Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 135 in window, 28750 - 28760, 11 bps 
B D                     Human  ttaa-ttca-----att
B D                     Chimp  ttaa-ttca-----att
B D                 Orangutan  ttaa-ttca-----att
B D                    Gibbon  ttaa-ttca-----att
B D                    Rhesus  ttaa-ctca-----att
B D       Crab-eating macaque  ttaa-ctca-----att
B D              Green monkey  ttaa-ctca-----att
B D                  Marmoset  ttaa-ttca-----att
B D           Squirrel monkey  ttaa-ttca-----att
B D                  Bushbaby  tt------a-----tta
           Chinese tree shrew  ttag-ttcagttctatt
       Lesser Egyptian jerboa  ttaa-ttta-----att
B D           Chinese hamster  t--a-ct-c-----agt
B D                       Rat  t--t-ctcc-----att
B D            Naked mole-rat  ttaa-ttca-----g--
B D                Guinea pig  taaa-ttca-----gtt
                   Chinchilla  taaa-ttcc-----ggt
             Brush-tailed rat  ttaa-accc-----agt
B D                      Pika  ttaa-ttct-----att
B D                    Alpaca  agagtttca-----gtt
               Bactrian camel  agagtttca-----gtt
                 Killer whale  agcg-ttca-----ctt
             Tibetan antelope  agag--tca-----att
B D                       Cow  atag--tca-----att
B D                     Sheep  agag--tct-----att
                Domestic goat  agag--tca-----att
B D                     Horse  taag-gtca-----gtt
B D          White rhinoceros  caag-ttca-----att
B D                       Cat  caag-ttca-----gtt
B D                       Dog  ccag-tttg-----gtt
B D                   Ferret   caag-ttca-----gtt
B D                     Panda  caag-ttcc-----gct
               Pacific walrus  tgag-ttca-----gtt
             Black flying-fox  -gag-ttca-----att
                Big brown bat  ggag-ttca-----atc
B D                  Microbat  tgag-ttca-----atc
B D                  Hedgehog  -----------------
B D                     Shrew  ctaa-ttca-----att
              Star-nosed mole  ctgg-ttca-----att
B D                    Tenrec  ttag-ttca-----att
B D                 Armadillo  ttag-atca-----att
B D                Coelacanth  =================
         Princess of Burundi  =================
         Pundamilia nyererei  =================
                 Zebra mbuna  =================
       Burton's mouthbreeder  =================
B D              Nile tilapia  =================
B D                    Medaka  =================
B D               Stickleback  =================
  D  Chinese softshell turtle  =================
B D                    Lizard  =================
  D            Painted turtle  =================
  D    Spiny softshell turtle  =================
B D             X. tropicalis  =================
B D                  Platypus  =================
B D           Tasmanian devil  =================
B D                   Opossum  =================
  D           Green seaturtle  =================
              Golden hamster  =================
B D                    Rabbit  -----------------
                Prairie vole  =================
B D                     Mouse  =================
         Cape elephant shrew  =================
B D                  Elephant  -----------------
B D                   Manatee  =================
        David's myotis (bat)  =================
B D                  Squirrel  =================

Inserts between block 1 and 2 in window
B D               Guinea pig 712bp

Alignment block 2 of 135 in window, 28761 - 28766, 6 bps 
B D                     Human  ctgtt-c
B D                     Chimp  ctgtt-c
B D                 Orangutan  ctgtt-c
B D                    Gibbon  ctgct-c
B D                    Rhesus  ctgtt-c
B D       Crab-eating macaque  ctgtt-c
B D              Green monkey  ctgtt-c
B D                  Marmoset  ctgtt-c
B D           Squirrel monkey  ctgtt-c
B D                  Bushbaby  ttgct-c
           Chinese tree shrew  ctgtt-c
       Lesser Egyptian jerboa  ctgtt--
B D           Chinese hamster  tcctt--
B D                       Rat  ttttt--
B D            Naked mole-rat  ctgtta-
                   Chinchilla  -tgtt--
             Brush-tailed rat  -tatt--
B D                      Pika  ctgct--
B D                    Alpaca  cgatt-c
               Bactrian camel  cgatt-c
                 Killer whale  ctgtt-c
             Tibetan antelope  ctctt-c
B D                       Cow  ctctt-c
B D                     Sheep  ctctt-c
                Domestic goat  ctctt-c
B D                     Horse  ctgtt-c
B D          White rhinoceros  ttgtt-c
B D                       Cat  gtgtt-c
B D                       Dog  atgtt-c
B D                   Ferret   ctgct-c
B D                     Panda  gcgtt-c
               Pacific walrus  gtgct-c
             Black flying-fox  ctgtt-c
                Big brown bat  ctatt-c
B D                  Microbat  ctatt-c
B D                  Hedgehog  tagtt-c
B D                     Shrew  cacgt-g
              Star-nosed mole  ttgtt-c
B D                    Tenrec  ctgtg-c
B D                 Armadillo  ctgtt-c
B D                Coelacanth  =======
         Princess of Burundi  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
B D              Nile tilapia  =======
B D                    Medaka  =======
B D               Stickleback  =======
  D  Chinese softshell turtle  =======
B D                    Lizard  =======
  D            Painted turtle  =======
  D    Spiny softshell turtle  =======
B D             X. tropicalis  =======
B D                  Platypus  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
  D           Green seaturtle  =======
              Golden hamster  =======
B D                    Rabbit  -------
                Prairie vole  =======
B D                     Mouse  =======
         Cape elephant shrew  =======
B D                  Elephant  -------
B D                   Manatee  =======
B D                Guinea pig  =======
        David's myotis (bat)  =======
B D                  Squirrel  =======

Alignment block 3 of 135 in window, 28767 - 28790, 24 bps 
B D                     Human  acaatatttagcactgatggctc-----a
B D                     Chimp  acaatattgagcactgatggctc-----a
B D                 Orangutan  acaatattgagcactgatggctc-----a
B D                    Gibbon  acaatattgagcactgatggctc-----a
B D                    Rhesus  acaagattgagcactgatggctc-----a
B D       Crab-eating macaque  acaagattgagcactgatggctc-----a
B D              Green monkey  acaagattgagcactgatggctc-----a
B D                  Marmoset  acaatactgagcactgatggctc-----a
B D           Squirrel monkey  acaatactgagcactgatggctc-----a
B D                  Bushbaby  tctagagtta-cacttttaactc-----a
           Chinese tree shrew  acaatattgagcacctgtagctctactgc
       Lesser Egyptian jerboa  aaaatattggtg---tagagctc-----a
B D           Chinese hamster  aaaactct---------------------
B D                       Rat  aaaacactg--------------------
B D            Naked mole-rat  --------aaac-------attc-----a
B D                Guinea pig  actatatttagc---tatgactc-----a
                   Chinchilla  aaaatattgagc---tataattc-----a
             Brush-tailed rat  aaaatactgagc-----tgattc-----a
B D                      Pika  aaaatattgagcgcttacaactc-----a
B D                    Alpaca  actatgttaagtgcctttggttc-----a
               Bactrian camel  accatgttaagtgcctttggttc-----a
                 Killer whale  tttatgttaagtgcccatggcac-----c
             Tibetan antelope  tttatgttaagtgcccacggctc-----c
B D                       Cow  tttatgttaagtgcccatggctc-----c
B D                     Sheep  tttatgttaagtgcccatggctc-----c
                Domestic goat  tttatgttaagtgcccatgactc-----c
B D                     Horse  acaatgttgagcgcctagggctc-----a
B D          White rhinoceros  ataatgttgagcacctatggctc-----a
B D                       Cat  acaatgctgagcac--aatgttc-----a
B D                       Dog  acagtgctgggcac--tatgttc-----a
B D                   Ferret   acagtaccaagcac--tacgttc-----a
B D                     Panda  acaatgccgtgtac--aacgttc-----a
               Pacific walrus  acaatgctgagc------cgttc-----a
             Black flying-fox  acagtgttgagaacctatgcttc-----a
                Big brown bat  acagtgttgagcaacgatgactc-----a
B D                  Microbat  acagtgtggagcgccgatgcctc-----a
B D                  Hedgehog  accatgttgaaatcctggggctc------
B D                     Shrew  atatcgtgca----ctatggctc------
              Star-nosed mole  acagagttgaacacctaaggccc------
B D                    Tenrec  acagtactgagtgcctgtggctc-----a
B D                 Armadillo  acaatattgagttcctacagctc-----a
B D                Coelacanth  =============================
         Princess of Burundi  =============================
         Pundamilia nyererei  =============================
                 Zebra mbuna  =============================
       Burton's mouthbreeder  =============================
B D              Nile tilapia  =============================
B D                    Medaka  =============================
B D               Stickleback  =============================
  D  Chinese softshell turtle  =============================
B D                    Lizard  =============================
  D            Painted turtle  =============================
  D    Spiny softshell turtle  =============================
B D             X. tropicalis  =============================
B D                  Platypus  =============================
B D           Tasmanian devil  =============================
B D                   Opossum  =============================
  D           Green seaturtle  =============================
              Golden hamster  =============================
B D                    Rabbit  -----------------------------
                Prairie vole  =============================
B D                     Mouse  =============================
         Cape elephant shrew  =============================
B D                  Elephant  -----------------------------
B D                   Manatee  =============================
        David's myotis (bat)  =============================
B D                  Squirrel  =============================

Inserts between block 3 and 4 in window
B D                   Tenrec 206bp
B D                Armadillo 5bp

Alignment block 4 of 135 in window, 28791 - 28793, 3 bps 
B D                     Human  cct
B D                     Chimp  cct
B D                 Orangutan  tct
B D                    Gibbon  cct
B D                    Rhesus  ctt
B D       Crab-eating macaque  ctt
B D              Green monkey  ctt
B D                  Marmoset  c--
B D           Squirrel monkey  cct
B D                  Bushbaby  taa
           Chinese tree shrew  cct
       Lesser Egyptian jerboa  aat
B D            Naked mole-rat  atc
B D                Guinea pig  atc
                   Chinchilla  att
             Brush-tailed rat  gtc
B D                      Pika  act
B D                    Alpaca  att
               Bactrian camel  att
                 Killer whale  att
             Tibetan antelope  att
B D                       Cow  att
B D                     Sheep  att
                Domestic goat  att
B D                     Horse  att
B D          White rhinoceros  att
B D                       Cat  aca
B D                       Dog  act
B D                   Ferret   acg
B D                     Panda  act
               Pacific walrus  act
             Black flying-fox  att
                Big brown bat  att
B D                  Microbat  att
B D                  Hedgehog  att
B D                     Shrew  att
              Star-nosed mole  att
B D                    Tenrec  cct
B D                 Armadillo  ctt
B D                Coelacanth  ===
         Princess of Burundi  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
B D              Nile tilapia  ===
B D                    Medaka  ===
B D               Stickleback  ===
  D  Chinese softshell turtle  ===
B D                    Lizard  ===
  D            Painted turtle  ===
  D    Spiny softshell turtle  ===
B D             X. tropicalis  ===
B D                  Platypus  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
  D           Green seaturtle  ===
              Golden hamster  ===
B D           Chinese hamster  ---
B D                    Rabbit  ---
                Prairie vole  ===
B D                     Mouse  ===
B D                       Rat  ---
         Cape elephant shrew  ===
B D                  Elephant  ---
B D                   Manatee  ===
        David's myotis (bat)  ===
B D                  Squirrel  ===

Inserts between block 4 and 5 in window
      Lesser Egyptian jerboa 5bp
B D           Naked mole-rat 5bp
B D               Guinea pig 5bp
                  Chinchilla 5bp
            Brush-tailed rat 5bp
B D                     Pika 772bp
B D                   Alpaca 5bp
              Bactrian camel 5bp
                Killer whale 5bp
            Tibetan antelope 5bp
B D                      Cow 5bp
B D                    Sheep 5bp
               Domestic goat 5bp
B D                    Horse 5bp
B D         White rhinoceros 5bp
B D                      Cat 5bp
B D                      Dog 5bp
B D                  Ferret  5bp
B D                    Panda 5bp
              Pacific walrus 5bp
            Black flying-fox 5bp
               Big brown bat 5bp
B D                 Microbat 5bp
B D                 Hedgehog 3bp
B D                    Shrew 5bp
             Star-nosed mole 5bp

Alignment block 5 of 135 in window, 28794 - 28805, 12 bps 
B D                     Human  tcttc-g--caga-------cc
B D                     Chimp  tcttc-g--caga-------cc
B D                 Orangutan  tcttt-g--caga-------cc
B D                    Gibbon  tcttt-g--caga-------cc
B D                    Rhesus  tcttc-a--caga-------cc
B D       Crab-eating macaque  tcttc-a--caga-------cc
B D              Green monkey  tcttc-a--caga-------cc
B D                  Marmoset  -cttc-a--caga-------cc
B D           Squirrel monkey  tcttc-a--caga-------cc
B D                  Bushbaby  gcata-aataaaa-------gc
           Chinese tree shrew  tcctc-a--tagcgccccctgc
       Lesser Egyptian jerboa  tcctt-a--tggg-------c-
B D           Chinese hamster  ---------gtga-------c-
B D                       Rat  --cct-c--gtgg-------c-
B D            Naked mole-rat  tcctc-a--tggc-------c-
B D                Guinea pig  tcctc-g--tggc-------c-
                   Chinchilla  gcctc-a--tggc-------t-
             Brush-tailed rat  ga--a-a--gtgc-------c-
B D                    Alpaca  tcttc-a--aagc-------cc
               Bactrian camel  tcttc-a--aagc-------cc
                 Killer whale  tcttc-a--aagc-------ct
             Tibetan antelope  tcttc-a--aagc-------cc
B D                       Cow  tcttc-a--aagc-------cc
B D                     Sheep  tcttc-a--aagc-------cc
                Domestic goat  tcttc-a--aagc-------cc
B D                     Horse  tctgc-a--aggc-------cc
B D          White rhinoceros  tcttc-c--atgc-------cc
B D                       Cat  tcttc-a--aggc-------ct
B D                       Dog  tcttc-g--aagc-------cc
B D                   Ferret   tcttc-a--aaga-------cc
B D                     Panda  ccttc-a--aagc-------cc
               Pacific walrus  tcttc-a--aagc-------cc
             Black flying-fox  cccttaa--aggc-------cc
                Big brown bat  tcctt-a--aggc-------ct
B D                  Microbat  tcctc-a--aggc-------ct
B D                  Hedgehog  ---------------------c
B D                     Shrew  tcttc-a--tggc-------tc
              Star-nosed mole  tcctc-a--cagc-------tc
B D                    Tenrec  tcctc-a--tggc-------cc
B D                 Armadillo  tcctc-t--cagc-------ca
B D                Coelacanth  ======================
         Princess of Burundi  ======================
         Pundamilia nyererei  ======================
                 Zebra mbuna  ======================
       Burton's mouthbreeder  ======================
B D              Nile tilapia  ======================
B D                    Medaka  ======================
B D               Stickleback  ======================
  D  Chinese softshell turtle  ======================
B D                    Lizard  ======================
  D            Painted turtle  ======================
  D    Spiny softshell turtle  ======================
B D             X. tropicalis  ======================
B D                  Platypus  ======================
B D           Tasmanian devil  ======================
B D                   Opossum  ======================
  D           Green seaturtle  ======================
              Golden hamster  ======================
B D                    Rabbit  ----------------------
                Prairie vole  ======================
B D                     Mouse  ======================
B D                      Pika  ======================
         Cape elephant shrew  ======================
B D                  Elephant  ----------------------
B D                   Manatee  ======================
        David's myotis (bat)  ======================
B D                  Squirrel  ======================

Alignment block 6 of 135 in window, 28806 - 28813, 8 bps 
B D                     Human  -accaaaa--a
B D                     Chimp  -accaaaa--a
B D                 Orangutan  -accaaaa--a
B D                    Gibbon  -accaaaa--a
B D                    Rhesus  -accaaaa--a
B D       Crab-eating macaque  -accaaaa--a
B D              Green monkey  -accaaaa--a
B D                  Marmoset  -accaaaa--a
B D           Squirrel monkey  -accaaaa--a
B D                  Bushbaby  -atgaaaacca
           Chinese tree shrew  -cccgaat--g
       Lesser Egyptian jerboa  -actgaaa--g
B D           Chinese hamster  -tctgaga---
B D                       Rat  -tctcaga--g
B D            Naked mole-rat  -ttggaaa--g
B D                Guinea pig  -atggaaa--g
                   Chinchilla  -atggaaa--g
             Brush-tailed rat  -atggaaa--a
B D                      Pika  -acagaaa--g
B D                    Alpaca  -cccaaaa--g
               Bactrian camel  -cccaaaa--g
                 Killer whale  -tccgaaa--g
             Tibetan antelope  -cctgaaa--g
B D                       Cow  -cctgaaa--g
B D                     Sheep  -cctgaaa--g
                Domestic goat  -cctgaaa--g
B D                     Horse  -tccaaaa--g
B D          White rhinoceros  -tccaaaa--a
B D                       Cat  --ctggaa--g
B D                       Dog  --tcaaaa--g
B D                   Ferret   -tccaaag--c
B D                     Panda  --ccgaaa--g
               Pacific walrus  -tctgaaa--g
             Black flying-fox  -tccaaaa--g
                Big brown bat  -cccaaaa--g
B D                  Microbat  -cccaaaa--g
B D                  Hedgehog  -tctgaaa--g
B D                     Shrew  -gctgaga--a
              Star-nosed mole  -tctgaag--c
B D                    Tenrec  acctaaaa--a
B D                 Armadillo  acct-aaa--g
B D                Coelacanth  ===========
         Princess of Burundi  ===========
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
B D              Nile tilapia  ===========
B D                    Medaka  ===========
B D               Stickleback  ===========
  D  Chinese softshell turtle  ===========
B D                    Lizard  ===========
  D            Painted turtle  ===========
  D    Spiny softshell turtle  ===========
B D             X. tropicalis  ===========
B D                  Platypus  ===========
B D           Tasmanian devil  ===========
B D                   Opossum  ===========
  D           Green seaturtle  ===========
              Golden hamster  ===========
B D                    Rabbit  -----------
                Prairie vole  ===========
B D                     Mouse  ===========
         Cape elephant shrew  ===========
B D                  Elephant  -----------
B D                   Manatee  ===========
        David's myotis (bat)  ===========
B D                  Squirrel  ===========

