Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 654 in window, 81847032 - 81847073, 42 bps 
B D                     Human  atgtgagtcttgatttcacctccaaaaatcttcggggctgtc
B D                     Chimp  atatgagtcttgatttcacctccaaaaatcttcggggctgtc
B D                   Gorilla  atgtgagtcttgatttcacctccaaaaatcttcggggctgtc
B D                 Orangutan  atgtgagtcttgatttcacctccaaaaatcttcggggctgtc
B D                    Gibbon  atgtgagtcttgatttcacctccaaaaatcttcggggctgtc
B D                    Rhesus  atgtgagtcttgatttcacctccaaaaatcttcggggctgtc
B D       Crab-eating macaque  atgtgagtcttgatttcacctccaaaaatcttcggggctgtc
B D                    Baboon  atgtgagtcttgatttcacctccaaaaatcttcggggctgtc
B D              Green monkey  atgtgcgtcttgatttcacctccaaaaatcttcggggctgtc
B D                  Marmoset  atgtgagtcttgatttcacctccaaaaatcttcggggctgtc
B D           Squirrel monkey  atgtgagtcttgatttcacctccaaaaatcttcggggctgtc
B D                  Bushbaby  atgtgtgtcttgatttcacctccgaagatctttggggctgtc
           Chinese tree shrew  atgtgcgtcttgatctcgcctccgaagatcttcggggctgtc
B D                  Squirrel  atgtgagtcttgatttcacctccaaaaatcttcggggctgtc
       Lesser Egyptian jerboa  atgtgcgtcttgatttcaccaccaaaaatcttcggggctgtc
                 Prairie vole  atgtgggtcttgatttcacctccaaaaatctttggggctgtc
B D           Chinese hamster  atgtgtgtcttgatttcgcctccaaaaatcttcggggctgtc
               Golden hamster  atgtgtgtcttgatttcacctccaaaaatcttcggggctgtc
B D                     Mouse  atgtgtgtcttgatctcacctccaaaaatcttcggagctgtc
B D                       Rat  atatgtgttttgatttcacctccgaaaatctttggagctgtc
B D            Naked mole-rat  atatgagtcttgatttcacccccaaaaatcttcggggctgtc
B D                Guinea pig  atgtgagtcttgatttcacccccaaaaatcttcggggctgtc
                   Chinchilla  atatgagtcttgatttcacccccaaaaatcttcggggctgtc
             Brush-tailed rat  atatgagtcttgatttcacctccaaaaatctttggggctgtc
B D                      Pika  atgtgcgtcttgatctcccctccgaagatctttggggctgtc
B D                    Alpaca  atgtgagtcttgatctcgcctccaaagatcttcggggctgtc
               Bactrian camel  atgtgagtcttgatctcgcctccaaagatcttcggggctgtc
B D                   Dolphin  atgtgtgtcttaatttcccctccgaagatcttcggggctgtc
                 Killer whale  atgtgtgtcttaatttcccctccgaagatcttcggggctgtc
             Tibetan antelope  atgtgagtcttgatttcccctccgaagatctttggggctgtc
B D                       Cow  atgtgagtcttgatttcccctccgaagatcttcggggctgtc
B D                     Sheep  atgtgagtcttgatttcccctccgaagatcttcggggctgtc
                Domestic goat  atgtgagtcttgatttcccctccgaagatcttcggggctgtc
B D                     Horse  atgtgtgtcttgatttcacctccgaaaatcttgggggctgtc
B D          White rhinoceros  atgtgcgtcttgatttcacctccgaaaatcttgggggccgtc
B D                       Cat  atgtgagtcttgatttcacctccgaaaatcttcggggctgtc
B D                       Dog  atgtgggtcttgatctcccctccgaagatcttcggggccgtc
B D                   Ferret   atgtgggtcttgatttcgcctccgaagatctttggggccgtc
B D                     Panda  atgtgggtcttgatttcacctccgaagatctttggggctgtc
               Pacific walrus  atgtgggtcttgatttcacctccgaagatctttggggctgtc
                 Weddell seal  atgtgagtcttgatttcacctccgaagatcttcggggctgtc
             Black flying-fox  atgtgagtcttgatgtcccctccaaaaatcttcggggccgtc
B D                   Megabat  atgtgagtcttgatgtcccctccaaaaatcttcggggccgtc
                Big brown bat  atgtgcgtcttgatctcgcccccgaagatcttgggggccgtc
         David's myotis (bat)  atgtgcgtcttgatctcgcccccaaagatcttcggggccgtc
B D                  Microbat  atgtgcgtcttgatctcgcccccgaagatctttggggccgtc
B D                  Hedgehog  atgtgggtcttgatttcacctccaaatatcttcggggctgtc
B D                     Shrew  atgtgggtcttgatttcacctccaaaaatctttggggccgtc
              Star-nosed mole  atgtgcgtcttgatctcgccgccgaagatcttcggggccgtc
B D                  Elephant  atgtgtgtcttgatctcacctccgaaaatcttcggggctgtc
          Cape elephant shrew  atgtgagtcttgatctcacctccaaaaatcttcggagccgtc
B D                   Manatee  atgtgcgtcttgatctcacccccaaaaatcttcggggctgtc
             Cape golden mole  atgtgagtcttgatttcccctccgaagatcttcggggctgtc
B D                    Tenrec  atgtgagtcttgatctcgcccccaaaaatcttcggggctgtc
                     Aardvark  atgtgtgtcttgatctcacctccaaaaatcttcggggccgtc
B D                 Armadillo  atgtgagttttgatttcacccccaaaaatcttcggggccgtc
B D                   Opossum  atatgagtcttgatttcacctccaaaaattttgggggccgtc
B D           Tasmanian devil  atatgagtcttgatttcacctccaaaaattttgggggccgtc
B D                   Wallaby  aaatgagttttcaaaggacctgcaaaaatctttggggcagtc
B D                  Platypus  atgtgcgtcttgatctcgcccccgaagatcttcggggccgtc
  D               Rock pigeon  atgtgagtcttgatctctcctccaaagattttaggagcagtc
  D              Saker falcon  atatgagtcttgatctctcctccgaagattttaggagcagtc
  D          Peregrine falcon  atatgagtcttgatctctcctccgaagattttaggagcagtc
  D       Collared flycatcher  atatgagtcttgatctctcctccaaatattttgggagcggtc
  D    White-throated sparrow  atatgagtcttgatctctcctccaaatattttaggagcagtc
B D       Medium ground finch  atatgagtcttgatctctcctccaaatattttaggagcagtc
B D               Zebra finch  atatgagtcttgatctctcctccaaatattttaggagcagtc
           Tibetan ground jay  atatgagtcttgatctctcctccaaatattttaggagcagtc
B D                Budgerigar  atgtgagtcttgatctcccctccaaagattttaggagcagtc
  D                    Parrot  atgtgagtcttgatctcccctccaaagattttaggagcggtc
  D             Scarlet macaw  atgtgagtcttgatctcccctccaaagattttcggagcggtc
  D              Mallard duck  atatgagtcttgatctctcctccaaagattttaggagcagtc
B D                   Chicken  atgtgagtcttgatctctcctccaaagattttaggagcagtc
B D                    Turkey  atgtgagtcttgatctctcctccaaagattttaggagcggtc
B D        American alligator  atgtgagtcttgatctctcctccaaagatctttggagcggtc
  D           Green seaturtle  atgtgagtcttgatctctcctccaaagatcttcggagcagtc
  D            Painted turtle  atgtgagtcttgatctctcctccaaagatcttaggagcagtc
  D  Chinese softshell turtle  atgtgagtcttgatctcacctccaaagatcttcggagccgtc
  D    Spiny softshell turtle  atgtgagtcttgatctcacctccaaagatctttggagccgtc
B D                    Lizard  atgtgagttttgatctctcctccaaagattttgggtgcagtc
B D             X. tropicalis  atatgagtcttaatctctccaccaaagatcattggagcagtc
B D                Coelacanth  atgtgagtcttaatttcacctccaaaaatcttgggggcagtc
B D                 Tetraodon  atgtgggacttgatatcgccaccgaagattttaggagcggtc
B D                      Fugu  atgtgggacttgatttcaccaccaaagattttaggagcagtc
       Yellowbelly pufferfish  atgtgggacttgatttcaccaccaaagattttaggagcagtc
B D              Nile tilapia  atgtgggacttgatttctccgccgaagattttaggggcggtc
          Princess of Burundi  atgtgggacttgatgtctccgccgaagattttaggggcagtc
        Burton's mouthbreeder  atgtgggacttgatgtctccgccgaagattttaggggcagtc
                  Zebra mbuna  atgtgggacttgatttctccgccaaagattttaggggcagtc
          Pundamilia nyererei  atgtgggacttgatttctccgccgaagattttaggggcagtc
B D                    Medaka  atgtgggacttgatgtctccgccgaagattttaggcgcggtc
           Southern platyfish  atgtgggactttatgtctccgccaaagatttttggggcggtc
B D               Stickleback  atgtgagacttgatttctcctccaaagattttaggagcggtc
B D              Atlantic cod  atgtgggacttgatttctcctccgaagattttgggggcggtc
B D                 Zebrafish  atatgggacttgatgtcacctccaaagattttgggagcagtc
     Mexican tetra (cavefish)  atgtgtgacttgatctcacctccgaagattttgggggccgtc
                  Spotted gar  atgtgggacttgatctcccctccaaagatcttgggggcagtc
B D                   Lamprey  atgtgcacattcaccagcccgctgaagagcagcgggaacgtc
B D                       Pig  ==========================================

Alignment block 2 of 654 in window, 81847074 - 81847074, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                      Pika  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  t
B D           Tasmanian devil  t
B D                  Platypus  t
  D               Rock pigeon  t
  D              Saker falcon  t
  D          Peregrine falcon  t
  D       Collared flycatcher  t
  D    White-throated sparrow  t
B D       Medium ground finch  t
B D               Zebra finch  t
           Tibetan ground jay  t
B D                Budgerigar  t
  D                    Parrot  t
  D             Scarlet macaw  t
  D              Mallard duck  t
B D                   Chicken  t
B D                    Turkey  t
B D        American alligator  t
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  t
  D    Spiny softshell turtle  t
B D                    Lizard  t
B D             X. tropicalis  t
B D                Coelacanth  t
B D                 Tetraodon  t
B D                      Fugu  t
       Yellowbelly pufferfish  t
B D              Nile tilapia  t
          Princess of Burundi  t
        Burton's mouthbreeder  t
                  Zebra mbuna  t
          Pundamilia nyererei  t
B D                    Medaka  t
           Southern platyfish  t
B D               Stickleback  t
B D              Atlantic cod  t
B D                 Zebrafish  t
     Mexican tetra (cavefish)  t
                  Spotted gar  t
B D                   Lamprey  t
          Chinese tree shrew  -
B D                  Bushbaby  -
B D                   Wallaby  -
B D                       Pig  =

Inserts between block 2 and 3 in window
B D          Tasmanian devil 2693bp
B D            X. tropicalis 1bp

Alignment block 3 of 654 in window, 81847075 - 81847075, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                      Pika  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  a
B D                       Cow  g
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   a
B D                     Panda  g
               Pacific walrus  a
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D                  Platypus  g
  D               Rock pigeon  g
  D              Saker falcon  g
  D          Peregrine falcon  g
  D       Collared flycatcher  g
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D               Zebra finch  g
           Tibetan ground jay  g
B D                Budgerigar  g
  D                    Parrot  g
  D             Scarlet macaw  g
  D              Mallard duck  g
B D                   Chicken  g
B D                    Turkey  g
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  a
  D  Chinese softshell turtle  g
  D    Spiny softshell turtle  g
B D                    Lizard  g
B D                Coelacanth  g
B D                 Tetraodon  g
B D                      Fugu  g
       Yellowbelly pufferfish  g
B D              Nile tilapia  g
          Princess of Burundi  g
        Burton's mouthbreeder  g
                  Zebra mbuna  g
          Pundamilia nyererei  g
B D                    Medaka  g
           Southern platyfish  g
B D               Stickleback  g
B D              Atlantic cod  g
B D                 Zebrafish  g
     Mexican tetra (cavefish)  g
                  Spotted gar  g
B D                   Lamprey  g
B D                     Shrew  -
          Chinese tree shrew  -
B D                  Bushbaby  -
B D                   Wallaby  -
B D             X. tropicalis  =
B D                       Pig  =
B D           Tasmanian devil  =

Inserts between block 3 and 4 in window
B D                  Opossum 3971bp
  D              Rock pigeon 146bp
B D       American alligator 2bp
B D               Coelacanth 1336bp

Alignment block 4 of 654 in window, 81847076 - 81847077, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Bushbaby  tg
           Chinese tree shrew  tg
B D                  Squirrel  tg
       Lesser Egyptian jerboa  tg
                 Prairie vole  tg
B D           Chinese hamster  tg
               Golden hamster  tg
B D                     Mouse  tg
B D                       Rat  tg
B D            Naked mole-rat  ca
B D                Guinea pig  cg
                   Chinchilla  tg
             Brush-tailed rat  ta
B D                   Dolphin  tg
                 Killer whale  tg
             Tibetan antelope  cg
B D                       Cow  cg
B D                     Sheep  ca
                Domestic goat  ca
B D                     Horse  tg
B D          White rhinoceros  ta
B D                       Cat  cg
B D                       Dog  tg
B D                   Ferret   tg
B D                     Panda  tg
               Pacific walrus  tg
                 Weddell seal  tg
             Black flying-fox  ca
B D                   Megabat  ca
                Big brown bat  tc
         David's myotis (bat)  tc
B D                  Microbat  tc
B D                  Hedgehog  tg
B D                     Shrew  -g
              Star-nosed mole  -g
B D                  Elephant  tg
          Cape elephant shrew  ca
B D                   Manatee  tg
             Cape golden mole  tg
B D                    Tenrec  ag
                     Aardvark  cg
B D                 Armadillo  tg
B D                  Platypus  tg
B D             X. tropicalis  -a
B D                 Tetraodon  cg
B D                      Fugu  ca
       Yellowbelly pufferfish  ca
B D              Nile tilapia  ca
          Princess of Burundi  ga
        Burton's mouthbreeder  ga
                  Zebra mbuna  ga
          Pundamilia nyererei  ga
B D                    Medaka  ca
           Southern platyfish  ca
B D               Stickleback  aa
B D              Atlantic cod  ca
B D                 Zebrafish  ca
     Mexican tetra (cavefish)  ag
                  Spotted gar  ca
B D                   Lamprey  ca
B D                    Alpaca  --
B D                      Pika  --
              Bactrian camel  --
B D                Coelacanth  ==
B D                    Turkey  --
  D              Mallard duck  --
  D             Scarlet macaw  --
  D                    Parrot  --
B D                Budgerigar  --
B D                   Wallaby  --
  D    Spiny softshell turtle  --
B D                    Lizard  --
  D          Peregrine falcon  --
  D               Rock pigeon  ==
  D            Painted turtle  --
B D                   Chicken  --
  D       Collared flycatcher  --
  D  Chinese softshell turtle  --
B D               Zebra finch  --
  D              Saker falcon  --
  D           Green seaturtle  --
B D       Medium ground finch  --
B D                   Opossum  ==
B D        American alligator  ==
  D    White-throated sparrow  --
          Tibetan ground jay  --
B D                       Pig  ==
B D           Tasmanian devil  ==

Inserts between block 4 and 5 in window
B D                 Platypus 289bp
B D            X. tropicalis 1bp
B D             Atlantic cod 4bp
    Mexican tetra (cavefish) 456bp
                 Spotted gar 1bp

Alignment block 5 of 654 in window, 81847078 - 81847084, 7 bps 
B D                     Human  tt---ataaa
B D                     Chimp  tt---ataaa
B D                   Gorilla  tt---ataaa
B D                 Orangutan  tt---ataaa
B D                    Gibbon  tt---ataaa
B D                    Rhesus  tt---ataaa
B D       Crab-eating macaque  tt---ataaa
B D                    Baboon  tt---ataaa
B D              Green monkey  tt---ataaa
B D                  Marmoset  tt---acaaa
B D           Squirrel monkey  tt---ataaa
B D                  Bushbaby  tt---acaaa
           Chinese tree shrew  tt---acaaa
B D                  Squirrel  tc---acaca
       Lesser Egyptian jerboa  gg---acaaa
                 Prairie vole  gg---acaag
B D           Chinese hamster  gg---acaag
               Golden hamster  gg---acaag
B D                     Mouse  ga---acagg
B D                       Rat  ga---acaag
B D            Naked mole-rat  tt-----aaa
B D                Guinea pig  tt---acaaa
                   Chinchilla  tt---acaaa
             Brush-tailed rat  tc---acaaa
B D                      Pika  ------caaa
B D                    Alpaca  -t---tgtca
               Bactrian camel  -t---tgtca
B D                   Dolphin  tt---agaaa
                 Killer whale  tt---agaaa
             Tibetan antelope  tt---ggaaa
B D                       Cow  tt---ggaaa
B D                     Sheep  tt---ggaaa
                Domestic goat  tt---ggaaa
B D                     Horse  tt---ataaa
B D          White rhinoceros  tt---ataaa
B D                       Cat  tt---gtaaa
B D                       Dog  tc---acaaa
B D                   Ferret   tc---ataag
B D                     Panda  tt---ataag
               Pacific walrus  tc---ataag
                 Weddell seal  tc---gtaag
             Black flying-fox  tc---acaaa
B D                   Megabat  tc---acaaa
                Big brown bat  ac---aaaca
         David's myotis (bat)  ac---aaaca
B D                  Microbat  ac---acaca
B D                  Hedgehog  gt---ttaag
B D                     Shrew  tt---gcaaa
              Star-nosed mole  gg---gcgag
B D                  Elephant  tc---agaaa
          Cape elephant shrew  tg---ggaaa
B D                   Manatee  tt---agaaa
             Cape golden mole  ta---ccaac
B D                    Tenrec  ag---agaga
                     Aardvark  tc---ataag
B D                 Armadillo  tt---aaaga
  D              Saker falcon  -----aggag
  D          Peregrine falcon  -----aggag
  D       Collared flycatcher  -----aggag
  D    White-throated sparrow  -----aggag
B D       Medium ground finch  -----aggag
B D               Zebra finch  -----aggaa
           Tibetan ground jay  -----aggag
B D                Budgerigar  -----aggaa
  D                    Parrot  -----aggaa
  D             Scarlet macaw  -----aggaa
  D              Mallard duck  -----aggag
B D                   Chicken  -----gggaa
B D                    Turkey  -----gggaa
B D        American alligator  -----aggaa
  D           Green seaturtle  ------ggag
  D            Painted turtle  ------ggag
  D  Chinese softshell turtle  ------ggag
  D    Spiny softshell turtle  ------ggag
B D                    Lizard  -g---acaaa
B D             X. tropicalis  aa---agaaa
B D                 Tetraodon  -----tgaag
B D                      Fugu  -----tgtaa
       Yellowbelly pufferfish  -----tgtaa
B D              Nile tilapia  -----ggaaa
          Princess of Burundi  -----gaaag
        Burton's mouthbreeder  -----gaaaa
                  Zebra mbuna  -----gaaaa
          Pundamilia nyererei  -----gaaaa
B D                    Medaka  -----cagaa
           Southern platyfish  ------atag
B D               Stickleback  -----gacaa
B D              Atlantic cod  -----agaaa
B D                 Zebrafish  -gtgaagaaa
                  Spotted gar  ----gaataa
B D                   Lamprey  ---ccgtgca
B D                Coelacanth  ==========
B D                   Wallaby  ----------
    Mexican tetra (cavefish)  ==========
  D               Rock pigeon  ==========
B D                  Platypus  ==========
B D                   Opossum  ==========
B D                       Pig  ==========
B D           Tasmanian devil  ==========

