Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 836 in window, 232137 - 232150, 14 bps 
B D                Human  aagttgggtggaag
B D               Gibbon  aagttgggtggaaa
B D  Crab-eating macaque  aagt----tggaag
B D               Baboon  aagt----tggaag
B D         Green monkey  aagt----tggaag
B D             Marmoset  atgttgggtggaag
B D      Squirrel monkey  atgtcggctggaag
      Chinese tree shrew  aacttaa-caggga
B D              Dolphin  aagccccgaggaag
            Killer whale  aagccccgaggaag
B D     White rhinoceros  aagcacggaggacg
B D                  Dog  -ttcccaactggcg
        Black flying-fox  aagtaggggggaag
B D              Megabat  aaatagggtgggat
B D             Bushbaby  ==============
         Pacific walrus  ==============
B D                Chimp  ==============
B D              Gorilla  ==============
B D               Rhesus  NNNNNNNNNNNNNN
B D                  Pig  ==============
B D            Orangutan  NNNNNNNNNNNNNN

Alignment block 2 of 836 in window, 232151 - 232153, 3 bps 
B D                Human  cag
B D               Gibbon  cag
B D  Crab-eating macaque  cag
B D               Baboon  cag
B D         Green monkey  cag
B D             Marmoset  cag
B D      Squirrel monkey  cag
      Chinese tree shrew  cag
B D              Dolphin  cag
            Killer whale  cag
B D                  Cow  cgg
B D     White rhinoceros  cag
B D                  Dog  c--
        Black flying-fox  cag
B D              Megabat  cag
B D             Bushbaby  ===
         Pacific walrus  ===
B D                Chimp  ===
B D              Gorilla  ===
B D               Rhesus  NNN
B D                  Pig  ===
B D            Orangutan  NNN

Inserts between block 2 and 3 in window
B D                 Dog 16bp

Alignment block 3 of 836 in window, 232154 - 232154, 1 bps 
B D                Human  c
B D               Gibbon  t
B D  Crab-eating macaque  c
B D               Baboon  c
B D         Green monkey  c
B D             Marmoset  c
B D      Squirrel monkey  c
      Chinese tree shrew  a
B D              Dolphin  c
            Killer whale  c
B D                  Cow  c
B D              Megabat  -
B D                  Dog  =
       Black flying-fox  -
B D             Bushbaby  =
         Pacific walrus  =
B D     White rhinoceros  -
B D                Chimp  =
B D              Gorilla  =
B D               Rhesus  N
B D                  Pig  =
B D            Orangutan  N

Alignment block 4 of 836 in window, 232155 - 232228, 74 bps 
B D                Human  g---------cggacc-ca----------cgg-----------------cacaccgaacgcactccaa--
B D               Gibbon  g---------cggcct-ca----------cag-----------------cgcacccaacgcactcaaa--
B D  Crab-eating macaque  g---------cgcccc-ca----------cgg-----------------tgcactgaacgcactcaaa--
B D               Baboon  gc--------cccccc-cg----------cgg-----------------tgcactgaacgcactcaaa--
B D         Green monkey  g---------cgcccc-ca----------cgg-----------------tgcaccgaacgcactcaaa--
B D             Marmoset  g---------cggccc-ca----------cgg-----------------agcaccgcaggcagtcaaa--
B D      Squirrel monkey  g---------cggccc-ca----------ggg-----------------tgcaccgaaggcaggcaaa--
      Chinese tree shrew  gctcagtgttcaacct-ca----------gggcctcaaaactgagctcttacctcgaactgcctgaaa--
B D               Alpaca  ---------gccgact-cc----------cgg-----------------gacacc-ccacggaacaga--
B D              Dolphin  ----------ccggct-cc----------ccg-----------------gacacc-agcctaataaaa--
            Killer whale  ----------ccggct-cc----------ccg-----------------gacacc-agccgaatcaaa--
B D                  Cow  ----------gggaac-cc----------gcg-----------------gagggc-agggcggggggagt
B D     White rhinoceros  ---------ccgggat-cc----------cgg-----------------aaccccaaagccacgcaaa--
B D                  Dog  ---------cccgccc-ccacggtgacgtccc-----------------ggcccc--ggccccgc-----
          Pacific walrus  ---------cccgccc-cc----------cgc-----------------cgctcc--ggccacgc-----
        Black flying-fox  ---------cccggccgca----------cgg-----------------gacgccaaagcgattcaga--
B D              Megabat  ---------cggggcc-ca----------ctg-----------------gacctgcaacacacccctg--
B D             Bushbaby  ======================================================================
B D                Chimp  ======================================================================
B D              Gorilla  ======================================================================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Pig  ======================================================================
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  -------ca--gaacccga-----cgcagacacgcgctttcaa-ccggcggagacact----
                  Gibbon  -------ca--gaacccga-----cgcagacacgcgctttcag-ccggcggagacact----
     Crab-eating macaque  -------ca--gaaccgga-----cgcagacacgcgctttcagcccaggggaaaaact----
                  Baboon  -------ca--gaaccgga-----cgcagacacgggctttcagcccaggggaaaaact----
            Green monkey  -------ca--gaaccgga-----cgcagacacgcgctttcagcccaggggaaaaact----
                Marmoset  -------gg--aaaccgga-----cgcagactcgcgctttcagccaggcggggagaca----
         Squirrel monkey  -------cg--aaagcgga-----cgcacacaggcgctctcggccgagcgggcagaca----
      Chinese tree shrew  -------cagggaagctga-----cgttgatccgaa---gcagcacagcagacagctc----
                  Alpaca  ------------------------agccgagacatgaggtgtgtcgggctgaaggacccgca
                 Dolphin  -------cg--cacccaaa-----cgctgaggctggaggtgtgtccggccggggtaggggct
            Killer whale  -------cg--cacccaaa-----cgctgaggatggaggtgtgttcggccggggtaggggct
                     Cow  ctccggccg--cgcccacaatgtccaccgaga--ggacacgccccacaccgctccagccgcc
        White rhinoceros  -------cg--aagccaga-----agtgtaagcttgacgcgtgttgagcgcaa---------
                     Dog  --------------------------------ctctccgc----tgacgtcca---------
          Pacific walrus  --------------------------------cccccctc----------------------
        Black flying-fox  -------ca--gatgcaag-----cccggaggccctaggtgcgcgtggtggga---------
                 Megabat  -------ca--gacgcaaa-----ctcggagactcaagtt-----ctgtggtc---------
                Bushbaby  ==============================================================
                   Chimp  ==============================================================
                 Gorilla  ==============================================================
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Pig  ==============================================================
               Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 5 of 836 in window, 232229 - 232248, 20 bps 
B D                Human  ggca-----ggg------ccagaaacgcgcg
B D               Gibbon  ggca-----ggg------ccagaaacgcgcg
B D  Crab-eating macaque  ggca-----ggg------tcggaaaagcaag
B D               Baboon  ggca-----ggg------tcggaaacgcacg
B D         Green monkey  ggca-----ggg------tcagaaacgcacg
B D             Marmoset  ggaa-----gtg------ccgaaaacgcggg
B D      Squirrel monkey  ccga-----ggg------ccgacagcgcgcg
      Chinese tree shrew  caaa-----ggg------acacagacggatt
B D                  Pig  ggaggggccgac------ctcgg-gcggcg-
B D               Alpaca  ---------gag------ccgga-gcggcc-
B D              Dolphin  ---------gac------ccggaaacggcc-
            Killer whale  ---------gac------ccggaaacggcc-
B D                  Cow  ---------caccgcgctcaggacacgccc-
B D     White rhinoceros  ggcgggtcagat------ctgcaaagggtc-
B D                  Dog  ggc--------c------ccgcaacccgtg-
          Pacific walrus  ggc--------t------acgtcacacgct-
        Black flying-fox  ggcggggcctac------ccggaagagccc-
B D              Megabat  agcagcacacac------tcggaaacgcct-
B D             Bushbaby  ===============================
B D                Chimp  ===============================
B D              Gorilla  ===============================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 5 and 6 in window
B D                 Pig 1bp
B D              Alpaca 1bp
B D             Dolphin 1bp
           Killer whale 1bp
B D                 Cow 1bp
B D                 Dog 29bp
         Pacific walrus 36bp
       Black flying-fox 1bp
B D             Megabat 1bp

Alignment block 6 of 836 in window, 232249 - 232271, 23 bps 
B D                Human  c---agcgggggcgggaggtcggtaa-----
B D               Gibbon  c---cgcggaggcgggaagtcaggaa-----
B D  Crab-eating macaque  c---agcgcgtgcgggagctcagaat-----
B D               Baboon  c---ggcgggggcgggagctcagaat-----
B D         Green monkey  c---ggcgggggcgggagctcagaat-----
B D             Marmoset  -----gcg-aggcggaagcttaggat-----
B D      Squirrel monkey  -----gcg-aggcggaagctcaggat-----
      Chinese tree shrew  ccaacgccaagaccggagttgggcag-----
B D                  Pig  ---------gg--------acggggcggggc
B D               Alpaca  ---------gggtggggcggtggggcggggc
B D              Dolphin  ---------gg-------agctgggcggga-
            Killer whale  ---------gg-------agctgggcggga-
B D                  Cow  ---------t---------cctgggcg----
        Black flying-fox  ---------------------ggg-cggggc
B D              Megabat  ---------------------gggaccaagc
B D                  Dog  ===============================
B D             Bushbaby  ===============================
         Pacific walrus  ===============================
B D     White rhinoceros  -------------------------------
B D                Chimp  ===============================
B D              Gorilla  ===============================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 6 and 7 in window
     Chinese tree shrew 6bp
B D                 Pig 2bp
B D              Alpaca 2bp
B D             Dolphin 2bp
           Killer whale 2bp
B D                 Cow 2bp
       Black flying-fox 9bp
B D             Megabat 13bp

Alignment block 7 of 836 in window, 232272 - 232274, 3 bps 
B D                Human  gc-t
B D               Gibbon  gcgt
B D  Crab-eating macaque  gc-g
B D               Baboon  gc-g
B D         Green monkey  gc-g
B D             Marmoset  gc-g
B D      Squirrel monkey  gc-g
B D             Bushbaby  gc-t
      Chinese tree shrew  ga-g
B D                  Pig  gc-c
B D               Alpaca  gc-t
B D              Dolphin  gc-t
            Killer whale  gc-t
B D                  Cow  gc-c
B D                  Cat  gc-t
        Black flying-fox  gc-n
B D              Megabat  g---
B D                  Dog  ====
         Pacific walrus  ====
B D     White rhinoceros  ----
B D                Chimp  ====
B D              Gorilla  ====
B D               Rhesus  NNNN
B D            Orangutan  NNNN

Inserts between block 7 and 8 in window
       Black flying-fox 30bp

Alignment block 8 of 836 in window, 232275 - 232276, 2 bps 
B D                Human  cc
B D               Gibbon  cc
B D  Crab-eating macaque  cc
B D               Baboon  cc
B D         Green monkey  cc
B D             Marmoset  cc
B D             Bushbaby  cc
      Chinese tree shrew  gt
B D                  Pig  -c
B D               Alpaca  -c
B D              Dolphin  -c
            Killer whale  -c
B D                  Cow  -t
B D     White rhinoceros  cc
B D                  Cat  -c
B D                  Dog  cc
B D              Ferret   cc
        Black flying-fox  -c
B D              Megabat  --
B D      Squirrel monkey  --
         Pacific walrus  ==
B D                Chimp  ==
B D              Gorilla  ==
B D               Rhesus  NN
B D            Orangutan  NN

Inserts between block 8 and 9 in window
B D                 Pig 10bp
B D              Alpaca 14bp
B D                 Cow 1bp
B D    White rhinoceros 17bp
B D                 Cat 29bp
B D                 Dog 10bp
B D             Ferret  14bp
       Black flying-fox 1bp

Alignment block 9 of 836 in window, 232277 - 232286, 10 bps 
B D                Human  ccgcccctgc
B D               Gibbon  ccgcccctgc
B D  Crab-eating macaque  ctgcctcggc
B D               Baboon  ctgcccctgc
B D         Green monkey  ctgcccctgc
B D             Marmoset  ccgccccttc
B D             Bushbaby  ccagctctgc
      Chinese tree shrew  acagcccaga
B D     White rhinoceros  tcgcccttcc
B D                  Cat  ccgcccctcc
B D                  Dog  tcgccctccc
B D              Ferret   acgctctccc
          Pacific walrus  tcgcactccc
            Weddell seal  tcgcactccc
        Black flying-fox  --------cc
B D               Alpaca  ==========
B D              Megabat  ----------
B D                  Cow  ==========
           Killer whale  ----------
B D      Squirrel monkey  ----------
B D              Dolphin  ----------
B D                Chimp  ==========
B D              Gorilla  ==========
B D               Rhesus  NNNNNNNNNN
B D                  Pig  ==========
B D            Orangutan  NNNNNNNNNN

Alignment block 10 of 836 in window, 232287 - 232293, 7 bps 
B D                Human  ccg-agac
B D               Gibbon  ccg-agac
B D  Crab-eating macaque  ccg-agac
B D               Baboon  ccg-agac
B D         Green monkey  ccg-agac
B D             Marmoset  ccg-agac
B D      Squirrel monkey  -------c
B D             Bushbaby  tcg-aggc
      Chinese tree shrew  ccc-acgc
B D                  Pig  cag-aata
B D               Alpaca  cca-cgcc
B D              Dolphin  ----aggc
            Killer whale  ----aggc
        Tibetan antelope  ccg-aggc
B D                  Cow  ccg-aggc
B D                Sheep  ccg-aggc
B D     White rhinoceros  -ta--ggc
B D                  Cat  gcagacgt
B D                  Dog  -ca--ggc
B D              Ferret   gca-cggc
          Pacific walrus  gca-cggc
            Weddell seal  gca-cggc
        Black flying-fox  gcc-ccgt
B D              Megabat  --------
B D                Chimp  ========
B D              Gorilla  ========
B D               Rhesus  NNNNNNNN
B D            Orangutan  NNNNNNNN

Alignment block 11 of 836 in window, 232294 - 232299, 6 bps 
B D                Human  cccgcc
B D              Gorilla  cccgcc
B D               Gibbon  cccgcc
B D  Crab-eating macaque  cccgcc
B D               Baboon  cccgc-
B D         Green monkey  cccgcc
B D             Marmoset  cccgcc
B D      Squirrel monkey  cccgcc
B D             Bushbaby  ccagcc
      Chinese tree shrew  cccggg
B D                  Pig  cccgcc
B D               Alpaca  cacgcc
B D              Dolphin  ctcgcc
            Killer whale  ctcgcc
        Tibetan antelope  tccgcc
B D                  Cow  tccgcc
B D                Sheep  tccgcc
B D     White rhinoceros  cccgcc
B D                  Cat  ccggtc
B D                  Dog  cccgcc
B D              Ferret   cccgcc
          Pacific walrus  cccgcc
            Weddell seal  cccgcc
        Black flying-fox  ccgccc
B D              Megabat  ccagcc
B D                Chimp  ======
B D               Rhesus  NNNNNN
B D            Orangutan  NNNNNN

Alignment block 12 of 836 in window, 232300 - 232314, 15 bps 
B D                Human  ccggcccg-------------gccccgc
B D               Gibbon  ccggcccg-------------gccccgc
B D  Crab-eating macaque  ccggcccg-------------gccccgc
B D               Baboon  ----cccg-------------gccccgc
B D         Green monkey  ccggcccg-------------gccccgc
B D             Marmoset  cctgcccg-------------gccccgc
B D      Squirrel monkey  cccgcccg-------------gccccgc
B D             Bushbaby  ccgttcgg-------------gacccgc
      Chinese tree shrew  cgagcccc-------------gccccgc
B D                  Pig  ccctccaggcccgccccacgcgccccgt
B D               Alpaca  acgccccctattctct----cgccccgc
B D              Dolphin  cacgcccacgctgctc----cgccccgc
            Killer whale  cacgcccacgctgctc----cgccccgc
        Tibetan antelope  ccaccccg-------------gccccac
B D                  Cow  caaccccg-------------gccccac
B D                Sheep  ccaccccg-------------gccccac
B D     White rhinoceros  cctaactg-------------gcc-ctc
B D                  Cat  ccctctct-------------tcctccc
B D                  Dog  ccacgttg-------------gcctcgc
B D              Ferret   ccaccttg-------------gcctcgc
          Pacific walrus  ccacgttg-------------gctacgc
            Weddell seal  cctggttg-------------gcctcgc
        Black flying-fox  cgcccccg-------------gctccgc
B D              Megabat  caccacaa-------------gccccgc
B D                Chimp  ============================
B D              Gorilla  ----------------------------
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 12 and 13 in window
     Chinese tree shrew 90bp

Alignment block 13 of 836 in window, 232315 - 232367, 53 bps 
B D                Human  ctttttctctgc-------ctcccct-----------ccctgcacgtacgggccccgcccc----t-c--
B D               Gibbon  cttccggcctgc--------tccgct-----------ccctgcacgtactggcaccacccc----t-a--
B D  Crab-eating macaque  ctttttgtctgcctcacccctccccg-----------cccggcacgtactggccccgccct----t-c--
B D               Baboon  ctttttgcctgcctcacccctcccca-----------cccggcacgtaccggccccgccct----t-c--
B D         Green monkey  ctttttgtctgcctcacccctccccg-----------cccggcacgtactggccccgccct----t-c--
B D             Marmoset  ctctttg-------------ccgccc-----------cactgcatgcactggccccgcccc----t-c--
B D      Squirrel monkey  ctccttgttt----------ccgccc-----------cgctgcgcgtacgggccccgcccc----g-c--
B D             Bushbaby  cc------------------ccctcg-----------gccga--------ggcctcgaccc----c-t--
B D                  Pig  ----------------------gacc-----------tc-------ctaaggccccgcccc--gct-tta
B D               Alpaca  ----------------------gcccggcgagcggctcc-------ctaaggccccgcccc--cag-g--
B D              Dolphin  ----------------------ctct-----------ccccg---actaaggccccgccct--gat-t--
            Killer whale  ----------------------ctct-----------ccccg---actaaggccccgccct--gat-t--
        Tibetan antelope  ----------------------ctcc-----------cc-------ctacggccccgcttc--cct-t--
B D                  Cow  ----------------------cgcc-----------cc-------ctacggccacgcccc--ccc-t--
B D                Sheep  ----------------------ctcc-----------cc-------ctacggccccgctcc--cct-t--
B D     White rhinoceros  ----------------------ccct-----------ccctg---actaaggccccgcccca-cgt-c--
B D                  Cat  ----------------------c--------------------------aggccacgccct----t-c--
B D                  Dog  ----------------------cact-----------cacgg---acaaaggccccgccct----ctt--
B D              Ferret   ----------------------ccct-----------cccgg---gcaaaggccccgcccc----t-c--
          Pacific walrus  ----------------------ccct-----------cccgg---acaaaggccccgccct----c-c--
            Weddell seal  ----------------------cgct-----------cccgg---acaaaggccccgccct----c-c--
        Black flying-fox  ----------------------ctgt-----------tcctg---gctgaggccccgccccatcct-c--
B D              Megabat  ----------------------ct----------------------ccaaggctccgcccccccag-t--
     Chinese tree shrew  ======================================================================
B D                Chimp  ======================================================================
B D              Gorilla  ----------------------------------------------------------------------
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  -gcgcgacg
                  Gibbon  -gcgccacg
     Crab-eating macaque  -gcgcggcg
                  Baboon  -gcgcgacg
            Green monkey  -gcgcgacg
                Marmoset  -gcgcgagg
         Squirrel monkey  -gcgcgagg
                Bushbaby  -ccgaacct
                     Pig  tgcgtaa--
                  Alpaca  -gcggaa--
                 Dolphin  -gcgtaa--
            Killer whale  -gcgtaa--
        Tibetan antelope  -acgtaa--
                     Cow  ---------
                   Sheep  -acgtaa--
        White rhinoceros  -gcgtaa--
                     Cat  -gcgtaa--
                     Dog  -acgtaa--
                 Ferret   -acgtaa--
          Pacific walrus  -acgtaa--
            Weddell seal  -acgtaa--
        Black flying-fox  -cgtcag--
                 Megabat  -tcgcag--
      Chinese tree shrew  =========
                   Chimp  =========
                 Gorilla  ---------
                  Rhesus  NNNNNNNNN
               Orangutan  NNNNNNNNN

Inserts between block 13 and 14 in window
B D            Marmoset 15bp
B D     Squirrel monkey 3bp
B D            Bushbaby 1bp

Alignment block 14 of 836 in window, 232368 - 232381, 14 bps 
B D                Human  ttttttgttgaccc
B D               Gibbon  atttttgttgaccc
B D  Crab-eating macaque  ttttttgttgaccc
B D               Baboon  tgttttgttgaccc
B D         Green monkey  tgttttgttgaccc
B D             Marmoset  ttttttgtcgaccc
B D      Squirrel monkey  ttttctgttgaccc
B D             Bushbaby  tttccggtggaccc
      Chinese tree shrew  tttcctgacggccc
B D                  Pig  cttcctgccgaccc
B D               Alpaca  tttcctgcccaccc
B D              Dolphin  tttcctgccgacgc
            Killer whale  tttcctgccgacgc
        Tibetan antelope  gtgcccggggaccc
B D                  Cow  ---------taccc
B D                Sheep  gtgcccgcggaccc
B D     White rhinoceros  tttcctgccgaccc
B D                  Cat  ttgcttactaaccc
B D                  Dog  cttcctactaaccc
B D              Ferret   tttcctactaaccc
          Pacific walrus  tttcctactaaccc
            Weddell seal  tttcctcctgaccc
        Black flying-fox  tt-cctggggacgc
B D              Megabat  ttgcttgccgaccc
B D                Chimp  ==============
B D              Gorilla  --------------
B D               Rhesus  NNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNN

Alignment block 15 of 836 in window, 232382 - 232522, 141 bps 
B D                Human  ggaaacggatt--ctccggagccgaggtccg-ctcgggtgagtgccctc-cgctttttgtgg--ccaaac
B D               Gibbon  ggaaacggatt--ctccggagccaaggtccg-ctcgggtgagtgccctc-cgctttctgtgg--ccaaac
B D  Crab-eating macaque  ggaaacggatt--ctccggagccaaggtccg-ctcgggtgagtgccctc-cgctttttgtgg--ccaaac
B D               Baboon  ggaaacggatt--ctccggagccaaggtccg-ct-gggtgagtgccctc-cgctttttgtgg--ccaaac
B D         Green monkey  ggaaacggatt--ctccggagccaaggtccg-ct-gggtgagtgccctc-cgctttttgtgg--ccaaac
B D             Marmoset  ggaaagggatt--ctccggagcccaggtccg-ctcgggtgagtgcgctg-cggtatttgcgg--cccaac
B D      Squirrel monkey  ggaaagcgttt--ctccggagcccaggcccg-ctcgggtgagtgcgctc-cggggctggtgg--ccaaac
B D             Bushbaby  ggaaac-gatt--ctgcggagccgaggaccc-ctccggtgagtacactc-cactttgtgtag--tcgaac
      Chinese tree shrew  ggaagaggcctggccttggag---agcaccg-ctctggc-agtgatccg-cggtgcgtgagg-tttgcgc
B D                  Pig  ggaagcggttt--t-cgggagtggaggtcct-ctctggtgagtt-------------------tcagatc
B D               Alpaca  ggaagcggatt--t-cgggagcgagggtccc-ctcgggtgagtgagctctgggtctctgcggttcaggcc
B D              Dolphin  ggaagcggatt--t-cgggagcgaaggtccc-ctcgggtgagtgagcccctcggctctgagagtcagagc
            Killer whale  ggaagcggatt--t-cgggagcgaaggtccc-ctcgggtgagtgagcccctcggctctgagaatcagagc
        Tibetan antelope  ggaagcgggtg--t-cgggagcgcccggccc-ctcgggtga-----------------------------
B D                  Cow  ggaagcgggtg--t-cgggagcacagggcct-ctc-ggtgagtgctgtcctgggcact-----tc----t
B D                Sheep  ggaagcgggtg--t-cgggagggcccggccc-cccgggtgagtgcggtcctgggcacg-----tc----t
B D     White rhinoceros  ggaagtggatt--tcccagagcggaggtcccactccggtaagtgagctc-cggtttttgttgttcaagcg
B D                  Cat  ggaagcggatt--tccggaagagcaggtatcgctc-ggtaagtgaattg-tggtgtttgaggttta----
B D                  Dog  ggaaggagatt--tccggaagcgaaggtcgcgctctggtaagtgaattc-tggtctttgaggtttaaagc
B D              Ferret   ggaagaggatt--tccggaagcgaaggtcctggtctggtgagtggattg-tggtctctgccgcttaaacc
B D                Panda  ggaagaggatt--tccggaagcgaaggttctgctctggtaagtgaattc-tggtctttgaggtttaaacc
          Pacific walrus  ggaagaggatt--tccggaagcgaaggtcctgctctggtaagtgaattc-tggtcttggatgtttaaacc
            Weddell seal  ggaagaggatt--tccggaagcgaaggtcctcctctggtaagtgaactc-tggccttggaggtttaaacc
        Black flying-fox  ggaaggggctt--tcccgccgcgacggtcgcactgcggtgagtgagctc-tgtcctgtgaggtttaggtc
B D              Megabat  ggaagcagatt--tcccaggtcaagggtccagtttcctggagcgagttt-tagtattt--agttcaaact
B D                Chimp  ======================================================================
B D              Gorilla  ----------------------------------------------------------------------
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  ccagccacgcagttcccttcctgcggcgtcctccacacccggggtctgctggtctccg------cgg---
                  Gibbon  ccagccacgcagtccccttcctgcggcatcctccacacccggggtctgcgggtctccg------cgg---
     Crab-eating macaque  ccagccacgcagtccccttcctgcgccatcctccatacccggggtctgtgggtctccg------cgg---
                  Baboon  ccagccacgcagtccccttcctgcgccatcctccatacccggggtctgtgggtctccg------cgg---
            Green monkey  ccagccacgcagtccccttcctgcgccatcctccatacccggggtctgtgggtctccg------cgg---
                Marmoset  catgctatgcag-ccccttcccgcgccgtcctccacacagggggtccgcgggtatccg------cgg---
         Squirrel monkey  cgtgctgtgcagcccccttcccgcgccgtcctccgcactcggggtccgcgggtatccg------cgg---
                Bushbaby  tctgcactgcaagctcctctctgcccggtcctccacagctggggtcaggaagtccccg------cgg---
      Chinese tree shrew  tgcgctctgcgtgggcttccctgcag-gtcctttacacccaccgcccg-aggactcct------cag---
                     Pig  cgcggtccatgggcccatccccacccgctcctccacacccacggtctgggggtccctg------cgg---
                  Alpaca  cgcgctccaaggcccctcccc-gtccggtcctccacgcccagggt----------ctgggggtgcgg---
                 Dolphin  cgcgctccacagccccctcccgaccgcatccttcacacgcaggtt----------ctg--------g---
            Killer whale  cgcgctccacagccccctcccgaccgcatccttcacacgcaggtt----------ctg--------g---
        Tibetan antelope  -------------------------------------------------------ctg------ccg---
                     Cow  cgcgctcctcggccccgcccc-accccttccttcacaccagggccc---gagtccctg------ccg---
                   Sheep  cgcgcgcctcggccccgccct-accccttccttcacgccggggccc---gagtccctg------ccg---
        White rhinoceros  tgggcgtggcgtctcctctcccgccccgtcctccacgcccgg----cccgggccccag------cgg---
                     Cat  ------cctcagccccttcccggccccattctccatacccggggcccaaggattcctg------ccactt
                     Dog  cgggctcctgtgccccttcccggctccgttctt--cgcccgaggcccgagggtccctg------cgg---
                 Ferret   cgggctcgtcggccccttcctggctcggtgctccacgccccgggaccgaggactcctg------cgg---
                   Panda  cgggctcctccgtcccttcctggctccgttctccacgcccggggtccgaggattcctg------cgg---
          Pacific walrus  cgggctcctcagcccctt-ctggctccattctccacgcccggggttcgaggatttctg------cgg---
            Weddell seal  cgggctcctcagcctcttgctggctctgttctccacgcccggggtccgaggattcctg------cgg---
        Black flying-fox  cgc------------cctccgcg--gcctcctccgcactcggggaccggcggtccttg------cgg---
                 Megabat  tgca--cgttgatgttctcagcgccgcgtcctccacacccggagtcca--ggatcctg------ggg---
                   Chimp  ======================================================================
                 Gorilla  ----------------------------------------------------------------------
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  --------atgtcacagg-ctcggc
                  Gibbon  --------atgtcacagg-ctcggc
     Crab-eating macaque  --------acgtcacagg-ctcggc
                  Baboon  --------acgtcacagg-ctcggc
            Green monkey  --------acgtcacagg-ctcagc
                Marmoset  --------acgtcacaag-ctcggc
         Squirrel monkey  --------acgtcacagg-ctcggc
                Bushbaby  --------acgtctctgg-gcccgc
      Chinese tree shrew  --------aagtcacag--------
                     Pig  --------acgtcacagat------
                  Alpaca  --------aggtgatggac------
                 Dolphin  --------gggtc------------
            Killer whale  --------gggtc------------
        Tibetan antelope  --------acgtcccaga-------
                     Cow  --------acgtcacaga-------
                   Sheep  --------acgtcacaga-------
        White rhinoceros  --------acgtcccagg-ccccgc
                     Cat  actggtccccgcctcagg-ccccgt
                     Dog  --------gggtcacagg-ccccgc
                 Ferret   --------gcgccccagg-ccccgc
                   Panda  --------gcgccacagg-ccccgc
          Pacific walrus  --------gcgtcctagg-ccccgc
            Weddell seal  --------gcgtcatagg-ccccgc
        Black flying-fox  --------gtgtcacagg-ccccgc
                 Megabat  --------acattacaga-acccgc
                   Chimp  =========================
                 Gorilla  -------------------------
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNN
               Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 15 and 16 in window
B D    White rhinoceros 315bp