Alignment block 7 of 135 in window, 28814 - 28896, 83 bps 
B D                     Human  tctgcct---tctacaatc-aacac-t--------------t----at--cccc--tttcttgtccctca
B D                     Chimp  tctacct---tctacaatc-aacac-t--------------t----at--cccc--tttcttgtccctca
B D                 Orangutan  tctacct---tctacaatt-aacac-t--------------t----at--tcct--tttctcatccctca
B D                    Gibbon  tccacct---tctacaatc-aacac-t--------------t----ac--tccc--tttctcatccctca
B D                    Rhesus  tctacct---tctacaatc-aacac-------------------------tccc--tttctcatccctca
B D       Crab-eating macaque  tctacct---tctacaatc-aacac-------------------------tccc--tttctcatccctca
B D              Green monkey  tctacct---tctctaatc-aacac-t--------------t----at--tccc--tttctcatccctca
B D                  Marmoset  tctactt---tctacaatc-aacac-t--------------t----at--tcct--tttctcatccctca
B D           Squirrel monkey  tctacct---tctacaatc-aacac-t--------------t----ac--tccc--tttctcatccctca
B D                  Bushbaby  tctacctaggtatagaagt-agtac-tacccatgtacaatat----gc--atcc--ttatttttccttca
           Chinese tree shrew  tctacct---tctgcagtc-aacac-t--------------t----gttattcc--ctttttgtttccta
B D                  Squirrel  tctgcct---tcttcaatc-aacac-t--------------t-ataat--ttcc--tttcttgtttctca
       Lesser Egyptian jerboa  --tacct---ca-gtaatc-aatac-t--------------t----ac--ttcc--tttcttattcctca
B D           Chinese hamster  -------------ataatc-aacac-t--------------t----at--ttcc--tttcttgttcctgg
B D                       Rat  --aacct---tctgcagtc-aacac-t--------------t----at--tttc--tttcttgttcctcg
B D            Naked mole-rat  t--------------gatc-gacac-t--------------t-attat--ttcc--tttcttattcctca
B D                Guinea pig  tgtgccc---tt-gtgatc-aacac-t--------------taactat--ttcc--tttcttctacctca
                   Chinchilla  tgtacct---tc-gtgatc-agcac-t--------------c-attat--ttcc--ttccttgtacc-ca
             Brush-tailed rat  cgcacct---tt-aggatc-aacac-t--------------t-actat--ttcc--tttcttgtagc-ca
B D                      Pika  tttacct---tt-gcaatc-aaccc-t--------------t-cgtat--ttcc--tcccttgtttctca
B D                    Alpaca  cttccct---tctgcagtc-aacac-t------------------tat--tctc--------gttcctca
               Bactrian camel  cttccct---tctgcagtc-aacac-t------------------tat--tctc--------gttcctca
                 Killer whale  cctacct---tctgcagtc-aacac-t--------------t-attat--tctc--tacctcattcctca
             Tibetan antelope  cctgcct---tctggaatc-agcac-t--------------t-actat--tctc-tttccccattcctca
B D                       Cow  cctgcct---tctgcaatc-agcac-t--------------t-actag--tctcttttccccattcctca
B D                     Sheep  cctgcct---tctggaatc-agcac-t--------------t-actat--tctc-tttccccattcctca
                Domestic goat  cctgcct---tttggaatc-agcac-t--------------t-actat--tctc-tttccccattcctca
B D                     Horse  tc-acct---tctgcaatc-aacac-t--------------t-gttat--tccc--tttctcattcctca
B D          White rhinoceros  tctgcct---tctgcaatc-aacac-c--------------t-attat--tgcc--tttctcattcctca
B D                       Cat  tctacct---tctgcaatc-aacac-t--------------c-attat--tccc--tttctcactgctca
B D                       Dog  cctgcct---tctataatc-aacactt--------------a-actat--tccc--tttctcactcctca
B D                   Ferret   tctgcct---tctgcagtc-aacac-------------------ttat--tccc--tttctcactcctca
B D                     Panda  tctacct---tctgcgacg-gacactt--------------t-attat--tcc----ttctcactcctc-
               Pacific walrus  tctacct---tctgtaatc-aacactt--------------t-attat--cccc--tttctcaatcctca
             Black flying-fox  tctacct---tctgtaatc-aatat-t--------------t-attat--tccc--tttctcattcctca
                Big brown bat  cctacct---tct-cagtc-aacac-t--------------t-actat--tccc--tctctcattcctca
B D                  Microbat  cctacct---tct-cagtc-aacac-t--------------t-attat--tccc--tctctcattcccca
B D                  Hedgehog  tctactt---cctgtagtc-aacag-t--------------a-atcat----tc--tttcttgtttctca
B D                     Shrew  tacaact---tccacaagc-aaaa---------------------caa---acc--tttctcattcctca
              Star-nosed mole  tctgtgt---tctactatt-gacat-t--------------t-gttat---ccc--tttcttgttcttca
B D                    Tenrec  tctactt---tctgcaatcgaacac-a--------------t-gctct----ct--ttttccactgctta
B D                 Armadillo  tctacct---tccacaatt-aaccc-t--------------t-attat----tc--ctttttattcctca
B D                Coelacanth  ======================================================================
         Princess of Burundi  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D              Nile tilapia  ======================================================================
B D                    Medaka  ======================================================================
B D               Stickleback  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D           Green seaturtle  ======================================================================
              Golden hamster  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Elephant  ----------------------------------------------------------------------
B D                   Manatee  ======================================================================
        David's myotis (bat)  ======================================================================

                        Human  ---------gc--------------agaaa-------------at-----tgagtaa--------aacct
                        Chimp  ---------gc--------------agaaa-------------at-----tgagtaa--------aacct
                    Orangutan  ---------gc--------------agaaa-------------at-----tgagtaa--------aacct
                       Gibbon  ---------gc--------------agaaa-------------at-----tgagtaa--------accct
                       Rhesus  ---------gc--------------agaaa-------------at-----tgagtca--------aagct
          Crab-eating macaque  ---------gc--------------agaaa-------------at-----tgagtca--------aagct
                 Green monkey  ---------gc--------------agaaa-------------at-----tgagtaa--------aagct
                     Marmoset  ---------gc--------------agaat-------------at-----tgagtaa--------aagct
              Squirrel monkey  ---------gc--------------agaat-------------at-----tgagtaa--------aagct
                     Bushbaby  aaaatttgggc--------------aaaaa-------------at-----tacgttatacatggcaatgt
           Chinese tree shrew  ---------ga--------------agaaa-------------ac-----cgaat-a--------cagca
                     Squirrel  ---------gc--------------ataaa-------------at-----tgcat-a--------aagcc
       Lesser Egyptian jerboa  ---------gc--------------agaaa-------------ac-----tacct-a--------gaagt
              Chinese hamster  ---------gg--------------aaagg--------------t-----tgtcc-a--------aagtt
                          Rat  ---------gg--------------agggggtggagatggagcat-----tgtct-a--------aagct
               Naked mole-rat  ---------gc--------------cgaaa-------------at-----tgcat-a--------aggct
                   Guinea pig  ---------cc--------------tgaaa-------------at-----tgcat-a--------aagct
                   Chinchilla  ---------cc--------------tgaaa-------------at-----tgcat-a--------aagct
             Brush-tailed rat  ---------ct--------------tg-aa-------------at-----tgcat-a--------aagct
                         Pika  ---------gt--------------agaaa-------------ac-----tgagt-a--------aatcg
                       Alpaca  ---------gc--------------agaaa-------------at-----tgagt-a--------gagct
               Bactrian camel  ---------gc--------------agaaa-------------at-----tgagt-a--------gagct
                 Killer whale  ---------gc--------------agaaa-------------tt-----cgagt-a--------aagcg
             Tibetan antelope  ---------gc--------------agaaa-------------gt-----taagt-a--------aaact
                          Cow  ---------gc--------------agaaa-------------gt-----taact-a--------aagc-
                        Sheep  ---------gc--------------agaaa-------------gt-----taagt-a--------aaact
                Domestic goat  ---------gc--------------agaaa-------------gt-----taagt-a--------aaact
                        Horse  ---------gc--------------agaaa-------------ac-----tgagt-a--------aagct
             White rhinoceros  ---------gc--------------agaaa-------------at-----tgagt-a--------aaggt
                          Cat  ---------gc--------------agaaa-------------atagctcagagt-a--------aagct
                          Dog  ---------ac--------------agaaa-------------at-----tgaga-a--------atgct
                      Ferret   ---------ac--------------agtaa-------------at-----tgagt-a--------aagct
                        Panda  ---------gc--------------agaaa-------------tt-----tgagt-a--------aagct
               Pacific walrus  ---------ac--------------agaaa-------------at-----tgagt-a--------aagct
             Black flying-fox  ---------gc--------------agaaa-------------at-----tg-------------aagct
                Big brown bat  ---------gc--------------agaaa-------------at-----tgggt-a-------aagcct
                     Microbat  ---------gc--------------agaaa-------------at-----tgggt-a-------aagcct
                     Hedgehog  ---------ga--------------agaaa-------------at-----tgaat-a--------aagtt
                        Shrew  ---------gcaaaaaagaaaaaagaaaaa-------------ac-----agggg-a--------aggtt
              Star-nosed mole  ---------gc--------------agaaa-------------gt-----tgagt-a--------aagtt
                       Tenrec  ---------gt---------------gaca-------------ct-----tgaga-a--------aagct
                    Armadillo  ---------gt--------------agaaa-------------gt-----tgaga-g--------aagcc
                   Coelacanth  ======================================================================
          Princess of Burundi  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
                       Medaka  ======================================================================
                  Stickleback  ======================================================================
     Chinese softshell turtle  ======================================================================
                       Lizard  ======================================================================
               Painted turtle  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
              Green seaturtle  ======================================================================
               Golden hamster  ======================================================================
                       Rabbit  ----------------------------------------------------------------------
                 Prairie vole  ======================================================================
                        Mouse  ======================================================================
          Cape elephant shrew  ======================================================================
                     Elephant  ----------------------------------------------------------------------
                      Manatee  ======================================================================
         David's myotis (bat)  ======================================================================

                        Human  cttcattgc---cataaaatac
                        Chimp  cttcattgc---cataaaatac
                    Orangutan  cttcattgc---cataaaatat
                       Gibbon  cttcattgc---cataaaatac
                       Rhesus  cttcattgc---cataaaatac
          Crab-eating macaque  cttcattgc---cataaaatac
                 Green monkey  cttcattgc---catcaaatac
                     Marmoset  cttcattgc---cataaaatac
              Squirrel monkey  cttcattgc---cataaaatgc
                     Bushbaby  attcattgc---cacagggtac
           Chinese tree shrew  attcattgc---cacaaaacac
                     Squirrel  agtcattac---tgcaaagtag
       Lesser Egyptian jerboa  actaattgt---cacaaaataa
              Chinese hamster  gttcatcat---cacaaactac
                          Rat  gttcattgt---cac-------
               Naked mole-rat  attcattgc---cacaaaatat
                   Guinea pig  attcattgc---cacaaaacac
                   Chinchilla  gctcactgc---cacaaaatac
             Brush-tailed rat  attcattgc---cacaaaatac
                         Pika  atttgcttc---cacaatgtac
                       Alpaca  gttcatttc---cacaagatgc
               Bactrian camel  gttcatttc---cacaagatgc
                 Killer whale  attcattgc---cacaaaatgc
             Tibetan antelope  cttctttgt---cacaaaatga
                          Cow  --tcgttgt---cacaaaatgc
                        Sheep  cttctttgt---cacaaaatga
                Domestic goat  tttctttgt---cacaaaatga
                        Horse  attcattgc---cacaatgtac
             White rhinoceros  gttcattgc---cacatcatac
                          Cat  atttgttgc---cacaaaatac
                          Dog  gtttgttgc---cacagaacac
                      Ferret   gtctgttgg---cacagaaccc
                        Panda  atctgttgc---cacaaaatac
               Pacific walrus  atctgttgc---cacaaaatat
             Black flying-fox  atttattgc---cacaaaatac
                Big brown bat  attcattgc---tacaaaatac
                     Microbat  attcattgc---tacaaaatac
                     Hedgehog  atcgactgt---gacaaaatgc
                        Shrew  gttgactgc---cacaaaataa
              Star-nosed mole  attgattgc---cataacacac
                       Tenrec  attattcattgccacaaaacac
                    Armadillo  attcattat-----caaaacac
                   Coelacanth  ======================
          Princess of Burundi  ======================
          Pundamilia nyererei  ======================
                  Zebra mbuna  ======================
        Burton's mouthbreeder  ======================
                 Nile tilapia  ======================
                       Medaka  ======================
                  Stickleback  ======================
     Chinese softshell turtle  ======================
                       Lizard  ======================
               Painted turtle  ======================
       Spiny softshell turtle  ======================
                X. tropicalis  ======================
                     Platypus  ======================
              Tasmanian devil  ======================
                      Opossum  ======================
              Green seaturtle  ======================
               Golden hamster  ======================
                       Rabbit  ----------------------
                 Prairie vole  ======================
                        Mouse  ======================
          Cape elephant shrew  ======================
                     Elephant  ----------------------
                      Manatee  ======================
         David's myotis (bat)  ======================

Inserts between block 7 and 8 in window
B D                Armadillo 6bp

Alignment block 8 of 135 in window, 28897 - 28905, 9 bps 
B D                     Human  t----aatatat------t
B D                     Chimp  t----aatatat------t
B D                 Orangutan  t----aatatat------t
B D                    Gibbon  t----aatatat------t
B D                    Rhesus  ---------tat------t
B D       Crab-eating macaque  ---------tat------t
B D              Green monkey  ---------tat------t
B D                  Marmoset  t----aatatat------t
B D           Squirrel monkey  t----aatacat------t
B D                  Bushbaby  tg---agtaatc------c
           Chinese tree shrew  tgagtaatagat-----ct
B D                  Squirrel  tgagtaatgtaa-----ct
       Lesser Egyptian jerboa  tgaccaatgt-t-----ct
B D           Chinese hamster  ctagaaacttat-----ct
B D                       Rat  ----aaacttat-----ca
B D            Naked mole-rat  caggtaatgtat-----ct
B D                Guinea pig  tgagtaatgtat-----tt
                   Chinchilla  cgagtaatgtat-----ct
             Brush-tailed rat  caagtaagtta--------
B D                      Pika  caggtaatgtaa-----ct
B D                    Alpaca  tgagtaat---------ct
               Bactrian camel  tgagtaat---------ct
                 Killer whale  tgagtaatatac-----ct
             Tibetan antelope  tgagtaatatac-----ct
B D                       Cow  tgagtaatgtat-----ct
B D                     Sheep  tgagtaatatac-----ct
                Domestic goat  tgagtaatatac-----ct
B D                     Horse  tgagtaatgtat-----ct
B D          White rhinoceros  tgggtaacatat-----ct
B D                       Cat  tgagtaatatat-----ct
B D                       Dog  tg--------at-----ct
B D                   Ferret   tc--------at-----gt
B D                     Panda  tg--------tt-----ct
               Pacific walrus  tg--------at-----ct
             Black flying-fox  tgaaatgt--at-----ct
                Big brown bat  tgagtaata-at-----ct
B D                  Microbat  tgagtaata-at-----ct
B D                  Hedgehog  t----aatatat-----ct
B D                     Shrew  tgacaaatatat-----cc
              Star-nosed mole  tgagtcatatacaatagat
B D                  Elephant  ----tgatatat-----a-
B D                    Tenrec  ----tgatctac-----a-
B D                 Armadillo  ----agatgtct-------
B D                Coelacanth  ===================
         Princess of Burundi  ===================
         Pundamilia nyererei  ===================
                 Zebra mbuna  ===================
       Burton's mouthbreeder  ===================
B D              Nile tilapia  ===================
B D                    Medaka  ===================
B D               Stickleback  ===================
  D  Chinese softshell turtle  ===================
B D                    Lizard  ===================
  D            Painted turtle  ===================
  D    Spiny softshell turtle  ===================
B D             X. tropicalis  ===================
B D                  Platypus  ===================
B D           Tasmanian devil  ===================
B D                   Opossum  ===================
  D           Green seaturtle  ===================
              Golden hamster  ===================
B D                    Rabbit  -------------------
                Prairie vole  ===================
B D                     Mouse  ===================
         Cape elephant shrew  ===================
B D                   Manatee  ===================
        David's myotis (bat)  ===================

Inserts between block 8 and 9 in window
B D                 Elephant 1bp
B D                   Tenrec 4bp

Alignment block 9 of 135 in window, 28906 - 28928, 23 bps 
B D                     Human  a----------ccaagg-----------------------------------------------------
B D                     Chimp  a----------ccaagg-----------------------------------------------------
B D                 Orangutan  a----------ccaggg-----------------------------------------------------
B D                    Gibbon  a----------ccaagg-----------------------------------------------------
B D                    Rhesus  a----------ccaagg-----------------------------------------------------
B D       Crab-eating macaque  a----------ccaagg-----------------------------------------------------
B D              Green monkey  a----------ccaagg-----------------------------------------------------
B D                  Marmoset  a----------ccaaga-----------------------------------------------------
B D           Squirrel monkey  a----------ccaagg-----------------------------------------------------
B D                  Bushbaby  a----------ctaaag-----------------------------------------------------
           Chinese tree shrew  g----------cgcagg-----------------------------------------------------
B D                  Squirrel  a----------acaagg-----------------------------------------------------
       Lesser Egyptian jerboa  a----------acaagg-----------------------------------------------------
B D           Chinese hamster  a----------actagt-----------------------------------------------------
B D                       Rat  a----------acacgt-----------------------------------------------------
B D            Naked mole-rat  a----------acaagg-----------------------------------------------------
B D                Guinea pig  a----------acaggg-----------------------------------------------------
                   Chinchilla  a----------acactg-----------------------------------------------------
             Brush-tailed rat  ---------------gg-----------------------------------------------------
B D                      Pika  acttcctctctacctgc-----------------------------------------------------
B D                    Alpaca  g----------tcaagg-----------------------------------------------------
               Bactrian camel  g----------tcaagg-----------------------------------------------------
                 Killer whale  a----------tcaagg-----------------------------------------------------
             Tibetan antelope  a----------tcaagc-----------------------------------------------------
B D                       Cow  a----------tcaagc-----------------------------------------------------
B D                     Sheep  a----------tcaagc-----------------------------------------------------
                Domestic goat  a----------tcaagc-----------------------------------------------------
B D                     Horse  g----------tcaagg-----------------------------------------------------
B D          White rhinoceros  a----------tcaaag-----------------------------------------------------
B D                       Cat  a----------tcaagg-----------------------------------------------------
B D                       Dog  g----------tctagg-----------------------------------------------------
B D                   Ferret   g----------tctagc-----------------------------------------------------
B D                     Panda  a----------tctagg-----------------------------------------------------
               Pacific walrus  a----------tctagg-----------------------------------------------------
             Black flying-fox  a----------ccaagg-----------------------------------------------------
                Big brown bat  a----------ccaagg-----------------------------------------------------
B D                  Microbat  a----------tcaagg-----------------------------------------------------
B D                  Hedgehog  a----------ttaaga-----------------------------------------------------
B D                     Shrew  a----------tcaagg-----------------------------------------------------
              Star-nosed mole  a----------tgaagt-----------------------------------------------------
B D                  Elephant  a----------gcaagg-----------------------------------------------------
B D                   Manatee  a----------tcaagg-----------------------------------------------------
B D                    Tenrec  a----------acaagggggagggggctacgaaaatttcatggaaaaatagaactacaagataatcccac
B D                 Armadillo  a----------tcaaag-----------------------------------------------------
B D                Coelacanth  ======================================================================
         Princess of Burundi  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D              Nile tilapia  ======================================================================
B D                    Medaka  ======================================================================
B D               Stickleback  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D           Green seaturtle  ======================================================================
              Golden hamster  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
         Cape elephant shrew  ======================================================================
        David's myotis (bat)  ======================================================================

                        Human  ---------------------------------------tttcctgttcacc-c------c-----c-
                        Chimp  ---------------------------------------tttcctgtttacc-c------c-----c-
                    Orangutan  ---------------------------------------tttcctgtttacc-c------c-----c-
                       Gibbon  ---------------------------------------tttcctgtttacc-c------c-----c-
                       Rhesus  ---------------------------------------tttcctgtttatc-c------c-----c-
          Crab-eating macaque  ---------------------------------------tttcctgtttacc-c------c-----c-
                 Green monkey  ---------------------------------------tttcctgttta-c-c------c-----c-
                     Marmoset  ---------------------------------------tttcctatttacc-c------c-----c-
              Squirrel monkey  ---------------------------------------tttcctgtttacc-c------c-----c-
                     Bushbaby  ---------------------------------------tttcccattcacc-c------catttac-
           Chinese tree shrew  ---------------------------------------tttcctgtttgtg-ctgtgtac-----a-
                     Squirrel  ---------------------------------------tttc---cttatc-c------t-----a-
       Lesser Egyptian jerboa  ---------------------------------------tttc---ttt----a------t-----a-
              Chinese hamster  ---------------------------------------tttc---ttggcc-c------t-----a-
                          Rat  ---------------------------------------tttc---tttgcc-a------t-----a-
               Naked mole-rat  ---------------------------------------tttc---ttcacc-c------t-----a-
                   Guinea pig  ---------------------------------------tttc---ttcacc-c------t-----a-
                   Chinchilla  ---------------------------------------tttc---ttcacc-c------t-----a-
             Brush-tailed rat  ---------------------------------------tttc---ttcacc-c------t-----a-
                         Pika  ---------------------------------------ttta---ctctgt-t------t-----a-
                       Alpaca  ---------------------------------------tttctgattta------------------
               Bactrian camel  ---------------------------------------tttctgatttacc-c------t-----g-
                 Killer whale  ---------------------------------------tttctggtttacc-t------t-----a-
             Tibetan antelope  ---------------------------------------tttctggtttacctt------t-----t-
                          Cow  ---------------------------------------tttctggtttacc-t------t-----a-
                        Sheep  ---------------------------------------tttctggtttacc-t------t-----t-
                Domestic goat  ---------------------------------------tttctggtttacc-t------t-----t-
                        Horse  ---------------------------------------ttcccggcttacc-c------t-----g-
             White rhinoceros  ---------------------------------------tttctggcttacc-c------t-----g-
                          Cat  ---------------------------------------tttctggtttacc-c----tat-----g-
                          Dog  ---------------------------------------tttccagtttg----------t-----g-
                      Ferret   ---------------------------------------tttccagtttatc-c------t-----g-
                        Panda  ---------------------------------------tttccagtttatc-c------t-----g-
               Pacific walrus  ---------------------------------------tttccagtttacc-c------t-----g-
             Black flying-fox  ---------------------------------------tttctggtttatc-c------t-----g-
                Big brown bat  ---------------------------------------tttctggtttact-c------t-----g-
                     Microbat  ---------------------------------------tttctggtttact-c------t-----g-
                     Hedgehog  ---------------------------------------tttt----------c------t-----a-
                        Shrew  ---------------------------------------tttc----------c------t-----g-
              Star-nosed mole  ---------------------------------------tttc----------c------t-----g-
                     Elephant  ---------------------------------------tttc--tttttac-c------t-----gt
                      Manatee  ---------------------------------------tttc--ttttcac-c------t-----gt
                       Tenrec  tacctttttggagtccacatttatatctataaaaagctttttc--tcttgtc-c------c-----gt
                    Armadillo  ---------------------------------------ttgctgttttccc-t------t-----gt
                   Coelacanth  ====================================================================
          Princess of Burundi  ====================================================================
          Pundamilia nyererei  ====================================================================
                  Zebra mbuna  ====================================================================
        Burton's mouthbreeder  ====================================================================
                 Nile tilapia  ====================================================================
                       Medaka  ====================================================================
                  Stickleback  ====================================================================
     Chinese softshell turtle  ====================================================================
                       Lizard  ====================================================================
               Painted turtle  ====================================================================
       Spiny softshell turtle  ====================================================================
                X. tropicalis  ====================================================================
                     Platypus  ====================================================================
              Tasmanian devil  ====================================================================
                      Opossum  ====================================================================
              Green seaturtle  ====================================================================
               Golden hamster  ====================================================================
                       Rabbit  --------------------------------------------------------------------
                 Prairie vole  ====================================================================
                        Mouse  ====================================================================
          Cape elephant shrew  ====================================================================
         David's myotis (bat)  ====================================================================

