Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1259 in window, 11785730 - 11785735, 6 bps 
B D                     Human  g--tcaag
B D                     Chimp  g--tcaag
B D                   Gorilla  g--tcaag
B D                 Orangutan  g--tcaag
B D                    Gibbon  g--tcaag
B D                    Rhesus  --------
B D       Crab-eating macaque  --------
B D                    Baboon  --------
B D              Green monkey  --------
B D                  Marmoset  --------
B D           Squirrel monkey  g--ccaag
B D                  Bushbaby  g--tca--
       Lesser Egyptian jerboa  g-------
                   Chinchilla  a--ccaag
             Brush-tailed rat  a--tcaat
B D                    Alpaca  g--tccag
               Bactrian camel  g--tcaag
B D                   Dolphin  --------
                 Killer whale  g--tt--g
B D                     Horse  g--taaaa
B D          White rhinoceros  g--c--tg
B D                       Cat  t--ttaat
B D                       Dog  g--ccaag
B D                   Ferret   g--tcaag
B D                     Panda  g--ccaag
               Pacific walrus  g--ccaag
                 Weddell seal  g--ccaag
             Black flying-fox  g--tcaag
B D                   Megabat  g--tcaag
B D                  Microbat  g--t--gg
B D                  Hedgehog  a--tcagc
          Cape elephant shrew  g-------
B D                   Manatee  gaa-----
                     Aardvark  g-------
B D                 Armadillo  t-------
B D                       Rat  ========
                Prairie vole  ========
              Golden hamster  ========
B D                     Mouse  ========
B D                      Pika  --------
B D                     Shrew  ========
B D                Guinea pig  ========
B D                       Pig  ========
B D                    Rabbit  ========
            Cape golden mole  ========
B D             X. tropicalis  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
  D    White-throated sparrow  ========
B D           Tasmanian devil  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
  D             Scarlet macaw  ========
B D                Budgerigar  ========
B D                   Opossum  ========
B D            Naked mole-rat  ========
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D       Medium ground finch  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D                    Parrot  ========
          Chinese tree shrew  ========
B D                  Platypus  ========
B D                   Wallaby  ========
B D                  Elephant  ========
B D           Chinese hamster  ========
B D                    Tenrec  ========
  D  Chinese softshell turtle  ========
             Star-nosed mole  ========
               Domestic goat  --------
B D                     Sheep  --------
            Tibetan antelope  --------
B D                  Squirrel  --------
        David's myotis (bat)  --------
               Big brown bat  ========
B D                       Cow  --------

Alignment block 2 of 1259 in window, 11785736 - 11785739, 4 bps 
B D                     Human  tttt
B D                     Chimp  tttt
B D                   Gorilla  tttt
B D                 Orangutan  tttt
B D                    Gibbon  tttt
B D                    Rhesus  tttg
B D       Crab-eating macaque  tttg
B D                    Baboon  tttg
B D              Green monkey  tttg
B D                  Bushbaby  gttt
B D           Chinese hamster  ttat
B D                    Alpaca  tttt
               Bactrian camel  tttt
                 Killer whale  ttct
B D                     Horse  ttct
B D          White rhinoceros  ttat
B D                       Cat  tttt
B D                       Dog  tcct
B D                   Ferret   tccc
B D                     Panda  tccc
               Pacific walrus  tccc
                 Weddell seal  tccc
             Black flying-fox  ttct
B D                   Megabat  ttct
B D                  Microbat  ttct
B D                  Hedgehog  ttct
          Cape elephant shrew  tcag
B D                   Manatee  tcag
                     Aardvark  -gag
B D                 Armadillo  -ttt
B D                       Rat  ====
                Prairie vole  ====
              Golden hamster  ====
B D                     Mouse  ====
      Lesser Egyptian jerboa  ----
B D                      Pika  ----
B D                     Shrew  ====
B D                Guinea pig  ====
B D                       Pig  ====
B D                    Rabbit  ====
            Cape golden mole  ====
B D                   Dolphin  ----
B D             X. tropicalis  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
B D            Naked mole-rat  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D       Medium ground finch  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
            Brush-tailed rat  ----
                  Chinchilla  ----
          Chinese tree shrew  ====
B D                  Platypus  ====
B D                   Wallaby  ====
B D                  Elephant  ====
B D                    Tenrec  ====
  D  Chinese softshell turtle  ====
             Star-nosed mole  ====
               Domestic goat  ----
B D                     Sheep  ----
            Tibetan antelope  ----
B D                  Squirrel  ----
        David's myotis (bat)  ----
               Big brown bat  ====
B D           Squirrel monkey  ----
B D                  Marmoset  ----
B D                       Cow  ----

Inserts between block 2 and 3 in window
B D                 Hedgehog 2219bp

Alignment block 3 of 1259 in window, 11785740 - 11785740, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D           Squirrel monkey  a
B D                  Bushbaby  t
B D           Chinese hamster  t
B D                    Alpaca  t
               Bactrian camel  t
                 Killer whale  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
B D                  Microbat  t
          Cape elephant shrew  c
B D                   Manatee  c
                     Aardvark  t
B D                 Armadillo  c
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  -
B D                      Pika  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D                    Gibbon  -
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  -
                  Chinchilla  -
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                  Elephant  =
B D                    Tenrec  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
B D                  Squirrel  -
        David's myotis (bat)  -
               Big brown bat  =
B D                  Marmoset  -
B D                       Cow  -

Alignment block 4 of 1259 in window, 11785741 - 11785741, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  c
B D           Chinese hamster  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
B D                     Horse  c
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
B D                  Microbat  t
          Cape elephant shrew  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  -
B D                      Pika  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
B D             X. tropicalis  =
B D                    Gibbon  -
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                  Elephant  =
B D                    Tenrec  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
                Killer whale  -
B D                  Squirrel  -
        David's myotis (bat)  -
               Big brown bat  =
B D                       Cow  -

Alignment block 5 of 1259 in window, 11785742 - 11785742, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  c
B D           Chinese hamster  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Alpaca  t
               Bactrian camel  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
B D                  Microbat  t
          Cape elephant shrew  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  -
B D                      Pika  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D                    Gibbon  -
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                  Elephant  =
B D                    Tenrec  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
                Killer whale  -
B D                  Squirrel  -
        David's myotis (bat)  -
               Big brown bat  =
B D                       Cow  -

Inserts between block 5 and 6 in window
B D                      Cat 10bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 254bp
              Pacific walrus 1bp
                Weddell seal 1bp

Alignment block 6 of 1259 in window, 11785743 - 11785747, 5 bps 
B D                     Human  gttta
B D                     Chimp  gttta
B D                   Gorilla  gttta
B D                 Orangutan  gttta
B D                    Gibbon  -ttta
B D                    Rhesus  tttta
B D       Crab-eating macaque  tttta
B D                    Baboon  tttta
B D              Green monkey  tttta
B D                  Marmoset  gttta
B D           Squirrel monkey  tttta
B D                  Bushbaby  ttttt
       Lesser Egyptian jerboa  ----t
B D           Chinese hamster  atttt
                   Chinchilla  ttctt
             Brush-tailed rat  ttttt
B D                      Pika  ---tt
               Bactrian camel  ---tt
B D                     Horse  cctct
B D          White rhinoceros  ttctt
B D                       Cat  attta
B D                       Dog  attcc
B D                   Ferret   attct
               Pacific walrus  agtcc
                 Weddell seal  ggtcc
             Black flying-fox  -tttt
B D                   Megabat  -tttt
B D                  Microbat  -tctt
          Cape elephant shrew  ttatg
B D                   Manatee  gttcc
                     Aardvark  ttttt
B D                 Armadillo  ttctc
B D                       Rat  =====
                Prairie vole  =====
              Golden hamster  =====
B D                     Mouse  =====
B D                  Hedgehog  =====
B D                     Shrew  =====
B D                Guinea pig  =====
B D                       Pig  =====
B D                    Rabbit  =====
            Cape golden mole  =====
B D                   Dolphin  -----
B D             X. tropicalis  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
  D             Scarlet macaw  =====
B D                Budgerigar  =====
B D                   Opossum  =====
B D            Naked mole-rat  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
          Chinese tree shrew  =====
B D                  Platypus  =====
B D                   Wallaby  =====
B D                  Elephant  =====
B D                    Tenrec  =====
  D  Chinese softshell turtle  =====
             Star-nosed mole  =====
               Domestic goat  -----
B D                     Sheep  -----
            Tibetan antelope  -----
B D                    Alpaca  -----
B D                     Panda  =====
                Killer whale  -----
B D                  Squirrel  -----
        David's myotis (bat)  -----
               Big brown bat  =====
B D                       Cow  -----

Inserts between block 6 and 7 in window
            Brush-tailed rat 12969bp
B D                     Pika 3bp