Alignment block 16 of 836 in window, 232523 - 232525, 3 bps 
B D                Human  aac
B D               Gibbon  aac
B D  Crab-eating macaque  aac
B D               Baboon  aac
B D         Green monkey  aac
B D             Marmoset  agc
B D      Squirrel monkey  aac
B D             Bushbaby  atc
B D                  Pig  --c
B D               Alpaca  --c
B D              Dolphin  --c
            Killer whale  --c
        Tibetan antelope  --c
B D                  Cow  --c
B D                Sheep  --c
B D                  Cat  agc
B D                  Dog  gcc
B D              Ferret   tac
B D                Panda  agc
          Pacific walrus  agc
            Weddell seal  agc
        Black flying-fox  -cc
B D              Megabat  -at
     Chinese tree shrew  ---
B D     White rhinoceros  ===
B D                Chimp  ===
B D              Gorilla  ---
B D               Rhesus  NNN
B D            Orangutan  NNN

Inserts between block 16 and 17 in window
B D                 Pig 1bp
B D              Alpaca 1bp
B D             Dolphin 1bp
           Killer whale 1bp
       Tibetan antelope 1bp
B D                 Cow 1bp
B D               Sheep 1bp
       Black flying-fox 1bp
B D             Megabat 1bp

Alignment block 17 of 836 in window, 232526 - 232548, 23 bps 
B D                Human  ---cgccctcc-tgtcggcg----gggagtc
B D               Gibbon  ---cgccctcc-tgtcggcg----gggagtc
B D  Crab-eating macaque  ---agccccac-tgtaggcg----gggagcc
B D               Baboon  ---agccccac-tgtcggcg----gggagcc
B D         Green monkey  ---agccccac-tgtcggcg----gggagcc
B D             Marmoset  ---cgccctcc-cgttggcg----gggagcc
B D      Squirrel monkey  ---cgccgtcc-cgtcggcg----gggaggc
B D             Bushbaby  ---cgctaacc-cgctggcg----gggagtc
      Chinese tree shrew  --------ctc-ctcctgcg----gggagcc
B D                  Pig  cgctctggccc-ctcgcac------------
B D               Alpaca  cgccctcgcccgctcctgc------------
B D              Dolphin  cgttctcgcat-ctccagc------------
            Killer whale  cgttcttgcct-ctccggc------------
        Tibetan antelope  cgctctcgcgc-cgctggc------------
B D                  Cow  cgctctcgcgc-cgctggc------------
B D                Sheep  cgctctcgcgc-cgctggc------------
B D     White rhinoceros  --cgcccgcgg-ggtca--------------
B D                  Cat  --cgcccgtca-gtcccggg----gggagtt
B D                  Dog  --cggccgtca-tgcccgcg----gggagac
B D              Ferret   --cgcccgtca-gacccgcg----gggagtc
B D                Panda  --cgcccgtca-gacccgcg----gggagtt
          Pacific walrus  --cgcccgtca-gacccgcg----gggagtt
            Weddell seal  --cgcccgtga-gacccgcg----gggagtt
        Black flying-fox  ------cgggg-accccgtt--------gcc
B D              Megabat  ------cgcta-tctccagtcggggggagct
B D                Chimp  ===============================
B D              Gorilla  -------------------------------
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 17 and 18 in window
B D             Ferret  2172bp

Alignment block 18 of 836 in window, 232549 - 232582, 34 bps 
B D                Human  cc---------gcgacgcccggaaatgctc-cgaagcctgtcgc
B D               Gibbon  cc---------gcgacgccctgaaatgctc-cgaagcctgtcgc
B D  Crab-eating macaque  cc---------gcgacgccctgaaatgctc-cgaagcctgtcgc
B D               Baboon  cc---------gcgacgccctgaaatgctc-cgaagcctgtcgc
B D         Green monkey  cc---------gcgacgccctgaaatgctc-cgaagcctgtcgc
B D             Marmoset  cc---------gcggcgccctgaaatgctc-cgaagcctgtcgc
B D      Squirrel monkey  cc---------gc-gcgccctgagatgctc-cgcagcctgtcgc
B D             Bushbaby  cg---------gcggtgtcc-gagacgccc-cgaggccttaagc
      Chinese tree shrew  cc---------gcgtcgccc-----------cgaagcccgtcgc
B D                  Pig  ctgcgatctcagggtcgccctgaga---tcgggatgtcgggcgc
B D               Alpaca  cc---------ttgtcgctctgaga--ctcgggatgccg-----
B D              Dolphin  cc---------gcgtcgccctgaga--ctcgggatgccgggcgc
            Killer whale  ct---------gcgtcgccctgaga--gtcgggatgcggggcgc
        Tibetan antelope  cc---------ggggcgccctgaga--ctcgcgatgccgggagc
B D                  Cow  cc---------ggggctccctgaca--ctcgcgaagccgggagc
B D                Sheep  cc---------ggggcgccctgaga--ctcgcgatgcccggagc
B D     White rhinoceros  cc---------gcgtcgcccggagacgcccggg--gccggtcgc
B D                  Cat  ca---------gcgttgccttgagacgctcaggacgtcgatccc
B D                  Dog  --------------------------gctcggggcgcgggtccc
B D                Panda  cg---------gccttgccctgagacgctcagggcgcctgtccc
          Pacific walrus  cg---------gggttgccctaagatactcggggcgccggtccc
            Weddell seal  cg---------gcgttgccctgagacactcggggcgccggtccc
        Black flying-fox  ct---------gagagaccgggaggcgccgcgacggtcg-----
B D              Megabat  cc---------gcctagtcaagaaccgctttgctgccag-----
B D              Ferret   ============================================
B D                Chimp  ============================================
B D              Gorilla  --------------------------------------------
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 18 and 19 in window
B D                 Dog 523bp

Alignment block 19 of 836 in window, 232583 - 232586, 4 bps 
B D                Human  ccag
B D               Gibbon  tcag
B D  Crab-eating macaque  tcag
B D               Baboon  tcag
B D         Green monkey  tcag
B D             Marmoset  tcag
B D      Squirrel monkey  tcag
B D             Bushbaby  gccg
B D                  Pig  tccg
B D              Dolphin  tcgg
            Killer whale  tcgg
        Tibetan antelope  tccg
B D                  Cow  tccg
B D                Sheep  tccg
B D     White rhinoceros  gccg
B D                  Cat  tccg
B D                Panda  tccg
          Pacific walrus  tcgg
            Weddell seal  tccg
B D               Alpaca  ----
B D              Megabat  ----
B D              Ferret   ====
B D                  Dog  ====
     Chinese tree shrew  ----
       Black flying-fox  ----
B D                Chimp  ====
B D              Gorilla  ----
B D               Rhesus  NNNN
B D            Orangutan  NNNN

Alignment block 20 of 836 in window, 232587 - 232640, 54 bps 
B D                Human  ctgccagatctg--cgtctgtgtccggttccg---------------tca-ctgaggtcgcccctgtccg
B D              Gorilla  ctgccagatctg--cgtctgtgtccggttccg---------------tca-ctgaggtcgcccctgtccg
B D               Gibbon  ctgccagatctg--cgtctgtgtccggttccg---------------tca-ctgaggtcgcccctgtccg
B D  Crab-eating macaque  ctgccagatctg--cgtctgtgtccggttccg---------------tca-ctgaggtcg-ccccgtcca
B D               Baboon  ctgccagatctg--cgtctgtgtccggttccg---------------tca-ctgaggtcgcccccgtccg
B D         Green monkey  ctgccagatctg--cgtctgtgtccagttccg---------------tca-ctgaggtcgcccctgtccg
B D             Marmoset  ctgccagatctg--ag-------------------------------------------gcccctgtccg
B D      Squirrel monkey  ctgcgagatctg--cgcccttgtccggttccg---------------tca-ctgaggtcgcccccgcccg
B D             Bushbaby  ctgctgcggccg--cggctgtgttcgattccggttc-cggttaaaacgcc-ccgaggctgacctcccact
      Chinese tree shrew  -------gtctg--ctgtcgcatccagctcaa---------------acgcccgggattgttctgacctc
B D                  Pig  ccgaagggtctg--agtccgcatccaccgccagtca------aaatcgcc-ccgaggccgaccccgtccg
B D               Alpaca  ----cgggttaa--agt-c----------------------------gcc-ccgaggccgtccccggccg
B D              Dolphin  ctgccgggtccg--agtccgcgtccgtttccggtca------aaatcgct-ccgaggccgtccccgtcag
            Killer whale  ctgccgggtccg--agtccgcgtccgtttccggtca------aaatcgct-ccgaggccgtccccgtcag
        Tibetan antelope  ctgccgggttcg--agt-cgcatccgtttccg---------------gat-ccgaggccatcccgatccg
B D                  Cow  ctgccaggttcg--agt-cgcatccgtttccg---------------gat-ccgaggccatcctggtccg
B D                Sheep  ctgccgggttcg--agt-cgcatccgtttccg---------------gat-ccgaggccatcccgatccg
B D     White rhinoceros  ct--------------gccgcggccgtttccggttg------aagtcgct-ccgc---------------
B D                  Cat  ctcctcggtcctctggtccgtgtccgtttccgattg------aagtcgta-cgga---------------
B D                Panda  ctccctagtccagtggtccgtgtctgtttccggtcg------aagtcgcc-ccga---------------
          Pacific walrus  ctccctggtccagtagtctgagtctgtttccggtcg------aagtcgcc-ccga---------------
            Weddell seal  ctccctcgtcccgtagtccgagtctgtttccggtcg------aagtcgcc-ccga---------------
        Black flying-fox  --cactgatc----ggctcgtttctgtttcccgtca------ccggcgcc-ccga---------------
B D              Megabat  --atctg-------gatccgcgtcagtttcaggtaaaatagctccgcgac-caga---------------
B D              Ferret   ======================================================================
B D                  Dog  ======================================================================
B D                Chimp  ======================================================================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  -gc
                 Gorilla  -gc
                  Gibbon  -gc
     Crab-eating macaque  -gc
                  Baboon  -gc
            Green monkey  -gc
                Marmoset  -gc
         Squirrel monkey  -gc
                Bushbaby  -gc
      Chinese tree shrew  -gc
                     Pig  ggc
                  Alpaca  --c
                 Dolphin  -gc
            Killer whale  -gc
        Tibetan antelope  -ac
                     Cow  -ac
                   Sheep  -ac
        White rhinoceros  ---
                     Cat  ---
                   Panda  ---
          Pacific walrus  ---
            Weddell seal  ---
        Black flying-fox  ---
                 Megabat  ---
                 Ferret   ===
                     Dog  ===
                   Chimp  ===
                  Rhesus  NNN
               Orangutan  NNN

Inserts between block 20 and 21 in window
B D    White rhinoceros 7bp
B D               Panda 2bp
         Pacific walrus 2bp
           Weddell seal 2bp
       Black flying-fox 17bp
B D             Megabat 12bp

Alignment block 21 of 836 in window, 232641 - 232659, 19 bps 
B D                Human  ccttccac----cctagttctct
B D              Gorilla  ccttccac----cctagttctct
B D               Gibbon  ccttccac----cctagttctct
B D  Crab-eating macaque  ccttctac----cctagttctct
B D               Baboon  ccttctac----cctagttctct
B D         Green monkey  ccttcgac----cctagttctct
B D             Marmoset  ccttccac----tctagttctct
B D      Squirrel monkey  ccttccac----cccagttctct
B D             Bushbaby  ctttccgc----cctg--tgtct
      Chinese tree shrew  tctttgcc----ttgtagtctct
B D                  Pig  ctttctgc----cttccttctct
B D               Alpaca  ctttccgc----cttcggtctct
B D              Dolphin  ctttctgc----cttcggtctct
            Killer whale  ctttctgc----cttcggcctct
        Tibetan antelope  cttccggc----ctacggtctct
B D                  Cow  cttccggc----ctatggtctct
B D                Sheep  cttccggc----cttcggtctct
B D     White rhinoceros  ccgcccgcctgtctgcgcc----
B D                Panda  ccttccacagaacccagtcccct
          Pacific walrus  ccttccacagaacccagtcctct
            Weddell seal  cctcccgcagaacccagtcctct
        Black flying-fox  ccttctgc----cttgagtccct
B D              Megabat  ctttctgt----cttgtttgttt
B D              Ferret   =======================
B D                  Cat  -----------------------
B D                  Dog  =======================
B D                Chimp  =======================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNN

Alignment block 22 of 836 in window, 232660 - 232661, 2 bps 
B D                Human  tc
B D              Gorilla  tc
B D               Gibbon  tc
B D  Crab-eating macaque  tc
B D               Baboon  tc
B D         Green monkey  tc
B D             Marmoset  tc
B D      Squirrel monkey  tc
B D             Bushbaby  tt
      Chinese tree shrew  tt
B D                  Pig  tc
B D               Alpaca  tc
B D              Dolphin  tc
            Killer whale  tc
        Tibetan antelope  tc
B D                  Cow  tc
B D                Sheep  tc
B D     White rhinoceros  gc
B D                Panda  -c
        Black flying-fox  gc
B D              Megabat  tc
B D              Ferret   ==
B D                  Cat  --
B D                  Dog  ==
           Weddell seal  --
         Pacific walrus  --
B D                Chimp  ==
B D               Rhesus  NN
B D            Orangutan  NN

Inserts between block 22 and 23 in window
B D    White rhinoceros 4bp
B D               Panda 50bp

Alignment block 23 of 836 in window, 232662 - 232712, 51 bps 
B D                Human  accgtccgcccatcctatcgcgcgcggcctcaggtcccgattcggcatgtg
B D              Gorilla  accgtccgcccatcctgtcgcgcgccgcgtcaggtccccattcggcatgtg
B D               Gibbon  accgtccgcccatcctgtcgcgcgccgcgtcaggtccccattcggcatgtg
B D  Crab-eating macaque  accgtccgcccatcctatcgcgcgccgcgtcaggtccccattcggcacatg
B D               Baboon  accgtccgcccatcctatcgcgcgccgcgtcacgtccccattcggcacgtg
B D         Green monkey  accgtccgcccatcctatcgcgcgccgcgtcaggtccccattcggcacgtg
B D             Marmoset  cccgtcggcccgtcctgtc-cgcgccgcgtcagggcccctttcggcacgcg
B D      Squirrel monkey  accgtcggcccatcctgtc-cgcgcggcgtcaggtccccattcggcacgtg
B D             Bushbaby  acgggccgcccgctgcatcccgcgcggcgtctagtgtttgatagggacgtg
      Chinese tree shrew  --------cctctcct----cgcccggtgtcacctgtccacgcgggacgcg
B D                  Pig  -cccgtctcccgccccgacccgcgc----------cccgactcgcgacgtg
B D               Alpaca  -accgtcttccgcccccgcccgcgcggtgtcagggccccactcgcaatgtg
B D              Dolphin  -accttctcccggcccgacccgcgccgtgtcaggcccccactcgtgacgtg
            Killer whale  -accgtctctaggcccgacccgcatcgtgtcaggtccccactcgcgacgtg
        Tibetan antelope  -acggggtcccgccccgacccacgctgtgtcaggtccccgctcgcaacgtg
B D                  Cow  -acggggtcccgcccc----------gtgtcaggtccccactcgcaacgtg
B D                Sheep  -acggggtcccgccccgacccacgctgtgtcagggccccactcgcaacgtg
B D     White rhinoceros  -tcggccgcgtcccgccccgcgccgtgtcccg----tccccccgggacgtg
        Black flying-fox  -gcggtgtccccgcccggcgcgacgggt------------ctcgggacgtg
B D              Megabat  -accgtctcttctttccacccgcgcagt------------gtctggaggcg
B D                Panda  ===================================================
B D              Ferret   ===================================================
B D                  Cat  ---------------------------------------------------
B D                  Dog  ===================================================
           Weddell seal  ---------------------------------------------------
         Pacific walrus  ---------------------------------------------------
B D                Chimp  ===================================================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 24 of 836 in window, 232713 - 232747, 35 bps 
B D                Human  gcttgtcttccatcgtcccca--c--cc--------------tcgcc------------------cc-tc
B D                Chimp  gcttgtcttccgtcgtcccccacc--cc--------------tcgcc------------------ccctc
B D              Gorilla  gcttgtcttccatcgtcccca--c--cc--------------tcgcc------------------cc-tc
B D               Gibbon  gcttgtcttccgtcgtcccca--c--cc--------------tcgcc------------------cc-tc
B D  Crab-eating macaque  gcttgtctcccgtcgtcccca--c--cc--------------ttgcc------------------cc-tc
B D               Baboon  gcttgtctcccgtcgtcccca--c--cc--------------ttgcc------------------cc-cc
B D         Green monkey  gcttgtctcccgtcggcccca--c--cc--------------ttgcc------------------cc-tc
B D             Marmoset  gcttgtctcccatcgtcccca--g--ac--------------tcgct------------------cc-tc
B D      Squirrel monkey  gcttgcctcccatcgtcccca--g--ac--------------tcgcc------------------cc-gc
B D             Bushbaby  aattgttgcccttcg-cccca--c--tc--------------tcgtc------------------cc-tc
      Chinese tree shrew  -------------gatcctag--c--tc--------------ttacc------------------ccagt
B D                  Pig  -------------------ga--c--tc--------------tcgcc------------------ct-cc
B D               Alpaca  -------------------ga--c--tc--------------tcgcc------------------cc-tc
B D              Dolphin  -------------------ga--c--tc--------------tcgcc------------------ct-tc
            Killer whale  -------------------ga--c--tc--------------tcgcc------------------ct-tc
        Tibetan antelope  -------------------cg--c--tc--------------tcgcc------------------ct-ct
B D                  Cow  -------------------cg--c--tc--------------tcgcc------------------ct-ct
B D                Sheep  -------------------cg--c--tc--------------tcgcc------------------ct-cg
B D     White rhinoceros  -------------------cg--t--tc--------------tcgcc-----------------------
        Black flying-fox  -------------------gg--tcgtcgcccttctccgcagtcgcccctcccgcccctcggtcagc-cc
B D              Megabat  -------------------gt--t--ttgcggtgcctgggggtagct------------------gc-ca
B D                Panda  ======================================================================
B D              Ferret   ======================================================================
B D                  Cat  ----------------------------------------------------------------------
B D                  Dog  ======================================================================
           Weddell seal  ----------------------------------------------------------------------
         Pacific walrus  ----------------------------------------------------------------------
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  tt---------------------
                   Chimp  tt---------------------
                 Gorilla  tt---------------------
                  Gibbon  tt---------------------
     Crab-eating macaque  tt---------------------
                  Baboon  tt---------------------
            Green monkey  tt---------------------
                Marmoset  tc---------------------
         Squirrel monkey  tc---------------------
                Bushbaby  tc---------------------
      Chinese tree shrew  ct---------------------
                     Pig  gcgccccgcatc--gcccctctc
                  Alpaca  act--------------------
                 Dolphin  gcgccccgcatc--gcccctctc
            Killer whale  gcg-cccgcatc--gcccctctc
        Tibetan antelope  ggg--------------------
                     Cow  gtg--------------------
                   Sheep  gtg--------------------
        White rhinoceros  ----------cc--gtcgccccc
        Black flying-fox  ggg----acgccgggccgtcccc
                 Megabat  gta----gcccc--gccctcctc
                   Panda  =======================
                 Ferret   =======================
                     Cat  -----------------------
                     Dog  =======================
            Weddell seal  -----------------------
          Pacific walrus  -----------------------
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNN
               Orangutan  NNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 24 and 25 in window
B D    White rhinoceros 2bp

Alignment block 25 of 836 in window, 232748 - 232757, 10 bps 
B D                Human  gg-cccctcag
B D                Chimp  agacccctcag
B D              Gorilla  gg-cccctcag
B D               Gibbon  gg-cccctcag
B D  Crab-eating macaque  gg-cagctcag
B D               Baboon  gg-ccgctcag
B D         Green monkey  gg-ccgctcag
B D             Marmoset  gg-cccctcag
B D      Squirrel monkey  gg-cccctcag
B D             Bushbaby  gg-c--ctcag
      Chinese tree shrew  gg-cgcctcgg
B D                  Pig  gg-cccctcag
B D              Dolphin  gg-cccctcgg
            Killer whale  gg-cccctcgg
        Tibetan antelope  ---cctctcgg
B D                  Cow  ---cctctcgg
B D                Sheep  ---cctctcgg
B D     White rhinoceros  ----------g
B D                  Cat  ----------g
B D               Alpaca  -----------
B D              Megabat  -----------
B D                Panda  ===========
B D              Ferret   ===========
B D                  Dog  ===========
       Black flying-fox  -----------
           Weddell seal  -----------
         Pacific walrus  -----------
B D               Rhesus  NNNNNNNNNNN
B D            Orangutan  NNNNNNNNNNN

Alignment block 26 of 836 in window, 232758 - 232763, 6 bps 
B D                Human  ggcagc-----------
B D                Chimp  agcagc-----------
B D              Gorilla  ggcagc-----------
B D            Orangutan  ggcagc-----------
B D               Gibbon  ggcagc-----------
B D  Crab-eating macaque  ggcagc-----------
B D               Baboon  ggcagc-----------
B D         Green monkey  ggcagc-----------
B D             Marmoset  ggcagg-----------
B D      Squirrel monkey  ggcggg-----------
B D             Bushbaby  ggcagc-----------
      Chinese tree shrew  ggcagc-----------
B D                  Pig  ---ggcagc--------
B D               Alpaca  -------g---------
B D              Dolphin  ---ggcag---------
            Killer whale  ---ggcag---------
        Tibetan antelope  ---agccg---------
B D                  Cow  ---ggccg---------
B D                Sheep  ---agccg---------
B D     White rhinoceros  ---gcctc-ggggcagc
B D                  Cat  ---gcctc-cca-----
        Black flying-fox  -----ttg-c-------
B D              Megabat  -----cta-c-------
B D                Panda  =================
B D              Ferret   =================
B D                  Dog  =================
           Weddell seal  -----------------
         Pacific walrus  -----------------
B D               Rhesus  NNNNNNNNNNNNNNNNN

Inserts between block 26 and 27 in window
B D    White rhinoceros 24bp
B D                 Cat 3bp