Inserts between block 5 and 6 in window
  D             Saker falcon 12bp
  D         Peregrine falcon 12bp
  D      Collared flycatcher 11bp
  D   White-throated sparrow 12bp
B D      Medium ground finch 12bp
B D              Zebra finch 11bp
          Tibetan ground jay 11bp
B D               Budgerigar 11bp
  D                   Parrot 11bp
  D            Scarlet macaw 11bp
  D             Mallard duck 265bp
B D                  Chicken 12bp
B D                   Turkey 12bp
B D       American alligator 2bp
  D          Green seaturtle 12bp
  D           Painted turtle 12bp
  D Chinese softshell turtle 10bp
  D   Spiny softshell turtle 10bp
B D                   Lizard 3bp
B D                Tetraodon 4bp
B D                     Fugu 4bp
      Yellowbelly pufferfish 4bp
B D             Nile tilapia 5bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 91bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
B D                   Medaka 9bp
          Southern platyfish 9bp
B D              Stickleback 1bp
B D             Atlantic cod 3bp
B D                Zebrafish 5bp
                 Spotted gar 8bp

Alignment block 6 of 654 in window, 81847085 - 81847087, 3 bps 
B D                     Human  --c-----tt
B D                     Chimp  --c-----tt
B D                   Gorilla  --c-----tt
B D                 Orangutan  --c-----tt
B D                    Gibbon  --c-----tt
B D                    Rhesus  --c-----tt
B D       Crab-eating macaque  --c-----tt
B D                    Baboon  --c-----tt
B D              Green monkey  --c-----tt
B D                  Marmoset  --c-----tt
B D           Squirrel monkey  --c-----gt
B D                  Bushbaby  --c-----at
           Chinese tree shrew  --g-----cg
B D                  Squirrel  --t-----ag
       Lesser Egyptian jerboa  --g-----gg
                 Prairie vole  --c-----aa
B D           Chinese hamster  --t-----aa
               Golden hamster  --c-----ag
B D                     Mouse  --a-----ag
B D                       Rat  --t-----ag
B D            Naked mole-rat  --c-----ag
B D                Guinea pig  --c-----ag
                   Chinchilla  --g-----ag
             Brush-tailed rat  --c-----ag
B D                      Pika  --c-----ac
B D                    Alpaca  --c-----ac
               Bactrian camel  --c-----ac
B D                   Dolphin  --c-----gc
                 Killer whale  --c-----gc
             Tibetan antelope  --c-----ac
B D                       Cow  --c-----ac
B D                     Sheep  --c-----ac
                Domestic goat  --c-----ac
B D                     Horse  --c-----at
B D          White rhinoceros  --c-----at
B D                       Cat  --c-----ag
B D                       Dog  --c-----ac
B D                   Ferret   --c-----ag
B D                     Panda  --c-----at
               Pacific walrus  --c-----at
                 Weddell seal  --c-----at
             Black flying-fox  --c-----a-
B D                   Megabat  --c-----a-
                Big brown bat  --c-----a-
         David's myotis (bat)  --c-----a-
B D                  Microbat  --c-----a-
B D                  Hedgehog  --c-----aa
B D                     Shrew  --c-----ac
              Star-nosed mole  --c-----ac
B D                  Elephant  --c-----gt
          Cape elephant shrew  --t-----gg
B D                   Manatee  --c-----gt
             Cape golden mole  --a-----ac
B D                    Tenrec  --g-----gt
                     Aardvark  --c-----at
B D                 Armadillo  --c-----ac
  D              Saker falcon  --------ct
  D          Peregrine falcon  --------ct
  D       Collared flycatcher  --------ct
  D    White-throated sparrow  --------ct
B D       Medium ground finch  --------ct
B D               Zebra finch  --------ct
           Tibetan ground jay  --------gt
B D                Budgerigar  --------ct
  D                    Parrot  --------ct
  D             Scarlet macaw  --------ct
B D        American alligator  --------ca
  D           Green seaturtle  --------ct
  D            Painted turtle  --------ct
  D  Chinese softshell turtle  --------tg
  D    Spiny softshell turtle  --------tg
B D                    Lizard  ---aaaagat
B D             X. tropicalis  -------aag
B D                   Lamprey  ccc-------
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
B D                   Wallaby  ----------
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
B D                 Zebrafish  ==========
  D               Rock pigeon  ==========
B D              Nile tilapia  ==========
B D                 Tetraodon  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
B D                  Platypus  ==========
B D                   Opossum  ==========
B D                       Pig  ==========
B D           Tasmanian devil  ==========

Alignment block 7 of 654 in window, 81847088 - 81847088, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  c
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                      Pika  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  c
             Cape golden mole  a
B D                    Tenrec  g
                     Aardvark  a
B D                 Armadillo  a
  D              Saker falcon  t
  D          Peregrine falcon  t
  D       Collared flycatcher  t
  D    White-throated sparrow  t
B D       Medium ground finch  t
B D               Zebra finch  t
           Tibetan ground jay  t
B D                Budgerigar  t
  D                    Parrot  t
  D             Scarlet macaw  t
B D        American alligator  a
  D           Green seaturtle  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
  D    Spiny softshell turtle  c
B D                    Lizard  g
B D             X. tropicalis  a
B D               Stickleback  a
B D              Atlantic cod  a
B D                 Zebrafish  a
                  Spotted gar  g
B D                   Lamprey  a
        David's myotis (bat)  -
B D                  Squirrel  -
      Lesser Egyptian jerboa  -
B D                  Microbat  -
               Big brown bat  -
            Black flying-fox  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
  D              Mallard duck  =
B D                   Wallaby  -
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D               Rock pigeon  =
B D              Nile tilapia  =
B D                 Tetraodon  =
B D                   Chicken  =
B D                  Platypus  =
B D                   Opossum  =
B D                   Megabat  -
B D                       Pig  =
B D           Tasmanian devil  =

Inserts between block 7 and 8 in window
B D              Stickleback 1bp
B D             Atlantic cod 138bp
B D                Zebrafish 1bp
                 Spotted gar 1bp

Alignment block 8 of 654 in window, 81847089 - 81847093, 5 bps 
B D                     Human  a-gtt---a
B D                     Chimp  a-gtt---a
B D                   Gorilla  a-gtt---a
B D                 Orangutan  a-gtt---a
B D                    Gibbon  a-gtt---a
B D                    Rhesus  a-gtt---a
B D       Crab-eating macaque  a-gtt---a
B D                    Baboon  a-gtt---a
B D              Green monkey  a-gtt---a
B D                  Marmoset  a-gtt---a
B D           Squirrel monkey  a-gtt---a
B D                  Bushbaby  a-gtt---a
           Chinese tree shrew  a-ccg---c
B D                  Squirrel  a-att---g
       Lesser Egyptian jerboa  a-gtt---a
                 Prairie vole  a-att---a
B D           Chinese hamster  a-att---a
               Golden hamster  a-att---a
B D                     Mouse  a-a-t---a
B D                       Rat  a-gtt---a
B D            Naked mole-rat  a-gtt---c
B D                Guinea pig  a-gtt---t
                   Chinchilla  a-gtt---t
             Brush-tailed rat  a-gtt---t
B D                      Pika  g-gcc---c
B D                    Alpaca  g-gtc---a
               Bactrian camel  g-gtc---a
B D                   Dolphin  a-gtt---a
                 Killer whale  a-gtt---a
             Tibetan antelope  g-att---a
B D                       Cow  g-gtt---a
B D                     Sheep  g-gtt---a
                Domestic goat  g-gtt---a
B D                     Horse  g-gtc---a
B D          White rhinoceros  g-gtt---a
B D                       Cat  g-gtt---a
B D                       Dog  g-gtt---a
B D                   Ferret   g-ggc---a
B D                     Panda  g-gtc---a
               Pacific walrus  g-att---a
                 Weddell seal  g-gtt---a
             Black flying-fox  --ggt---c
B D                   Megabat  --ggt---c
                Big brown bat  --gtt---a
         David's myotis (bat)  --gtc---a
B D                  Microbat  --gtt---a
B D                  Hedgehog  g-gcc---a
B D                     Shrew  a-------t
              Star-nosed mole  g-ggccgct
B D                  Elephant  aagtc---a
          Cape elephant shrew  a--tc---a
B D                   Manatee  a-gtc---a
             Cape golden mole  --gtc---a
B D                    Tenrec  t-gtc---a
                     Aardvark  --gtc---g
B D                 Armadillo  a-gat---a
  D              Saker falcon  t-att---t
  D          Peregrine falcon  t-att---t
  D       Collared flycatcher  t-gtc---t
  D    White-throated sparrow  t-att---t
B D       Medium ground finch  t-att---t
B D               Zebra finch  t-att---t
           Tibetan ground jay  t-att---t
B D                Budgerigar  t-att---t
  D                    Parrot  t-att---t
  D             Scarlet macaw  t-att---t
B D        American alligator  g-agc---t
  D           Green seaturtle  c-aca---t
  D            Painted turtle  c-aca---t
  D  Chinese softshell turtle  c-aca---t
  D    Spiny softshell turtle  c-aca---t
B D                    Lizard  c-att---a
B D             X. tropicalis  a-ata---a
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
B D               Stickleback  =========
         Pundamilia nyererei  =========
                 Zebra mbuna  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D                    Medaka  =========
B D                Coelacanth  =========
B D                    Turkey  =========
                 Spotted gar  =========
  D              Mallard duck  =========
B D                   Wallaby  ---------
          Southern platyfish  =========
    Mexican tetra (cavefish)  =========
B D                 Zebrafish  =========
  D               Rock pigeon  =========
B D              Nile tilapia  =========
B D                 Tetraodon  =========
B D                   Chicken  =========
B D              Atlantic cod  =========
B D                  Platypus  =========
B D                   Opossum  =========
B D                       Pig  =========
B D           Tasmanian devil  =========

Alignment block 9 of 654 in window, 81847094 - 81847098, 5 bps 
B D                     Human  ctggg
B D                     Chimp  ctggg
B D                   Gorilla  ctggg
B D                 Orangutan  ctggg
B D                    Gibbon  ctggg
B D                    Rhesus  ctggg
B D       Crab-eating macaque  ctggg
B D                    Baboon  ctggg
B D              Green monkey  ctggg
B D                  Marmoset  ct-gg
B D           Squirrel monkey  ct-gg
B D                  Bushbaby  cctgg
           Chinese tree shrew  cc--g
B D                  Squirrel  cttcg
       Lesser Egyptian jerboa  ctggg
                 Prairie vole  ctagg
B D           Chinese hamster  ctggg
               Golden hamster  ctggg
B D                     Mouse  ctgca
B D                       Rat  ctggg
B D            Naked mole-rat  ctatg
B D                Guinea pig  ctgtg
                   Chinchilla  ccatg
             Brush-tailed rat  ctata
B D                      Pika  c---g
B D                    Alpaca  cttgg
               Bactrian camel  cttgg
B D                   Dolphin  cttgg
                 Killer whale  cttgg
             Tibetan antelope  cttgg
B D                       Cow  cttgg
B D                     Sheep  cttgg
                Domestic goat  tttgg
B D                     Horse  ctggg
B D          White rhinoceros  ctggg
B D                       Cat  ctggg
B D                       Dog  ctgag
B D                   Ferret   ctggg
B D                     Panda  ctggg
               Pacific walrus  ctggg
                 Weddell seal  ctggg
             Black flying-fox  acgag
B D                   Megabat  acgag
                Big brown bat  ccggg
         David's myotis (bat)  ccggg
B D                  Microbat  caggg
B D                  Hedgehog  tgagg
B D                     Shrew  cgtgg
              Star-nosed mole  caggg
B D                  Elephant  cgtgg
          Cape elephant shrew  ---ga
B D                   Manatee  ct-gg
             Cape golden mole  gatga
B D                    Tenrec  ggcgg
                     Aardvark  ctgga
B D                 Armadillo  cctgc
  D              Saker falcon  ttgga
  D          Peregrine falcon  ttgga
  D       Collared flycatcher  ttgga
  D    White-throated sparrow  ttgga
B D       Medium ground finch  ttgga
B D               Zebra finch  ttggg
           Tibetan ground jay  ttgga
B D                Budgerigar  ctgga
  D                    Parrot  ctgga
  D             Scarlet macaw  ctgga
B D        American alligator  ctgtc
  D           Green seaturtle  tagga
  D            Painted turtle  tagga
  D  Chinese softshell turtle  taggg
  D    Spiny softshell turtle  taggg
B D                    Lizard  ctgga
B D             X. tropicalis  agaag
B D                 Tetraodon  --gaa
B D                      Fugu  --gag
       Yellowbelly pufferfish  --gag
          Princess of Burundi  ---ag
                  Zebra mbuna  ---ag
          Pundamilia nyererei  ---ag
B D               Stickleback  --gat
       Burton's mouthbreeder  =====
B D                    Medaka  =====
B D                Coelacanth  =====
B D                    Turkey  =====
                 Spotted gar  =====
  D              Mallard duck  =====
B D                   Wallaby  -----
          Southern platyfish  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
  D               Rock pigeon  =====
B D              Nile tilapia  =====
B D                   Chicken  =====
B D              Atlantic cod  =====
B D                  Platypus  =====
B D                   Opossum  =====
B D                       Pig  =====
B D           Tasmanian devil  =====

Inserts between block 9 and 10 in window
  D             Saker falcon 11bp
  D         Peregrine falcon 11bp
  D      Collared flycatcher 11bp
  D   White-throated sparrow 11bp
B D      Medium ground finch 11bp
B D              Zebra finch 11bp
          Tibetan ground jay 11bp
B D               Budgerigar 9bp
  D                   Parrot 9bp
  D            Scarlet macaw 9bp
B D       American alligator 19bp
  D          Green seaturtle 11bp
  D           Painted turtle 11bp
  D Chinese softshell turtle 11bp
  D   Spiny softshell turtle 11bp
B D                   Lizard 147bp