Inserts between block 9 and 10 in window
B D                 Squirrel 6bp
      Lesser Egyptian jerboa 1bp
B D          Chinese hamster 6bp
B D                      Rat 6bp
B D           Naked mole-rat 6bp
B D               Guinea pig 6bp
                  Chinchilla 6bp
            Brush-tailed rat 6bp
B D                     Pika 2bp
B D                   Alpaca 4bp
              Bactrian camel 6bp
                Killer whale 6bp
            Tibetan antelope 6bp
B D                      Cow 6bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                    Horse 6bp
B D         White rhinoceros 6bp
B D                      Cat 6bp
B D                      Dog 6bp
B D                  Ferret  6bp
B D                    Panda 6bp
              Pacific walrus 5bp
            Black flying-fox 6bp
               Big brown bat 5bp
B D                 Microbat 6bp
B D                 Hedgehog 6bp
B D                    Shrew 6bp
             Star-nosed mole 6bp

Alignment block 10 of 135 in window, 28929 - 28972, 44 bps 
B D                     Human  agagtacagaa----tgagacacactcaac-aactaaaacctccct----------cta
B D                     Chimp  agagtacagaa----tgagacacactcaac-aactaaaaccttcct----------cta
B D                 Orangutan  agagtacagaa----tgagaca----caac-aactaaaacctccct----------cta
B D                    Gibbon  agagtacagaa----tgagacacactcaac-aactaaaacctccct----------ctt
B D                    Rhesus  agagtacagaa----tgagacacactcaac-aactaaaaccaccct----------cta
B D       Crab-eating macaque  agagtacagaa----tgagacacactcaac-aactaaaaccaccct----------cta
B D              Green monkey  agagtacagag----tgagacacactcaac-aactaaaaccaccct----------cta
B D                  Marmoset  agagtacatac----ttagacacactcaac-aactaaaaccttcct----------cga
B D           Squirrel monkey  agagtacagac----ttagacacactcaac-aactaaaagcttcct----------cga
B D                  Bushbaby  aagatactgaa----taagacacact---c-aactaagacttccc-----------cta
           Chinese tree shrew  agagcacaga-------agatgtacttgac-aactaagacttcctt----------cta
B D                  Squirrel  gtagtacagac----tgggatactccta------------ttttct----------ctg
       Lesser Egyptian jerboa  -gactgaaaactaagtaatgca--------------ggactttctt----------cca
B D           Chinese hamster  agagtaaagac----taagacacaccaa--------gtctttccct----------ctc
B D                     Mouse  agagcaaagactaagtaagacacatcct--------ggctttccct----------cta
B D                       Rat  agagcaaagtctaagtaagacacatccc--------ggttttccc-----------cta
B D            Naked mole-rat  agaatacagag----gaggacatactcaac-tagtaaggcttttct----------ctt
B D                Guinea pig  agaatacagag----gaggacacactcaac-caatgctgtttttct----------ctt
                   Chinchilla  agagtacggag----gaggacacgctcagc-tattaaggcttttct----------cct
             Brush-tailed rat  agaggacaacg----gaggacatgctcaat-tattaaggcctttgt----------cct
B D                      Pika  aaagcacaaga----taaaacatcctcaat-aattatgacttccct----------ata
B D                    Alpaca  aaagtctacaa----taagacacactcaac-agctgaggctttcct----------cta
               Bactrian camel  aaagtctacaa----taagacacactcgac-agctgaggctttcct----------gca
                 Killer whale  agggtctagaa----tacgacacactcaac-aactaaggctttcct----------cta
             Tibetan antelope  aggttccagaa----taagacgcactcaac-aactaaggcttt-ct----------tta
B D                       Cow  agggtccagaa----taagacgcactcaac-aactaaggcttt-ct----------tta
B D                     Sheep  aggttccagaa----taagacacactcaac-aactaaggcttt-ct----------tta
                Domestic goat  aggttccagaa----taagacacactcaac-aactaaggcttt-ct----------tta
B D                     Horse  agagcccagaa----taagacttactcaac-aactaaggctttcct----------cta
B D          White rhinoceros  agagcccagag----taagacacactcaac-aactaaggctttcct----------cta
B D                       Cat  agagtccagaa----cgctgtgcacttcac-aactaagcctttcct----------tta
B D                       Dog  agagtacagaa----taaggggcactccac-aactaaggcttccct----------tta
B D                   Ferret   agagtccggaa----taaggtgcactcagc-aaccacgggtttcct----------ttg
B D                     Panda  agagtccagaa----taaggcaaactcgac-aaccaagg--ttcct----------gta
               Pacific walrus  -gagtccagaa----taaggtgcactcaac-aaccagggttttcct----------tta
             Black flying-fox  agagttcggaa----tgagacacactcagc-aactaaggctttcct----------ctc
                Big brown bat  tgagtccagaa----taagacacactcaac-aactagggctttcct----------cca
B D                  Microbat  cgagtccagaa----taagacacactcaac-aactaaggctttcct----------cta
B D                  Hedgehog  agtgtcaagta----tg-------ctcaga-aactaaagatttcct----------cta
B D                     Shrew  agcagacaggc----taggacactctcaac-agttaagcttttgct----------ctg
              Star-nosed mole  agagtccagaa----taagaca--ttcagt-aactaagcttttctt----------cta
B D                  Elephant  gttgtctagaa----ttagacacactccac-tactaaagctttcct----------tta
B D                   Manatee  cttgtctagaa----taagacgtactccac-tactaaagatttcct----------tta
B D                    Tenrec  gttgtctagaa----taaggtgtgttcatc-aacacaggctctcctgtcgtagtactta
B D                 Armadillo  cttgtctggag----taggacatactcaacaaactatggctttcct----------tta
B D                Coelacanth  ===========================================================
         Princess of Burundi  ===========================================================
         Pundamilia nyererei  ===========================================================
                 Zebra mbuna  ===========================================================
       Burton's mouthbreeder  ===========================================================
B D              Nile tilapia  ===========================================================
B D                    Medaka  ===========================================================
B D               Stickleback  ===========================================================
  D  Chinese softshell turtle  ===========================================================
B D                    Lizard  ===========================================================
  D            Painted turtle  ===========================================================
  D    Spiny softshell turtle  ===========================================================
B D             X. tropicalis  ===========================================================
B D                  Platypus  ===========================================================
B D           Tasmanian devil  ===========================================================
B D                   Opossum  ===========================================================
  D           Green seaturtle  ===========================================================
              Golden hamster  ===========================================================
B D                    Rabbit  -----------------------------------------------------------
                Prairie vole  ===========================================================
         Cape elephant shrew  ===========================================================
        David's myotis (bat)  ===========================================================

Inserts between block 10 and 11 in window
B D                 Microbat 229bp

Alignment block 11 of 135 in window, 28973 - 28998, 26 bps 
B D                     Human  aactgcttaaa-ga----gttt---------a-t-t------cctcca
B D                     Chimp  gactgcttaaa-ga----gttt---------a-t-t------cctcca
B D                 Orangutan  gactgcttaaa-ga----gttt---------a-t-t------cctcca
B D                    Gibbon  gactgcttaaa-ga----gttt---------a-t-t------cctcca
B D                    Rhesus  gactgcttaaa-ga----gttt---------a-t-t------ccatt-
B D       Crab-eating macaque  gactgcttaaa-ga----ggtt---------a-t-t------ccatt-
B D              Green monkey  tactgcttaaa-ga----gttt---------a-t-t------ccccca
B D                  Marmoset  gactgcttaaa-gg----gatt---------t-c-t------ccccca
B D           Squirrel monkey  gactgcttaaa-gg----gttt---------t-c-t------ccccca
B D                  Bushbaby  gactgcttaaa-gg-------------------t-c------tcccca
           Chinese tree shrew  gaatacttaaatga----cttt---------t-t-t------ttttta
B D                  Squirrel  gactgctataa-aa----g------------t-t-t------------
       Lesser Egyptian jerboa  cattgctttca-gg----g--------------t-t------------
B D           Chinese hamster  cctggtgttaa-ga----g------------t-c-t------------
B D                     Mouse  cattgcgttga-gg----a-----------------------------
B D                       Rat  tgttgcatgga-gtagaca-----------------------------
B D            Naked mole-rat  aactgctttaa-gg----ggta---------t-t-t------------
B D                Guinea pig  agctgctttaa-gg----agta---------t-t-t------------
                   Chinchilla  aattgctttga-gg----gata---------t-t-t------------
             Brush-tailed rat  aactgcttcaa-gg----ggta---------t-t-t------------
B D                      Pika  aaccacttaaa-gg----gctt---------t-t-t------gca--g
B D                    Alpaca  tactacttaaa-gg----gtcc---------a-t-t------------
               Bactrian camel  tactacttgaa-gg----gtcc---------a-t-t------------
                 Killer whale  gactacttaaa-gt----gtcc---------a-t-t------------
             Tibetan antelope  gacttcttaaa-gg----gccc---------a-t-t------------
B D                       Cow  gacttcttaaa-gg----gtcc---------a-t-t------------
B D                     Sheep  gacttcttaaa-gg----gcct---------a-t-t------------
                Domestic goat  gacttcttaaa-gg----gccc---------a-t-t------------
B D                     Horse  gactgcttaaa-tg----gttc---------a-t--------------
B D          White rhinoceros  gactgcttaaa-gg----attc---------gtt--------------
B D                       Cat  aaatactgaaa-gt----gtcc---------a-c--------------
B D                       Dog  agctgcttaaa-ga----ctcc---------a-c--------------
B D                   Ferret   aagtgcttaaa--g----gtcc---------a-c--------------
B D                     Panda  aagtgcttgaa-gg----gccc---------a-c--------------
               Pacific walrus  aagtgcttaaa-gg----gtcc---------a-c--------------
             Black flying-fox  -----ggaaaa-gg----gtcc---------a-tt-------------
                Big brown bat  -----gggaaa-gg----gtcc---------a-tt-------------
B D                  Hedgehog  aactgcttaaa-ga----tttt---------t-t-tctttt-------
B D                     Shrew  gtatgcttaaa-tg----catt---------c-a-tttttc-------
              Star-nosed mole  gactgctttaa-ag----ggct---------c-g-ttttgtc------
B D                  Elephant  gactgcttaaa-gc----atctttttttttt-----------------
B D                   Manatee  gactgcttaaa-gg----atcttttttttt------------------
B D                    Tenrec  aacaggttaga-tg----gttt--------------------------
B D                 Armadillo  cactg-ttaaa-gc----gtacatctttta------------------
B D                Coelacanth  ================================================
         Princess of Burundi  ================================================
         Pundamilia nyererei  ================================================
                 Zebra mbuna  ================================================
       Burton's mouthbreeder  ================================================
B D              Nile tilapia  ================================================
B D                    Medaka  ================================================
B D               Stickleback  ================================================
  D  Chinese softshell turtle  ================================================
B D                    Lizard  ================================================
  D            Painted turtle  ================================================
  D    Spiny softshell turtle  ================================================
B D             X. tropicalis  ================================================
B D                  Platypus  ================================================
B D           Tasmanian devil  ================================================
B D                   Opossum  ================================================
  D           Green seaturtle  ================================================
              Golden hamster  ================================================
B D                    Rabbit  ------------------------------------------------
                Prairie vole  ================================================
         Cape elephant shrew  ================================================
B D                  Microbat  ================================================
        David's myotis (bat)  ================================================

Alignment block 12 of 135 in window, 28999 - 29000, 2 bps 
B D                     Human  tt-
B D                     Chimp  tt-
B D                 Orangutan  tt-
B D                    Gibbon  tt-
B D                    Rhesus  tt-
B D       Crab-eating macaque  tt-
B D              Green monkey  tt-
B D                  Marmoset  tt-
B D           Squirrel monkey  tt-
B D                  Bushbaby  tt-
           Chinese tree shrew  gt-
B D                  Squirrel  ta-
       Lesser Egyptian jerboa  ta-
B D           Chinese hamster  ta-
B D            Naked mole-rat  tt-
B D                Guinea pig  tt-
                   Chinchilla  tt-
             Brush-tailed rat  tt-
B D                      Pika  tt-
B D                    Alpaca  tt-
               Bactrian camel  tt-
                 Killer whale  gt-
             Tibetan antelope  at-
B D                       Cow  gt-
B D                     Sheep  at-
                Domestic goat  at-
B D                     Horse  tt-
B D          White rhinoceros  tt-
B D                       Cat  tt-
B D                       Dog  tt-
B D                   Ferret   tt-
B D                     Panda  -t-
               Pacific walrus  tt-
             Black flying-fox  -t-
B D                  Microbat  -c-
              Star-nosed mole  -t-
B D                  Elephant  -tt
B D                Coelacanth  ===
         Princess of Burundi  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
B D              Nile tilapia  ===
B D                    Medaka  ===
B D               Stickleback  ===
  D  Chinese softshell turtle  ===
B D                    Lizard  ===
  D            Painted turtle  ===
  D    Spiny softshell turtle  ===
B D             X. tropicalis  ===
B D                  Platypus  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
  D           Green seaturtle  ===
              Golden hamster  ===
B D                    Rabbit  ---
                Prairie vole  ===
B D                     Mouse  ---
B D                       Rat  ---
               Big brown bat  ---
         Cape elephant shrew  ===
B D                   Manatee  ---
B D                    Tenrec  ---
B D                  Hedgehog  ---
B D                 Armadillo  ---
B D                     Shrew  ---
        David's myotis (bat)  ===

Inserts between block 12 and 13 in window
B D                 Squirrel 39bp
      Lesser Egyptian jerboa 12bp
B D          Chinese hamster 10bp
B D           Naked mole-rat 8bp
B D               Guinea pig 8bp
                  Chinchilla 9bp
            Brush-tailed rat 2bp

Alignment block 13 of 135 in window, 29001 - 29001, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                    Alpaca  t
               Bactrian camel  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
             Black flying-fox  t
B D                  Microbat  c
              Star-nosed mole  t
B D                  Elephant  t
B D                Coelacanth  =
         Princess of Burundi  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
B D                    Medaka  =
B D               Stickleback  =
  D  Chinese softshell turtle  =
B D                    Lizard  =
  D            Painted turtle  =
  D    Spiny softshell turtle  =
B D             X. tropicalis  =
B D                  Platypus  =
B D           Tasmanian devil  =
B D                   Opossum  =
  D           Green seaturtle  =
              Golden hamster  =
B D           Chinese hamster  =
B D                    Rabbit  -
                Prairie vole  =
B D                     Mouse  -
B D                      Pika  -
B D                       Rat  -
               Big brown bat  -
         Cape elephant shrew  =
B D                   Manatee  -
B D                    Tenrec  -
B D                  Hedgehog  -
            Brush-tailed rat  =
B D                Guinea pig  =
B D                 Armadillo  -
B D                     Shrew  -
        David's myotis (bat)  =
                  Chinchilla  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
B D                  Squirrel  =

Inserts between block 13 and 14 in window
B D                 Microbat 1bp
             Star-nosed mole 1bp

Alignment block 14 of 135 in window, 29002 - 29013, 12 bps 
B D                     Human  t--ttt-----t-tccttcg
B D                     Chimp  t--ttt-----t-tccatcg
B D                 Orangutan  t--ctt-----t-tcctttg
B D                    Gibbon  t---tt-----t-tctttcg
B D                    Rhesus  t---tt-----t-tccttcg
B D       Crab-eating macaque  t---tt-----t-tccttcg
B D              Green monkey  t---tt-----t-tccttcg
B D                  Marmoset  t--ttt-----tcctctttg
B D           Squirrel monkey  t--ttt-----t-ctctttg
B D                  Bushbaby  t---ct-----t-ctcttta
           Chinese tree shrew  tctttt-----t-cttttca
B D                  Squirrel  -tcttc-----c-cctctct
       Lesser Egyptian jerboa  -ttttc-----a-attttca
                 Prairie vole  -tcttg-----t-tctttca
B D                     Mouse  -tctta-----t-tcattca
B D                       Rat  -tctta-----c-tcttt--
B D            Naked mole-rat  -ttctt-----t-cttttcc
B D                Guinea pig  -tttta-----t-attttca
                   Chinchilla  -ttttt-----t-attttca
             Brush-tailed rat  -gtttt-----t-attctca
B D                      Pika  -attgt-----t-ctctgca
B D                    Alpaca  --ccat-----t-ttcttca
               Bactrian camel  --ccat-----t-ttcttca
                 Killer whale  --tttc-----t-ctcttca
             Tibetan antelope  --tttc-----t-ctcttca
B D                       Cow  --tttc-----t-ctctcca
B D                     Sheep  --tttc-----t-ctcttta
                Domestic goat  --tttc-----t-ctcttta
B D                     Horse  --tttc-----t-ctcttca
B D          White rhinoceros  --tttc-----t-ctcctca
B D                       Cat  --ttgc-----t-cccttta
B D                       Dog  --ttgt-----t-ctcttta
B D                   Ferret   --ttgc-----t-ctcttta
B D                     Panda  --ttgc-----t-ctcttta
               Pacific walrus  --ttgc-----g-ctcttta
             Black flying-fox  --ttcc-----t-ctcctca
                Big brown bat  ----gt-----t-tcactca
         David's myotis (bat)  --ttgt-----t-tcgctca
B D                  Microbat  --ttgt-----t-tcgctca
B D                  Hedgehog  -----------------ata
              Star-nosed mole  -------------cttgtca
B D                  Elephant  ----ttttctct-ctcttta
B D                   Manatee  -----------t-ctcttca
B D                    Tenrec  -----------t-ctcttca
B D                 Armadillo  -----------t-ctcttca
B D                Coelacanth  ====================
         Princess of Burundi  ====================
         Pundamilia nyererei  ====================
                 Zebra mbuna  ====================
       Burton's mouthbreeder  ====================
B D              Nile tilapia  ====================
B D                    Medaka  ====================
B D               Stickleback  ====================
  D  Chinese softshell turtle  ====================
B D                    Lizard  ====================
  D            Painted turtle  ====================
  D    Spiny softshell turtle  ====================
B D             X. tropicalis  ====================
B D                  Platypus  ====================
B D           Tasmanian devil  ====================
B D                   Opossum  ====================
  D           Green seaturtle  ====================
              Golden hamster  ====================
B D           Chinese hamster  ====================
B D                    Rabbit  --------------------
         Cape elephant shrew  ====================
B D                     Shrew  --------------------