Alignment block 27 of 836 in window, 232764 - 232807, 44 bps 
B D                Human  cctgggattcggcagacgccagtcct---ccctgaga-tgctt-cc--c---ca--
B D                Chimp  cctgagattcgacagacgccagtcct---ccctgaga-tgctt-cc--c---ca--
B D              Gorilla  cctgggattcggcagacgccagtcct---ccctgaga-tgctt-cc--c---ca--
B D            Orangutan  cctgggattcggcagacgccagtcct---ccctgacaccgcttacc--c---ca--
B D               Gibbon  cctgggattcggcagacgccattcct---cactgaga-tgcct-cc--c---ca--
B D  Crab-eating macaque  cctgggatttggcagacgccagtcct---ccctgaga-tgtct-cc--c---ca--
B D               Baboon  cctgggatttggcagacgccagtcct---ccctgaga-tgcct-cc--c---ca--
B D         Green monkey  cctgggatttggcagacgccagtcct---ccctgaga-tgcct-cc--c---ca--
B D             Marmoset  cctgggattcggcagacgtcgatcct---c--------------------------
B D      Squirrel monkey  cctgggattgggcagacgccgatcct---ccctgagg-taact--c--c---ca--
B D             Bushbaby  cct------------actccggttct---ccttgaga-ccctt--c--c---ca--
      Chinese tree shrew  cctggcattctgttgaccccagatcc---c--------acctt-cc--c---ca--
B D                  Pig  cccggaacgccgcgccctcccctgtccatcctg-----ggcct-cc--t---tcgg
B D               Alpaca  cccg-----cttcgcccttcc-tggc---cctg-----gcatt-gc--g---caga
B D              Dolphin  cccgggacgccgcgccctcccgcggc---cctg-----ggact-cc--a---ccga
            Killer whale  cccgggacgccgcgccctcccgcggc---cctg-----ggact-cc--a---caga
        Tibetan antelope  cccgggactccgcgccgtcccgcggc---tccc-----ctcct-tc--ttcccaga
B D                  Cow  cacgggactccgcgccctccggcggc---tcca-----ggaat-cc--g---caga
B D                Sheep  cccgggactccgcgccctcccgcggc---tccg-----ggaat-cc--g---caga
B D     White rhinoceros  ccctggactctgca-gacccggccct-ctccgg-----agacc-ct--c---ccgg
B D                  Cat  ---------------aacccagtcct-cttctg-----aaacc-ct--c---gcca
          Pacific walrus  -----------------------------cctg-----aaact-ctgcc---gccg
            Weddell seal  -----------------------------cctg-----aaact-ctgcc---gccg
        Black flying-fox  cctggggttgcgccgtccccagtcct------------gaccc-cc--c---cgca
B D              Megabat  cttggggttctagagaccccagccct-ctcctgagtc-aacct-cc--c---catt
B D                Panda  ========================================================
B D              Ferret   ========================================================
B D                  Dog  ========================================================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 27 and 28 in window
     Chinese tree shrew 1121bp

Alignment block 28 of 836 in window, 232808 - 232822, 15 bps 
B D                Human  tcct-----tccctccgcca
B D                Chimp  tcct-----tccctccgcca
B D              Gorilla  tcct-----tccctccgcca
B D            Orangutan  tcct-----tccctccgcca
B D               Gibbon  tcct-----tccctcctcca
B D  Crab-eating macaque  tcct-----tccctccgcca
B D               Baboon  tcct-----tccctccgcca
B D         Green monkey  tcct-----tccctccgcca
B D             Marmoset  ----------ccctcggcca
B D      Squirrel monkey  tcct-----gccctcggccc
B D             Bushbaby  tcctcgggctccaggggcta
B D                  Pig  ccg-----------------
B D               Alpaca  cccc-----agtcttctcct
B D              Dolphin  cccc-----agtgttctcct
            Killer whale  cccc-----tgtgttctcct
        Tibetan antelope  cccc-----cgccttctcca
B D                  Cow  cccc-----cgtcttctcca
B D                Sheep  cccg-----cgtctcctcca
B D     White rhinoceros  tcca-----cgtccccctgc
B D                  Cat  tcct-----cttcctcccgc
          Pacific walrus  ccgt-----cgccctcccgc
            Weddell seal  ccgt-----cgccctcccgc
        Black flying-fox  tcgt-----cgtcctcctgc
B D              Megabat  ctgg-----cgtagttctgg
B D                Panda  ====================
B D              Ferret   ====================
B D                  Dog  ====================
     Chinese tree shrew  ====================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNN

Inserts between block 28 and 29 in window
B D              Alpaca 7bp
B D             Dolphin 35bp
           Killer whale 35bp
       Tibetan antelope 5bp
B D                 Cow 5bp
B D               Sheep 5bp
B D    White rhinoceros 7bp
B D                 Cat 5bp
         Pacific walrus 5bp
           Weddell seal 5bp
       Black flying-fox 5bp
B D             Megabat 5bp

Alignment block 29 of 836 in window, 232823 - 232824, 2 bps 
B D                Human  gg
B D                Chimp  gg
B D              Gorilla  gg
B D            Orangutan  gg
B D               Gibbon  gg
B D  Crab-eating macaque  gg
B D               Baboon  gg
B D         Green monkey  gg
B D             Marmoset  gg
B D      Squirrel monkey  gg
B D             Bushbaby  gt
        Tibetan antelope  gg
B D                  Cow  gg
B D                Sheep  gg
           Domestic goat  gg
B D               Alpaca  ==
B D              Megabat  ==
B D                Panda  ==
B D              Ferret   ==
B D                  Cat  ==
B D                  Dog  ==
     Chinese tree shrew  ==
           Killer whale  ==
       Black flying-fox  ==
B D              Dolphin  ==
           Weddell seal  ==
         Pacific walrus  ==
B D     White rhinoceros  ==
B D               Rhesus  NN
B D                  Pig  --

Inserts between block 29 and 30 in window
B D              Baboon 3772bp

Alignment block 30 of 836 in window, 232825 - 232845, 21 bps 
B D                Human  ccctacg-tctccgcaa-acccc
B D                Chimp  ccctacg-tctccgcaa-acccc
B D              Gorilla  ccctacg-tctccgcaa-acccc
B D            Orangutan  ccctacg-tcttcgcaa-acccc
B D               Gibbon  ctctacg-tctccgcaa-agccc
B D  Crab-eating macaque  ccctacg-tctccgcaa-acccc
B D         Green monkey  ccctacg-tctccgcaa-acccc
B D             Marmoset  ctctccg-tttccgcagaacccc
B D      Squirrel monkey  ccctccg-tctccgcag-acccc
B D             Bushbaby  tactgcg-gctccccag-acctt
B D                  Pig  ---ggac-ctgcctctc-gctcc
B D               Alpaca  ---ggcc-ctgccgcac-gcgcc
B D              Dolphin  ---ggcc-gtgccaatc-gctgc
            Killer whale  ---ggcc-gtgccaatc-gctgc
        Tibetan antelope  cccggcc-ccgccgctc-gctcc
B D                  Cow  cccggcc-ccgccgctc-gctcc
B D                Sheep  cccggcc-ccgccgctg-gctcc
           Domestic goat  tccgggg-ccgccgctg-gctcc
B D     White rhinoceros  ----ggg-gctcc----------
B D                  Cat  ----gaa-gcacg-----gtcac
          Pacific walrus  ----ggg-gcacc-----gtcgc
            Weddell seal  ----ggg-gcgcc-----gtcac
        Black flying-fox  ----ggc-ctgcc-----gctcc
B D              Megabat  ----agctctgct-----gctcc
B D                Panda  =======================
B D              Ferret   =======================
B D                  Dog  =======================
     Chinese tree shrew  =======================
B D               Baboon  =======================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 30 and 31 in window
       Black flying-fox 9bp
B D             Megabat 9bp

Alignment block 31 of 836 in window, 232846 - 232848, 3 bps 
B D                Human  ac-g
B D                Chimp  ac-g
B D              Gorilla  ac-g
B D            Orangutan  cc-g
B D               Gibbon  cc-g
B D  Crab-eating macaque  cc-g
B D         Green monkey  cc-g
B D             Marmoset  tg-g
B D      Squirrel monkey  tg-g
B D             Bushbaby  cc-t
B D                  Pig  -c--
B D               Alpaca  -cc-
B D              Dolphin  -g--
            Killer whale  -g--
        Tibetan antelope  -c--
B D                  Cow  -c--
B D                Sheep  -c--
           Domestic goat  -c--
B D              Megabat  cc--
B D                Panda  ====
B D              Ferret   ====
B D                  Cat  ----
B D                  Dog  ====
     Chinese tree shrew  ====
       Black flying-fox  ====
           Weddell seal  ----
         Pacific walrus  ----
B D     White rhinoceros  ----
B D               Baboon  ====
B D               Rhesus  NNNN

Alignment block 32 of 836 in window, 232849 - 232860, 12 bps 
B D                Human  cttcggggtggc
B D                Chimp  cttcggggtgac
B D              Gorilla  cttcggggtgac
B D            Orangutan  cttcggggtgac
B D               Gibbon  cttcggggtgac
B D  Crab-eating macaque  cttcggggtgac
B D         Green monkey  cttcggggtgac
B D             Marmoset  ctttggggtcac
B D      Squirrel monkey  ctttggagtcac
B D             Bushbaby  ctgaggagtcgc
B D                  Pig  cttcccggtcac
B D               Alpaca  -ttcacggtcac
          Bactrian camel  cttcgcggtcac
B D              Dolphin  cttcgcggtcaa
            Killer whale  cttcgcggtcac
        Tibetan antelope  ctccgcggccag
B D                  Cow  ctcggcggtcac
B D                Sheep  ctccgcggtcac
           Domestic goat  ctccgcggtcac
B D     White rhinoceros  cctcgcggtcac
        Black flying-fox  --tcgcggtcac
B D              Megabat  cttcacagtccc
B D                Panda  ============
B D              Ferret   ============
B D                  Cat  ------------
B D                  Dog  ============
     Chinese tree shrew  ============
           Weddell seal  ------------
         Pacific walrus  ------------
B D               Baboon  ============
B D               Rhesus  NNNNNNNNNNNN

Alignment block 33 of 836 in window, 232861 - 232945, 85 bps 
B D                Human  cgcctc-agacagg-accctgagtccgagactggg--gt-aggggacctgcccgatcctgtaacaaccct
B D                Chimp  cgcctc-agacagg-accctgagtccgagactggg--gt-aggggacctgcccgatcctgtaacaaccct
B D              Gorilla  cgcctc-agacagg-accctgagcccgagactggg--gt-aggggacctgcccgatcctgtaacaaccct
B D            Orangutan  cgcctc-agacagg-accctgagtccgggactggg--gt-aagggacctgcccgatcctgtaacaacccg
B D               Gibbon  cgcctc-agacagg-accctgagtccgggactggg--gt-aggagacctgcgcgatgctgtaacaacccg
B D  Crab-eating macaque  cgcttc-agacagg-aagctgagtccgggcctggg--gt-aagggacctgcccaatcctgtgacagcccg
B D         Green monkey  cgcttc-agacagg-acgctgagtccgggcctggg--gt-aagggacctgcccaatcctgtgacagcccg
B D             Marmoset  cgcctc-agacagg-actctcagtccgggactggg--ac-aggggacctgcccaaccctataacaccccg
B D      Squirrel monkey  cgcctc-aggcagg-accctcggtccggggctggg--cc-aggggacctgcccaaccctgtaacaccccg
B D             Bushbaby  cgcctc-tcggaggccccctgagccgggtgctttg--ag-agacgaccggccctgtactgtgtc--tccc
B D                  Pig  cgcctc-agaaagg-tccttgagccctgggctgga--ggtgaggtttcagtcctg-acagtgacgcgccg
B D               Alpaca  cgcctc-agaaggg-ccctggagccccgggctggg--gg-aggg--------------------gccccg
          Bactrian camel  cgcctc-agaaggg-cccttgagccccgggctgga--gg-aggg--------------------gccccg
B D              Dolphin  cgcctc-agaaagg-ccctagagccccgggctggg--ggcaggggatcagtcctgtgaagtgacaccccg
            Killer whale  cgcctc-agaaagg-ccctagagccccgggctggg--ggcaggggatcagtcctgtgaagtgacaccccg
        Tibetan antelope  cgcctc-agtaagg-cccctgagcccc---ctggg--gg-agggcactggccctgtccagtgacggcccg
B D                  Cow  cgcctc-agtaagg-cccctgagcccc---ctggg--ga-agggtatcggccctgtccagtgacgccccg
B D                Sheep  cgcctc-agtaagg-cccctga-cccc---ctggg--gg-cgggcatcggccctgtccagtgacgccccg
           Domestic goat  cgcctc-agtaagg-cccctgagcccc---ctggg--gg-agggcattggccctgtccagtgacgccgcg
B D     White rhinoceros  cgcctc-agggagg-gtc-tgagccccgggctgggctgg-gggtgtccgcccctgccctgcgactccccc
B D                  Cat  cgcctc-agcgagg-ctcgtgggccccggcctgac--gg-cagagaccgatcccgtgctaggaacccccg
B D                Panda  cgcctc-ggggagg-cccgtgagcccgggactgag--gg-aagagagcgagtttgtcctgtgacaaccca
          Pacific walrus  cgcctc-ggggagg-cccgtgagccccggactgag--gg-aagagagcgagcccgtccagtgacacgccg
            Weddell seal  cgcctc-ggggagg-cccgt----------------------------gagcccgtccagtgacaccccg
        Black flying-fox  cgcctctcgggggg-cccctgatccccacg----------------------ctgtcctgtgacacgtcg
B D              Megabat  cgcctc-agggagg-ccccagaaccccgtgctggg--gc-actcacctgcccctgtactatgacactcct
B D              Ferret   ======================================================================
B D                  Dog  ======================================================================
     Chinese tree shrew  ======================================================================
B D               Baboon  ======================================================================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  cgtgctt-ctg--cacaa------t-cgcc
                   Chimp  cgtgctt-ctg--cacaa------t-cgcc
                 Gorilla  cgtgctt-ctg--cacag------t-cgcc
               Orangutan  cgtgctt-ctg--cacaa------t-tgcc
                  Gibbon  cgtgctt-ctg--cacaa------t-cgcc
     Crab-eating macaque  cgtcctt-ctg---acag------t-cacc
            Green monkey  cgtcctt-ctg--cacag------t-cacc
                Marmoset  tgtcctt-ctg--cacag------t-cagc
         Squirrel monkey  tgccctt-ctg--cacgg------t-cacc
                Bushbaby  cggtatc-cgg--cacag------t-ccca
                     Pig  tgtgctt-ccg-tcccaa------g-ccct
                  Alpaca  ggtcctt-gtg-tcccg-------------
          Bactrian camel  ggtcctt-gtg-tcccg-------------
                 Dolphin  tgccctt-ctg-tcccaa------a-tcct
            Killer whale  tgtcctt-ctg-tcccaa------a-tcct
        Tibetan antelope  ggacctt-ctg-tcccaa------g-ccct
                     Cow  tgacctt-ctg-tcccaa------g-tcct
                   Sheep  tgacctt-ctg-tcccaa------g-ccct
           Domestic goat  tgacctt-ctg-tcccaa------g-ccct
        White rhinoceros  tgttctc--tg-ccccag------atcccg
                     Cat  tgtacttcacg-tcccaa------t-cctg
                   Panda  tgtcctt-gcgcccccag------a-cctg
          Pacific walrus  tgtcctt-gcg-ccgcag------a-cctg
            Weddell seal  tgtcctt-gcg-ccgcag------a-cctg
        Black flying-fox  tgtcctt-ctgtcccgagtccactg-tcta
                 Megabat  tg---tt-ctgtttccag------a-tcca
                 Ferret   ==============================
                     Dog  ==============================
      Chinese tree shrew  ==============================
                  Baboon  ==============================
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 34 of 836 in window, 232946 - 232967, 22 bps 
B D                Human  tccca-ctagcggt----gactg-ttg-g
B D                Chimp  tccca-ctagcggt----gactg-ttg-g
B D              Gorilla  tccca-ctagcggt----gagtg-ttg-g
B D            Orangutan  tccca-ctagcggt----gactg-tcg-g
B D               Gibbon  tccca-ctagcggt----gactg-tcg-g
B D  Crab-eating macaque  tccca-ctagcggt----gac--------
B D         Green monkey  tccca-ctagcggt----gac--------
B D             Marmoset  t-cca-ctggcagt----gactg-tcg-g
B D      Squirrel monkey  tccca-ctggcagt----gactg-tcc-g
B D             Bushbaby  cccca-cgggctgc----ggatg-tcgta
      Chinese tree shrew  tccca-ctggcagccccggactgaatg-c
B D                  Pig  ctctg-ctggcggt----gccag-----g
B D               Alpaca  ccgcg-ctggcgat----accgg-cca-c
          Bactrian camel  ccgcg-ctggcgat----accgg-cca-c
B D              Dolphin  atccg-ctggcgat----accga-cca-a
            Killer whale  atcag-ctggcgat----accga-cca-a
        Tibetan antelope  atgct-ctgccggc----gcggg------
B D                  Cow  atcct-ttgccggc----acggg------
B D                Sheep  atcct-ctgccggc----gcggg------
           Domestic goat  atcct-ctgccggc----gcggg------
B D     White rhinoceros  cctgc-c--gctgt-----cctg-ccg-a
B D                  Cat  ctcccgctggctgt----gtctg-acg-c
B D                Panda  ctccc-c------------------ct-a
          Pacific walrus  ctccc-cgggctgt----gtgtg-acg-g
            Weddell seal  ctccc-cgggctgt----gtgtg-acg-g
        Black flying-fox  cccct-ctggctgt----gcctg-cca-g
B D              Megabat  tccca-ctggctgt----gcttg-tca-a
B D              Ferret   =============================
B D                  Dog  =============================
B D               Baboon  =============================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 34 and 35 in window
B D                 Pig 3bp
B D              Alpaca 3bp
         Bactrian camel 3bp
B D             Dolphin 3bp
           Killer whale 3bp
B D                 Cat 1bp
B D               Panda 1bp
         Pacific walrus 1bp
           Weddell seal 1bp
       Black flying-fox 3bp
B D             Megabat 3bp

Alignment block 35 of 836 in window, 232968 - 232975, 8 bps 
B D                Human  gtgttta-c
B D                Chimp  gtgttta-c
B D              Gorilla  gtgttta-c
B D            Orangutan  gtgttta-c
B D               Gibbon  gtgttca-c
B D             Marmoset  gtgttta-c
B D      Squirrel monkey  gtgtgta-c
B D             Bushbaby  gtgttta-t
      Chinese tree shrew  gtgtgta-c
B D                  Pig  gtgttca-c
B D               Alpaca  gtttgcc-t
          Bactrian camel  gtttgca-t
B D              Dolphin  gtgtcca-c
            Killer whale  gtgtcca-c
B D                Horse  gtgttca-c
B D     White rhinoceros  gcgtcca-c
B D                  Cat  gtgtttgcc
B D                Panda  gggttcg-c
          Pacific walrus  gtgttcg-c
            Weddell seal  gtgttct-c
        Black flying-fox  gtgttca-c
B D              Megabat  gtgttta-c
B D              Ferret   =========
B D                  Dog  =========
          Domestic goat  ---------
B D                Sheep  ---------
B D                  Cow  ---------
       Tibetan antelope  ---------
B D               Baboon  =========
B D               Rhesus  NNNNNNNNN
B D         Green monkey  ---------
B D  Crab-eating macaque  ---------

Alignment block 36 of 836 in window, 232976 - 232977, 2 bps 
B D                Human  ct
B D                Chimp  ct
B D              Gorilla  ct
B D            Orangutan  ct
B D               Gibbon  ct
B D  Crab-eating macaque  ct
B D               Baboon  at
B D         Green monkey  ct
B D             Marmoset  ct
B D      Squirrel monkey  ct
B D             Bushbaby  c-
      Chinese tree shrew  -t
B D                  Pig  at
B D              Dolphin  at
            Killer whale  at
B D                Horse  gt
B D     White rhinoceros  gg
B D                  Cat  ct
B D                Panda  gt
          Pacific walrus  gt
            Weddell seal  gt
        Black flying-fox  at
B D              Megabat  at
         Bactrian camel  --
B D               Alpaca  --
B D              Ferret   ==
B D                  Dog  ==
          Domestic goat  --
B D                Sheep  --
B D                  Cow  --
       Tibetan antelope  --
B D               Rhesus  NN

Inserts between block 36 and 37 in window
B D              Baboon 1018bp
     Chinese tree shrew 1bp

Alignment block 37 of 836 in window, 232978 - 233006, 29 bps 
B D                Human  tcccggtg-tcccactga-gaagcgggctct
B D                Chimp  tcccggtg-tcccactga-gaagtgggctct
B D              Gorilla  tcccggtg-tcccactga-gaagtgggctct
B D            Orangutan  tcccggtg-tcccactga-gaagtgagcttt
B D               Gibbon  tcccggtg-tcccactga-gaagtgggctct
B D  Crab-eating macaque  tcccggtg-ccccactga-gaagtgggctct
B D         Green monkey  tcccggtg-tcccactga-gaagtgggctct
B D             Marmoset  ttcccatg-tcccacttg-gaagtgagctat
B D      Squirrel monkey  ttccgatg-tcccactca-gaagtggcctgt
      Chinese tree shrew  ttgcgatg-tgccac--g-gcagtgagctct
B D                  Pig  tcccggta-gctcacggg-aaagtgtgctc-
B D               Alpaca  tcctgacg-tctcacggg-aaagtgtgctct
          Bactrian camel  tcccgacg-tctcacggg-aaagtgtgctct
B D              Dolphin  tcccgatg-tctcacggg-aaagtgtgctct
            Killer whale  tcccgatg-tctcacggg-aaagtgtgctct
        Tibetan antelope  tgccgctc-cctcatggg-acagtgtcctc-
B D                  Cow  taccgctc-cctcatggg-acagtgtcctc-
B D                Sheep  taccgctc-cctcatggg-acagtgtcctc-
           Domestic goat  taccgctc-cctcatggg-acagtgtcctc-
B D                Horse  tcca---g-ccccactgg-agagtgcgctcc
B D     White rhinoceros  tcccgatg-tcccgttgc-caagtgcgctct
B D                  Cat  gtcca--catcccactggaaaagggagctct
B D                Panda  gctgg--c-tcccgctgg-aaagggagcgcc
          Pacific walrus  gcccg--g-tcccgcggg--aagggagcgcc
            Weddell seal  gcccg--g-tcccgcggg-aaagggcgctcc
        Black flying-fox  ttctgatg-tcccattgg-aaggcgagctcg
B D              Megabat  ttctggtg-tccactgga-aaaatgtgctct
B D              Ferret   ===============================
B D                  Dog  ===============================
B D             Bushbaby  -------------------------------
B D               Baboon  ===============================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 38 of 836 in window, 233007 - 233086, 80 bps 
B D                Human  t-cct-tgg-caggggct--------tcttcattgcc-tcgctgtggatgtcg---------aggt---g
B D                Chimp  t-cct-tgg-caggggct--------tcttcattgcc-tcgctgtggatgtcg---------aggt---g
B D              Gorilla  t-cct-tgg-cgggggcg--------tcttcattgcc-tcgctgtggatgtcg---------aggt---g
B D            Orangutan  t-cct-tgg-caggggct--------tcttcattgcc-tcgctgtggatgtcg---------aggt---g
B D               Gibbon  t-cct-tgg-caggggct--------tcttcatggcc-tcgctgtggatgtcg---------aggt---g
B D  Crab-eating macaque  t-cct-tgg-caggggct--------tcttcactgta-tcgctgtggatgtcg---------aggt---g
B D         Green monkey  t-cct-tgg-caggggct--------tctttactgca-tcgctgtggatgtcg---------aggt---g
B D             Marmoset  t-cct-tgg-catgggct--------tctt---tgca-tcgctgaggatgtcg---------agat----
B D      Squirrel monkey  t-cct-tgg-catgggct--------tctt---tgca-tcgctgagggtgtcg---------agat----
B D             Bushbaby  ---------------------------ctccgttgca-tcactgtggatgtcg---------aggt---g
      Chinese tree shrew  t-tct-gggaaaggggca--------tcttcgtttca-tccctgacgatgggg---------aggt---g
B D                  Pig  ----------------------------tttgttcca-tccctgcgaatgtag---------a------g
B D               Alpaca  tccgg-ggc-agagagct--------tctttgttcca-cccccgtggacgtcgcgctgtggca------a
          Bactrian camel  tcctg-ggc-agagagct--------tctttgttcca-cccccgtggacgttgcgctgtggca------a
B D              Dolphin  t-ctg-ggc---agagca--------tctttgttcca-cccctgtggaagtcg---------a------g
            Killer whale  t-ctg-ggc---agagca--------tctttgttcca-cccctgtggatggcg---------a------g
        Tibetan antelope  --ctg-ggc---agagca--------cctttgctcca-ttcc-gtgggtgtcg---------a------g
B D                  Cow  --ctg-ggc---agagca--------tctttgctcca-ttcc-atgggtgtcg---------a------g
B D                Sheep  --ctg-ggc---agagca--------cctttgctccg-ttcc-gtgggtgtcg---------a------g
           Domestic goat  --ctg-ggc---agagca--------cctttgctccg-ttcc-gtgggtgtcg---------a------g
B D                Horse  t-gcg-acc-cgagggcg--------gctgtgttccg-tccctgcgggtgtcg---------gggt---g
B D     White rhinoceros  t-gtg-atc-ggagggc---------gctgtcttccg-tccctgtgggcgtcg---------gggt---g
B D                  Cat  t-cctgggc-agagatca--------actgtgatcccatccctttgaatgtcc---------agtt---g
B D                Panda  t-cca---------------------------------tcccggagagtgtcg---------cggt---g
          Pacific walrus  t-ctg-----------------------------------ccggggagtgtcg---------cggt---g
            Weddell seal  t-ccg---------------------------------tcccggggagtgtcg---------cggt---g
        Black flying-fox  t-gct-ggg-cagagggc--------catttcatcca-tccctgtgggtgtcg---------aaatgcgg
B D              Megabat  t-cct-ggg-caggatta--------tgtttattcta-gtcctgtgaatgcag---------gggc---g
B D              Opossum  t-cct-ggc-caggagctataggtgctgttcatggac-ccccagaaggc-------------tggt---g
B D              Ferret   ======================================================================
B D                  Dog  ======================================================================
B D               Baboon  ======================================================================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  gggcaggagagtgaggagaaaac-a--gag-------gaggg---ag
                   Chimp  gggcaggagagtgaggagaaaac-a--gag-----aggaggg---ag
                 Gorilla  gggcaggagagtgaggagaaaac-g--gag-----aggaggg---ag
               Orangutan  gggcaggagagtgaggagaaaac-a--gag-----atgaggg---ag
                  Gibbon  gggcaggagagtgaggagaaaac-a--gag-----aagaggg---ag
     Crab-eating macaque  gggcaggatcgtgaggagaaaacaa--gag-----aagaggg---ag
            Green monkey  gggcaggagagtgaggagagaacaa--gag-----aagaggg---ag
                Marmoset  gggcaggggagtgagtaaaatac-a--gcg-----aagagag---ag
         Squirrel monkey  gggcaggggggtgaggagaaaac-a--gag-----aagagag---ag
                Bushbaby  gaggcaagggatgaggagaaaaa-a--ggc-----a-----------
      Chinese tree shrew  gggcagaggat--------gaac-a--gag-----aaaaaga---gg
                     Pig  tgggcagggacgtggagg------a--agg-----gataacg---ag
                  Alpaca  ggggtgggacaggacgag------a--ccg-----aa---gg---ag
          Bactrian camel  ggggtgggacaggacgag------a--ccg-----aa---gg---ag
                 Dolphin  tgggcgggggaggatgag------a--cag-----aacaagg---ag
            Killer whale  tgggcgggggaggatgag------a--cag-----aacaagg---ag
        Tibetan antelope  ggaggcgggcaggccgag------a--ctg-----aaccggg---ag
                     Cow  tggggcgggcaggccgag------a--ctg-----aa----------
                   Sheep  tgaggcgggcaggccgag------a--ctg-----aaccggg---ag
           Domestic goat  tgaggcgggcaggccgag------a--ctg-----aaccggg---ag
                   Horse  tggc-gggggatgcggag------a--aaa-----gacagaa---cg
        White rhinoceros  tggcggggggatgaggag------aacaga-----gacagag---cg
                     Cat  tgtccgcaggatgaggat------a--caa-----ga----------
                   Panda  tgtcgggaggatgaggag------a--aaa-----gacaagg---ag
          Pacific walrus  tgtcgggagcatgaggag------a--aga-----gacgagg---ag
            Weddell seal  tgtcgggagcttgaggag------g--aag-----gacgagg---ag
        Black flying-fox  gggc-ggggggtgagggg------a--agg-----gacggaggaacg
                 Megabat  aggc-gggtgatgaggaa------a--tggagaccaagggagaacca
                 Opossum  tggcccagggcagagggtgtggc-a--gag-----aggaggg---gg
                 Ferret   ===============================================
                     Dog  ===============================================
                  Baboon  ===============================================
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 38 and 39 in window
B D                 Pig 8bp
B D              Alpaca 4bp
         Bactrian camel 4bp
B D             Dolphin 11bp
       Tibetan antelope 50bp
B D                 Cow 20bp
B D               Sheep 52bp
          Domestic goat 22bp
B D               Horse 11bp
B D    White rhinoceros 11bp
B D                 Cat 9bp
B D               Panda 11bp
         Pacific walrus 11bp
           Weddell seal 11bp
       Black flying-fox 11bp
B D             Megabat 19bp