Alignment block 7 of 1259 in window, 11785748 - 11785750, 3 bps 
B D                     Human  ttt-
B D                     Chimp  ttt-
B D                   Gorilla  ttt-
B D                 Orangutan  ttt-
B D                    Gibbon  ttt-
B D                    Rhesus  ttt-
B D       Crab-eating macaque  ttt-
B D                    Baboon  ttt-
B D              Green monkey  ttt-
B D                  Marmoset  ttt-
B D           Squirrel monkey  ttt-
B D                  Bushbaby  ttt-
       Lesser Egyptian jerboa  ttc-
B D           Chinese hamster  tat-
B D                      Pika  ttc-
               Bactrian camel  -tt-
B D                     Horse  -tt-
B D          White rhinoceros  -tt-
B D                       Cat  -tt-
B D                       Dog  -tt-
B D                   Ferret   -tt-
               Pacific walrus  -tt-
                 Weddell seal  -tt-
             Black flying-fox  -tt-
B D                   Megabat  -tt-
B D                  Microbat  -at-
          Cape elephant shrew  -ttg
B D                   Manatee  -ttg
                     Aardvark  -ttt
B D                 Armadillo  -tta
B D                       Rat  ====
                Prairie vole  ====
              Golden hamster  ====
B D                     Mouse  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
B D                Guinea pig  ====
B D                       Pig  ====
B D                    Rabbit  ====
            Cape golden mole  ====
B D                   Dolphin  ----
B D             X. tropicalis  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
B D            Naked mole-rat  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D       Medium ground finch  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
            Brush-tailed rat  ====
                  Chinchilla  ----
          Chinese tree shrew  ====
B D                  Platypus  ====
B D                   Wallaby  ====
B D                  Elephant  ====
B D                    Tenrec  ====
  D  Chinese softshell turtle  ====
             Star-nosed mole  ====
               Domestic goat  ----
B D                     Sheep  ----
            Tibetan antelope  ----
B D                    Alpaca  ----
B D                     Panda  ====
                Killer whale  ----
B D                  Squirrel  ----
        David's myotis (bat)  ----
               Big brown bat  ====
B D                       Cow  ----

Inserts between block 7 and 8 in window
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 2bp
B D                  Megabat 2bp
B D                 Microbat 4bp

Alignment block 8 of 1259 in window, 11785751 - 11785752, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  tt
       Lesser Egyptian jerboa  tc
B D           Chinese hamster  tt
                   Chinchilla  tt
B D                      Pika  at
B D                     Horse  tt
B D          White rhinoceros  tc
B D                       Cat  tt
B D                       Dog  tt
B D                   Ferret   tt
               Pacific walrus  tt
                 Weddell seal  tt
          Cape elephant shrew  tg
B D                   Manatee  tt
                     Aardvark  tt
B D                 Armadillo  tt
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                       Pig  ==
B D                    Rabbit  ==
            Cape golden mole  ==
B D                   Megabat  ==
B D                   Dolphin  --
B D             X. tropicalis  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
B D            Naked mole-rat  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Brush-tailed rat  ==
          Chinese tree shrew  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D                  Elephant  ==
B D                    Tenrec  ==
  D  Chinese softshell turtle  ==
             Star-nosed mole  ==
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
              Bactrian camel  --
B D                    Alpaca  --
B D                     Panda  ==
                Killer whale  --
            Black flying-fox  ==
B D                  Squirrel  --
        David's myotis (bat)  --
               Big brown bat  ==
B D                  Microbat  ==
B D                       Cow  --

Inserts between block 8 and 9 in window
         Cape elephant shrew 31bp
B D                  Manatee 2bp
                    Aardvark 295bp

Alignment block 9 of 1259 in window, 11785753 - 11785756, 4 bps 
B D                     Human  -gag--a
B D                     Chimp  -gag--a
B D                   Gorilla  -gag--a
B D                 Orangutan  -gag--a
B D                    Gibbon  -gag--a
B D                    Rhesus  -gag--a
B D       Crab-eating macaque  -gag--a
B D                    Baboon  -gag--a
B D              Green monkey  -gag--a
B D                  Marmoset  -gag--a
B D           Squirrel monkey  -gag--a
B D                  Bushbaby  -gag---
       Lesser Egyptian jerboa  -gag--g
B D           Chinese hamster  -gag--a
                   Chinchilla  -aat---
B D                      Pika  -ga----
B D                     Horse  -gga-a-
B D          White rhinoceros  -gga---
B D                       Cat  -gaga--
B D                       Dog  -gga---
B D                   Ferret   -gga---
               Pacific walrus  -gga---
                 Weddell seal  -gga---
          Cape elephant shrew  aaaa---
B D                 Armadillo  ggaa---
B D                       Rat  =======
                Prairie vole  =======
              Golden hamster  =======
B D                     Mouse  =======
B D                  Hedgehog  =======
B D                     Shrew  =======
B D                Guinea pig  =======
B D                       Pig  =======
B D                    Rabbit  =======
            Cape golden mole  =======
                    Aardvark  =======
B D                   Megabat  =======
B D                   Dolphin  -------
B D             X. tropicalis  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
  D    White-throated sparrow  =======
B D           Tasmanian devil  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
B D                   Opossum  =======
B D            Naked mole-rat  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  =======
B D       Medium ground finch  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D                    Parrot  =======
            Brush-tailed rat  =======
          Chinese tree shrew  =======
B D                  Platypus  =======
B D                   Wallaby  =======
B D                   Manatee  =======
B D                  Elephant  =======
B D                    Tenrec  =======
  D  Chinese softshell turtle  =======
             Star-nosed mole  =======
               Domestic goat  -------
B D                     Sheep  -------
            Tibetan antelope  -------
              Bactrian camel  -------
B D                    Alpaca  -------
B D                     Panda  =======
                Killer whale  -------
            Black flying-fox  =======
B D                  Squirrel  -------
        David's myotis (bat)  -------
               Big brown bat  =======
B D                  Microbat  =======
B D                       Cow  -------

Inserts between block 9 and 10 in window
              Pacific walrus 156bp
                Weddell seal 1bp
         Cape elephant shrew 13bp

Alignment block 10 of 1259 in window, 11785757 - 11785759, 3 bps 
B D                     Human  cag
B D                     Chimp  cag
B D                   Gorilla  cag
B D                 Orangutan  cag
B D                    Gibbon  cag
B D                    Rhesus  cag
B D       Crab-eating macaque  cag
B D                    Baboon  cag
B D              Green monkey  cag
B D                  Marmoset  caa
B D           Squirrel monkey  cag
B D                  Bushbaby  -ag
       Lesser Egyptian jerboa  taa
B D           Chinese hamster  cag
B D          White rhinoceros  -aa
B D                       Cat  cag
B D                       Dog  aaa
B D                   Ferret   -aa
                 Weddell seal  -aa
          Cape elephant shrew  cat
B D                   Manatee  cac
B D                       Rat  ===
                Prairie vole  ===
              Golden hamster  ===
B D                     Mouse  ===
B D                      Pika  ---
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                Guinea pig  ===
B D                       Pig  ===
B D                    Rabbit  ===
            Cape golden mole  ===
                    Aardvark  ===
B D                   Megabat  ===
B D                   Dolphin  ---
B D             X. tropicalis  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
B D            Naked mole-rat  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Brush-tailed rat  ===
                  Chinchilla  ---
          Chinese tree shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D                  Elephant  ===
B D                    Tenrec  ===
  D  Chinese softshell turtle  ===
             Star-nosed mole  ===
               Domestic goat  ---
B D                     Sheep  ---
            Tibetan antelope  ---
              Bactrian camel  ---
B D                    Alpaca  ---
              Pacific walrus  ===
B D                     Panda  ===
                Killer whale  ---
            Black flying-fox  ===
B D                     Horse  ---
B D                  Squirrel  ---
B D                 Armadillo  ---
        David's myotis (bat)  ---
               Big brown bat  ===
B D                  Microbat  ===
B D                       Cow  ---

Inserts between block 10 and 11 in window
B D         White rhinoceros 1bp
B D                  Ferret  1bp
                Weddell seal 410bp

Alignment block 11 of 1259 in window, 11785760 - 11785760, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -a
       Lesser Egyptian jerboa  -g
B D           Chinese hamster  -g
B D          White rhinoceros  -a
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
          Cape elephant shrew  t-
B D                   Manatee  c-
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
B D                      Pika  --
                Weddell seal  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                       Pig  ==
B D                    Rabbit  ==
            Cape golden mole  ==
                    Aardvark  ==
B D                   Megabat  ==
B D                   Dolphin  --
B D             X. tropicalis  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
B D            Naked mole-rat  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Brush-tailed rat  ==
                  Chinchilla  --
          Chinese tree shrew  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D                  Elephant  ==
B D                    Tenrec  ==
  D  Chinese softshell turtle  ==
             Star-nosed mole  ==
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
              Bactrian camel  --
B D                    Alpaca  --
              Pacific walrus  ==
B D                     Panda  ==
                Killer whale  --
            Black flying-fox  ==
B D                     Horse  --
B D                  Squirrel  --
B D                 Armadillo  --
        David's myotis (bat)  --
               Big brown bat  ==
B D                  Microbat  ==
B D                       Cow  --

Inserts between block 11 and 12 in window
B D         White rhinoceros 298bp
B D                      Cat 1bp
B D                      Dog 211bp