Inserts between block 14 and 15 in window
B D                Armadillo 3bp

Alignment block 15 of 135 in window, 29014 - 29017, 4 bps 
B D                     Human  gca-------------------------------------------------------------------
B D                     Chimp  gca-------------------------------------------------------------------
B D                 Orangutan  gca-------------------------------------------------------------------
B D                    Gibbon  gca-------------------------------------------------------------------
B D                    Rhesus  gca-------------------------------------------------------------------
B D       Crab-eating macaque  gca-------------------------------------------------------------------
B D              Green monkey  gca-------------------------------------------------------------------
B D                  Marmoset  gca-------------------------------------------------------------------
B D           Squirrel monkey  gca-------------------------------------------------------------------
B D                  Bushbaby  gca-------------------------------------------------------------------
           Chinese tree shrew  gta-------------------------------------------------------------------
B D                  Squirrel  gtgtgagctcagcatcaaacccagtgcctcacccatgctaggcaagtgctttaccaccaggatataaccc
       Lesser Egyptian jerboa  gtg-------------------------------------------------------------------
                 Prairie vole  gtg-------------------------------------------------------------------
B D           Chinese hamster  --g-------------------------------------------------------------------
B D                     Mouse  gtg-------------------------------------------------------------------
B D                       Rat  gtg-------------------------------------------------------------------
B D            Naked mole-rat  gca-------------------------------------------------------------------
B D                Guinea pig  aca-------------------------------------------------------------------
                   Chinchilla  aca-------------------------------------------------------------------
             Brush-tailed rat  gca-------------------------------------------------------------------
B D                      Pika  gca-------------------------------------------------------------------
B D                    Alpaca  gca-------------------------------------------------------------------
               Bactrian camel  gca-------------------------------------------------------------------
                 Killer whale  gca-------------------------------------------------------------------
             Tibetan antelope  gca-------------------------------------------------------------------
B D                       Cow  gca-------------------------------------------------------------------
B D                     Sheep  gca-------------------------------------------------------------------
                Domestic goat  gca-------------------------------------------------------------------
B D                     Horse  gca-------------------------------------------------------------------
B D          White rhinoceros  gca-------------------------------------------------------------------
B D                       Cat  gca-------------------------------------------------------------------
B D                       Dog  gca-------------------------------------------------------------------
B D                   Ferret   gca-------------------------------------------------------------------
B D                     Panda  gca-------------------------------------------------------------------
               Pacific walrus  aca-------------------------------------------------------------------
             Black flying-fox  gca-------------------------------------------------------------------
                Big brown bat  gca-------------------------------------------------------------------
         David's myotis (bat)  gca-------------------------------------------------------------------
B D                  Microbat  gca-------------------------------------------------------------------
B D                  Hedgehog  gca-------------------------------------------------------------------
B D                     Shrew  ----------------------------------------------------------------------
              Star-nosed mole  gga-------------------------------------------------------------------
B D                  Elephant  gca-------------------------------------------------------------------
          Cape elephant shrew  gta-------------------------------------------------------------------
B D                   Manatee  gca-------------------------------------------------------------------
B D                    Tenrec  gca-------------------------------------------------------------------
B D                 Armadillo  gta-------------------------------------------------------------------
B D                Coelacanth  ======================================================================
         Princess of Burundi  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D              Nile tilapia  ======================================================================
B D                    Medaka  ======================================================================
B D               Stickleback  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D           Green seaturtle  ======================================================================
              Golden hamster  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------

                        Human  ---------------------------t
                        Chimp  ---------------------------t
                    Orangutan  ---------------------------t
                       Gibbon  ---------------------------t
                       Rhesus  ---------------------------t
          Crab-eating macaque  ---------------------------t
                 Green monkey  ---------------------------t
                     Marmoset  ---------------------------t
              Squirrel monkey  ---------------------------t
                     Bushbaby  ---------------------------t
           Chinese tree shrew  ---------------------------t
                     Squirrel  aggcctcagttacttttctctaccgcat
       Lesser Egyptian jerboa  ---------------------------t
                 Prairie vole  ---------------------------t
              Chinese hamster  ---------------------------t
                        Mouse  ---------------------------t
                          Rat  ---------------------------t
               Naked mole-rat  ---------------------------t
                   Guinea pig  ---------------------------t
                   Chinchilla  ---------------------------t
             Brush-tailed rat  ---------------------------t
                         Pika  ---------------------------t
                       Alpaca  ---------------------------t
               Bactrian camel  ---------------------------t
                 Killer whale  ---------------------------t
             Tibetan antelope  ---------------------------t
                          Cow  ---------------------------t
                        Sheep  ---------------------------t
                Domestic goat  ---------------------------t
                        Horse  ---------------------------t
             White rhinoceros  ---------------------------t
                          Cat  ---------------------------t
                          Dog  ---------------------------t
                      Ferret   ---------------------------t
                        Panda  ---------------------------t
               Pacific walrus  ---------------------------t
             Black flying-fox  ---------------------------t
                Big brown bat  ---------------------------t
         David's myotis (bat)  ---------------------------t
                     Microbat  ---------------------------t
                     Hedgehog  ---------------------------c
                        Shrew  ---------------------------t
              Star-nosed mole  ---------------------------t
                     Elephant  ---------------------------t
          Cape elephant shrew  ---------------------------t
                      Manatee  ---------------------------t
                       Tenrec  ---------------------------t
                    Armadillo  ---------------------------t
                   Coelacanth  ============================
          Princess of Burundi  ============================
          Pundamilia nyererei  ============================
                  Zebra mbuna  ============================
        Burton's mouthbreeder  ============================
                 Nile tilapia  ============================
                       Medaka  ============================
                  Stickleback  ============================
     Chinese softshell turtle  ============================
                       Lizard  ============================
               Painted turtle  ============================
       Spiny softshell turtle  ============================
                X. tropicalis  ============================
                     Platypus  ============================
              Tasmanian devil  ============================
                      Opossum  ============================
              Green seaturtle  ============================
               Golden hamster  ============================
                       Rabbit  ----------------------------

Alignment block 16 of 135 in window, 29018 - 29033, 16 bps 
B D                     Human  tttctgtg----------aat-atctg--
B D                     Chimp  tttctgtg----------aat-atctg--
B D                 Orangutan  tttctgtg----------aat-atccg--
B D                    Gibbon  tttctgtg----------aat-atctg--
B D                    Rhesus  tttctatg----------aat-atctg--
B D       Crab-eating macaque  tttctatg----------aat-atctg--
B D              Green monkey  tttctatg----------aat-atctg--
B D                  Marmoset  tttccatg----------aat-atctg--
B D           Squirrel monkey  tttccgtg----------aat-atctg--
B D                  Bushbaby  tttctgag----------cat-atctgcc
           Chinese tree shrew  tgtctgtg----------tgt-ttctgtt
B D                  Squirrel  ttttggtg----------cac-atcag--
       Lesser Egyptian jerboa  tttt-gtg----------ctt-agctg--
                 Prairie vole  tcttcatg----------tgt-attca--
B D           Chinese hamster  tgttcctg----------tat-attgg--
B D                     Mouse  ttctcctg----------cgt-atctg--
B D                       Rat  ttcccctg----------tgt-atctg--
B D            Naked mole-rat  ttttggtg----------cgt-atcta--
B D                Guinea pig  tttcgagg----------cat-atcta--
                   Chinchilla  tttgggtg----------cct-atcta--
             Brush-tailed rat  tttgggtc----------cac-atcta--
B D                    Rabbit  tttgtgtg----------cat-gtctg--
B D                      Pika  tttctgtg----------tat-gtctg--
B D                    Alpaca  tttttgtg----------ccc-atctgca
               Bactrian camel  tttctgtg----------ccc-ttcagca
                 Killer whale  tttctgca----------tatgagttgca
             Tibetan antelope  tttctgca----------aatgaattgca
B D                       Cow  tttatgca----------aatgaattgca
B D                     Sheep  tttctgca----------aatgaattgca
                Domestic goat  tttctgca----------aatgaattgca
B D                     Horse  tttccgtg----------cat-atctgca
B D          White rhinoceros  tttctgtg----------cat-atctaca
B D                       Cat  tttctgtg----------cct-atctg--
B D                       Dog  tttctgca----------cct-gtctg--
B D                   Ferret   tttctggg----------cct-atctg--
B D                     Panda  cttctgtg----------cct-gtctg--
               Pacific walrus  tttctgtg----------cct-gtccg--
             Black flying-fox  tttctgtg----------tat-atctgca
                Big brown bat  tgtctgtg----------tat-atcttca
         David's myotis (bat)  tttctgtg----------tat-atctgca
B D                  Microbat  tttctgtg----------tat-atctgca
B D                  Hedgehog  tttctgtg----------caa-gtctgca
B D                     Shrew  tctctatg----------tat-atgtgcc
              Star-nosed mole  tcactggg----------cct-atctgca
B D                  Elephant  cttctttggtcacatatattt-atccata
          Cape elephant shrew  tttctttg----------cct-ggctata
B D                   Manatee  tttctttg----------cat-atccata
B D                    Tenrec  tttctttg-----------at-agtcata
B D                 Armadillo  tttctttg----------cag-gtccata
B D                Coelacanth  =============================
         Princess of Burundi  =============================
         Pundamilia nyererei  =============================
                 Zebra mbuna  =============================
       Burton's mouthbreeder  =============================
B D              Nile tilapia  =============================
B D                    Medaka  =============================
B D               Stickleback  =============================
  D  Chinese softshell turtle  =============================
B D                    Lizard  =============================
  D            Painted turtle  =============================
  D    Spiny softshell turtle  =============================
B D             X. tropicalis  =============================
B D                  Platypus  =============================
B D           Tasmanian devil  =============================
B D                   Opossum  =============================
  D           Green seaturtle  =============================
              Golden hamster  =============================

Alignment block 17 of 135 in window, 29034 - 29034, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  c
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                    Alpaca  t
               Bactrian camel  t
                 Killer whale  a
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
             Black flying-fox  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  a
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  t
B D                    Tenrec  g
B D                   Opossum  t
B D                Coelacanth  =
         Princess of Burundi  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
B D                    Medaka  =
B D               Stickleback  =
  D  Chinese softshell turtle  =
B D                    Lizard  =
  D            Painted turtle  =
  D    Spiny softshell turtle  =
B D             X. tropicalis  =
B D                  Platypus  =
B D           Tasmanian devil  =
  D           Green seaturtle  =
              Golden hamster  =
B D                 Armadillo  -

Alignment block 18 of 135 in window, 29035 - 29057, 23 bps 
B D                     Human  atg--a-gttaaatgcgtacttttct
B D                     Chimp  atg--a-gttaaatgcgtacttttct
B D                 Orangutan  atg--a-gttaaatgcgtacttttct
B D                    Gibbon  atg--a-gttaaatgcgtacttttct
B D                    Rhesus  atg--a-gttaaatgcgtacttttct
B D       Crab-eating macaque  atg--a-gttaaatgcgtacttttct
B D              Green monkey  atg--a-gttaaatgcatacttttct
B D                  Marmoset  atc--a-gttaaatgtatacttttct
B D           Squirrel monkey  aag--a-gttaaatgtatacttttct
B D                  Bushbaby  atg--a-actgaacttgtacccttct
           Chinese tree shrew  gcg--a-gtttaatgtgtactttttt
B D                  Squirrel  acatga-gttaaatgtatg-----ct
       Lesser Egyptian jerboa  atgtaa-tccca--gtatgaactact
                 Prairie vole  atgtga-gccgagtgtgtgtgtttct
B D           Chinese hamster  atgtga-gctgagcggatatgtttct
B D                     Mouse  gtggga-gctga--gtataagtttct
B D                       Rat  gtgtga-gctgaacatatgtgtttct
B D            Naked mole-rat  acatga-ggtgaatgcgtgcttttct
B D                Guinea pig  acacca-ggtgaatgcatgcttttct
                   Chinchilla  aca-ca-ggcgaatgtgtgcttttct
             Brush-tailed rat  aca-ca-ggtga--gtgtccttttct
B D                    Rabbit  gtg--a-gctgaacatgtgcatgtct
B D                      Pika  gtg--a-gccaattgtgtgcttggct
B D                    Alpaca  atg--a-gttgaatgtgcacttctct
               Bactrian camel  atg--a-gttgaatgtgcacttctct
                 Killer whale  atg--a-gttgaatgtgtatttttct
             Tibetan antelope  atg--a-gttgaatgtgtacttttct
B D                       Cow  atg--a-gttgaatgtgtacttttct
B D                     Sheep  atg--a-gttgaatgtgtacttttct
                Domestic goat  atg--a-gttgaatgtgtacttttct
B D                     Horse  agg--a-gttgaatgtgtacttttct
B D          White rhinoceros  atg--a-gttgaatgtgtacttttct
B D                       Cat  atg--aagttg--tgtgtacctttct
B D                       Dog  atg--a-gttgaatgtgtacctttct
B D                   Ferret   atg--g------------acttttct
B D                     Panda  gtg--a-ctcgaatgtttaactttct
               Pacific walrus  atg--a-gttgaatgtgtacctttct
             Black flying-fox  agg--a-gttgaatgtgtacttttcc
                Big brown bat  atg--a-gttgaatgtgtaatttttt
         David's myotis (bat)  atg--a-gttgaatgtgtaatttttt
B D                  Microbat  atg--a-gttgaatgtgtaacttttt
B D                  Hedgehog  gtg--a-gctga--ctgtattttcct
B D                     Shrew  gtg--a-gttga--gtgaacttttct
              Star-nosed mole  gta--a-gttgaatgtgcacttttcc
B D                  Elephant  atg--a-gttgaatgtgtatttttct
          Cape elephant shrew  tta--a-gttgaaagtgtccatttct
B D                   Manatee  atg--a-gttgaacgtgtatttttct
B D                    Tenrec  atg--a-gtcaaatgtatacatttct
B D                 Armadillo  -tg--a-gctgaatgt-tac-tttct
B D                   Opossum  gtg--g-atgaattgcacccttttct
B D           Tasmanian devil  atg--a-atcaaatgtactctttcct
B D                Coelacanth  ==========================
         Princess of Burundi  ==========================
         Pundamilia nyererei  ==========================
                 Zebra mbuna  ==========================
       Burton's mouthbreeder  ==========================
B D              Nile tilapia  ==========================
B D                    Medaka  ==========================
B D               Stickleback  ==========================
  D  Chinese softshell turtle  ==========================
B D                    Lizard  ==========================
  D            Painted turtle  ==========================
  D    Spiny softshell turtle  ==========================
B D             X. tropicalis  ==========================
B D                  Platypus  ==========================
  D           Green seaturtle  ==========================
              Golden hamster  ==========================

Alignment block 19 of 135 in window, 29058 - 29060, 3 bps 
B D                     Human  aac
B D                     Chimp  aac
B D                 Orangutan  aac
B D                    Gibbon  aac
B D                    Rhesus  aac
B D       Crab-eating macaque  aac
B D              Green monkey  aac
B D                  Marmoset  aac
B D           Squirrel monkey  aac
B D                  Bushbaby  agc
           Chinese tree shrew  aga
B D                  Squirrel  aga
       Lesser Egyptian jerboa  tg-
                 Prairie vole  aga
B D           Chinese hamster  aga
B D                     Mouse  aga
B D                       Rat  aga
B D            Naked mole-rat  aca
B D                Guinea pig  agg
                   Chinchilla  cgg
             Brush-tailed rat  agg
B D                    Rabbit  aga
B D                      Pika  aga
B D                    Alpaca  gga
               Bactrian camel  gga
                 Killer whale  gga
             Tibetan antelope  gaa
B D                       Cow  gaa
B D                     Sheep  gaa
                Domestic goat  gaa
B D                     Horse  aga
B D          White rhinoceros  aga
B D                       Cat  aga
B D                       Dog  aga
B D                   Ferret   aga
B D                     Panda  aga
               Pacific walrus  aga
             Black flying-fox  aga
                Big brown bat  cga
         David's myotis (bat)  aga
B D                  Microbat  aga
B D                  Hedgehog  att
B D                     Shrew  a-a
              Star-nosed mole  a-g
B D                  Elephant  aga
          Cape elephant shrew  aga
B D                   Manatee  aga
B D                    Tenrec  agg
B D                 Armadillo  aga
B D                   Opossum  aaa
B D           Tasmanian devil  aaa
B D                Coelacanth  aac
         Princess of Burundi  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
B D              Nile tilapia  ===
B D                    Medaka  ===
B D               Stickleback  ===
  D  Chinese softshell turtle  ===
B D                    Lizard  ===
  D            Painted turtle  ===
  D    Spiny softshell turtle  ===
B D             X. tropicalis  ===
B D                  Platypus  ===
  D           Green seaturtle  ===
              Golden hamster  ===

Alignment block 20 of 135 in window, 29061 - 29063, 3 bps 
B D                     Human  c------------tt
B D                     Chimp  c------------tt
B D                 Orangutan  c------------tt
B D                    Gibbon  c------------tt
B D                    Rhesus  c------------tt
B D       Crab-eating macaque  c------------tt
B D              Green monkey  c--------------
B D                  Marmoset  c----------tctt
B D           Squirrel monkey  c----------tctt
B D                  Bushbaby  c----------cctc
           Chinese tree shrew  c---------ttctt
B D                  Squirrel  c---------cttg-
                 Prairie vole  c---------ctctt
B D           Chinese hamster  a---------ctctc
B D                     Mouse  a---------ctcct
B D                       Rat  a---------ctctc
B D            Naked mole-rat  c---------cccct
B D                Guinea pig  c---------ccctt
                   Chinchilla  t---------ccctt
             Brush-tailed rat  -------------ct
B D                    Rabbit  t---------ctctc
B D                      Pika  t---------ctctc
B D                    Alpaca  c---------ctc--
               Bactrian camel  c---------ctc--
                 Killer whale  c---------ctctt
             Tibetan antelope  c---------ctctt
B D                       Cow  c---------gtctt
B D                     Sheep  c---------ctctt
                Domestic goat  c---------ctctt
B D                     Horse  c---------ctctt
B D          White rhinoceros  c---------ctctt
B D                       Cat  c---------ctcat
B D                       Dog  c---------ctcct
B D                   Ferret   c---------ctctc
B D                     Panda  c---------ctctt
               Pacific walrus  c---------ctctt
             Black flying-fox  c---------ctctt
                Big brown bat  t---------ctctt
         David's myotis (bat)  t---------ttctt
B D                  Microbat  t---------ttctt
B D                  Hedgehog  c---------ctcct
B D                     Shrew  a---------ctgca
              Star-nosed mole  a---------atatt
B D                  Elephant  ----------ttttt
          Cape elephant shrew  cttcctttttttttt
B D                   Manatee  ----------ttttt
B D                    Tenrec  ----------ctttt
B D                 Armadillo  c---------ctctt
B D                   Opossum  a---------ctccc
B D           Tasmanian devil  a---------atctc
B D                  Platypus  ---------aaacac
  D           Green seaturtle  ------------ctc
  D            Painted turtle  ------------ctt
B D                Coelacanth  ------------att
         Princess of Burundi  ===============
         Pundamilia nyererei  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
B D              Nile tilapia  ===============
B D                    Medaka  ===============
B D               Stickleback  ===============
  D  Chinese softshell turtle  ===============
B D                    Lizard  ===============
  D    Spiny softshell turtle  ===============
B D             X. tropicalis  ===============
              Golden hamster  ===============
      Lesser Egyptian jerboa  ---------------

