetan antelope  aa--catcc------cca-gtttcatc-----tgaactttaca------tccatgaaattattggaggga
B D                       Cow  aa--catcc------tca-gtttcatc-----tgaactttaca------tccatgaaattattggaggga
B D                     Sheep  aa--catcc------tca-gtttcatc-----tgaactttaca------tccatgaaattattggaggga
                Domestic goat  aa--catcc------tca-gtttcatc-----tgaactttaca------tccatgaaattattggaggga
B D                     Horse  gg--tgccc------tca-ttttcatctcatcttagctttact------ttcatgaaattgtttggggga
B D          White rhinoceros  aa--ggccc------tca-ttttcatcttagcttagctttact------tccatgaaattgttgtaggga
B D                       Dog  aa--tgctc------tca-ttttcatcttctcatagctttagt------tccatgaaattgttggaggga
B D                   Ferret   aa--tgctc------tca-ttgtcatcttcttttagctttact------tccatgaaattgttggaagga
B D                     Panda  aa--tgctc------ttg-ttttcatcttct-ttagctttact------tccatgaaattgttggaagga
               Pacific walrus  aa--tgctc------tca-ttttcatcttctcttagctttact------tccatgaaattatcggaagga
                 Weddell seal  aa--tgctc------tca-ttttcatcttctcttagctctact------tccatgaaattattggaagga
                Big brown bat  aa--caccc------cca-ttttcatctaagcttagctttact------tccatgcaattgttggaggga
         David's myotis (bat)  aa--caccg------tca-ttttcatctaagcttagctttact------tccatgcaattgttggaggga
B D                  Microbat  aa--caccg------tca-ttttcatctaagcttagctttact------tccatgcaattgttggaggga
B D                  Hedgehog  ag--aaatt------cca-tttccctcaagttccagttttact------tc-atgaaattgttggaggaa
              Star-nosed mole  ag--cacca------gca-ttttcatcttatctttgctttcct------tctgtgaaattgttagaggga
              Golden hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                      Pika  ======================================================================
B D                     Shrew  ======================================================================
B D                    Rabbit  ======================================================================
B D                Coelacanth  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
B D                   Megabat  ======================================================================
B D                   Dolphin  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D           Chinese hamster  ======================================================================
B D                    Tenrec  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Cat  ======================================================================
B D                  Bushbaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
            Black flying-fox  ======================================================================
B D                 Armadillo  ======================================================================

                        Human  aca-----tgtg
                        Chimp  aca-----tgtg
                      Gorilla  aca-----tgtg
                    Orangutan  aca-----tgtg
                       Gibbon  aca-----tgtg
                       Rhesus  acg-----tgtg
          Crab-eating macaque  acg-----tgtg
                       Baboon  atg-----tgtg
                 Green monkey  aca-----tgtg
                     Marmoset  --a-----tgtg
              Squirrel monkey  aca-----tatg
           Chinese tree shrew  cca-----tgta
                     Squirrel  aca-----ctta
               Naked mole-rat  ata-----tatg
                   Guinea pig  gca-----tata
                   Chinchilla  aca-----tgtg
             Brush-tailed rat  act-----tatg
                          Pig  acgaaacgtgtg
                       Alpaca  acaagatgtgtg
               Bactrian camel  acaagacgtgtg
                 Killer whale  acaagacatgtg
             Tibetan antelope  acaagacattta
                          Cow  gcaagacattta
                        Sheep  acaagacattta
                Domestic goat  acaagacattta
                        Horse  acaagacttgtg
             White rhinoceros  acaagacttgtg
                          Dog  acaggttatgtg
                      Ferret   acaagttaagtg
                        Panda  acaagttacgcg
               Pacific walrus  acaagttatgtg
                 Weddell seal  acaagttatgtg
                Big brown bat  ataagatataag
         David's myotis (bat)  ataagatatatg
                     Microbat  ataagatatatg
                     Hedgehog  ttatgatactta
              Star-nosed mole  --agagcatcta
               Golden hamster  ============
       Lesser Egyptian jerboa  ============
                          Rat  ============
                 Prairie vole  ============
                        Mouse  ============
                         Pika  ============
                        Shrew  ============
                       Rabbit  ============
                   Coelacanth  ============
                     Aardvark  ============
             Cape golden mole  ============
                      Megabat  ============
                      Dolphin  ============
                       Turkey  ============
                      Chicken  ============
                 Mallard duck  ============
           Tibetan ground jay  ============
                  Zebra finch  ============
       White-throated sparrow  ============
              Tasmanian devil  ============
               Painted turtle  ============
                   Budgerigar  ============
                      Opossum  ============
                  Rock pigeon  ============
          Medium ground finch  ============
                       Lizard  ============
             Peregrine falcon  ============
                 Saker falcon  ============
                      Wallaby  ============
                      Manatee  ============
                     Elephant  ============
              Chinese hamster  ============
                       Tenrec  ============
              Green seaturtle  ============
                          Cat  ============
                     Bushbaby  ============
     Chinese softshell turtle  ============
          Collared flycatcher  ============
             Black flying-fox  ============
                    Armadillo  ============

Alignment block 5 of 80 in window, 86584568 - 86584576, 9 bps 
B D                     Human  agtagagtt
B D                     Chimp  agtagagtt
B D                   Gorilla  agtagagtt
B D                 Orangutan  agcagagtt
B D                    Gibbon  agtagagtt
B D                    Rhesus  agtagagtt
B D       Crab-eating macaque  agtagagtt
B D                    Baboon  agcagagtt
B D              Green monkey  agtagagtt
B D                  Marmoset  aatagagtt
B D           Squirrel monkey  aatagagtt
           Chinese tree shrew  aataaggtt
B D                  Squirrel  aatagggtt
B D            Naked mole-rat  agtagggtt
B D                Guinea pig  agtagggtt
                   Chinchilla  agcaggacg
             Brush-tailed rat  agtagagtt
B D                      Pika  agtagggct
B D                       Pig  agtaggggt
B D                    Alpaca  agtaggatt
               Bactrian camel  agtaggatt
                 Killer whale  agtagggtg
             Tibetan antelope  agtagggtt
B D                       Cow  agtagggtt
B D                     Sheep  agtagggtt
                Domestic goat  agtagggtt
B D                     Horse  agtagggtt
B D          White rhinoceros  agtagggtt
B D                       Dog  aatagggtt
B D                   Ferret   agtagggtt
B D                     Panda  agtagggtt
               Pacific walrus  agtagggtt
                 Weddell seal  agtggggtt
                Big brown bat  aatagggtt
         David's myotis (bat)  aatagggtt
B D                  Microbat  aatagggtt
B D                  Hedgehog  ggtaggatt
              Star-nosed mole  agtcatatt
              Golden hamster  =========
      Lesser Egyptian jerboa  =========
B D                       Rat  =========
                Prairie vole  =========
B D                     Mouse  =========
B D                     Shrew  =========
B D                    Rabbit  =========
B D                Coelacanth  =========
                    Aardvark  =========
            Cape golden mole  =========
B D                   Megabat  =========
B D                   Dolphin  =========
B D                    Turkey  =========
B D                   Chicken  =========
  D              Mallard duck  =========
          Tibetan ground jay  =========
B D               Zebra finch  =========
  D    White-throated sparrow  =========
B D           Tasmanian devil  =========
  D            Painted turtle  =========
B D                Budgerigar  =========
B D                   Opossum  =========
  D               Rock pigeon  =========
B D       Medium ground finch  =========
B D                    Lizard  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
B D                   Wallaby  =========
B D                   Manatee  =========
B D                  Elephant  =========
B D           Chinese hamster  =========
B D                    Tenrec  =========
  D           Green seaturtle  =========
B D                       Cat  =========
B D                  Bushbaby  =========
  D  Chinese softshell turtle  =========
  D       Collared flycatcher  =========
            Black flying-fox  =========
B D                 Armadillo  =========

Alignment block 6 of 80 in window, 86584577 - 86584604, 28 bps 
B D                     Human  gccaaacgcagtaaata-aaaatacagaa
B D                     Chimp  ggcaaacgcagtaagta-aaaatacagaa
B D                   Gorilla  gccaaacgcagtaaata-aaaatacagaa
B D                 Orangutan  gccaaacgcagtaaata-aaaatacagaa
B D                    Gibbon  gccaaacgcagtaaata-aaattacagaa
B D                    Rhesus  gccaaacccagtaaata-aaaat-cagaa
B D       Crab-eating macaque  gccaaacccagtaaata-aaaat-cagaa
B D                    Baboon  gccaaacccagtaaata-aaaat-cagaa
B D              Green monkey  gccaaacccagtaaata-aaaatacagaa
B D                  Marmoset  gccaaatgcagtaaata-aaaatacagaa
B D           Squirrel monkey  gccaaatgcagtaaata-aaaatacagaa
           Chinese tree shrew  gccagatgcagcaaatg-aaaatacagga
B D                  Squirrel  gccagatatagcaaata-aaagtacagaa
B D            Naked mole-rat  gctaggtacaatgaata-aaaaaaaaaga
B D                Guinea pig  gccagagacagcaaata-aaaatgcatgc
                   Chinchilla  accagatacagcaaata-aaaacacaaga
B D                      Pika  gccagatgcagcaatta-aaagcacagaa
B D                       Pig  gtcagatgtcataaatg-aaaatacagga
B D                    Alpaca  gtcagatgaagcaaatg-aaaatgcagga
               Bactrian camel  gtcagatgtagcaaatg-aaaatacagga
                 Killer whale  gtcagatgtagcaaatg-aaaatacagga
             Tibetan antelope  gtcacatgtagcaaatgaaaaacatggga
B D                       Cow  gtcagatgtagcaaatgaaaaacatggga
B D                     Sheep  gtcacatgtagcaaatgaaaaacatggga
                Domestic goat  gtcacacatagcaaatgaaaaacatggga
B D                     Horse  ggctgaggtagcaaata----ataccgta
B D          White rhinoceros  gccagatgtagcaaata----atactgga
B D                       Dog  gccaagtgtagcaaata----attcagga
B D                   Ferret   gcccagtgcagcgaata----atacagga
B D                     Panda  gccaagtgcagcaaata----atacagga
               Pacific walrus  gctaagtgcagcaaata----atacagga
                 Weddell seal  gctaagtgcagaaaata----atacagga
                Big brown bat  gccgaatgtagcaaata----atacagga
         David's myotis (bat)  gtcgaatgtagcaaata----atacagga
B D                  Microbat  gtcaaatg-agcaaata----atacagga
B D                  Hedgehog  gtcagacgtagcaacaa-caaacacacaa
              Star-nosed mole  gtcagatgtagcaaatg-aaaatatagga
              Golden hamster  =============================
      Lesser Egyptian jerboa  =============================
B D                       Rat  =============================
                Prairie vole  =============================
B D                     Mouse  =============================
B D                     Shrew  =============================
B D                    Rabbit  =============================
B D                Coelacanth  =============================
                    Aardvark  =============================
            Cape golden mole  =============================
B D                   Megabat  =============================
B D                   Dolphin  =============================
B D                    Turkey  =============================
B D                   Chicken  =============================
  D              Mallard duck  =============================
          Tibetan ground jay  =============================
B D               Zebra finch  =============================
  D    White-throated sparrow  =============================
B D           Tasmanian devil  =============================
  D            Painted turtle  =============================
B D                Budgerigar  =============================
B D                   Opossum  =============================
  D               Rock pigeon  =============================
B D       Medium ground finch  =============================
B D                    Lizard  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
B D                   Wallaby  =============================
            Brush-tailed rat  -----------------------------
B D                   Manatee  =============================
B D                  Elephant  =============================
B D           Chinese hamster  =============================
B D                    Tenrec  =============================
  D           Green seaturtle  =============================
B D                       Cat  =============================
B D                  Bushbaby  =============================
  D  Chinese softshell turtle  =============================
  D       Collared flycatcher  =============================
            Black flying-fox  =============================
B D                 Armadillo  =============================