Alignment block 12 of 1259 in window, 11785761 - 11785762, 2 bps 
B D                     Human  gt
B D                     Chimp  gt
B D                   Gorilla  gt
B D                 Orangutan  gt
B D                    Gibbon  gt
B D                    Rhesus  gt
B D       Crab-eating macaque  gt
B D                    Baboon  gt
B D              Green monkey  gt
B D                  Marmoset  gt
B D           Squirrel monkey  at
B D                  Bushbaby  gt
       Lesser Egyptian jerboa  gt
B D           Chinese hamster  gt
B D                       Cat  a-
B D                   Ferret   a-
          Cape elephant shrew  tt
B D                   Manatee  at
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
B D                      Pika  --
                Weddell seal  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                       Pig  ==
B D                    Rabbit  ==
            Cape golden mole  ==
                    Aardvark  ==
B D                   Megabat  ==
B D                   Dolphin  --
B D             X. tropicalis  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
B D            Naked mole-rat  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Brush-tailed rat  ==
                  Chinchilla  --
          Chinese tree shrew  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D                  Elephant  ==
B D                    Tenrec  ==
  D  Chinese softshell turtle  ==
             Star-nosed mole  ==
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
              Bactrian camel  --
B D                    Alpaca  --
              Pacific walrus  ==
B D                     Panda  ==
                Killer whale  --
B D                       Dog  ==
            Black flying-fox  ==
B D          White rhinoceros  ==
B D                     Horse  --
B D                  Squirrel  --
B D                 Armadillo  --
        David's myotis (bat)  --
               Big brown bat  ==
B D                  Microbat  ==
B D                       Cow  --

Inserts between block 12 and 13 in window
B D                  Ferret  118bp

Alignment block 13 of 1259 in window, 11785763 - 11785772, 10 bps 
B D                     Human  ctggctcaat
B D                     Chimp  ctggctcaat
B D                   Gorilla  ctggctcaat
B D                 Orangutan  ctggctcagt
B D                    Gibbon  ctggttcaat
B D                    Rhesus  ctggctaaat
B D       Crab-eating macaque  ctggctcaat
B D                    Baboon  ctggttcaat
B D              Green monkey  ctggctcaat
B D                  Marmoset  ctggctcagt
B D           Squirrel monkey  ctggctcagt
B D                  Bushbaby  ctcactatgt
       Lesser Egyptian jerboa  ctcacttta-
B D           Chinese hamster  ttctctgtgt
B D                       Cat  --gagacag-
          Cape elephant shrew  cttttttaat
B D                   Manatee  ctctactggt
B D                       Rat  ==========
                Prairie vole  ==========
              Golden hamster  ==========
B D                     Mouse  ==========
B D                      Pika  ----------
                Weddell seal  ==========
B D                  Hedgehog  ==========
B D                     Shrew  ==========
B D                Guinea pig  ==========
B D                       Pig  ==========
B D                    Rabbit  ==========
            Cape golden mole  ==========
                    Aardvark  ==========
B D                   Megabat  ==========
B D                   Dolphin  ----------
B D             X. tropicalis  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
  D    White-throated sparrow  ==========
B D           Tasmanian devil  ==========
  D            Painted turtle  ==========
  D           Green seaturtle  ==========
B D        American alligator  ==========
  D             Scarlet macaw  ==========
B D                Budgerigar  ==========
B D                   Opossum  ==========
B D            Naked mole-rat  ==========
  D               Rock pigeon  ==========
  D       Collared flycatcher  ==========
B D       Medium ground finch  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D                    Parrot  ==========
            Brush-tailed rat  ==========
                  Chinchilla  ----------
          Chinese tree shrew  ==========
B D                  Platypus  ==========
B D                   Wallaby  ==========
B D                  Elephant  ==========
B D                    Tenrec  ==========
  D  Chinese softshell turtle  ==========
B D                   Ferret   ==========
             Star-nosed mole  ==========
               Domestic goat  ----------
B D                     Sheep  ----------
            Tibetan antelope  ----------
              Bactrian camel  ----------
B D                    Alpaca  ----------
              Pacific walrus  ==========
B D                     Panda  ==========
                Killer whale  ----------
B D                       Dog  ==========
            Black flying-fox  ==========
B D          White rhinoceros  ==========
B D                     Horse  ----------
B D                  Squirrel  ----------
B D                 Armadillo  ----------
        David's myotis (bat)  ----------
               Big brown bat  ==========
B D                  Microbat  ==========
B D                       Cow  ----------

Inserts between block 13 and 14 in window
B D                      Cat 9bp

Alignment block 14 of 1259 in window, 11785773 - 11785773, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  c
B D           Chinese hamster  a
               Golden hamster  a
                   Chinchilla  t
          Cape elephant shrew  t
B D                   Manatee  t
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
      Lesser Egyptian jerboa  -
B D                      Pika  -
                Weddell seal  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  =
B D                     Panda  =
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                  Squirrel  -
B D                 Armadillo  -
        David's myotis (bat)  -
               Big brown bat  =
B D                  Microbat  =
B D                       Cow  -

Inserts between block 14 and 15 in window
         Cape elephant shrew 13bp

Alignment block 15 of 1259 in window, 11785774 - 11785774, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  a
       Lesser Egyptian jerboa  g
B D           Chinese hamster  g
               Golden hamster  g
                   Chinchilla  g
B D                       Cat  g
              Star-nosed mole  g
          Cape elephant shrew  g
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
B D                      Pika  -
                Weddell seal  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  -
B D                  Elephant  =
B D                    Tenrec  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  =
B D                     Panda  =
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                  Squirrel  -
B D                 Armadillo  -
        David's myotis (bat)  -
               Big brown bat  =
B D                  Microbat  =
B D                       Cow  -

Alignment block 16 of 1259 in window, 11785775 - 11785791, 17 bps 
B D                     Human  cccag-----------------------------------------------------------------
B D                     Chimp  cccag-----------------------------------------------------------------
B D                   Gorilla  cccag-----------------------------------------------------------------
B D                 Orangutan  cccag-----------------------------------------------------------------
B D                    Gibbon  cccag-----------------------------------------------------------------
B D                    Rhesus  cccag-----------------------------------------------------------------
B D       Crab-eating macaque  cccag-----------------------------------------------------------------
B D                    Baboon  tccag-----------------------------------------------------------------
B D              Green monkey  cccag-----------------------------------------------------------------
B D                  Marmoset  accag-----------------------------------------------------------------
B D           Squirrel monkey  accag-----------------------------------------------------------------
B D                  Bushbaby  tcctc-----------------------------------------------------------------
       Lesser Egyptian jerboa  cccag-----------------------------------------------------------------
B D           Chinese hamster  ccctg-----------------------------------------------------------------
               Golden hamster  gactgatgtaagagagggagagacaataaactccccaaattgttctctggtctccacaagtgtaccaaag
B D                       Cat  ---gg-----------------------------------------------------------------
              Star-nosed mole  cccag-----------------------------------------------------------------
          Cape elephant shrew  ---------------------------------tttaggttggtttagagattttttttttttaaa----
B D                   Manatee  ----------------------------------------------------------------------
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                      Pika  ----------------------------------------------------------------------
                Weddell seal  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
B D                    Rabbit  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
B D                   Megabat  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
B D             X. tropicalis  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
B D            Naked mole-rat  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ----------------------------------------------------------------------
          Chinese tree shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
               Domestic goat  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
            Tibetan antelope  ----------------------------------------------------------------------
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
              Pacific walrus  ======================================================================
B D                     Panda  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                       Dog  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ----------------------------------------------------------------------
B D                  Squirrel  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
B D                       Cow  ----------------------------------------------------------------------

                        Human  -------gctgaagcagag
                        Chimp  -------gctgaagcagag
                      Gorilla  -------gctgaagcagag
                    Orangutan  -------gctgaagcagag
                       Gibbon  -------gctgaagcagag
                       Rhesus  -------cctgaagcagag
          Crab-eating macaque  -------cctgaagcagag
                       Baboon  -------cctgaagcagag
                 Green monkey  -------cctgaagcagag
                     Marmoset  -------gctgaagcagtg
              Squirrel monkey  -------gctgaagcagtg
                     Bushbaby  -------agtagagcactg
       Lesser Egyptian jerboa  -------gctgacctgg--
              Chinese hamster  -------gctgtcctgg--
               Golden hamster  catgcacgccctcccca--
                          Cat  -------gcaggagcagag
              Star-nosed mole  -------gcaggggcag--
          Cape elephant shrew  -------tcagaa------
                      Manatee  -------ccagta------
                          Rat  ===================
                 Prairie vole  ===================
                        Mouse  ===================
                         Pika  -------------------
                 Weddell seal  ===================
                     Hedgehog  ===================
                        Shrew  ===================
                   Guinea pig  ===================
                          Pig  ===================
                       Rabbit  ===================
             Cape golden mole  ===================
                     Aardvark  ===================
                      Megabat  ===================
                      Dolphin  -------------------
                X. tropicalis  ===================
                       Turkey  ===================
                      Chicken  ===================
                 Mallard duck  ===================
           Tibetan ground jay  ===================
                  Zebra finch  ===================
       White-throated sparrow  ===================
              Tasmanian devil  ===================
               Painted turtle  ===================
              Green seaturtle  ===================
           American alligator  ===================
                Scarlet macaw  ===================
                   Budgerigar  ===================
                      Opossum  ===================
               Naked mole-rat  ===================
                  Rock pigeon  ===================
          Collared flycatcher  ===================
          Medium ground finch  ===================
             Peregrine falcon  ===================
                 Saker falcon  ===================
                       Parrot  ===================
             Brush-tailed rat  ===================
                   Chinchilla  -------------------
           Chinese tree shrew  ===================
                     Platypus  ===================
                      Wallaby  ===================
                     Elephant  ===================
                       Tenrec  ===================
     Chinese softshell turtle  ===================
                      Ferret   ===================
                Domestic goat  -------------------
                        Sheep  -------------------
             Tibetan antelope  -------------------
               Bactrian camel  -------------------
                       Alpaca  -------------------
               Pacific walrus  ===================
                        Panda  ===================
                 Killer whale  -------------------
                          Dog  ===================
             Black flying-fox  ===================
             White rhinoceros  ===================
                        Horse  -------------------
                     Squirrel  -------------------
                    Armadillo  -------------------
         David's myotis (bat)  -------------------
                Big brown bat  ===================
                     Microbat  ===================
                          Cow  -------------------