Alignment block 10 of 654 in window, 81847099 - 81847166, 68 bps 
B D                     Human  tct-------gagt------------------------------------------------cacacact
B D                     Chimp  tct-------gagt------------------------------------------------cacacact
B D                   Gorilla  tct-------gagt------------------------------------------------cacacact
B D                 Orangutan  tct-------gagt------------------------------------------------cacacact
B D                    Gibbon  tct-------gagt------------------------------------------------cacacact
B D                    Rhesus  tct-------gagt------------------------------------------------cacacgct
B D       Crab-eating macaque  tct-------gagt------------------------------------------------cacacgct
B D                    Baboon  tct-------gagt------------------------------------------------cacacgct
B D              Green monkey  tct-------gagt------------------------------------------------cacaggct
B D                  Marmoset  tct-------gagc------------------------------------------------tacacaat
B D           Squirrel monkey  tct-------gagc------------------------------------------------tatacact
B D                  Bushbaby  gct-------gagt------------------------------------------------cacagact
           Chinese tree shrew  tct-------gagc------------------------------------------------cacaagca
B D                  Squirrel  tct-------aagc------------------------------------------------cacaagct
       Lesser Egyptian jerboa  cct-------gagc------------------------------------------------cataaac-
                 Prairie vole  ttt-------gagc------------------------------------------------catgagc-
B D           Chinese hamster  ttg-------gagc------------------------------------------------tgtgagc-
               Golden hamster  ttt-------gagc------------------------------------------------tgtgagc-
B D                     Mouse  tct-------gtcttctgcta-----------------------------------------tacaccc-
B D                       Rat  tca-------gttct-----------------------------------------------tactccc-
B D            Naked mole-rat  tca-------gagc------------------------------------------------cacaagct
B D                Guinea pig  tca-------gagc------------------------------------------------cataaact
                   Chinchilla  tca-------gagc------------------------------------------------cacaaatg
             Brush-tailed rat  tca-------gaac------------------------------------------------cacaaact
B D                      Pika  gct-------gag-------------------------------------------------cgccagcg
B D                    Alpaca  tct-------gagc------------------------------------------------caccaact
               Bactrian camel  tct-------gagc------------------------------------------------caccaact
B D                   Dolphin  tct-------gagt------------------------------------------------cacaaacc
                 Killer whale  tct-------gagt------------------------------------------------cacaaacc
             Tibetan antelope  tct-------aaga------------------------------------------------cacagacc
B D                       Cow  tct-------ggga------------------------------------------------cacaaacc
B D                     Sheep  tct-------gaga------------------------------------------------cacagacc
                Domestic goat  tct-------gaga------------------------------------------------cacagacc
B D                     Horse  tct-------gagc------------------------------------------------cacgagct
B D          White rhinoceros  tct-------gagc------------------------------------------------tatgaact
B D                       Cat  tct-------gagc------------------------------------------------cacgaact
B D                       Dog  tct-------gagc------------------------------------------------cacagacc
B D                   Ferret   tct-------gggc------------------------------------------------catgaact
B D                     Panda  tct-------gagc------------------------------------------------cacgaact
               Pacific walrus  tgt-------gagc------------------------------------------------catgagct
                 Weddell seal  tgt-------gagc------------------------------------------------cgtgagcc
             Black flying-fox  -ct-------cagc------------------------------------------------tactgacg
B D                   Megabat  -ct-------cagc------------------------------------------------tactgacg
                Big brown bat  cct-------cagc------------------------------------------------cccgagct
         David's myotis (bat)  -ct-------cag-------------------------------------------------cccgagct
B D                  Microbat  -ct-------cagc------------------------------------------------cccgagct
B D                  Hedgehog  tct-------gagg------------------------------------------------tgcaaact
B D                     Shrew  tct-------gaga------------------------------------------------cgc-----
              Star-nosed mole  ccg-------ggga------------------------------------------------ggc-----
B D                  Elephant  tct-------gagc------------------------------------------------tgtgagct
          Cape elephant shrew  tgt-------gagc------------------------------------------------tgtgggct
B D                   Manatee  tct-------gagc------------------------------------------------cgtgagct
             Cape golden mole  act-------gaga------------------------------------------------cgtgaaca
B D                    Tenrec  cct-------g---------------------------------------------------------ca
                     Aardvark  ccc-------gggc------------------------------------------------catgagcc
B D                 Armadillo  tca-------gagc------------------------------------------------cacgagct
  D              Saker falcon  ttg-------gtgc------------------------------------------------caagacca
  D          Peregrine falcon  ttg-------gtgc------------------------------------------------caagacca
  D       Collared flycatcher  tcg-------gtat------------------------------------------------ccagagca
  D    White-throated sparrow  tca-------gtat------------------------------------------------ccagacca
B D       Medium ground finch  tca-------gtat------------------------------------------------ccagacca
B D               Zebra finch  tca-------gtat------------------------------------------------ccagacca
           Tibetan ground jay  tca-------gtac------------------------------------------------ccaagcca
B D                Budgerigar  ctg-------gtgt------------------------------------------------caagacca
  D                    Parrot  ctg-------gtgg------------------------------------------------caaga---
  D             Scarlet macaw  ttg-------gctc------------------------------------------------cgttac--
B D                   Chicken  ctg-------aaaa------------------------------------------------caa----a
B D                    Turkey  ctg-------aaaa------------------------------------------------caa----a
B D        American alligator  cca-------gcac------------------------------------------------caa-----
  D           Green seaturtle  ccc-------aggg------------------------------------------------ccagagcc
  D            Painted turtle  ccc-------agtg------------------------------------------------tcagagcc
  D  Chinese softshell turtle  ccc-------agtg------------------------------------------------ccagagcc
  D    Spiny softshell turtle  ccc-------agcg------------------------------------------------cccgagcc
B D             X. tropicalis  ----------------------------------------------------------------------
B D                 Tetraodon  g------------g------------------------------------------------cgtgagga
B D                      Fugu  att----------g------------------------------------------------cataagga
       Yellowbelly pufferfish  att----------g------------------------------------------------cataagga
B D              Nile tilapia  --t-------gaca------------------------------------------------tgtgagga
          Princess of Burundi  ttt-------gaca------------------------------------------------cgtgagga
                  Zebra mbuna  ttt-------gaca------------------------------------------------cgtgagga
          Pundamilia nyererei  ttt-------gaca------------------------------------------------cgtgagga
B D                    Medaka  ------------tagc---------aacgt--------------------------------cgcaccga
           Southern platyfish  ------------aa------------------------------------------------cgtattaa
B D               Stickleback  attaaaatgggaca------------------------------------------------tgtgaggg
B D                 Zebrafish  ---------------cttagaatgaatcgt---------------------------tttcccatacagc
                  Spotted gar  ----------------ttaaaacaaagcatgaactcccagagcctaaaagctgattttattccatcaggc
       Burton's mouthbreeder  ======================================================================
B D                Coelacanth  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D                    Lizard  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D               Rock pigeon  ======================================================================
B D              Atlantic cod  ======================================================================
B D                  Platypus  ======================================================================
B D                   Opossum  ======================================================================
B D                       Pig  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  a------ttaatgc-----------a-g---aaga----ttct------------------------c--
                        Chimp  a------ttaatgc-----------a-g---aagg----ttct------------------------c--
                      Gorilla  a------ttaatgc-----------a-g---aagg----ttct------------------------c--
                    Orangutan  a------ttaatgc-----------a-g---aagg----ttct------------------------c--
                       Gibbon  a------ttaatac-----------a-g---aatg----ttct------------------------c--
                       Rhesus  g------ttaacgc-----------g-g---aatg----ttct------------------------c--
          Crab-eating macaque  g------ttaacgc-----------a-g---aatg----ttct------------------------c--
                       Baboon  g------ttaacgc-----------a-g---aatg----ttct------------------------c--
                 Green monkey  a------ttaacgc-----------a-g---aatg----ttct------------------------c--
                     Marmoset  a------ttaatgc-----------a-g---aatg----tttt------------------------c--
              Squirrel monkey  a------ttaatgc-----------a-g---aatg----tttt------------------------c--
                     Bushbaby  aa-gctgttaatgc-----------a-ga--aatg----ttct------------------------g--
           Chinese tree shrew  g-----------gc-----------c-g---agg------------------------------------
                     Squirrel  a----atatttgac-----------a-g---a---------at------------------------a--
       Lesser Egyptian jerboa  -----agctctgac-----------a-g---c---------ct------------------------a--
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  a----agccctgac-----------a-g---aaca----atgt------------------------c--
                   Guinea pig  a----agcctggac-----------a-g---acta----gagt------------------------c--
                   Chinchilla  a----agccttgac-----------a-g---a--a----tagt------------------------c--
             Brush-tailed rat  a----agccttgaa-----------a-g---a--a----gagt------------------------c--
                         Pika  g----aggcctccc-----------a-c---a---------gc------------------------c--
                       Alpaca  aa-gctactgacat-----------a-g---gct-----ttct------------------------c--
               Bactrian camel  aa-gctactgacat-----------a-g---gct-----ttct------------------------c--
                      Dolphin  aa-actgttgacac-----------a-g---gcta----ttct------------------------c--
                 Killer whale  aa-actgttgacac-----------a-g---gcta----ttct------------------------c--
             Tibetan antelope  aa-gctatcaacac-----------g-g---gcta----ttct------------------------c--
                          Cow  aa-gctatcgacac-----------g-g---gcta----ttct------------------------c--
                        Sheep  aa-gctatcaacac-----------g-g---gcta----ttct------------------------c--
                Domestic goat  aa-gctatcaacac-----------g-g---gcta----ttct------------------------c--
                        Horse  aa-actattgacat-----------a-g---gata----ttct------------------------c--
             White rhinoceros  aa-gctagtgacac-----------a-g---gata----t--t------------------------c--
                          Cat  aa-gccatttacac-----------a-g---aaca----ttct------------------------c--
                          Dog  aa-gccacgaacac-----------a-g---gatg----ttct------------------------c--
                      Ferret   ga-gccgctaac-------------------gaga----ttcc------------------------c--
                        Panda  ga-gccatgaacaa-----------a-g---gata----ttct------------------------c--
               Pacific walrus  ga-gccgtgaacac-----------a-g---gata----ttct------------------------c--
                 Weddell seal  ga-gccgtgagcac-----------a-g---gata----ttct------------------------c--
             Black flying-fox  ta-gg---------------------------aga----tgct------------------------c--
                      Megabat  ca-gg---------------------------aga----tgct------------------------c--
                Big brown bat  ca-gctctg------------------g---caca----ggac------------------------c--
         David's myotis (bat)  ca-gc-----------------------------------------------------------------
                     Microbat  ca-gc-----------------------------------------------------------------
                     Hedgehog  ag-accactgttgt-----------g-g---gaca----tccc------------------------aag
                        Shrew  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                     Elephant  ga-gc--------------------------------------------------------------c--
          Cape elephant shrew  gg-ct--------------------------------------------------------------g--
                      Manatee  ga-----------------------------------------------------------------g--
             Cape golden mole  gc-----------------------------------------------------------------g--
                       Tenrec  gg-----------------------------------------------------------------c--
                     Aardvark  aa-gc--------------------------------------------------------------a--
                    Armadillo  gt-gccatcagcag-----------a-g---gagc----cttccccagggcccccagcccctgaccgc--
                 Saker falcon  gc-ttggctctgct-----------a-ttctgact----agac------------------------c--
             Peregrine falcon  gc-ttggctctgct-----------a-ttctgact----agac------------------------c--
          Collared flycatcher  gt-ttaactccact-----------a-tgctgacc----agcc------------------------c--
       White-throated sparrow  gt-ttaagtccact-----------a-tgctg--------------------------------------
          Medium ground finch  gt-ttaactccact-----------a-tgctg--------------------------------------
                  Zebra finch  gt-ttaactccact-----------a-tgctgacc----agcc------------------------c--
           Tibetan ground jay  gt-ttaactccact-----------a-tgctgacc----agcc------------------------c--
                   Budgerigar  gc-ttggctctgct-----------a-ttctgacc----aggc------------------------c--
                       Parrot  -----------------------------ccagca----aggc------------------------c--
                Scarlet macaw  ----------------------------tctgacc----aggc------------------------c--
                      Chicken  gc-ttggcccga-c-----------a-ttctcact----aggtaa----------------------c--
                       Turkey  gt-ttggccctacc-----------a-ttctcact----atgt------------------------c--
           American alligator  -----ggcttctcg-----------g-agctg--c----tggc------------------------c--
              Green seaturtle  aa-tgggcttttct-----------g-ccctgatg----gtgc------------------------c--
               Painted turtle  ca-tgggcttttct-----------g-cactgatg----atgc------------------------c--
     Chinese softshell turtle  ca-cgggct----t-----------t-tctgcacggaccatgc------------------------c--
       Spiny softshell turtle  ca-cgggct------------------------------gtgc------------------------c--
                X. tropicalis  ----------------------------------------------------------------------
                    Tetraodon  ccgaccggagggct-----------g-g---agcg----atcc---------------------------
                         Fugu  tc-atggaaggact-----------g-g---agcg----gtct---------------------------
       Yellowbelly pufferfish  tc-atggaaggact-----------g-g---agcg----atct---------------------------
                 Nile tilapia  aa-acatct------------------g---gaca----gcag---------------------------
          Princess of Burundi  aa-acatctggact-----------gtg---gaca----gcat---------------------------
                  Zebra mbuna  aa-acatctggagt-----------gcg---gaca----gcat---------------------------
          Pundamilia nyererei  aa-acatctggagt-----------gcg---gaca----gcat---------------------------
                       Medaka  c--agcttttcatt-----------g-g---gacg----tcac---------------------------
           Southern platyfish  t--acattataagt-----------g-t---atca----atag---------------------------
                  Stickleback  ta-atacttgtacttgttatcgtcag-g---gaca----gtgt---------------------------
                    Zebrafish  t--gcaaactaact-----------tca---aata----gttc---------------------------
                  Spotted gar  at-ttctcctggca-----------t-g---gtca----gcgg---------------------------
        Burton's mouthbreeder  ======================================================================
                   Coelacanth  ======================================================================
                 Mallard duck  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                       Lizard  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                  Rock pigeon  ======================================================================
                 Atlantic cod  ======================================================================
                     Platypus  ======================================================================
                      Opossum  ======================================================================
                          Pig  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ----------cc--------------------------aat--ggcctcca-------------------
                        Chimp  ----------cc--------------------------aac--ggcctcca-------------------
                      Gorilla  ----------cc--------------------------aac--ggcctcca-------------------
                    Orangutan  ----------cc--------------------------aac--ggcctcca-------------------
                       Gibbon  ----------cc--------------------------aac--ggcctcca-------------------
                       Rhesus  ----------cc--------------------------aac--ggcctcca-------------------
          Crab-eating macaque  ----------cc--------------------------aac--ggcctcca-------------------
                       Baboon  ----------cc--------------------------aac--ggcctcca-------------------
                 Green monkey  ----------cc--------------------------aac--ggcctcca-------------------
                     Marmoset  ----------cc--------------------------aac--aacctcca-------------------
              Squirrel monkey  ----------cc--------------------------aac--aacctcca-------------------
                     Bushbaby  ----------cc--------------------------agt--ggtct-ca-------------------
           Chinese tree shrew  --------------------------------------aca--ggcctcc--------------------
                     Squirrel  ----------ctgatgacagtgacaaatgcgcctcctgcat--gtccag---------------------
       Lesser Egyptian jerboa  ----------ct--------------------ctcct-agt--ggttct---------------------
                 Prairie vole  ----------------------------------------t--gttctc---------------------
              Chinese hamster  --------------------------------------agt--ggcccc---------------------
               Golden hamster  --------------------------------------agt--ggcccc---------------------
                        Mouse  --------------------------------------agt--gtccc----------------------
                          Rat  --------------------------------------agt--ggccc----------------------
               Naked mole-rat  ----------tc--------------------------ggt--ggcctg---------------------
                   Guinea pig  ----------cc--------------------------att--ggcccc---------------------
                   Chinchilla  ----------cc--------------------------agt--ggcccc---------------------
             Brush-tailed rat  ----------tc--------------------------tgt--ggctac---------------------
                         Pika  ----------cc--------------------------agt--gagccc---------------------
                       Alpaca  ----------tc---------------------------gt--gaccccct-------------------
               Bactrian camel  ----------tc---------------------------gt--gaccccct-------------------
                      Dolphin  ----------tc--------------------------aat--ggccccaa---------------tgcc
                 Killer whale  ----------tc--------------------------aat--ggccccaa---------------tgcc
             Tibetan antelope  ----------tc--------------------------ctt--ggccccca---------------ggcc
                          Cow  ----------tc--------------------------ctt--ggccccaa---------------ggcc
                        Sheep  ----------tc--------------------------ctt--ggcccccaggccaccaaacacctggcc
                Domestic goat  ----------tc--------------------------ctt--ggcccccaggccaccaaacacctggcc
                        Horse  ----------tc--------------------------agtggagcaacaa---------------tg--
             White rhinoceros  ----------tc--------------------------agtggagcaacaa---------------tg--
                          Cat  ----------tc--------------------------aat--ggctgcaa---------------tgcc
                          Dog  ----------tc--------------------------aac--agctatga---------------tgcc
                      Ferret   ----------tc--------------------------tgc--ggctgcga---------------tgcc
                        Panda  ----------tc--------------------------cac--agctacaa---------------ggcc
               Pacific walrus  ----------tc--------------------------aac--agctacaa---------------ggcc
                 Weddell seal  ----------tc--------------------------aac--agctatga---------------ggcc
             Black flying-fox  ----------tc--------------------------aac--ggccccaa---------------cgcc
                      Megabat  ----------tc--------------------------aac--ggccccaa---------------cgcc
                Big brown bat  ----------tc--------------------------aat--ggcc-----------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                     Hedgehog  tgtctaaggacc--------------------------aga--ggctgtgg-------------------
                        Shrew  ----------gc--------------------------tgt--g--cgtgg-------------------
              Star-nosed mole  ----------cc--------------------------tgg--ggacgtgg-------------------
                     Elephant  ----------tc--------------------------agt-----------------------------
          Cape elephant shrew  ----------tc--------------------------agc-----------------------------
                      Manatee  ----------tc--------------------------aga-----------------------------
             Cape golden mole  ----------cc--------------------------tgt-----------------------------
                       Tenrec  ----------cc--------------------------cga-----------------------------
                     Aardvark  ----------tc--------------------------agg-----------------------------
                    Armadillo  ----------ct--------------------------gga-----------------------------
                 Saker falcon  ----------ac--------------------------agg--agcctcca-------------------
             Peregrine falcon  ----------ac--------------------------agg--agcctcca-------------------
          Collared flycatcher  ----------at--------------------------agc--agcctcca-------------------
       White-throated sparrow  --------------------------------------agc--agcctcca-------------------
          Medium ground finch  --------------------------------------agc--agccccca-------------------
                  Zebra finch  ----------ac--------------------------agc--agcctcca-------------------
           Tibetan ground jay  ----------ac--------------------------agc--agcctcca-------------------
                   Budgerigar  ----------at--------------------------agg--agcctcca-------------------
                       Parrot  ----------ac--------------------------agg--agcctcca-------------------
                Scarlet macaw  ----------at--------------------------agg--agcctcca-------------------
                      Chicken  ----------ac--------------------------aag------tcaa-------------------
                       Turkey  ----------ac--------------------------aag------tcaa-------------------
           American alligator  ----------ac--------------------------agg--agacagcc-------------------
              Green seaturtle  ----------aa--------------------------ggg--agtcacca-------------------
               Painted turtle  ----------aa--------------------------ggg--agtcacca-------------------
     Chinese softshell turtle  ----------aa--------------------------ggg--aatcacc--------------------
       Spiny softshell turtle  ----------aa--------------------------agg--aatcacca-------------------
                X. tropicalis  ----------------------------------------------------------------------
                    Tetraodon  ----------------------------------------------------------------------
                         Fugu  ----------------------------------------------------------------------
       Yellowbelly pufferfish  ----------------------------------------------------------------------
                 Nile tilapia  ----------------------------------------------------------------------
          Princess of Burundi  ----------------------------------------------------------------------
                  Zebra mbuna  ----------------------------------------------------------------------
          Pundamilia nyererei  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
                  Stickleback  ----------------------------------------------------------------------
                    Zebrafish  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
        Burton's mouthbreeder  ======================================================================
                   Coelacanth  ======================================================================
                 Mallard duck  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                       Lizard  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                  Rock pigeon  ======================================================================
                 Atlantic cod  ======================================================================
                     Platypus  ======================================================================
                      Opossum  ======================================================================
                          Pig  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  -------a-tgt-------------------------------------------ca---g-ac----gc
                        Chimp  -------a-tgt-------------------------------------------ca---g-ac----gc
                      Gorilla  -------a-tgt-------------------------------------------ca---g-ac----gc
                    Orangutan  -------a-tgt-------------------------------------------ca---g-ac----gc
                       Gibbon  -------a-tgt-------------------------------------------ca---g-ac----gc
                       Rhesus  -------a-tgc-------------------------------------------ta---g-at----gc
          Crab-eating macaque  -------a-tgc-------------------------------------------ta---g-at----gc
                       Baboon  -------a-tgc-------------------------------------------ta---g-ac----gc
                 Green monkey  -------g-tgc-------------------------------------------ta---g-at----gc
                     Marmoset  -------a-tgc-------------------------------------------ca---g-ac----gc
              Squirrel monkey  -------a-tgc-------------------------------------------ca---g-ac----gc
                     Bushbaby  -------a-tgc-------------------------------------------cacctg-at----gc
           Chinese tree shrew  ----------tc-------------------------------------------cc---g-ag----gc
                     Squirrel  ------------------------------------------------------------g-ga----gc
       Lesser Egyptian jerboa  ------------------------------------------------------------g-gg----ac
                 Prairie vole  ------------------------------------------------------------a-gaccattt
              Chinese hamster  ------------------------------------------------------------a-gg----gt
               Golden hamster  ------------------------------------------------------------a-gg----gt
                        Mouse  ---------------------------------------------------------------a----gc
                          Rat  --------------------------------------------------------------ga----gc
               Naked mole-rat  ------------------------------------------------------------a-ag----ac
                   Guinea pig  ------------------------------------------------------------a-ag----ac
                   Chinchilla  ------------------------------------------------------------a-ag----tc
             Brush-tailed rat  ------------------------------------------------------------a-ag----tc
                         Pika  ------------------------------------------------------------c-aa----ga
                       Alpaca  -------g-cctggaccaca-----------------------gcgggggttctgca---c-at------
               Bactrian camel  -------g-cctggaccaca-----------------------gcgggggttctgca---c-at------
                      Dolphin  accacaag-cctggacaaca-----------------------gcaggggctctgca---a-gt----gg
                 Killer whale  accacaag-cctggacaaca-----------------------gcaggggctctgca---a-gt----gg
             Tibetan antelope  accaaaca-cct-----------------------------------ggtctctata---a-gt----ca
                          Cow  accacaca-cct-----------------------------------ggtctctgta---a-gt----ca
                        Sheep  accacaca-cct-----------------------------------ggtctctgta---a-gt----ca
                Domestic goat  accacaca-act-----------------------------------ggtctctgta---a-gt----ca
                        Horse  ----------------------------------------------aggactctgta---a-gt----gg
             White rhinoceros  ----------------------------------------------gggtttctcta---a-gtttaggg
                          Cat  accg---c-tgc----------------------------------aacgatctgta---c-gt----gg
                          Dog  gcca---c-cac-----------------------------------acactcggcg---c-ct----gg
                      Ferret   accg---a-ggc----------------------------------aacactgccta---tcga----gg
                        Panda  accg---a-cgc----------------------------------cacactccgta---t-gt----gg
               Pacific walrus  accg---a-tgc----------------------------------aacattctgta---t-gt----gg
                 Weddell seal  acca---a-tgc----------------------------------aacactctgta---t-gt----gg
             Black flying-fox  actg---a-cgc-----------------------------------ccggacgacc---a-tg----gg
                      Megabat  actg---a-cgc-----------------------------------ccggacgacc---c-cg----gg
                Big brown bat  ---g---a-cgc-----------------------------------ctgggcagca---g-tg----gg
         David's myotis (bat)  --------------------------------------------------gacggcg---c-ag----gg
                     Microbat  --------------------------------------------------gacggca---c-cg----gg
                     Hedgehog  ------------------------------------------------------------g-ct----gg
                        Shrew  ------------------------------------------------------------g-ga----ca
              Star-nosed mole  ------------------------------------------------------------g-gg----cg
                     Elephant  ------------------------------------------------------------g-ca----gg
          Cape elephant shrew  ------------------------------------------------------------a-ca----gg
                      Manatee  ------------------------------------------------------------g-ca----gg
             Cape golden mole  ------------------------------------------------------------g-tg----gg
                       Tenrec  ------------------------------------------------------------c-cc----tg
                     Aardvark  ------------------------------------------------------------g-tg----gg
                    Armadillo  ------------------------------------------------------------c-ta----gg
                 Saker falcon  -------a-tactacaggac-----------------------tgctttgaacagca---a-gc----t-
             Peregrine falcon  -------a-tactacaggac-----------------------tgctttgaacagca---a-gc----t-
          Collared flycatcher  -------a-tactgcaggac-----------------------tgctctgcacagca---a-gc----t-
       White-throated sparrow  -------a-tgctgcaggcc-----------------------tgctctgcacagca---a-gc----t-
          Medium ground finch  -------a-tgctgcaggac-----------------------tgctctgcacagca---a-gc----t-
                  Zebra finch  -------a-tactgcaggac-----------------------tgctgtgcacagca---a-gc----t-
           Tibetan ground jay  -------a-tactgcaggac-----------------------tgctctgcacagca---a-gc----t-
                   Budgerigar  -------g--attaaaggaa-----------------------gactttgaacag-a---a-gc----t-
                       Parrot  -------g--attacagcag-----------------------ggctttgaacag-a---a-gc----t-
                Scarlet macaw  -------g--actaaaggag-----------------------ggctttgaacag-a---a-gc----t-
                      Chicken  -------a-tactacaggac-----------------------tgctttgaacagca---a-gc----t-
                       Turkey  -------g-tactacaggac-----------------------agctctgaacagca---a-gc----t-
           American alligator  -------g-gactagagctc-----------------------tactt--------a---g-gc----t-
              Green seaturtle  -------agaatataagtgc-----------------------cactctgaggagca---a-ac----t-
               Painted turtle  -------aaaatgcaagtgc-----------------------cacttggaggtgca---a-ac----t-
     Chinese softshell turtle  ---------aacagcagcg---------------------------tgtgaggagca---a-gg----t-
       Spiny softshell turtle  -------agaacagcagcgc-----------------------tgctgtgaggagca---g-gg----t-
                X. tropicalis  -------------tcagaacagttctagcaacaaggggagaggggtggagttagaca---a---------
                    Tetraodon  ----------------------------------------------------------------------
                         Fugu  ----------------------------------------------------------------------
       Yellowbelly pufferfish  ----------------------------------------------------------------------
                 Nile tilapia  ----------------------------------------------------------------------
          Princess of Burundi  ----------------------------------------------------------------------
                  Zebra mbuna  ----------------------------------------------------------------------
          Pundamilia nyererei  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
                  Stickleback  ----------------------------------------------------------------------
                    Zebrafish  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
        Burton's mouthbreeder  ======================================================================
                   Coelacanth  ======================================================================
                 Mallard duck  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                       Lizard  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                  Rock pigeon  ======================================================================
                 Atlantic cod  ======================================================================
                     Platypus  ======================================================================
                      Opossum  ======================================================================
                          Pig  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  -t-------g---g-------------------acagcag
                        Chimp  -t-------g---g-------------------acagcag
                      Gorilla  -t-------g---g-------------------acagcag
                    Orangutan  -t-------g---g-------------------acagcag
                       Gibbon  -t-------g---g-------------------acagcag
                       Rhesus  -t-------g---g-------------------acagcag
          Crab-eating macaque  -t-------g---g-------------------acagcag
                       Baboon  -t-------g---g-------------------acagcag
                 Green monkey  -t-------g---g-------------------acagcag
                     Marmoset  -t-------g---g-------------------agagcag
              Squirrel monkey  -t-------g---g-------------------agaacag
                     Bushbaby  tt-------a---a-------------------atgacag
           Chinese tree shrew  -c-------g---g-------------------a------
                     Squirrel  -c--------------------------------------
       Lesser Egyptian jerboa  -catt----a---c-------------------atgctta
                 Prairie vole  -t--------------------------------------
              Chinese hamster  -c--------------------------------------
               Golden hamster  -c--------------------------------------
                        Mouse  -c--------------------------------------
                          Rat  -c--------------------------------------
               Naked mole-rat  -cacc----g---g-------------------attcctg
                   Guinea pig  -tgcc----a---g-------------------acacctg
                   Chinchilla  -cacc----a---g-------------------acacctg
             Brush-tailed rat  -cact----a---g-------------------acaactg
                         Pika  -catctttgg---g-------------------gtgtctg
                       Alpaca  -g-------g---g-------------------gccccag
               Bactrian camel  -g-------g---g-------------------gccccag
                      Dolphin  -g-------g---g-------------------ttcccac
                 Killer whale  -g-------g---g-------------------tccccac
             Tibetan antelope  -g-------g---g-------------------tccccag
                          Cow  -g-------g---g-------------------tccccag
                        Sheep  -g-------g---g-------------------tccccag
                Domestic goat  -g-------g---g-------------------tccccag
                        Horse  -g-------g---g-------------------tccccag
             White rhinoceros  -g-------g---gtca----------------tccccag
                          Cat  -g-------g---g-------------------ttcccgg
                          Dog  -g-------g---a-------------------tccctgg
                      Ferret   -g-------g-----------------------tccctgg
                        Panda  -g-------g-----------------------tccccgg
               Pacific walrus  -g-------g-----------------------gtcccgg
                 Weddell seal  -g-------g-----------------------gtcccgg
             Black flying-fox  -g-------a---c-------------------tgagcgg
                      Megabat  -g-------a---a-------------------tgagcgg
                Big brown bat  -g-------ggctc-------------------tccatgg
         David's myotis (bat)  -c-------agc-c-------------------tccatg-
                     Microbat  -g-------gactc-------------------ctcatgg
                     Hedgehog  -g-------g---g-------------------ctacagc
                        Shrew  -g-------g---g-------------------cggccgc
              Star-nosed mole  -g-------g---g-------------------cg--cgg
                     Elephant  -g-------a---gcaagcctggc---------cccacca
          Cape elephant shrew  -g-------a---g-------------------cccac--
                      Manatee  -g-------a---g-------------------ccccccg
             Cape golden mole  -g-------a-----------------------ccc----
                       Tenrec  -g-------a-----------------------cccatcg
                     Aardvark  -c-------a-----------------------cccagcg
                    Armadillo  -g-------a---caggaactggcagtctcttgcccgccg
                 Saker falcon  ----------------------------------------
             Peregrine falcon  ----------------------------------------
          Collared flycatcher  ----------------------------------------
       White-throated sparrow  ----------------------------------------
          Medium ground finch  ----------------------------------------
                  Zebra finch  ----------------------------------------
           Tibetan ground jay  ----------------------------------------
                   Budgerigar  ----------------------------------------
                       Parrot  ----------------------------------------
                Scarlet macaw  ----------------------------------------
                      Chicken  ----------------------------------------
                       Turkey  ----------------------------------------
           American alligator  ----------------------------------------
              Green seaturtle  ----------------------------------------
               Painted turtle  ----------------------------------------
     Chinese softshell turtle  ----------------------------------------
       Spiny softshell turtle  ----------------------------------------
                X. tropicalis  ----------------------------------------
                    Tetraodon  ----------------------------------------
                         Fugu  ----------------------------------------
       Yellowbelly pufferfish  ----------------------------------------
                 Nile tilapia  ----------------------------------------
          Princess of Burundi  ----------------------------------------
                  Zebra mbuna  ----------------------------------------
          Pundamilia nyererei  ----------------------------------------
                       Medaka  ----------------------------------------
           Southern platyfish  ----------------------------------------
                  Stickleback  ----------------------------------------
                    Zebrafish  ----------------------------------------
                  Spotted gar  ----------------------------------------
        Burton's mouthbreeder  ========================================
                   Coelacanth  ========================================
                 Mallard duck  ========================================
                      Wallaby  ----------------------------------------
                       Lizard  ========================================
     Mexican tetra (cavefish)  ========================================
                  Rock pigeon  ========================================
                 Atlantic cod  ========================================
                     Platypus  ========================================
                      Opossum  ========================================
                          Pig  ========================================
              Tasmanian devil  ========================================