Alignment block 21 of 135 in window, 29064 - 29100, 37 bps 
B D                     Human  tgtt-attttg--------aaagttattctg--atatt-----cc--------------t------atcc
B D                     Chimp  tgtt-attttg--------aaagttattctg--atgtt-----cc--------------t------atcc
B D                 Orangutan  tgtt-attttg--------aaagttattctg--atatt-----cc--------------t------atcc
B D                    Gibbon  tgtt-attttg--------aaagctattc-g--atatt-----cc--------------t------atcc
B D                    Rhesus  tgtt-attttg--------aaagttattctg--atatt-----cc--------------t------gtac
B D       Crab-eating macaque  tgtt-attttg--------aaagttattctg--atatt-----cc--------------t------gtac
B D              Green monkey  tgtt-attttg--------aaagttattctg--acatt-----cc--------------t------gtac
B D                  Marmoset  tgtt-attttg--------aaagttattcta--atatt-----cc--------------t------atcc
B D           Squirrel monkey  tgtt-attttg--------aaagtttttctg--atatt-----cc--------------t------atcc
B D                  Bushbaby  tgtc-attgtg--------aaagtgatcctg--atattccttacc--------------t------atcc
           Chinese tree shrew  tgtc-attttg--------atatttatcttg--acatc-----cc--------------tttgtccgcct
B D                  Squirrel  --tt-attttg--------aaaactatcttg--ctgtc-----ccttca-------ac-c------atcc
       Lesser Egyptian jerboa  --tc-attttg--------aaagatatttta--atgtt-----ccttta-------tc-c------accc
                 Prairie vole  --tc-cctttg--------gaagggatcctg--agatt-----cctttg-------tt-c------a-cc
B D           Chinese hamster  --tc-cctttg--------aaaggtatcctg--ggatt-----ccttta-------tt-c------accc
B D                     Mouse  --tc-ccttta---------aagatgtgttg--aggtt-----ccttta-------ta-c------accc
B D                       Rat  --tc-cctttg---------aagatatgcgg--agatt-----ccttta-------tt-c------acgt
B D            Naked mole-rat  tgtc-attttg--------aaagtcatcctg--atatc-----cctcta-------tc-t------accc
B D                Guinea pig  tgtt-atttta--------aaaattatcctg--acatc-----tcttta-------tc-t------accg
                   Chinchilla  ggtc-attttg--------aaagttatccag--agatc-----ccttta-------tc-t------gcac
             Brush-tailed rat  tgtc-attctg--------caagttatgcca--atagt-----cctctg-------tc-t------accc
B D                    Rabbit  tgct-attctg--------gaagtcatcctg--atgtc-----cccctt-------ccat------agcc
B D                      Pika  tgtc-tttctg--------aaagccat-cta--ataat-----cccctt-------ccat------agcc
B D                    Alpaca  tgtc-attttg--------gaagttatcctg--agatc-----ccttta-------cc-c------accc
               Bactrian camel  tgtc-attttg--------gaagttatcctg--agatc-----ccttta-------cc-c------accc
                 Killer whale  tgtc-attttg--------gaagttatcctg--atatc-----ccttta-------cc-c------acgc
             Tibetan antelope  tgtc-atcttg--------gaagttattctg--atgtc-----ccttta-------tc-c------agcc
B D                       Cow  tgtc-attttg--------gaagttatcctg--atgtc-----ccttta-------tc-c------accc
B D                     Sheep  tgtc-atcttg--------gaagttatcctg--atgtc-----ccttta-------tc-c------agcc
                Domestic goat  tgtc-atcttg--------gaagttatcctg--atgtc-----ccttta-------tc-c------agcc
B D                     Horse  tgtc-attttg--------gaagttatcctagtatatc-----ccttta-------cc-c------accc
B D          White rhinoceros  tgtc-attttg--------gaagttatcctggtatatc-----ccttta-------cc-c------accc
B D                       Cat  tgtc-atcttg--------gaagttatcctg--atatc-----ccttta-------cc-c------atcc
B D                       Dog  tgtc-accttg--------gaagttatcctg--atatc-----ccgtta-------cc-t------gccc
B D                   Ferret   tgtc-gtcttg--------ggagttttcctg--acatc-----cctcta-------cc-c------acgc
B D                     Panda  tgtc-accttg--------gaagttaccctg--atatc-----ccttta-------cc-c------accc
               Pacific walrus  tgtc-atgttg--------gaagttatcctg--ctatc-----ccttta-------cc-c------accc
             Black flying-fox  tgtc-attttg--------gaaattatcccg--ctat------ccttta-------cc-c------atac
                Big brown bat  tgtc-attttg--------gaagttatcctg--atatc-----ctttta-------cc-c------atgc
         David's myotis (bat)  tgtc-attttg--------gaagttatcctg--atata-----ctttta-------cc-c------atgc
B D                  Microbat  tgtc-attttg--------gaagttatcctg--atata-----ctttta-------cc-c------atgc
B D                  Hedgehog  tgtc-attttg--------aaagttatactg--ctttg-----tttcaa-------ta-t------accc
B D                     Shrew  tatc-attttg--------aatgttgtcctg--attcc-----ccttta-------tc-a------gccc
              Star-nosed mole  ttgt-catttg--------aaagttaccctg--atttc-----c--------------------------
B D                  Elephant  tgtc-attttg--------aaagttttcccg--atatc-----ccttta-------cc-c------atcc
          Cape elephant shrew  taac-acttta--------aaaatattcagg--atatc-----cttatg-------cc-c------accc
B D                   Manatee  tgtc-atttag--------aaagttttccta--atatc-----tcttta-------ac-c------atcc
B D                    Tenrec  tgcc-attttg--------aaaatgttcctg--a-atc-----ccgcta-------ct-c------accc
B D                 Armadillo  tgtcttttttg--------aaagttctcctg--atctc-----cctgta-------cc-c------acct
B D                   Opossum  ctgg-actttt--------gaaagcttctct--attcc-----tctttc-------at-t------ctcc
B D           Tasmanian devil  cttg-actttt--------gaaatcatcttt--attcc-----tctttc-------aa-t------c---
B D                  Platypus  tgat-attata--------aaagctcttttg----ttt-----cc--------------t------acct
  D           Green seaturtle  ------tctta---gaaaaaaactgcctttg--atatt-----ttcatc-----aaga-t------acct
  D            Painted turtle  ------tctta---gaaaaaaactgcctttg--atatt-----ttcatc-----aaga-t------acct
  D  Chinese softshell turtle  tgtg-attttgactgagaaaaagttatcttg--atatt-----ttcatt-------ga-t------acct
  D    Spiny softshell turtle  tgtg-attttgactgagaaaaagctatcttg--atatt-----tttatt-----aaga-t------gcct
B D                Coelacanth  tctt-cttttt--------aga-ttgccctg--ttacc-----ccaaaatggcagaat-t------atcc
         Princess of Burundi  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D              Nile tilapia  ======================================================================
B D                    Medaka  ======================================================================
B D               Stickleback  ======================================================================
B D                    Lizard  ======================================================================
B D             X. tropicalis  ======================================================================
              Golden hamster  ======================================================================

                        Human  a------gt
                        Chimp  a------gt
                    Orangutan  a------gt
                       Gibbon  a------gt
                       Rhesus  a------gt
          Crab-eating macaque  a------gt
                 Green monkey  a------gt
                     Marmoset  a------gt
              Squirrel monkey  a------gt
                     Bushbaby  a------gc
           Chinese tree shrew  a------gt
                     Squirrel  a------gt
       Lesser Egyptian jerboa  a------gt
                 Prairie vole  g------gc
              Chinese hamster  a------gc
                        Mouse  a------gc
                          Rat  g------gc
               Naked mole-rat  a------gt
                   Guinea pig  a------gt
                   Chinchilla  a------gt
             Brush-tailed rat  a------gt
                       Rabbit  a------gt
                         Pika  a------gt
                       Alpaca  a------ct
               Bactrian camel  a------ct
                 Killer whale  a------gt
             Tibetan antelope  acagtg---
                          Cow  acaatg-gt
                        Sheep  acagtgagt
                Domestic goat  acagtgagt
                        Horse  a------gt
             White rhinoceros  a------gt
                          Cat  a------gt
                          Dog  a------gt
                      Ferret   a------gc
                        Panda  a------gc
               Pacific walrus  a------gc
             Black flying-fox  a------gt
                Big brown bat  a------gt
         David's myotis (bat)  a------gt
                     Microbat  a------gt
                     Hedgehog  a------gt
                        Shrew  t------gt
              Star-nosed mole  ---------
                     Elephant  a------gt
          Cape elephant shrew  a------gt
                      Manatee  a------gt
                       Tenrec  a-------c
                    Armadillo  a------gt
                      Opossum  a--atg-tt
              Tasmanian devil  -------tt
                     Platypus  g------gt
              Green seaturtle  t------gt
               Painted turtle  t------gt
     Chinese softshell turtle  c--------
       Spiny softshell turtle  c------at
                   Coelacanth  a------aa
          Princess of Burundi  =========
          Pundamilia nyererei  =========
                  Zebra mbuna  =========
        Burton's mouthbreeder  =========
                 Nile tilapia  =========
                       Medaka  =========
                  Stickleback  =========
                       Lizard  =========
                X. tropicalis  =========
               Golden hamster  =========

Alignment block 22 of 135 in window, 29101 - 29108, 8 bps 
B D                     Human  tgtgc-----c-tc
B D                     Chimp  tgtgc-----c-tc
B D                 Orangutan  tgtgc-----c-tc
B D                    Gibbon  tgtgc-----c-tc
B D                    Rhesus  tgtgc-----c-tc
B D       Crab-eating macaque  tgtgc-----c-tc
B D              Green monkey  tgtgc-----c-tc
B D                  Marmoset  tgtgc-----c-tc
B D           Squirrel monkey  tatgc-----c-tc
B D                  Bushbaby  tcggc-----c-tc
           Chinese tree shrew  tgtgc-----c-tc
B D                  Squirrel  tgtgc-----c-tt
       Lesser Egyptian jerboa  tgagc-----c-tc
                 Prairie vole  tgtgc-----c-cc
B D           Chinese hamster  tgtgc-----c-tt
B D                     Mouse  tgtgc-----c-tc
B D                       Rat  tgtgc-----c-tc
B D            Naked mole-rat  tgggc-----c-tc
B D                Guinea pig  ggtgc-----c-tc
                   Chinchilla  tgtgc-----c-tc
             Brush-tailed rat  tgtgc-----c-tc
B D                    Rabbit  agcgc-----tctg
B D                      Pika  tgttc-----t-gg
B D                    Alpaca  tgtgc-----c-tc
               Bactrian camel  tgtgc-----c-tc
                 Killer whale  tgtgc-----c-tc
             Tibetan antelope  ----c-----c-tc
B D                       Cow  tgtgc-----c-tc
B D                     Sheep  tgtgc-----c-tc
                Domestic goat  tgtgc-----c-tc
B D                     Horse  tgtgc-----c-tc
B D          White rhinoceros  tgtac-----c-tc
B D                       Cat  cgtac-----c-tc
B D                       Dog  tgtgc-----t-tc
B D                   Ferret   tctgc-----c-tc
B D                     Panda  tgtgc-----c-tc
               Pacific walrus  tgtgc-----c-tc
             Black flying-fox  tgtgc-----c-tc
                Big brown bat  tgtgc-----c-tc
         David's myotis (bat)  tgtgc-----c-tc
B D                  Microbat  tgtgc-----c-tc
B D                  Hedgehog  tgtgc-----c-ct
B D                     Shrew  tgtgc-----c-tt
              Star-nosed mole  --tgc-----c-tc
B D                  Elephant  tgtgc-----c-tc
          Cape elephant shrew  tgtgg-----c-ta
B D                   Manatee  tttgc-----c-tc
B D                    Tenrec  tgtgc-----c-tc
B D                 Armadillo  tatgc-----c-tc
B D                   Opossum  gacat-----c-tt
B D           Tasmanian devil  atcat-----c-tc
B D                  Platypus  ------------cc
  D           Green seaturtle  aatatga--ag-tg
  D            Painted turtle  aatatta--gg-tc
  D  Chinese softshell turtle  ---at-----g-tc
  D    Spiny softshell turtle  aatat-----g-tc
B D                Coelacanth  tgtgatgttgc-at
B D                    Medaka  tttgt-----a-tc
         Princess of Burundi  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
B D              Nile tilapia  ==============
B D               Stickleback  ==============
B D                    Lizard  ==============
B D             X. tropicalis  ==============
              Golden hamster  ==============

Inserts between block 22 and 23 in window
                Killer whale 3bp

Alignment block 23 of 135 in window, 29109 - 29121, 13 bps 
B D                     Human  atttactagaaat
B D                     Chimp  atttactagaaat
B D                 Orangutan  atttactagaaat
B D                    Gibbon  atttactagaaat
B D                    Rhesus  atttactagaaat
B D       Crab-eating macaque  atttactagaaat
B D              Green monkey  atttactagaaat
B D                  Marmoset  attttctagaaat
B D           Squirrel monkey  attttgtagaaat
B D                  Bushbaby  attttctagcact
           Chinese tree shrew  actttctagaaac
B D                  Squirrel  attttctagaaat
       Lesser Egyptian jerboa  attttct--aaaa
                 Prairie vole  attctcttgacat
B D           Chinese hamster  gttctcttgaaat
B D                     Mouse  gttctctcg-aat
B D                       Rat  gttctcgtgaaat
B D            Naked mole-rat  attctctagaaat
B D                Guinea pig  atttcctagaaat
                   Chinchilla  attttctagacat
             Brush-tailed rat  attttctagaaat
B D                    Rabbit  gttttctggaagt
B D                      Pika  gttttctggaaat
B D                    Alpaca  attttctagaaat
               Bactrian camel  attttctagaaat
                 Killer whale  attttctagaagt
             Tibetan antelope  cttctctagaaat
B D                       Cow  ---ctctagaaat
B D                     Sheep  cttctctagaaat
                Domestic goat  cttctctagaaat
B D                     Horse  attttctggaaat
B D          White rhinoceros  attttctagacat
B D                       Cat  atgttctagaaat
B D                       Dog  attttcttgaaat
B D                   Ferret   attttctagaaat
B D                     Panda  attttctagaaat
               Pacific walrus  attttctagaact
             Black flying-fox  atgttctagaaat
                Big brown bat  attttctagaaat
         David's myotis (bat)  attttctagaaac
B D                  Microbat  attttctagaaac
B D                  Hedgehog  gttttcttgaaat
B D                     Shrew  attttcta-aaag
              Star-nosed mole  actttctagaaat
B D                  Elephant  attttttagaaat
          Cape elephant shrew  attttctaggaat
B D                   Manatee  actgtttagaaat
B D                    Tenrec  gttctctacaaat
B D                 Armadillo  atttcctagaaat
B D                   Opossum  atc------aata
B D           Tasmanian devil  atc------aata
B D                  Platypus  atctttc------
  D           Green seaturtle  acttcattaatat
  D            Painted turtle  tctttgttaatat
  D  Chinese softshell turtle  acttcattaatat
  D    Spiny softshell turtle  acttcattaatat
B D                Coelacanth  agctgcaagagat
B D                    Medaka  ---agtaacaaga
B D               Stickleback  attgatcataaat
         Princess of Burundi  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  =============
       Burton's mouthbreeder  =============
B D              Nile tilapia  =============
B D                    Lizard  =============
B D             X. tropicalis  =============
              Golden hamster  =============

Inserts between block 23 and 24 in window
B D                   Medaka 9bp

Alignment block 24 of 135 in window, 29122 - 29150, 29 bps 
B D                     Human  ttgctcac-atggccaaa--tg-atgtatccac
B D                     Chimp  ttgctcac-atggccaaa--tg-atgtatccac
B D                 Orangutan  ttgctcac-atggccaaa--tg-atgtatccac
B D                    Gibbon  ttgctcac-atggccaaa--tg-atgtatccac
B D                    Rhesus  ttgctcac-acggccaaa--tg-atgtatccac
B D       Crab-eating macaque  ttgctcac-atggccaaa--tg-atgtatccac
B D              Green monkey  ttgctcac-atggccaaa--tg-atgtatccac
B D                  Marmoset  ttgctcac-atggccaaa--tg-atgtatccgc
B D           Squirrel monkey  ttgctcac-atggccaaa--tg-atgtatccac
B D                  Bushbaby  ttattcac-atggccaaa--tg-atgtctccac
           Chinese tree shrew  ttactcac-atggccaaa--tg-atgtgtccac
B D                  Squirrel  ttactcac-atgactaaa--tg-atgtattcac
       Lesser Egyptian jerboa  ttactcat-atggctgca--tg-atatatccac
                 Prairie vole  ttcctccc-atggccaca--cg-acgtgtctac
B D           Chinese hamster  ttcctcac-atggccata--tg-atctgtccac
B D                     Mouse  gtcctcac-atggcccta--tg-atgtgtccac
B D                       Rat  gtcctcat-gtgaccctg--tg-atgtgtccac
B D            Naked mole-rat  ttactcac-atggccaaa--tg-atgtatccac
B D                Guinea pig  tttctcac-atgggcaga--tg-atgtatccac
                   Chinchilla  tttctcac-atgggcaaa--tg-ctgtatccac
             Brush-tailed rat  tttctcac-atgggcaaa--tg-atatatccac
B D                    Rabbit  ttactcac-atggcaaaa--tg-atgtatccac
B D                      Pika  ttaatcac-atggccaaa--tg-atgtacccac
B D                    Alpaca  ttacttat-atggtcaaa--tg-atatatccac
               Bactrian camel  ttactcat-atggtcaaa--tg-atatatccac
                 Killer whale  ttactcat-atggtcaaa--tg-atgtatccac
             Tibetan antelope  ttactcat-gtggtcaaa--tg-ctgtttccac
B D                       Cow  ttagtcat-atggtcaaa--tg-ctgtttccac
B D                     Sheep  ttactcat-gtggtcaaa--tg-ctgtttccac
                Domestic goat  ttactcat-gtggtcaaa--tg-ctgtttccac
B D                     Horse  ttactcac-atggccaaa--tg-atgtatccac
B D          White rhinoceros  atactcac-atggccaaa--tg-atgtatccac
B D                       Cat  ttactcac-atggccaaa--tg-atgtatccac
B D                       Dog  ttactcac-atggccaaa--tg-atgtatccac
B D                   Ferret   ttactcac-atgtccaaa--tg-atgtgtccac
B D                     Panda  ttactcat-gtggccaaa--tg-atgtatccac
               Pacific walrus  ttactcac-atggccaaa--tg-atgtatccac
             Black flying-fox  ttactcac-atggccaaa--tg-atgtatccac
                Big brown bat  ttactcac-aaggccaaa--tg-atgtatccac
         David's myotis (bat)  ttactcac-aaggccaaa--tg-atgtatccac
B D                  Microbat  ttactcac-aaggccaaa--tg-atgtatccac
B D                  Hedgehog  ttactcac-atggtcaaa--ta-ttgtattcac
B D                     Shrew  tcactcat-atggtcaag--tg-atgtctccac
              Star-nosed mole  ttaatgac-atggtcaaa--tg-atatatccac
B D                  Elephant  ttactcat-atgaccaaa--tgaatgtatccac
          Cape elephant shrew  ttactcac-atgaccagt--tgaatgtatccac
B D                   Manatee  gtactcat-atggccaaa--taaatgtattcac
B D                    Tenrec  gtactgat-atggccaaa--tgaatgtatccac
B D                 Armadillo  ttacttac-atggccaaa--tg-atgtatccac
B D                   Opossum  ttactctt-gtcactaaa--tt-atgttcctga
B D           Tasmanian devil  gtactctc--taattaaa--tg-atgtttctgc
B D                  Platypus  ----------tgattaaa--ta-ttgtatcctc
  D           Green seaturtle  ttact----gtaaccact--tg------cctgc
  D            Painted turtle  ttact----gtaatcact--tg------cctgc
  D  Chinese softshell turtle  ttact----gtattcaca--tg------cctgc
  D    Spiny softshell turtle  ttgct----gtattcact--tg------cctgc
B D                Coelacanth  ttgaaaattgtgttctga--tt-gtttatactg
B D              Nile tilapia  ttgctcactaatgtcaac--tc-atgttt----
          Princess of Burundi  ttgctcactaatgtcaac--tc-atgtat----
        Burton's mouthbreeder  ttgctcactaatgtcaac--tc-atgtat----
                  Zebra mbuna  ttgctcactaatgtcaac--tc-atgtat----
          Pundamilia nyererei  ttgctcactaatgtcaac--tc-atgtat----
B D                    Medaka  gtgctcactaatgctatctgtc-actggc----
B D               Stickleback  ---------cagatcgtctgtc-acctgt----
B D                    Lizard  =================================
B D             X. tropicalis  =================================
              Golden hamster  =================================