Inserts between block 6 and 7 in window
B D                 Hedgehog 1637bp

Alignment block 7 of 80 in window, 86584605 - 86584641, 37 bps 
B D                     Human  tgctcagttaaatttgaatttcagataggaagcaagt
B D                     Chimp  tgctcagttaaatttgaatttcagataggaagcaagt
B D                   Gorilla  tgctcagttaaatttgaatttcagataggaagcaagt
B D                 Orangutan  tgctcagttaaattcgaatttcagataggaagcaagt
B D                    Gibbon  tgctcagttaaatttgaatttcagataggaagcaagt
B D                    Rhesus  tgctcagttaactttgaatttgagataggaagcgagt
B D       Crab-eating macaque  tgctcagttaactttgaatttgagataggaagcgagt
B D                    Baboon  tgctcagttaactttgaatttgagataggaagcgagt
B D              Green monkey  tgttcagttaactttgaatttcagataggaagtgagt
B D                  Marmoset  tactcagccacatttgaatttcagataggaagcaagt
B D           Squirrel monkey  tactcagttacatttgaatttcagacaggaagcaagt
           Chinese tree shrew  cgcccagttaaatttaaatttcagatagacaatctgt
B D                  Squirrel  agcccagttaaatttgaatttcag-gtaggaaaaaat
B D            Naked mole-rat  tgctctgctaaatttgaatttcagagagacaacaaat
B D                Guinea pig  tgctctgctgaatttgagcttcag-gagatgacaaac
                   Chinchilla  tgctctgctaaatttgaatttcag-gggacaacaag-
B D                      Pika  tgcccagttaaatttgaattttaa-tagaagacag--
B D                       Pig  ctcccagttaaatctgaatttcagagagaaaacaaac
B D                    Alpaca  tggtcagttacatttgaatttc---------act---
               Bactrian camel  tgatcagttatatttgaatttc---------act---
                 Killer whale  tggccagttaaatttgaatttcagatagacaacaaat
             Tibetan antelope  tgcccaattaactttgaatttcagatagac-acaaat
B D                       Cow  tgcccaattaactttgaatttcagatagac-acaaat
B D                     Sheep  tgcccaattaactttgaatttcagatagac-acaaat
                Domestic goat  tgcccaattaactttgaatttcagatagac-acaaat
B D                     Horse  tgcccagctaaatttgaatttcagagagaaaacaagt
B D          White rhinoceros  tgcccagttaaatttgaatttcagagagaaaacaaat
B D                       Dog  ttcccagttacatttgaatttcagagagacaaca---
B D                   Ferret   ttcccagttaaacttgaattttagatggacaacacat
B D                     Panda  ttcccagttaaatttgaattttagatagacaacaaat
               Pacific walrus  ttcccagttaaatttgaattttagatagacaacaaat
                 Weddell seal  ttcccagttaaattggaattttagacagacaacaaat
                Big brown bat  tgctcagttaaatttgaatttcaagtagatagcaaat
         David's myotis (bat)  tgttcagttcaatttgaatttcagatagatagcaaat
B D                  Microbat  tgttcagttcaatttgaatttcagatagatagcaaat
              Star-nosed mole  tttccaattaaatttgaatttcagatagaaggcaaat
              Golden hamster  =====================================
      Lesser Egyptian jerboa  =====================================
B D                       Rat  =====================================
                Prairie vole  =====================================
B D                     Mouse  =====================================
B D                     Shrew  =====================================
B D                  Hedgehog  =====================================
B D                    Rabbit  =====================================
B D                Coelacanth  =====================================
                    Aardvark  =====================================
            Cape golden mole  =====================================
B D                   Megabat  =====================================
B D                   Dolphin  =====================================
B D                    Turkey  =====================================
B D                   Chicken  =====================================
  D              Mallard duck  =====================================
          Tibetan ground jay  =====================================
B D               Zebra finch  =====================================
  D    White-throated sparrow  =====================================
B D           Tasmanian devil  =====================================
  D            Painted turtle  =====================================
B D                Budgerigar  =====================================
B D                   Opossum  =====================================
  D               Rock pigeon  =====================================
B D       Medium ground finch  =====================================
B D                    Lizard  =====================================
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
B D                   Wallaby  =====================================
            Brush-tailed rat  -------------------------------------
B D                   Manatee  =====================================
B D                  Elephant  =====================================
B D           Chinese hamster  =====================================
B D                    Tenrec  =====================================
  D           Green seaturtle  =====================================
B D                       Cat  =====================================
B D                  Bushbaby  =====================================
  D  Chinese softshell turtle  =====================================
  D       Collared flycatcher  =====================================
            Black flying-fox  =====================================
B D                 Armadillo  =====================================

Inserts between block 7 and 8 in window
B D                      Pig 4bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 3bp
B D                    Sheep 3bp
               Domestic goat 3bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Dog 1bp
B D                    Panda 538bp
             Star-nosed mole 5bp

Alignment block 8 of 80 in window, 86584642 - 86584647, 6 bps 
B D                     Human  aa-tttt
B D                     Chimp  aa-tttt
B D                   Gorilla  aa-tttt
B D                 Orangutan  aa-tttt
B D                    Gibbon  aa-tttt
B D                    Rhesus  ac-tttt
B D       Crab-eating macaque  ac-tttt
B D                    Baboon  ac-tttt
B D              Green monkey  ac-tttt
B D                  Marmoset  aa-tttt
B D           Squirrel monkey  aa-ttct
           Chinese tree shrew  ca-tttt
B D                  Squirrel  aattttt
B D            Naked mole-rat  aa-ttct
B D                Guinea pig  aa-tttt
                   Chinchilla  ga-tttt
B D                      Pika  ---tttt
B D                       Pig  ---ttt-
B D                    Alpaca  ----tt-
               Bactrian camel  ----tt-
                 Killer whale  ---ttt-
             Tibetan antelope  ----tt-
B D                       Cow  ---ttt-
B D                     Sheep  ----tt-
                Domestic goat  ----tt-
B D                     Horse  ac-ttt-
B D          White rhinoceros  ac-att-
B D                       Dog  at-ctt-
B D                   Ferret   ---ctt-
               Pacific walrus  ---ctt-
                 Weddell seal  ---ctt-
                Big brown bat  aa-ttt-
         David's myotis (bat)  ca-ttt-
B D                  Microbat  ca-ttt-
              Star-nosed mole  at-ttt-
              Golden hamster  =======
      Lesser Egyptian jerboa  =======
B D                       Rat  =======
                Prairie vole  =======
B D                     Mouse  =======
B D                     Shrew  =======
B D                  Hedgehog  =======
B D                    Rabbit  =======
B D                Coelacanth  =======
                    Aardvark  =======
            Cape golden mole  =======
B D                   Megabat  =======
B D                   Dolphin  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
  D    White-throated sparrow  =======
B D           Tasmanian devil  =======
  D            Painted turtle  =======
B D                Budgerigar  =======
B D                   Opossum  =======
  D               Rock pigeon  =======
B D       Medium ground finch  =======
B D                    Lizard  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
B D                   Wallaby  =======
            Brush-tailed rat  -------
B D                   Manatee  =======
B D                  Elephant  =======
B D           Chinese hamster  =======
B D                    Tenrec  =======
  D           Green seaturtle  =======
B D                       Cat  =======
B D                  Bushbaby  =======
  D  Chinese softshell turtle  =======
  D       Collared flycatcher  =======
B D                     Panda  =======
            Black flying-fox  =======
B D                 Armadillo  =======

Inserts between block 8 and 9 in window
B D                  Ferret  3bp
              Pacific walrus 482bp
                Weddell seal 552bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp

Alignment block 9 of 80 in window, 86584648 - 86584657, 10 bps 
B D                     Human  t--aaataatat
B D                     Chimp  t--aaataatat
B D                   Gorilla  t--aaataatat
B D                 Orangutan  t--aaataatat
B D                    Gibbon  t--aaataatat
B D                    Rhesus  t--aaacaatat
B D       Crab-eating macaque  t--aaacaatat
B D                    Baboon  t--aaataatat
B D              Green monkey  t--aaataatat
B D                  Marmoset  t--aaataatac
B D           Squirrel monkey  t--aaacaatac
           Chinese tree shrew  t----attatgg
B D                  Squirrel  t----attattt
B D            Naked mole-rat  t----attaaat
B D                Guinea pig  t----attaaat
                   Chinchilla  t----attaaac
B D                      Pika  taaaaattattt
B D                       Pig  t--ccattatat
B D                    Alpaca  t--tcattatgt
               Bactrian camel  t--tcattatgt
                 Killer whale  t--tcattttat
             Tibetan antelope  t--ttgttatat
B D                       Cow  t--ttgttatat
B D                     Sheep  t--ttgttatat
                Domestic goat  t--ttgttatat
B D                     Horse  t--tcattatat
B D          White rhinoceros  t--tcatt----
B D                       Dog  t--tcattatat
B D                   Ferret   -----ataatat
                Big brown bat  t--cagttatat
         David's myotis (bat)  t--cagttatat
B D                  Microbat  t--tagttatat
              Star-nosed mole  t--tcatcttat
              Golden hamster  ============
      Lesser Egyptian jerboa  ============
B D                       Rat  ============
                Prairie vole  ============
B D                     Mouse  ============
B D                     Shrew  ============
B D                  Hedgehog  ============
B D                    Rabbit  ============
B D                Coelacanth  ============
                    Aardvark  ============
            Cape golden mole  ============
B D                   Megabat  ============
B D                   Dolphin  ============
B D                    Turkey  ============
B D                   Chicken  ============
  D              Mallard duck  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
  D    White-throated sparrow  ============
B D           Tasmanian devil  ============
  D            Painted turtle  ============
B D                Budgerigar  ============
B D                   Opossum  ============
  D               Rock pigeon  ============
B D       Medium ground finch  ============
B D                    Lizard  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
B D                   Wallaby  ============
            Brush-tailed rat  ------------
B D                   Manatee  ============
B D                  Elephant  ============
B D           Chinese hamster  ============
B D                    Tenrec  ============
  D           Green seaturtle  ============
B D                       Cat  ============
B D                  Bushbaby  ============
                Weddell seal  ============
  D  Chinese softshell turtle  ============
  D       Collared flycatcher  ============
              Pacific walrus  ============
B D                     Panda  ============
            Black flying-fox  ============
B D                 Armadillo  ============

Inserts between block 9 and 10 in window
B D         White rhinoceros 97bp
B D                      Dog 699bp
B D                  Ferret  3bp