Inserts between block 16 and 17 in window
B D                      Cat 329bp

Alignment block 17 of 1259 in window, 11785792 - 11785812, 21 bps 
B D                     Human  gagtg----atctca-------------------------------------------------------
B D                     Chimp  gagtg----atctca-------------------------------------------------------
B D                   Gorilla  gaggg----atctca-------------------------------------------------------
B D                 Orangutan  gcgcg----atctca-------------------------------------------------------
B D                    Gibbon  gcgtg----atctca-------------------------------------------------------
B D                    Rhesus  gtgtg----atctca-------------------------------------------------------
B D       Crab-eating macaque  gtgtg----atctca-------------------------------------------------------
B D                    Baboon  gtgtg----atctca-------------------------------------------------------
B D              Green monkey  gtgtg----atctca-------------------------------------------------------
B D                  Marmoset  gctcactgaatcttg-------------------------------------------------------
B D           Squirrel monkey  gctcacagcatctcg-------------------------------------------------------
B D                  Bushbaby  tggtg-----tcaca-------------------------------------------------------
       Lesser Egyptian jerboa  ---------aattca---------------------------------------ctatgtt---------
B D           Chinese hamster  ---------aactca---------------------------------------ctctgta---------
               Golden hamster  ---------tacttaccacacacattaatctcccccctctcccagacagggtttctctgtgtagctttgt
               Bactrian camel  ----------------------------------------------------------------------
B D                  Microbat  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                      Pika  ----------------------------------------------------------------------
                Weddell seal  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
B D                    Rabbit  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
B D                   Megabat  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
B D             X. tropicalis  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
B D            Naked mole-rat  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ----------------------------------------------------------------------
          Chinese tree shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
               Domestic goat  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
            Tibetan antelope  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
              Pacific walrus  ======================================================================
B D                     Panda  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                       Dog  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ----------------------------------------------------------------------
B D                  Squirrel  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ======================================================================
B D                       Cow  ----------------------------------------------------------------------

                        Human  ----g------------ctcactgca
                        Chimp  ----g------------ctcactgca
                      Gorilla  ----g------------ctcactgca
                    Orangutan  ----g------------ctcactgca
                       Gibbon  ----g------------ctcactgca
                       Rhesus  ----a------------ctcactgca
          Crab-eating macaque  ----a------------ctcactgca
                       Baboon  ----a------------ctcactgca
                 Green monkey  ----a------------ctcactgca
                     Marmoset  ----g------------ctcactgca
              Squirrel monkey  ----g------------ctcactgca
                     Bushbaby  ----g------------ctcacagca
       Lesser Egyptian jerboa  ----gt-----------ttcaggatg
              Chinese hamster  ----g------------accaggctg
               Golden hamster  caacg------------acaaggctg
               Bactrian camel  -----------------ctcattaga
                     Microbat  -----aaatgaaacatgctcattaca
              Star-nosed mole  ----------------------tgca
          Cape elephant shrew  -----aaatgaaacctgctcattaca
                      Manatee  -----aaacagcaacccctggct---
                          Rat  ==========================
                 Prairie vole  ==========================
                        Mouse  ==========================
                         Pika  --------------------------
                 Weddell seal  ==========================
                     Hedgehog  ==========================
                        Shrew  ==========================
                   Guinea pig  ==========================
                          Pig  ==========================
                       Rabbit  ==========================
             Cape golden mole  ==========================
                     Aardvark  ==========================
                      Megabat  ==========================
                      Dolphin  --------------------------
                X. tropicalis  ==========================
                       Turkey  ==========================
                      Chicken  ==========================
                 Mallard duck  ==========================
           Tibetan ground jay  ==========================
                  Zebra finch  ==========================
       White-throated sparrow  ==========================
              Tasmanian devil  ==========================
               Painted turtle  ==========================
              Green seaturtle  ==========================
           American alligator  ==========================
                Scarlet macaw  ==========================
                   Budgerigar  ==========================
                      Opossum  ==========================
               Naked mole-rat  ==========================
                  Rock pigeon  ==========================
          Collared flycatcher  ==========================
          Medium ground finch  ==========================
             Peregrine falcon  ==========================
                 Saker falcon  ==========================
                       Parrot  ==========================
             Brush-tailed rat  ==========================
                   Chinchilla  --------------------------
           Chinese tree shrew  ==========================
                     Platypus  ==========================
                      Wallaby  ==========================
                     Elephant  ==========================
                       Tenrec  ==========================
                          Cat  ==========================
     Chinese softshell turtle  ==========================
                      Ferret   ==========================
                Domestic goat  --------------------------
                        Sheep  --------------------------
             Tibetan antelope  --------------------------
                       Alpaca  --------------------------
               Pacific walrus  ==========================
                        Panda  ==========================
                 Killer whale  --------------------------
                          Dog  ==========================
             Black flying-fox  ==========================
             White rhinoceros  ==========================
                        Horse  --------------------------
                     Squirrel  --------------------------
                    Armadillo  --------------------------
         David's myotis (bat)  --------------------------
                Big brown bat  ==========================
                          Cow  --------------------------

Alignment block 18 of 1259 in window, 11785813 - 11785813, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
       Lesser Egyptian jerboa  g
B D           Chinese hamster  g
               Golden hamster  g
               Bactrian camel  a
              Star-nosed mole  g
          Cape elephant shrew  a
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
B D                      Pika  -
                Weddell seal  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  -
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  -
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
B D                    Alpaca  -
              Pacific walrus  =
B D                     Panda  =
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                  Squirrel  -
B D                 Armadillo  -
        David's myotis (bat)  -
               Big brown bat  =
B D                  Microbat  -
B D                       Cow  -

Alignment block 19 of 1259 in window, 11785814 - 11785829, 16 bps 
B D                     Human  cctctgcctcccggg---------t
B D                     Chimp  cctctgcctcccggg---------t
B D                   Gorilla  cctccgcctcccggg---------t
B D                 Orangutan  cctccgcctcccggg---------t
B D                    Gibbon  cctccgcctcctgga---------t
B D                    Rhesus  cctccacctctcaga---------t
B D       Crab-eating macaque  cctccacctctcagg---------t
B D                    Baboon  cctccacctcccagg---------t
B D              Green monkey  cctctacctcccagg---------t
B D                  Marmoset  cctctgcctcgtggg---------t
B D           Squirrel monkey  cctctgcctcgtggg---------t
B D                  Bushbaby  cctcaaactcctggg---------c
       Lesser Egyptian jerboa  cctcgaactcatggt----------
B D           Chinese hamster  cctcaaactcacaga----------
               Golden hamster  cctctaactcacaga----------
          Cape elephant shrew  --------gtaagggagccctggt-
B D                   Manatee  ---------tatggg----------
B D                       Rat  =========================
                Prairie vole  =========================
B D                     Mouse  =========================
B D                      Pika  -------------------------
                Weddell seal  =========================
B D                  Hedgehog  =========================
B D                     Shrew  =========================
B D                Guinea pig  =========================
B D                       Pig  =========================
B D                    Rabbit  =========================
            Cape golden mole  =========================
                    Aardvark  =========================
B D                   Megabat  =========================
B D                   Dolphin  -------------------------
B D             X. tropicalis  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
  D              Mallard duck  =========================
          Tibetan ground jay  =========================
B D               Zebra finch  =========================
  D    White-throated sparrow  =========================
B D           Tasmanian devil  =========================
  D            Painted turtle  =========================
  D           Green seaturtle  =========================
B D        American alligator  =========================
  D             Scarlet macaw  =========================
B D                Budgerigar  =========================
B D                   Opossum  =========================
B D            Naked mole-rat  =========================
  D               Rock pigeon  =========================
  D       Collared flycatcher  =========================
B D       Medium ground finch  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
  D                    Parrot  =========================
            Brush-tailed rat  =========================
                  Chinchilla  -------------------------
          Chinese tree shrew  =========================
B D                  Platypus  =========================
B D                   Wallaby  =========================
B D                  Elephant  =========================
B D                    Tenrec  =========================
B D                       Cat  =========================
  D  Chinese softshell turtle  =========================
B D                   Ferret   =========================
             Star-nosed mole  -------------------------
               Domestic goat  -------------------------
B D                     Sheep  -------------------------
            Tibetan antelope  -------------------------
              Bactrian camel  -------------------------
B D                    Alpaca  -------------------------
              Pacific walrus  =========================
B D                     Panda  =========================
                Killer whale  -------------------------
B D                       Dog  =========================
            Black flying-fox  =========================
B D          White rhinoceros  =========================
B D                     Horse  -------------------------
B D                  Squirrel  -------------------------
B D                 Armadillo  -------------------------
        David's myotis (bat)  -------------------------
               Big brown bat  =========================
B D                  Microbat  -------------------------
B D                       Cow  -------------------------