Inserts between block 10 and 11 in window
  D             Saker falcon 16bp
  D         Peregrine falcon 16bp
  D      Collared flycatcher 16bp
  D   White-throated sparrow 15bp
B D      Medium ground finch 16bp
B D              Zebra finch 16bp
          Tibetan ground jay 16bp
B D               Budgerigar 15bp
  D                   Parrot 15bp
  D            Scarlet macaw 15bp
B D                  Chicken 15bp
B D                   Turkey 15bp
B D       American alligator 16bp
  D          Green seaturtle 16bp
  D           Painted turtle 16bp
  D Chinese softshell turtle 14bp
  D   Spiny softshell turtle 1bp
B D                Tetraodon 2bp
B D                     Fugu 2bp
      Yellowbelly pufferfish 2bp
B D             Nile tilapia 2bp
         Princess of Burundi 2bp
                 Zebra mbuna 2bp
         Pundamilia nyererei 2bp
B D                   Medaka 2bp
          Southern platyfish 2bp
B D              Stickleback 2bp
B D                Zebrafish 89bp
                 Spotted gar 1bp

Alignment block 11 of 654 in window, 81847167 - 81847182, 16 bps 
B D                     Human  ---------------tggtgaccgggagcct
B D                     Chimp  ---------------tggtgaccgggagcct
B D                   Gorilla  ---------------tggtgaccgggagcct
B D                 Orangutan  ---------------tggtaaccgggagcct
B D                    Gibbon  ---------------tggtgaccgggagcct
B D                    Rhesus  ---------------tggtgaccaggagcct
B D       Crab-eating macaque  ---------------tggtgaccaggagcct
B D                    Baboon  ---------------tggtgaccgggagcct
B D              Green monkey  ---------------tggtgaccgggagccc
B D                  Marmoset  ---------------tggtgaccaggagcct
B D           Squirrel monkey  ---------------tggtgaccaggggcct
B D                  Bushbaby  ---------------tggtgactagg-----
B D                      Pika  ---------------gtctga-------gcc
B D                    Alpaca  ---------------gg------ctgaaggt
               Bactrian camel  ---------------gg------ctgaaggt
B D                   Dolphin  ---------------ga------ccgaacat
                 Killer whale  ---------------ga------ccgtacat
             Tibetan antelope  ---------------ga------ccaaacgt
B D                       Cow  ---------------ga------ccaaacat
B D                     Sheep  ---------------ga------ccaaacat
                Domestic goat  ---------------ga------ccaaacgt
B D                     Horse  ---------------gg-----ctgggacct
B D          White rhinoceros  ---------------gg-----ccaggacct
B D                       Cat  ---------------gg-----tcgggaccc
B D                       Dog  ---------------gg-----ccaggacct
B D                   Ferret   ---------------gg-----ccgggacct
B D                     Panda  ---------------gg-----ccgggacct
               Pacific walrus  ---------------ag-----tggagacct
                 Weddell seal  ---------------gg-----ccgggacct
             Black flying-fox  ---------------gg--------------
B D                   Megabat  ---------------gg--------------
                Big brown bat  ---------------gg--------------
B D                  Microbat  ---------------gg--------------
B D                  Hedgehog  ---------------ac-----cctgaggag
B D                     Shrew  ---------------gc-----ccc-acgcc
              Star-nosed mole  ---------------gg-----c--------
B D                  Elephant  ----------------------------ccc
          Cape elephant shrew  ----------------------------ccc
B D                   Manatee  ---------------cg-----cc---cccg
             Cape golden mole  ----------------------------ccc
B D                    Tenrec  ---------------cc-----at----ctc
                     Aardvark  ---------------tc-----ccgccaccc
B D                 Armadillo  ----------------------------tgc
B D                 Tetraodon  ----------ggagatc--------------
B D                      Fugu  t--------tatagacg--------------
       Yellowbelly pufferfish  t--------tatagacg--------------
B D              Nile tilapia  tggtgtga-gaaaatgg--------------
          Princess of Burundi  tggtgtga-gaaaaagg--------------
                  Zebra mbuna  tggtgtga-gaaaaagg--------------
          Pundamilia nyererei  tggtgtga-gaaaaagg--------------
B D                    Medaka  cggagtgatggcag-----------------
           Southern platyfish  tgaagggagaactgtct--------------
B D               Stickleback  ---------gaaagagg--------------
                  Spotted gar  -----------cagagg--------------
B D                Guinea pig  -------------------------------
B D                       Rat  -------------------------------
B D                     Mouse  -------------------------------
              Golden hamster  -------------------------------
B D           Chinese hamster  -------------------------------
                Prairie vole  -------------------------------
        David's myotis (bat)  -------------------------------
B D                  Squirrel  -------------------------------
                  Chinchilla  -------------------------------
      Lesser Egyptian jerboa  -------------------------------
            Brush-tailed rat  -------------------------------
          Chinese tree shrew  -------------------------------
B D            Naked mole-rat  -------------------------------
       Burton's mouthbreeder  ===============================
B D                Coelacanth  ===============================
B D                    Turkey  ===============================
  D              Mallard duck  ===============================
  D             Scarlet macaw  ===============================
  D                    Parrot  ===============================
B D                Budgerigar  ===============================
B D                   Wallaby  -------------------------------
  D    Spiny softshell turtle  ===============================
B D                    Lizard  ===============================
    Mexican tetra (cavefish)  ===============================
  D          Peregrine falcon  ===============================
B D                 Zebrafish  ===============================
  D               Rock pigeon  ===============================
  D            Painted turtle  ===============================
B D                   Chicken  ===============================
B D              Atlantic cod  ===============================
B D                  Platypus  ===============================
  D       Collared flycatcher  ===============================
  D  Chinese softshell turtle  ===============================
B D               Zebra finch  ===============================
  D              Saker falcon  ===============================
B D             X. tropicalis  -------------------------------
  D           Green seaturtle  ===============================
B D       Medium ground finch  ===============================
B D                   Opossum  ===============================
B D        American alligator  ===============================
  D    White-throated sparrow  ===============================
          Tibetan ground jay  ===============================
B D                       Pig  ===============================
B D           Tasmanian devil  ===============================

Inserts between block 11 and 12 in window
B D                   Medaka 2bp

Alignment block 12 of 654 in window, 81847183 - 81847186, 4 bps 
B D                     Human  c---a-tg--
B D                     Chimp  c---a-tg--
B D                   Gorilla  c---a-tg--
B D                 Orangutan  c---a-tg--
B D                    Gibbon  c---a-tg--
B D                    Rhesus  c---a-tg--
B D       Crab-eating macaque  c---a-tg--
B D                    Baboon  c---a-tg--
B D              Green monkey  c---a-tg--
B D                  Marmoset  c---a-tg--
B D           Squirrel monkey  c---a-tg--
B D                  Bushbaby  -------g--
       Lesser Egyptian jerboa  g---g-ct--
B D            Naked mole-rat  t---g-ag--
B D                Guinea pig  g---a-ag--
                   Chinchilla  g---a-tg--
             Brush-tailed rat  g---a-tg--
B D                      Pika  g---c-ta--
B D                    Alpaca  c---a-cg--
               Bactrian camel  c---a-tg--
B D                   Dolphin  c---a-tg--
                 Killer whale  c---a-tg--
             Tibetan antelope  c---a-gg--
B D                       Cow  c---a-gg--
B D                     Sheep  c---a-gg--
                Domestic goat  c---a-gg--
B D                     Horse  c---a-cg--
B D          White rhinoceros  c---a-cg--
B D                       Cat  c---a-cg--
B D                       Dog  c---------
B D                   Ferret   c---g-tg--
B D                     Panda  c---g-tg--
               Pacific walrus  c---g-gg--
                 Weddell seal  c---g-gg--
B D                  Hedgehog  c---c-ag--
B D                     Shrew  c---a-cg--
B D                  Elephant  c---a-cg--
          Cape elephant shrew  c---c-tg--
B D                   Manatee  c---c-tg--
             Cape golden mole  a---c-cg--
B D                    Tenrec  c---c-cg--
                     Aardvark  c---g-tg--
B D                 Armadillo  c---c-cg--
  D              Saker falcon  t---g-tg--
  D          Peregrine falcon  t---g-tg--
  D       Collared flycatcher  t---g-tg--
  D    White-throated sparrow  t---g-tg--
B D       Medium ground finch  t---g-tg--
B D               Zebra finch  c---g-tg--
           Tibetan ground jay  t---g-tg--
B D                Budgerigar  t---g-tg--
  D                    Parrot  t---c-tg--
  D             Scarlet macaw  t---g-tg--
B D                   Chicken  t---g-ca--
B D                    Turkey  t---g-ca--
B D        American alligator  t---g-ca--
  D           Green seaturtle  ttggg-tc--
  D            Painted turtle  ttgta-tc--
  D  Chinese softshell turtle  --agg-tc--
  D    Spiny softshell turtle  ----a-tc--
B D                    Lizard  t---acca--
B D                 Tetraodon  ------ccgg
B D                      Fugu  ------cacg
       Yellowbelly pufferfish  ------cacg
B D              Nile tilapia  ------gatc
          Princess of Burundi  ------gatc
                  Zebra mbuna  ------gatc
          Pundamilia nyererei  ------gatc
           Southern platyfish  ------tggt
B D               Stickleback  ------tgga
                  Spotted gar  ------cagg
B D                       Rat  ----------
B D                     Mouse  ----------
              Golden hamster  ----------
B D           Chinese hamster  ----------
                Prairie vole  ----------
        David's myotis (bat)  ----------
             Star-nosed mole  ----------
B D                  Squirrel  ----------
          Chinese tree shrew  ----------
B D                  Microbat  ----------
               Big brown bat  ----------
            Black flying-fox  ----------
       Burton's mouthbreeder  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
  D              Mallard duck  ==========
B D                   Wallaby  ----------
    Mexican tetra (cavefish)  ==========
B D                 Zebrafish  ==========
  D               Rock pigeon  ==========
B D              Atlantic cod  ==========
B D                  Platypus  ==========
B D             X. tropicalis  ----------
B D                   Opossum  ==========
B D                   Megabat  ----------
B D                       Pig  ==========
B D           Tasmanian devil  ==========