Inserts between block 24 and 25 in window
B D               Coelacanth 6bp

Alignment block 25 of 135 in window, 29151 - 29287, 137 bps 
B D                     Human  agaacaatttgaaactagaccttttggaagcgaactcctac-aaactgtcatcaatgttagcagaacttg
B D                     Chimp  agaacaatttgaaactagaccttttggaagcgaactcctac-aaactgtcatcaatgttagcagaacttg
B D                 Orangutan  agaacaatttgaaactagaccttttggaagcaaactcctac-aaactgtcatcaatgttagcagaacttg
B D                    Gibbon  agaacaatttgaaactagaccttttggaagcgaactcctac-aaactgtcatcaatgttagcagaacttg
B D                    Rhesus  agaacaatttgaaactagaccttttggaagcaaactcctac-aaactgtcatcagtgttagcagaacttg
B D       Crab-eating macaque  agaacaatttgaaactagaccttttggaagcaaactcctac-aaactgtcatcagtgttagcagaacttg
B D              Green monkey  agaacaatttgaaactagaccttttggaagcgaactcctac-aaactgtcatcagtgttagcagaacttg
B D                  Marmoset  agaacaatttgaagctagacctattggaagcgaactcctac-aaactgtcatcaacattagcagaacttg
B D           Squirrel monkey  agaacaatttgaaactagacctattggaagcgaactcctac-aaactgtcatcaacgttagcagaacttg
B D                  Bushbaby  agaacaacttgaaactagaccttttggaagcgaactcctat-aaactgtcatcagtgttagcagaactag
           Chinese tree shrew  agaacaacttgaaattggaccttctgcaagcaaactcctat-aaactgtcatcagtattagcagaacttg
B D                  Squirrel  agaacaatttgaaactagaccttctgcaagccaactcctat-aaactgtcatcagtattagcagaacttg
       Lesser Egyptian jerboa  agaacaatttgaaactagaccttttgcaagcgaactcttat-aaactgtcatcggtattagcagaacttg
                 Prairie vole  agaacagtttgaaactagaccttttgcaagcgaactcctac-aagctgtcgtcagtgttagcagacctgg
B D           Chinese hamster  agaatagtttgaaactagaccttttgcaagcaaactcctac-aaactgtcatcagtgttagcagacctgg
B D                     Mouse  agaacagtttgaaactagaccttttgcaagcgaactcctac-aaactgtcgtcagtgttggcagacctgg
B D                       Rat  agaacagcttgaaactagaccttttgcaagcgaactcctac-aagctgtcgacggtgttggcagacctgg
B D            Naked mole-rat  agaacaatttgaaactagaccttctgcaagcaaactcctat-aaactgttgtcagtattagcagaacttg
B D                Guinea pig  agaacaacctgaaactggaccttctgcaggcaaactcctataaaactgtcgtcagtattagcagaacttg
                   Chinchilla  agaacaatttgaaactagaccttctgcaagcgaactcctac-aaactgtcatcggtcttagcagaacttg
             Brush-tailed rat  agaacaatttgaaactagatcttctgcaagcaaactcttat-aaactgtcatcagtattagcagaactcg
B D                    Rabbit  agaacaatctgaaactggaccttctgcaagcaaattcctat-aaactttcatctgtattggcagaactgg
B D                      Pika  agaacaatttgaaactggaccttctgcaagcaaactcctat-aaactgtcatcagtattggcggaacttg
B D                    Alpaca  agaccaacttgaaactagaccttctgcaagcaaactcctac-aaactgtcatctgtgttagcagaacttg
               Bactrian camel  agaccaacttgaaactagaccttctgcaagcaaactcctac-aaactgtcatctgtgttagcagaacttg
                 Killer whale  agaataacttgaaactaatgcttttgcaagcaaacgcctat-aaactgtcatccgtcttagcagaacttg
             Tibetan antelope  agaatagcttgaaactagaccttctgcaagcaaactcctat-aaactgtcatccgtgttagcagaacttg
B D                       Cow  agaatagcttgaaactagaccttctgcaagcaaactcctat-aaactgtcatctgtgttagcagaacttg
B D                     Sheep  agaatagcttgaaactagaccttctgcaagcaaactcctat-aaactctcatccgtgttagcagaacttg
                Domestic goat  agaatagcttgaaactagaccttctacaagcaaactcctat-aaactgtcatccgtgttagcagaacttg
B D                     Horse  agacaaatttgaaactagaccttttgcaagcaaactcctat-aaactgtcatcagtgttagcagaacttg
B D          White rhinoceros  agacaaatttgaaactagaccttttgcaagcaaactcctat-aaactgtcgtcagtgttagcagaacttg
B D                       Cat  agaccaacttgaaactagatcttttgcaagcaaactcctac-aaactgtcatcagtgttagcagaacttg
B D                       Dog  agaccaatctgaaactagatcttttgcaagcaaactcctac-aaactggcatcggtgttagcagaacttg
B D                   Ferret   agaccaatttgaaactagaccttttgcaagcaaatgcctac-aaactgtcatcggtgttagcagaacttg
B D                     Panda  agaccaatttgaaactagacctcttgcaagcaaactcctac-aaactgtcatcggtgttagcagaactgg
               Pacific walrus  agaccaatttgaaactaaaccttttgcaagcaaactcctac-aaactgtcatcggtgttagcagaacttg
             Black flying-fox  agatcaatttgaaactaaaccttttgcaagcaaactcctat-aaactgtcatcagtgttagcagaacttg
                Big brown bat  agaccattttgaaactagacctgatgcaagcaaatgcctat-aaactgtcatcagtgttagcagaacttg
         David's myotis (bat)  agaccattttgaaactagacctgatgcaagcaaacgcctat-aaactgtcatcagtgttagcagaacttg
B D                  Microbat  agaccattttgaaactagacctgatgcaagcaaacgcctat-aaactgtcatcagtgttagcagaacttg
B D                  Hedgehog  agactaatttgaaactagaccttttgcaagccaattcctat-aaactgtcatcagtgttagcagaacttg
B D                     Shrew  agactaatctgaaactcgaccttttgcaagcaaactcctat-aaactgtcctcggtgttagctgaactag
              Star-nosed mole  agaccaatttgaagctagaccttttgcaagcaaactcctat-aaactgtcatctgtgttagcagaagttg
B D                  Elephant  agaccaatttgaagctagaccttttgcaagcaaatgcctac-aaactgtcatcaatattagcagaacttg
          Cape elephant shrew  agaccaatttgaagctccaccttttgcaagcaaattcctat-aaactgttgtcagtattagcagaccttg
B D                   Manatee  agaccaatctgaaactagaccttctgcaagcaaactcctat-aaactgtcatcagtattagcagaacttg
B D                    Tenrec  agatcaatttgaagctagacctgttgcaagcaaactcctat-aaactgtcatcagtattagcagaacttg
B D                 Armadillo  agaccagcttgaaactagaccttttgcaagtgaacttctat-aaactgtcatcagtattagcggaacttg
B D                   Opossum  agaccaaactgaaactagaccttctacaagccaatttcttc-aaattgtcatccgtattggctgaacttg
B D           Tasmanian devil  agacaagcctgaaactagatcttctgcaggccaacttcttc-aaattgtcatcagtattggctgacttgg
B D                  Platypus  agacaaagctgaaattggcacttttgcaagcaaacttatac-aagctgttgggcgtgctagctgacctcg
  D           Green seaturtle  agacaagtctaaaaacaagccttttgcgagcaaacagctgc-aaactatccacagtatttgcagaacta-
  D            Painted turtle  agacaagcccaaaaacaagccttttgcgagcgaacatctgc-aaactatccacagtactagcagaactag
  D  Chinese softshell turtle  agacaagcctgaaaacaagctttttgcaagcaaaattctgc-aaacttactatagtactaacagaactag
  D    Spiny softshell turtle  agacaagcctgaaaacaagctttttacaagcaaaattctgc-aaactaac--taatactggcagcactag
B D             X. tropicalis  agacaaacttaaaaatacatttgttggaagcaaatcacttc-aaactgttatcaacccttgcagaactgg
B D                Coelacanth  agaccagcttaaaactaaatcttctggaagctaacttcttc-aaactcacatcaaccatggcagaattgg
B D              Nile tilapia  agaatactctaaaattggatctcctggaggctactcactac-aaactctctacatcgctgtctgaattag
          Princess of Burundi  agaatactctaaaactggatctcctggaggctactcattac-aaactctctacatcgctgtctaaattag
        Burton's mouthbreeder  agaatactctaaaactggatctcctggaggctactcattac-aaactctctacatcgctgtctaaattag
                  Zebra mbuna  agaatactctaaaactggatctcctggaggctactcattac-aaactctctacatcgctgtctaaattag
          Pundamilia nyererei  agaatactctaaaactggatctcctggaggctactcattac-aaactctctacatcgctgtctaaattag
B D                    Medaka  agattactttaaaactgaatctactggaagccacaagctcc-aaactttctttaacactgtcgggaatag
B D               Stickleback  agacgaccctaaaactggatctccttgaagccacactctgc-aaactctctgtatcactgtctgagttgg
B D                    Lizard  ======================================================================
              Golden hamster  ======================================================================

                        Human  agcaaagacctcaacccagccatccttgtagtaattccatcttcaggtggagggaaaaggtaacattt
                        Chimp  agcaaagacctcaacccagccatccttgtagtaactccatcttcaggtggagagaaaaggtaacattt
                    Orangutan  agcaaagacctcaacccagccatccttgtagtaactccatcttcaggtggagggaaaaggtaacattc
                       Gibbon  agcaaagacctcaacccagccatccttgcagtaactccatcttcaggtggagggaaaaggtaacattc
                       Rhesus  agcaaagacctcaacccagccatccttgcagtaactccatcttcaggtggagggaaaaggtaacattc
          Crab-eating macaque  agcaaagacctcaacccagccatccttgcagtaactccatcttcaggtggagggaaaaggtaacattc
                 Green monkey  agcaaagacctcaacccagccatccttgcagtaactccatcttcaggtggagggaaaaggtaacattc
                     Marmoset  agcaaagacctcaacccagccatccttgtagtaactccatcttcaggtggagggaaaaggtaacattc
              Squirrel monkey  agcaaagacctcaacccagccatccttgcagtaactccatcttcaggtggagggaaaaggtaacattc
                     Bushbaby  agcaaagacctaaacccagccatccctgcagtacctccatcttcaagtggaaagaaaaggtaaaattc
           Chinese tree shrew  agaaaagacctaaacccagtcatccttgtagtaactccatcttcaagtggaaagaaaaggt-------
                     Squirrel  agcaaagacctaaacccagccatccctgtagtacctccattttcaagtggaaagaaaaggtaaagcta
       Lesser Egyptian jerboa  agcaaagacctaaacccagccatccctgtagcagctccatcttcaagtggaaagaaaaggtaaacctc
                 Prairie vole  agcagaggccgaaacccagccacccctgtagcgcctgcatcttcaagtggaaggaaaaggtaacgtgg
              Chinese hamster  agcaaaggccaaagcccagccatccctgtagcaactgcatcttcaagtggaaagaaaaggtaatggtg
                        Mouse  agcaacggccaaagccctgccatccctgtagcacctgcattttcaagtggaaagaaaaggtaacgtga
                          Rat  agcaacggccaaagccctgtcatccgtgcagcaactgcattttcaagtggaaggaaaaggtaacgaga
               Naked mole-rat  agcaaagaactaaacccagccatccctgtagcaactccatcttcaagtggaaagaaaaggtaa--cgg
                   Guinea pig  agcaaagaactaaacccaaccatccgtgtagtaactccatcttcaagtggaaagataaggtaaactgg
                   Chinchilla  aacagagaactaaacccagccatccctgtagcaactccatcttcaagtggaaagaaaaggtaaaacag
             Brush-tailed rat  agcaaagaacgaaacccagccatccctgcagtaactccatcttcaagtggaaagaaaaggtaaaatag
                       Rabbit  agcaaagacctaagcccagccatccctgtagtaactgcatcttcaaatggaaagaaaaggtgaaagtg
                         Pika  agcaaagacctaaacccagccatccctgtagtaattgtatcttcaagtggaaagaaaaggtaaaatgg
                       Alpaca  agcaaagacctcagcccagccatccctgtagtgactccatcttcaagtggaaagaaaaggtaaaaa-t
               Bactrian camel  agcaaagacctcagcccagccatccctgtagtgactccatcttcaagtggaaagaaaaggtaaaaa-t
                 Killer whale  agcaaagacctcaacccagccatgtctgcagtaactccatcttcaagtggaaagaaaaggtaagcatt
             Tibetan antelope  agcaaagacctcaacccaaccatccctgtagtaactccatcttcaagtggaaagaaaaggtaaacatt
                          Cow  agcaaagacctcaacccaaccatccctgtagtaactccatcttcaagtggaaagaaaaggtaaacatt
                        Sheep  agcaaagacctcaacccaaccatccctgtagtaactccatcttcaagtggaaagaaaaggtaaacatt
                Domestic goat  agcaaagacctcaacccaaccatccctgtagtaactccatcttcaagtggaaagaaaaggtaaacatt
                        Horse  agaaaagacctcaacccagccatccctgtagtaactccatcttcaagtggaaagaaaaggtaaaattt
             White rhinoceros  agaaaagacctcaacccagccatccctgtagtaattccatcttcaagtggaaagaaaaggtaaaattt
                          Cat  agcaaagacctcaacccaaccatccctgcagtaactccatcttcaggtggaaagaaaaggtaaaaatt
                          Dog  agcaaagacctcagcccagccatccctgtagtaactccatcttcaggtggaaagaaaaggtaaaaatt
                      Ferret   agcaaagacctcaacccagccatccctgtagtaacgccatcttcaggtggaaagaaaaggtaaaaact
                        Panda  agcagagacctcaaccgagccatccctgtagtaactccatcttcaagtggaaagaaaaggtaaacatt
               Pacific walrus  agcaaagacctcaacccagccatccctgtagtaactccatcttcaagtggaaagaaaaggtaaaaatt
             Black flying-fox  agcaaagacctcaacccagccatccctatagtaactccatcttcaagtggaaagaaaaggtaaaattt
                Big brown bat  aacaaagacctcaacccagccatccttgtagtaactccatcttcaagcggaaagaaaaggtaaaaatt
         David's myotis (bat)  aacaaagacctcagcccagccatccttgtagtaactccatcttcaagcggaaagaaaaggtaaaaatt
                     Microbat  aacaaagacctcaacccagccatccttgtagtaactccatcttcaagcggaaagaaaaggtaaaaatt
                     Hedgehog  agaaaagacctaaacccagccatccctgtagtgcctccatcttcaaatggaaagaaaaggtaacattt
                        Shrew  agcatacacccaaaccgactcattcctgtagtacccgcatcttcaagtggaaagaaaaggtaaaactt
              Star-nosed mole  agcgaagacctaaacccagccatccctgcagttcctacatcttcaagtggaaagaaaaggtaaaaaat
                     Elephant  agcaaagacctaaacccacacatccctgtagcacctgcatcttcaagtggaaagaaaaggtaaaattt
          Cape elephant shrew  agcaaagacctaaacccaggcacccctgcagcacctgcatcttcaagtggaaagaaaaggtaaagttg
                      Manatee  agcaaagacctaaacccccacatccctgtagcacctgcatcttcaagtggaaagaaaaggtaaaattt
                       Tenrec  agcaaagacctaagcccaggcatccctgtagcaactgcatcttcaaatggaaggacaaggtaaatgct
                    Armadillo  agcaaagacctaaacccaaccatccctgtaacatctgcatcttcacgtggaaagaaaaggtaaaatgt
                      Opossum  agcagagacctaaaccaacacatccatgcatctcttgtatctccaagtggaaagagaaggtaa-----
              Tasmanian devil  agcagaaacctaaaccaacacatccgtgcagttcttgtatctctaagtggaaagaaaaggtaa-----
                     Platypus  agcacagtcccagacccacacatctcagcagcagctgcatctccaagtggaaagaaaaggtaagatgc
              Green seaturtle  agcagaagcgtaagcccacacatccctggagcgactgtatctccaactggaaagagaaggtaaagcag
               Painted turtle  agcagaagcctaagcccagacatccctggagcgactgtatctccaactggaaagagaaggtaaagcag
     Chinese softshell turtle  aggagaagcctaagcccacacat-cctggcattactgtatctgcaactggaaagagatggtaaagcag
       Spiny softshell turtle  agcagaagcctaagcccacacat-cctagtattactgtatctgcaactggaaagagatggtaaagcag
                X. tropicalis  aaggaaggtctttgtcgccccacccatgcagtgaacggatctcaaaatggaaagaaaaggtgccatat
                   Coelacanth  agaagaaagaaaaaccttcacgtccttcttacaacaatatctacaaatggaaagacaaggtaatatt-
                 Nile tilapia  aagggaaacccaagtcccatcaccggttcagtgacagtattctgaaatggaaggacaaggtaagatct
          Princess of Burundi  aagggaaaccaaagtcccatcaccggttcagcaacagtattctgaaatggaaggacaaggtaagactt
        Burton's mouthbreeder  aagggaaaccaaagtcccatcaccggttcagcaacagtattctgaaatggaaggacaaggtaagattt
                  Zebra mbuna  aagggaaaccaaagtcccatcaccggttcagcaacagtattctgaaatggaaggacaaggtaagattt
          Pundamilia nyererei  aagggaaaccaaagtcccatcaccggttcagcaacagtattctgaaatggaaggacaaggtaagattt
                       Medaka  aaggaaaacccgagtcgtgccatcctttcagcgacagcatatctaaatggaaagataaggtaagaact
                  Stickleback  aggggcaacccaaggcccatcaccgttttagtgaaagcattgtgaaatggaaagataaggtaagatt-
                       Lizard  ====================================================================
               Golden hamster  ====================================================================

Inserts between block 25 and 26 in window
B D             Nile tilapia 7466bp
         Princess of Burundi 7426bp
       Burton's mouthbreeder 7205bp
                 Zebra mbuna 7587bp
         Pundamilia nyererei 7191bp

Alignment block 26 of 135 in window, 29288 - 29289, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  aa
B D                  Squirrel  aa
B D                     Mouse  cg
B D                       Rat  t-
B D            Naked mole-rat  aa
B D                Guinea pig  aa
                   Chinchilla  aa
             Brush-tailed rat  aa
B D                    Rabbit  aa
B D                      Pika  aa
B D                    Alpaca  ta
               Bactrian camel  ta
                 Killer whale  ta
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D                     Horse  ta
B D          White rhinoceros  ta
B D                       Cat  ta
B D                       Dog  ta
B D                   Ferret   ta
B D                     Panda  ta
               Pacific walrus  ta
             Black flying-fox  ta
                Big brown bat  ta
         David's myotis (bat)  ta
B D                  Microbat  ta
B D                  Hedgehog  aa
B D                     Shrew  ta
              Star-nosed mole  ta
B D                  Elephant  ga
          Cape elephant shrew  ga
B D                   Manatee  ga
B D                    Tenrec  ga
B D                 Armadillo  ga
B D                  Platypus  ac
  D           Green seaturtle  tt
  D            Painted turtle  tt
  D  Chinese softshell turtle  tt
  D    Spiny softshell turtle  tt
B D             X. tropicalis  aa
B D                Coelacanth  --
         Princess of Burundi  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
B D              Nile tilapia  ==
B D                    Medaka  --
B D               Stickleback  --
B D                    Lizard  ==
B D           Tasmanian devil  --
B D                   Opossum  --
              Golden hamster  ==
B D           Chinese hamster  --
                Prairie vole  --
      Lesser Egyptian jerboa  --
          Chinese tree shrew  --

Inserts between block 26 and 27 in window
B D            X. tropicalis 7134bp

Alignment block 27 of 135 in window, 29290 - 29290, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D              Green monkey  g
B D                  Bushbaby  a
B D                  Squirrel  g
B D                     Mouse  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                    Alpaca  a
               Bactrian camel  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
             Black flying-fox  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  a
B D                    Tenrec  a
B D                 Armadillo  a
B D                  Platypus  a
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  a
B D                Coelacanth  g
         Princess of Burundi  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
B D                    Medaka  -
B D               Stickleback  -
B D                    Lizard  =
B D             X. tropicalis  =
B D           Tasmanian devil  -
B D                   Opossum  -
              Golden hamster  =
B D           Chinese hamster  -
                Prairie vole  -
B D                      Pika  -
B D                       Rat  -
B D                       Dog  -
      Lesser Egyptian jerboa  -
          Chinese tree shrew  -
B D           Squirrel monkey  -
B D                  Marmoset  -