Alignment block 39 of 836 in window, 233087 - 233089, 3 bps 
B D                Human  gta
B D                Chimp  gta
B D              Gorilla  gta
B D            Orangutan  gta
B D               Gibbon  gta
B D  Crab-eating macaque  gta
B D         Green monkey  gta
B D             Marmoset  gta
B D      Squirrel monkey  gtg
      Chinese tree shrew  gcg
B D                  Pig  ggg
B D               Alpaca  gga
          Bactrian camel  gga
            Killer whale  aca
        Tibetan antelope  gga
B D                Sheep  gga
B D                Horse  --g
B D     White rhinoceros  --g
B D                  Cat  --t
B D                Panda  --a
          Pacific walrus  --a
            Weddell seal  --a
        Black flying-fox  --g
B D              Megabat  --g
B D              Opossum  atg
B D              Ferret   ===
B D                  Dog  ===
          Domestic goat  ===
B D                  Cow  ===
B D             Bushbaby  ---
B D              Dolphin  ===
B D               Baboon  ===
B D               Rhesus  NNN

Inserts between block 39 and 40 in window
B D                 Pig 14bp
B D              Alpaca 5bp
         Bactrian camel 5bp
           Killer whale 8bp
       Tibetan antelope 4bp
B D               Sheep 4bp
B D               Horse 5bp
B D    White rhinoceros 6bp
B D                 Cat 1bp
B D               Panda 1bp
         Pacific walrus 1bp
           Weddell seal 1bp
       Black flying-fox 2bp
B D             Megabat 2bp

Alignment block 40 of 836 in window, 233090 - 233120, 31 bps 
B D                Human  ---------gagccaacgagcgagaaaag-------gggagggaagt
B D                Chimp  ---------gagccaacgagcgagaaaag-------gggagggaaat
B D              Gorilla  ---------gagccaacgagcgagaaaag-------gggagggaagt
B D            Orangutan  ---------ggaccagcgagcgagaaaag-------gggagggaaat
B D               Gibbon  ---------gcgccagcgagcgagaaaag-------ggaagggaaat
B D  Crab-eating macaque  ---------gggccagcgagggacaaaag-------gggagggaaat
B D         Green monkey  ---------gggccagcgagggacaaaag-------gaaagggaaat
B D             Marmoset  ---------gggccagcgaggaagaaagg-------gggagggaaac
B D      Squirrel monkey  ---------gggccagcgaggacgaaagg-------gggacggaagt
B D             Bushbaby  -----------gccatcgagggagagaaa-------ggaagggtagt
      Chinese tree shrew  ---------agagcggtgaatgagaacgg-------gggaggtaaac
B D                  Pig  ---------gggagcgtgaggacttgtaa-------agtagga----
B D               Alpaca  ------------------aggacttggaa-------agtaaaa----
          Bactrian camel  ------------------aggacttggaa-------agtaaaa----
        Tibetan antelope  ----------ggtgcagtgggactggaga-------gacaaaa----
B D                  Cow  ------------------aggacttgaaa-------agcaaaa----
B D                Sheep  ----------ggtgcagtgggactggaga-------gacaaaa----
           Domestic goat  ------------------aggacttgaaa-------agtgagg----
B D                Horse  ---------aggagagtgagggcttagaa-------aggg--taaat
B D     White rhinoceros  ---------gggagagtgagggcttaaaa-------aagggttaggt
B D                  Cat  ---------gagacgg--agggagtaagg-------gagagtcaagt
B D                Panda  ---------gggacggcaagggcttaaaa-------cggagtaacgt
          Pacific walrus  ---------gggacggcaagggcggaaca-------cggagttacgc
            Weddell seal  ---------ggggcggcaagggcttaacg-------cggagttacgc
        Black flying-fox  ---------gggagagcgagggctcagaa-------aagggtacaac
B D              Megabat  ---------gagggaaggaggaacaggag-------gagggtaaaac
B D              Opossum  ggaccattagggctggggggtgccaaaaagcatcatgggaga-----
B D              Ferret   ===============================================
B D                  Dog  ===============================================
           Killer whale  ===============================================
B D              Dolphin  ===============================================
B D               Baboon  ===============================================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 40 and 41 in window
B D                 Pig 48bp
B D              Alpaca 16bp
         Bactrian camel 15bp
       Tibetan antelope 242bp
B D                 Cow 1bp
B D               Sheep 9bp
          Domestic goat 1bp

Alignment block 41 of 836 in window, 233121 - 233133, 13 bps 
B D                Human  tt-----------agatgggaagt
B D                Chimp  tt-----------agatgggaagt
B D              Gorilla  tt-----------agatgggaagt
B D            Orangutan  tt-----------agatgggaagt
B D               Gibbon  tt-----------agatgggaaat
B D  Crab-eating macaque  tt-----------agatgggaagt
B D         Green monkey  tt-----------agatggcaagt
B D             Marmoset  tt--------agaagatgggaagt
B D      Squirrel monkey  tt--------agaagacgggaagt
B D             Bushbaby  tt--------agaagacgggaagt
      Chinese tree shrew  ta-----------gggatggtgca
B D                  Pig  ----------agaggtgggagga-
B D               Alpaca  ---------------ggggac---
          Bactrian camel  ---------------ggggac---
B D                  Cow  ----------agaggagggaggg-
B D                Sheep  ----------aaaaaagggaagt-
           Domestic goat  ----------agaggagggaggg-
B D                Horse  ----------agggaataggagg-
B D     White rhinoceros  ----------ggacagtgggagg-
B D                  Cat  ----------ggaggatgggagg-
B D                Panda  ----------gggggatgggagg-
          Pacific walrus  ----------ggaggatgggagg-
            Weddell seal  ----------ggaggatgggagc-
        Black flying-fox  ----------agggcacgggcga-
B D              Megabat  ----------tgaggaggga----
B D              Opossum  ttggatggcagtatgaggaga---
B D              Ferret   ========================
B D                  Dog  ========================
       Tibetan antelope  ========================
           Killer whale  ========================
B D              Dolphin  ========================
B D               Baboon  ========================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 41 and 42 in window
B D                 Pig 9bp
B D              Alpaca 1bp
         Bactrian camel 1bp
B D                 Cow 9bp
B D               Sheep 218bp
          Domestic goat 9bp
B D               Horse 1bp
B D    White rhinoceros 1bp
B D                 Cat 1bp
B D               Panda 1bp
         Pacific walrus 1bp
           Weddell seal 1bp
       Black flying-fox 1bp

Alignment block 42 of 836 in window, 233134 - 233188, 55 bps 
B D                Human  ggatgggtctgag-------------gaatttgaacaaacac--cgacaat-gaa--ggagagtgac-ct
B D                Chimp  ggatgggtctgag-------------gaatttgaacaaacat--tgacaat-gaa--ggagagtgac-ct
B D              Gorilla  ggatgggtctgag-------------gaatttgaacaaacac--tgacagt-gaa--ggagagtgac-ct
B D            Orangutan  ggatgggtctgag-------------gaatttgagcaaacac--tgacaat-gaa--ggagagtgac-ct
B D               Gibbon  ggatgggtctgag-------------gaatttgaacaaacac--tgacaat-gaa--ggagagtgac-ct
B D  Crab-eating macaque  ggatgggtgtgag-------------gaatttgaacaaacac--tgagaat-gaa--ggagagtgac-ct
B D         Green monkey  ggatgggtctgag-------------gaatttgaacaaacac--tgagaat-gaa--ggagagtgac-ct
B D             Marmoset  ggatgggtctgaa-------------gaatttagacaaac----tgagaat-gaa--ggagagtgac-ct
B D      Squirrel monkey  ggatgggtctgaa-------------gaatttagacaaac----tgagaat-gaa--ggagagtgac-cc
B D             Bushbaby  aggtgtgtgtgag-------------gaattgggaaaaacacagtgtgaat-gaa--gaagagtgac-ct
      Chinese tree shrew  ggttgattacaaa-------------gaacttggaaagac----t---------------gagtgctgct
B D                  Pig  ---------caat-------------ggaattggaaggacagcgtacaggt--gcaaagaaattgac-ct
B D               Alpaca  ---------gatt-------------ggacttggaaagacaaaatacaggt-gaaaaaggaagtgac-ct
          Bactrian camel  ---------gatt-------------ggacttggaaagacaaaatacaggt-gaaaaagaaagtgac-ct
B D                  Cow  ---------cagt-------------gggactggagagacaaaataccggt-aaaaaaggaaagtga-ct
           Domestic goat  ---------cggt-------------gggactggagagacaaaataccggtaaaaaaaggaaagtga-ct
B D                Horse  -ggtgtgtgcagt-------------ggacttggtaagaggcaataaaagt-ggaaaagaaagtgac-ct
B D     White rhinoceros  gggtgggtgcagt-------------ggacttggtaagacgcagtaatagt-tagaaagaaagtgac-ca
B D                  Cat  gggtggttacaat-------------ggactttcacaggaacagtgacagt-gagaaagaaagtgac-ct
B D                Panda  gggtggttacaga-------------ggactttgaaagaagcagtgaaagt-gaggaagaatgtggc-ct
          Pacific walrus  gggtggttacaga-------------ggactttg-aggaagcagcgaaagt-gaggaagaaggcggc-ct
            Weddell seal  gggtggttacag--------------gggctttg-aagaagcagtgaaggt-ga-gaagaaagtggc-ct
        Black flying-fox  gggtgggtgcggt-------------ggacttgga---acatagtcaaagt-gaa----aaagtgac-ct
B D              Megabat  gggtgagtccggt-------------ggatttggaaagacacagtaagaat-gaa--agagagtgac-ct
B D              Opossum  gcctgggccagaggaaaatcacctcaggagctgaatggaggc--tggtagg-aag--gggaagggac-ct
B D              Ferret   ======================================================================
B D                  Dog  ======================================================================
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
           Killer whale  ======================================================================
B D              Dolphin  ======================================================================
B D               Baboon  ======================================================================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  gagc
                   Chimp  gagc
                 Gorilla  gagc
               Orangutan  gagc
                  Gibbon  gagc
     Crab-eating macaque  gagc
            Green monkey  gagc
                Marmoset  gagc
         Squirrel monkey  gaga
                Bushbaby  ggac
      Chinese tree shrew  gagc
                     Pig  gggc
                  Alpaca  gggc
          Bactrian camel  gggc
                     Cow  gaat
           Domestic goat  gaat
                   Horse  gggc
        White rhinoceros  gggc
                     Cat  gggg
                   Panda  gggg
          Pacific walrus  ggg-
            Weddell seal  gggg
        Black flying-fox  gggc
                 Megabat  aggc
                 Opossum  cagg
                 Ferret   ====
                     Dog  ====
                   Sheep  ====
        Tibetan antelope  ====
            Killer whale  ====
                 Dolphin  ====
                  Baboon  ====
                  Rhesus  NNNN

Alignment block 43 of 836 in window, 233189 - 233199, 11 bps 
B D                Human  -aagtagtagtg
B D                Chimp  -aagtagtagtg
B D              Gorilla  -aagtagtagtg
B D            Orangutan  -aagtactagtg
B D               Gibbon  -aagcagtagtg
B D  Crab-eating macaque  -aagtagtagtg
B D         Green monkey  -aagtagtagtg
B D             Marmoset  -aggaagtagtg
B D      Squirrel monkey  -gagaagtcgcg
B D             Bushbaby  -aagaagcagtg
      Chinese tree shrew  -aacggg-----
B D                  Pig  -aagatgcagta
B D               Alpaca  -aagaagcagta
          Bactrian camel  -aagaagcagta
        Tibetan antelope  -aagaggcatta
B D                  Cow  -aagtagcattg
B D                Sheep  -aagaggcatta
           Domestic goat  -aagaagcattg
B D                Horse  -gagaagcactg
B D     White rhinoceros  -aggaagcagtg
B D                  Cat  -agaagatagtt
B D                Panda  -aga--acagta
            Weddell seal  -aaa--accgta
        Black flying-fox  -aacaagcagt-
B D              Megabat  -aaaaagcagtg
B D              Opossum  aggccagca---
B D              Ferret   ============
B D                  Dog  ============
           Killer whale  ============
B D              Dolphin  ============
         Pacific walrus  ------------
B D               Baboon  ============
B D               Rhesus  NNNNNNNNNNNN

Inserts between block 43 and 44 in window
       Tibetan antelope 1bp
B D                 Cow 94bp
B D               Sheep 1bp
          Domestic goat 209bp

Alignment block 44 of 836 in window, 233200 - 233201, 2 bps 
B D                Human  gg
B D                Chimp  gg
B D              Gorilla  gg
B D            Orangutan  gg
B D               Gibbon  gg
B D  Crab-eating macaque  gg
B D         Green monkey  gg
B D             Marmoset  ac
B D      Squirrel monkey  ag
B D             Bushbaby  ta
B D                  Pig  gg
B D               Alpaca  gg
          Bactrian camel  gg
        Tibetan antelope  -g
B D                  Cow  -g
B D                Sheep  -g
B D                Horse  gg
B D     White rhinoceros  gg
B D                  Cat  ca
B D                Panda  ta
            Weddell seal  ca
B D              Megabat  ag
B D              Opossum  ga
B D              Ferret   ==
B D                  Dog  ==
          Domestic goat  ==
     Chinese tree shrew  --
           Killer whale  ==
       Black flying-fox  --
B D              Dolphin  ==
         Pacific walrus  --
B D               Baboon  ==
B D               Rhesus  NN

Inserts between block 44 and 45 in window
B D                 Cow 117bp

Alignment block 45 of 836 in window, 233202 - 233293, 92 bps 
B D                Human  g-taaatgg--------aaatagacaaaatggg----aatcagcagagatat---gg---aggacaga--
B D                Chimp  g-taaatgg--------aaatagacaaaatggg----aatcagcagagatat---gg---aggacaga--
B D              Gorilla  g-taaatgg--------aaatagacaaaatggg----aatcagcagagatat---gg---aggacaga--
B D            Orangutan  g-taaatgg--------aaatagacaaaatggg----aatcagcagagatat---gg---aggacaga--
B D               Gibbon  g-taaatgg--------aaatagac-aaatggg----aatcagcagagatgt---ag---aggacaga--
B D  Crab-eating macaque  g-taaatgg--------aaatagacaaaacggc----aatcagcagagatgt---gg---aggacaga--
B D         Green monkey  a-taaatgg--------aaatagacaaaacggg----aatcagcagagatgg---gg---aggacaga--
B D             Marmoset  a-taaatgg--------aaatagacaagacggg----aatcagcagagatgggaagg---agggcaga--
B D      Squirrel monkey  g-taaatag--------aagtagacaagacggggatcaatcagcagagacgtgaagg---agggcagg--
B D             Bushbaby  a-taaatga--------aaatagagggaaatgg----gatcggcggagagat---gg---agga------
      Chinese tree shrew  ----------------------gaccgaaaggg----ggtcctcttagagat---gg---cagagggggc
B D                  Pig  g-ttcgtga--------aaataaaccaaaagga----gaccaacagggagat---ggcaaaggacaga--
B D               Alpaca  a-tacgtga--------aaacagacaaaa--ga----gatcaacagggaggt---ggccaaggacaga--
          Bactrian camel  a-tacgtga--------aaacagacaaaa--ga----gatcaacagggaggt---ggccaaggacaga--
        Tibetan antelope  g-tacatga--------aaacagacaaaaagga----gatcaatacggagat---ggccaaggacaga--
B D                  Cow  g-tacatga--------aaacagacaaaaagga----gatcaatacggagat---ggccaaggacaga--
B D                Sheep  g-tacatga--------aaacagacaaaaagga----gattaatatggagat---ggccaaggacaga--
           Domestic goat  g-tacatga--------aaacagacaaaaagga----gattaacacggagat---ggccaaggacaga--
B D                Horse  a-tacatga--------aaatagaca-aa----------------aagagat---gaacaagcgtaga--
B D     White rhinoceros  attacgtga--------aaacagacagaa----------------aggaggt---gaacaaggataga--
B D                  Cat  g-tatgtgaaaagagacaaaaagatc-------------------agtacgg---aaatagggacaga--
B D                Panda  g-cttgtga--------agacaggtc-------------------aacacgg---gaatagggaca----
          Pacific walrus  -------ga--------aggcggatc-------------------agcacgg---gaatagggacg----
            Weddell seal  g-cctgcga--------agacagatc-------------------agcacgg---gaatagggaca----
        Black flying-fox  ---------------------------------------------agggtgc---gta------------
B D              Megabat  a-gaaatga--------aaatagacaaaaag--------------aggatca---gcagagagatgaa--
B D              Opossum  g-caccagg--------aag-----------------gccctgcagtgaggg---ag--gggggctga--
B D              Ferret   ======================================================================
B D                  Dog  ======================================================================
           Killer whale  ======================================================================
B D              Dolphin  ======================================================================
B D               Baboon  ======================================================================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  atac----------aatgaggaggccttgaccgt---cag-tagcag-a--g-agggcagc
                   Chimp  atac----------aatgaggaggccttgatcgt---cag-tagcag-a--g-agggcaag
                 Gorilla  atac----------aatgaggaggccttggccgt---cag-tagcag-a--g-agggcaac
               Orangutan  atac----------aatgaggaggccttgaccgt---cag-tagcag-a--g-aggtcaac
                  Gibbon  atac----------aatgaggaggccttgaccgt---cag-tagcag-aaga-agggcaac
     Crab-eating macaque  atac----------aatgagggggccctgactgt---cag-tagcag-a--g-ggggcaac
            Green monkey  atac----------aatgagggggccctgaccgt---cag-tagcag-a--c-ggggcaac
                Marmoset  atgc----------aatgagaaggccttgaccat---cac-tagcag-a--g-ggggcagc
         Squirrel monkey  aaac----------aatgagaaggccttgaccat---cac-tagcag-g--g-ggggcagc
                Bushbaby  --------------------gaggcct--actgc---cag-aagcag-a-----gggcagc
      Chinese tree shrew  atag----------aaggtgagagccttgaccag---cagttaggaa-g--g-gtgaaaac
                     Pig  ctg-----------gatgaggggattttcaccaa---cag-aagcag-t--aggggaaaat
                  Alpaca  ata-----------attgagggggctttcaacaa---cag-tagcag-t--tggggacagt
          Bactrian camel  ata-----------gatgagggggctttcaacaa---cag-tagcag-t--tggggacagt
        Tibetan antelope  atg-----------gaggaggggactttcaccag---cag-tagcag-t--tggggagagt
                     Cow  atg-----------gaggcggggactttcacccg---cag-tagcag-t--tggggaaagt
                   Sheep  atg-----------gaggaggggactttcaccag---cag-tagctgtt--tggggag---
           Domestic goat  atg-----------gaggaggggactttcaccag---cag-tagcag-t--tggggag---
                   Horse  ata-----------gatgaggggactttgaccaa---gag-tcacag-t--t-ggggcaat
        White rhinoceros  aca-----------ggtgaggggac-ctgaccaa---gag-tagcag-t--t-ggggcaat
                     Cat  gta-----------tgtaatcagactttgaccaa---cag-tagcat-t-----gggcgat
                   Panda  --a-----------tatagtgagactctgaccaa---cag-tggccg-c-----gggcgat
          Pacific walrus  --a-----------tgcagtgagaccctgacctc---cac-tggcgg-c-----gggcgat
            Weddell seal  --a-----------tccagtgagactctgacctccggcgg-cggcgg-c-----gggcgat
        Black flying-fox  --------------gatgaggggacttggaccaa---tag-tagcag-t--t-ggggcaat
                 Megabat  agagaacagactaggaggagggagttttgaccaa---cag-tagaaa-t--g-gggacaaa
                 Opossum  gga-----------gaggaggagggccttcccca---cag--------g--g-agggctgc
                 Ferret   =============================================================
                     Dog  =============================================================
            Killer whale  =============================================================
                 Dolphin  =============================================================
                  Baboon  =============================================================
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 46 of 836 in window, 233294 - 233317, 24 bps 
B D                Human  ag-aagcctaa--ttcccaaattcttt
B D                Chimp  ag-aagcctaa--ttcccaaattcttt
B D              Gorilla  ag-aagcctaa--ttcccaaattcctt
B D            Orangutan  ag-aagcctaa--ttcccaaattcctt
B D               Gibbon  agaaagcctaaattccccaaattcctt
B D  Crab-eating macaque  ag-aagcctaa--ttctcaaattcctt
B D         Green monkey  ag-aagcctaa--ttcccaaattcctt
B D             Marmoset  ag-aagcctaa--ttcccaaattcctt
B D      Squirrel monkey  ag-aagcctaa--ttcccagattcctt
B D             Bushbaby  ag-gagggaaa--ttcccaaatcc---
      Chinese tree shrew  at-aaagatag--atgccaaattcctt
B D                  Pig  ag-aaaggtag--attccaaagtcatt
B D               Alpaca  ag-aaggatag--attccaaattcact
          Bactrian camel  ag-aaggatag--attccaaattcatt
        Tibetan antelope  ag-aaggatag--attccaaattcatt
B D                  Cow  ag-aaggatag--attccaaattcatt
B D                Sheep  ag-aaggatag--attccaaattcatt
           Domestic goat  ag-aaggatag--attccaaattcatt
B D                Horse  ag-acgggtag--actccaaatgcatt
B D     White rhinoceros  ag-aagggtag--gttccaaattcgtt
B D                  Cat  ag-gaggttgg--attgcagtctcatt
B D                Panda  gg-aaggggat--attgcagacgcgtt
          Pacific walrus  gg-aaggggac--actgcagacgcatt
            Weddell seal  gg-aa-gggac--gttgcagacgcgtt
        Black flying-fox  ag-aagggtag--attccaaatatatt
B D              Megabat  gg-aagggtag--atctcaaa------
B D              Ferret   ===========================
B D                  Dog  ===========================
           Killer whale  ===========================
B D              Dolphin  ===========================
B D               Baboon  ===========================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 46 and 47 in window
       Tibetan antelope 28bp
B D                 Cow 23bp
B D               Sheep 28bp
          Domestic goat 154bp

Alignment block 47 of 836 in window, 233318 - 233343, 26 bps 
B D                Human  agatgg---ttttct---gatttcca-aattag
B D                Chimp  agatgg---ttttct---gatttcca-aactag
B D              Gorilla  agatgg---ttttct---gatttcca-aattag
B D            Orangutan  agatgg---ttttct---gatttcca-aattag
B D               Gibbon  agatgg---ttttct---gatttcca-aattag
B D  Crab-eating macaque  agatga---ttttct---gatttcca-aattag
B D         Green monkey  agatgg---ttttct---gatttcca-aattag
B D             Marmoset  agatgg---ctttct---gatttcca-agttac
B D      Squirrel monkey  agatgg---ttttct---gatttcca-aattac
      Chinese tree shrew  acatga---ttttct---aatttcca-gattac
B D                  Pig  agattt---tttttttttagtttccc-agttac
B D               Alpaca  aggttt---tttttc---actttcca-aattac
          Bactrian camel  aggttt---tttttt-taactttcca-aattac
        Tibetan antelope  aagtcg---tctccg---actctttgcgacccc
B D                  Cow  aagtcg---tctcgg---actctttg-gacccc
B D                Sheep  aagttg---tctccg---actctttgcaacccc
B D                Horse  -aggtgct-ttttta---aatttcca-aattac
B D     White rhinoceros  -agatgct-ttttta---tatttcca-aactac
B D                  Cat  -aattt---tttttt---aatttcta-aattgc
B D                Panda  -agataagtttttta---aagttcta-aattgc
          Pacific walrus  -agatatg-ttttta---aagttcta-aattgc
            Weddell seal  -agatacg-ttttta---aagttcta-aatcgc
        Black flying-fox  -ggttgtt-ttttta---aatttcca-cattaa
B D              Megabat  ----------------------ttca-atctgt
B D              Ferret   =================================
B D                  Dog  =================================
          Domestic goat  =================================
           Killer whale  =================================
B D             Bushbaby  ---------------------------------
B D              Dolphin  =================================
B D               Baboon  =================================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 47 and 48 in window
       Tibetan antelope 110bp
B D                 Cow 82bp
B D               Sheep 109bp

Alignment block 48 of 836 in window, 233344 - 233348, 5 bps 
B D                Human  tttcc
B D                Chimp  tttcc
B D              Gorilla  tttcc
B D            Orangutan  tttcc
B D               Gibbon  tttcc
B D  Crab-eating macaque  tttcc
B D         Green monkey  tttcc
B D             Marmoset  tttcc
B D      Squirrel monkey  tttcc
B D             Bushbaby  ---ac
      Chinese tree shrew  tct--
B D                  Pig  tttcc
B D               Alpaca  ttttc
          Bactrian camel  ttttc
        Tibetan antelope  tttcc
B D                Sheep  tttcc
           Domestic goat  tttcc
B D                Horse  tttcg
B D     White rhinoceros  tttca
B D                  Cat  tttcc
B D                Panda  tttcc
          Pacific walrus  ttccc
            Weddell seal  tttcc
        Black flying-fox  attac
B D              Megabat  attcc
B D              Ferret   =====
B D                  Dog  =====
B D                  Cow  =====
           Killer whale  =====
B D              Dolphin  =====
B D               Baboon  =====
B D               Rhesus  NNNNN