Inserts between block 19 and 20 in window
         Cape elephant shrew 107bp

Alignment block 20 of 1259 in window, 11785830 - 11785866, 37 bps 
B D                     Human  tcaagtgattctcccgcctcagcttcctgagtagctg
B D                     Chimp  tcaagtgatcctcccgcctcagcttcctgagtagctg
B D                   Gorilla  tcaagtgatcctcccgcctcagcttcctgagtagctg
B D                 Orangutan  tcaagcgatcctcctgcctcagcttcctgagtagctg
B D                    Gibbon  tcaagcgatcctcccgcctcagcttcctgagtagctg
B D                    Rhesus  tcaagcgatcctcccacctcagcctcctgagtagctg
B D       Crab-eating macaque  tcaagcgatcctcccacctcagcctcctgagtagctg
B D                    Baboon  tcaagcgatcctcctacctcagcctcctgagtagctg
B D              Green monkey  tcaagcgatcctcccacctcagcctcctgagtagctg
B D                  Marmoset  tcaagcaattctcccgcctcagcctcctgaatagctg
B D           Squirrel monkey  tgaagcaattctcccgcctcagcctcctgagtagctg
B D                  Bushbaby  ttaagtgattctcttgcctcagcctcccaagtagct-
       Lesser Egyptian jerboa  ------gaccctcctacctctgcctcccgagt-gctg
B D           Chinese hamster  ------gatccacctgcctctgcctcctcagt-gctg
               Golden hamster  ------gatctgcctgcctctgcctccagagt-gctg
              Star-nosed mole  ---------------------gc------aggacccg
B D                   Manatee  -------------------cagtctccagactggcag
B D                       Rat  =====================================
                Prairie vole  =====================================
B D                     Mouse  =====================================
B D                      Pika  -------------------------------------
                Weddell seal  =====================================
B D                  Hedgehog  =====================================
B D                     Shrew  =====================================
B D                Guinea pig  =====================================
B D                       Pig  =====================================
B D                    Rabbit  =====================================
            Cape golden mole  =====================================
                    Aardvark  =====================================
B D                   Megabat  =====================================
B D                   Dolphin  -------------------------------------
B D             X. tropicalis  =====================================
B D                    Turkey  =====================================
B D                   Chicken  =====================================
  D              Mallard duck  =====================================
          Tibetan ground jay  =====================================
B D               Zebra finch  =====================================
  D    White-throated sparrow  =====================================
B D           Tasmanian devil  =====================================
  D            Painted turtle  =====================================
  D           Green seaturtle  =====================================
B D        American alligator  =====================================
  D             Scarlet macaw  =====================================
B D                Budgerigar  =====================================
B D                   Opossum  =====================================
B D            Naked mole-rat  =====================================
  D               Rock pigeon  =====================================
  D       Collared flycatcher  =====================================
B D       Medium ground finch  =====================================
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
  D                    Parrot  =====================================
            Brush-tailed rat  =====================================
                  Chinchilla  -------------------------------------
         Cape elephant shrew  =====================================
          Chinese tree shrew  =====================================
B D                  Platypus  =====================================
B D                   Wallaby  =====================================
B D                  Elephant  =====================================
B D                    Tenrec  =====================================
B D                       Cat  =====================================
  D  Chinese softshell turtle  =====================================
B D                   Ferret   =====================================
               Domestic goat  -------------------------------------
B D                     Sheep  -------------------------------------
            Tibetan antelope  -------------------------------------
              Bactrian camel  -------------------------------------
B D                    Alpaca  -------------------------------------
              Pacific walrus  =====================================
B D                     Panda  =====================================
                Killer whale  -------------------------------------
B D                       Dog  =====================================
            Black flying-fox  =====================================
B D          White rhinoceros  =====================================
B D                     Horse  -------------------------------------
B D                  Squirrel  -------------------------------------
B D                 Armadillo  -------------------------------------
        David's myotis (bat)  -------------------------------------
               Big brown bat  =====================================
B D                  Microbat  -------------------------------------
B D                       Cow  -------------------------------------

Inserts between block 20 and 21 in window
B D                  Manatee 195bp

Alignment block 21 of 1259 in window, 11785867 - 11785889, 23 bps 
B D                     Human  gga--------------------------ctacaa----gtg-------------------------cac
B D                     Chimp  gga--------------------------ctacag----gtg-------------------------cac
B D                   Gorilla  gga--------------------------ctaccg----gtg-------------------------cac
B D                 Orangutan  gga--------------------------ctacag----gtg-------------------------cac
B D                    Gibbon  gga--------------------------ctacag----gtg-------------------------cac
B D                    Rhesus  gga--------------------------ctacgg----gtg-------------------------cat
B D       Crab-eating macaque  gga--------------------------ctacgg----gtg-------------------------cat
B D                    Baboon  gga--------------------------ctacgg----gtg-------------------------cgt
B D              Green monkey  gga--------------------------ctacgg----gtg-------------------------cgt
B D                  Marmoset  gca--------------------------ctacag----gtg-------------------------tgc
B D           Squirrel monkey  gga--------------------------ctacag----gtg-------------------------cgc
B D                  Bushbaby  ------------------------------tatag----gta-------------------------ccc
       Lesser Egyptian jerboa  gga--------------------------ttaaag----gta-------------------------tgc
B D           Chinese hamster  gggtgcaccaccaccacctggcattttttttaaagagtggtatgcagagaaccaggaggctggcaagtgc
               Golden hamster  gga--------------------------ttaaag-gtggta--------------------gc-----c
              Star-nosed mole  ggg--------------------------ccac-------------------------------------
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                      Pika  ----------------------------------------------------------------------
                Weddell seal  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
B D                    Rabbit  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
B D                   Megabat  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
B D             X. tropicalis  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
B D            Naked mole-rat  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
               Domestic goat  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
            Tibetan antelope  ----------------------------------------------------------------------
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
              Pacific walrus  ======================================================================
B D                     Panda  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                       Dog  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ----------------------------------------------------------------------
B D                  Squirrel  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ======================================================================
B D                  Microbat  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------

                        Human  gccaccac
                        Chimp  gccaccac
                      Gorilla  gccaccac
                    Orangutan  gccaccac
                       Gibbon  gccaccac
                       Rhesus  gccaccac
          Crab-eating macaque  gccaccac
                       Baboon  gccaccac
                 Green monkey  gccaccac
                     Marmoset  accaccat
              Squirrel monkey  accaccat
                     Bushbaby  accacaac
       Lesser Egyptian jerboa  accaccat
              Chinese hamster  accaccaa
               Golden hamster  accacc--
              Star-nosed mole  --------
                          Rat  ========
                 Prairie vole  ========
                        Mouse  ========
                         Pika  --------
                 Weddell seal  ========
                     Hedgehog  ========
                        Shrew  ========
                   Guinea pig  ========
                          Pig  ========
                       Rabbit  ========
             Cape golden mole  ========
                     Aardvark  ========
                      Megabat  ========
                      Dolphin  --------
                X. tropicalis  ========
                       Turkey  ========
                      Chicken  ========
                 Mallard duck  ========
           Tibetan ground jay  ========
                  Zebra finch  ========
       White-throated sparrow  ========
              Tasmanian devil  ========
               Painted turtle  ========
              Green seaturtle  ========
           American alligator  ========
                Scarlet macaw  ========
                   Budgerigar  ========
                      Opossum  ========
               Naked mole-rat  ========
                  Rock pigeon  ========
          Collared flycatcher  ========
          Medium ground finch  ========
             Peregrine falcon  ========
                 Saker falcon  ========
                       Parrot  ========
             Brush-tailed rat  ========
                   Chinchilla  --------
          Cape elephant shrew  ========
           Chinese tree shrew  ========
                     Platypus  ========
                      Wallaby  ========
                      Manatee  ========
                     Elephant  ========
                       Tenrec  ========
                          Cat  ========
     Chinese softshell turtle  ========
                      Ferret   ========
                Domestic goat  --------
                        Sheep  --------
             Tibetan antelope  --------
               Bactrian camel  --------
                       Alpaca  --------
               Pacific walrus  ========
                        Panda  ========
                 Killer whale  --------
                          Dog  ========
             Black flying-fox  ========
             White rhinoceros  ========
                        Horse  --------
                     Squirrel  --------
                    Armadillo  --------
         David's myotis (bat)  --------
                Big brown bat  ========
                     Microbat  --------
                          Cow  --------