Alignment block 13 of 654 in window, 81847187 - 81847204, 18 bps 
B D                     Human  cc-----------------------------------a---------------c-ccc-----caa-c--
B D                     Chimp  cc-----------------------------------a---------------c-ccc-----caa-c--
B D                   Gorilla  cc-----------------------------------a--------------cc-ccc-----caa-c--
B D                 Orangutan  cc-----------------------------------a---------------c-ccc-----caa-c--
B D                    Gibbon  cc-----------------------------------a---------------c-ccc-----caa-c--
B D                    Rhesus  ct-----------------------------------a---------------c-ccc-----caa-c--
B D       Crab-eating macaque  ct-----------------------------------a---------------c-ccc-----caa-c--
B D                    Baboon  ct-----------------------------------a---------------c-ccc-----caa-c--
B D              Green monkey  ct-----------------------------------a---------------c-ccc-----caa-c--
B D                  Marmoset  cc-----------------------------------a---------------c-tcc-----caa-t--
B D           Squirrel monkey  cc-----------------------------------a---------------c-ccc-----c------
B D                  Bushbaby  cc-----------------------------------c---------------c-tcc-----ca-----
           Chinese tree shrew  -----------------------------------------------------g-ccc-----ca-----
B D                  Squirrel  -------------------------------------cacctgcaccatctgac-tcc-----cac-t--
       Lesser Egyptian jerboa  at-------------aagacaaggtaacttgaat---c---------------c-cac-----tac-c--
                 Prairie vole  -------------------------------------c---------------c-cag-----ggg-t--
B D           Chinese hamster  -------------------------------------c---------------c-cag-----cac-t--
               Golden hamster  -------------------------------------c---------------c-cag-----cac-t--
B D                     Mouse  -------------------------------------c---------------c-ccc-----cac-t--
B D                       Rat  -------------------------------------c---------------c-tac-----cac-t--
B D            Naked mole-rat  ac-----------------------------------a---------------g-tgt-----ggc-t--
B D                Guinea pig  at-----------------------------------a---------------g-tgt-----agc-t--
                   Chinchilla  ac-----------------------------------a---------------g-tat-----ggt-g--
             Brush-tailed rat  ac-----------------------------------a---------------gttat-----gtc-t--
B D                      Pika  ac-----------------------------------c---------------a-cag-----ggc-c--
B D                    Alpaca  cc-----------------------------------c---------------c-tcttgcacccc-c--
               Bactrian camel  cc-----------------------------------c---------------c-tctcg---ccc-c--
B D                   Dolphin  ac-----------------------------------c---------------c---------ccc-g--
                 Killer whale  ac-----------------------------------c---------------c---------cct-g--
             Tibetan antelope  ac-----------------------------------c--------------------------------
B D                       Cow  ac-----------------------------------c--------------------------------
B D                     Sheep  ac-----------------------------------c--------------------------------
                Domestic goat  ac-----------------------------------c--------------------------------
B D                     Horse  ac-----------------------------------c---------------c-tcc-----cac-a--
B D          White rhinoceros  ac-----------------------------------c---------------c-tcc-----cac-a--
B D                       Cat  ac-----------------------------------c---------------c-tcc-----cac-a--
B D                       Dog  -t-----------------------------------c---------------c-tgg-----ggc-g--
B D                   Ferret   ac-----------------------------------c---------------c-ccc-----cac-g--
B D                     Panda  ac-----------------------------------c---------------c-tccag---cac-a--
               Pacific walrus  gc-----------------------------------t---------------c-tcc-----cgt-g--
                 Weddell seal  gc-----------------------------------t---------------c-tgc-----cat-g--
             Black flying-fox  -------------------------------------------------------tcc-----tgg-g--
B D                   Megabat  -------------------------------------------------------tcc-----cgg-g--
                Big brown bat  -------------------------------------------------------tcc-----tgg-g--
         David's myotis (bat)  ----------------------------------------------------------------------
B D                  Microbat  -------------------------------------------------------tcc-----cgg-g--
B D                  Hedgehog  tc-----------------------------------c--------------------------------
B D                     Shrew  tc-----------------------------------c--------------------------------
B D                  Elephant  cc-----------------------------------c---------------a-gca-----gcc-c--
          Cape elephant shrew  gc-----------------------------------c---------------a-gct-----cccgc--
B D                   Manatee  cc-----------------------------------c---------------c-gca-----gcc-c--
             Cape golden mole  cc-----------------------------------c---------------c-act---------c--
B D                    Tenrec  ct-----------------------------------g---------------c-tct---------g--
                     Aardvark  cc-----------------------------------c---------------a-cct-----ggt-c--
B D                 Armadillo  gg-----------------------------------c---------------c-gcc-----agc-c--
  D               Rock pigeon  -------------------------------------------------------ggc-----agc-t--
  D              Saker falcon  tt-----------------------------------c---------------t-tca-----cac-t--
  D          Peregrine falcon  tt-----------------------------------c---------------t-tca-----cac-t--
  D       Collared flycatcher  tc-----------------------------------c---------------t-tcc-----cac-t--
  D    White-throated sparrow  tc-----------------------------------c---------------t-ccc-----cac-t--
B D       Medium ground finch  tc-----------------------------------c---------------t-tcc-----cac-t--
B D               Zebra finch  tc-----------------------------------c---------------t-tcc-----cac-t--
           Tibetan ground jay  tc-----------------------------------c---------------t-tcc-----cat-t--
B D                Budgerigar  tt-----------------------------------c---------------t-cca-----cac-t--
  D                    Parrot  tt-----------------------------------c---------------t-cta-----cgc-t--
  D             Scarlet macaw  ttctctacactcctccataacaatggactagtgtcagc---------------t-cca-----aga-t--
B D                   Chicken  tt-----------------------------------c---------------t-tc-------------
B D                    Turkey  tt-----------------------------------c---------------t-tc-------------
B D        American alligator  ac---------------------------agggcaggc---------------t-cca-----agt-c--
  D           Green seaturtle  tc-----------------------------------c---------------t-gct-----taa-tct
  D            Painted turtle  tc-----------------------------------c---------------t-gct-----t------
  D  Chinese softshell turtle  tc-----------------------------------c---------------t-gct-----tat-c--
  D    Spiny softshell turtle  cc-----------------------------------t---------------t-gct-----tat-c--
B D                    Lizard  tc-----------------------------------c---------------t-gat-----cac-a--
B D                Coelacanth  cc-----------------------------------c---------------c-tct------------
             Star-nosed mole  ----------------------------------------------------------------------
      Yellowbelly pufferfish  ----------------------------------------------------------------------
B D                      Fugu  ----------------------------------------------------------------------
B D               Stickleback  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
                 Zebra mbuna  ----------------------------------------------------------------------
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
B D                    Medaka  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
  D              Mallard duck  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
          Southern platyfish  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D              Nile tilapia  ----------------------------------------------------------------------
B D                 Tetraodon  ----------------------------------------------------------------------
B D              Atlantic cod  ======================================================================
B D                  Platypus  ======================================================================
B D             X. tropicalis  ----------------------------------------------------------------------
B D                   Opossum  ======================================================================
B D                       Pig  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ---------c-----cactcc
                        Chimp  ---------c-----cactcc
                      Gorilla  ---------c-----cactcc
                    Orangutan  ---------c-----cactcc
                       Gibbon  ---------c-----cactcc
                       Rhesus  ---------c-----cactcc
          Crab-eating macaque  ---------c-----cactcc
                       Baboon  ---------c-----cactcc
                 Green monkey  ---------c-----cactcc
                     Marmoset  ---------c-------cccc
              Squirrel monkey  ---------------------
                     Bushbaby  ---------------------
           Chinese tree shrew  -------------------cg
                     Squirrel  ---------a-----gagcc-
       Lesser Egyptian jerboa  ---------c-----tgccct
                 Prairie vole  ---------t-----cctcc-
              Chinese hamster  ---------c-----tgcct-
               Golden hamster  ---------c-----ggcct-
                        Mouse  ---------c-----tacct-
                          Rat  ---------c-----tacct-
               Naked mole-rat  ---------g-----ggctc-
                   Guinea pig  ---------g-----ggctc-
                   Chinchilla  ---------g-----ggttc-
             Brush-tailed rat  ---------g-----ggctc-
                         Pika  ---------c-----gcacc-
                       Alpaca  ---------c-----ccaccc
               Bactrian camel  ---------c-----cccccc
                      Dolphin  ---------a-----aacctc
                 Killer whale  ---------a-----aacctc
             Tibetan antelope  --------------------c
                          Cow  --------------------c
                        Sheep  --------------------c
                Domestic goat  --------------------c
                        Horse  ---------c-----cagccc
             White rhinoceros  ---------c-----cacccc
                          Cat  ---------c-----cgcccc
                          Dog  ---------c-----cacccc
                      Ferret   ---------c-----cacccc
                        Panda  ---------c-----cacccc
               Pacific walrus  ---------c-----cacccc
                 Weddell seal  ---------c-----cacccc
             Black flying-fox  ---------g-----cacc--
                      Megabat  ---------g-----cacc--
                Big brown bat  ---------g-----ggcccc
         David's myotis (bat)  ----------------gccct
                     Microbat  ---------g-----cgcccc
                     Hedgehog  ---------------------
                        Shrew  ---------------------
                     Elephant  ---------c-----gtgccc
          Cape elephant shrew  ---------c-----tggccc
                      Manatee  ---------c---agtggccc
             Cape golden mole  ---------c-----aggccc
                       Tenrec  ---------c-----ccgcct
                     Aardvark  ---------c--tggcagcct
                    Armadillo  ---------c-----ctgccc
                  Rock pigeon  ---------ccaagacaga--
                 Saker falcon  ---------tctccatacc--
             Peregrine falcon  ---------tctccatacc--
          Collared flycatcher  ---------cctccatacc--
       White-throated sparrow  ---------cctccacacc--
          Medium ground finch  ---------cctccacaca--
                  Zebra finch  ---------cctccacacc--
           Tibetan ground jay  ---------cctccatacc--
                   Budgerigar  ---------cctccataac--
                       Parrot  ---------cctccataac--
                Scarlet macaw  ---------acgacacaac--
                      Chicken  ---------------cctc--
                       Turkey  ---------------tgtc--
           American alligator  ---------agaacacagc--
              Green seaturtle  ag-------gcacagtagg--
               Painted turtle  --catctaggcacagtagg--
     Chinese softshell turtle  ---------------tagg--
       Spiny softshell turtle  ---------------tagg--
                       Lizard  ---------caattttgtc--
                   Coelacanth  ---------------------
              Star-nosed mole  ---------------------
       Yellowbelly pufferfish  ---------------------
                         Fugu  ---------------------
                  Stickleback  ---------------------
          Pundamilia nyererei  ---------------------
                  Zebra mbuna  ---------------------
        Burton's mouthbreeder  =====================
          Princess of Burundi  ---------------------
                       Medaka  =====================
                  Spotted gar  ---------------------
                 Mallard duck  =====================
                      Wallaby  ---------------------
           Southern platyfish  ---------------------
     Mexican tetra (cavefish)  =====================
                    Zebrafish  =====================
                 Nile tilapia  ---------------------
                    Tetraodon  ---------------------
                 Atlantic cod  =====================
                     Platypus  =====================
                X. tropicalis  ---------------------
                      Opossum  =====================
                          Pig  =====================
              Tasmanian devil  =====================

Inserts between block 13 and 14 in window
B D                 Squirrel 11bp
                Prairie vole 8bp
B D          Chinese hamster 8bp
              Golden hamster 8bp
B D                    Mouse 9bp
B D                      Rat 7bp
B D           Naked mole-rat 8bp
B D               Guinea pig 8bp
                  Chinchilla 8bp
            Brush-tailed rat 8bp
B D                     Pika 19bp
B D                    Shrew 1bp

Alignment block 14 of 654 in window, 81847205 - 81847212, 8 bps 
B D                     Human  ------tccccat--------------c
B D                     Chimp  ------tccccat--------------c
B D                   Gorilla  ------tccccat--------------c
B D                 Orangutan  ------tccccat--------------c
B D                    Gibbon  ------tccccat--------------c
B D                    Rhesus  ------tccccat--------------c
B D       Crab-eating macaque  ------tccccat--------------c
B D                    Baboon  ------tccccat--------------c
B D              Green monkey  ------tccccat--------------c
B D                  Marmoset  ------tccccac--------------c
B D                  Bushbaby  -------cataat--------------c
           Chinese tree shrew  ------ggcacgt--------------t
       Lesser Egyptian jerboa  ------tg--------------------
B D                    Alpaca  ---------------------------c
               Bactrian camel  ---------------------------c
B D                   Dolphin  ---------------------------c
                 Killer whale  ---------------------------c
             Tibetan antelope  ---------------------------t
B D                       Cow  ---------------------------t
B D                     Sheep  ---------------------------t
                Domestic goat  ---------------------------t
B D                     Horse  ---------------------------t
B D          White rhinoceros  ---------------------------c
B D                     Panda  ------ccc------------------c
                Big brown bat  ---------------------------t
         David's myotis (bat)  ---------------------------g
B D                  Microbat  ---------------------------c
B D                 Armadillo  ------tcactctcggccgggagcgtg-
B D                 Tetraodon  ---------------------------a
B D                      Fugu  ---------------------------c
       Yellowbelly pufferfish  ---------------------------c
B D              Nile tilapia  ---------------------------t
          Princess of Burundi  ---------------------------t
                  Zebra mbuna  ---------------------------t
          Pundamilia nyererei  ---------------------------t
           Southern platyfish  ---------------------------t
B D               Stickleback  ---------------------------t
                  Spotted gar  ---------------------------c
B D                   Lamprey  tcgccgtc--------------------
B D                    Tenrec  ----------------------------
B D                  Hedgehog  ----------------------------
B D                Guinea pig  ============================
B D                       Rat  ============================
B D                     Mouse  ============================
              Golden hamster  ============================
B D           Chinese hamster  ============================
                Prairie vole  ============================
B D                  Elephant  ----------------------------
         Cape elephant shrew  ----------------------------
B D                     Shrew  ============================
             Star-nosed mole  ----------------------------
B D                  Squirrel  ============================
B D                      Pika  ============================
B D                   Manatee  ----------------------------
                  Chinchilla  ============================
            Brush-tailed rat  ============================
              Pacific walrus  ----------------------------
B D                       Dog  ----------------------------
B D                       Cat  ----------------------------
B D            Naked mole-rat  ============================
            Black flying-fox  ----------------------------
B D                   Ferret   ----------------------------
            Cape golden mole  ----------------------------
                Weddell seal  ----------------------------
                    Aardvark  ----------------------------
       Burton's mouthbreeder  ============================
B D                    Medaka  ============================
B D                Coelacanth  ----------------------------
B D                    Turkey  ----------------------------
  D              Mallard duck  ============================
  D             Scarlet macaw  ----------------------------
  D                    Parrot  ----------------------------
B D                Budgerigar  ----------------------------
B D                   Wallaby  ----------------------------
  D    Spiny softshell turtle  ----------------------------
B D                    Lizard  ----------------------------
    Mexican tetra (cavefish)  ============================
  D          Peregrine falcon  ----------------------------
B D                 Zebrafish  ============================
  D               Rock pigeon  ----------------------------
  D            Painted turtle  ----------------------------
B D                   Chicken  ----------------------------
B D              Atlantic cod  ============================
B D                  Platypus  ============================
  D       Collared flycatcher  ----------------------------
  D  Chinese softshell turtle  ----------------------------
B D           Squirrel monkey  ----------------------------
B D               Zebra finch  ----------------------------
  D              Saker falcon  ----------------------------
B D             X. tropicalis  ----------------------------
  D           Green seaturtle  ----------------------------
B D       Medium ground finch  ----------------------------
B D                   Opossum  ============================
B D        American alligator  ----------------------------
  D    White-throated sparrow  ----------------------------
          Tibetan ground jay  ----------------------------
B D                   Megabat  ----------------------------
B D                       Pig  ============================
B D           Tasmanian devil  ============================

Inserts between block 14 and 15 in window
      Lesser Egyptian jerboa 8bp
B D                Armadillo 1bp
B D                Tetraodon 8bp
B D                     Fugu 8bp
      Yellowbelly pufferfish 8bp
B D             Nile tilapia 8bp
         Princess of Burundi 8bp
                 Zebra mbuna 8bp
         Pundamilia nyererei 8bp
          Southern platyfish 7bp
B D              Stickleback 8bp
                 Spotted gar 9bp

Alignment block 15 of 654 in window, 81847213 - 81847222, 10 bps 
B D                     Human  cccagcctgg-
B D                     Chimp  cccagcctgg-
B D                   Gorilla  cccagcctgg-
B D                 Orangutan  cccagcctgg-
B D                    Gibbon  cccagcctgg-
B D                    Rhesus  cccagcctgg-
B D       Crab-eating macaque  cccagcctgg-
B D                    Baboon  cccagcctgg-
B D              Green monkey  cccagcctgg-
B D                  Marmoset  ccaagcctgg-
B D           Squirrel monkey  ---agcctgg-
B D                  Bushbaby  ccccacctgg-
           Chinese tree shrew  ggcagactgg-
B D                    Alpaca  cgccatcggg-
               Bactrian camel  cgccatcggg-
B D                   Dolphin  ccccaccagg-
                 Killer whale  ccccaccagg-
             Tibetan antelope  ccccaaccgg-
B D                       Cow  ccccacctgg-
B D                     Sheep  ccccaaccgg-
                Domestic goat  ccccaaccag-
B D                     Horse  tctctcaagg-
B D          White rhinoceros  acgctcgacg-
B D                       Cat  gccctcaggg-
B D                       Dog  actctcaggg-
B D                   Ferret   atcctcaggg-
B D                     Panda  actctcaggg-
               Pacific walrus  gccctcaggg-
                 Weddell seal  -ctctcaggg-
             Black flying-fox  gcacgca----
B D                   Megabat  gcacgca----
                Big brown bat  ccccgcgc---
         David's myotis (bat)  ac---------
B D                  Microbat  acccgcgcag-
B D                  Platypus  cccgggcggg-
B D                Coelacanth  cccagtctca-
B D                 Tetraodon  -------cgg-
B D                      Fugu  -------tgt-
       Yellowbelly pufferfish  -------tgt-
B D              Nile tilapia  -------tgt-
          Princess of Burundi  -------tga-
                  Zebra mbuna  -------tga-
          Pundamilia nyererei  -------tga-
B D               Stickleback  -------ttg-
                  Spotted gar  -------tgc-
B D                   Lamprey  -cgcgaccggc
B D                    Tenrec  -----------
B D                  Hedgehog  -----------
B D                Guinea pig  ===========
B D                       Rat  ===========
B D                     Mouse  ===========
              Golden hamster  ===========
B D           Chinese hamster  ===========
                Prairie vole  ===========
B D                  Elephant  -----------
         Cape elephant shrew  -----------
B D                     Shrew  ===========
             Star-nosed mole  -----------
B D                  Squirrel  ===========
B D                      Pika  ===========
B D                 Armadillo  ===========
B D                   Manatee  -----------
                  Chinchilla  ===========
      Lesser Egyptian jerboa  ===========
            Brush-tailed rat  ===========
B D            Naked mole-rat  ===========
            Cape golden mole  -----------
                    Aardvark  -----------
       Burton's mouthbreeder  ===========
B D                    Medaka  ===========
B D                    Turkey  -----------
  D              Mallard duck  ===========
  D             Scarlet macaw  -----------
  D                    Parrot  -----------
B D                Budgerigar  -----------
B D                   Wallaby  -----------
  D    Spiny softshell turtle  -----------
B D                    Lizard  -----------
          Southern platyfish  ===========
    Mexican tetra (cavefish)  ===========
  D          Peregrine falcon  -----------
B D                 Zebrafish  ===========
  D               Rock pigeon  -----------
  D            Painted turtle  -----------
B D                   Chicken  -----------
B D              Atlantic cod  ===========
  D       Collared flycatcher  -----------
  D  Chinese softshell turtle  -----------
B D               Zebra finch  -----------
  D              Saker falcon  -----------
B D             X. tropicalis  -----------
  D           Green seaturtle  -----------
B D       Medium ground finch  -----------
B D                   Opossum  ===========
B D        American alligator  -----------
  D    White-throated sparrow  -----------
          Tibetan ground jay  -----------
B D                       Pig  ===========
B D           Tasmanian devil  ===========

Inserts between block 15 and 16 in window
                 Spotted gar 11bp

Alignment block 16 of 654 in window, 81847223 - 81847223, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
           Chinese tree shrew  g
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  g
                 Killer whale  t
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  t
B D          White rhinoceros  g
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  t
                 Weddell seal  c
B D                  Platypus  c
B D                Coelacanth  g
B D                 Tetraodon  g
B D                      Fugu  g
       Yellowbelly pufferfish  g
B D              Nile tilapia  g
          Princess of Burundi  g
                  Zebra mbuna  g
          Pundamilia nyererei  g
B D               Stickleback  g
     Mexican tetra (cavefish)  g
                  Spotted gar  g
B D                   Lamprey  g
B D                    Tenrec  -
B D                  Hedgehog  -
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  =
                Prairie vole  =
B D                  Elephant  -
         Cape elephant shrew  -
B D                     Shrew  =
        David's myotis (bat)  -
             Star-nosed mole  -
B D                  Squirrel  =
B D                      Pika  =
B D                 Armadillo  =
B D                   Manatee  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  =
B D                  Microbat  -
B D                  Bushbaby  -
               Big brown bat  -
B D            Naked mole-rat  =
            Black flying-fox  -
            Cape golden mole  -
                    Aardvark  -
       Burton's mouthbreeder  =
B D                    Medaka  =
B D                    Turkey  -
  D              Mallard duck  =
  D             Scarlet macaw  -
  D                    Parrot  -
B D                Budgerigar  -
B D                   Wallaby  -
  D    Spiny softshell turtle  -
B D                    Lizard  -
          Southern platyfish  =
  D          Peregrine falcon  -
B D                 Zebrafish  =
  D               Rock pigeon  -
  D            Painted turtle  -
B D                   Chicken  -
B D              Atlantic cod  =
  D       Collared flycatcher  -
  D  Chinese softshell turtle  -
B D               Zebra finch  -
  D              Saker falcon  -
B D             X. tropicalis  -
  D           Green seaturtle  -
B D       Medium ground finch  -
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  -
          Tibetan ground jay  -
B D                   Megabat  -
B D                       Pig  =
B D           Tasmanian devil  =