Alignment block 10 of 80 in window, 86584658 - 86584673, 16 bps 
B D                     Human  gtgtg--------------tt---ccaaatat--t
B D                     Chimp  gtgag--------------tt---ccaaatat--t
B D                   Gorilla  gtgag--------------tt---ccaaatat--t
B D                 Orangutan  gtgag--------------tt---ccaaatat--t
B D                    Gibbon  gtgag--------------tt---ccagatat--t
B D                    Rhesus  gcgag--------------tt---ccaaatat--t
B D       Crab-eating macaque  gcgag--------------tt---ccaaatat--t
B D                    Baboon  gcgag--------------tt---ccaaatat--t
B D              Green monkey  gcgag--------------tt---ccaaatat--t
B D                  Marmoset  gtgag--------------tc---ccaaatat--t
B D           Squirrel monkey  gtgag--------------tc---ccaaatat--t
           Chinese tree shrew  atatg--------------tc---tcagaaaa--t
B D                  Squirrel  atata--------------tt---gcaaatat--t
B D            Naked mole-rat  gtata--------------tt---ccacagag--t
B D                Guinea pig  gtcta--------------tt---ccacatag--t
                   Chinchilla  gtgcaacatgggatgcattta---ttaaatag--t
B D                      Pika  gtatg--------------tc---ccaaatat--t
B D                       Pig  gtatg--------------tc---cctaatgt---
B D                    Alpaca  gtatg--------------tc---ccaagtat---
               Bactrian camel  gtatg--------------tc---ccaagtat---
                 Killer whale  gtgtg--------------tc---ctaaatat---
             Tibetan antelope  gcatg--------------tc---ccaaatat---
B D                       Cow  gtatg--------------tc---ccaaatat---
B D                     Sheep  gcatg--------------tc---ccaaatat---
                Domestic goat  gcatg--------------tc---ccaaatat---
B D                     Horse  gtatg--------------tc---ccaaatatt--
B D                   Ferret   ---tt--------------ttaaaacaaaaatt--
                Big brown bat  gtatg--------------tc---tcaaatgtt--
         David's myotis (bat)  gtatg--------------tc---tcaaatatt--
B D                  Microbat  gtatg--------------tc---tcaaatatt--
              Star-nosed mole  ttatg--------------tc---ccaaatat-t-
              Golden hamster  ===================================
      Lesser Egyptian jerboa  ===================================
B D                       Rat  ===================================
                Prairie vole  ===================================
B D                     Mouse  ===================================
B D                     Shrew  ===================================
B D                  Hedgehog  ===================================
B D                    Rabbit  ===================================
B D                Coelacanth  ===================================
                    Aardvark  ===================================
            Cape golden mole  ===================================
B D                   Megabat  ===================================
B D                   Dolphin  ===================================
B D                    Turkey  ===================================
B D                   Chicken  ===================================
  D              Mallard duck  ===================================
          Tibetan ground jay  ===================================
B D               Zebra finch  ===================================
  D    White-throated sparrow  ===================================
B D           Tasmanian devil  ===================================
  D            Painted turtle  ===================================
B D                Budgerigar  ===================================
B D                   Opossum  ===================================
  D               Rock pigeon  ===================================
B D       Medium ground finch  ===================================
B D                    Lizard  ===================================
  D          Peregrine falcon  ===================================
  D              Saker falcon  ===================================
B D                   Wallaby  ===================================
            Brush-tailed rat  -----------------------------------
B D                   Manatee  ===================================
B D                  Elephant  ===================================
B D           Chinese hamster  ===================================
B D                    Tenrec  ===================================
  D           Green seaturtle  ===================================
B D                       Cat  ===================================
B D                  Bushbaby  ===================================
                Weddell seal  ===================================
  D  Chinese softshell turtle  ===================================
  D       Collared flycatcher  ===================================
              Pacific walrus  ===================================
B D                     Panda  ===================================
B D                       Dog  ===================================
            Black flying-fox  ===================================
B D          White rhinoceros  ===================================
B D                 Armadillo  ===================================

Inserts between block 10 and 11 in window
B D                  Ferret  430bp

Alignment block 11 of 80 in window, 86584674 - 86584729, 56 bps 
B D                     Human  gcagcatgggacatgggtatag-t---aaaaaatgatttgttgtttatctgaaattcaaa
B D                     Chimp  gcagcatgggacatgggtatag-t---aaaaaatgatttgttgtttatctgaaattcaaa
B D                   Gorilla  gcagcatgggacatgggtatag-t--aaaaaaatgatttgttgtttatctgaaattcaaa
B D                 Orangutan  gcagcatgggacatgggtatag-t---aaaaagtgatttgttgtttatctgaaattcaaa
B D                    Gibbon  gcagcatgggacatgggtatag-t---aaaaaatgatttgttgtttatctgaaattcaaa
B D                    Rhesus  gcagtatgggacatgggtatag-t---aaaaaatgatttgttgtttatctgaaattcaaa
B D       Crab-eating macaque  gcagtatgggacatgggtatag-t---aaaaaatgatttgttgtttatctgaaattcaaa
B D                    Baboon  gcagtatgggacatgggtatag-t---aaaaaacgatttgttgtttatctgaaattcaaa
B D              Green monkey  gcagtatgggacatgggtatag-t---aaaaaacgatttgttgtttatctgaaattcaaa
B D                  Marmoset  gcagcttgggaagtgggtatag-t---aaaaaatgatttgttgtctatgtgaaattcaaa
B D           Squirrel monkey  gcagcctgggaagtgggtatag-t---aaaaaatgatttgttgtttatctgaaattcaaa
           Chinese tree shrew  gcagtgtgggaaacacttatac-t---aaaaaatgactggttgtttatctaaaatttaaa
B D                  Squirrel  gcagcatgggatgaactta-ac-t---aaaaaataatttgtt---tatttgaaattcaaa
B D            Naked mole-rat  acaacatgggatgcacttgtat-t---aaacattcattcatt---tatctgaagttcaaa
B D                Guinea pig  gtatcatgggatgcatttttat-t---aaacattagttcatt---tatctgaaattcaaa
                   Chinchilla  acaacatggaatgcatttgtac-t---aagcattagttcatt---tatctgaaattcaaa
B D                      Pika  gcattgtggaaag-acatatgc-t---aaaaaatgatttattg-ctatctgatattcaag
B D                       Pig  gcattgtgggccatacttaatgca---gaaaaatgattcc----ttatctgaaattcaaa
B D                    Alpaca  gcagtatgggacatgcac-----t---gaaaaatgatcca----ttatctgaaattcata
               Bactrian camel  gcagtatgggacatgcac-----t---gaaaaatgatcca----ttatctgaaattcata
                 Killer whale  gcagtgtgggacatatttagcaat---gaaaaatgattca----ctatctgaaattcaaa
             Tibetan antelope  gcag-------------------t---gaaaaatgattca----gtatctgtaatgcaaa
B D                       Cow  gcagtgtgggacatacttaacact---gaaaaatgattca----atatctgtagtccaaa
B D                     Sheep  gcag-------------------t---gaaaaatggttca----atatctgtaatccaaa
                Domestic goat  gcag-------------------t---gaaaaatgattca----atatctgtaatccaaa
B D                     Horse  gtagcatgggacatatttatat-t---agaaaa--atttgaaatttctctgaaat-----
                Big brown bat  aaaacgtgggacatactaatac-taaaaaaaaatgattaattgtttatctgaaattcaaa
         David's myotis (bat)  acaacgtgggacatactaatac-t---aaaaaatgattcgttgtttatctgaaattcaaa
B D                  Microbat  aaaacgtgggacatactaatac-t---aaaaaatgattcgttgttcatctgaaattcaaa
              Star-nosed mole  gcagcctttgacaaatatac---a---caaaaccggttgt----ttatctgaaattaaat
              Golden hamster  ============================================================
      Lesser Egyptian jerboa  ============================================================
B D                       Rat  ============================================================
                Prairie vole  ============================================================
B D                     Mouse  ============================================================
B D                     Shrew  ============================================================
B D                  Hedgehog  ============================================================
B D                    Rabbit  ============================================================
B D                Coelacanth  ============================================================
                    Aardvark  ============================================================
            Cape golden mole  ============================================================
B D                   Megabat  ============================================================
B D                   Dolphin  ============================================================
B D                    Turkey  ============================================================
B D                   Chicken  ============================================================
  D              Mallard duck  ============================================================
          Tibetan ground jay  ============================================================
B D               Zebra finch  ============================================================
  D    White-throated sparrow  ============================================================
B D           Tasmanian devil  ============================================================
  D            Painted turtle  ============================================================
B D                Budgerigar  ============================================================
B D                   Opossum  ============================================================
  D               Rock pigeon  ============================================================
B D       Medium ground finch  ============================================================
B D                    Lizard  ============================================================
  D          Peregrine falcon  ============================================================
  D              Saker falcon  ============================================================
B D                   Wallaby  ============================================================
            Brush-tailed rat  ------------------------------------------------------------
B D                   Manatee  ============================================================
B D                  Elephant  ============================================================
B D           Chinese hamster  ============================================================
B D                    Tenrec  ============================================================
  D           Green seaturtle  ============================================================
B D                       Cat  ============================================================
B D                  Bushbaby  ============================================================
                Weddell seal  ============================================================
  D  Chinese softshell turtle  ============================================================
B D                   Ferret   ============================================================
  D       Collared flycatcher  ============================================================
              Pacific walrus  ============================================================
B D                     Panda  ============================================================
B D                       Dog  ============================================================
            Black flying-fox  ============================================================
B D          White rhinoceros  ============================================================
B D                 Armadillo  ============================================================

Inserts between block 11 and 12 in window
                  Chinchilla 32bp

Alignment block 12 of 80 in window, 86584730 - 86584730, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
           Chinese tree shrew  t
B D                  Squirrel  t
B D                Guinea pig  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
              Star-nosed mole  t
              Golden hamster  =
      Lesser Egyptian jerboa  =
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                    Rabbit  =
B D                Coelacanth  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  =
B D                   Dolphin  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
B D                Budgerigar  =
B D                   Opossum  =
                  Chinchilla  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                   Wallaby  =
            Brush-tailed rat  -
B D                   Manatee  =
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  =
  D           Green seaturtle  =
B D                       Cat  =
B D                  Bushbaby  =
                Weddell seal  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
  D       Collared flycatcher  =
              Pacific walrus  =
B D                     Panda  =
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                 Armadillo  =

Alignment block 13 of 80 in window, 86584731 - 86584734, 4 bps 
B D                     Human  ataa
B D                     Chimp  ataa
B D                   Gorilla  ataa
B D                 Orangutan  ataa
B D                    Gibbon  ataa
B D                    Rhesus  gtaa
B D       Crab-eating macaque  gtaa
B D                    Baboon  ataa
B D              Green monkey  ataa
B D                  Marmoset  ataa
B D           Squirrel monkey  ataa
           Chinese tree shrew  gtaa
B D                  Squirrel  ttga
B D                Guinea pig  ggat
B D                      Pika  ttta
B D                       Pig  ctaa
               Bactrian camel  ttaa
                 Killer whale  ttaa
             Tibetan antelope  ttaa
B D                       Cow  ttaa
B D                     Sheep  ttaa
                Domestic goat  ttaa
B D                     Horse  ttaa
                Big brown bat  ttga
         David's myotis (bat)  ttga
B D                  Microbat  ttga
              Star-nosed mole  --aa
              Golden hamster  ====
      Lesser Egyptian jerboa  ====
B D                       Rat  ====
                Prairie vole  ====
B D                     Mouse  ====
B D                     Shrew  ====
B D                  Hedgehog  ====
B D                    Rabbit  ====
B D                Coelacanth  ====
                    Aardvark  ====
            Cape golden mole  ====
B D                   Megabat  ====
B D                   Dolphin  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
B D                Budgerigar  ====
B D                   Opossum  ====
                  Chinchilla  ====
B D            Naked mole-rat  ----
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                   Wallaby  ====
            Brush-tailed rat  ----
B D                   Manatee  ====
B D                  Elephant  ====
B D           Chinese hamster  ====
B D                    Tenrec  ====
  D           Green seaturtle  ====
B D                       Cat  ====
B D                  Bushbaby  ====
                Weddell seal  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   ====
  D       Collared flycatcher  ====
B D                    Alpaca  ----
              Pacific walrus  ====
B D                     Panda  ====
B D                       Dog  ====
            Black flying-fox  ====
B D          White rhinoceros  ====
B D                 Armadillo  ====

Inserts between block 13 and 14 in window
              Bactrian camel 25bp
             Star-nosed mole 1bp