Alignment block 49 of 836 in window, 233349 - 233353, 5 bps 
B D                Human  ctttt
B D                Chimp  ctttt
B D              Gorilla  ctttt
B D            Orangutan  ctttt
B D               Gibbon  ctttt
B D  Crab-eating macaque  ctttg
B D         Green monkey  ctttt
B D             Marmoset  ctttt
B D      Squirrel monkey  ctttt
B D             Bushbaby  ttttt
B D                  Pig  ttttt
B D               Alpaca  ttttt
          Bactrian camel  ttttt
        Tibetan antelope  aaatt
B D                  Cow  -cttt
B D                Sheep  aaatt
           Domestic goat  aaatt
B D                Horse  ctttt
B D     White rhinoceros  ctttt
B D                  Cat  ctatt
B D                  Dog  ctgtg
B D                Panda  ctatt
          Pacific walrus  ctatt
            Weddell seal  ccatt
        Black flying-fox  ctttt
B D              Megabat  ctttc
B D              Ferret   =====
     Chinese tree shrew  -----
           Killer whale  =====
B D              Dolphin  =====
B D               Baboon  =====
B D               Rhesus  NNNNN

Inserts between block 49 and 50 in window
B D                 Pig 254bp

Alignment block 50 of 836 in window, 233354 - 233356, 3 bps 
B D                Human  a----aa
B D                Chimp  a----aa
B D              Gorilla  a----aa
B D            Orangutan  a----aa
B D               Gibbon  a----aa
B D  Crab-eating macaque  a----aa
B D         Green monkey  a----aa
B D             Marmoset  a----ac
B D      Squirrel monkey  a----aa
B D             Bushbaby  a----aa
B D                  Pig  a----aa
B D               Alpaca  a----aa
          Bactrian camel  a----aa
        Tibetan antelope  a----ag
B D                  Cow  a----ag
B D                Sheep  a----ag
           Domestic goat  a----ag
B D                Horse  a----aa
B D     White rhinoceros  a----aa
B D                  Cat  a----aa
B D                Panda  a----aa
          Pacific walrus  aaattaa
            Weddell seal  a----aa
        Black flying-fox  a----aa
B D              Megabat  a----aa
B D              Ferret   =======
B D                  Dog  -------
     Chinese tree shrew  -------
           Killer whale  =======
B D              Dolphin  =======
B D               Baboon  =======
B D               Rhesus  NNNNNNN

Inserts between block 50 and 51 in window
B D               Panda 295bp

Alignment block 51 of 836 in window, 233357 - 233378, 22 bps 
B D                Human  tttattgtgtcaggttcagctt
B D                Chimp  tttattgtgtcaggttcagctt
B D              Gorilla  tttgtggggtcaggttcagctt
B D            Orangutan  tttattgtgtcaggttcagctt
B D               Gibbon  tttattgtgtcaggttcagctt
B D  Crab-eating macaque  tttgttgtatcaggttcagttt
B D         Green monkey  tttgttgtgtcaggttcagttt
B D             Marmoset  tttgttg--tcaggttcagatt
B D      Squirrel monkey  tttattg--tcaggttcagatt
B D             Bushbaby  tttgctgtgtcaggttcaaatt
      Chinese tree shrew  --------gttaggttcaaatt
B D                  Pig  tgtatcgtgtcaaattcagatc
B D               Alpaca  cttaccgtatcaaattaagatc
          Bactrian camel  cttaccgtatcaaattaagatc
        Tibetan antelope  tgtattgtgtcagcttcagatc
B D                  Cow  tgtattgtgtcagattcaaatc
B D                Sheep  tgtattgtgtcagattcagatc
           Domestic goat  tgtattgtgtcagattcagatc
B D                Horse  tttattgtgtcaaattcagatt
B D     White rhinoceros  tttattgtgttaaattcagatt
B D                  Cat  -ttatt-tgtcacattcaaact
B D                  Dog  tttattgtgtcgtgcttagatt
          Pacific walrus  ttaattaagtcacattcagacg
            Weddell seal  ttaattaagtcacattcgga-g
        Black flying-fox  ttaattgtgtcagattcagact
B D              Megabat  tgtattgtgtccaattcagatt
B D                Panda  ======================
B D              Ferret   ======================
           Killer whale  ======================
B D              Dolphin  ======================
B D               Baboon  ======================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNN

Alignment block 52 of 836 in window, 233379 - 233379, 1 bps 
B D                Human  a
B D                Chimp  a
B D              Gorilla  a
B D            Orangutan  a
B D               Gibbon  a
B D  Crab-eating macaque  a
B D         Green monkey  a
B D             Marmoset  a
B D      Squirrel monkey  a
B D             Bushbaby  a
      Chinese tree shrew  a
B D                  Pig  a
B D               Alpaca  a
          Bactrian camel  a
        Tibetan antelope  a
B D                  Cow  a
B D                Sheep  a
           Domestic goat  a
B D                Horse  a
B D     White rhinoceros  a
B D                  Cat  a
B D                  Dog  a
          Pacific walrus  a
            Weddell seal  a
        Black flying-fox  a
B D              Megabat  a
        Cape golden mole  a
B D                Panda  =
B D              Ferret   =
           Killer whale  =
B D              Dolphin  =
B D               Baboon  =
B D               Rhesus  N

Inserts between block 52 and 53 in window
       Cape golden mole 262bp

Alignment block 53 of 836 in window, 233380 - 233384, 5 bps 
B D                Human  tgagg
B D                Chimp  taagg
B D              Gorilla  tgagg
B D            Orangutan  tgagg
B D               Gibbon  tgagg
B D  Crab-eating macaque  tgagg
B D         Green monkey  tgagg
B D             Marmoset  agaga
B D      Squirrel monkey  agaga
B D             Bushbaby  tgaag
      Chinese tree shrew  cgagg
B D                  Pig  tgagc
B D               Alpaca  tgagg
          Bactrian camel  tgagg
        Tibetan antelope  tgaga
B D                  Cow  tgaga
B D                Sheep  tgaga
           Domestic goat  tgaga
B D                Horse  tgagg
B D     White rhinoceros  tgaga
B D                  Cat  tgagg
B D                  Dog  tgaag
          Pacific walrus  tgagt
            Weddell seal  tgagt
        Black flying-fox  tgagt
B D              Megabat  tgcgg
B D                Panda  =====
B D              Ferret   =====
           Killer whale  =====
       Cape golden mole  =====
B D              Dolphin  =====
B D               Baboon  =====
B D               Rhesus  NNNNN

Alignment block 54 of 836 in window, 233385 - 233481, 97 bps 
B D                Human  cctcaatacttt-tcagtcttaattgtatattgaaaatacttt---ttgtttactaaatgctttt-taca
B D                Chimp  cctcaatacttt-tcagtcttaattgtatactgaaaatacttt---ttgtttattaaatactttt-taca
B D            Orangutan  cctcaatacttt-tcagtcttaattgtatattgaaaatacttt---ttgtttagtaaatactttt-taca
B D               Gibbon  cctcagtacttt-tcagtcttaattgtatattgaaaatacttt---ttgtttagcagatactttt-taca
B D  Crab-eating macaque  cctcaatacttt-tcagtcttaattatgtattgaaaatacttt---ttgtttggtaaatac-ttt-taca
B D         Green monkey  cctcaatacttt-tcagtcttaattgtgtattgaaaatacttt---ttgtttagtaaatac-ttt-taca
B D             Marmoset  cctcaatacttt-tcagtcttaattatatattgaaaatagtttttgttgtttaacaaatac-ttt-taca
B D      Squirrel monkey  cctctatacttt-tcagtcttaattatataacgaaaatactttttgttgtttaataaatac-ttt-taca
B D             Bushbaby  ccttgatacttcagtagtcttaattatatattgaaaatatttt---ttgtttagtaaaatt-ttg-tatg
      Chinese tree shrew  atttagtgctttcccagtttctgttatatattgaaagt--ttt---atttttagtaaataa-ttt-taca
B D                  Pig  catcagtgcttatcctgtc--tattgtatacttaaagtattctttagcacttagtaaataa-gttttaca
B D               Alpaca  cctcagcgctttccttgtctttattgtatactaaaagaattctgtagtgcttagtaaacaa-gttttaca
          Bactrian camel  cctcagcgctttccctgtctttattgtatactaaaagaattctgtagtgcttagtaaataa-gttttaca
        Tibetan antelope  cctcggttcttttcttgtcattattgtgtactaaaagtattctctggtgcttagtaaataa-tttgtaca
B D                  Cow  ccttggtccttttcttgtcattattgtgtactaaaagtattctctggtgcttagtaaataa-tttgtaca
B D                Sheep  cctcggtccttttcttgtcattattgtgtactaaaagtatt-----------------------------
           Domestic goat  cctcggtccttttcttgtcattattgtgtactaaaagtattctctggtgcttagtaagtaa-tttgtaca
B D                Horse  cctcaaagcttttcttgtctttattatatactgaaagtattctttagtgcttcgtgaggaa-ttt-taca
B D     White rhinoceros  cctcaatgcttttcctgtc--tattatatattgaaagtattctttaatgcctagtaaataa-ttt-taca
B D                  Cat  ccacagtgcttttcctgtc--cgctatatactgaaagtgt--tttgctgattagtaaataa-ttt-taca
B D                  Dog  c----------tttctgct--c-ct-tattgtagaaaa----tctttgga--agttcatca-ttt-tgca
          Pacific walrus  ccacagtgcttttcctata--t-ct-taaagtgcacgtg---tttgttgattagtaaataa-cgt-taca
            Weddell seal  ccacagtgcttttcctgta--t-ttatatactgaaagtgttctttgtcgattagtaaataa-tgt-taca
        Black flying-fox  ctttaaagcttttccggtc-----tatac---------------tggtgtgtagtaaataa-ttt-taca
B D              Megabat  tctcaatggttttccaaccttttttatatgttaatgacatcctatggtgcttagcaaataa-ttt-taca
B D                Panda  ======================================================================
B D              Ferret   ======================================================================
           Killer whale  ======================================================================
       Cape golden mole  ======================================================================
B D              Dolphin  ======================================================================
B D               Baboon  ======================================================================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  ttaattcagtgtgcacttcgtaaggataatga
                   Chimp  ttaattcagtgtgcacttcgtaaggatattga
               Orangutan  ttaattcagtgcgcacttcgtaaggatattga
                  Gibbon  ttaattcagtaggcacttcgtaaggatattga
     Crab-eating macaque  ttaattcagtgtgcactttgtaagaatattga
            Green monkey  ttaattcagtgtgcacttcgtaagaatattga
                Marmoset  ctaattcagtgtgcacttcgtaaggatattga
         Squirrel monkey  ctaattcagtgtgcacttcgtaacgatattga
                Bushbaby  ctaatttagtgt--acttggtaagtatattaa
      Chinese tree shrew  ttatttcagtgtgcattcggtaaggatgttga
                     Pig  ctatttcaatgtgcagttggtggggacactga
                  Alpaca  ct-tttcactgtgcagttggtaagga---taa
          Bactrian camel  ct-tttcactgtgcagttggtaagga---taa
        Tibetan antelope  ctatttcggtgtgcagttggtagggatattac
                     Cow  ctatttc-gtgtgcagttggtagggatattaa
                   Sheep  --------------------------------
           Domestic goat  ctatttcggtgtgcagttggtagggatattac
                   Horse  ctatttcagtgtgctgttggtagggaagttgg
        White rhinoceros  ttatttcagtgtgcatttggtaggaaagt---
                     Cat  atatttctgtgtgca---gttggagatactga
                     Dog  ctgtttcaatgtgcatttgttaaggatagtga
          Pacific walrus  gtgtttctgtgtgcggttgttggatatattga
            Weddell seal  gtgtttctgtgtgcagttgttggatatat---
        Black flying-fox  ctcttttagtgtgcaatttgaagggatattgt
                 Megabat  ctatttcaatgtgttcttggtaaggatattgg
                   Panda  ================================
                 Ferret   ================================
            Killer whale  ================================
        Cape golden mole  ================================
                 Dolphin  ================================
                  Baboon  ================================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 54 and 55 in window
B D               Sheep 11bp

Alignment block 55 of 836 in window, 233482 - 233487, 6 bps 
B D                Human  tgat---tt
B D                Chimp  tgat---tt
B D            Orangutan  tgat---tt
B D               Gibbon  ttat---tt
B D  Crab-eating macaque  tgat---tt
B D         Green monkey  tgat---tt
B D             Marmoset  tgat---tt
B D      Squirrel monkey  tgat---gt
B D             Bushbaby  tgat---tt
      Chinese tree shrew  tttt---tt
B D                  Pig  tgat---tt
B D               Alpaca  tgat---tt
          Bactrian camel  tgat---tt
        Tibetan antelope  ttat---tt
B D                  Cow  tgat---tt
           Domestic goat  tgat---tt
B D                Horse  tgat---tt
B D     White rhinoceros  tgat---tt
B D                  Cat  tgat---tt
          Pacific walrus  tgat---tg
            Weddell seal  tgat---tt
        Black flying-fox  ttttttgtt
B D              Megabat  tgattt-tt
B D                Panda  =========
B D              Ferret   =========
B D                  Dog  =========
B D                Sheep  =========
           Killer whale  =========
       Cape golden mole  =========
B D              Dolphin  =========
B D               Baboon  =========
B D              Gorilla  NNNNNNNNN
B D               Rhesus  NNNNNNNNN

Inserts between block 55 and 56 in window
B D            Bushbaby 33bp
     Chinese tree shrew 866bp

Alignment block 56 of 836 in window, 233488 - 233506, 19 bps 
B D                Human  gagttagtttagtattcaa
B D                Chimp  gagttagtttagtattcaa
B D            Orangutan  gagttagtttagtattcaa
B D               Gibbon  gagttagtttagtattcaa
B D  Crab-eating macaque  gagttagtttagttttcaa
B D         Green monkey  gagttagtttagttttcaa
B D             Marmoset  gagttggtttaatattcaa
B D      Squirrel monkey  ga----gtttaatattcaa
B D             Bushbaby  gagttagtctaatatttag
B D                  Pig  ---ttgtcttaacagtcaa
B D               Alpaca  ---ttgtcttaacggtcaa
          Bactrian camel  ---ttgtcttaacggtcaa
        Tibetan antelope  ---ttgtcttaaacgtcag
B D                  Cow  ---ttgtcttaaaagtcag
           Domestic goat  ---ttgtcttaaaagtcag
B D                Horse  ---ttgttttagcagtcaa
B D     White rhinoceros  ---ttgttttaacagtcaa
B D                  Cat  ---ttgtcttgacattcaa
          Pacific walrus  ---ttatcttcacattcaa
            Weddell seal  ---ttgtcttcacattcaa
        Black flying-fox  ---ttgttttaacagtgaa
B D              Megabat  ---ttactttgacaatcaa
B D                Panda  ===================
B D              Ferret   ===================
B D                  Dog  ===================
     Chinese tree shrew  ===================
B D                Sheep  ===================
           Killer whale  ===================
       Cape golden mole  ===================
B D              Dolphin  ===================
B D               Baboon  ===================
B D              Gorilla  NNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNN

Inserts between block 56 and 57 in window
B D                 Pig 35bp
B D              Alpaca 32bp
         Bactrian camel 32bp
       Tibetan antelope 35bp
B D                 Cow 35bp
          Domestic goat 35bp
B D               Horse 32bp
B D    White rhinoceros 32bp
B D                 Cat 32bp
         Pacific walrus 434bp
           Weddell seal 32bp
       Black flying-fox 27bp
B D             Megabat 32bp

Alignment block 57 of 836 in window, 233507 - 233509, 3 bps 
B D                Human  cag
B D                Chimp  cag
B D            Orangutan  cag
B D               Gibbon  cag
B D  Crab-eating macaque  cat
B D         Green monkey  cat
B D             Marmoset  cag
B D      Squirrel monkey  cag
B D             Bushbaby  tag
B D                  Pig  cag
B D               Alpaca  cag
          Bactrian camel  cag
        Tibetan antelope  cag
B D                  Cow  cag
B D                Sheep  cag
           Domestic goat  cag
B D                Horse  cag
B D     White rhinoceros  cag
B D                  Cat  cat
            Weddell seal  cac
B D              Megabat  ===
B D                Panda  ===
B D              Ferret   ===
B D                  Dog  ===
     Chinese tree shrew  ===
           Killer whale  ===
       Black flying-fox  ===
       Cape golden mole  ===
B D              Dolphin  ===
         Pacific walrus  ===
B D               Baboon  ===
B D              Gorilla  NNN
B D               Rhesus  NNN

Alignment block 58 of 836 in window, 233510 - 233510, 1 bps 
B D                Human  c
B D                Chimp  c
B D            Orangutan  c
B D               Gibbon  c
B D  Crab-eating macaque  c
B D         Green monkey  c
B D             Marmoset  c
B D      Squirrel monkey  c
B D             Bushbaby  t
B D                  Pig  c
B D               Alpaca  c
          Bactrian camel  c
B D              Dolphin  t
        Tibetan antelope  c
B D                  Cow  c
B D                Sheep  t
           Domestic goat  c
B D                Horse  c
B D     White rhinoceros  c
B D                  Cat  c
            Weddell seal  c
        Black flying-fox  c
B D              Megabat  c
B D                Panda  =
B D              Ferret   =
B D                  Dog  =
     Chinese tree shrew  =
           Killer whale  =
       Cape golden mole  =
         Pacific walrus  =
B D               Baboon  =
B D              Gorilla  N
B D               Rhesus  N

Inserts between block 58 and 59 in window
       Black flying-fox 2bp

Alignment block 59 of 836 in window, 233511 - 233520, 10 bps 
B D                Human  ttcctctatt
B D                Chimp  ttcctctatt
B D            Orangutan  ttcctctatt
B D               Gibbon  ttcctctatt
B D  Crab-eating macaque  ttcctctatt
B D         Green monkey  ttcctctatt
B D             Marmoset  ttcctctctt
B D      Squirrel monkey  ttcctctctt
B D             Bushbaby  ttcct-tctt
B D                  Pig  attctttctt
B D               Alpaca  atcttttctt
          Bactrian camel  atcttttctt
        Tibetan antelope  attctttctt
B D                  Cow  attctttctt
B D                Sheep  attctttctt
           Domestic goat  attctttctt
B D                Horse  -ttccttttt
B D     White rhinoceros  -ttcctttct
B D                  Cat  -ttccttttt
            Weddell seal  -ttcttttct
        Black flying-fox  -gtgttttt-
B D              Megabat  -gtctttct-
B D                Panda  ==========
B D              Ferret   ==========
B D                  Dog  ==========
     Chinese tree shrew  ==========
           Killer whale  ==========
       Cape golden mole  ==========
B D              Dolphin  ----------
         Pacific walrus  ==========
B D               Baboon  ==========
B D              Gorilla  NNNNNNNNNN
B D               Rhesus  NNNNNNNNNN

Inserts between block 59 and 60 in window
B D               Horse 1bp
B D    White rhinoceros 1bp
B D                 Cat 1bp
           Weddell seal 1bp

Alignment block 60 of 836 in window, 233521 - 233522, 2 bps 
B D                Human  cc
B D                Chimp  cc
B D            Orangutan  cc
B D               Gibbon  cc
B D  Crab-eating macaque  cc
B D         Green monkey  cc
B D             Marmoset  cc
B D      Squirrel monkey  cc
B D             Bushbaby  cc
B D                  Pig  -c
B D               Alpaca  -c
          Bactrian camel  -c
        Tibetan antelope  -c
B D                  Cow  -c
B D                Sheep  -c
           Domestic goat  -c
B D                Horse  -c
B D     White rhinoceros  -c
B D                  Cat  -c
B D                  Dog  -c
            Weddell seal  -c
B D              Megabat  -c
B D                Panda  ==
B D              Ferret   ==
     Chinese tree shrew  ==
           Killer whale  ==
       Black flying-fox  --
       Cape golden mole  ==
B D              Dolphin  --
         Pacific walrus  ==
B D               Baboon  ==
B D              Gorilla  NN
B D               Rhesus  NN

Inserts between block 60 and 61 in window
B D               Horse 1bp
B D    White rhinoceros 1bp
B D                 Dog 1bp
           Weddell seal 1bp

Alignment block 61 of 836 in window, 233523 - 233528, 6 bps 
B D                Human  tttata
B D                Chimp  tttata
B D            Orangutan  tttata
B D               Gibbon  tttata
B D  Crab-eating macaque  tttata
B D         Green monkey  tttata
B D             Marmoset  tttgta
B D      Squirrel monkey  tttgta
B D             Bushbaby  cttatg
B D                  Pig  tgtatg
B D               Alpaca  agtata
          Bactrian camel  agtata
        Tibetan antelope  tgtatg
B D                  Cow  tgtatg
B D                Sheep  tgtatg
           Domestic goat  tgtatg
B D                Horse  cttact
B D     White rhinoceros  tttatg
B D                  Dog  tttatg
B D                Panda  tttgtg
            Weddell seal  tttatg
        Black flying-fox  ----tg
B D              Megabat  cccatg
B D              Ferret   ======
B D                  Cat  ------
     Chinese tree shrew  ======
           Killer whale  ======
       Cape golden mole  ======
B D              Dolphin  ------
         Pacific walrus  ======
B D               Baboon  ======
B D              Gorilla  NNNNNN
B D               Rhesus  NNNNNN

Inserts between block 61 and 62 in window
           Weddell seal 389bp

Alignment block 62 of 836 in window, 233529 - 233538, 10 bps 
B D                Human  tgatctctgt
B D                Chimp  tgatctctgt
B D            Orangutan  tgatctctgt
B D               Gibbon  tggtctctgt
B D  Crab-eating macaque  tgatctctgt
B D         Green monkey  tgatctctgt
B D             Marmoset  tgatctttgt
B D      Squirrel monkey  tgatctttgt
B D             Bushbaby  tgatcttttg
B D                  Pig  taattttttt
B D               Alpaca  tgatttttta
          Bactrian camel  tgatttttta
        Tibetan antelope  tgagttttta
B D                  Cow  tgagttttta
B D                Sheep  tgagttttta
           Domestic goat  tgagttttta
B D                Horse  tgatct----
B D     White rhinoceros  tgatctttta
B D                  Cat  -aatatttta
B D                  Dog  tgatcttttg
B D                Panda  tgatccttta
          Pacific walrus  tgatctttta
            Weddell seal  tgatctttta
        Black flying-fox  tgatctttta
B D              Megabat  ttatctttta
B D              Ferret   ==========
     Chinese tree shrew  ==========
           Killer whale  ==========
       Cape golden mole  ==========
B D              Dolphin  ----------
B D               Baboon  ==========
B D              Gorilla  NNNNNNNNNN
B D               Rhesus  NNNNNNNNNN

Inserts between block 62 and 63 in window
B D                 Pig 24bp
B D              Alpaca 1bp
         Bactrian camel 1bp

Alignment block 63 of 836 in window, 233539 - 233570, 32 bps 
B D                Human  attta-----------------------------------------------------------------
B D                Chimp  attta-----------------------------------------------------------------
B D            Orangutan  attta-----------------------------------------------------------------
B D               Gibbon  attta-----------------------------------------------------------------
B D  Crab-eating macaque  attta-----------------------------------------------------------------
B D         Green monkey  gttta-----------------------------------------------------------------
B D             Marmoset  attta-----------------------------------------------------------------
B D      Squirrel monkey  attta-----------------------------------------------------------------
B D             Bushbaby  atcag-----------------------------------------------------------------
B D                  Pig  atgtggaagttctcgggccagagatggaacctgtgccacagcagcaaccataaccacagcagtgaaaacc
B D               Alpaca  attta-----------------------------------------------------------------
          Bactrian camel  attta-----------------------------------------------------------------
B D              Dolphin  attta-----------------------------------------------------------------
            Killer whale  attta-----------------------------------------------------------------
        Tibetan antelope  atgta-----------------------------------------------------------------
B D                  Cow  attta-----------------------------------------------------------------
B D                Sheep  atgta-----------------------------------------------------------------
           Domestic goat  atgta-----------------------------------------------------------------
B D                Horse  -ttta-----------------------------------------------------------------
B D     White rhinoceros  attta-----------------------------------------------------------------
B D                  Cat  attat-----------------------------------------------------------------
B D                  Dog  ctaat-----------------------------------------------------------------
B D                Panda  attac-----------------------------------------------------------------
          Pacific walrus  attat-----------------------------------------------------------------
            Weddell seal  attat-----------------------------------------------------------------
        Black flying-fox  attta-----------------------------------------------------------------
B D              Megabat  actaa-----------------------------------------------------------------
B D              Ferret   ======================================================================
     Chinese tree shrew  ======================================================================
       Cape golden mole  ======================================================================
B D               Baboon  ======================================================================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  -----------------------------------------------------------at-gg-ctgtg
                   Chimp  -----------------------------------------------------------at-gg-ctgtg
               Orangutan  -----------------------------------------------------------at-ag-ctgtg
                  Gibbon  -----------------------------------------------------------at-gg-ctgtg
     Crab-eating macaque  -----------------------------------------------------------at-ga-ctgta
            Green monkey  -----------------------------------------------------------at-ga-ctgta
                Marmoset  -----------------------------------------------------------at-gg-ctgtg
         Squirrel monkey  -----------------------------------------------------------at-gg-ctgtg
                Bushbaby  -----------------------------------------------------------ataag-ctgtg
                     Pig  taggatccttaatctgctgagccactagggaactactgtatgtgatttgaaaaaatttact-gggctgtg
                  Alpaca  -----------------------------------------------------------ct-gctctgta
          Bactrian camel  -----------------------------------------------------------ct-gctctgta
                 Dolphin  -----------------------------------------------------------tt-ggtctgtg
            Killer whale  -----------------------------------------------------------tt-ggtctgtg
        Tibetan antelope  -----------------------------------------------------------tt-ggtctgtg
                     Cow  -----------------------------------------------------------tt-ggtctgtg
                   Sheep  -----------------------------------------------------------tt-ggtctgtg
           Domestic goat  -----------------------------------------------------------tt-ggtctgtg
                   Horse  -----------------------------------------------------------at-agtctatg
        White rhinoceros  -----------------------------------------------------------at-agcctatg
                     Cat  -----------------------------------------------------------at-ggtctgag
                     Dog  -----------------------------------------------------------ag-gatctgaa
                   Panda  -----------------------------------------------------------at-gatctgag
          Pacific walrus  -----------------------------------------------------------at-gatctgag
            Weddell seal  -----------------------------------------------------------at-gatctgag
        Black flying-fox  -----------------------------------------------------------ac-ggtctatg
                 Megabat  -----------------------------------------------------------gt-gggctgtg
                 Ferret   ======================================================================
      Chinese tree shrew  ======================================================================
        Cape golden mole  ======================================================================
                  Baboon  ======================================================================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  gcataaagtttccaacta
                   Chimp  gcataaagtttccaacta
               Orangutan  gcataaagtttccaacca
                  Gibbon  gcataaagtttccaacta
     Crab-eating macaque  ggataaaatttccaacta
            Green monkey  ggataaaatttccaacta
                Marmoset  ggataaagttcccaacta
         Squirrel monkey  ggataaagttcccaacta
                Bushbaby  gactaaagtttccaatta
                     Pig  agct--agttt----ctg
                  Alpaca  agctacagtttccaccta
          Bactrian camel  agctacagtttccaacta
                 Dolphin  agct--agtttccaacta
            Killer whale  agct--agtttccaacta
        Tibetan antelope  agctacagttttcaacta
                     Cow  atctacagttttcaacta
                   Sheep  agctacagttttcaacta
           Domestic goat  agctacagttttcaacta
                   Horse  ggctaaagt-ttcaacta
        White rhinoceros  agctaaagtattcaacta
                     Cat  agctaaggtttccaacta
                     Dog  agctgaagtttccggcta
                   Panda  aactaaagtttccaacta
          Pacific walrus  agctaaagtttccaactc
            Weddell seal  agctaaagtttccaacta
        Black flying-fox  aactaaagtttccaaata
                 Megabat  agctaaagtttccaatta
                 Ferret   ==================
      Chinese tree shrew  ==================
        Cape golden mole  ==================
                  Baboon  ==================
                 Gorilla  NNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNN

Alignment block 64 of 836 in window, 233571 - 233571, 1 bps 
B D                Human  a
B D                Chimp  a
B D            Orangutan  a
B D               Gibbon  a
B D  Crab-eating macaque  a
B D         Green monkey  a
B D             Marmoset  a
B D      Squirrel monkey  a
B D             Bushbaby  a
B D                  Pig  a
B D               Alpaca  a
          Bactrian camel  a
B D              Dolphin  a
            Killer whale  a
        Tibetan antelope  c
B D                  Cow  a
B D                Sheep  a
           Domestic goat  a
B D                Horse  a
B D     White rhinoceros  a
B D                  Cat  a
B D                  Dog  a
B D                Panda  a
          Pacific walrus  a
            Weddell seal  a
        Black flying-fox  a
B D              Megabat  a
        Cape golden mole  a
B D              Ferret   =
     Chinese tree shrew  =
B D               Baboon  =
B D              Gorilla  N
B D               Rhesus  N

Alignment block 65 of 836 in window, 233572 - 233648, 77 bps 
B D                Human  gtttaag----tatcaagttttcttt------------------------------gtgc-tgttttctg
B D                Chimp  gtataag----tatcaagttttcttt------------------------------gtgc-tgttttctg
B D            Orangutan  gtataag----tatcaagttctcttt------------------------------gtgc-tgttttctg
B D               Gibbon  gtagaag----tatcaagttttcttt------------------------------gtgc-tgttttctg
B D  Crab-eating macaque  gtataaa----tatcaagttttcttt------------------------------gtgc-tgttttctg
B D         Green monkey  gtataag----tatcaagttttcttt------------------------------gtgc-tgttttctg
B D             Marmoset  gtgtaag----tatcaagttttcttt------------------------------gtgc-cattgtctg
B D      Squirrel monkey  gtataag----tatcaagttttcttt------------------------------gtgc-cattttctg
B D             Bushbaby  gtataggatctcttcaaggtttgtttgtttgtttttggtggggggggtggggtttggttc-tgttttctg
B D                  Pig  gtatatgatctcttcaaatacccttt-----------------------gggtttttttgttttgttttg
B D               Alpaca  gtatatcgtctcttcaaattccc--------------------------------------tttgttttg
          Bactrian camel  gtgtatcgtctcttcaaattccc--------------------------------------tttgttttg
B D              Dolphin  gtatatgctcttttcaaattcccttt-------------------------gtttttttg-tttgttttg
            Killer whale  gtatatgctcttttcaaattcccttt-------------------------gtttttgtg-tttgttttg
        Tibetan antelope  gtatatgctcccttcagatttccttt-------------------------atttttttg-tttgttttg
B D                  Cow  gtatatgctctcttcaaatttcttta-------------------------atttttttg-tttgttttg
B D                Sheep  gtatatgctcccttcaaatttccttt-------------------------atttttttg-tttgttttg
           Domestic goat  gtatatgctcccttcaaatttccttt-------------------------atttttttg-tttgttttg
B D                Horse  gcatgtgatctcttcagattct---------------------------------ctttg-tcctttttg
B D     White rhinoceros  gtatttgatctctttggattcc---------------------------------ctttg-tcctttttg
B D                  Cat  gtttatgatttctttgaattcccttt--------------------------gccctttt-ttgttgtta
B D                  Dog  gtttatgatttcttcagatttc---------------------------------------ttctgtccc
B D                Panda  gtatatgatgtcttcaaattttctgt---------------------------ccttttt-tttttttta
          Pacific walrus  gtatatgatttgttcaaatctc---------------------------------------tttttttaa
            Weddell seal  gtatatgatttcttcagatttc---------------------------------------------caa
        Black flying-fox  gtatatgattccttcaaattccctta--------------------------gttttttg-ttgttg---
B D              Megabat  atacatgttctctt---------------------------------------tgccctg-tctctg---
B D              Ferret   ======================================================================
     Chinese tree shrew  ======================================================================
B D               Baboon  ======================================================================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  ---------caaata--------ttgaaggatgacctggattgtcctagaa-ctttgttc
                   Chimp  ---------caaata--------ttaaaggatgacctggattgtcctagaa-ctttgttc
               Orangutan  ---------caaata--------ttgaaggatggcctgaattgtcctagaa-ctttgttc
                  Gibbon  ---------caaata--------ttgaaggatggcctggattgtcctagaa-ctttgttc
     Crab-eating macaque  ---------caatta--------ttgaaggatgggctgaattgtcctagaa-ctttgttc
            Green monkey  ---------caatta--------ttgaaggatgggctgaattgtcctagaa-ctttgttc
                Marmoset  ---------caaata--------ttgcaggttgggctagattgtcctagaa-c-ttgttc
         Squirrel monkey  ---------caaata--------ttgcaggttgggctagattgtcctagaa-ctttgttc
                Bushbaby  ---------ctaata--------ttgaaggatgggctggattgtcctggaa-c-------
                     Pig  ttttttta-cgaat------------aaggataggctggatacttccagaa-ctttcttc
                  Alpaca  ---------caaata--------ttgaaggataggctggatggttctggag-ctttgttc
          Bactrian camel  ---------caaata--------ttgaaggataggctggatggttctggag-ctttgttc
                 Dolphin  ---------caaata--------ttgaatgataggctggatggttctagaa-ctttgttc
            Killer whale  ---------caaata--------ttgaatgataggctggatggttctagaa-ctttgttc
        Tibetan antelope  ---------caaata--------ttgagcaataggctggatgattctagaa-c-ttgttc
                     Cow  ---------caaata--------ttgaatgataggctggatgattctagaa-c-ttgttc
                   Sheep  ---------caaata--------ctgaacaataggctggatgattctagaa-c-ttgttc
           Domestic goat  ---------caaata--------ttgaacaataggctggatgattctagaa-c-ttgttc
                   Horse  g--------caaatg--------ttgaaggatgggctgaattgtcctggaa-ctttgttc
        White rhinoceros  g--------caaata---------tgaaggatgggctgaattgtcctggaa-ctgtgttc
                     Cat  ttctttcaccaaata--------tcgtgggatgggctgcatagtcctggaacctttgttc
                     Dog  gcc--------------------------------ccgggttgttgtggaa-ctttgtcc
                   Panda  aac------caaata--------ttgtaggatggaatgcatcattctggaa-cttcattc
          Pacific walrus  aacaaaaaacaaaaa--------ttgtaggatgggctgcgtcattctggaa-ctttgttc
            Weddell seal  aacaaaaaacaaaaa--------ttgtaggattggctgcatcattcgggaa-ctttgttc
        Black flying-fox  ---------ttgttgttgttttaacgaaggatgctctggattgtcctgg----ttc----
                 Megabat  ---------aaaatg--------atcaaggatgaactggattgttatggaa-ttttgtca
                 Ferret   ============================================================
      Chinese tree shrew  ============================================================
                  Baboon  ============================================================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 66 of 836 in window, 233649 - 233749, 101 bps 
B D                Human  caacagattacatgtgttcataatgaat--------agactgctcaaagatatttcc-----------aa
B D                Chimp  caacagattacatgtgttcataatgaat--------aaattgctca--gatatttcc-----------aa
B D            Orangutan  caacagattccatgtgttcataatgaat--------acattgctcaaagatatttcctttgagcaaaaaa
B D               Gibbon  caacagatc-catatgttcataatgaat--------aaattgctcaaagatatttcc-----------aa
B D  Crab-eating macaque  caacagattccatgtgttcataatgaat--------aaattgctcaaagatatttcg-----------aa
B D         Green monkey  caacagattccacgtgttcataatgaat--------aaattgctcaaagatatttcg-----------aa
B D             Marmoset  cagcagattccatctgttcataatgaat--------acattgctcaaaggtatttcc-----------ag
B D      Squirrel monkey  caacagattccatctgttcataatgaat--------acattgctcaaaggtatttcc-----------aa
B D             Bushbaby  ----agattccatctgttcataatgaat--------aaattgcttatagatactacc-----------aa
B D                  Pig  aaataaatctcatctgttcatgatgaat--------aca--agtcagaggtct-----------------
B D               Alpaca  taaccaatcttatctgttcgtgatgaat--------acattactcagagctatttcc-----------at
          Bactrian camel  tagccaatcttatctgttcatgatgaat--------acattactcagagctatttcc-----------at
B D              Dolphin  tcacagacctcatttgttcatgatgaat--------acattattcagagctatttcc-----------ac
            Killer whale  tcacagacctcatttgtttatgatgaat--------acattattcagagctatttcc-----------ac
        Tibetan antelope  tcacagatctcatttgttcatgatgagt--------actttactcagagctatttcc-----------at
B D                  Cow  tcacagatctcatttgttcatgatgagt--------acattactcagagctgtttcc-----------at
B D                Sheep  tcacagatctcatttgttcatgatgagt--------actttactcagagctatttcc-----------at
           Domestic goat  tcacagatctcatttgttcatgatgagt--------actttactcagagctatttcc-----------at
B D                Horse  taacagatatcatctgttcatgatgaac--------acattctccagagctgtctct-----------at
B D     White rhinoceros  taacagatctcatttgttcgtggtgaat--------acattgttcagtgctattttc-----------at
B D                  Cat  taacttgtctc-----atcatgataaat--------acattgctcaaaggtacttcc-----------at
B D                  Dog  taacgtgtctcatctgatcctaataaat--------acgttgctgaaaggtacttcc-----------gt
B D                Panda  taacatgtctcatctaatcatgataaac--------acagtgctcaaaggtacttcc-----------at
          Pacific walrus  taacgtgtctcatctgatcataataaac--------acattgctcaaaggtacttcc-----------at
            Weddell seal  taacatgtctcatttgatcataataaat--------acattgctcaaaggtacttcc-----------at
        Black flying-fox  taacagagcttgtctgttcctgatggatctgttaaaacttccctcagaactgtttct-----------gt
B D              Megabat  ----------------------------------------------------------------------
B D              Ferret   ======================================================================
     Chinese tree shrew  ======================================================================
B D               Baboon  ======================================================================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  a----gctcac-cttttatgtttttcagttccaataatt--acatcttttt---------aaggt--t
                   Chimp  a----gctcac-cttttatgtttttcagttccaataatt--acatcttttt---------aaggt--t
               Orangutan  a----gctcac-cttttatgtttttcagttccaataatt--acatcttttt---------aaggt--t
                  Gibbon  a----gctcac-cttttatgtttttcagttccaacaatt--acatcttttt---------aaggt--t
     Crab-eating macaque  a----gctcac-cttttatgttttttattgccaataatt--acatcttttt---------aattt--t
            Green monkey  a----gctcac-cttttatgtttttcattgccaataatt--acatcttttt---------aattt--t
                Marmoset  a----gctgacgtttttatatttttctgttccaacaatt--agatattttc---------aattt--t
         Squirrel monkey  a----actgacgtttttatatttttctcttccaacaatt--agatattttc---------aattt--t
                Bushbaby  a----acttac-ct------cttttaagtgcaaataatt--aggtcttttt---------aattt--t
                     Pig  ---------aa-cttgcagttttgctagtcatgataacc--aggtgttctt---------aatgt---
                  Alpaca  a----gctgaa-ct--ttttttttccagtgtcgataatt--aggtgttttt---------aa------
          Bactrian camel  a----gctgaa-cttctttttttcccagtgtcgataatt--aggtgttttt---------aa------
                 Dolphin  a----gctgaa-cttttgtgttttccaatgccgataatt--aagtgttctt---------aatgt---
            Killer whale  a----gctgaa-cttttgtgttttccaatgccgataatt--aagtgttctt---------aatgt---
        Tibetan antelope  a----cctgaa-tgtgtgtgtttcccaatgccgttatttaaaagtgttctt---------aatgt---
                     Cow  a----cctgaa-cgttggtgtttcccaatgccgttatttaaaagtgttctt---------aatgt---
                   Sheep  a----cctgaa-tgtttgtgtttcccaatgccattatttaaaagtgttctt---------aatgt---
           Domestic goat  a----cctgaa-tgtttgtgtttcccaatgccattatttaaaagtgttctt---------aatgt---
                   Horse  a----gctgac-cttttgtgttttccagtgctgataatt--aggtcttctt---------aatgt---
        White rhinoceros  a----gctgac-tttttatgttttccagtgccaataatt--aggtcttctt---------aacat---
                     Cat  acctgcctgac-cttgtacgtttcctcatgccaataatt--aggtctt------------aatat---
                     Dog  t----cctgat-tttgtctgttttcccctgccaataata--gggtctgttttcccctgccaataatc-
                   Panda  a----cctgac-cttgtatgttttcccatgccaataatt--aggtcttctt---------aacaa---
          Pacific walrus  a----cttgcc-cttgtatgttttcccatgccaataatt--aggtcttctt---------aacaa---
            Weddell seal  a----cttgac-tttgtatgttttcccatgccaataatt--aggtcttctt---------aacaa---
        Black flying-fox  a----gctgac-cttttatgttttccagggccaataatt--agatattatt---------a-------
                 Megabat  --------------------------------------------------------------------
                 Ferret   ====================================================================
      Chinese tree shrew  ====================================================================
                  Baboon  ====================================================================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 66 and 67 in window
B D                 Dog 7bp

Alignment block 67 of 836 in window, 233750 - 233751, 2 bps 
B D                Human  ta
B D                Chimp  ta
B D            Orangutan  ta
B D               Gibbon  ta
B D  Crab-eating macaque  ta
B D         Green monkey  ta
B D             Marmoset  ta
B D      Squirrel monkey  ta
B D             Bushbaby  ta
B D                  Pig  ta
B D              Dolphin  ta
            Killer whale  ta
        Tibetan antelope  ta
B D                  Cow  ta
B D                Sheep  ta
           Domestic goat  ta
B D                Horse  ta
B D     White rhinoceros  tg
B D                  Cat  tc
B D                  Dog  ga
B D              Ferret   ta
B D                Panda  ta
          Pacific walrus  ta
            Weddell seal  ta
         Bactrian camel  --
B D               Alpaca  --
B D              Megabat  --
     Chinese tree shrew  ==
       Black flying-fox  --
B D               Baboon  ==
B D              Gorilla  NN
B D               Rhesus  NN

Alignment block 68 of 836 in window, 233752 - 233772, 21 bps 
B D                Human  tatttttt-gatgacttaatgt
B D                Chimp  tatttttt-gatgacttaatgt
B D            Orangutan  tatttttt-gatgacttaatgt
B D               Gibbon  tatttttt-aataacttattgt
B D  Crab-eating macaque  tatttttg-gatgacttaatgt
B D         Green monkey  tatttttg-gatgacttaatgt
B D             Marmoset  tgtttttg-gatgacttaatgt
B D      Squirrel monkey  tgtttttg-gatgacttaatgt
B D             Bushbaby  tagttttt-gatggtttaatgt
B D                  Pig  cactttttcaatatatttgtgt
B D               Alpaca  ----------aattatttatgg
          Bactrian camel  ----------aattatttatgg
B D              Dolphin  tatttttt-gatatattcatgg
            Killer whale  tatttttt-gatatactcatgg
        Tibetan antelope  tacttttt--atatattcatag
B D                  Cow  tacttttt--atatagtcatag
B D                Sheep  tacttttt--atatattcatag
           Domestic goat  tacttttt--atatattcatag
B D                Horse  tatttttt-gttgtattaatgt
B D     White rhinoceros  tatttttt-gttgtggtagtgt
B D                  Cat  catttt-t-gatgtataaatgt
B D                  Dog  aatttttt-gatgtactgatgt
B D              Ferret   catttttt-gatgtattgatat
B D                Panda  catttttt-gatgtattgatgt
          Pacific walrus  cattttct-gatgtattgatgt
            Weddell seal  cattttct-gatgtattgatgt
        Black flying-fox  ttttattt-gaggtactaatgt
B D      Tasmanian devil  tatttcct-catcacttaataa
B D              Megabat  ----------------------
     Chinese tree shrew  ======================
B D               Baboon  ======================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNN

Inserts between block 68 and 69 in window
B D                 Pig 17bp
B D              Alpaca 5bp
         Bactrian camel 5bp
B D             Dolphin 17bp
           Killer whale 17bp
       Tibetan antelope 17bp
B D                 Cow 17bp
B D               Sheep 17bp
          Domestic goat 17bp

Alignment block 69 of 836 in window, 233773 - 233838, 66 bps 
B D                Human  gatgt---tctgg------agaaga--------c---aaatgcttttaatcaatatgattaaaaccgtga
B D                Chimp  gatgt---tctgg------agaaga--------c---aaatgcttttaatcaatatgattaaaaccgtga
B D            Orangutan  gatgt---tctgg------agaaga--------c---aaatgcttttaatcaatatgattaaaactgtga
B D               Gibbon  gatgt---tctgg------agaaga--------c---aaatgcttttaatcaatatgcttaaaaccgtga
B D  Crab-eating macaque  gatgt---tctgg------aaaaga--------c---aaatgcttttagtcaatatgattaaaaccgtga
B D         Green monkey  gatgt---tctgg------aaaaga--------c---aaatgcttttaatcaatatgattaaaaccgtga
B D             Marmoset  gatgt---tctgg------aaaaga--------c---aaatacttttaatcaatatgattaaaaccatga
B D      Squirrel monkey  gatgt---tctgg------aaaagg--------c---aaatacttttaatcaatatgattaaaaccgtga
B D             Bushbaby  ggtgc---tctgg------aaagga--------aatgaaatgcttttaatgaatgtggct----------
B D                  Pig  tgtat---tatgg------aaaaga---aaagtt---aaatgcatttattaaatgtgattaaaaccatga
B D               Alpaca  tatat---tatgg------aaaaga---taaatt---aaatgcttttagtcaatatgattaaaaccatga
          Bactrian camel  tgtat---tatgg------gaaaga---taaatt---aaatgcttttagtcaatatgattaaaaccatga
B D              Dolphin  tttat---tatgg------aaaaga---gaaatt---aaatgattttaatcagtatgattaaaaacatga
            Killer whale  tttat---tatgg------aaaaga---gaaatt--------attttaatcagtatgagtaaaaacatga
        Tibetan antelope  tctat------------------ta---gaaatt---aaatggttttaatcaagatgattacaaccgtga
B D                  Cow  tctat---tgtgg------aaaata---gaaatt---aaatggttttaatcaagatgattacaaccatga
B D                Sheep  tctat---tgtgg------aaaata---gaaatt---aaatggttttaatcaagatgataacaaccatga
           Domestic goat  tctat---tgtgg------aaaata---gaaatt---aaatggttttaatcaagatgattacaaccatga
B D                Horse  gatgt---tctgg------aaaaga--------t---aaatgctttcagttaatatgattaaaaccatga
B D     White rhinoceros  gatgt---tctgg------aaaaga---gatatt---aaatgctgttaattaatatgattaaaagcatga
B D                  Cat  gatgt---tctgg------taaaaa-gagaagtt---aaaagcatttaatcagtgtgagtaaaaccatga
B D                  Dog  gatgt---tttgggggggaaaaaaa----aagac---aaaagcttttgatcagtgtgagtaaaaccatga
B D              Ferret   gatgt---tctgg------aaaaaa-gggaaatt---aaaagcttttaatcagtgtgagtaaaaccatga
B D                Panda  gatgt---tctgg------aaaaaa----aaatt---gaaagcttttaatcattgtgagtaaaaccatga
          Pacific walrus  gatgt---tctgg------aaaaaaagagaaatt---aaaagcttttaatcagtgtgagtaaaatcatga
            Weddell seal  gatat---tctgg------aaaaaa--agaaatt---aaaagcttttaatcagtgtgagtaaaaccatga
        Black flying-fox  gataa---tctcg------aaaaga---gcagtt---aaatgcttttaattaatatgaataaaaccatgc
B D              Megabat  gatgt---tctgg------aaaaga---ggagtt---agatattttagatcattgtgattaaaaccatga
B D      Tasmanian devil  gatgtacaactgg------aaaata--------c---ac---ttttaaatctaattagttcatactttga
     Chinese tree shrew  ======================================================================
B D               Baboon  ======================================================================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  a--agacaaatcgctgtt
                   Chimp  a--agacaaatcgctgtt
               Orangutan  a--agacaaatcgttgtt
                  Gibbon  a--agacaaatcgctgtt
     Crab-eating macaque  a--agacaaattgctgtt
            Green monkey  a----acaaattgctgtt
                Marmoset  a--agacaaattgctctt
         Squirrel monkey  a--agacaaattgctctt
                Bushbaby  ------------gctctt
                     Pig  a--gaagaacttgccctt
                  Alpaca  a--agagaacttgccctt
          Bactrian camel  a--agagaacttgccctt
                 Dolphin  c--agagaacttgctctt
            Killer whale  c--agagaacttgctctt
        Tibetan antelope  a--ggacaacctgcactt
                     Cow  a--agacaacttgccctt
                   Sheep  a--agacaacttgcactt
           Domestic goat  a--agacaacttgcactt
                   Horse  a--agagaagttgctctt
        White rhinoceros  a--agagaagttgctctt
                     Cat  aatagagaagctgctctt
                     Dog  gatagaggcgcgccagtt
                 Ferret   aatagagaagttgttgct
                   Panda  aatagagaagttgctctt
          Pacific walrus  aatagagaagttgctctt
            Weddell seal  aatagagaagttgctctt
        Black flying-fox  a--agagaagttgctctt
                 Megabat  a--agagaagtggctctt
         Tasmanian devil  a--aaacaattggccctt
      Chinese tree shrew  ==================
                  Baboon  ==================
                 Gorilla  NNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNN

Inserts between block 69 and 70 in window
B D     Tasmanian devil 5087bp

Alignment block 70 of 836 in window, 233839 - 233949, 111 bps 
B D                Human  acttaagagtgtgacatat-gatctgaaatctttagg-gggcagggatgtt-aagggaaa--actgccac
B D                Chimp  acttaagagtgtgacatat-gatctgaaatctttagg-gggcagggatgtt-aagggaaa--actgccac
B D            Orangutan  acttaagagtgtgacatat-gatctgaaatctttagg-gggaagggatgtt-aagggaaa--actgccac
B D               Gibbon  acttaagagtgtgacatgt-gatctgaaatctttagg-gggcagggatgtt-aaggggaa--acggccac
B D  Crab-eating macaque  acttaagagtgtgaaattt-gatctcaaatctttagg-gggcagggatgtt-aagggaaa--actgccac
B D         Green monkey  acttaagagtgtgaaattt-gatctcaaatctttagg-gggcaggaatgtt-aagggaaa--actgccac
B D             Marmoset  acttaagagtatgaaatat-gatctgaaatgtttagg-gggcagggatgat-aagggaaa--actcccac
B D      Squirrel monkey  acttaagaatgtgaaatat-gatctgaaatcattaggaggggagggatgat-aagagaaa--actcccac
B D             Bushbaby  gctcaggagtatgagatat-tatctgatatcttttg--gagcagatatgat-gagggaaaacactaccac
B D                  Pig  gctcaggagcatgaaatat-gat-tggaatctttag--gggcaggggtgagaaatggcaggccttgccac
B D               Alpaca  gctcaggaaaaggaaataattgtctggaatctttag--gggcagtggtgag-aatggcaagccttgccac
          Bactrian camel  gctcaggaaaaggaaataattgtctggaatctttag--gggcagtggtgag-aatggcaagccttgccac
B D              Dolphin  gctcgggagagttaaatat-gatctggaatctttag--gggcaggggtggg-aatggtaagccttgccac
            Killer whale  gctcgggagaattaaatat-gatctggaatctttag--gggcaggggtgag-aatggtaaaccttgccac
        Tibetan antelope  gctcaggaaaatgaagtga-gatctggaatcttcag--gggcaggagtgag-aatgat------------
B D                  Cow  gctcaggaaaatgaaatga-gatctggaatctttag--gggcaggagtgag-aatgat------------
B D                Sheep  tctcaggaaaatgaagtga-gatctggaatctttag--gggcaggagtgag-aatgat------------
           Domestic goat  gctcaggaaaatgaagtga-gatctggaatctttag--gggcaggagtgag-aatgat------------
B D                Horse  gct---cagaatgaaatat-ggtctggaatctttag--aggcagggatgag-aggtgtaagcctttccac
B D     White rhinoceros  gcttggcaaaatgatatat-ggtctggaatctttag--aggcagggatgag-aagtgcaggccttgccac
B D                  Cat  gctcaggaga----aatac-gggcaggaattttcag--gagcaggggtgag-aagggcaagccttaccac
B D                  Dog  gctcaagaggatgcactgt-gggctggagtcttcag--gagcaggggtgag-aagggcgggcctcaccag
B D              Ferret   gctcaggaggctggaataa-ggtctggaaccttcag--cggc-----------agggcaggccttgtcac
B D                Panda  gctcagggggatggaatac-gggctggaatcttcat--ggacagggatgag-aagggcaagccttgccac
          Pacific walrus  gctcaggaggatggaatgt-gggctggaatcttcag--gggcagggatgag-aagggcaagacttgccac
            Weddell seal  gctcaggaggatggaatac-cggctggaatcctcag--gggcagggatgag-aagggcaagccttgccaa
        Black flying-fox  gctcaggaggatgaaatat-ggtctggactatttgg--g-gcagaagcgag-aagggcaagcctggccac
B D              Megabat  gctcagtagtttgaaacat-gatctataatttttaa--g---------gac-aaggatgagaactgccac
     Chinese tree shrew  ======================================================================
B D      Tasmanian devil  ======================================================================
B D               Baboon  ======================================================================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  tatcgtattaag-gtcatgccattcctgtgaagc-----tggtgcttgtt-ac
                   Chimp  tatcgtatcaag-gtcatgccattcctgtgaagc-----tggtgctggtt-ac
               Orangutan  tatcgcatcaag-atcatgtcattcctgtgaagc-----tggtgctggtt-ac
                  Gibbon  tatcacatcaag-atcatgtcattcccgtgaagc-----tggtgctggtt-ac
     Crab-eating macaque  tgtcgcatccag-atcatgtcattcctgttaagc-----tggtgctggtt-ac
            Green monkey  tattgcatccag-atcatgtcattcctgtgaagc-----tggtgctggtt-ac
                Marmoset  tattgcatctaa-atcatgtcattcccgtgaggc-----tgatgctattt-ac
         Squirrel monkey  tatcgcatccaa-atcatgtcattcctgtgaggc-----tgatgctgttt-ac
                Bushbaby  tgtcccatccaa-ggtatgtcattcctgtgagac-----agata---------
                     Pig  tatccattccag-accaccccgtgcctgtgaggc-----cagtagcagtt-ac
                  Alpaca  tatccagtccag-accaccccatgcctgtgaggc-----cagtaattgtt-gc
          Bactrian camel  tatccagtccag-accaccccatgcctgtgaggt-----cagtaattgtt-gc
                 Dolphin  tatccagtccag-accaccccatgcctgtgaggc-----cagtaacggtt-ac
            Killer whale  tatccagtccag-accaccccatgcctgtgaggc-----cagtaatggtt-ac
        Tibetan antelope  -------cctgg-accaccctacgcctgtgaggc-----cagtaatggtt-cc
                     Cow  -------cctgg-accacctggtgcctgtgaggc-----cagtcatggtt-cc
                   Sheep  -------cctgg-accaccccatgcctgtgaggc-----cagtaatggtt-cc
           Domestic goat  -------cctgg-accaccccatgcctgtgaggc-----cagtaatggtt-cc
                   Horse  tatccagtccag-gccaccccatgcctgtgaggc-----tagtgatggtt-ac
        White rhinoceros  tatccaatccag-gccactccatgcctgtgaggc-----cagtgacggtt-ac
                     Cat  tatcaaatgcaa-tccaactcatgt--ataaggc-----cagtaatggttac-
                     Dog  gattgaa------accacctcacgt--gcaaagc-------aggatggtgga-
                 Ferret   tattgaacacaactccaatgcatgc--ataaggccaatgcaatgatagtttat
                   Panda  tattgactgcag-gccaaggcatgc--ataagac-----caatgacggtttac
          Pacific walrus  tactgactgcaa-gccaacgcatgc--ataaggc-----cagtgatggtttac
            Weddell seal  cactgaatgcaa-gccagcgcatgc--ataaggc-----cagtgatggtttac
        Black flying-fox  tggacagtagag-gccatcctgtgcttgtgaggc-----cagtgacggtt-gc
                 Megabat  tatcccatctgg-gccatgtcattcctgtgagaa-----caatgctggtt-cc
      Chinese tree shrew  =====================================================
         Tasmanian devil  =====================================================
                  Baboon  =====================================================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 71 of 836 in window, 233950 - 233964, 15 bps 
B D                Human  tctctactggcttct---
B D                Chimp  tctctactggcttct---
B D            Orangutan  tctctactggcttct---
B D               Gibbon  tctctactggcttct---
B D  Crab-eating macaque  tgtctactggcttct---
B D               Baboon  tctctactggcctct---
B D         Green monkey  tctctattggcttct---
B D             Marmoset  tctctactggcttct---
B D      Squirrel monkey  tctctcctggcttcc---
B D             Bushbaby  -ctctactggatttt---
B D                  Pig  ttg----------ctcct
B D               Alpaca  tcc----------ctcct
          Bactrian camel  tcc----------ctcct
B D              Dolphin  tct----------ctcct
            Killer whale  tct----------ctcct
        Tibetan antelope  tct----------ttcct
B D                  Cow  tct----------ttcct
B D                Sheep  tct----------ttcct
           Domestic goat  tct----------ttcct
B D                Horse  tctctaccggcctcccct
B D     White rhinoceros  tctcatgtggcctctcct
B D                  Cat  -ctccactggc--ctcct
B D                  Dog  -ctccaggagcctctcct
B D              Ferret   tctccccaggcctctcct
B D                Panda  tctccactagcctctc--
          Pacific walrus  tctccactagcctctcct
            Weddell seal  tctccactagcctctcct
        Black flying-fox  tctttgctagcatctcca
B D              Megabat  tctattttggccac-cta
     Chinese tree shrew  ==================
B D      Tasmanian devil  ==================
B D              Gorilla  NNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNN

Inserts between block 71 and 72 in window
B D            Bushbaby 3bp

Alignment block 72 of 836 in window, 233965 - 234024, 60 bps 
B D                Human  gttcacctttcc------------acc----ggccccaagacaca--cacata---gtgacacaaggcag
B D                Chimp  gttcacctttcc------------acc----agccccaagacaca--cacata---ctgacacaaggcag
B D            Orangutan  gttcacctttcc------------acc----agccccaagacaca--cacata---gtgacacaaggcag
B D               Gibbon  cttcacctttcc------------acc----ggccccaagacaca--cacata---gtgacacaaggcat
B D  Crab-eating macaque  gttcacctttcc------------acc----tgccccaagacata--cacata---gtgacataaggcag
B D               Baboon  gttcacctttcc------------acc----tgccccaagacata--cacgta---gtgacataaggcag
B D         Green monkey  gttcacctttcc------------acc----tgccccaagacata--cacgta---gtgacataaggcag
B D             Marmoset  gtccacctttcc------------act----tgccccatga-----------------------------
B D      Squirrel monkey  gtttacctttcc------------act----tgccccacga-----------------------------
B D             Bushbaby  tttcacctttct------------acc----tgacccaaaacaca--aatatg---acatc---------
B D                  Pig  gttcacgcctctgcctgcccccgcctctgcctgcccccaaatgca--cccaca---cagtcaaaaggcag
B D               Alpaca  gttcacatgt-------------------------ccgaaacaca--ttcaca---cagtcaaaaggcag
          Bactrian camel  gttcacatgt-------------------------ccgaaacaca--ttcaca---cagtcaaaaggcat
B D              Dolphin  gttcacatctct------------tcc----tgcccccaaacaca--cacaca---tagtacaaaggcag
            Killer whale  gttcacatctct------------ttc----tgcccccaaacata--cacaca---tagtacaaaggcag
        Tibetan antelope  gttcatgtgtct------------ttccacgtgccccaggacacattcttgca---tagtcaaaaggcaa
B D                  Cow  gttcatgtgtct------------ttccacatgccccaggatacattctcgca---tagtcaaaaggcaa
B D                Sheep  gttcatgtgtct------------ttccacgtgccccaggacacattcttgca---tagtcaaaaggcaa
           Domestic goat  gttcatgtgtct------------ttccacgtgccccaggacacattcttgca---tagtcaaaaggcaa
B D                Horse  gttcacatctct------------gcc----tgccccaggataca--cacaca---gtgtcacaaggcag
B D     White rhinoceros  gttcacatctct------------gcc----tgccccaaaataca--caca-------gtgacaaagcag
B D                  Cat  tttcacatctct------------gcc----tggcccaaaacaca--c--------acagcacagggaat
B D                  Dog  -ttcacatctct------------gcc----tggccccaaacac------------acagcacaaggcag
B D              Ferret   tctgtcatctct------------gcc----tagcccaaaacacc--cacacac--aaagcacaagacct
B D                Panda  -ctcacatttct------------gcc----tggcccaaaacaca--cacacacacagagcacaaggcag
          Pacific walrus  tctctcatctct------------acc----tggcccagaacaca--cacaca---agaacacaaggcgg
            Weddell seal  tctctcatctct------------act----tgacccaaaacaca--cac------agagcacaaggcag
        Black flying-fox  gtccacatctct------------gcc----tgcccc-------------------caagcaca---cag
B D              Megabat  atgttcctcctt------------gcc----tgcccca------------------cagtcacaaggcag
     Chinese tree shrew  ======================================================================
B D      Tasmanian devil  ======================================================================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  tgga----------ca-ggg----------aa
                   Chimp  tgga----------ta-ggg----------aa
               Orangutan  tgga----------ta-ggg----------aa
                  Gibbon  tgga----------ta-ggg----------aa
     Crab-eating macaque  tgga----------ta-ggg----------aa
                  Baboon  tgga----------ta-ggg----------aa
            Green monkey  tgga----------ta-ggg----------aa
                Marmoset  --------------------------------
         Squirrel monkey  --------------------------------
                Bushbaby  taga----------ta-ggg----------aa
                     Pig  ctgg----------ta-ggg----------ag
                  Alpaca  ctgg----------ta-ggg----------aa
          Bactrian camel  ctgg----------ta-ggg----------aa
                 Dolphin  ctgg----------ta-ggg----------aa
            Killer whale  ctgg----------ta-ggg----------aa
        Tibetan antelope  ctgg----------ta-ggg----------aa
                     Cow  ctgg----------ta-ggg----------aa
                   Sheep  ctgg----------ta-ggg----------aa
           Domestic goat  ctgg----------ta-ggg----------aa
                   Horse  ctggg---------taggga----------aa
        White rhinoceros  ctggg---------ta-aga----------aa
                     Cat  ctggg---------ga-ggg----------aa
                     Dog  ctgga---------aa-ggg----------ga
                 Ferret   ttggg---------aa-agg----------aa
                   Panda  ctggg---------aa-ggggatttttaaaat
          Pacific walrus  ttggg---------aa-ggg-----------a
            Weddell seal  ttggg---------aa-ggg----------aa
        Black flying-fox  cgtaacaggacaacta-gga----------aa
                 Megabat  cttaa---------ta-ggg----------ga
      Chinese tree shrew  ================================
         Tasmanian devil  ================================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 72 and 73 in window
B D            Bushbaby 1bp

Alignment block 73 of 836 in window, 234025 - 234170, 146 bps 
B D                Human  agagcaag-actttata-aagtaagcaca-----caa-caaaggtatctttctaat---gagg-aggagg
B D                Chimp  agagcaag-acttgata-aagtaagcaca-----gaa-caaaggtatctttctaat---gagg-aggaga
B D            Orangutan  agagcaag-actttata-aggtaagcaca-----gaa-caaaggtatctttctaat---gagg-aggagg
B D               Gibbon  agagcaag-actgtata-aagtaagcaca-----gaa-caaaggtgtctttctaat---gagg-aagagg
B D  Crab-eating macaque  agagcaag-acttttta-aagtaagcacg-----gaa-caaaggtgtctttctaat---gagg-aggagc
B D               Baboon  agagcaag-ac-tttta-aagtaagcaca-----gaa-caaaggtgtctttctaat---gagg-aggagc
B D         Green monkey  agagcaag-acttttta-aagtaagcaca-----gaa-caaaggtgtcttcctaat---gagg-aggagg
B D             Marmoset  ----caag-acttttta-aagtaagcaca-----gaa-cgtaggtatctttctaatgaggagg-aggagg
B D      Squirrel monkey  ----caag-acttttta-aagtaagcaca-----gaa-cataggtatctttctaat---gagg-aggagg
B D             Bushbaby  agagcaag-acttcttc-aactaagcata-----gaa-caaagatatctctccatt---gaag-aggtgg
      Chinese tree shrew  agagcaag-acatttta-ta-----tata-----aaa-caaaagtatct--ccagt---ggggcaggggc
B D                  Pig  agaccacg-acttttgt-aactaagcaca-----gag-caaag--atttctccaat---aaga-aggcgg
B D               Alpaca  agactaat-attttttt-aactgaacacaaaagaaaa-aaaattactttctccaat---gatg-agatgg
          Bactrian camel  agactaat-attttttt-aactgaacacaaaag-aaa-aaaattaatttctccaat---gatg-agatgg
B D              Dolphin  agaccaag-agttttta-aactaagcaca-----gag-caaagttatttctccaat---gagg-agatga
            Killer whale  agaccaag-agttttta-aactaagcaca-----gag-caaagttatttctccaat---gagg-agatga
        Tibetan antelope  agatcaag-atttttta-aa-taagcaca-----gaa-cagaggtatttctccaag---gagg-aggtgg
B D                  Cow  agatcaag-agtgt------ttaagcaca-----aaa-cagaggtatttctccaag---gagg-atgtgg
B D                Sheep  agatcaag-atttttta-aattaagcaca-----gaa-cagaggtatttctccaag---gagg-aggtgg
           Domestic goat  agatcaag-atttttta-aattaagcaca-----gaa-cagaggtatttctccaag---gagg-aggtgg
B D                Horse  agaccaag-acttctta-aactaaacaca-----gac-cgaagatctctctccaac---gagg-aagtgg
B D     White rhinoceros  agatcagg-acttttta-aactaaacaca-----gac-caaagatatctctccgat---gagg-aggtgg
B D                  Cat  agcccaag-aatt-ttataaataatcgct-----gaa-caaaggtatctctctagt---gagg-aggtga
B D                  Dog  agacccag-aattgttg-aaataagtgca-----gaa-caaatgcatctgtccgcc---aagg--aataa
B D              Ferret   agaccaagaaatt-tta-aaataagcaaa-----gaa-caa--acatctttccaac---gggg-aggtaa
B D                Panda  aagcccaa-aatt-tta-aaataagcaca-----aaa-caagtgtatctctccaat---gagg-aggtaa
          Pacific walrus  agaccaag-aatt-tta-aagtaagcata-----gaa-cagatatatctctt-------------ggcaa
            Weddell seal  aaaccaag-aatt-tta-aaacaagcaca-----gaa-cagatacatctctt-------------ggtaa
        Black flying-fox  agaccagg-gcttttta-aactaaacaga-----a---caaaggtatctctccaat---gagg-aggtgg
B D              Megabat  gagcccag-acttttta-aactaagtgta-----cattcaaaagtatctctccagt---gagg-aggagg
B D      Tasmanian devil  ======================================================================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  -tgttggttctg------ggaaggaagct-----------------t-----gggatttgggtattca--
                   Chimp  -tgttggttctg------ggaaggaagct-----------------t-----gggatttgggtattca--
               Orangutan  -tgttggttccg------ggaaggaagcttggaggagaaagggcaat-----gggatttgggtattca--
                  Gibbon  -tgttggttccg------ggaaggaagcttggaggagaaagggcaat-----gggatttgggtatgta--
     Crab-eating macaque  -tgttggttccg------ggaaggaagcttggaggagaaagggcaat-----aagatttgggtattca--
                  Baboon  -tgttggttccg------ggaaggaagcttggaggtgaaagggcaat-----aagatttgggtattca--
            Green monkey  -tgttggttccg------ggaaggaagcttggaggagaaagggcaat-----aagatttgggtgttca--
                Marmoset  -tgttggttctg------ggaaggaagcttgaaggaggaagggcagt-----gggatttgggtattca--
         Squirrel monkey  -tgttggttttg------ggaaggaagcttgaaggagaaagggcagt-----gggatttgggtattca--
                Bushbaby  ctcttgcttctg------ggaaaggaccttggagaaggaagggcagt-----gcagcttgggggttca--
      Chinese tree shrew  -acttatttctg------agaaagaagtgttgaggaggaagggcaat-----atagtttgagtaacca--
                     Pig  tacttggctctg------ggaagggagtttggaggagagag--caat-----gcggtttgcatgttaa--
                  Alpaca  cacttggctctg------ggaagagagcttggaggacaaagggcaat-----gtaa-ttggatgttaa--
          Bactrian camel  cacttggctctg------ggaagagagcttggaggagaaagggcaat-----gtaa-ttggatgttaa--
                 Dolphin  cacttggctctg------ggaagggagc-tggaggagaaagggcaat-----gcagtttggatgttaa--
            Killer whale  cacttggctctg------ggaagggagc-tggaggagaaagggcaat-----gcagtttggatgttaa--
        Tibetan antelope  cacttggttcag------gaaagggaacttggaggagaaaggatgat-----gtactttggatgttag--
                     Cow  cacttggttcag------gaaagggaacttggaggagaaagggtgat-----ccactttggatgttag--
                   Sheep  cacttggttcag------gaaagggaacttggaggagaaaagatgat-----gtactttggatgttag--
           Domestic goat  cacttggttcag------gaaagggaacttggaggagaaaggatgat-----gtactttggatgct----
                   Horse  tgcttggctctg------ggaagacagcttggcggaggaagggcaat-----gcagtttgggtgttaa--
        White rhinoceros  cacttggctctg------ggaagacaacttggaggagaaggggcaat-----gcagtttgggtgtcat--
                     Cat  gacttggctctg------tga--------------tggaaaggcaaa-----gcacttgggatgttaa--
                     Dog  gacttgtctcag------cga--------------gggcg-------------------gcgtattag--
                 Ferret   cccttggttttg------aga--------------tgggaggataat-----gtgcagtgagtgttaa--
                   Panda  gccttggttctg------cga--------------tgggagggcaaa-----gtgccatgggtgttaa--
          Pacific walrus  accttggttc-------------------------------------------tgcgatgggtgttac--
            Weddell seal  accttggttctg------gga--------------tgggagggcaaa-----gtgcgatgggtgttaa--
        Black flying-fox  cagttggccctg------------------------------ggaat-----gcagtttgggtgtaaa--
                 Megabat  gaaggggcactgactttgtaaaggcagct------tggagaaggaatatgaagctatttgggggttaaag
         Tasmanian devil  ======================================================================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  ------ggatccagaagt--gagagagcctgggaa-----------------------------------
                   Chimp  ------ggatccagaagt--gagagagcctgggaa-----------------------------------
               Orangutan  ------ggatacagaagt--gagagagcctgggaa-----------------------------------
                  Gibbon  ------tgatccagaagtgagagagagcctgagaa-----------------------------------
     Crab-eating macaque  ------ggatccagaagtgagagagagcttgggaa-----------------------------------
                  Baboon  ------ggatccagaagtgagagagagcctgggaa---------ctggagaaagaaaaagcattgcccat
            Green monkey  ------ggatccagaagtgagagagaacctgggaagctcaggaaccggagaaagaaaaagcatt------
                Marmoset  ------agatccagaaatgagagaaagcctgggaa-----------------------------------
         Squirrel monkey  ------agatccagaaatgagagaaagcctgggaa-----------------------------------
                Bushbaby  ------ggatccaagaatgggagagagcctaggaa-----------------------------------
      Chinese tree shrew  ------ggattcaaga-tggggtagcccctgggaa-----------------------------------
                     Pig  ------gg-------agtagaagagagcctgggag-----------------------------------
                  Alpaca  ------gg-------aatggaagagagcctgagaa-----------------------------------
          Bactrian camel  ------cg-------aatggaagagagcctgagaa-----------------------------------
                 Dolphin  ------gg-------aatggaagagagcctgggaa-----------------------------------
            Killer whale  ------gg-------aatggaagagagcctgggaa-----------------------------------
        Tibetan antelope  ------ag-------agtgagaaagagcctaggaa-----------------------------------
                     Cow  ------ag-------agtgaaaaagagcctaggaa-----------------------------------
                   Sheep  ------ag-------agtgaaaaagagcctaggaa-----------------------------------
           Domestic goat  ------gg-------agtgaaaaagagcctaggaa-----------------------------------
                   Horse  ------gg-------aatggcagagagccagggaa-----------------------------------
        White rhinoceros  ------gg-------aatggcagagagcctgggaa-----------------------------------
                     Cat  ------tg-------gatggaagggagcctgggaa-----------------------------------
                     Dog  ------tg-------ggc----------------------------------------------------
                 Ferret   ------ta-------gatgggagagagcctggg-a-----------------------------------
                   Panda  ------tg-------gatgggagagagcctggg-a-----------------------------------
          Pacific walrus  ------tg-------ggtgggagagagcctggg-a-----------------------------------
            Weddell seal  ------tg-------ggtgggagagagcctggg-a-----------------------------------
        Black flying-fox  ------gg-------agtgggagagagcctgggaa-----------------------------------
                 Megabat  atccacag-------aataggagggagtctgagaa-----------------------------------
         Tasmanian devil  ======================================================================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  ------------------gtt-------------------------------------------------
                   Chimp  ------------------gtt-------------------------------------------------
               Orangutan  ------------------gtt-------------------------------------------------
                  Gibbon  ------------------gct-------------------------------------------------
     Crab-eating macaque  ------------------gct-------------------------------------------------
                  Baboon  tctcacccatgaccctgtgctcagcaggtacta----------------------------------gca
            Green monkey  ------------------gcc----------cattctcacccatgaccctgtgctcagcaggtactagca
                Marmoset  ------------------gct-------------------------------------------------
         Squirrel monkey  ------------------gct-------------------------------------------------
                Bushbaby  ------------------gct-------------------------------------------------
      Chinese tree shrew  --------------------t-------------------------------------------------
                     Pig  ------------------gct-------------------------------------------------
                  Alpaca  ------------------gcc-------------------------------------------------
          Bactrian camel  ------------------gcc-------------------------------------------------
                 Dolphin  ------------------gct-------------------------------------------------
            Killer whale  ------------------gct-------------------------------------------------
        Tibetan antelope  ------------------gct-------------------------------------------------
                     Cow  ------------------gct-------------------------------------------------
                   Sheep  ------------------gct-------------------------------------------------
           Domestic goat  ------------------gct-------------------------------------------------
                   Horse  ------------------gct-------------------------------------------------
        White rhinoceros  ------------------gct-------------------------------------------------
                     Cat  ------------------gct-------------------------------------------------
                     Dog  ----------------------------------------------------------------------
                 Ferret   ------------------gca-------------------------------------------------
                   Panda  ------------------gct-------------------------------------------------
          Pacific walrus  ------------------gct-------------------------------------------------
            Weddell seal  ------------------gct-------------------------------------------------
        Black flying-fox  ------------------gtt-------------------------------------------------
                 Megabat  ------------------gct-------------------------------------------------
         Tasmanian devil  ======================================================================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  ----------caggaaccagagaaag-aaa
                   Chimp  ----------caggaaccagagaaag-aaa
               Orangutan  ----------caggaaccagagaaag-aaa
                  Gibbon  ----------caggaaccagagacag-aaa
     Crab-eating macaque  ----------caggaaccggagaaag-aaa
                  Baboon  gagacttcagcaggaaccagagaaag-aaa
            Green monkey  gagacttcagcaggaatcagagaaagaaaa
                Marmoset  ----------caggaaccagaaaaag-aaa
         Squirrel monkey  ----------caggaaccagagaaag-aaa
                Bushbaby  ----------tgggaactggaaaaag-gaa
      Chinese tree shrew  ----------tcagaacaggagaaag-gaa
                     Pig  ----------caggcgtaggagggaa-gga
                  Alpaca  ----------taggaataggagaaaa-gga
          Bactrian camel  ----------taggaataggagaaaa-gga
                 Dolphin  ----------caggaataggagaaaa-gga
            Killer whale  ----------caggaataggagaaaa-gga
        Tibetan antelope  ----------cagcaacaggagagga-gga
                     Cow  ----------cagcaacaggagagga-gga
                   Sheep  ----------cagcaacaggagagga-gga
           Domestic goat  ----------cagcaacaggagagga-gga
                   Horse  ----------tcagaataggagaaaa-tgt
        White rhinoceros  ----------caggaataggagaaaa-ggt
                     Cat  ----------cagagactggagaaaa-gga
                     Dog  -------------agaccagagagga-ggg
                 Ferret   ----------cagagacaggag--------
                   Panda  ----------cagagacaggagaaga-gaa
          Pacific walrus  ----------cagagacagg---aga-gga
            Weddell seal  ----------cagagacaggagaaga-gga
        Black flying-fox  ----------caggaacaggagacaa----
                 Megabat  ----------caggagcagaaaaaaa----
         Tasmanian devil  ==============================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 73 and 74 in window
       Black flying-fox 3bp
B D             Megabat 12307bp