Inserts between block 16 and 17 in window
B D                Tetraodon 1bp
B D                     Fugu 1bp
      Yellowbelly pufferfish 1bp
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
B D              Stickleback 1bp
    Mexican tetra (cavefish) 11bp
                 Spotted gar 7bp

Alignment block 17 of 654 in window, 81847224 - 81847234, 11 bps 
B D                     Human  ggctgcagggc
B D                     Chimp  ggctgcagggc
B D                   Gorilla  ggctgcagggc
B D                 Orangutan  ggctgcagggc
B D                    Gibbon  ggctgcagggc
B D                    Rhesus  ggatgcatggc
B D       Crab-eating macaque  ggatgcatggc
B D                    Baboon  ggctgcatggc
B D              Green monkey  ggctgcatggc
B D                  Marmoset  agctgtaggac
B D           Squirrel monkey  ggctgtaggac
B D                  Bushbaby  -gctgcagaac
           Chinese tree shrew  gtc-------c
B D                    Alpaca  gcaggaccagc
               Bactrian camel  acaggaccagc
B D                   Dolphin  gcaggaccagc
                 Killer whale  gcaggaccagc
             Tibetan antelope  gcaaaatcagc
B D                       Cow  gcaagatcagc
B D                     Sheep  gcaaaatcagc
                Domestic goat  gcaaaatcagc
B D                     Horse  gaaggaccagc
B D          White rhinoceros  gaaggaccagc
B D                       Cat  gcaggacccac
B D                       Dog  acaggacccac
B D                   Ferret   acaggacccac
B D                     Panda  gcaggacccac
               Pacific walrus  gcaggacccac
                 Weddell seal  gcaggacccac
             Black flying-fox  ---ggccccgc
B D                   Megabat  ---ggcccagc
                Big brown bat  ---ggcctggc
         David's myotis (bat)  ---gcctgggt
B D                  Microbat  -ctgccccggc
B D                  Platypus  cgacgccgggt
  D               Rock pigeon  -------accg
  D              Saker falcon  -------ccta
  D          Peregrine falcon  -------ccta
  D       Collared flycatcher  -------cccc
  D    White-throated sparrow  -------ccca
B D       Medium ground finch  -------cccc
B D               Zebra finch  -------ccca
           Tibetan ground jay  -------cctg
B D                Budgerigar  -------ccca
  D                    Parrot  -------ccca
  D             Scarlet macaw  -------c---
B D                   Chicken  -------actc
B D                    Turkey  -------accc
B D        American alligator  -------cccc
  D           Green seaturtle  -------ctcc
  D            Painted turtle  -------ttcc
  D  Chinese softshell turtle  -------tgcc
  D    Spiny softshell turtle  -------tgcc
B D                    Lizard  -------tggt
B D                Coelacanth  gtatgaat---
B D                 Tetraodon  ga---------
B D                      Fugu  ac---------
       Yellowbelly pufferfish  ac---------
B D               Stickleback  gt---------
                  Spotted gar  gc---------
B D                   Lamprey  ggtgtcatcgc
B D                    Tenrec  -----------
B D                  Hedgehog  -----------
B D                Guinea pig  ===========
B D                       Rat  ===========
B D                     Mouse  ===========
              Golden hamster  ===========
B D           Chinese hamster  ===========
                Prairie vole  ===========
B D                  Elephant  -----------
         Cape elephant shrew  -----------
B D                     Shrew  ===========
             Star-nosed mole  -----------
B D                  Squirrel  ===========
B D                      Pika  ===========
B D                 Armadillo  ===========
B D                   Manatee  -----------
                  Chinchilla  ===========
      Lesser Egyptian jerboa  ===========
            Brush-tailed rat  ===========
B D            Naked mole-rat  ===========
            Cape golden mole  -----------
                    Aardvark  -----------
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
         Princess of Burundi  ===========
B D                    Medaka  ===========
  D              Mallard duck  ===========
B D                   Wallaby  -----------
          Southern platyfish  ===========
    Mexican tetra (cavefish)  ===========
B D                 Zebrafish  ===========
B D              Nile tilapia  ===========
B D              Atlantic cod  ===========
B D             X. tropicalis  -----------
B D                   Opossum  ===========
B D                       Pig  ===========
B D           Tasmanian devil  ===========

Inserts between block 17 and 18 in window
  D            Scarlet macaw 66bp
B D                Tetraodon 8bp
B D                     Fugu 2bp
      Yellowbelly pufferfish 2bp
B D              Stickleback 4bp
                 Spotted gar 1bp

Alignment block 18 of 654 in window, 81847235 - 81847236, 2 bps 
B D                     Human  -ag
B D                     Chimp  -ag
B D                   Gorilla  -ag
B D                 Orangutan  -ag
B D                    Gibbon  -ag
B D                    Rhesus  -ag
B D       Crab-eating macaque  -ag
B D                    Baboon  -ag
B D              Green monkey  -ag
B D                  Marmoset  -at
B D           Squirrel monkey  -at
B D                  Bushbaby  -ag
           Chinese tree shrew  -cg
B D                    Alpaca  -ag
               Bactrian camel  -ag
B D                   Dolphin  -ag
                 Killer whale  -ag
             Tibetan antelope  -aa
B D                       Cow  -aa
B D                     Sheep  -aa
                Domestic goat  -aa
B D                     Horse  -ac
B D          White rhinoceros  -ag
B D                       Cat  -ag
B D                       Dog  -ta
B D                   Ferret   -ag
B D                     Panda  -ag
               Pacific walrus  -ag
                 Weddell seal  -ag
             Black flying-fox  -ag
B D                   Megabat  -ag
                Big brown bat  -gg
         David's myotis (bat)  -gg
B D                  Microbat  -gg
  D               Rock pigeon  -ga
  D              Saker falcon  -aa
  D          Peregrine falcon  -aa
  D       Collared flycatcher  -ca
  D    White-throated sparrow  -aa
B D       Medium ground finch  -ga
B D               Zebra finch  -ga
           Tibetan ground jay  -tt
B D                Budgerigar  -ga
  D                    Parrot  -ga
B D                   Chicken  -ga
B D                    Turkey  -aa
B D        American alligator  -ag
  D           Green seaturtle  -ag
  D            Painted turtle  -ag
  D  Chinese softshell turtle  -ag
  D    Spiny softshell turtle  -ag
B D                    Lizard  -ga
B D             X. tropicalis  -at
B D                 Tetraodon  -tg
B D                      Fugu  -ag
       Yellowbelly pufferfish  -ag
B D              Nile tilapia  -gg
          Princess of Burundi  -ag
                  Zebra mbuna  -ag
          Pundamilia nyererei  -ag
B D               Stickleback  -gg
B D              Atlantic cod  -aa
B D                 Zebrafish  -aa
     Mexican tetra (cavefish)  -ta
                  Spotted gar  -gg
B D                   Lamprey  c--
B D                    Tenrec  ---
B D                  Hedgehog  ---
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ===
B D           Chinese hamster  ===
                Prairie vole  ===
B D                  Elephant  ---
         Cape elephant shrew  ---
B D                     Shrew  ===
             Star-nosed mole  ---
B D                  Squirrel  ===
B D                      Pika  ===
B D                 Armadillo  ===
B D                   Manatee  ---
                  Chinchilla  ===
      Lesser Egyptian jerboa  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
            Cape golden mole  ---
                    Aardvark  ---
       Burton's mouthbreeder  ===
B D                    Medaka  ===
B D                Coelacanth  ---
  D              Mallard duck  ===
  D             Scarlet macaw  ===
B D                   Wallaby  ---
          Southern platyfish  ===
B D                  Platypus  ---
B D                   Opossum  ===
B D                       Pig  ===
B D           Tasmanian devil  ===

Inserts between block 18 and 19 in window
B D                   Alpaca 6bp
              Bactrian camel 6bp
B D                  Dolphin 8bp
                Killer whale 8bp
            Tibetan antelope 6bp
B D                      Cow 6bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                    Horse 6bp
B D         White rhinoceros 6bp
B D                      Cat 6bp
B D                      Dog 6bp
B D                  Ferret  6bp
B D                    Panda 6bp
              Pacific walrus 6bp
                Weddell seal 6bp
            Black flying-fox 3bp
B D                  Megabat 3bp
               Big brown bat 4bp
        David's myotis (bat) 62bp
B D                 Microbat 4bp
  D              Rock pigeon 70bp
  D             Saker falcon 10bp
  D         Peregrine falcon 10bp
  D      Collared flycatcher 4bp
  D   White-throated sparrow 5bp
B D      Medium ground finch 5bp
B D              Zebra finch 5bp
          Tibetan ground jay 5bp
B D               Budgerigar 10bp
  D                   Parrot 10bp
B D                  Chicken 5bp
B D                   Turkey 5bp
B D       American alligator 28bp
  D          Green seaturtle 5bp
  D           Painted turtle 5bp
  D Chinese softshell turtle 5bp
  D   Spiny softshell turtle 5bp
B D                   Lizard 5bp
B D            X. tropicalis 1bp

Alignment block 19 of 654 in window, 81847237 - 81847237, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  t
           Chinese tree shrew  c
  D              Saker falcon  c
  D          Peregrine falcon  c
  D       Collared flycatcher  c
  D    White-throated sparrow  c
B D       Medium ground finch  c
B D               Zebra finch  c
           Tibetan ground jay  c
B D                Budgerigar  c
  D                    Parrot  c
B D                   Chicken  c
B D                    Turkey  c
B D        American alligator  c
  D           Green seaturtle  a
  D            Painted turtle  g
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  a
B D                    Lizard  t
B D                Coelacanth  t
B D                 Tetraodon  c
B D                      Fugu  c
       Yellowbelly pufferfish  c
B D              Nile tilapia  c
          Princess of Burundi  c
                  Zebra mbuna  c
          Pundamilia nyererei  c
B D               Stickleback  t
B D              Atlantic cod  c
B D                 Zebrafish  t
     Mexican tetra (cavefish)  c
                  Spotted gar  c
B D                   Lamprey  t
B D                    Tenrec  -
B D                  Hedgehog  -
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  =
                Prairie vole  =
B D                  Elephant  -
            Tibetan antelope  =
         Cape elephant shrew  -
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  =
               Domestic goat  =
B D                     Sheep  =
B D                       Cow  =
B D                    Alpaca  =
             Star-nosed mole  -
B D                  Squirrel  =
B D                      Pika  =
B D                 Armadillo  =
B D                   Manatee  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
B D          White rhinoceros  =
            Brush-tailed rat  =
              Pacific walrus  =
B D                       Dog  =
B D                       Cat  =
B D                  Microbat  =
               Big brown bat  =
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  =
B D                     Panda  =
            Black flying-fox  =
B D                   Ferret   =
            Cape golden mole  -
B D                   Dolphin  =
                Weddell seal  =
                    Aardvark  -
       Burton's mouthbreeder  =
B D                    Medaka  =
  D              Mallard duck  =
  D             Scarlet macaw  =
B D                   Wallaby  -
          Southern platyfish  =
  D               Rock pigeon  =
B D                  Platypus  -
B D             X. tropicalis  =
B D                   Opossum  =
B D                   Megabat  =
B D                       Pig  =
B D           Tasmanian devil  =

Inserts between block 19 and 20 in window
B D                    Chimp 8bp
B D                  Gorilla 8bp
B D                Orangutan 8bp
B D                   Gibbon 8bp
B D                   Rhesus 8bp
B D      Crab-eating macaque 8bp
B D                   Baboon 8bp
B D             Green monkey 8bp
B D                 Marmoset 8bp
B D          Squirrel monkey 8bp
B D                 Bushbaby 8bp
          Chinese tree shrew 7bp
  D             Saker falcon 93bp
  D         Peregrine falcon 93bp
  D      Collared flycatcher 125bp
  D   White-throated sparrow 90bp
B D      Medium ground finch 92bp
B D              Zebra finch 92bp
          Tibetan ground jay 92bp
B D               Budgerigar 85bp
  D                   Parrot 87bp
B D                  Chicken 125bp
B D                   Turkey 125bp
B D       American alligator 19bp
  D          Green seaturtle 78bp
  D           Painted turtle 85bp
  D Chinese softshell turtle 53bp
  D   Spiny softshell turtle 42bp
B D                   Lizard 2bp

Alignment block 20 of 654 in window, 81847238 - 81847240, 3 bps 
B D                     Human  cgc
B D                     Chimp  cgc
B D                   Gorilla  cgc
B D                 Orangutan  cgc
B D                    Gibbon  cgc
B D                    Rhesus  cgc
B D       Crab-eating macaque  cgc
B D                    Baboon  cgc
B D              Green monkey  cgc
B D                  Marmoset  cgc
B D           Squirrel monkey  cgt
B D                  Bushbaby  cgc
           Chinese tree shrew  cgc
B D                  Squirrel  cac
       Lesser Egyptian jerboa  ccc
                 Prairie vole  ctc
B D           Chinese hamster  ctc
               Golden hamster  ctt
B D                     Mouse  ccc
B D                       Rat  ccc
B D            Naked mole-rat  cat
B D                Guinea pig  cat
                   Chinchilla  cat
             Brush-tailed rat  cat
B D                      Pika  ccc
B D                    Alpaca  cac
               Bactrian camel  cac
B D                   Dolphin  cac
                 Killer whale  cac
             Tibetan antelope  cac
B D                       Cow  cac
B D                     Sheep  cac
                Domestic goat  cac
B D                     Horse  cac
B D          White rhinoceros  cac
B D                       Cat  cgc
B D                       Dog  cgc
B D                   Ferret   cac
B D                     Panda  cgc
               Pacific walrus  cgc
                 Weddell seal  cgc
             Black flying-fox  cgt
B D                   Megabat  cgt
                Big brown bat  cgc
B D                  Microbat  cgc
B D                  Hedgehog  --t
B D                     Shrew  cgc
              Star-nosed mole  --t
B D                 Armadillo  cgg
B D                   Opossum  cat
B D           Tasmanian devil  cat
B D                  Platypus  cct
  D               Rock pigeon  cct
  D              Saker falcon  cct
  D          Peregrine falcon  cct
  D       Collared flycatcher  ccc
  D    White-throated sparrow  ccc
B D       Medium ground finch  ccc
B D               Zebra finch  ccc
           Tibetan ground jay  ccc
B D                Budgerigar  cca
  D                    Parrot  cca
  D             Scarlet macaw  cca
  D              Mallard duck  ccc
B D                   Chicken  ccc
B D                    Turkey  ccc
B D        American alligator  cat
  D           Green seaturtle  cat
  D            Painted turtle  cgt
  D  Chinese softshell turtle  cat
  D    Spiny softshell turtle  cat
B D                    Lizard  cat
B D             X. tropicalis  ctc
B D                Coelacanth  cct
B D                 Tetraodon  tgt
B D                      Fugu  tgt
       Yellowbelly pufferfish  tgt
B D              Nile tilapia  ccc
          Princess of Burundi  ccc
                  Zebra mbuna  ccc
          Pundamilia nyererei  ccc
B D               Stickleback  ctc
B D              Atlantic cod  cgt
B D                 Zebrafish  cct
     Mexican tetra (cavefish)  aat
                  Spotted gar  tc-
B D                   Lamprey  cgc
B D                    Tenrec  ---
B D                  Elephant  ---
         Cape elephant shrew  ---
        David's myotis (bat)  ===
B D                   Manatee  ---
            Cape golden mole  ---
                    Aardvark  ---
       Burton's mouthbreeder  ===
B D                    Medaka  ===
B D                   Wallaby  ---
          Southern platyfish  ===
B D                       Pig  ===

Inserts between block 20 and 21 in window
B D                Tetraodon 4bp
B D                     Fugu 1bp
      Yellowbelly pufferfish 1bp
B D             Nile tilapia 7bp
         Princess of Burundi 7bp
                 Zebra mbuna 7bp
         Pundamilia nyererei 7bp
B D              Stickleback 1bp
B D             Atlantic cod 1bp

Alignment block 21 of 654 in window, 81847241 - 81847243, 3 bps 
B D                     Human  acc
B D                     Chimp  acc
B D                   Gorilla  acc
B D                 Orangutan  acc
B D                    Gibbon  acc
B D                    Rhesus  acc
B D       Crab-eating macaque  acc
B D                    Baboon  acc
B D              Green monkey  acc
B D                  Marmoset  acc
B D           Squirrel monkey  acc
B D                  Bushbaby  acc
           Chinese tree shrew  acc
B D                  Squirrel  acc
       Lesser Egyptian jerboa  acc
                 Prairie vole  acc
B D           Chinese hamster  acc
               Golden hamster  acc
B D                     Mouse  acc
B D                       Rat  acc
B D            Naked mole-rat  acc
B D                Guinea pig  acc
                   Chinchilla  acc
             Brush-tailed rat  acc
B D                      Pika  acc
B D                    Alpaca  acc
               Bactrian camel  acc
B D                   Dolphin  acc
                 Killer whale  acc
             Tibetan antelope  acc
B D                       Cow  acc
B D                     Sheep  acc
                Domestic goat  acc
B D                     Horse  acc
B D          White rhinoceros  acc
B D                       Cat  acc
B D                       Dog  acc
B D                   Ferret   acc
B D                     Panda  acc
               Pacific walrus  acc
                 Weddell seal  acc
             Black flying-fox  acc
B D                   Megabat  acc
                Big brown bat  acc
B D                  Microbat  acc
B D                  Hedgehog  acc
B D                     Shrew  acc
              Star-nosed mole  acc
B D                  Elephant  acc
          Cape elephant shrew  acc
B D                   Manatee  acc
             Cape golden mole  acc
B D                    Tenrec  acc
                     Aardvark  acc
B D                 Armadillo  acc
B D                   Opossum  acc
B D           Tasmanian devil  acc
B D                  Platypus  acc
  D               Rock pigeon  acc
  D              Saker falcon  acc
  D          Peregrine falcon  acc
  D       Collared flycatcher  acc
  D    White-throated sparrow  acc
B D       Medium ground finch  acc
B D               Zebra finch  acc
           Tibetan ground jay  acc
B D                Budgerigar  acc
  D                    Parrot  acc
  D             Scarlet macaw  acc
  D              Mallard duck  acc
B D                   Chicken  acc
B D                    Turkey  acc
B D        American alligator  acc
  D           Green seaturtle  acc
  D            Painted turtle  acc
  D  Chinese softshell turtle  acc
  D    Spiny softshell turtle  acc
B D                    Lizard  acc
B D             X. tropicalis  acc
B D                Coelacanth  acc
B D                 Tetraodon  acc
B D                      Fugu  acc
       Yellowbelly pufferfish  acc
B D              Nile tilapia  acc
          Princess of Burundi  acc
        Burton's mouthbreeder  acc
                  Zebra mbuna  acc
          Pundamilia nyererei  acc
B D                    Medaka  acc
           Southern platyfish  acc
B D               Stickleback  acc
B D              Atlantic cod  acc
B D                 Zebrafish  acc
     Mexican tetra (cavefish)  acc
                  Spotted gar  acc
B D                   Lamprey  acc
        David's myotis (bat)  ===
B D                   Wallaby  ---
B D                       Pig  ===