Alignment block 14 of 80 in window, 86584735 - 86584738, 4 bps 
B D                     Human  ctgg
B D                     Chimp  ctgg
B D                   Gorilla  ctgg
B D                 Orangutan  ctgg
B D                    Gibbon  ctgg
B D                    Rhesus  ccgg
B D       Crab-eating macaque  ccgg
B D                    Baboon  ctgg
B D              Green monkey  ctgg
B D                  Marmoset  ctgg
B D           Squirrel monkey  ctgg
           Chinese tree shrew  ctgc
B D                  Squirrel  ctgg
B D                Guinea pig  atgg
B D                      Pika  ctga
B D                       Pig  ttgg
                 Killer whale  ctgg
             Tibetan antelope  ctgg
B D                       Cow  ctgg
B D                     Sheep  ctgg
                Domestic goat  ctgg
B D                     Horse  ccgg
                Big brown bat  ccgg
         David's myotis (bat)  ctgg
B D                  Microbat  ctgg
              Star-nosed mole  ctga
              Golden hamster  ====
      Lesser Egyptian jerboa  ====
B D                       Rat  ====
                Prairie vole  ====
B D                     Mouse  ====
B D                     Shrew  ====
B D                  Hedgehog  ====
B D                    Rabbit  ====
B D                Coelacanth  ====
                    Aardvark  ====
            Cape golden mole  ====
B D                   Megabat  ====
B D                   Dolphin  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
B D                Budgerigar  ====
B D                   Opossum  ====
                  Chinchilla  ====
B D            Naked mole-rat  ----
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                   Wallaby  ====
            Brush-tailed rat  ----
B D                   Manatee  ====
B D                  Elephant  ====
B D           Chinese hamster  ====
B D                    Tenrec  ====
  D           Green seaturtle  ====
B D                       Cat  ====
B D                  Bushbaby  ====
                Weddell seal  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   ====
  D       Collared flycatcher  ====
              Bactrian camel  ====
B D                    Alpaca  ----
              Pacific walrus  ====
B D                     Panda  ====
B D                       Dog  ====
            Black flying-fox  ====
B D          White rhinoceros  ====
B D                 Armadillo  ====

Alignment block 15 of 80 in window, 86584739 - 86584743, 5 bps 
B D                     Human  ctgtc
B D                     Chimp  ctgtc
B D                   Gorilla  ctttc
B D                 Orangutan  ctgtc
B D                    Gibbon  ctgtc
B D                    Rhesus  cagtc
B D       Crab-eating macaque  cagtc
B D                    Baboon  cagtc
B D              Green monkey  tagtc
B D                  Marmoset  ctgtc
B D           Squirrel monkey  ctgtc
           Chinese tree shrew  ctatc
B D                  Squirrel  ctctc
B D                Guinea pig  ctctt
B D                      Pika  ctgcc
B D                       Pig  ccatc
                 Killer whale  tcatc
             Tibetan antelope  ccacc
B D                       Cow  ccacc
B D                     Sheep  ccacc
                Domestic goat  ccgcc
                Big brown bat  gcgtc
         David's myotis (bat)  gtgtc
B D                  Microbat  gtgtc
              Star-nosed mole  ttatt
              Golden hamster  =====
      Lesser Egyptian jerboa  =====
B D                       Rat  =====
                Prairie vole  =====
B D                     Mouse  =====
B D                     Shrew  =====
B D                  Hedgehog  =====
B D                    Rabbit  =====
B D                Coelacanth  =====
                    Aardvark  =====
            Cape golden mole  =====
B D                   Megabat  =====
B D                   Dolphin  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
  D            Painted turtle  =====
B D                Budgerigar  =====
B D                   Opossum  =====
                  Chinchilla  =====
B D            Naked mole-rat  -----
  D               Rock pigeon  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                   Wallaby  =====
            Brush-tailed rat  -----
B D                   Manatee  =====
B D                  Elephant  =====
B D           Chinese hamster  =====
B D                    Tenrec  =====
  D           Green seaturtle  =====
B D                       Cat  =====
B D                  Bushbaby  =====
                Weddell seal  =====
  D  Chinese softshell turtle  =====
B D                   Ferret   =====
  D       Collared flycatcher  =====
              Bactrian camel  =====
B D                    Alpaca  -----
              Pacific walrus  =====
B D                     Panda  =====
B D                       Dog  =====
            Black flying-fox  =====
B D          White rhinoceros  =====
B D                     Horse  -----
B D                 Armadillo  =====

Alignment block 16 of 80 in window, 86584744 - 86584744, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
           Chinese tree shrew  c
B D                Guinea pig  c
B D                      Pika  c
B D                       Pig  t
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
              Star-nosed mole  g
              Golden hamster  =
      Lesser Egyptian jerboa  =
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                    Rabbit  =
B D                Coelacanth  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  =
B D                   Dolphin  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
B D                Budgerigar  =
B D                   Opossum  =
                  Chinchilla  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                   Wallaby  =
            Brush-tailed rat  -
B D                   Manatee  =
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  =
  D           Green seaturtle  =
B D                       Cat  =
B D                  Bushbaby  =
                Weddell seal  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
  D       Collared flycatcher  =
              Bactrian camel  =
B D                    Alpaca  -
              Pacific walrus  =
B D                     Panda  =
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                  Squirrel  -
B D                 Armadillo  =

Inserts between block 16 and 17 in window
               Big brown bat 18bp
        David's myotis (bat) 18bp
B D                 Microbat 18bp

Alignment block 17 of 80 in window, 86584745 - 86584757, 13 bps 
B D                     Human  tg--tactttatctg
B D                     Chimp  tg--tactttatctg
B D                   Gorilla  tg--tactttatctg
B D                 Orangutan  tg--tactttatctg
B D                    Gibbon  tg--tactttatctg
B D                    Rhesus  tg--tacttgatctg
B D       Crab-eating macaque  tg--tacttgatctg
B D                    Baboon  tg--tacttgatctg
B D              Green monkey  tg--tacttgatctg
B D                  Marmoset  tg--gattttatctg
B D           Squirrel monkey  tg--tattttatctg
           Chinese tree shrew  ta--tactttatgtg
B D            Naked mole-rat  -------------t-
B D                Guinea pig  tg--agctttatctg
B D                      Pika  tg--tattttatctg
B D                       Pig  ta--tgttttacctg
                 Killer whale  tg--ttttcttccct
             Tibetan antelope  ta--ttttttttttt
B D                       Cow  ta--t----------
B D                     Sheep  tatttttttttttta
                Domestic goat  ta--tttttttttta
              Star-nosed mole  ta--tattttatctg
              Golden hamster  ===============
      Lesser Egyptian jerboa  ===============
B D                       Rat  ===============
                Prairie vole  ===============
B D                     Mouse  ===============
B D                     Shrew  ===============
B D                  Hedgehog  ===============
B D                    Rabbit  ===============
B D                Coelacanth  ===============
                    Aardvark  ===============
            Cape golden mole  ===============
B D                   Megabat  ===============
B D                   Dolphin  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
          Tibetan ground jay  ===============
B D               Zebra finch  ===============
  D    White-throated sparrow  ===============
B D           Tasmanian devil  ===============
  D            Painted turtle  ===============
B D                Budgerigar  ===============
B D                   Opossum  ===============
                  Chinchilla  ===============
  D               Rock pigeon  ===============
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
B D                   Wallaby  ===============
            Brush-tailed rat  ---------------
B D                   Manatee  ===============
B D                  Elephant  ===============
B D           Chinese hamster  ===============
B D                    Tenrec  ===============
  D           Green seaturtle  ===============
B D                       Cat  ===============
B D                  Bushbaby  ===============
                Weddell seal  ===============
  D  Chinese softshell turtle  ===============
B D                   Ferret   ===============
  D       Collared flycatcher  ===============
              Bactrian camel  ===============
B D                    Alpaca  ---------------
               Big brown bat  ===============
              Pacific walrus  ===============
B D                     Panda  ===============
B D                       Dog  ===============
            Black flying-fox  ===============
B D          White rhinoceros  ===============
B D                     Horse  ---------------
B D                  Squirrel  ---------------
        David's myotis (bat)  ===============
B D                  Microbat  ===============
B D                 Armadillo  ===============

Inserts between block 17 and 18 in window
                Killer whale 1bp
            Tibetan antelope 6bp
B D                    Sheep 5bp
               Domestic goat 5bp

Alignment block 18 of 80 in window, 86584758 - 86584758, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                Guinea pig  g
B D                      Pika  a
B D                       Pig  g
                 Killer whale  g
             Tibetan antelope  g
                Domestic goat  g
              Star-nosed mole  g
              Golden hamster  =
      Lesser Egyptian jerboa  =
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                    Rabbit  =
B D                Coelacanth  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  =
B D                   Dolphin  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
B D                Budgerigar  =
B D                   Opossum  =
                  Chinchilla  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                   Wallaby  =
            Brush-tailed rat  -
          Chinese tree shrew  -
B D                   Manatee  =
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  =
  D           Green seaturtle  =
B D                       Cat  =
B D                  Bushbaby  =
                Weddell seal  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
B D                     Sheep  =
  D       Collared flycatcher  =
              Bactrian camel  =
B D                    Alpaca  -
               Big brown bat  =
              Pacific walrus  =
B D                     Panda  =
B D                       Cow  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                  Squirrel  -
        David's myotis (bat)  =
B D                  Microbat  =
B D                 Armadillo  =

Alignment block 19 of 80 in window, 86584759 - 86584761, 3 bps 
B D                     Human  taa
B D                     Chimp  taa
B D                   Gorilla  taa
B D                 Orangutan  taa
B D                    Gibbon  taa
B D                    Rhesus  taa
B D       Crab-eating macaque  taa
B D                    Baboon  taa
B D              Green monkey  taa
B D                  Marmoset  taa
B D           Squirrel monkey  taa
B D                      Pika  cag
B D                       Pig  caa
                 Killer whale  caa
             Tibetan antelope  caa
                Domestic goat  caa
              Star-nosed mole  caa
              Golden hamster  ===
      Lesser Egyptian jerboa  ===
B D                       Rat  ===
                Prairie vole  ===
B D                     Mouse  ===
B D                     Shrew  ===
B D                  Hedgehog  ===
B D                Guinea pig  ---
B D                    Rabbit  ===
B D                Coelacanth  ===
                    Aardvark  ===
            Cape golden mole  ===
B D                   Megabat  ===
B D                   Dolphin  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
B D                Budgerigar  ===
B D                   Opossum  ===
                  Chinchilla  ===
B D            Naked mole-rat  ---
  D               Rock pigeon  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                   Wallaby  ===
            Brush-tailed rat  ---
          Chinese tree shrew  ---
B D                   Manatee  ===
B D                  Elephant  ===
B D           Chinese hamster  ===
B D                    Tenrec  ===
  D           Green seaturtle  ===
B D                       Cat  ===
B D                  Bushbaby  ===
                Weddell seal  ===
  D  Chinese softshell turtle  ===
B D                   Ferret   ===
B D                     Sheep  ===
  D       Collared flycatcher  ===
              Bactrian camel  ===
B D                    Alpaca  ---
               Big brown bat  ===
              Pacific walrus  ===
B D                     Panda  ===
B D                       Cow  ---
B D                       Dog  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
B D                     Horse  ---
B D                  Squirrel  ---
        David's myotis (bat)  ===
B D                  Microbat  ===
B D                 Armadillo  ===

Inserts between block 19 and 20 in window
B D                      Pig 404bp

Alignment block 20 of 80 in window, 86584762 - 86584767, 6 bps 
B D                     Human  acatac
B D                     Chimp  acatac
B D                   Gorilla  acatac
B D                 Orangutan  gcatac
B D                    Gibbon  acatac
B D                    Rhesus  ccatat
B D       Crab-eating macaque  ccatat
B D                    Baboon  ccatat
B D              Green monkey  ccatat
B D                  Marmoset  ccatac
B D           Squirrel monkey  ccatac
B D                      Pika  acactc
                 Killer whale  ccctac
             Tibetan antelope  ccctac
                Domestic goat  ccctac
              Star-nosed mole  tgttac
              Golden hamster  ======
      Lesser Egyptian jerboa  ======
B D                       Rat  ======
                Prairie vole  ======
B D                     Mouse  ======
B D                     Shrew  ======
B D                  Hedgehog  ======
B D                Guinea pig  ------
B D                    Rabbit  ======
B D                Coelacanth  ======
                    Aardvark  ======
            Cape golden mole  ======
B D                       Pig  ======
B D                   Megabat  ======
B D                   Dolphin  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
  D            Painted turtle  ======
B D                Budgerigar  ======
B D                   Opossum  ======
                  Chinchilla  ======
B D            Naked mole-rat  ------
  D               Rock pigeon  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D                   Wallaby  ======
            Brush-tailed rat  ------
          Chinese tree shrew  ------
B D                   Manatee  ======
B D                  Elephant  ======
B D           Chinese hamster  ======
B D                    Tenrec  ======
  D           Green seaturtle  ======
B D                       Cat  ======
B D                  Bushbaby  ======
                Weddell seal  ======
  D  Chinese softshell turtle  ======
B D                   Ferret   ======
B D                     Sheep  ======
  D       Collared flycatcher  ======
              Bactrian camel  ======
B D                    Alpaca  ------
               Big brown bat  ======
              Pacific walrus  ======
B D                     Panda  ======
B D                       Cow  ------
B D                       Dog  ======
            Black flying-fox  ======
B D          White rhinoceros  ======
B D                     Horse  ------
B D                  Squirrel  ------
        David's myotis (bat)  ======
B D                  Microbat  ======
B D                 Armadillo  ======