Alignment block 22 of 1259 in window, 11785890 - 11785896, 7 bps 
B D                     Human  gcct-----ggc
B D                     Chimp  gcct-----ggc
B D                   Gorilla  gcct-----ggc
B D                 Orangutan  gcct-----ggc
B D                    Gibbon  acct-----ggc
B D                    Rhesus  acct-----ggc
B D       Crab-eating macaque  acct-----ggc
B D                    Baboon  acct-----ggc
B D              Green monkey  acct-----ggc
B D                  Marmoset  gcct-----ggc
B D           Squirrel monkey  gccc-----ggc
B D                  Bushbaby  gcct-----ggt
       Lesser Egyptian jerboa  gcctggcgacac
B D           Chinese hamster  gctt-----cac
               Golden hamster  gccc-----gat
B D                   Ferret   gcct-----ggc
              Star-nosed mole  gccc-----cgc
B D                       Rat  ============
                Prairie vole  ============
B D                     Mouse  ============
B D                      Pika  ------------
                Weddell seal  ============
B D                  Hedgehog  ============
B D                     Shrew  ============
B D                Guinea pig  ============
B D                       Pig  ============
B D                    Rabbit  ============
            Cape golden mole  ============
                    Aardvark  ============
B D                   Megabat  ============
B D                   Dolphin  ------------
B D             X. tropicalis  ============
B D                    Turkey  ============
B D                   Chicken  ============
  D              Mallard duck  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
  D    White-throated sparrow  ============
B D           Tasmanian devil  ============
  D            Painted turtle  ============
  D           Green seaturtle  ============
B D        American alligator  ============
  D             Scarlet macaw  ============
B D                Budgerigar  ============
B D                   Opossum  ============
B D            Naked mole-rat  ============
  D               Rock pigeon  ============
  D       Collared flycatcher  ============
B D       Medium ground finch  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
  D                    Parrot  ============
            Brush-tailed rat  ============
                  Chinchilla  ------------
         Cape elephant shrew  ============
          Chinese tree shrew  ============
B D                  Platypus  ============
B D                   Wallaby  ============
B D                   Manatee  ============
B D                  Elephant  ============
B D                    Tenrec  ============
B D                       Cat  ============
  D  Chinese softshell turtle  ============
               Domestic goat  ------------
B D                     Sheep  ------------
            Tibetan antelope  ------------
              Bactrian camel  ------------
B D                    Alpaca  ------------
              Pacific walrus  ============
B D                     Panda  ============
                Killer whale  ------------
B D                       Dog  ============
            Black flying-fox  ============
B D          White rhinoceros  ============
B D                     Horse  ------------
B D                  Squirrel  ------------
B D                 Armadillo  ------------
        David's myotis (bat)  ------------
               Big brown bat  ============
B D                  Microbat  ------------
B D                       Cow  ------------

Alignment block 23 of 1259 in window, 11785897 - 11785904, 8 bps 
B D                     Human  taattttt-------
B D                     Chimp  taattttt-------
B D                   Gorilla  taattttt-------
B D                 Orangutan  taattttt-------
B D                    Gibbon  taattttt-------
B D                    Rhesus  taattttt-------
B D       Crab-eating macaque  taattttt-------
B D                    Baboon  taattttt-------
B D              Green monkey  taattttt-------
B D                  Marmoset  taattttt-------
B D           Squirrel monkey  taattttt-------
B D                  Bushbaby  tagttttt-------
B D                  Squirrel  taattttt-------
       Lesser Egyptian jerboa  tcattttt-------
B D           Chinese hamster  cagatctt-------
               Golden hamster  cctttttt-------
B D            Naked mole-rat  taatcgtt-------
B D                   Ferret   -------tggcttag
              Star-nosed mole  -------ta------
B D                       Rat  ===============
                Prairie vole  ===============
B D                     Mouse  ===============
B D                      Pika  ---------------
                Weddell seal  ===============
B D                  Hedgehog  ===============
B D                     Shrew  ===============
B D                Guinea pig  ===============
B D                       Pig  ===============
B D                    Rabbit  ===============
            Cape golden mole  ===============
                    Aardvark  ===============
B D                   Megabat  ===============
B D                   Dolphin  ---------------
B D             X. tropicalis  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
          Tibetan ground jay  ===============
B D               Zebra finch  ===============
  D    White-throated sparrow  ===============
B D           Tasmanian devil  ===============
  D            Painted turtle  ===============
  D           Green seaturtle  ===============
B D        American alligator  ===============
  D             Scarlet macaw  ===============
B D                Budgerigar  ===============
B D                   Opossum  ===============
  D               Rock pigeon  ===============
  D       Collared flycatcher  ===============
B D       Medium ground finch  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
  D                    Parrot  ===============
            Brush-tailed rat  ===============
                  Chinchilla  ---------------
         Cape elephant shrew  ===============
          Chinese tree shrew  ===============
B D                  Platypus  ===============
B D                   Wallaby  ===============
B D                   Manatee  ===============
B D                  Elephant  ===============
B D                    Tenrec  ===============
B D                       Cat  ===============
  D  Chinese softshell turtle  ===============
               Domestic goat  ---------------
B D                     Sheep  ---------------
            Tibetan antelope  ---------------
              Bactrian camel  ---------------
B D                    Alpaca  ---------------
              Pacific walrus  ===============
B D                     Panda  ===============
                Killer whale  ---------------
B D                       Dog  ===============
            Black flying-fox  ===============
B D          White rhinoceros  ===============
B D                     Horse  ---------------
B D                 Armadillo  ---------------
        David's myotis (bat)  ---------------
               Big brown bat  ===============
B D                  Microbat  ---------------
B D                       Cow  ---------------

Inserts between block 23 and 24 in window
      Lesser Egyptian jerboa 133bp
B D           Naked mole-rat 1bp

Alignment block 24 of 1259 in window, 11785905 - 11785905, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  g
B D                       Rat  =
                Prairie vole  =
              Golden hamster  -
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
                Weddell seal  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  -
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  =
B D                  Elephant  =
B D           Chinese hamster  -
B D                    Tenrec  =
B D                       Cat  =
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  =
B D                     Panda  =
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                  Squirrel  -
B D                 Armadillo  -
        David's myotis (bat)  -
               Big brown bat  =
B D                  Microbat  -
B D                       Cow  -

Inserts between block 24 and 25 in window
B D                 Bushbaby 136bp

Alignment block 25 of 1259 in window, 11785906 - 11785906, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D           Chinese hamster  a
               Golden hamster  t
B D            Naked mole-rat  t
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
                Weddell seal  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  -
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  =
B D                     Panda  =
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                  Squirrel  -
B D                 Armadillo  -
        David's myotis (bat)  -
               Big brown bat  =
B D                  Microbat  -
B D                       Cow  -

Alignment block 26 of 1259 in window, 11785907 - 11785907, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D                  Squirrel  g
B D           Chinese hamster  a
               Golden hamster  t
B D            Naked mole-rat  t
         David's myotis (bat)  a
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
                Weddell seal  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  -
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  =
B D                     Panda  =
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                 Armadillo  -
               Big brown bat  =
B D                  Microbat  -
B D                       Cow  -

Inserts between block 26 and 27 in window
B D                 Squirrel 2bp
B D          Chinese hamster 1bp
              Golden hamster 1bp

Alignment block 27 of 1259 in window, 11785908 - 11785917, 10 bps 
B D                     Human  tttttagtag
B D                     Chimp  tttttagtag
B D                   Gorilla  tttttagtag
B D                 Orangutan  ttttcagtag
B D                    Gibbon  tttttagtag
B D                    Rhesus  tgtttagtag
B D       Crab-eating macaque  tttttagtag
B D                    Baboon  tttttagtag
B D              Green monkey  tttttagtag
B D                  Marmoset  tttttagtag
B D           Squirrel monkey  tttttagtag
B D                  Bushbaby  tttt---tag
B D           Chinese hamster  --ttcagtta
               Golden hamster  --ttttttta
B D                    Alpaca  ttctcattag
B D                   Ferret   ---tcggtgg
         David's myotis (bat)  ttctttgtgg
B D                       Rat  ==========
                Prairie vole  ==========
B D                     Mouse  ==========
      Lesser Egyptian jerboa  ==========
B D                      Pika  ----------
                Weddell seal  ==========
B D                  Hedgehog  ==========
B D                     Shrew  ==========
B D                Guinea pig  ==========
B D                       Pig  ==========
B D                    Rabbit  ==========
            Cape golden mole  ==========
                    Aardvark  ==========
B D                   Megabat  ==========
B D                   Dolphin  ----------
B D             X. tropicalis  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
  D    White-throated sparrow  ==========
B D           Tasmanian devil  ==========
  D            Painted turtle  ==========
  D           Green seaturtle  ==========
B D        American alligator  ==========
  D             Scarlet macaw  ==========
B D                Budgerigar  ==========
B D                   Opossum  ==========
B D            Naked mole-rat  ----------
  D               Rock pigeon  ==========
  D       Collared flycatcher  ==========
B D       Medium ground finch  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D                    Parrot  ==========
            Brush-tailed rat  ==========
                  Chinchilla  ----------
         Cape elephant shrew  ==========
          Chinese tree shrew  ==========
B D                  Platypus  ==========
B D                   Wallaby  ==========
B D                   Manatee  ==========
B D                  Elephant  ==========
B D                    Tenrec  ==========
B D                       Cat  ==========
  D  Chinese softshell turtle  ==========
             Star-nosed mole  ----------
               Domestic goat  ----------
B D                     Sheep  ----------
            Tibetan antelope  ----------
              Bactrian camel  ----------
              Pacific walrus  ==========
B D                     Panda  ==========
                Killer whale  ----------
B D                       Dog  ==========
            Black flying-fox  ==========
B D          White rhinoceros  ==========
B D                     Horse  ----------
B D                  Squirrel  ==========
B D                 Armadillo  ----------
               Big brown bat  ==========
B D                  Microbat  ----------
B D                       Cow  ----------

Alignment block 28 of 1259 in window, 11785918 - 11785918, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D           Chinese hamster  c
               Golden hamster  a
B D                    Alpaca  a
B D                   Ferret   a
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
                Weddell seal  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  -
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
  D  Chinese softshell turtle  =
             Star-nosed mole  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
              Pacific walrus  =
B D                     Panda  =
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                  Squirrel  =
B D                 Armadillo  -
        David's myotis (bat)  -
               Big brown bat  =
B D                  Microbat  -
B D                       Cow  -