Alignment block 22 of 654 in window, 81847244 - 81847248, 5 bps 
B D                     Human  tgctc
B D                     Chimp  tgctc
B D                   Gorilla  tgctc
B D                 Orangutan  tgctc
B D                    Gibbon  tgctc
B D                    Rhesus  tgctc
B D       Crab-eating macaque  tgctc
B D                    Baboon  tgctc
B D              Green monkey  tgctc
B D                  Marmoset  tgctc
B D           Squirrel monkey  tgctc
B D                  Bushbaby  tgctc
           Chinese tree shrew  tgctc
B D                  Squirrel  tgctc
       Lesser Egyptian jerboa  tgctc
                 Prairie vole  tgttc
B D           Chinese hamster  tgttc
               Golden hamster  tgttc
B D                     Mouse  tgttc
B D                       Rat  tgttc
B D            Naked mole-rat  tgttc
B D                Guinea pig  tgctc
                   Chinchilla  tgctc
             Brush-tailed rat  tgctc
B D                      Pika  tgttc
B D                    Alpaca  tgctc
               Bactrian camel  tgctc
B D                   Dolphin  tgctc
                 Killer whale  tgctc
             Tibetan antelope  tgctc
B D                       Cow  tgctc
B D                     Sheep  tgctc
                Domestic goat  tgctc
B D                     Horse  tgctc
B D          White rhinoceros  tgctc
B D                       Cat  tgctc
B D                       Dog  tgctc
B D                   Ferret   tgctc
B D                     Panda  tgctc
               Pacific walrus  tgctc
                 Weddell seal  tgctc
             Black flying-fox  tgctc
B D                   Megabat  tgctc
                Big brown bat  tgctc
B D                  Microbat  tgctc
B D                  Hedgehog  tgctc
B D                     Shrew  tgctc
              Star-nosed mole  tgctc
B D                  Elephant  tgctc
          Cape elephant shrew  tgctc
B D                   Manatee  tgctc
             Cape golden mole  tgctc
B D                    Tenrec  tgctc
                     Aardvark  tgctc
B D                 Armadillo  tgctc
B D                   Opossum  tgctc
B D           Tasmanian devil  tgctc
B D                   Wallaby  tgctc
B D                  Platypus  tgctc
  D               Rock pigeon  tgttc
  D              Saker falcon  tgttc
  D          Peregrine falcon  tgttc
  D       Collared flycatcher  tgctc
  D    White-throated sparrow  tgctc
B D       Medium ground finch  tgctc
B D               Zebra finch  tgttc
           Tibetan ground jay  tgctc
B D                Budgerigar  tgttc
  D                    Parrot  tgttc
  D             Scarlet macaw  tgttc
  D              Mallard duck  tgttc
B D                   Chicken  tgctc
B D                    Turkey  tgctc
B D        American alligator  tgctc
  D           Green seaturtle  tgttc
  D            Painted turtle  tgttc
  D  Chinese softshell turtle  tgttc
  D    Spiny softshell turtle  tgttc
B D                    Lizard  tgttc
B D             X. tropicalis  tgctc
B D                Coelacanth  tgttc
B D                 Tetraodon  tgctc
B D                      Fugu  tgctc
       Yellowbelly pufferfish  tgctc
B D              Nile tilapia  tgctc
          Princess of Burundi  tgctc
        Burton's mouthbreeder  tgctc
                  Zebra mbuna  tgctc
          Pundamilia nyererei  tgctc
B D                    Medaka  tgctc
           Southern platyfish  tgctc
B D               Stickleback  tgctc
B D              Atlantic cod  tgctc
B D                 Zebrafish  tgctc
     Mexican tetra (cavefish)  tgctc
                  Spotted gar  tgctc
B D                   Lamprey  tgctc
        David's myotis (bat)  =====
B D                       Pig  =====

Alignment block 23 of 654 in window, 81847249 - 81847347, 99 bps 
B D                     Human  ggtgaactcgatgacaaggggcagctggttgtgtttgataaagtccagcaggttctccttggtgacctcc
B D                     Chimp  ggtgaactcgatgacaaggggcagctggttgtgtttgataaagtccagcaggttctccttggtgacctcc
B D                   Gorilla  ggtgaactcgatgacaaggggcagctggttgtgtttgataaagtccagcaggttctccttggtgacctcc
B D                 Orangutan  ggtgaactcgatgacaaggggcagctggttgtgtttgataaagtccagcaggttctccttggtgacctcc
B D                    Gibbon  ggtgaactcgatgacaaggggcagctggttgtgtttgataaagtccagcaggttctccttggtgacctcc
B D                    Rhesus  ggtgaactcgatgacaaggggcagctggttgtatttgataaagtccagcaggttctccttggtgacctcc
B D       Crab-eating macaque  ggtgaactcgatgacaaggggcagctggttgtatttgataaagtccagcaggttctccttggtgacctcc
B D                    Baboon  agtgaactcgatgacaaggggcagctggttgtatttgataaagtccagcaggttctccttggtgacctcc
B D              Green monkey  agtgaactcgatgacaaggggcagctggttgtatttgataaagtccagcaggttctccttggtgacctcc
B D                  Marmoset  ggtgaactcaatgacaaggggtagctggttgtgtttgataaagtccagcaggctctccttggtgacctcc
B D           Squirrel monkey  agtgaactcgatgacaaggggcaactggttgtgtttgataaagtccagcaggttctccttggtgacctcc
B D                  Bushbaby  agtgaactcgatgaccaggggcagctggttgtgcttgatgaagtccagcaagttttccttggtgacctcc
           Chinese tree shrew  ggtgaactcgatgaccaggggcagctggttgtgcttcaggaaggccagcaggctctccttggtgatctcc
B D                  Squirrel  agtgaactcaatgaccaggggcagctggttgtgcttgatgaagtccagcaggttctctttggtgatctcc
       Lesser Egyptian jerboa  agtaaactcgatgaccagaggcagttggttgtgcttgatgaagtctagcagcttctctttggtgacttct
                 Prairie vole  agtgaactcgatgaccaaaggcagctgattgtgcttgatgaagtctagcagcttctccttggtgatctca
B D           Chinese hamster  agtgaactcgatgaccaaaggcagctggttgtgcttaataaagtccaacagcttctccttggtgacctca
               Golden hamster  agtgaactcgatgaccaaaggcagttggttgtgcttaatgaagtctagcagcttctccttggtgacctca
B D                     Mouse  agtgaactcgatgaccaaaggcagctgattgtgcttgatgaagtctagaagcttctccttggtgatctca
B D                       Rat  agtgaactcgatgaccaaaggcagctggttgtgcttgatgaagtctaacagcttctccttggtgatctca
B D            Naked mole-rat  ggtgaactcgatgaccaggggtagctggttgtgcttgatgaagtccagcaatttctctttggtgatctcc
B D                Guinea pig  agtgaactcgatgaccaggggcagctggttgtgcttgatgaagtccagcaagttctctttggtgacctcc
                   Chinchilla  agtgaactcaatgaccagggggagctggttgtgcttgataaagtccagcaacttctctttggtgacctcc
             Brush-tailed rat  ggtgaactcaatgaccaggggtagctggttgtgcttgatgaattccagcaatttctctttggtgacctcc
B D                      Pika  tgtgaactcgatgaccagcggtagctggttgtgcttgatgaagtccagcagcttctccttggtgacctcc
B D                    Alpaca  ggtgaactcaatgaccagcggcagctggttgtgcttgatgaaatccaacagcttctccttggtgacctcg
               Bactrian camel  ggtgaactcgatgaccagcggcagctggttgtgcttgatgaagtccaacagcttctccttggtgacctcc
B D                   Dolphin  agtgaactcgatgaccaggggtaactggttgtgcttgatgaagtccagaagtttctccttggtgacctcc
                 Killer whale  agtgaactcgatgaccaggggtaactggttgtgcttgatgaagtccagaagtttctccttggtgacctcc
             Tibetan antelope  ggtgaactcgatgaccaggggcaactggttgtgcttgatgaagtccagaagcttctccttggtgacctcc
B D                       Cow  ggtgaactcaatgaccaggggcaactggttgtgcttgatgaagtccagaagcttttctttggtgacctcc
B D                     Sheep  ggtgaactcgatgaccaggggcaactggttgtgcttgatgaagtccagaagcttctccttggtgacctcc
                Domestic goat  ggtgaactcgatgaccaggggcaactggttgtgcttgatgaagtccagaagcttctccttggtgacctcc
B D                     Horse  cgtgaactcgatgaccagtggcagctggttgtgcttgacgaagtccagcagcttctccttggtgatctcc
B D          White rhinoceros  ggtgaactcgataaccagtggcagctggttgtgcttgacgaagtccagcagcttctctttggtgacctcc
B D                       Cat  agtgaactcgatgaccagcggcagctggttgtgcttgatgaagtccaacagcttgtctttggtgatgtcc
B D                       Dog  tgtgaactcgatgaccagtggcagctggttgtgcttgatgaagtccaacagcttctccttgctgatttcc
B D                   Ferret   cgtgaactcgatgaccagcggcagctggttgtgcttgatgaagtccagcagtttctctttggtgacgtcc
B D                     Panda  cgtgaactcgatgaccagcggcagctggttgtgcttgatgaagtccaacaacttgtccttggtgacgtcc
               Pacific walrus  cgtgaactcgatgaccagcggcagctggttgtgtttgatgaagtccagcagcttctctttggtgacgtcc
                 Weddell seal  tgtgaactcgatgaccagcggcagctggttgtgcttgatgaagtccagcagcttctctttggtgacgtcc
             Black flying-fox  ggtgaactcgatgaccagcggcagctggttgtgcttgatgaaggccagcagcttctctttggtgacctcc
B D                   Megabat  ggtgaactcgatgaccagcggcagctggttgtgcttgatgaaggccagcagcttctctttggtgacctcc
                Big brown bat  ggtgaactcgatgaccagcggcagctggttgtgcttgatgaagtccagcagcttctccttggtgacctcc
         David's myotis (bat)  ngtgaactcgatgaccaggggcagctggttgtgcttgatgaaatccagcagtttctccttggtgacctcc
B D                  Microbat  ggtgaactcgatgaccaggggcagctggttgtgcttgatgaagtccagcagcttctccttggtgacctcc
B D                  Hedgehog  cgtgaactcgatgaccagtggcagctggttgtgcttgatgaaatccagcagcttctccttggtgatctcc
B D                     Shrew  cgtgaactcgatgaccaggggcagctggttgtgcttgatgaagtccagcagcttctccttggtgatctcc
              Star-nosed mole  cgtgaactcgatgaccaggggcagctggttgagctttataaagtccagcagcttctccttggtgatgtcc
B D                  Elephant  ggtgaactcaatgaccagtggcagctggttgtgcctgatgaagttcaggaggctctccttggtaacctcc
          Cape elephant shrew  cgtgaactcgataaccaggggcagctggttgtgtctgatgaaattgaggaggttctccttggtcacctcc
B D                   Manatee  tgtgaactcgatgaccagaggcagctggttgtgcctgatgaagctgaggaggttctccttggtgacctcc
             Cape golden mole  ggtgaactcaatgaccagcggcagctggttgtgcctgatgaagttgaggaggccctccttggtcatctcc
B D                    Tenrec  ggtgaactcgatgaccagtggcagctggttgtgccggatgaagttgaggaggctctccttggtgggctcc
                     Aardvark  tgtgaactcgatgaccagtggcagctggttgtgcctgatgaagctgagaaggttctccttggtgacctcc
B D                 Armadillo  cgtgaactcgatgaccagcggcagctggttgtgcttgatgaagctcagcaggttctccttggtgacttcc
B D                   Opossum  cgtgaactcaatgactaagggcagccggtgataattaacaaaatccattaggttctccttggtaatctct
B D           Tasmanian devil  agtgaactcgatgaccaagggcagccggtgataattaacaaaagtcaataggttctccttggtaatctct
B D                   Wallaby  agtgaactcgatgaccaagggcagcttgtagagattaacaaaatctgctatggccactttagtaatctct
B D                  Platypus  cgtgaactcgatgaccaagggcaactggttctgcttgatgaagttggacaggttctctttggtgacctcc
  D               Rock pigeon  agtgaactctatgaccagaggcaacgcgttggacttgatgaagttcagtaaattgtcttttgtgatgtcc
  D              Saker falcon  agtgaactctatgaccagaggcaaggcattagactttatgaagttcagtaaattatcttttgtgagctcc
  D          Peregrine falcon  agtgaactctatgaccagaggcaaggcattagactttatgaagttcagtaaattatcttttgtgagctcc
  D       Collared flycatcher  agtgaactctatgaccagaggcaatgaattagacttgatgaagttgagcagattatcttttgtgagatcc
  D    White-throated sparrow  agtgaactctatgaccagaggcaatgaattagacttgatgaagttcagcagattatcttttgtgagatcc
B D       Medium ground finch  agtgaactctatgaccagaggcaatgaattagacttgatgaagttcagcagattatcttttgtgagatcc
B D               Zebra finch  agtgaactctatgaccagaggcaatgaattagacttgatgaagttcagcagattatcttttttgaaatcc
           Tibetan ground jay  agtgaactctatgaccagaggcaatgaattagacttgatgaagttcagcagattatcttttgtgagatcc
B D                Budgerigar  agtgaactctatgaccagaggcaatgaattggacttgatgaagttcagcaaattatcttttgtgagatcc
  D                    Parrot  agtgaactctatgaccagaggcaatgaattggacttgatgaagttcagtaaattatcttttgtgagatcc
  D             Scarlet macaw  agtgaactctatgaccagaggcagtgaattggacttgatgaagttcagtaaattatcttttgtgagatcc
  D              Mallard duck  agtgaactctataaccagaggcaactgattagacttgatgaagttcagtaagttatcttttgtgagatct
B D                   Chicken  agtaaactctatgacaagaggcagctgattagacttgatgaagttcagcaagttatctttggtaagatcc
B D                    Turkey  agtaaactctatgacaagaggcaactggttagacttgatgaagttcagcaagttatctttcgtaagatcc
B D        American alligator  agtgaactcgatcactagaggcagctggttggacttgatgaagttcagcagattctcctttgtgatctcg
  D           Green seaturtle  agtgaactcaattaccagaggcaactggttagacttgatgaagttcagcaagttctcttttgtaatgtca
  D            Painted turtle  agtgaactcaatgaccagaggcagctggttagacttgatgaagttcagcaagttctcttttgtaagatca
  D  Chinese softshell turtle  tgtgaactcgatgaccaaaggcagctggttggacttgatgaaattcagcaagttctcttttgtaatgtca
  D    Spiny softshell turtle  tgtgaactcgatgaccaaaggcagctggttagacttgatgaaattcagcaagttctcttttgtaatgtca
B D                    Lizard  agtaaattcaatcaccaagggcaactggtttgatttgatgaagttcaacaggttctcctttgttatctcc
B D             X. tropicalis  agtaaattctataaccagaggcaaacgattggcctttatgaagctcaaaacttcttccttggtgatatct
B D                Coelacanth  agtgaactcgatcaccattgggagctggttggctttaatgaagttcagtagattctccttagtcagttct
B D                 Tetraodon  ggtgaactcaatcacaagaggcagctggttggacttgacaaaattcaggaggttctccttggtcacctcg
B D                      Fugu  ggtgaactcgatgacaagaggcagctggttggacttgacaaaattcaggaggttctctttggtcacctcg
       Yellowbelly pufferfish  ggtgaactcgatgacaagaggcagctggttggacttgacaaaattcaggaggttctctttggtcacctcg
B D              Nile tilapia  ggtgaactcaatgaccaggggcagctggttggccttgacaaaggacagaagcgcttctttggtcaggtca
          Princess of Burundi  ggtgaactcaatgaccaggggcagctggttggccttgacaaaggacagaagcgcttctttggtcagctca
        Burton's mouthbreeder  ggtgaactcaatgaccaggggcagctggttggccttgacaaaggactgaagcgcttctttggtcagctca
                  Zebra mbuna  ggtgaactcaatgaccaggggcagctggttggccttgacaaaggactgaagcgcttctttggtcagctca
          Pundamilia nyererei  ggtgaactcaatgaccaggggcagctggttggccttgacaaaggactgaagcgcttctttggtcagctca
B D                    Medaka  ggtgaactcgatgaccagaggcagctggttggctttgacaaaagcaaggaggccgtctttggtcagctcc
           Southern platyfish  tgtgaactcaatgaccagcggaagctggttggccttaacgaaagccaagagcttctccttcgtcagctct
B D               Stickleback  tgtgaactcaataaccagaggcaactggttggtcttgacaaaagccaggaggttctctttggtcagctct
B D              Atlantic cod  ggtgaactcgatgaccaggggcagctggttggtcttgatgaaggccaggatgttctccttggtcatctct
B D                 Zebrafish  tgtgaactcgatgaccaggggaagctggttggccttgatgaagttcagtaaactttctttgctgacctct
     Mexican tetra (cavefish)  agtgaactcgatgaccaggggcagctggttggccttgatgaagctcaggaggccctctttgctgagttct
                  Spotted gar  cgtgaactcgatgaccatgggcagctggttggccttgatgaagctcaggaggctctccttggtgacgtcg
B D                   Lamprey  ggtgaactcgatgagtagaggcagctcgttggacttgacgaacttgcgcaggccttccttgctcagctcg
B D                       Pig  ======================================================================