Inserts between block 20 and 21 in window
            Tibetan antelope 3bp
               Domestic goat 3bp

Alignment block 21 of 80 in window, 86584768 - 86584769, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D                    Baboon  ca
B D              Green monkey  ca
B D                  Marmoset  at
B D           Squirrel monkey  tt
B D                      Pika  gc
              Golden hamster  ==
      Lesser Egyptian jerboa  ==
B D                       Rat  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                Guinea pig  --
B D                    Rabbit  ==
B D                Coelacanth  ==
                    Aardvark  ==
            Cape golden mole  ==
B D                       Pig  ==
B D                   Megabat  ==
B D                   Dolphin  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
B D                Budgerigar  ==
B D                   Opossum  ==
                  Chinchilla  ==
B D            Naked mole-rat  --
  D               Rock pigeon  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D                   Wallaby  ==
            Brush-tailed rat  --
          Chinese tree shrew  --
B D                   Manatee  ==
B D                  Elephant  ==
B D           Chinese hamster  ==
B D                    Tenrec  ==
  D           Green seaturtle  ==
B D                       Cat  ==
B D                  Bushbaby  ==
                Weddell seal  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
  D       Collared flycatcher  ==
             Star-nosed mole  --
              Bactrian camel  ==
B D                    Alpaca  --
               Big brown bat  ==
              Pacific walrus  ==
B D                     Panda  ==
B D                       Cow  --
                Killer whale  --
B D                       Dog  ==
            Black flying-fox  ==
B D          White rhinoceros  ==
B D                     Horse  --
B D                  Squirrel  --
        David's myotis (bat)  ==
B D                  Microbat  ==
B D                 Armadillo  ==

Inserts between block 21 and 22 in window
B D                     Pika 424bp

Alignment block 22 of 80 in window, 86584770 - 86584784, 15 bps 
B D                     Human  ttttttt----tctttttt-------
B D                     Chimp  ttttttc-----ctttttt-------
B D                   Gorilla  ttttttc-----ctttttt-------
B D                 Orangutan  ttttttt------cctttt-------
B D                    Gibbon  ttttttc------tttttt-------
B D                    Rhesus  agttttc-----ttttttt-------
B D       Crab-eating macaque  agttttc-----ttttttt-------
B D                    Baboon  acttttc----tttttttt-------
B D              Green monkey  atttttttttttttttttt-------
B D                  Marmoset  tcttttt----tctttttt-------
B D           Squirrel monkey  ttttttt----tctttttt-------
                 Killer whale  -------------atattt-------
B D                       Cow  --------------ttttt------t
              Star-nosed mole  -------------atatttaggacct
              Golden hamster  ==========================
      Lesser Egyptian jerboa  ==========================
B D                       Rat  ==========================
                Prairie vole  ==========================
B D                     Mouse  ==========================
B D                      Pika  ==========================
B D                     Shrew  ==========================
B D                  Hedgehog  ==========================
B D                Guinea pig  --------------------------
B D                    Rabbit  ==========================
B D                Coelacanth  ==========================
                    Aardvark  ==========================
            Cape golden mole  ==========================
B D                       Pig  ==========================
B D                   Megabat  ==========================
B D                   Dolphin  ==========================
B D                    Turkey  ==========================
B D                   Chicken  ==========================
  D              Mallard duck  ==========================
          Tibetan ground jay  ==========================
B D               Zebra finch  ==========================
  D    White-throated sparrow  ==========================
B D           Tasmanian devil  ==========================
  D            Painted turtle  ==========================
B D                Budgerigar  ==========================
B D                   Opossum  ==========================
                  Chinchilla  ==========================
B D            Naked mole-rat  --------------------------
  D               Rock pigeon  ==========================
B D       Medium ground finch  ==========================
B D                    Lizard  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
B D                   Wallaby  ==========================
            Brush-tailed rat  --------------------------
          Chinese tree shrew  --------------------------
B D                   Manatee  ==========================
B D                  Elephant  ==========================
B D           Chinese hamster  ==========================
B D                    Tenrec  ==========================
  D           Green seaturtle  ==========================
B D                       Cat  ==========================
B D                  Bushbaby  ==========================
                Weddell seal  ==========================
  D  Chinese softshell turtle  ==========================
B D                   Ferret   ==========================
               Domestic goat  ==========================
B D                     Sheep  ==========================
            Tibetan antelope  ==========================
  D       Collared flycatcher  ==========================
              Bactrian camel  ==========================
B D                    Alpaca  --------------------------
               Big brown bat  ==========================
              Pacific walrus  ==========================
B D                     Panda  ==========================
B D                       Dog  ==========================
            Black flying-fox  ==========================
B D          White rhinoceros  ==========================
B D                     Horse  --------------------------
B D                  Squirrel  --------------------------
        David's myotis (bat)  ==========================
B D                  Microbat  ==========================
B D                 Armadillo  ==========================

Inserts between block 22 and 23 in window
B D                 Marmoset 38bp
B D          Squirrel monkey 37bp

Alignment block 23 of 80 in window, 86584785 - 86584788, 4 bps 
B D                     Human  tttg
B D                     Chimp  tttg
B D                   Gorilla  tttg
B D                 Orangutan  tttg
B D                    Gibbon  tttg
B D                    Rhesus  tttg
B D       Crab-eating macaque  tttg
B D                    Baboon  tttg
B D              Green monkey  tttg
B D                       Cow  ttta
              Star-nosed mole  attg
              Golden hamster  ====
      Lesser Egyptian jerboa  ====
B D                       Rat  ====
                Prairie vole  ====
B D                     Mouse  ====
B D                      Pika  ====
B D                     Shrew  ====
B D                  Hedgehog  ====
B D                Guinea pig  ----
B D                    Rabbit  ====
B D                Coelacanth  ====
                    Aardvark  ====
            Cape golden mole  ====
B D                       Pig  ====
B D                   Megabat  ====
B D                   Dolphin  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
B D                Budgerigar  ====
B D                   Opossum  ====
                  Chinchilla  ====
B D            Naked mole-rat  ----
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                   Wallaby  ====
            Brush-tailed rat  ----
          Chinese tree shrew  ----
B D                   Manatee  ====
B D                  Elephant  ====
B D           Chinese hamster  ====
B D                    Tenrec  ====
  D           Green seaturtle  ====
B D                       Cat  ====
B D                  Bushbaby  ====
                Weddell seal  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   ====
               Domestic goat  ====
B D                     Sheep  ====
            Tibetan antelope  ====
  D       Collared flycatcher  ====
              Bactrian camel  ====
B D                    Alpaca  ----
               Big brown bat  ====
              Pacific walrus  ====
B D                     Panda  ====
                Killer whale  ----
B D                       Dog  ====
            Black flying-fox  ====
B D          White rhinoceros  ====
B D                     Horse  ----
B D                  Squirrel  ----
        David's myotis (bat)  ====
B D                  Microbat  ====
B D           Squirrel monkey  ====
B D                  Marmoset  ====
B D                 Armadillo  ====

Alignment block 24 of 80 in window, 86584789 - 86584798, 10 bps 
B D                     Human  agacggagtc
B D                     Chimp  agatggagtc
B D                   Gorilla  agacggagtc
B D                 Orangutan  agaccgagtc
B D                    Gibbon  agatggagtc
B D                    Rhesus  agatggagtc
B D       Crab-eating macaque  agatggagtc
B D                    Baboon  agatggagtc
B D              Green monkey  aggtgaagtc
              Star-nosed mole  agttggggcc
              Golden hamster  ==========
      Lesser Egyptian jerboa  ==========
B D                       Rat  ==========
                Prairie vole  ==========
B D                     Mouse  ==========
B D                      Pika  ==========
B D                     Shrew  ==========
B D                  Hedgehog  ==========
B D                Guinea pig  ----------
B D                    Rabbit  ==========
B D                Coelacanth  ==========
                    Aardvark  ==========
            Cape golden mole  ==========
B D                       Pig  ==========
B D                   Megabat  ==========
B D                   Dolphin  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
  D    White-throated sparrow  ==========
B D           Tasmanian devil  ==========
  D            Painted turtle  ==========
B D                Budgerigar  ==========
B D                   Opossum  ==========
                  Chinchilla  ==========
B D            Naked mole-rat  ----------
  D               Rock pigeon  ==========
B D       Medium ground finch  ==========
B D                    Lizard  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
B D                   Wallaby  ==========
            Brush-tailed rat  ----------
          Chinese tree shrew  ----------
B D                   Manatee  ==========
B D                  Elephant  ==========
B D           Chinese hamster  ==========
B D                    Tenrec  ==========
  D           Green seaturtle  ==========
B D                       Cat  ==========
B D                  Bushbaby  ==========
                Weddell seal  ==========
  D  Chinese softshell turtle  ==========
B D                   Ferret   ==========
               Domestic goat  ==========
B D                     Sheep  ==========
            Tibetan antelope  ==========
  D       Collared flycatcher  ==========
              Bactrian camel  ==========
B D                    Alpaca  ----------
               Big brown bat  ==========
              Pacific walrus  ==========
B D                     Panda  ==========
B D                       Cow  ----------
                Killer whale  ----------
B D                       Dog  ==========
            Black flying-fox  ==========
B D          White rhinoceros  ==========
B D                     Horse  ----------
B D                  Squirrel  ----------
        David's myotis (bat)  ==========
B D                  Microbat  ==========
B D           Squirrel monkey  ==========
B D                  Marmoset  ==========
B D                 Armadillo  ==========