Alignment block 29 of 1259 in window, 11785919 - 11785927, 9 bps 
B D                     Human  gacggggt----------------------t
B D                     Chimp  --cggggt----------------------t
B D                   Gorilla  gacagggt----------------------t
B D                 Orangutan  gacggggt----------------------t
B D                    Gibbon  gacggggt----------------------t
B D                    Rhesus  gacggggt----------------------t
B D       Crab-eating macaque  gacggggt----------------------t
B D                    Baboon  gacggggt----------------------t
B D              Green monkey  gacagggt----------------------t
B D                  Marmoset  --tggggt----------------------t
B D           Squirrel monkey  --cggggt----------------------t
B D                  Bushbaby  aatagggt----------------------c
B D           Chinese hamster  agcatggt----------------------t
               Golden hamster  agagtggtatgcagagaacttggaggcttgc
B D                   Ferret   gcatggga----------------------c
              Star-nosed mole  ----ggga----------------------g
B D                       Rat  ===============================
                Prairie vole  ===============================
B D                     Mouse  ===============================
      Lesser Egyptian jerboa  ===============================
B D                      Pika  -------------------------------
                Weddell seal  ===============================
B D                  Hedgehog  ===============================
B D                     Shrew  ===============================
B D                Guinea pig  ===============================
B D                       Pig  ===============================
B D                    Rabbit  ===============================
            Cape golden mole  ===============================
                    Aardvark  ===============================
B D                   Megabat  ===============================
B D                   Dolphin  -------------------------------
B D             X. tropicalis  ===============================
B D                    Turkey  ===============================
B D                   Chicken  ===============================
  D              Mallard duck  ===============================
          Tibetan ground jay  ===============================
B D               Zebra finch  ===============================
  D    White-throated sparrow  ===============================
B D           Tasmanian devil  ===============================
  D            Painted turtle  ===============================
  D           Green seaturtle  ===============================
B D        American alligator  ===============================
  D             Scarlet macaw  ===============================
B D                Budgerigar  ===============================
B D                   Opossum  ===============================
B D            Naked mole-rat  -------------------------------
  D               Rock pigeon  ===============================
  D       Collared flycatcher  ===============================
B D       Medium ground finch  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
  D                    Parrot  ===============================
            Brush-tailed rat  ===============================
                  Chinchilla  -------------------------------
         Cape elephant shrew  ===============================
          Chinese tree shrew  ===============================
B D                  Platypus  ===============================
B D                   Wallaby  ===============================
B D                   Manatee  ===============================
B D                  Elephant  ===============================
B D                    Tenrec  ===============================
B D                       Cat  ===============================
  D  Chinese softshell turtle  ===============================
               Domestic goat  -------------------------------
B D                     Sheep  -------------------------------
            Tibetan antelope  -------------------------------
              Bactrian camel  -------------------------------
B D                    Alpaca  -------------------------------
              Pacific walrus  ===============================
B D                     Panda  ===============================
                Killer whale  -------------------------------
B D                       Dog  ===============================
            Black flying-fox  ===============================
B D          White rhinoceros  ===============================
B D                     Horse  -------------------------------
B D                  Squirrel  ===============================
B D                 Armadillo  -------------------------------
        David's myotis (bat)  -------------------------------
               Big brown bat  ===============================
B D                  Microbat  -------------------------------
B D                       Cow  -------------------------------

Inserts between block 29 and 30 in window
B D          Chinese hamster 24bp
              Golden hamster 31bp

Alignment block 30 of 1259 in window, 11785928 - 11785981, 54 bps 
B D                     Human  tcaccatattgcccaagctgg------tctc-ga---------actcctgaactcaagtgatcctcccac
B D                     Chimp  tcaccatattgcccaagctgg------tctc-ga---------actcctgaactcaagtgatcctcccac
B D                   Gorilla  tcaccatattgcccaagctgg------tctc-ga---------actcctgaactcaagtgatcctcccac
B D                 Orangutan  tcaccatattgcccaagctgg------tctc-ga---------actcctgaactcaagtgatcctcccac
B D                    Gibbon  tcaccatattgcccaagctgg------tctc-ga---------actcctgaactcaagtgatcctcccac
B D                    Rhesus  tcaccatattgcccaagctgg------tctc-ga---------actcctgaattcaagtgatcctcccac
B D       Crab-eating macaque  tcaccatattgcccaagctgg------tctc-ga---------actcctgaattcaagtgatcctcccac
B D                    Baboon  tcaccatattgcccaagctgg------tctc-aa---------actcctgaattcaagtgatcctcccac
B D              Green monkey  tcaccatattgcccaagctgg------tctc-ga---------actcctgaattcaagtgatcctcccac
B D                  Marmoset  tcaccatgttgtccaagctgg------tctc-aa---------actcctgacctcaagtgatcttcccac
B D           Squirrel monkey  acaccatgttgtctaagctgg------tctc-aa---------actcctgacctcaagcgatcctcccac
B D                  Bushbaby  ttgc--tgtgggttaggctgg------tcttaga---------actggtgagctcaggcaatctacccgc
B D           Chinese hamster  attctagagggcctgagttcggg----tccc-ag---------aacccacatccggagacttacaaccct
               Golden hamster  tcaccaga--tcttaaattcagt----taca-gc---------agtctggggctggagagatggttccat
B D            Naked mole-rat  ----------------ttttaat----tgga-aa---------aatt---------aaatatg-------
B D                      Pika  tcacccaa--tacccaccttggtgccatgca-ga---------accccctccccacacataca-------
B D                   Ferret   tctcga---------------------tctc-ag---------ggttgtgagttcaagc-----------
              Star-nosed mole  tcaaca---------------------ccta-agctggggcccaggcgcagcctcagac-----------
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
                Weddell seal  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
B D                    Rabbit  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
B D                   Megabat  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
B D             X. tropicalis  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
               Domestic goat  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
            Tibetan antelope  ----------------------------------------------------------------------
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
              Pacific walrus  ======================================================================
B D                     Panda  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                       Dog  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ======================================================================
B D                  Microbat  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------

Alignment block 31 of 1259 in window, 11785982 - 11785992, 11 bps 
B D                     Human  ctcgac--------------ttccc
B D                     Chimp  ctcgac--------------ttccc
B D                   Gorilla  ctcgac--------------ttccc
B D                 Orangutan  ctcgac--------------ttccc
B D                    Gibbon  ctcaac--------------ttccc
B D                    Rhesus  ctcgac--------------ttccc
B D       Crab-eating macaque  ctcgac--------------ttccc
B D                    Baboon  ctcgac--------------tttcc
B D              Green monkey  ctcgac--------------ttccc
B D                  Marmoset  ctcgac--------------ctccc
B D           Squirrel monkey  ctggac--------------ctccc
B D                  Bushbaby  cttggc--------------ctccc
B D           Chinese hamster  gcgaag--------------ctcca
               Golden hamster  ggtaaagagtactagctgctcttct
               Pacific walrus  ------------------------c
              Star-nosed mole  --------------------cagac
B D                       Rat  =========================
                Prairie vole  =========================
B D                     Mouse  =========================
      Lesser Egyptian jerboa  =========================
B D                      Pika  -------------------------
                Weddell seal  =========================
B D                  Hedgehog  =========================
B D                     Shrew  =========================
B D                Guinea pig  =========================
B D                       Pig  =========================
B D                    Rabbit  =========================
            Cape golden mole  =========================
                    Aardvark  =========================
B D                   Megabat  =========================
B D                   Dolphin  -------------------------
B D             X. tropicalis  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
  D              Mallard duck  =========================
          Tibetan ground jay  =========================
B D               Zebra finch  =========================
  D    White-throated sparrow  =========================
B D           Tasmanian devil  =========================
  D            Painted turtle  =========================
  D           Green seaturtle  =========================
B D        American alligator  =========================
  D             Scarlet macaw  =========================
B D                Budgerigar  =========================
B D                   Opossum  =========================
B D            Naked mole-rat  -------------------------
  D               Rock pigeon  =========================
  D       Collared flycatcher  =========================
B D       Medium ground finch  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
  D                    Parrot  =========================
            Brush-tailed rat  =========================
                  Chinchilla  -------------------------
         Cape elephant shrew  =========================
          Chinese tree shrew  =========================
B D                  Platypus  =========================
B D                   Wallaby  =========================
B D                   Manatee  =========================
B D                  Elephant  =========================
B D                    Tenrec  =========================
B D                       Cat  =========================
  D  Chinese softshell turtle  =========================
B D                   Ferret   -------------------------
               Domestic goat  -------------------------
B D                     Sheep  -------------------------
            Tibetan antelope  -------------------------
              Bactrian camel  -------------------------
B D                    Alpaca  -------------------------
B D                     Panda  =========================
                Killer whale  -------------------------
B D                       Dog  =========================
            Black flying-fox  =========================
B D          White rhinoceros  =========================
B D                     Horse  -------------------------
B D                  Squirrel  =========================
B D                 Armadillo  -------------------------
        David's myotis (bat)  -------------------------
               Big brown bat  =========================
B D                  Microbat  -------------------------
B D                       Cow  -------------------------