                        Human  ccttcaaagttgttccggccttcatcaaa
                        Chimp  ccttcaaagttgttccggccttcatcaaa
                      Gorilla  ccttcaaagttgttccggccttcatcaaa
                    Orangutan  ccttcaaagttgttccggccttcatcaaa
                       Gibbon  ccttcaaagttgttccggccttcatcaaa
                       Rhesus  ccttcaaagttgttccggccttcatcaaa
          Crab-eating macaque  ccttcaaagttgttccggccttcatcaaa
                       Baboon  ccttcaaagttgttccggccttcatcaaa
                 Green monkey  ccttcaaagttgttccggccttcatcaaa
                     Marmoset  ccttcaaagttgttccggccttcatcaaa
              Squirrel monkey  ccttcaaagttgtttcggccttcatcaaa
                     Bushbaby  ccctcaaagttattccggccttcgtcaaa
           Chinese tree shrew  cccgcaaagtcgttccggccttcgtcaaa
                     Squirrel  ccttcaaagttgttccggccctcatcaaa
       Lesser Egyptian jerboa  ccctcaaagttgttccggccttcatcaaa
                 Prairie vole  ccctcaaagttgttgcggccttcatcaaa
              Chinese hamster  ccttcaaagttgttgcggccttcatcaaa
               Golden hamster  ccttcaaagttgtttcggccttcatcaaa
                        Mouse  ccctcaaagttgttgcggccttcatcaaa
                          Rat  ccttcaaaattgttgcggccttcatcaaa
               Naked mole-rat  ccctcaaagttgttccggccttcatcaaa
                   Guinea pig  ccttcaaagttgttccggccttcatcaaa
                   Chinchilla  ccctcaaagttgtttcggccttcatcaaa
             Brush-tailed rat  ccctcaaagttgttccggccttcatcaaa
                         Pika  ccctcgaaatcgttccgtccttcatcaaa
                       Alpaca  ccctcaaagtcattccggccttcgtcgaa
               Bactrian camel  ccctcaaagtcattccggccttcgtcgaa
                      Dolphin  ccctcaaagttgttccggccttcatcaaa
                 Killer whale  ccctcaaagttgttccggccttcatcaaa
             Tibetan antelope  ccctcaaagttgttccggccttcgtcaaa
                          Cow  ccctcaaagttgttccggccttcgtcaaa
                        Sheep  ccctcaaagttgttccggccttcgtcaaa
                Domestic goat  ccctcaaagttgttccggccttcgtcaaa
                        Horse  ccctcaaagttgttccggccctcatcaaa
             White rhinoceros  ccctcaaagttgttccggccttcgtcaaa
                          Cat  ccctcgaagttgttccggccttcatcaaa
                          Dog  ccctcgaagttgttgcggccttcgtcaaa
                      Ferret   ccctcaaagttgttgcggccttcgtcgaa
                        Panda  ccctcgaaattgttgcggccttcgtcaaa
               Pacific walrus  ccctcaaagttgttgcggccttcatcaaa
                 Weddell seal  ccctcaaagttgttgcggccttcatcaaa
             Black flying-fox  ccctcaaagtcgttccggccttcgtcaaa
                      Megabat  ccctcaaagtcgttccggccttcgtcaaa
                Big brown bat  ccctcgaagtcgttccggccttcgtcgaa
         David's myotis (bat)  ccctcgaagtcgttccggccttcgtcgaa
                     Microbat  ccctcgaagtcgttccggccttcgtcgaa
                     Hedgehog  ccttcaaaattgtttcggccttcatcaaa
                        Shrew  ccgtcaaagttgttccgaccctcgtcaaa
              Star-nosed mole  ccctcgaagttgttccggccttcgtcaaa
                     Elephant  ccctcaaagttgttccgaccttcgtcaaa
          Cape elephant shrew  ccctcaaagttgttccgaccttcatcaaa
                      Manatee  ccttcgaagtcgttccgaccttcgtcaaa
             Cape golden mole  ccatcaaagttgttccggccttcatcaaa
                       Tenrec  ccgtcaaagttgttccgaccttcgtcaaa
                     Aardvark  ccctcaaagttgttccgaccttcgtcaaa
                    Armadillo  ccctcgaagttgttccgaccttcgtcaaa
                      Opossum  ccatcgtagttgtttctaccttcatcaaa
              Tasmanian devil  ccttcaaaattgtttcgaccttcatcaaa
                      Wallaby  ccggcaaagttgtttctaccatcatcaaa
                     Platypus  ccggagaagctgttgcggccttcgtcgaa
                  Rock pigeon  ccttcaaagttgttacggccttcgtcaaa
                 Saker falcon  ccttcaaagttgttacggccttcatcaaa
             Peregrine falcon  ccttcaaagttgttacggccttcatcaaa
          Collared flycatcher  ccttcaaagttgttcttgccttcatcgaa
       White-throated sparrow  ccttcaaagttgttctggccttcatcgaa
          Medium ground finch  ccttcaaagttgttctggccttcatcgaa
                  Zebra finch  ccttcaaagttgttctggccttcatcaaa
           Tibetan ground jay  ccttcaaagttgttctggccttcatcaaa
                   Budgerigar  ccttcaaagttgttgcggccttcatcaaa
                       Parrot  ccttcaaagttgttacggccttcatcaaa
                Scarlet macaw  ccttcaaagttgttgcggccttcatcaaa
                 Mallard duck  ccttcaaagttgttacggccttcatcaaa
                      Chicken  ccttcaaagttgttacgtccttcatcaaa
                       Turkey  ccttcaaagttgttacgtccttcatcaaa
           American alligator  ccctcaaaattgttgcgaccttcatcaaa
              Green seaturtle  ccttcaaagttgttgcgaccttcatcaaa
               Painted turtle  ccttcaaagttgttgcgaccttcatcaaa
     Chinese softshell turtle  ccttcaaagttgttgcgcccttcatcgaa
       Spiny softshell turtle  ccttcaaagttgttgcgcccttcatcgaa
                       Lizard  ccatcaaagttgttacggccttcatcaaa
                X. tropicalis  ccctcatatgcatttcggccttcatcaaa
                   Coelacanth  ccttcaaagttattccgtccctcatcaaa
                    Tetraodon  ccctcaaacgtgttgcggccttcatcaaa
                         Fugu  ccatcaaaagtgttgcgaccttcatcaaa
       Yellowbelly pufferfish  ccatcaaaagtgttgcgaccttcatcaaa
                 Nile tilapia  ccatcgaaggtattgcgtccctcatcaaa
          Princess of Burundi  ccatcgaaggtattgcgtccctcatcaaa
        Burton's mouthbreeder  ccatcgaaggtattgcgtccctcatcaaa
                  Zebra mbuna  ccatcgaaggtattgcgtccctcatcaaa
          Pundamilia nyererei  ccatcgaaggtattgcgtccctcatcaaa
                       Medaka  ccatcaaaggtgtttcgcccttcgtcaaa
           Southern platyfish  ccatcaaaggtattgcgaccttcatcgaa
                  Stickleback  ccatcaaaggtattgcgcccttcatcaaa
                 Atlantic cod  ccgtcaaaggtgttgcggccctcgtcgaa
                    Zebrafish  ccatcgaaagtatttcgaccctcatcaaa
     Mexican tetra (cavefish)  ccatcaaaagtgttacggccctcgtcaaa
                  Spotted gar  ccctcgaaggcattgcggccctcgtcgaa
                      Lamprey  ccctcgtacacgttccggccctcgtcgaa
                          Pig  =============================

Alignment block 24 of 654 in window, 81847348 - 81847350, 3 bps 
B D                     Human  ctg
B D                     Chimp  ctg
B D                   Gorilla  ctg
B D                 Orangutan  ctg
B D                    Gibbon  ctg
B D                    Rhesus  ctg
B D       Crab-eating macaque  ctg
B D                    Baboon  ctg
B D              Green monkey  ctg
B D                  Marmoset  ctg
B D           Squirrel monkey  ctg
B D                  Bushbaby  ctg
           Chinese tree shrew  ctg
B D                  Squirrel  ctg
       Lesser Egyptian jerboa  cta
                 Prairie vole  cta
B D           Chinese hamster  cta
               Golden hamster  cta
B D                     Mouse  cta
B D                       Rat  cta
B D            Naked mole-rat  ctg
B D                Guinea pig  ctg
                   Chinchilla  ctg
             Brush-tailed rat  ctg
B D                      Pika  ctg
B D                    Alpaca  ctg
               Bactrian camel  cgg
B D                   Dolphin  ctg
                 Killer whale  ctg
             Tibetan antelope  ctg
B D                       Cow  ctg
B D                     Sheep  ctg
                Domestic goat  ctg
B D                     Horse  ctg
B D          White rhinoceros  ctg
B D                       Cat  ctg
B D                       Dog  ctg
B D                   Ferret   ctg
B D                     Panda  ctg
               Pacific walrus  ctg
                 Weddell seal  ctg
             Black flying-fox  ctg
B D                   Megabat  ctg
                Big brown bat  ctg
         David's myotis (bat)  ctg
B D                  Microbat  ctg
B D                  Hedgehog  cta
B D                     Shrew  cta
              Star-nosed mole  ctg
B D                  Elephant  ctg
          Cape elephant shrew  ctg
B D                   Manatee  ctg
             Cape golden mole  ctg
B D                    Tenrec  ctg
                     Aardvark  ctg
B D                 Armadillo  ctg
B D                   Opossum  ctg
B D           Tasmanian devil  ctg
B D                  Platypus  ctg
  D               Rock pigeon  ctg
  D              Saker falcon  ctg
  D          Peregrine falcon  ctg
  D       Collared flycatcher  ctg
  D    White-throated sparrow  ctg
B D       Medium ground finch  ctg
B D               Zebra finch  ctg
           Tibetan ground jay  ctg
B D                Budgerigar  ctg
  D                    Parrot  ctg
  D             Scarlet macaw  ctg
  D              Mallard duck  ctg
B D                   Chicken  ctg
B D                    Turkey  ctg
B D        American alligator  ctg
  D           Green seaturtle  ctg
  D            Painted turtle  ctg
  D  Chinese softshell turtle  ctg
  D    Spiny softshell turtle  ctg
B D                    Lizard  ctg
B D             X. tropicalis  ct-
B D                Coelacanth  ctg
B D                 Tetraodon  ctg
B D                      Fugu  ctg
       Yellowbelly pufferfish  ctg
B D              Nile tilapia  ctg
          Princess of Burundi  ctg
        Burton's mouthbreeder  ctg
                  Zebra mbuna  ctg
          Pundamilia nyererei  ctg
B D                    Medaka  ctg
           Southern platyfish  cta
B D               Stickleback  ctg
B D              Atlantic cod  ctg
B D                 Zebrafish  ctg
     Mexican tetra (cavefish)  cta
                  Spotted gar  ctg
B D                   Lamprey  ctg
B D                   Wallaby  ---
B D                       Pig  ===

Inserts between block 24 and 25 in window
B D                  Chicken 2420bp
B D                   Turkey 2473bp
B D                Tetraodon 678bp
B D                     Fugu 808bp
      Yellowbelly pufferfish 805bp
B D                  Lamprey 1088bp

Alignment block 25 of 654 in window, 81847351 - 81847354, 4 bps 
B D                     Human  tgga
B D                     Chimp  tgga
B D                   Gorilla  tgga
B D                 Orangutan  tgga
B D                    Gibbon  tgga
B D                    Rhesus  tgga
B D       Crab-eating macaque  tgga
B D                    Baboon  tgga
B D              Green monkey  tgga
B D                  Marmoset  tgga
B D           Squirrel monkey  tgga
B D                  Bushbaby  tggg
           Chinese tree shrew  cggg
B D                  Squirrel  tgga
       Lesser Egyptian jerboa  tgga
                 Prairie vole  cgga
B D           Chinese hamster  cgga
               Golden hamster  tgga
B D                     Mouse  cgga
B D                       Rat  tgga
B D            Naked mole-rat  tggg
B D                Guinea pig  tggg
                   Chinchilla  tggg
             Brush-tailed rat  tggg
B D                      Pika  tgga
B D                    Alpaca  tgga
               Bactrian camel  cgga
B D                   Dolphin  tgga
                 Killer whale  tgga
             Tibetan antelope  tgga
B D                       Cow  tgga
B D                     Sheep  tgga
                Domestic goat  tgga
B D                     Horse  tgga
B D          White rhinoceros  tgga
B D                       Cat  tggg
B D                       Dog  tgga
B D                   Ferret   tgga
B D                     Panda  tgga
               Pacific walrus  tgga
                 Weddell seal  tgga
             Black flying-fox  ggga
B D                   Megabat  ggga
                Big brown bat  tgga
         David's myotis (bat)  cgga
B D                  Microbat  tgga
B D                  Hedgehog  cgga
B D                     Shrew  cgga
              Star-nosed mole  caga
B D                  Elephant  ggga
          Cape elephant shrew  agga
B D                   Manatee  agca
             Cape golden mole  tgga
B D                    Tenrec  -aga
                     Aardvark  agga
B D                 Armadillo  agga
B D                   Opossum  agaa
B D           Tasmanian devil  agaa
B D                  Platypus  ggag
B D        American alligator  --gg
  D           Green seaturtle  --gg
  D            Painted turtle  --gg
  D  Chinese softshell turtle  --gg
  D    Spiny softshell turtle  --gg
B D                    Lizard  -cag
B D                Coelacanth  aaga
B D              Nile tilapia  -caa
          Princess of Burundi  -caa
        Burton's mouthbreeder  -caa
                  Zebra mbuna  -caa
          Pundamilia nyererei  -caa
B D                    Medaka  tgga
           Southern platyfish  tcaa
B D               Stickleback  tgaa
B D              Atlantic cod  --ga
B D                 Zebrafish  --aa
     Mexican tetra (cavefish)  --aa
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                    Turkey  ====
                 Spotted gar  ----
  D              Mallard duck  ----
  D             Scarlet macaw  ----
  D                    Parrot  ----
B D                Budgerigar  ----
B D                   Wallaby  ----
  D          Peregrine falcon  ----
  D               Rock pigeon  ----
B D                   Lamprey  ====
B D                 Tetraodon  ====
B D                   Chicken  ====
  D       Collared flycatcher  ----
B D               Zebra finch  ----
  D              Saker falcon  ----
B D             X. tropicalis  ----
B D       Medium ground finch  ----
  D    White-throated sparrow  ----
          Tibetan ground jay  ----
B D                       Pig  ====

Inserts between block 25 and 26 in window
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
B D                   Medaka 2334bp
B D             Atlantic cod 2bp
B D                Zebrafish 1bp
    Mexican tetra (cavefish) 2bp

Alignment block 26 of 654 in window, 81847355 - 81847358, 4 bps 
B D                     Human  cag--a
B D                     Chimp  cag--a
B D                   Gorilla  cag--a
B D                 Orangutan  cag--a
B D                    Gibbon  cag--a
B D                    Rhesus  cag--a
B D       Crab-eating macaque  cag--a
B D                    Baboon  cag--a
B D              Green monkey  cag--a
B D                  Marmoset  cag--a
B D           Squirrel monkey  cag--a
B D                  Bushbaby  cag--a
           Chinese tree shrew  caa--g
B D                  Squirrel  cag--a
       Lesser Egyptian jerboa  cag--a
                 Prairie vole  cag--a
B D           Chinese hamster  aag--a
               Golden hamster  aag--a
B D                     Mouse  cag--a
B D                       Rat  cag--a
B D            Naked mole-rat  ccg--a
B D                Guinea pig  cgg--a
                   Chinchilla  cag--a
             Brush-tailed rat  cag--a
B D                      Pika  cac--a
B D                    Alpaca  cag--a
               Bactrian camel  cag--a
B D                   Dolphin  gag--a
                 Killer whale  gag--a
             Tibetan antelope  cag--a
B D                       Cow  cag--a
B D                     Sheep  cag--a
                Domestic goat  cag--a
B D                     Horse  cag--a
B D          White rhinoceros  cag--a
B D                       Cat  cac--a
B D                       Dog  tgc--a
B D                   Ferret   tgc--a
B D                     Panda  cgc--a
               Pacific walrus  cac--a
                 Weddell seal  cgc--a
             Black flying-fox  cgg--a
B D                   Megabat  cgg--a
                Big brown bat  cag--a
         David's myotis (bat)  cag--a
B D                  Microbat  cag--a
B D                  Hedgehog  cag--a
B D                     Shrew  cac--g
              Star-nosed mole  cag--a
B D                  Elephant  cag--a
          Cape elephant shrew  gagaaa
B D                   Manatee  cag--a
             Cape golden mole  caa--a
B D                    Tenrec  cag--a
                     Aardvark  cag--a
B D                 Armadillo  cgg--a
B D                   Opossum  aag--a
B D           Tasmanian devil  aag--a
B D                  Platypus  cgg--g
  D               Rock pigeon  caa--a
  D              Saker falcon  caa--a
  D          Peregrine falcon  caa--a
  D       Collared flycatcher  caa--g
  D    White-throated sparrow  caa--g
B D       Medium ground finch  caa--g
B D               Zebra finch  caa--g
           Tibetan ground jay  caa--g
B D                Budgerigar  caa--a
  D                    Parrot  caa--a
  D             Scarlet macaw  caa--a
  D              Mallard duck  caa--a
B D                   Chicken  tga--a
B D        American alligator  gaa--a
  D           Green seaturtle  gag--a
  D            Painted turtle  gag--a
  D  Chinese softshell turtle  gag--a
  D    Spiny softshell turtle  gag--a
B D                    Lizard  gaa--a
B D             X. tropicalis  -ag--a
B D                Coelacanth  caa--a
B D              Nile tilapia  --g--g
          Princess of Burundi  --g--g
        Burton's mouthbreeder  --g--g
                  Zebra mbuna  --g--g
          Pundamilia nyererei  --g--g
           Southern platyfish  --g--a
B D               Stickleback  aag--g
B D              Atlantic cod  -----a
B D                 Zebrafish  -----g
     Mexican tetra (cavefish)  -----a
                  Spotted gar  cag--g
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                    Medaka  ======
B D                    Turkey  ======
B D                   Wallaby  ------
B D                   Lamprey  ======
B D                 Tetraodon  ======
B D                       Pig  ======

Inserts between block 26 and 27 in window
B D                 Hedgehog 7831bp
             Star-nosed mole 769bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
  D              Rock pigeon 4bp
  D      Collared flycatcher 2180bp
  D   White-throated sparrow 7bp
B D      Medium ground finch 7bp
B D              Zebra finch 7bp
          Tibetan ground jay 7bp
  D             Mallard duck 4bp
B D                  Chicken 4bp
B D       American alligator 2bp
B D                   Lizard 2bp

Alignment block 27 of 654 in window, 81847359 - 81847359, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                      Pika  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  a
B D                       Cow  g
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                     Shrew  g
B D                   Opossum  a
B D           Tasmanian devil  a
B D                  Platypus  g
  D              Saker falcon  a
  D          Peregrine falcon  a
  D              Mallard duck  a
B D                   Chicken  c
B D        American alligator  a
  D           Green seaturtle  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
  D    Spiny softshell turtle  c
B D                    Lizard  c
B D             X. tropicalis  a
B D                Coelacanth  a
B D              Nile tilapia  a
          Princess of Burundi  a
        Burton's mouthbreeder  a
                  Zebra mbuna  a
          Pundamilia nyererei  a
           Southern platyfish  a
B D               Stickleback  a
B D              Atlantic cod  a
B D                 Zebrafish  a
     Mexican tetra (cavefish)  a
                  Spotted gar  a
B D                    Tenrec  -
B D                  Hedgehog  =
B D                  Elephant  -
         Cape elephant shrew  -
             Star-nosed mole  =
B D                 Armadillo  -
B D                   Manatee  -
            Cape golden mole  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D                    Medaka  =
B D                    Turkey  =
  D             Scarlet macaw  -
  D                    Parrot  -
B D                Budgerigar  -
B D                   Wallaby  -
  D               Rock pigeon  =
B D                   Lamprey  =
B D                 Tetraodon  =
  D       Collared flycatcher  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                       Pig  =

Inserts between block 27 and 28 in window
B D             Nile tilapia 2480bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 2491bp
                 Zebra mbuna 2599bp
         Pundamilia nyererei 3860bp
          Southern platyfish 1712bp
B D             Atlantic cod 3bp
B D                Zebrafish 3bp
    Mexican tetra (cavefish) 3bp

Alignment block 28 of 654 in window, 81847360 - 81847360, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  c
                   Chinchilla  a
             Brush-tailed rat  a
B D                      Pika  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
B D                     Shrew  c
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  a
B D           Tasmanian devil  a
B D                  Platypus  a
  D              Saker falcon  a
  D          Peregrine falcon  a
  D    White-throated sparrow  a
B D       Medium ground finch  a
B D               Zebra finch  a
           Tibetan ground jay  a
B D                Budgerigar  a
  D                    Parrot  a
  D             Scarlet macaw  a
  D              Mallard duck  a
B D                   Chicken  a
B D        American alligator  a
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  a
B D                    Lizard  a
B D             X. tropicalis  a
B D                Coelacanth  a
          Princess of Burundi  a
B D               Stickleback  a
B D                 Zebrafish  a
     Mexican tetra (cavefish)  a
                  Spotted gar  a
B D                  Hedgehog  =
        David's myotis (bat)  -
             Star-nosed mole  =
B D                  Microbat  -
               Big brown bat  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                    Medaka  =
B D                    Turkey  =
B D                   Wallaby  -
          Southern platyfish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
B D                 Tetraodon  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
B D                       Pig  =

Inserts between block 28 and 29 in window
B D                     Pika 11bp
  D             Saker falcon 2bp
  D         Peregrine falcon 2bp
  D   White-throated sparrow 2039bp
B D      Medium ground finch 1614bp
B D              Zebra finch 2140bp
          Tibetan ground jay 2640bp
B D               Budgerigar 2337bp
  D                   Parrot 3bp
  D            Scarlet macaw 3bp
  D             Mallard duck 28bp
B D                  Chicken 33bp

Alignment block 29 of 654 in window, 81847361 - 81847361, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  a
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  t
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  a
                   Chinchilla  g
             Brush-tailed rat  g
B D                      Pika  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                     Shrew  a
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                   Opossum  g
B <