Inserts between block 24 and 25 in window
             Star-nosed mole 200bp

Alignment block 25 of 80 in window, 86584799 - 86584855, 57 bps 
B D                     Human  tcactctgtcacccaggctggagtgcagtggtacgatcttgactcactgcaacctcc
B D                     Chimp  tcactctgtcacccaggctggagtgcagtggtacgatcttaactcactgcaacctcc
B D                   Gorilla  tcactctgtcacccaggctggagtgcagtggtacgatcttgactcactgcaacctcc
B D                 Orangutan  tcactctgtcacccaggctggagtgcagtggtacgatcttgactcactgcaacctcc
B D                    Gibbon  tcactctgtcacccaggctggagtgcagtggtacgatcttgactcactgcaacctct
B D                    Rhesus  ttagtctgtcccccaggctggagtgcagtggtgcgatatcaactcactgcaacctct
B D       Crab-eating macaque  ttagtctgtcccccaggctggagtgcagtggtgcgatctcaactcactgcaacctct
B D                    Baboon  ttagtctgtcccccaggctggagtgcagtggtgcgatctcaactcactgcaacctct
B D              Green monkey  ttagtctgtcgcccaggctggagtgcagtggtgcgatctcaactcactgcaacctct
B D            Naked mole-rat  -------------------ggagt---------------------------------
              Golden hamster  =========================================================
      Lesser Egyptian jerboa  =========================================================
B D                       Rat  =========================================================
                Prairie vole  =========================================================
B D                     Mouse  =========================================================
B D                      Pika  =========================================================
B D                     Shrew  =========================================================
B D                  Hedgehog  =========================================================
B D                Guinea pig  ---------------------------------------------------------
B D                    Rabbit  =========================================================
B D                Coelacanth  =========================================================
                    Aardvark  =========================================================
            Cape golden mole  =========================================================
B D                       Pig  =========================================================
B D                   Megabat  =========================================================
B D                   Dolphin  =========================================================
B D                    Turkey  =========================================================
B D                   Chicken  =========================================================
  D              Mallard duck  =========================================================
          Tibetan ground jay  =========================================================
B D               Zebra finch  =========================================================
  D    White-throated sparrow  =========================================================
B D           Tasmanian devil  =========================================================
  D            Painted turtle  =========================================================
B D                Budgerigar  =========================================================
B D                   Opossum  =========================================================
                  Chinchilla  =========================================================
  D               Rock pigeon  =========================================================
B D       Medium ground finch  =========================================================
B D                    Lizard  =========================================================
  D          Peregrine falcon  =========================================================
  D              Saker falcon  =========================================================
B D                   Wallaby  =========================================================
            Brush-tailed rat  ---------------------------------------------------------
          Chinese tree shrew  ---------------------------------------------------------
B D                   Manatee  =========================================================
B D                  Elephant  =========================================================
B D           Chinese hamster  =========================================================
B D                    Tenrec  =========================================================
  D           Green seaturtle  =========================================================
B D                       Cat  =========================================================
B D                  Bushbaby  =========================================================
                Weddell seal  =========================================================
  D  Chinese softshell turtle  =========================================================
B D                   Ferret   =========================================================
               Domestic goat  =========================================================
B D                     Sheep  =========================================================
            Tibetan antelope  =========================================================
  D       Collared flycatcher  =========================================================
             Star-nosed mole  =========================================================
              Bactrian camel  =========================================================
B D                    Alpaca  ---------------------------------------------------------
               Big brown bat  =========================================================
              Pacific walrus  =========================================================
B D                     Panda  =========================================================
B D                       Cow  ---------------------------------------------------------
                Killer whale  ---------------------------------------------------------
B D                       Dog  =========================================================
            Black flying-fox  =========================================================
B D          White rhinoceros  =========================================================
B D                     Horse  ---------------------------------------------------------
B D                  Squirrel  ---------------------------------------------------------
        David's myotis (bat)  =========================================================
B D                  Microbat  =========================================================
B D           Squirrel monkey  =========================================================
B D                  Marmoset  =========================================================
B D                 Armadillo  =========================================================

Alignment block 26 of 80 in window, 86584856 - 86584866, 11 bps 
B D                     Human  gccccccaggt
B D                     Chimp  gccccccaggt
B D                   Gorilla  gccccccaggt
B D                 Orangutan  gccccccaggt
B D                    Gibbon  gccccccaggt
B D                    Rhesus  gccccccaggt
B D       Crab-eating macaque  gccccccaggt
B D                    Baboon  gccccccaggt
B D              Green monkey  gccctccaggt
                 Killer whale  -------agga
B D                     Horse  ---------gt
              Golden hamster  ===========
      Lesser Egyptian jerboa  ===========
B D                       Rat  ===========
                Prairie vole  ===========
B D                     Mouse  ===========
B D                      Pika  ===========
B D                     Shrew  ===========
B D                  Hedgehog  ===========
B D                Guinea pig  -----------
B D                    Rabbit  ===========
B D                Coelacanth  ===========
                    Aardvark  ===========
            Cape golden mole  ===========
B D                       Pig  ===========
B D                   Megabat  ===========
B D                   Dolphin  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
  D              Mallard duck  ===========
          Tibetan ground jay  ===========
B D               Zebra finch  ===========
  D    White-throated sparrow  ===========
B D           Tasmanian devil  ===========
  D            Painted turtle  ===========
B D                Budgerigar  ===========
B D                   Opossum  ===========
                  Chinchilla  ===========
B D            Naked mole-rat  -----------
  D               Rock pigeon  ===========
B D       Medium ground finch  ===========
B D                    Lizard  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
B D                   Wallaby  ===========
            Brush-tailed rat  -----------
          Chinese tree shrew  -----------
B D                   Manatee  ===========
B D                  Elephant  ===========
B D           Chinese hamster  ===========
B D                    Tenrec  ===========
  D           Green seaturtle  ===========
B D                       Cat  ===========
B D                  Bushbaby  ===========
                Weddell seal  ===========
  D  Chinese softshell turtle  ===========
B D                   Ferret   ===========
               Domestic goat  ===========
B D                     Sheep  ===========
            Tibetan antelope  ===========
  D       Collared flycatcher  ===========
             Star-nosed mole  ===========
              Bactrian camel  ===========
B D                    Alpaca  -----------
               Big brown bat  ===========
              Pacific walrus  ===========
B D                     Panda  ===========
B D                       Cow  -----------
B D                       Dog  ===========
            Black flying-fox  ===========
B D          White rhinoceros  ===========
B D                  Squirrel  -----------
        David's myotis (bat)  ===========
B D                  Microbat  ===========
B D           Squirrel monkey  ===========
B D                  Marmoset  ===========
B D                 Armadillo  ===========

Inserts between block 26 and 27 in window
                Killer whale 4bp
B D                    Horse 5bp

Alignment block 27 of 80 in window, 86584867 - 86584886, 20 bps 
B D                     Human  tcaagtgattctcctgcctt
B D                     Chimp  tcaagtgattctcctgcctc
B D                   Gorilla  tcaagtgattctcctgcctc
B D                 Orangutan  tcaagtgattctcctccctc
B D                    Gibbon  tcaagtgattctcctgcctc
B D                    Rhesus  tcaagcaattctcctgcctc
B D       Crab-eating macaque  tcaagcaattctcctgcctc
B D                    Baboon  tcaagcaattctcctgcctc
B D              Green monkey  tcaagcaattctcctgcctc
B D            Naked mole-rat  -----tggctcttctg----
B D                    Alpaca  ttaagtggcagtcctgtctt
                 Killer whale  ttgagt------------tt
              Golden hamster  ====================
      Lesser Egyptian jerboa  ====================
B D                       Rat  ====================
                Prairie vole  ====================
B D                     Mouse  ====================
B D                      Pika  ====================
B D                     Shrew  ====================
B D                  Hedgehog  ====================
B D                Guinea pig  --------------------
B D                    Rabbit  ====================
B D                Coelacanth  ====================
                    Aardvark  ====================
            Cape golden mole  ====================
B D                       Pig  ====================
B D                   Megabat  ====================
B D                   Dolphin  ====================
B D                    Turkey  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
          Tibetan ground jay  ====================
B D               Zebra finch  ====================
  D    White-throated sparrow  ====================
B D           Tasmanian devil  ====================
  D            Painted turtle  ====================
B D                Budgerigar  ====================
B D                   Opossum  ====================
                  Chinchilla  ====================
  D               Rock pigeon  ====================
B D       Medium ground finch  ====================
B D                    Lizard  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
B D                   Wallaby  ====================
            Brush-tailed rat  --------------------
          Chinese tree shrew  --------------------
B D                   Manatee  ====================
B D                  Elephant  ====================
B D           Chinese hamster  ====================
B D                    Tenrec  ====================
  D           Green seaturtle  ====================
B D                       Cat  ====================
B D                  Bushbaby  ====================
                Weddell seal  ====================
  D  Chinese softshell turtle  ====================
B D                   Ferret   ====================
               Domestic goat  ====================
B D                     Sheep  ====================
            Tibetan antelope  ====================
  D       Collared flycatcher  ====================
             Star-nosed mole  ====================
              Bactrian camel  ====================
               Big brown bat  ====================
              Pacific walrus  ====================
B D                     Panda  ====================
B D                       Cow  --------------------
B D                       Dog  ====================
            Black flying-fox  ====================
B D          White rhinoceros  ====================
B D                     Horse  ====================
B D                  Squirrel  --------------------
        David's myotis (bat)  ====================
B D                  Microbat  ====================
B D           Squirrel monkey  ====================
B D                  Marmoset  ====================
B D                 Armadillo  ====================

Alignment block 28 of 80 in window, 86584887 - 86584906, 20 bps 
B D                     Human  agcctcccaagtagctggga
B D                     Chimp  agcctcccaagtagctggga
B D                   Gorilla  agcctcccaagtagctggga
B D                 Orangutan  agcctcccaagtagctggga
B D                    Gibbon  aacctcccaagtagctggga
B D                    Rhesus  agcctcccaagtagcgggga
B D       Crab-eating macaque  agcctcccaagtagcgggga
B D                    Baboon  agcctcccaagtagctggga
B D              Green monkey  agcctcccaagtagctggga
                 Killer whale  ---------gataactggaa
              Golden hamster  ====================
      Lesser Egyptian jerboa  ====================
B D                       Rat  ====================
                Prairie vole  ====================
B D                     Mouse  ====================
B D                      Pika  ====================
B D                     Shrew  ====================
B D                  Hedgehog  ====================
B D                Guinea pig  --------------------
B D                    Rabbit  ====================
B D                Coelacanth  ====================
                    Aardvark  ====================
            Cape golden mole  ====================
B D                       Pig  ====================
B D                   Megabat  ====================
B D                   Dolphin  ====================
B D                    Turkey  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
          Tibetan ground jay  ====================
B D               Zebra finch  ====================
  D    White-throated sparrow  ====================
B D           Tasmanian devil  ====================
  D            Painted turtle  ====================
B D                Budgerigar  ====================
B D                   Opossum  ====================
                  Chinchilla  ====================
B D            Naked mole-rat  --------------------
  D               Rock pigeon  ====================
B D       Medium ground finch  ====================
B D                    Lizard  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
B D                   Wallaby  ====================
            Brush-tailed rat  --------------------
          Chinese tree shrew  --------------------
B D                   Manatee  ====================
B D                  Elephant  ====================
B D           Chinese hamster  ====================
B D                    Tenrec  ====================
  D           Green seaturtle  ====================
B D                       Cat  ====================
B D                  Bushbaby  ====================
                Weddell seal  ====================
  D  Chinese softshell turtle  ====================
B D                   Ferret   ====================
               Domestic goat  ====================
B D                     Sheep  ====================
            Tibetan antelope  ====================
  D       Collared flycatcher  ====================
             Star-nosed mole  ====================
              Bactrian camel  ====================
B D                    Alpaca  --------------------
               Big brown bat  ====================
              Pacific walrus  ====================
B D                     Panda  ====================
B D                       Cow  --------------------
B D                       Dog  ====================
            Black flying-fox  ====================
B D          White rhinoceros  ====================
B D                     Horse  ====================
B D                  Squirrel  --------------------
        David's myotis (bat)  ====================
B D                  Microbat  ====================
B D           Squirrel monkey  ====================
B D                  Marmoset  ====================
B D                 Armadillo  ====================