Inserts between block 27 and 28 in window
B D                   Rabbit 381bp
  D          Green seaturtle 2bp
  D           Painted turtle 2bp
  D Chinese softshell turtle 2bp
  D   Spiny softshell turtle 2bp

Alignment block 28 of 135 in window, 29291 - 29294, 4 bps 
B D                     Human  g--aga
B D                     Chimp  g--aga
B D                 Orangutan  g--aga
B D                    Gibbon  g--aga
B D                    Rhesus  g--aga
B D       Crab-eating macaque  g--aga
B D              Green monkey  g--aga
B D                  Marmoset  g--aga
B D           Squirrel monkey  g--aaa
B D                  Bushbaby  g--aga
           Chinese tree shrew  g--aat
B D                  Squirrel  ---aga
       Lesser Egyptian jerboa  ---aga
                 Prairie vole  ---aga
B D           Chinese hamster  ---aga
B D                     Mouse  -tgaga
B D                       Rat  ---cga
B D            Naked mole-rat  ---agc
B D                Guinea pig  ---caa
                   Chinchilla  ---aga
             Brush-tailed rat  ---aga
B D                    Rabbit  --gaga
B D                      Pika  --gaga
B D                    Alpaca  --gagg
               Bactrian camel  --gagg
                 Killer whale  --aagg
             Tibetan antelope  --gagg
B D                       Cow  --gagg
B D                     Sheep  --gagg
                Domestic goat  --gagg
B D                     Horse  --gaga
B D          White rhinoceros  --gaga
B D                       Cat  --gaga
B D                       Dog  ---aga
B D                   Ferret   --gaga
B D                     Panda  --gaga
               Pacific walrus  --gaga
             Black flying-fox  --gagg
                Big brown bat  --gaga
         David's myotis (bat)  --gaga
B D                  Microbat  --gaga
B D                  Hedgehog  --gagc
B D                     Shrew  --gaga
              Star-nosed mole  --gaga
B D                  Elephant  --gaaa
          Cape elephant shrew  --ggaa
B D                   Manatee  --gaga
B D                    Tenrec  --gaga
B D                 Armadillo  --gaga
  D           Green seaturtle  --gtaa
  D            Painted turtle  --gtaa
  D  Chinese softshell turtle  --ggaa
  D    Spiny softshell turtle  --ggaa
B D                Coelacanth  --ggga
B D                    Medaka  ---gta
B D               Stickleback  -----a
         Princess of Burundi  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
B D              Nile tilapia  ======
B D                    Lizard  ======
B D             X. tropicalis  ======
B D                  Platypus  ------
B D           Tasmanian devil  ------
B D                   Opossum  ------
              Golden hamster  ======

Inserts between block 28 and 29 in window
B D                 Bushbaby 96bp
B D                      Cat 1bp
  D Chinese softshell turtle 1643bp
  D   Spiny softshell turtle 1544bp

Alignment block 29 of 135 in window, 29295 - 29299, 5 bps 
B D                     Human  ctggt
B D                     Chimp  ctggt
B D                 Orangutan  ctggt
B D                    Gibbon  ctggt
B D                    Rhesus  ctggt
B D       Crab-eating macaque  ctggt
B D              Green monkey  ctggt
B D                  Marmoset  ctgga
B D           Squirrel monkey  ctgga
B D                  Bushbaby  ctggt
           Chinese tree shrew  atggt
B D                  Squirrel  tcgat
       Lesser Egyptian jerboa  tcagt
                 Prairie vole  tc-ac
B D           Chinese hamster  ttgat
B D                     Mouse  tcagt
B D                       Rat  tcggg
B D            Naked mole-rat  ctggt
B D                Guinea pig  gtgct
                   Chinchilla  ctggt
             Brush-tailed rat  ttggc
B D                    Rabbit  tt---
B D                      Pika  ct---
B D                    Alpaca  tcggt
               Bactrian camel  tcggt
                 Killer whale  ttggc
             Tibetan antelope  ctggt
B D                       Cow  ctggt
B D                     Sheep  ctggt
                Domestic goat  ctggt
B D                     Horse  ttgat
B D          White rhinoceros  ttggt
B D                       Cat  ttggt
B D                       Dog  ttgtt
B D                   Ferret   tggat
B D                     Panda  tgggc
               Pacific walrus  tgagt
             Black flying-fox  ttggt
                Big brown bat  ttggt
         David's myotis (bat)  ttggt
B D                  Microbat  ttggt
B D                  Hedgehog  atgac
B D                     Shrew  ctggt
              Star-nosed mole  tgggt
B D                  Elephant  ttggt
          Cape elephant shrew  tgggt
B D                   Manatee  ttggt
B D                    Tenrec  ttggg
B D                 Armadillo  ttcat
B D                   Opossum  --ggc
B D           Tasmanian devil  --ggc
B D                  Platypus  aaagc
  D           Green seaturtle  tcagt
  D            Painted turtle  tcagt
B D                Coelacanth  ctact
B D                    Medaka  tcaac
B D               Stickleback  ttcat
         Princess of Burundi  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
B D              Nile tilapia  =====
  D  Chinese softshell turtle  =====
B D                    Lizard  =====
  D    Spiny softshell turtle  =====
B D             X. tropicalis  =====
              Golden hamster  =====

Inserts between block 29 and 30 in window
  D          Green seaturtle 567bp
  D           Painted turtle 976bp

Alignment block 30 of 135 in window, 29300 - 29310, 11 bps 
B D                     Human  ------tgtaatttctt
B D                     Chimp  ------tgtaatttctt
B D                 Orangutan  ------tgtaatttctt
B D                    Gibbon  ------tgtaatttctt
B D                    Rhesus  ------tgtaagttctt
B D       Crab-eating macaque  ------tgtaagttctt
B D              Green monkey  ------tgtaagttctt
B D                  Marmoset  ------tgtgatatcct
B D           Squirrel monkey  ------tgtgatttctt
B D                  Bushbaby  ------tgtcatttctt
           Chinese tree shrew  ------tgcgatttctt
B D                  Squirrel  ------tataatttttt
       Lesser Egyptian jerboa  ------tatgatttcta
                 Prairie vole  ------tgggatggctt
B D           Chinese hamster  ------tgcgatgtctt
B D                     Mouse  ------tgggatgtgtt
B D                       Rat  ------tgggacatgct
B D            Naked mole-rat  ------tgagatttctt
B D                Guinea pig  ------tgaaatttctt
                   Chinchilla  ------tgaaatttctt
             Brush-tailed rat  ------tgaaatgtctc
B D                    Rabbit  ------tataatttttt
B D                      Pika  ------tgtaatttctt
B D                    Alpaca  ------tataatttctt
               Bactrian camel  ------tataat---tt
                 Killer whale  ------tataatttctg
             Tibetan antelope  ------tataatttctt
B D                       Cow  ------tataatttctt
B D                     Sheep  ------tataattcctt
                Domestic goat  ------tataattcctt
B D                     Horse  ------tgtaatttctt
B D          White rhinoceros  ------tgtaatttctt
B D                       Cat  ------tgtaatttctt
B D                       Dog  ------cataatttctt
B D                   Ferret   ------tgtaatttcct
B D                     Panda  ------tgtgatttctt
               Pacific walrus  ------tgtaatttctt
             Black flying-fox  ------tgtaatttctt
                Big brown bat  ------tataatttctt
         David's myotis (bat)  ------tataatttctt
B D                  Microbat  ------tataatttctt
B D                  Hedgehog  ------tgtagtttctt
B D                     Shrew  ------ggtaatttttc
              Star-nosed mole  ------tgtaatttatc
B D                  Elephant  ------t----------
          Cape elephant shrew  ------tacaattcctt
B D                   Manatee  ------t----------
B D                    Tenrec  ------tata-------
B D                 Armadillo  ------t----------
B D                   Opossum  ------tactatttcta
B D           Tasmanian devil  ------ccctatatcta
B D                  Platypus  ------ttttattttta
B D                Coelacanth  ------tgttctttcat
B D                    Medaka  tgttagtgggatttt--
B D               Stickleback  cat--------tttc--
         Princess of Burundi  =================
         Pundamilia nyererei  =================
                 Zebra mbuna  =================
       Burton's mouthbreeder  =================
B D              Nile tilapia  =================
  D  Chinese softshell turtle  =================
B D                    Lizard  =================
  D            Painted turtle  =================
  D    Spiny softshell turtle  =================
B D             X. tropicalis  =================
  D           Green seaturtle  =================
              Golden hamster  =================

Inserts between block 30 and 31 in window
B D                 Hedgehog 730bp
B D                 Platypus 1bp
B D               Coelacanth 4bp

Alignment block 31 of 135 in window, 29311 - 29315, 5 bps 
B D                     Human  ga-ttg
B D                     Chimp  ga-ttg
B D                 Orangutan  ga-ttg
B D                    Gibbon  ga-ttg
B D                    Rhesus  ga-ttg
B D       Crab-eating macaque  ga-ttg
B D              Green monkey  ga-ttg
B D                  Marmoset  ga-ttg
B D           Squirrel monkey  ga-ttg
B D                  Bushbaby  ga-tgg
           Chinese tree shrew  ga-ttg
B D                  Squirrel  ga-ttg
       Lesser Egyptian jerboa  aa-ttg
                 Prairie vole  ag-ctg
B D           Chinese hamster  ac-ctg
B D                     Mouse  ggaacg
B D                       Rat  gggatg
B D            Naked mole-rat  ga-ctg
B D                Guinea pig  ga-ctg
                   Chinchilla  ga-ctg
             Brush-tailed rat  aa-ctg
B D                    Rabbit  ga-ttg
B D                      Pika  ca-ttg
B D                    Alpaca  aa-ctg
               Bactrian camel  aa-ctg
                 Killer whale  ga-ctg
             Tibetan antelope  ga-ctg
B D                       Cow  ga-ctg
B D                     Sheep  ga-ctg
                Domestic goat  ga-ctg
B D                     Horse  ga-ctt
B D          White rhinoceros  gc-ctg
B D                       Cat  ga-ctg
B D                       Dog  ga-ctg
B D                   Ferret   ga-cgg
B D                     Panda  ga-tgg
               Pacific walrus  ga-cgg
             Black flying-fox  ga-ttg
                Big brown bat  ga-cta
         David's myotis (bat)  aa-cta
B D                  Microbat  ga-cta
B D                  Hedgehog  aa-ctg
B D                     Shrew  ta-cag
              Star-nosed mole  aa-ctg
B D                  Elephant  -g-ctg
          Cape elephant shrew  ag-cta
B D                   Manatee  -g-ctg
B D                    Tenrec  -a-ctg
B D                 Armadillo  -a-cca
B D                  Platypus  ga-gtg
B D                Coelacanth  ca-c--
B D                    Medaka  aa-ttg
B D               Stickleback  aa-cag
         Princess of Burundi  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
B D              Nile tilapia  ======
  D  Chinese softshell turtle  ======
B D                    Lizard  ======
  D            Painted turtle  ======
  D    Spiny softshell turtle  ======
B D             X. tropicalis  ======
B D           Tasmanian devil  ------
B D                   Opossum  ------
  D           Green seaturtle  ======
              Golden hamster  ======

Inserts between block 31 and 32 in window
B D                Armadillo 1bp
B D                 Platypus 41bp

Alignment block 32 of 135 in window, 29316 - 29316, 1 bps 
B D                     Human  g
B D                     Chimp  a
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  g
B D                      Pika  g
B D                    Alpaca  a
               Bactrian camel  a
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  c
               Pacific walrus  g
             Black flying-fox  a
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
B D                    Tenrec  c
B D                 Armadillo  t
B D                Coelacanth  g
B D                    Medaka  g
B D               Stickleback  g
         Princess of Burundi  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
  D  Chinese softshell turtle  =
B D                    Lizard  =
  D            Painted turtle  =
  D    Spiny softshell turtle  =
B D             X. tropicalis  =
B D                  Platypus  =
B D           Tasmanian devil  -
B D                   Opossum  -
  D           Green seaturtle  =
              Golden hamster  =

Inserts between block 32 and 33 in window
B D                   Medaka 6533bp
B D              Stickleback 4bp

Alignment block 33 of 135 in window, 29317 - 29356, 40 bps 
B D                     Human  gcctgctgggt--gg-agtggc-----ttaaagt-a---g--cat--cag--ggc--aaa
B D                     Chimp  gcctgctgggt--gg-agtggc-----ttaaagt-a---g--cat--cag--ggc--aaa
B D                 Orangutan  gcctgctgggt--gg-agtggc-----ttaaagt-a---g--cat--cag--ggc--aaa
B D                    Gibbon  gcctgctgggt--gg-agtggc-----ttaaagt-a---g--cat--cag--ggc--aaa
B D                    Rhesus  gcctgctgggt--gg-aatggc-----ttaaagt-a---g--cat--cag--ggc--aaa
B D       Crab-eating macaque  gcctgctgggt--gg-aatggc-----ttaaagt-a---g--cat--cag--ggc--aaa
B D              Green monkey  gcctgctgggt--gg-agtggc-----ttaaagt-a---g--cat--cag--ggc--aaa
B D                  Marmoset  gcctgctgggt--gg-agtggc-----ttaaagt-a---g--cat--caggggaa--aaa
B D           Squirrel monkey  gcctgctgggt--gg-agtggc-----ttaaagt-a---g--cat--caggtgga--aaa
B D                  Bushbaby  gcctcctgggt--ggaagtggttgctattaaaat-a---g--caa--cag--ggc--aaa
           Chinese tree shrew  gcttgctgggt--gg-gatggc-----ctaaagt-a---g--caa--tag--ggt--aaa
B D                  Squirrel  actctctatgt---g-gtgggc-----ttaaatt-a---a--cat--caa--agc--aaa
       Lesser Egyptian jerboa  gcctgtcaggt---------------------ag-a---a--tgt--taa--ggc--aaa
                 Prairie vole  actggccaggc--ag-aagggc-----ttaccag-a---a--agt--caa--ggc--aga
B D           Chinese hamster  gcttgccaggt--gg-aagggc-----ttaaaag-c---a--ggt--caa--ggc--aga
B D                     Mouse  acttgagaagc--ag-aagggt-----ttaaaag-a---a--cat--caa--ggc--aga
B D                       Rat  gcctgtgcagt--gg-aagggc-----ctaaaag-a---a--tgt--caa--gcc--agc
B D            Naked mole-rat  atttgctaggt--gg-agcagc-----ttaaagt-t---g--gat--caa--ggc--aaa
B D                Guinea pig  gcttactaaat--ag-actggt-----gtaaagt-g---gcacct--tat--ggc--aaa
                   Chinchilla  gcttactaggc--ag-agtggc-----gtagagt-g---g--cct--tga--gtc--aaa
             Brush-tailed rat  gctcagtaggt--ag-agaggt-----gtaaagt-g---g--ccg--cga--ggc--aaa
B D                    Rabbit  gtttgctgggc--ac-agtggc-----tcaaagt-a---c--cac--cag--ggc--aaa
B D                      Pika  gtttgctgggt--gc-aatgac-----ccaaagt-a---g--cac--tgg--ggc--aaa
B D                    Alpaca  gcttgctgggt--gg-aatgac-----ttcaagc-a---t--cat--cag--ggc---ca
               Bactrian camel  gcttgctgggt--gg-aatgac-----ttcaagc-a---t--cat--cag--ggc---ca
                 Killer whale  gcttgctgggt--gg-aatggc-----ttaaggc-a---g--caa--cag--gcc--aaa
             Tibetan antelope  ccttgttgggt--ag-aatgac-----tcaaagc-a---g--cat--cag--ggc--aaa
B D                       Cow  ccttgttgggt--ag-aatgat-----tcaaaga-a---g--cat--cag--ggc--aaa
B D                     Sheep  cctcgttgggt--ag-agtgac-----tcaaagc-a---g--cat--cag--ggc--aaa
                Domestic goat  ccttgttgggt--ag-aatgac-----tcaaagc-a---g--cat--cag--ggc--aaa
B D                     Horse  gcttgctggat--gg-aatggc-----ttaaag--a---g--cat--cag--ggc--aaa
B D          White rhinoceros  gcttgctgggt--gg-aatggc-----ttaaag--g---g--cat--cag--ggc--aaa
B D                       Cat  gtttgctgtat--gg-agtggc-----ttcaaat-a---g--tac--cgg--ggc-aaaa
B D                       Dog  gcttgttatat--gg-agtggc-----ttcaagt-a---g--tac--cag--ggcaagaa
B D                   Ferret   gcttgctgtaa--gg-agtggc-----ttcaagt-a---g--tac--tag--gga-ggaa
B D                     Panda  gcttgctggat--gg-agtggc-----ttctggt-a---g--cac--cag--ggc--aaa
               Pacific walrus  atttgctgtat--gg-agtggc-----ttcaagt-a---g--tgc--cag--ggc--aaa
             Black flying-fox  gcttgctgaat--gg-agtggc-----ttatagt-a---g--cat--cgg--ttc--aaa
                Big brown bat  gcttcctgggt--ga-agtggc-----ttaaagt-a---g--cat--cag--agc--aaa
         David's myotis (bat)  gcttactgggt--ga-agtggt-----at-aagt-a---g--cat--cag--agc--aaa
B D                  Microbat  gcttactgggt--ga-agtggt-----ttaaagt-a---g--cat--cag--agc--aaa
B D                  Hedgehog  gtctgccaagt--gg-agtagc-----ttcaaat-a---g--tgt--cag--ggt--gaa
B D                     Shrew  acttgttgggt--ag-agt-gc-----tgaaaag-a---g--cat--cag--ggt--aaa
              Star-nosed mole  gcttgctaggt--gg-aatagc-----ttaaaat-a---g--cat--cag--agt--taa
B D                  Elephant  gcttgctggct--ag-agcgtc-----ttaaaagca---g--cat--cag--ggt--aaa
          Cape elephant shrew  gcttgttgaat--aa-gatggc-----ttaaagtcac-ta--cat--act--ttt--taa
B D                   Manatee  gcttgctggct--ag-agtgtc-----ttaaagt-a---g--cat--cag--ggt--aaa
B D                    Tenrec  gcttgcaggat-aaa-agtggc-----ttaaagtgacatg--tgc--cag--tgg--ggc
B D                 Armadillo  tcttgctgggt--ag-agcagc-----ttaaagt-a---g--cat--cag--agc--aaa
B D                   Opossum  -----------------------------ggata-a---a--cat--tgt--ggt--cat
B D           Tasmanian devil  -----------------------------ggata-a---a--cat--tga--gtc--cct
B D                Coelacanth  atgtatttgga--at-atttat-----ttaatag-a---a--aactataa--ggt--a--
B D               Stickleback  ---tcctgcatcgag-ggtagc-----ttaggttca---a--cag--cgg--gcc--aaa
         Princess of Burundi  ============================================================
         Pundamilia nyererei  ============================================================
                 Zebra mbuna  ============================================================
       Burton's mouthbreeder  ============================================================
B D              Nile tilapia  ============================================================
B D                    Medaka  ============================================================
  D  Chinese softshell turtle  ============================================================
B D                    Lizard  ============================================================
  D            Painted turtle  ============================================================
  D    Spiny softshell turtle  ============================================================
B D             X. tropicalis  ============================================================
B D                  Platypus  ============================================================
  D           Green seaturtle  ============================================================
              Golden hamster  ============================================================

Inserts between block 33 and 34 in window
B D           Naked mole-rat 3bp
B D               Guinea pig 14bp