Alignment block 32 of 1259 in window, 11785993 - 11786029, 37 bps 
B D                     Human  aaag-------------------------tgctgggattacaggtgtgagccaccgcgccag
B D                     Chimp  aaag-------------------------tgctgggattacaggtgtgagccaccgtgccag
B D                   Gorilla  aaagtgctgggattacaggnnnnnnnnnntgctgggattacaggtgtgagccaccgcgccag
B D                 Orangutan  aaag-------------------------tgctgggattacaggtgtgagccactgcgccag
B D                    Gibbon  aaag-------------------------tgctgggattacaggtgtgagccactgcgccag
B D                    Rhesus  aaag-------------------------tgctgggattacaggtgtgagccactgcaccag
B D       Crab-eating macaque  aaag-------------------------tgctgggattacaggtgtgagccactgcaccag
B D                    Baboon  aaag-------------------------tgctgggattacaggtgtgagccactgcaccag
B D              Green monkey  aaag-------------------------tgctgggattacaggtgtgagccactgcaccag
B D                  Marmoset  aaag-------------------------tgctgagattacaggtgtgagccactgcacctg
B D           Squirrel monkey  aaag-------------------------tgctgggattacaggtgtgagccactgcacctg
B D                  Bushbaby  agag-------------------------tgctaggattacgggcctgagccactgtaccca
B D           Chinese hamster  gggg-------------------------gatctgactca-------gg--ccctgttctga
               Golden hamster  agag-------------------------gacctgagtta-------gggtcccagcaccca
B D                      Pika  ---------------------------------------------------cacagcagcag
B D                   Ferret   ---------------------------------------------------------cccat
               Pacific walrus  tcga-------------------------tctcggggttgt------gagttcgagctccat
              Star-nosed mole  aggt-------------------------tcccggggcagta-----gtgatcc---ctcaa
          Cape elephant shrew  aatc-------------------------tgctggagagtcagttatggg------------
B D                       Rat  ==============================================================
                Prairie vole  ==============================================================
B D                     Mouse  ==============================================================
      Lesser Egyptian jerboa  ==============================================================
                Weddell seal  ==============================================================
B D                  Hedgehog  ==============================================================
B D                     Shrew  ==============================================================
B D                Guinea pig  ==============================================================
B D                       Pig  ==============================================================
B D                    Rabbit  ==============================================================
            Cape golden mole  ==============================================================
                    Aardvark  ==============================================================
B D                   Megabat  ==============================================================
B D                   Dolphin  --------------------------------------------------------------
B D             X. tropicalis  ==============================================================
B D                    Turkey  ==============================================================
B D                   Chicken  ==============================================================
  D              Mallard duck  ==============================================================
          Tibetan ground jay  ==============================================================
B D               Zebra finch  ==============================================================
  D    White-throated sparrow  ==============================================================
B D           Tasmanian devil  ==============================================================
  D            Painted turtle  ==============================================================
  D           Green seaturtle  ==============================================================
B D        American alligator  ==============================================================
  D             Scarlet macaw  ==============================================================
B D                Budgerigar  ==============================================================
B D                   Opossum  ==============================================================
B D            Naked mole-rat  --------------------------------------------------------------
  D               Rock pigeon  ==============================================================
  D       Collared flycatcher  ==============================================================
B D       Medium ground finch  ==============================================================
  D          Peregrine falcon  ==============================================================
  D              Saker falcon  ==============================================================
  D                    Parrot  ==============================================================
            Brush-tailed rat  ==============================================================
                  Chinchilla  --------------------------------------------------------------
          Chinese tree shrew  ==============================================================
B D                  Platypus  ==============================================================
B D                   Wallaby  ==============================================================
B D                   Manatee  ==============================================================
B D                  Elephant  ==============================================================
B D                    Tenrec  ==============================================================
B D                       Cat  ==============================================================
  D  Chinese softshell turtle  ==============================================================
               Domestic goat  --------------------------------------------------------------
B D                     Sheep  --------------------------------------------------------------
            Tibetan antelope  --------------------------------------------------------------
              Bactrian camel  --------------------------------------------------------------
B D                    Alpaca  --------------------------------------------------------------
B D                     Panda  ==============================================================
                Killer whale  --------------------------------------------------------------
B D                       Dog  ==============================================================
            Black flying-fox  ==============================================================
B D          White rhinoceros  ==============================================================
B D                     Horse  --------------------------------------------------------------
B D                  Squirrel  ==============================================================
B D                 Armadillo  --------------------------------------------------------------
        David's myotis (bat)  --------------------------------------------------------------
               Big brown bat  ==============================================================
B D                  Microbat  --------------------------------------------------------------
B D                       Cow  --------------------------------------------------------------

Alignment block 33 of 1259 in window, 11786030 - 11786032, 3 bps 
B D                     Human  gcc
B D                     Chimp  gcc
B D                   Gorilla  gcc
B D                 Orangutan  gcc
B D                    Gibbon  gcc
B D                    Rhesus  gtc
B D       Crab-eating macaque  gtc
B D                    Baboon  atc
B D              Green monkey  gtc
B D                  Marmoset  gcc
B D           Squirrel monkey  gcc
B D                  Bushbaby  gcc
B D           Chinese hamster  ctt
               Golden hamster  cat
B D                      Pika  tc-
B D                   Ferret   gtt
               Pacific walrus  gtt
              Star-nosed mole  gtc
B D                  Elephant  ttt
B D                   Manatee  gtt
B D                       Rat  ===
                Prairie vole  ===
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
                Weddell seal  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                Guinea pig  ===
B D                       Pig  ===
B D                    Rabbit  ===
            Cape golden mole  ===
                    Aardvark  ===
B D                   Megabat  ===
B D                   Dolphin  ---
B D             X. tropicalis  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
B D            Naked mole-rat  ---
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Brush-tailed rat  ===
                  Chinchilla  ---
         Cape elephant shrew  ---
          Chinese tree shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D                    Tenrec  ===
B D                       Cat  ===
  D  Chinese softshell turtle  ===
               Domestic goat  ---
B D                     Sheep  ---
            Tibetan antelope  ---
              Bactrian camel  ---
B D                    Alpaca  ---
B D                     Panda  ===
                Killer whale  ---
B D                       Dog  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
B D                     Horse  ---
B D                  Squirrel  ===
B D                 Armadillo  ---
        David's myotis (bat)  ---
               Big brown bat  ===
B D                  Microbat  ---
B D                       Cow  ---

Inserts between block 33 and 34 in window
B D          Chinese hamster 44bp
              Golden hamster 11bp

Alignment block 34 of 1259 in window, 11786033 - 11786034, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Squirrel  aa
B D           Chinese hamster  aa
               Golden hamster  aa
B D                      Pika  aa
B D                   Ferret   -g
               Pacific walrus  -g
              Star-nosed mole  -a
B D                  Elephant  aa
B D                   Manatee  ag
B D                       Rat  ==
                Prairie vole  ==
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
                Weddell seal  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                       Pig  ==
B D                    Rabbit  ==
            Cape golden mole  ==
                    Aardvark  ==
B D                   Megabat  ==
B D                   Dolphin  --
B D             X. tropicalis  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
B D            Naked mole-rat  --
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Brush-tailed rat  ==
                  Chinchilla  --
         Cape elephant shrew  --
          Chinese tree shrew  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D                    Tenrec  ==
B D                       Cat  ==
B D                  Bushbaby  --
  D  Chinese softshell turtle  ==
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
              Bactrian camel  --
B D                    Alpaca  --
B D                     Panda  ==
                Killer whale  --
B D                       Dog  ==
            Black flying-fox  ==
B D          White rhinoceros  ==
B D                     Horse  --
B D                 Armadillo  --
        David's myotis (bat)  --
               Big brown bat  ==
B D                  Microbat  --
B D                       Cow  --

Inserts between block 34 and 35 in window
B D                 Squirrel 2bp
B D                     Pika 2bp
B D                  Ferret  1bp
              Pacific walrus 1bp

Alignment block 35 of 1259 in window, 11786035 - 11786035, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                   Dolphin  g
B D                   Ferret   g
               Pacific walrus  g
B D                  Elephant  g
B D                   Manatee  g
B D                       Rat  =
                Prairie vole  =
              Golden hamster  -
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
                Weddell seal  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
B D                   Megabat  =
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  -
         Cape elephant shrew  -
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D           Chinese hamster  -
B D                    Tenrec  =
B D                       Cat  =
B D                  Bushbaby  -
  D  Chinese softshell turtle  =
             Star-nosed mole  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
B D                     Panda  =
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                  Squirrel  =
B D                 Armadillo  -
        David's myotis (bat)  -
               Big brown bat  =
B D                  Microbat  -
B D                       Cow  -

Inserts between block 35 and 36 in window
B D                   Rhesus 2bp
B D      Crab-eating macaque 1bp

Alignment block 36 of 1259 in window, 11786036 - 11786036, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Elephant  t
B D                   Manatee  t
B D                       Rat  =
                Prairie vole  =
              Golden hamster  -
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
                Weddell seal  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
B D                   Megabat  =
B D                   Dolphin  -
B D              Green monkey  -
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  -
         Cape elephant shrew  -
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D           Chinese hamster  -
B D                    Tenrec  =
B D                       Cat  =
B D                  Bushbaby  -
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  -
B D                     Panda  =
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  -
B D                  Squirrel  =
B D                 Armadillo  -
        David's myotis (bat)  -
               Big brown bat  =
B D                  Microbat  -
B D                       Cow  -

Alignment block 37 of 1259 in window, 11786037 - 11786038, 2 bps