Alignment block 29 of 80 in window, 86584907 - 86584940, 34 bps 
B D                     Human  ttacaggcgcctgccacggagcccagctaatttt
B D                     Chimp  ttacaggcgcctgccacggagcccagctaatttt
B D                   Gorilla  ttacaggcgcctgccacagagcccagctaatttt
B D                 Orangutan  ttacaggcgcttgccactgcccccagctaatttt
B D                    Gibbon  ttacaggcgcctgccacggcgcccagctaatttt
B D                    Rhesus  ttacagacgcctgccacgggacccagctaattct
B D       Crab-eating macaque  ttacagacgcctgccacgggacccagctaattct
B D                    Baboon  ttacagacgcctgccacgggacccagctaattct
B D              Green monkey  ttacagacgcctgccacggggcccagctaattct
              Golden hamster  ==================================
      Lesser Egyptian jerboa  ==================================
B D                       Rat  ==================================
                Prairie vole  ==================================
B D                     Mouse  ==================================
B D                      Pika  ==================================
B D                     Shrew  ==================================
B D                  Hedgehog  ==================================
B D                Guinea pig  ----------------------------------
B D                    Rabbit  ==================================
B D                Coelacanth  ==================================
                    Aardvark  ==================================
            Cape golden mole  ==================================
B D                       Pig  ==================================
B D                   Megabat  ==================================
B D                   Dolphin  ==================================
B D                    Turkey  ==================================
B D                   Chicken  ==================================
  D              Mallard duck  ==================================
          Tibetan ground jay  ==================================
B D               Zebra finch  ==================================
  D    White-throated sparrow  ==================================
B D           Tasmanian devil  ==================================
  D            Painted turtle  ==================================
B D                Budgerigar  ==================================
B D                   Opossum  ==================================
                  Chinchilla  ==================================
B D            Naked mole-rat  ----------------------------------
  D               Rock pigeon  ==================================
B D       Medium ground finch  ==================================
B D                    Lizard  ==================================
  D          Peregrine falcon  ==================================
  D              Saker falcon  ==================================
B D                   Wallaby  ==================================
            Brush-tailed rat  ----------------------------------
          Chinese tree shrew  ----------------------------------
B D                   Manatee  ==================================
B D                  Elephant  ==================================
B D           Chinese hamster  ==================================
B D                    Tenrec  ==================================
  D           Green seaturtle  ==================================
B D                       Cat  ==================================
B D                  Bushbaby  ==================================
                Weddell seal  ==================================
  D  Chinese softshell turtle  ==================================
B D                   Ferret   ==================================
               Domestic goat  ==================================
B D                     Sheep  ==================================
            Tibetan antelope  ==================================
  D       Collared flycatcher  ==================================
             Star-nosed mole  ==================================
              Bactrian camel  ==================================
B D                    Alpaca  ----------------------------------
               Big brown bat  ==================================
              Pacific walrus  ==================================
B D                     Panda  ==================================
B D                       Cow  ----------------------------------
                Killer whale  ----------------------------------
B D                       Dog  ==================================
            Black flying-fox  ==================================
B D          White rhinoceros  ==================================
B D                     Horse  ==================================
B D                  Squirrel  ----------------------------------
        David's myotis (bat)  ==================================
B D                  Microbat  ==================================
B D           Squirrel monkey  ==================================
B D                  Marmoset  ==================================
B D                 Armadillo  ==================================

Alignment block 30 of 80 in window, 86584941 - 86584961, 21 bps 
B D                     Human  ttgtatttttagtagagacag
B D                     Chimp  ttgtatttttagtagagacag
B D                   Gorilla  ttgtatttttagtagagacag
B D                 Orangutan  ttgtatttttagtagagacag
B D                    Gibbon  ttgtatttttagtagagacag
B D                    Rhesus  ttgtgtttttagtagagacag
B D       Crab-eating macaque  ttgtgtttttagtagagacag
B D                    Baboon  ttgtgtttttagtagagacag
B D              Green monkey  ttgtatttttagtagagacag
B D                  Squirrel  ttgtactttatctggcaacag
B D                     Horse  -tgtatttc------------
              Golden hamster  =====================
      Lesser Egyptian jerboa  =====================
B D                       Rat  =====================
                Prairie vole  =====================
B D                     Mouse  =====================
B D                      Pika  =====================
B D                     Shrew  =====================
B D                  Hedgehog  =====================
B D                Guinea pig  ---------------------
B D                    Rabbit  =====================
B D                Coelacanth  =====================
                    Aardvark  =====================
            Cape golden mole  =====================
B D                       Pig  =====================
B D                   Megabat  =====================
B D                   Dolphin  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
  D    White-throated sparrow  =====================
B D           Tasmanian devil  =====================
  D            Painted turtle  =====================
B D                Budgerigar  =====================
B D                   Opossum  =====================
                  Chinchilla  =====================
B D            Naked mole-rat  ---------------------
  D               Rock pigeon  =====================
B D       Medium ground finch  =====================
B D                    Lizard  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
B D                   Wallaby  =====================
            Brush-tailed rat  ---------------------
          Chinese tree shrew  ---------------------
B D                   Manatee  =====================
B D                  Elephant  =====================
B D           Chinese hamster  =====================
B D                    Tenrec  =====================
  D           Green seaturtle  =====================
B D                       Cat  =====================
B D                  Bushbaby  =====================
                Weddell seal  =====================
  D  Chinese softshell turtle  =====================
B D                   Ferret   =====================
               Domestic goat  =====================
B D                     Sheep  =====================
            Tibetan antelope  =====================
  D       Collared flycatcher  =====================
             Star-nosed mole  =====================
              Bactrian camel  =====================
B D                    Alpaca  ---------------------
               Big brown bat  =====================
              Pacific walrus  =====================
B D                     Panda  =====================
B D                       Cow  ---------------------
                Killer whale  ---------------------
B D                       Dog  =====================
            Black flying-fox  =====================
B D          White rhinoceros  =====================
        David's myotis (bat)  =====================
B D                  Microbat  =====================
B D           Squirrel monkey  =====================
B D                  Marmoset  =====================
B D                 Armadillo  =====================

Inserts between block 30 and 31 in window
B D                    Horse 10bp

Alignment block 31 of 80 in window, 86584962 - 86584965, 4 bps 
B D                     Human  ggtt
B D                     Chimp  gatt
B D                   Gorilla  ggtt
B D                 Orangutan  ggtt
B D                    Gibbon  ggtt
B D                    Rhesus  ggtt
B D       Crab-eating macaque  ggtt
B D                    Baboon  agtt
B D              Green monkey  ggtt
B D            Naked mole-rat  agct
              Golden hamster  ====
      Lesser Egyptian jerboa  ====
B D                       Rat  ====
                Prairie vole  ====
B D                     Mouse  ====
B D                      Pika  ====
B D                     Shrew  ====
B D                  Hedgehog  ====
B D                Guinea pig  ----
B D                    Rabbit  ====
B D                Coelacanth  ====
                    Aardvark  ====
            Cape golden mole  ====
B D                       Pig  ====
B D                   Megabat  ====
B D                   Dolphin  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
B D                Budgerigar  ====
B D                   Opossum  ====
                  Chinchilla  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                   Wallaby  ====
            Brush-tailed rat  ----
          Chinese tree shrew  ----
B D                   Manatee  ====
B D                  Elephant  ====
B D           Chinese hamster  ====
B D                    Tenrec  ====
  D           Green seaturtle  ====
B D                       Cat  ====
B D                  Bushbaby  ====
                Weddell seal  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   ====
               Domestic goat  ====
B D                     Sheep  ====
            Tibetan antelope  ====
  D       Collared flycatcher  ====
             Star-nosed mole  ====
              Bactrian camel  ====
B D                    Alpaca  ----
               Big brown bat  ====
              Pacific walrus  ====
B D                     Panda  ====
B D                       Cow  ----
                Killer whale  ----
B D                       Dog  ====
            Black flying-fox  ====
B D          White rhinoceros  ====
B D                     Horse  ====
B D                  Squirrel  ----
        David's myotis (bat)  ====
B D                  Microbat  ====
B D           Squirrel monkey  ====
B D                  Marmoset  ====
B D                 Armadillo  ====

Alignment block 32 of 80 in window, 86584966 - 86584978, 13 bps 
B D                     Human  tcaccatgttggc
B D                     Chimp  tcaccatgttggc
B D                   Gorilla  tcaccatgttggc
B D                 Orangutan  tcaccatgttggc
B D                    Gibbon  tcaccgtgttggc
B D                    Rhesus  ttaccatgttggc
B D       Crab-eating macaque  ttaccatgttggc
B D                    Baboon  tcaccatgttggc
B D              Green monkey  tcaccttgttggc
B D            Naked mole-rat  ttatctggtta--
B D                Guinea pig  tcaccacattcgc
              Golden hamster  =============
      Lesser Egyptian jerboa  =============
B D                       Rat  =============
                Prairie vole  =============
B D                     Mouse  =============
B D                      Pika  =============
B D                     Shrew  =============
B D                  Hedgehog  =============
B D                    Rabbit  =============
B D                Coelacanth  =============
                    Aardvark  =============
            Cape golden mole  =============
B D                       Pig  =============
B D                   Megabat  =============
B D                   Dolphin  =============
B D                    Turkey  =============
B D                   Chicken  =============
  D              Mallard duck  =============
          Tibetan ground jay  =============
B D               Zebra finch  =============
  D    White-throated sparrow  =============
B D           Tasmanian devil  =============
  D            Painted turtle  =============
B D                Budgerigar  =============
B D                   Opossum  =============
                  Chinchilla  =============
  D               Rock pigeon  =============
B D       Medium ground finch  =============
B D                    Lizard  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
B D                   Wallaby  =============
            Brush-tailed rat  -------------
          Chinese tree shrew  -------------
B D                   Manatee  =============
B D                  Elephant  =============
B D           Chinese hamster  =============
B D                    Tenrec  =============
  D           Green seaturtle  =============
B D                       Cat  =============
B D                  Bushbaby  =============
                Weddell seal  =============
  D  Chinese softshell turtle  =============
B D                   Ferret   =============
               Domestic goat  =============
B D                     Sheep  =============
            Tibetan antelope  =============
  D       Collared flycatcher  =============
             Star-nosed mole  =============
              Bactrian camel  =============
B D                    Alpaca  -------------
               Big brown bat  =============
              Pacific walrus  =============
B D                     Panda  =============
B D                       Cow  -------------
                Killer whale  -------------
B D                       Dog  =============
            Black flying-fox  =============
B D          White rhinoceros  =============
B D                     Horse  =============
B D                  Squirrel  -------------
        David's myotis (bat)  =============
B D                  Microbat  =============
B D           Squirrel monkey  =============
B D                  Marmoset  =============
B D                 Armadillo  =============

Alignment block 33 of 80 in window, 86584979 - 86584982, 4 bps 
B D                     Human  cagg
B D                     Chimp  cagg
B D                   Gorilla  cagg
B D                 Orangutan  cagg
B D                    Gibbon  cagg
B D                    Rhesus  cagg
B D       Crab-eating macaque  cagg
B D                    Baboon  cagg
B D              Green monkey  cagg
              Golden hamster  ====
      Lesser Egyptian jerboa  ====
B D                       Rat  ====
                Prairie vole  ====
B D                     Mouse  ====
B D                      Pika  ====
B D                     Shrew  ====
B D                  Hedgehog  ====
B D                Guinea pig  ----
B D                    Rabbit  ====
B D                Coelacanth  ====
                    Aardvark  ====
            Cape golden mole  ====
B D                       Pig  ====
B D                   Megabat  ====
B D                   Dolphin  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
B D                Budgerigar  ====
B D                   Opossum  ====
                  Chinchilla  ====
B D            Naked mole-rat  ----
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                   Wallaby  ====
            Brush-tailed rat  ----
          Chinese tree shrew  ----
B D                   Manatee  ====
B D                  Elephant  ====
B D           Chinese hamster  ====
B D                    Tenrec  ====
  D           Green seaturtle  ====
B D                       Cat  ====
B D                  Bushbaby  ====
                Weddell seal  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   ====
               Domestic goat  ====
B D                     Sheep  ====
            Tibetan antelope  ====
  D       Collared flycatcher  ====
             Star-nosed mole  ====
              Bactrian camel  ====
B D                    Alpaca  ----
               Big brown bat  ====
              Pacific walrus  ====
B D                     Panda  ====
B D                       Cow  ----
                Killer whale  ----
B D                       Dog  ====
            Black flying-fox  ====
B D          White rhinoceros  ====
B D                     Horse  ====
B D                  Squirrel  ----
        David's myotis (bat)  ====
B D                  Microbat  ====
B D           Squirrel monkey  ====
B D                  Marmoset  ====
B D                 Armadillo  ====