Alignment block 74 of 836 in window, 234171 - 234223, 53 bps 
B D                Human  aagccttgcccattctcacc-ca-tgacactgtgctcag-caggtactagc--ag---------------
B D                Chimp  aagccttgcccattctcacc-ca-tgacactgtgctcag-caggtactagt--ag---------------
B D            Orangutan  aagccttgcgcattctcacc-ca-tgaccctgtgctcag-caggtactagcagag---------------
B D               Gibbon  aagccttgcccattctcacc-cg-tgaccttgtgctcag-caggtactagcagag---------------
B D  Crab-eating macaque  aagcattgcccattctcacc-ca-tgaccctgtgctcag-caggtactagcagagacttcagcaggaacc
B D               Baboon  aagcattgcccattcacacc-ca-tgacactgtgctcag-caggtactagcagag---------------
B D         Green monkey  aagccttgcccattctcacc-ca-tgacactgtgctcag-caggtactagcagag---------------
B D             Marmoset  aagccctgtctgttctcacc-ca-tgaccctgtgctcat-caggtactagcaaag---------------
B D      Squirrel monkey  aagctttgcctgttctcacc-ca-tgacactgtgctcgg-caggtactaacaaag---------------
B D             Bushbaby  aatcctcacccagtctcact-ag-tgaccttgtgtttag-c------------ag---------------
      Chinese tree shrew  cagccctgcctgttgtcact-ag-tgac--tgtgctata-cag----------ag---------------
B D                  Pig  ggactctgcctgtctccacc-tagtgctcctgtgctcag-caggtgatagaagac---------------
B D               Alpaca  gcagtctacccatcctcacc-tggtgatcctgtgctcag-caggtattggaagac---------------
          Bactrian camel  gcactctacccatcctcacc-tggtgatcctgtgctcag-caggtattggaagac---------------
B D              Dolphin  gacctctgcccatccttact-tggggatcctgtgctcag-caggtactagaagac---------------
            Killer whale  gacctctgcccatccttact-tgggggtcctttgtctag-caggtactagaagac---------------
        Tibetan antelope  gacctcttcccatccttacc-tggtgatgctgtgctcag-caggtgctggaagac---------------
B D                  Cow  gacctcttcccatccttatc-tggtgatgctgtgctcag-caggtgctggaagac---------------
B D                Sheep  gacctcttcccatccttacc-tggggatgctgtgctcag-caggtgctggaagac---------------
           Domestic goat  gacctcttcccatccttacc-tggtgatgctgtgctcag-caggtgctggaagac---------------
B D                Horse  gagctctcgccatcctcacc-tgttgttcttgtgctcagccgggtactagaagag---------------
B D     White rhinoceros  gagctctgcccatcctcacc-tggtgatcttgtgctcag-caggtcctagaagag---------------
B D                  Cat  aaagcctgcacatcctaccc-tggtggtcctgtgttcag-catacgctacaagag---------------
B D                  Dog  ----------catcctccctccagcaatcctcggttcag-catacactg--ggag---------------
B D              Ferret   -aa--ctccacatcctccct-tggtaatcctgtatgcag-cctataccgcaagag---------------
B D                Panda  -aa--ctccatatcctcctt-tggtgatcctgtgttcag-tctataaagcaagag---------------
          Pacific walrus  cag--ctccacatcctccct-tggtgatcctgtgttcag-cctgtactgcaagag---------------
            Weddell seal  gag--ctccacatcctccct-tggtgatcctgtgttcag-cctatactgcaagag---------------
        Black flying-fox  gagctccgccctcccttacc-tggtgagccagtgctcag-cagctgccggaaaag---------------
B D              Opossum  aggcctggctgcctctcccc-tcctgacaccccccaccc-ccttttatggctgtc---------------
B D              Megabat  ======================================================================
B D      Tasmanian devil  ======================================================================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  ---------------------------------------------------------------act
                   Chimp  ---------------------------------------------------------------act
               Orangutan  ---------------------------------------------------------------act
                  Gibbon  ---------------------------------------------------------------act
     Crab-eating macaque  agagaaagaaaaagcattgcccattcacacccatgacactgtgttcagcaggtactagcagatact
                  Baboon  ---------------------------------------------------------------act
            Green monkey  ---------------------------------------------------------------act
                Marmoset  ---------------------------------------------------------------cct
         Squirrel monkey  ---------------------------------------------------------------act
                Bushbaby  ------------------------------------------------------------------
      Chinese tree shrew  ---------------------------------------------------------------act
                     Pig  ---------------------------------------------------------------atg
                  Alpaca  ---------------------------------------------------------------act
          Bactrian camel  ---------------------------------------------------------------act
                 Dolphin  ---------------------------------------------------------------act
            Killer whale  ---------------------------------------------------------------act
        Tibetan antelope  ---------------------------------------------------------------ac-
                     Cow  ---------------------------------------------------------------act
                   Sheep  ---------------------------------------------------------------ac-
           Domestic goat  ---------------------------------------------------------------ac-
                   Horse  ---------------------------------------------------------------gct
        White rhinoceros  ---------------------------------------------------------------gct
                     Cat  -----------------------------------------------------------------t
                     Dog  ---------------------------------------------------------------act
                 Ferret   ---------------------------------------------------------------act
                   Panda  ---------------------------------------------------------------act
          Pacific walrus  ---------------------------------------------------------------act
            Weddell seal  ---------------------------------------------------------------act
        Black flying-fox  ---------------------------------------------------------------act
                 Opossum  ---------------------------------------------------------------aat
                 Megabat  ==================================================================
         Tasmanian devil  ==================================================================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 75 of 836 in window, 234224 - 234336, 113 bps 
B D                Human  tcaggct---ctgtgac-taaaagg-------ggtc-aga-ccagttgatatacccaca--gctgc-cat
B D                Chimp  tcaggct---ctgtgac-taaaagg-------ggtc-aga-ccagttgatatacccaca--gctgc-cat
B D            Orangutan  tcaagct---ctgtgac-taaaagg-------ggtc-aga-ccagttcatatacccaca--gctgc-cat
B D               Gibbon  tcaggct---ctgtgac-taaaagg-------ggtc-aga-ccagttcatatacccaca--gctac-cat
B D  Crab-eating macaque  tcaggct---ctgtgac-taaaagg-------gatc-aga-ccagttcatatacccaca--gctgc-cat
B D               Baboon  tcaggct---ctgtgac-taaaagg-------ggtc-aga-ccagttcatatacccaca--gctgc-cat
B D         Green monkey  tcaggct---ctgtgac-taaaagg-------ggtc-aga-ccagttcatatacccaca--gctgc-cat
B D             Marmoset  tcaggct---ctgtgac-taaaagg-------ggtcggaa-ccagtttgtgtacccaca--gctgc-cat
B D      Squirrel monkey  tcaggct---ctatgac-caaaagg-------ggtc-gaa-ccagtttgtgtacccaca--gctgc-cat
B D             Bushbaby  --------------------------------ggtc-agc-ccagtttgtataaccaaa--tctgc-tat
      Chinese tree shrew  atggact--cctatg----gaaagg-------ggtc-agt-ccagttcataagcctgca--gttgc-cac
B D                  Pig  gtgagga---ctgtgatgtgaaagggag----ggtc-gcc-ccagttctcagtgccgta--tctgtgggg
B D               Alpaca  gtgggga---ttgtgacttgaaagg-aa----ggtc-tca-ccaactcacattcccata--gctgc-cat
          Bactrian camel  gtgggga---ttgtgacttgaaagg-aa----ggtc-tca-ccaactcaccttcccata--gctgc-cat
B D              Dolphin  gtgagga---tggtgacttgaaaggtag----ggtc-aca-ccaactcacattcccata--tctgc-cat
            Killer whale  gtgagga---tggtgacttgaaaggtag----ggtc-aca-ccaactcacattcccata--tctgc-cat
        Tibetan antelope  --aagga---t--tggcttgaaaaggag----ggtt-gta-ccaacttgccttcccata--tctgc-tgt
B D                  Cow  gtgagga---t--tgacttgaaagggag----ggtt-gta-ccaacttgccttcccgta--tctgc-tgt
B D                Sheep  --aagga---t--tggcgtgaaaaagag----ggtt-gta-ccaacttgccttcccata--tctgc-tgt
           Domestic goat  --aagga---t--tggcttgaaaaggag----ggtt-gta-ccaacttgccttcccata--tctgc-tgt
B D                Horse  gcgagga---ttgtgaattgaaagggaa----agtc-aca-tcgcgtcccgtacccgta--gctgc-cac
B D     White rhinoceros  gcgggga---ttatgacttgaaagggaaggtcagtc-acg-tcaactcacatacccata--gcttc-cac
B D                  Cat  gcaagga---ttgtgacttgaatggga--------c-aca-aagactcacattcccacg--gctac-cac
B D                  Dog  gcaag------------------gtggg----ggtc-aca-tacactccc-tcatcctg--aatgc-cag
B D              Ferret   gcaagga---ttgtaacttgaaagggag----ggtc-aca-cagactcccattcccctg--aatgc-cag
B D                Panda  gcaagga---ttgtgacttgaaagggag----agtc-aca-cagactcccattcctctg--aatgc-cag
          Pacific walrus  gcaagga---ttgtgacttgaaagggag----ggtc-aca-cagactcctgttcctctg--catgc-cag
            Weddell seal  gcaagga---ttgtgacttgaaagggag----ggtc-aca-cagactcctgttcctctg--aatgc-cag
        Black flying-fox  g------------tgacttcaaagggag----gatc-aca-caaactcacat--ccata--gctgc-cat
                Aardvark  tcaggctggtcggggacctgaagggga-----cctc-agg-cgagcccagatgcccctgctgcagc-cg-
B D              Opossum  gtgggct---ctagaaccaccaa---------actt-gcagccacctggcatgtggaaa--gcccc-cac
B D              Megabat  ======================================================================
B D      Tasmanian devil  ======================================================================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  gtaaggatgtgtgtggacttcactagggaagaacggtgttatgaaagaaggggcagaaa
                   Chimp  gtaaggatgtgtg--gacttcactagggaagaacagtgttatgaaagaaggggcagaaa
               Orangutan  gtaaggatgtgtgtgaacttcactagggaagaacggtgttatgaaagaaggggcagaaa
                  Gibbon  gtaaggatgtgtgtggacttcactaggaaagaacggtgttatgaaggaaggggcagaaa
     Crab-eating macaque  gtaaggatgtgtgtggactttactagggaagaagggtgttatgaaggaaggggcagaaa
                  Baboon  gtaaggatgtgtgtggactttactagggaagaagggtgttatgaaggaaggggcagaaa
            Green monkey  gtaaggatgtgtgtggactttactagggaagaagggtgttatgaaggaaggggcagaaa
                Marmoset  gtaagggtgtttttggacttcactagggaagaagggtgttatgaaggaagggtcagaag
         Squirrel monkey  ataagggtgtttgtgaacttcactagggaagaagggtgttgtgaaggaagggtcagaag
                Bushbaby  gtagag-----tatgggcttcactagggtgggaagacattcaggagaaaggtgctgaa-
      Chinese tree shrew  tta-----gtacatgggcttcagtaggatgggagggtatcatgaagaaaggggcagaaa
                     Pig  gtga-----tgtgtgagctttac-aggaaagaagggtg-tatgaagtgaagggcagaga
                  Alpaca  gtaa-----agtgtgggctctac-aggatagaaggata-tatgaagtgacaggcagaca
          Bactrian camel  gtaa-----agtgtgggctctac-aggatagaaggata-tatgaagtgacaggcagaca
                 Dolphin  gtga-----tgtgtgggctttac-agggtagaagggtg-tatggagtaaagggcagaga
            Killer whale  gtga-----tgtgtgggctttac-agggtagaagggtg-tatggagtaaagggcagaga
        Tibetan antelope  gtga-----tgtgtgggctttac-agcatag-----------------aggggcagaga
                     Cow  gtga-----tgtgtgggctttac-agcatag-----------------aggggcagaga
                   Sheep  gtga-----tgtgtgggctttac-agtatag-----------------aggggcagaga
           Domestic goat  gtga-----tgtgtgggctttac-agtatag-----------------aggggcagaga
                   Horse  atga-----catgtgggcttcaccaaggtggaagggtgttatgaaacaaagggcagaca
        White rhinoceros  gtga-----cgtgtgggcgtcatcaggatggaagggtgttatggaacaaagggcagaca
                     Cat  gtgg-----tgtatgggcttcaccaggattca-gggtattgtgaagcacaaggta-a--
                     Dog  ggga-----cacgc-agcttccc----------ggg-----------------------
                 Ferret   gtga-----caggtgggcttcagcaggaatc--gggcattgtgaagcacagggcaga--
                   Panda  gtga-----caggtgggcttcaccaggatgcaggggcattatgaagcacaaggcaga--
          Pacific walrus  gtga-----caggtgggcttcaccagggttcaggggtgttgagaagcacaggacaga--
            Weddell seal  gtga-----ccggtgggcttcaccagggttcaggggtattaagaagcacagggcaga--
        Black flying-fox  ggga-----tgtgt-ggcttcatcaggat-------------gaagca-aaggcaaa--
                Aardvark  ---------aggctggacgtcccccggagaggagggcagtacg----------------
                 Opossum  ttgaaa---gggaagactttcactttgccaggagacaatttcgaagtgagggaaa----
                 Megabat  ===========================================================
         Tasmanian devil  ===========================================================
                 Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 75 and 76 in window
     Chinese tree shrew 257bp

Alignment block 76 of 836 in window, 234337 - 234380, 44 bps 
B D                Human  aactcacctgttggtctgcatgtagaggtttattgt------cctgaa-tt----
B D                Chimp  aactcacctgttggtctgcatgtagaggtttattgt------cctgaa-tt----
B D            Orangutan  aactcacctgttggtctccatgtagaggtttattgt------cctgaa-tt----
B D               Gibbon  aactcacctgttggtctctatgtagatgtttagtat------cctgaa-tt----
B D  Crab-eating macaque  aactcacctgttggtctccaggtagaagtttattgt------cccgaa-tt----
B D               Baboon  aactcacctgttggtctccaggtggaagtttattgt------cccgaa-tt----
B D         Green monkey  aactcacctgttggtctccacgtagaattttattgt------cccgaa-tt----
B D             Marmoset  aactcacctgttcgtctcagtgtagaagtttattgt------cctgaa-tt----
B D      Squirrel monkey  aactcaccggttggtctccgtgtagaagtttatttt------cctgaa-tt----
B D             Bushbaby  ---------------------------gtttattgt------cctgaa-tc----
      Chinese tree shrew  aacctacctgttagtctccatgtacaagtttattgt------ctttaa-tc----
B D                  Pig  gacgtagctgttggtctccatgttcgagttcattgt------ccctgt-cc----
B D               Alpaca  agcttagctgttggtctccatgtgggagtttattgt------gcctgc-tc----
          Bactrian camel  aacttagctgttggtctccatgtaggagtttattgt------ccctgc-tc----
B D              Dolphin  aacttagctgttggtctccatgtaggagtttatcgt------ccctgc-tc----
            Killer whale  aacttagctgttggtctccatgtaggagtttatcgt------ccctgc-tc----
        Tibetan antelope  aacttagctgttgatgcccatgtaggagtttattgg------ccctgt-tg----
B D                  Cow  aacttagctgttgatgcccatgtaggagtttattgg------ccctgt-tc----
B D                Sheep  aacttagctgttgatgcccatgtaggagtttattgg------ccctgt-tc----
           Domestic goat  aacttagctgttgatgcccatgtaggagtttattgg------ccctgt-tc----
B D                Horse  aactcatctgttgatctctgtgcaggactttattgt------ccctgc-tc----
B D     White rhinoceros  aactcacttgttgatctccatgcaggagtttattgt------ccctgc-tc----
B D                  Cat  ----catgtgttcctctccatttacaagtgtattat------ccctgt-tc----
B D                  Dog  ---------gttcccctctgtctgcaggtatattat------ccccgt-tc----
B D              Ferret   ----cacttgttcctctccatctgcaagtttatcat------ccctct-tc----
B D                Panda  ----cacctgttcctctccatctgcaagtttatcat------ccctgt-tc----
          Pacific walrus  ----cacttgttcctctccatctgcaagtgtgtcat------ccctgt-tc----
            Weddell seal  ----cacttgttcctctccatctgcaagtgtatcat------ccctgt-tc----
        Black flying-fox  --ctcaccta-tggtctccctgtaggaattcat-at------cccttt-tc----
                Aardvark  --ctcacctggtgggctgtgtgtacgaggttattgt------ccctgagtc----
B D              Opossum  gccccccctcccaagttctgactaataatacacagtgaagtactttag-ctggag
B D              Megabat  =======================================================
B D      Tasmanian devil  =======================================================
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 77 of 836 in window, 234381 - 234390, 10 bps 
B D                Human  cctggaggtt
B D                Chimp  cctggaggtt
B D            Orangutan  cctggaggtt
B D               Gibbon  cctggaggtt
B D  Crab-eating macaque  cctggaggtt
B D               Baboon  cctggaggtt
B D         Green monkey  actggaggtt
B D             Marmoset  cctggaggtt
B D      Squirrel monkey  cctggaggtt
B D             Bushbaby  cctgatggtt
      Chinese tree shrew  cctaaagact
B D                  Pig  cttgatagct
B D               Alpaca  cttgattgtt
          Bactrian camel  cctgattgtt
B D              Dolphin  cctgatagtt
            Killer whale  cctgatagtt
        Tibetan antelope  cctaatagtt
B D                  Cow  cctaatagtt
B D                Sheep  cctaatagtt
           Domestic goat  cctaatagtt
B D                Horse  cc-aatggtt
B D     White rhinoceros  cctgatggtt
B D                  Cat  cctggtggct
B D                  Dog  cctggtggtt
B D              Ferret   cctggtgctt
B D                Panda  cctggtgctt
          Pacific walrus  cctggtgctt
            Weddell seal  cctggtgctt
        Black flying-fox  cccagtggtt
                Aardvark  ccttctgggg
B D              Opossum  -ctggcagtc
B D      Tasmanian devil  cctgggg---
B D              Megabat  ==========
B D              Gorilla  NNNNNNNNNN
B D               Rhesus  NNNNNNNNNN

Inserts between block 77 and 78 in window
     Chinese tree shrew 180bp

Alignment block 78 of 836 in window, 234391 - 234401, 11 bps 
B D                Human  cagtga-----aaagc
B D                Chimp  cagtga-----aaagc
B D            Orangutan  cagtga-----aaagc
B D               Gibbon  cagtga-----aaagc
B D  Crab-eating macaque  cagtga-----aaagc
B D               Baboon  cagtga-----aaagc
B D         Green monkey  cagtga-----aaagc
B D             Marmoset  cagtga-----aaagc
B D      Squirrel monkey  cagtga-----aaagc
B D             Bushbaby  tggtgg-----aaagc
B D                  Pig  cagcag-----accgc
B D               Alpaca  cagcat-----acagc
          Bactrian camel  cagcat-----acagc
B D              Dolphin  cattag-----acagc
            Killer whale  cagcag-----acagc
        Tibetan antelope  cagcag-----at-gt
B D                  Cow  cagcag-----at-gc
B D                Sheep  cagcag-----ac-gt
           Domestic goat  cagcag-----ac-gt
B D                Horse  cagtag-----acagc
B D     White rhinoceros  cggtgg-----acagc
B D                  Cat  tagtag-----agagt
B D                  Dog  cagtag-----ccagc
B D              Ferret   tagtag-----accac
B D                Panda  tagtag-----actgc
          Pacific walrus  tagtag-----actgc
            Weddell seal  tagtag-----accgc
        Black flying-fox  cagtgg-----acagc
                Aardvark  cagcgg-----gcagc
B D              Opossum  ctgtgatgggtaaagt
B D      Tasmanian devil  ctataa--agaaaagc
B D              Megabat  ================
     Chinese tree shrew  ================
B D              Gorilla  NNNNNNNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNNNNNNN

Inserts between block 78 and 79 in window
B D             Opossum 32bp

Alignment block 79 of 836 in window, 234402 - 234409, 8 bps 
B D                Human  ---agaagatt
B D                Chimp  ---agaagatt
B D            Orangutan  ------agatt
B D               Gibbon  ---agaagatt
B D  Crab-eating macaque  ---agaagact
B D               Baboon  ---agaagatt
B D         Green monkey  ---agaagatt
B D             Marmoset  ---agaaaatt
B D      Squirrel monkey  ---agaaaatt
B D             Bushbaby  ------agact
      Chinese tree shrew  ---aaatgact
B D                  Pig  ---caaggacc
B D               Alpaca  ---agaggacc
          Bactrian camel  ---agaggacc
B D              Dolphin  ---agaggact
            Killer whale  ---agaggact
        Tibetan antelope  ---agaggacc
B D                  Cow  ---agaggacc
B D                Sheep  ---agaggacc
           Domestic goat  ---agaggacc
B D                Horse  ---agagaacc
B D     White rhinoceros  ---agagaacc
B D                  Cat  ---agaggacc
B D                  Dog  ---ggagga-t
B D              Ferret   ---agagaacc
B D                Panda  ---agaggacc
          Pacific walrus  ---agaggacc
            Weddell seal  ---agaggacc
        Black flying-fox  ---agatggcc
                Aardvark  ----agggact
B D              Opossum  gggagaag---
B D      Tasmanian devil  aggagatg---
B D              Megabat  ===========
B D              Gorilla  NNNNNNNNNNN
B D               Rhesus  NNNNNNNNNNN

Inserts between block 79 and 80 in window
               Aardvark 228bp

Alignment block 80 of 836 in window, 234410 - 234419, 10 bps 
B D                Human  gtcttttaca
B D                Chimp  gtcttttaca
B D            Orangutan  gtcttttaca
B D               Gibbon  gtcttttaca
B D  Crab-eating macaque  gtctttttca
B D               Baboon  gtctttttca
B D         Green monkey  gtcttttaca
B D             Marmoset  gtctttttaa
B D      Squirrel monkey  gtctttttaa
B D             Bushbaby  ttctttttca
      Chinese tree shrew  gtttttttca
B D                  Pig  attttttcca
B D               Alpaca  attttttcca
          Bactrian camel  attttttcca
B D              Dolphin  attttttcca
            Killer whale  attttttcca
        Tibetan antelope  attttttcca
B D                  Cow  attttttcca
B D                Sheep  attttttcca
           Domestic goat  attttttcca
B D                Horse  atcttttcca
B D     White rhinoceros  gtcttttcca
B D                  Cat  atctcttcca
B D                  Dog  acagatgcca
B D              Ferret   acctagtcca
B D                Panda  accttttcca
          Pacific walrus  gcctattcca
            Weddell seal  acctattcca
        Black flying-fox  gtctcttcca
B D              Opossum  cccttctcta
B D      Tasmanian devil  gtctttgcca
B D              Megabat  ==========
B D              Gorilla  NNNNNNNNNN
               Aardvark  ==========
B D               Rhesus  NNNNNNNNNN

Alignment block 81 of 836 in window, 234420 - 234437, 18 bps 
B D                Human  ---catgttga-gttatg-cccc
B D                Chimp  ---catgttga-gttatg-cccc
B D            Orangutan  ---catgttga-gttatg-cccc
B D               Gibbon  ---catgttga-gttatg-cccc
B D  Crab-eating macaque  ---catgttga-gttatg-cccc
B D               Baboon  ---catgttga-gttatg-cccc
B D         Green monkey  ---catgttga-gttatg-cccc
B D             Marmoset  ---catgttga-gttctg-cccc
B D      Squirrel monkey  ---catgttga-cttctg-cccc
B D             Bushbaby  ---catgttga-attgtg--tcc
      Chinese tree shrew  ---catattga-gttctg--cct
B D                  Pig  ---aatgttg--atattt-ccc-
B D               Alpaca  ---aatgttga-atttct-ccc-
          Bactrian camel  ---aatgttga-atttct-ccc-
B D              Dolphin  ---aatgttga-atttct-ccc-
            Killer whale  ---aatgttga-atttct-ccc-
        Tibetan antelope  ---aatgttga-atttctcccc-
B D                  Cow  ---aatgttta-atttctcccc-
B D                Sheep  ---aatattga-atttctcccc-
           Domestic goat  ---aatgttga-atttctcccc-
B D                Horse  ---catgttga-attcct-c---
B D     White rhinoceros  ---tgtgttga-attcct-c---
B D                  Cat  ---cgcgctgactttcct-c---
B D                  Dog  ---cacgctca-tctcct-c---
B D              Ferret   ---catgctga-tttcct-c---
B D                Panda  ---cgtgctga-tttcct-c---
            Weddell seal  ---catgctga-tttcct-c---
        Black flying-fox  ---cgtgttga-attcct-c---
B D              Opossum  --aggtatc--------------
B D      Tasmanian devil  ccaagagct--------------
B D              Megabat  =======================
         Pacific walrus  -----------------------
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNN
               Aardvark  =======================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 81 and 82 in window
B D               Horse 2bp
B D    White rhinoceros 2bp
B D                 Cat 2bp
B D                 Dog 2bp
B D             Ferret  806bp
B D               Panda 2bp
           Weddell seal 2bp
       Black flying-fox 2bp

Alignment block 82 of 836 in window, 234438 - 234484, 47 bps 
B D                Human  catatatgtggttgtggtaaagaaagag-------------ggtgtgttgatgagaggtc---
B D                Chimp  catatatgtggttgtggtaaagaaagag-------------ggcgtcttgatgagaggtc---
B D            Orangutan  cacatatgtggtt---gtaaagaaagag-------------ggtgtgttgatgagaggtc---
B D               Gibbon  catatatgtggttgtggtacagaaaaag-------------ggtgtgttgatgggaagtc---
B D  Crab-eating macaque  catatatgtggttgtggtaaagaaagag-------------ggtatgtcgatgggaagtc---
B D               Baboon  catatatgtggttgtggtaaagaaagag-------------ggtatgtcgatgggatgtc---
B D         Green monkey  catatatgtggttgtggtaaagaaagag-------------ggtatgtcgatgggaagtc---
B D             Marmoset  catatatgtggttgtgggaaaagaagag-------------ggtatgttgattggaagtc---
B D      Squirrel monkey  catatatgtggttgtcggaaaagaagag-------------ggtatgttgattggaagtc---
B D             Bushbaby  cacgtgtgtaattctgataaaggaagag-------------gagacgtctgttggaagcc---
      Chinese tree shrew  catgtgcatgattgtagtaagggagaagagggtat------ggtatgttggtttaaagcc---
B D                  Pig  tacatgtggggttgtgtcg-agcaaggg-------------gatgagtt-atttgaagac---
B D               Alpaca  tatgtgtgtggttgtggca-tggcagga-------------gat-----------aagac---
          Bactrian camel  tatgtgtgtggttgtggca-tggcagga-------------gat-----------aagac---
B D              Dolphin  tacatatgtggttgtggcc-aggaaggg-------------gataagtt-atttgaagac---
            Killer whale  tacatatgtggttgtggcc-aggaaggg-------------gataagtt-atttgaagac---
        Tibetan antelope  tatatgtgtggttgtggcc-agaaaggg-------------gagaagtt-atttgaagac---
B D                  Cow  tacatgtgtggttgtggcc-agaaaggg-------------gagaagtt-atttgaagac---
B D                Sheep  tacatgtgtggttgtggcc-agaaaggg-------------gagaagtt-atttgaagac---
           Domestic goat  tacatgtgtggttgtggcc-agaaaggg-------------gagaagtt-atttgaagac---
B D                Horse  cacgtgtgtgattctggcaaagggaggt-------------gataagtt-attcaaacac---
B D     White rhinoceros  cgtgtgtgtggttgtggcaaaggaaggg-------------aataagtt-attcgaacac---
B D                  Cat  cacttgagtgctcgtagcccaggaatgg-------------gacaagtt-attcaaagac---
B D                  Dog  catgtgcgtgcctgtagcctag-----------------------------------------
B D                Panda  tacgtgagtg-ttgtagcccaggaatgg-------------gacaagtt-attcaaagac---
            Weddell seal  cacgtgagtg-ttcgagcccaggagtgg-------------gacaagtt-atacaaagac---
        Black flying-fox  cacctgtgtggttgtagtaaagggaaag-------------g--aagtt-attccgacac---
B D              Opossum  caca-----gctgagggaaggggaccagagaaagcag----ggcctg--gatgtccaggggtc
B D      Tasmanian devil  caca-----gtctgttgaggggaaatagtgaattcagttttggtgtgttgagttcaagatgtc
B D              Megabat  ===============================================================
B D              Ferret   ===============================================================
         Pacific walrus  ---------------------------------------------------------------
B D              Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Aardvark  ===============================================================
B D               Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 82 and 83 in window
B D             Opossum 34bp

Alignment block 83 of 836 in window, 234485 - 234501, 17 bps 
B D                Human  c--tgaaatgcattttc-ct--
B D                Chimp  c--tgaaatgcattttc-ct--
B D            Orangutan  c--tgaaatgcattttc-ct--
B D               Gibbon  c--taaaatgcatgttc-tt--
B D  Crab-eating macaque  c--tgaaatgcatgttc-ct--
B D               Baboon  c--tgaaatgcatgttc-ct--
B D         Green monkey  c--tgaaatgcatgttc-ct--
B D             Marmoset  c--tgaaatgcatgt