Alignment block 34 of 80 in window, 86584983 - 86585009, 27 bps 
B D                     Human  ttggtcttgaactcctgaactca-tgat
B D                     Chimp  ctggtctcgaactcctgacctca-tgat
B D                   Gorilla  ctggtctcgaactcctgacctca-tgat
B D                 Orangutan  ctggtcttgaactcctgacctca-tgat
B D                    Gibbon  ctggtcttgaactcctgacctca-tgat
B D                    Rhesus  ctggtcttgaactcctgacctca-tgat
B D       Crab-eating macaque  ctggtcttgaactcctgacctca-tgat
B D                    Baboon  ctggtcttgaactcctgacctca-tgat
B D              Green monkey  ctgatcttgaactcctgacctca-tgat
B D                   Ferret   ttgatctaaaatt-caaatttaactga-
               Pacific walrus  ttgatctaaaattccaaatttaactga-
              Golden hamster  ============================
      Lesser Egyptian jerboa  ============================
B D                       Rat  ============================
                Prairie vole  ============================
B D                     Mouse  ============================
B D                      Pika  ============================
B D                     Shrew  ============================
B D                  Hedgehog  ============================
B D                Guinea pig  ----------------------------
B D                    Rabbit  ============================
B D                Coelacanth  ============================
                    Aardvark  ============================
            Cape golden mole  ============================
B D                       Pig  ============================
B D                   Megabat  ============================
B D                   Dolphin  ============================
B D                    Turkey  ============================
B D                   Chicken  ============================
  D              Mallard duck  ============================
          Tibetan ground jay  ============================
B D               Zebra finch  ============================
  D    White-throated sparrow  ============================
B D           Tasmanian devil  ============================
  D            Painted turtle  ============================
B D                Budgerigar  ============================
B D                   Opossum  ============================
                  Chinchilla  ============================
B D            Naked mole-rat  ----------------------------
  D               Rock pigeon  ============================
B D       Medium ground finch  ============================
B D                    Lizard  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
B D                   Wallaby  ============================
            Brush-tailed rat  ----------------------------
          Chinese tree shrew  ----------------------------
B D                   Manatee  ============================
B D                  Elephant  ============================
B D           Chinese hamster  ============================
B D                    Tenrec  ============================
  D           Green seaturtle  ============================
B D                       Cat  ============================
B D                  Bushbaby  ============================
                Weddell seal  ============================
  D  Chinese softshell turtle  ============================
               Domestic goat  ============================
B D                     Sheep  ============================
            Tibetan antelope  ============================
  D       Collared flycatcher  ============================
             Star-nosed mole  ============================
              Bactrian camel  ============================
B D                    Alpaca  ----------------------------
               Big brown bat  ============================
B D                     Panda  ============================
B D                       Cow  ----------------------------
                Killer whale  ----------------------------
B D                       Dog  ============================
            Black flying-fox  ============================
B D          White rhinoceros  ============================
B D                     Horse  ============================
B D                  Squirrel  ----------------------------
        David's myotis (bat)  ============================
B D                  Microbat  ============================
B D           Squirrel monkey  ============================
B D                  Marmoset  ============================
B D                 Armadillo  ============================

Inserts between block 34 and 35 in window
B D                  Ferret  1bp
              Pacific walrus 1bp

Alignment block 35 of 80 in window, 86585010 - 86585027, 18 bps 
B D                     Human  ccacccgcctcagcctcc
B D                     Chimp  ccacccgcctcagcctcc
B D                   Gorilla  ccacccgcctcagcctcc
B D                 Orangutan  ccacccgcctcagcctcc
B D                    Gibbon  ccaccagcctcagcctcc
B D                    Rhesus  ccacctgtctcagcctcc
B D       Crab-eating macaque  ccacctgtctcagcctcc
B D                    Baboon  ccacccgtctcagcctcc
B D              Green monkey  ccacccgtctcagcctcc
B D            Naked mole-rat  ccacacgtttcagactc-
B D                    Alpaca  ttacctg-----------
B D                   Ferret   caaccta---cagcttgt
               Pacific walrus  caaccta---cagcttcc
              Golden hamster  ==================
      Lesser Egyptian jerboa  ==================
B D                       Rat  ==================
                Prairie vole  ==================
B D                     Mouse  ==================
B D                      Pika  ==================
B D                     Shrew  ==================
B D                  Hedgehog  ==================
B D                Guinea pig  ------------------
B D                    Rabbit  ==================
B D                Coelacanth  ==================
                    Aardvark  ==================
            Cape golden mole  ==================
B D                       Pig  ==================
B D                   Megabat  ==================
B D                   Dolphin  ==================
B D                    Turkey  ==================
B D                   Chicken  ==================
  D              Mallard duck  ==================
          Tibetan ground jay  ==================
B D               Zebra finch  ==================
  D    White-throated sparrow  ==================
B D           Tasmanian devil  ==================
  D            Painted turtle  ==================
B D                Budgerigar  ==================
B D                   Opossum  ==================
                  Chinchilla  ==================
  D               Rock pigeon  ==================
B D       Medium ground finch  ==================
B D                    Lizard  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
B D                   Wallaby  ==================
            Brush-tailed rat  ------------------
          Chinese tree shrew  ------------------
B D                   Manatee  ==================
B D                  Elephant  ==================
B D           Chinese hamster  ==================
B D                    Tenrec  ==================
  D           Green seaturtle  ==================
B D                       Cat  ==================
B D                  Bushbaby  ==================
                Weddell seal  ==================
  D  Chinese softshell turtle  ==================
               Domestic goat  ==================
B D                     Sheep  ==================
            Tibetan antelope  ==================
  D       Collared flycatcher  ==================
             Star-nosed mole  ==================
              Bactrian camel  ==================
               Big brown bat  ==================
B D                     Panda  ==================
B D                       Cow  ------------------
                Killer whale  ------------------
B D                       Dog  ==================
            Black flying-fox  ==================
B D          White rhinoceros  ==================
B D                     Horse  ==================
B D                  Squirrel  ------------------
        David's myotis (bat)  ==================
B D                  Microbat  ==================
B D           Squirrel monkey  ==================
B D                  Marmoset  ==================
B D                 Armadillo  ==================

Alignment block 36 of 80 in window, 86585028 - 86585037, 10 bps 
B D                     Human  caaagtgctg
B D                     Chimp  caaagtgctg
B D                   Gorilla  caaagtgctg
B D                 Orangutan  caaagtgctg
B D                    Gibbon  caaagtgctg
B D                    Rhesus  caaagtgctg
B D       Crab-eating macaque  caaagtgctg
B D                    Baboon  gaaagtgctg
B D              Green monkey  caaagtgctg
B D                       Pig  caaggt-gtg
B D                   Ferret   -------ctg
               Pacific walrus  -------ctg
              Golden hamster  ==========
      Lesser Egyptian jerboa  ==========
B D                       Rat  ==========
                Prairie vole  ==========
B D                     Mouse  ==========
B D                      Pika  ==========
B D                     Shrew  ==========
B D                  Hedgehog  ==========
B D                Guinea pig  ----------
B D                    Rabbit  ==========
B D                Coelacanth  ==========
                    Aardvark  ==========
            Cape golden mole  ==========
B D                   Megabat  ==========
B D                   Dolphin  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
  D    White-throated sparrow  ==========
B D           Tasmanian devil  ==========
  D            Painted turtle  ==========
B D                Budgerigar  ==========
B D                   Opossum  ==========
                  Chinchilla  ==========
B D            Naked mole-rat  ----------
  D               Rock pigeon  ==========
B D       Medium ground finch  ==========
B D                    Lizard  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
B D                   Wallaby  ==========
            Brush-tailed rat  ----------
          Chinese tree shrew  ----------
B D                   Manatee  ==========
B D                  Elephant  ==========
B D           Chinese hamster  ==========
B D                    Tenrec  ==========
  D           Green seaturtle  ==========
B D                       Cat  ==========
B D                  Bushbaby  ==========
                Weddell seal  ==========
  D  Chinese softshell turtle  ==========
               Domestic goat  ==========
B D                     Sheep  ==========
            Tibetan antelope  ==========
  D       Collared flycatcher  ==========
             Star-nosed mole  ==========
              Bactrian camel  ==========
B D                    Alpaca  ----------
               Big brown bat  ==========
B D                     Panda  ==========
B D                       Cow  ----------
                Killer whale  ----------
B D                       Dog  ==========
            Black flying-fox  ==========
B D          White rhinoceros  ==========
B D                     Horse  ==========
B D                  Squirrel  ----------
        David's myotis (bat)  ==========
B D                  Microbat  ==========
B D           Squirrel monkey  ==========
B D                  Marmoset  ==========
B D                 Armadillo  ==========

Inserts between block 36 and 37 in window
B D                      Pig 4bp

Alignment block 37 of 80 in window, 86585038 - 86585061, 24 bps 
B D                     Human  ggattacaggcgtgagccaccgcg
B D                     Chimp  ggattacaggcgtgagccactgcg
B D                   Gorilla  ggattacaggcgtgagccaccgcg
B D                 Orangutan  ggattacaggcgtgagccaccgtg
B D                    Gibbon  ggattacaggcgtgagccactgcg
B D                    Rhesus  ggattacgggcgtgaaccaccgca
B D       Crab-eating macaque  ggattatgggcgtgaaccaccgca
B D                    Baboon  ggattacgggcatgaaccaccgca
B D              Green monkey  ggattacaggcgtgaaccaccgca
B D                       Pig  aggtcacagatgtg-------gct
                 Killer whale  gggttac-----------------
B D                   Ferret   ---------------------gca
               Pacific walrus  ---------------------gcg
              Golden hamster  ========================
      Lesser Egyptian jerboa  ========================
B D                       Rat  ========================
                Prairie vole  ========================
B D                     Mouse  ========================
B D                      Pika  ========================
B D                     Shrew  ========================
B D                  Hedgehog  ========================
B D                Guinea pig  ------------------------
B D                    Rabbit  ========================
B D                Coelacanth  ========================
                    Aardvark  ========================
            Cape golden mole  ========================
B D                   Megabat  ========================
B D                   Dolphin  ========================
B D                    Turkey  ========================
B D                   Chicken  ========================
  D              Mallard duck  ========================
          Tibetan ground jay  ========================
B D               Zebra finch  ========================
  D    White-throated sparrow  ========================
B D           Tasmanian devil  ========================
  D            Painted turtle  ========================
B D                Budgerigar  ========================
B D                   Opossum  ========================
                  Chinchilla  ========================
B D            Naked mole-rat  ------------------------
  D               Rock pigeon  ========================
B D       Medium ground finch  ========================
B D                    Lizard  ========================
  D          Peregrine falcon  ========================
  D              Saker falcon  ========================
B D                   Wallaby  ========================
            Brush-tailed rat  ------------------------
          Chinese tree shrew  ------------------------
B D                   Manatee  ========================
B D                  Elephant  ========================
B D           Chinese hamster  ========================
B D                    Tenrec  ========================
  D           Green seaturtle  ========================
B D                       Cat  ========================
B D                  Bushbaby  ========================
                Weddell seal  ========================
  D  Chinese softshell turtle  ========================
               Domestic goat  ========================
B D                     Sheep  ========================
            Tibetan antelope  ========================
  D       Collared flycatcher  ========================
             Star-nosed mole  ========================
              Bactrian camel  ========================
B D                    Alpaca  ------------------------
               Big brown bat  ========================
B D                     Panda  ========================
B D                       Cow  ------------------------
B D                       Dog  ========================
            Black flying-fox  ========================
B D          White rhinoceros  ========================
B D                     Horse  ========================
B D                  Squirrel  ------------------------
        David's myotis (bat)  ========================
B D                  Microbat  ========================
B D           Squirrel monkey  ========================
B D                  Marmoset  ========================
B D                 Armadillo  ========================

Inserts between block 37 and 38 in window
B D                      Pig 21bp
B D                  Ferret  13bp
              Pacific walrus 13bp

Alignment block 38 of 80 in window, 86585062 - 86585062, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  t
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                       Pig  t
B D                       Cow  c
B D                     Horse  c
B D                   Ferret   t
               Pacific walrus  t
              Golden hamster  =
      Lesser Egyptian jerboa  =
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
B D                      Pika  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                Guinea pig  -
B D                    Rabbit  =
B D                Coelacanth  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  =
B D                   Dolphin  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
B D                Budgerigar  =
B D                   Opossum  =
                  Chinchilla  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                   Wallaby  =
            Brush-tailed rat  -
          Chinese tree shrew  -
B D                   Manatee  =
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  =
  D           Green seaturtle  =
B D                       Cat  =
B D                  Bushbaby  =
                Weddell seal  =
  D  Chinese softshell turtle  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
  D       Collared flycatcher  =
             Star-nosed mo