Alignment block 34 of 135 in window, 29357 - 29376, 20 bps 
B D                     Human  aaa------------------------------ggtgtt---aggaattctat
B D                     Chimp  aaa------------------------------ggtgtt---aggaattctat
B D                 Orangutan  aaa------------------------------ggtgtt---aggaattctat
B D                    Gibbon  aaa------------------------------ggtgtt---aggaattccat
B D                    Rhesus  aaa------------------------------gatatt---aggaattctat
B D       Crab-eating macaque  aaa------------------------------gatatt---aggaattctat
B D              Green monkey  aaa------------------------------ggtgtt---aggaattctat
B D                  Marmoset  aaa------------------------------gctgtt---agaaattctat
B D           Squirrel monkey  aaa------------------------------gctgtt---aaaaattctat
B D                  Bushbaby  aa--------------------------------ctgct---ataaattatat
           Chinese tree shrew  gaa------------------------------gtcatc---atgagtgatat
B D                  Squirrel  aaa------------------------------gttgtg---atgaattacat
       Lesser Egyptian jerboa  aa-------------------------------cctgtc---ataaat--tgt
                 Prairie vole  aaa------------------------------cccacc---ataact--ttc
B D           Chinese hamster  aag------------------------------cccacc---ataact--tac
B D                     Mouse  aa------------------------------------------------tcc
B D                       Rat  aa------------------------------------------------tgt
B D            Naked mole-rat  aaa------------------------------gctgtt---atgaatcacat
B D                Guinea pig  aaa------------------------------cctgct---acacatcacac
                   Chinchilla  aaa------------------------------gctgtt---atgagtcacat
             Brush-tailed rat  gaa------------------------------gctgtt---atgagtcaaat
B D                    Rabbit  tat------------------------------g-tttt---ggggactgtat
B D                      Pika  cat--------------------------------tgtt---gggaatcatat
B D                    Alpaca  aaa------------------------------gctgta---atgaattatat
               Bactrian camel  aaa------------------------------gctgta---atgaattatat
                 Killer whale  aaa------------------------------actttt---acgaattatat
             Tibetan antelope  aaa------------------------------gctgtt---gtgaattatat
B D                       Cow  aaa------------------------------gctgtt---atgaattatat
B D                     Sheep  aaa------------------------------gctgtt---atgaattatat
                Domestic goat  aaa------------------------------gctgtt---atgaattatat
B D                     Horse  aaa------------------------------gctgtt---atgaattgtat
B D          White rhinoceros  gaa------------------------------gctgtt---atgaattgaat
B D                       Cat  aag------------------------------gctatt---atgaattacat
B D                       Dog  aaa------------------------------gctatt---ctgaaccatgt
B D                   Ferret   gag------------------------------gctatt---atgaattctat
B D                     Panda  aag------------------------------gctatt---gtgagttatat
               Pacific walrus  aag------------------------------gctatt---atgaattatat
             Black flying-fox  aaa------------------------------gttatc---atgaattatat
                Big brown bat  aac------------------------------gctgta---atgaattatgt
         David's myotis (bat)  aaa------------------------------gctgta---atgaattatgt
B D                  Microbat  aaa------------------------------gctgta---atgaattatgt
B D                  Hedgehog  aaa------------------------------gataat---gtgaatcatat
B D                     Shrew  aag-------------------------------ctatt---atgaattatgt
              Star-nosed mole  gcg--------------------------------------------------
B D                  Elephant  aaa----------------------------aagcagat---gtgaattatat
          Cape elephant shrew  aac----------------------------------------tgaattatat
B D                   Manatee  aaa-----------------------------agctttt---gtgacttacat
B D                    Tenrec  agg----------------------------gagcggat---ctgatttatat
B D                 Armadillo  aaa------------------------------gcagtt---atttattatat
B D                   Opossum  aa------------------------------------------gtatttttt
B D           Tasmanian devil  aggagcttgtgaaagtaatggtcaggcaacggagctgct-----ggattacta
B D                  Platypus  aaa------------------------------tgaatt---agtaaaattat
B D                Coelacanth  aaa------------------------------gtcatttgactaaaattcct
B D               Stickleback  -----------------------------------ttta---aggagatctat
         Princess of Burundi  =====================================================
         Pundamilia nyererei  =====================================================
                 Zebra mbuna  =====================================================
       Burton's mouthbreeder  =====================================================
B D              Nile tilapia  =====================================================
B D                    Medaka  =====================================================
  D  Chinese softshell turtle  =====================================================
B D                    Lizard  =====================================================
  D            Painted turtle  =====================================================
  D    Spiny softshell turtle  =====================================================
B D             X. tropicalis  =====================================================
  D           Green seaturtle  =====================================================
              Golden hamster  =====================================================

Inserts between block 34 and 35 in window
B D              Stickleback 5862bp

Alignment block 35 of 135 in window, 29377 - 29383, 7 bps 
B D                     Human  gtgat------at-----
B D                     Chimp  gtgac------at-----
B D                 Orangutan  gtgac------at-----
B D                    Gibbon  gtgac------at-----
B D                    Rhesus  gtgat------at-----
B D       Crab-eating macaque  gtgat------at-----
B D              Green monkey  gtgat------at-----
B D                  Marmoset  gtggc------at-----
B D           Squirrel monkey  gtgac------at-----
B D                  Bushbaby  gtgtt------at-----
           Chinese tree shrew  gaatc------at-----
B D                  Squirrel  gtgcc------at-----
       Lesser Egyptian jerboa  gtaac------at-----
                 Prairie vole  aagct------gt-----
B D           Chinese hamster  gagct------gt-----
B D                     Mouse  gtgtc------at-----
B D                       Rat  gcgcc------at-----
B D            Naked mole-rat  gtaca------gt-----
B D                Guinea pig  atgca------gt-----
                   Chinchilla  gtgca------gt-----
             Brush-tailed rat  gtgca------gt-----
B D                    Rabbit  gtgct------at-----
B D                      Pika  gtgcc------at-----
B D                    Alpaca  atgcc------at-----
               Bactrian camel  atacc------at-----
                 Killer whale  atgcc------at-----
             Tibetan antelope  atgcc------at-----
B D                       Cow  atgccaattataa-----
B D                     Sheep  atgcc------at-----
                Domestic goat  atgcc------at-----
B D                     Horse  gtgcc------at-----
B D          White rhinoceros  gtgtc------at-----
B D                       Cat  gtgcc------ac-----
B D                       Dog  gtacc------at-----
B D                   Ferret   atggc------at-----
B D                     Panda  gtacc------at-----
               Pacific walrus  atgcc------at-----
             Black flying-fox  atgtt------gt-----
                Big brown bat  atgcc------ac-----
         David's myotis (bat)  atgcc------ac-----
B D                  Microbat  atgcc------ac-----
B D                  Hedgehog  gtgca------ta-----
B D                     Shrew  gtgcc------ta-----
B D                  Elephant  gtgct------at-----
          Cape elephant shrew  atgct------ac-----
B D                   Manatee  gtgct------at-----
B D                    Tenrec  atgct------gt-----
B D                 Armadillo  gtacc------at-----
B D                   Opossum  attta------a------
B D           Tasmanian devil  attca------at-----
B D                  Platypus  gtaat------ag-----
B D                Coelacanth  gtaaa------atgacat
         Princess of Burundi  ==================
         Pundamilia nyererei  ==================
                 Zebra mbuna  ==================
       Burton's mouthbreeder  ==================
B D              Nile tilapia  ==================
B D                    Medaka  ==================
B D               Stickleback  ==================
  D  Chinese softshell turtle  ==================
B D                    Lizard  ==================
  D            Painted turtle  ==================
  D    Spiny softshell turtle  ==================
B D             X. tropicalis  ==================
  D           Green seaturtle  ==================
              Golden hamster  ==================
             Star-nosed mole  ------------------

Inserts between block 35 and 36 in window
B D                 Bushbaby 1bp
          Chinese tree shrew 5bp
B D                   Alpaca 6bp
              Bactrian camel 6bp
                Killer whale 6bp
            Tibetan antelope 6bp
B D                      Cow 6bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                    Horse 28bp
B D         White rhinoceros 6bp
B D                      Cat 6bp
B D                      Dog 5bp
B D                  Ferret  6bp
B D                    Panda 6bp
              Pacific walrus 6bp
            Black flying-fox 6bp
               Big brown bat 6bp
        David's myotis (bat) 6bp
B D                 Microbat 6bp
B D                 Hedgehog 6bp
B D                    Shrew 6bp
B D                 Elephant 10bp
         Cape elephant shrew 11bp
B D                  Manatee 29bp
B D                   Tenrec 121bp
B D                Armadillo 10bp
B D                  Opossum 5bp
B D          Tasmanian devil 7bp

Alignment block 36 of 135 in window, 29384 - 29384, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  c
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  g
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  g
B D                    Rabbit  t
B D                      Pika  t
B D                    Alpaca  c
               Bactrian camel  c
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
             Black flying-fox  c
                Big brown bat  c
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  g
B D                     Shrew  a
B D                  Elephant  t
          Cape elephant shrew  t
B D                    Tenrec  a
B D                 Armadillo  t
B D           Tasmanian devil  t
B D                  Platypus  t
B D                Coelacanth  t
         Princess of Burundi  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
B D                    Medaka  =
B D               Stickleback  =
  D  Chinese softshell turtle  =
B D                    Lizard  =
  D            Painted turtle  =
  D    Spiny softshell turtle  =
B D             X. tropicalis  =
B D                   Opossum  =
  D           Green seaturtle  =
              Golden hamster  =
B D                   Manatee  =
             Star-nosed mole  -
B D                     Horse  =

Inserts between block 36 and 37 in window
B D                 Squirrel 8bp
      Lesser Egyptian jerboa 8bp
                Prairie vole 11bp
B D          Chinese hamster 12bp
B D                    Mouse 12bp
B D                      Rat 12bp
B D           Naked mole-rat 8bp
B D               Guinea pig 7bp
                  Chinchilla 8bp
            Brush-tailed rat 8bp
B D                   Rabbit 394bp
B D                     Pika 65bp

Alignment block 37 of 135 in window, 29385 - 29385, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -t
           Chinese tree shrew  -c
B D           Tasmanian devil  -a
B D                  Platypus  -g
B D                Coelacanth  t-
         Princess of Burundi  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
B D              Nile tilapia  ==
B D                    Medaka  ==
B D               Stickleback  ==
  D  Chinese softshell turtle  ==
B D                    Lizard  ==
  D            Painted turtle  ==
  D    Spiny softshell turtle  ==
B D             X. tropicalis  ==
B D                   Opossum  ==
  D           Green seaturtle  ==
              Golden hamster  ==
B D           Chinese hamster  ==
B D                    Rabbit  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                     Panda  --
B D                      Pika  ==
B D                       Rat  ==
               Big brown bat  --
         Cape elephant shrew  --
B D                  Elephant  --
B D                   Manatee  ==
B D                    Tenrec  --
B D                   Ferret   --
               Domestic goat  --
B D                     Sheep  --
B D                       Cow  --
            Tibetan antelope  --
B D                  Hedgehog  --
            Brush-tailed rat  ==
                Killer whale  --
B D                Guinea pig  ==
B D                 Armadillo  --
             Star-nosed mole  --
B D                     Shrew  --
B D                  Microbat  --
        David's myotis (bat)  --
            Black flying-fox  --
              Pacific walrus  --
B D                       Dog  --
B D                       Cat  --
B D          White rhinoceros  --
B D                     Horse  ==
              Bactrian camel  --
B D                    Alpaca  --
                  Chinchilla  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
B D                  Squirrel  ==

Inserts between block 37 and 38 in window
B D          Tasmanian devil 1289bp

Alignment block 38 of 135 in window, 29386 - 29406, 21 bps 
B D                     Human  atattca-------------tgcagttag-------ttaa-----------g
B D                     Chimp  atattca-------------tgc----ag-------ttaa-----------g
B D                 Orangutan  atatcca-------------tac----ag-------ttaa-----------t
B D                    Gibbon  atattca-------------tac----ag-------ttaa-----------t
B D                    Rhesus  atattca-------------tac----ac-------ttaa-----------t
B D       Crab-eating macaque  atattca-------------tac----ac-------ttaa-----------t
B D              Green monkey  atattca-------------tac----ac-------tta-------------
B D                  Marmoset  ttattca-------------tac----ac-------ctaa-----------t
B D           Squirrel monkey  gtattca-------------tat----ac-------ctaa-----------t
B D                  Bushbaby  ctgttcc-------------aag----tc-------ttaattacagtatttt
           Chinese tree shrew  atgtcct-------------aat----ag-------caga-------atctt
B D                  Squirrel  --acttt-------------ttt----gc-------aaaa-----------t
       Lesser Egyptian jerboa  --gttct-------------tac----ca-------cagt-----------c
                 Prairie vole  --attct-------------tgc----tc-------tggt-----------g
B D           Chinese hamster  --gttct-------------tac----tc-------cagt-----------g
B D                     Mouse  --gttct-------------tac----tg-------cagc-----------c
B D                       Rat  --gttct-------------tac----tg-------cagc-----------t
B D            Naked mole-rat  --attct-------------tat----tg-------caaa-----------a
B D                Guinea pig  --atcct-------------tat----tg-------cgta-----------a
                   Chinchilla  --atcct-------------tat----tg-------caga-----------a
             Brush-tailed rat  --atcct-------------tct----tg-------caga-----------a
B D                      Pika  --gtttttgagtacctgtgatat----tt-------cag-------------
B D                    Alpaca  cattccc-------------aac----tg-------caga-----------a
               Bactrian camel  cattccc-------------aac----tg-------caga-----------a
                 Killer whale  aatcccc-------------agt----tg-------caca-----------a
             Tibetan antelope  aatctcc-------------aat----tg-------caca-----------a
B D                       Cow  aatctcc-------------aat----tg-------caca-----------a
B D                     Sheep  aatctcc-------------aat----tg-------caca-----------a
                Domestic goat  aatctcc-------------aat----tg-------caca-----------a
B D          White rhinoceros  aaatccc-------------act----tg-------cgga-----------a
B D                       Cat  aaatccc-------------agt----tg-------tgga-----------a
B D                       Dog  aaatccc-------------aac----tg-------tggc-----------a
B D                   Ferret   aaatccc-------------aat----tg-------tgga-----------a
B D                     Panda  aaatccc-------------agt----tg-------tgga-----------a
               Pacific walrus  aaatccc-------------aa-----tg-------tgga-----------a
             Black flying-fox  aaatcct-------------aac----tg-------caga-----------a
                Big brown bat  aaatctc-------------aac----tg-------caga-----------a
         David's myotis (bat)  aaatctc-------------aac----tg-------taga-----------a
B D                  Microbat  aaatctc-------------aac----tg-------caga-----------a
B D                  Hedgehog  ------------------------------------caga-----------a
B D                     Shrew  ggctcca-------------aat----ta-------gaga-----------a
              Star-nosed mole  ------------------------------------ggga-----------a
B D                  Elephant  ----cct-------------aat----aa-------tgga-----------a
          Cape elephant shrew  ----cat-------------agt----cg-------tgga-----------a
B D                    Tenrec  ----ccc-------------aac----ca-------taac-----------a
B D                 Armadillo  ----cct-------------aat----tgcacattttaaa-----------a
B D                   Opossum  taccttc-------------tgt----tt-------tag-------------
B D                  Platypus  ------------------agcac----tt-------aaaa-----------a
B D                Coelacanth  acattca--------------------tg-------caaa------------
         Princess of Burundi  ====================================================
         Pundamilia nyererei  ====================================================
                 Zebra mbuna  ====================================================
       Burton's mouthbreeder  ====================================================
B D              Nile tilapia  ====================================================
B D                    Medaka  ====================================================
B D               Stickleback  ====================================================
  D  Chinese softshell turtle  ====================================================
B D                    Lizard  ====================================================
  D            Painted turtle  ====================================================
  D    Spiny softshell turtle  ====================================================
B D             X. tropicalis  ====================================================
B D           Tasmanian devil  ====================================================
  D           Green seaturtle  ====================================================
              Golden hamster  ====================================================
B D                    Rabbit  ====================================================
B D                   Manatee  ====================================================
B D                     Horse  ====================================================

Inserts between block 38 and 39 in window
B D                 Squirrel 3bp
      Lesser Egyptian jerboa 4bp
                Prairie vole 3bp
B D          Chinese hamster 3bp
B D                    Mouse 3bp
B D                      Rat 3bp
B D           Naked mole-rat 4bp
B D               Guinea pig 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp
B D                     Pika 43bp
B D                   Alpaca 7bp
              Bactrian camel 7bp
                Killer whale 7bp
            Tibetan antelope 7bp
B D                      Cow 7bp
B D                    Sheep 7bp
               Domestic goat 7bp
B D         White rhinoceros 4bp
B D                      Cat 4bp
B D                      Dog 4bp
B D                  Ferret  4bp
B D                    Panda 4bp
              Pacific walrus 4bp
            Black flying-fox 7bp
               Big brown bat 7bp
        David's myotis (bat) 7bp
B D                 Microbat 7bp
B D                 Hedgehog 4bp
B D                    Shrew 4bp
             Star-nosed mole 2bp
B D                 Elephant 5bp
         Cape elephant shrew 5bp
B D                   Tenrec 26bp
B D                Armadillo 2bp
B D                 Platypus 2bp

Alignment block 39 of 135 in window, 29407 - 29411, 5 bps 
B D                     Human  aag-----------------------------------------------at
B D                     Chimp  aag-----------------------------------------------at
B D                 Orangutan  aag-----------------------------------------------at
B D                    Gibbon  aag-----------------------------------------------at
B D                    Rhesus  aag-----------------------------------------------at
B D       Crab-eating macaque  aag-----------------------------------------------at
B D              Green monkey  --------------------------------------------------at
B D                  Marmoset  aag-----------------------------------------------at
B D           Squirrel monkey  aag-----------------------------------------------at
B D                  Bushbaby  aag-----------------------------------------------at
           Chinese tree shrew  agg-----------------------------------------------at
B D                  Squirrel  aag-----------------------------------------------at
       Lesser Egyptian jerboa  aag-----------------------------------------------at
                 Prairie vole  aaa-----------------------------------------------at
B D           Chinese hamster  aag-----------------------------------------------at
B D                     Mouse  aag-----------------------------------------------ac
B D                       Rat  aag-----------------------------------------------at
B D            Naked mole-rat  aag-----------------------------------------------at
B D                Guinea pig  aag-----------------------------------------------at
                   Chinchilla  aag-----------------------------------------------at
             Brush-tailed rat  aaa-----------------------------------------------ac
B D                    Rabbit  aag-----------------------------------------------at
B D                      Pika  aagtacagagacacatggtttttcttattgaccttgtatccagtatcttagt
B D                    Alpaca  --c-----------------------------------------------gt
               Bactrian camel  --c-----------------------------------------------gt
                 Killer whale  --------------------------------------------------at
             Tibetan antelope  --------------------------------------------------at
B D                       Cow  --------------------------------------------------at
B D                     Sheep  --------------------------------------------------at
                Domestic goat  --------------------------------------------------at
B D                     Horse  aag-----------------------------------------------at
B D          White rhinoceros  aag-----------------------------------------------at
B D                       Cat  aag-----------------------------------------------at
B D                       Dog  aag-----------------------------------------------at
B D                   Ferret   aag-----------------------------------------------at
B D                     Panda  aag-----------------------------------------------at
               Pacific walrus  aag-----------------------------------------------at
             Black flying-fox  --------------------------------------------------gt
                Big brown bat  --------------------------------------------------at
         David's myotis (bat)  --------------------------------------------------a-
B D                  Microbat  --------------------------------------------------at
B D                  Hedgehog  aag-----------------------------------------------at
B D                     Shrew  aag-----------------------------------------------at
              Star-nosed mole  aag-----------------------------------------------ct
B D                   Opossum  --a-----------------------------------------------at
B D                  Platypus  acc-----------------------------------------------ac
B D                Coelacanth  aag-----------------------------------------------ag
         Princess of Burundi  ====================================================
         Pundamilia nyererei  ====================================================
                 Zebra mbuna  ====================================================
       Burton's mouthbreeder  ====================================================
B D              Nile tilapia  ====================================================
B D                    Medaka  ====================================================
B D               Stickleback  ====================================================
  D  Chinese softshell turtle  ====================================================
B D                    Lizard  ====================================================
  D            Painted turtle  ====================================================
  D    Spiny softshell turtle  ====================================================
B D             X. tropicalis  ====================================================
B D           Tasmanian devil  ====================================================
  D           Green seaturtle  ====================================================
              Golden hamster  ====================================================
         Cape elephant shrew  ====================================================
B D                  Elephant  ====================================================
B D                   Manatee  ====================================================
B D                    Tenrec  ====================================================
B D                 Armadillo  ====================================================

Inserts between block 39 and 40 in window
B D                 Marmoset 2bp
B D          Squirrel monkey 2bp
B D                 Platypus 1bp

Alignment block 40 of 135 in window, 29412 - 29472, 61 bps 
B D                     Human  aaa---tg--------------------------------------------------------------
B D                     Chimp  aaa---tg--------------------------------------------------------------
B D                 Orangutan  aaa---tg--------------------------------------------------------------
B D                    Gibbon  aaa---tg--------------------------------------------------------------
B D                    Rhesus  aaa---tg--------------------------------------------------------------
B D       Crab-eating macaque  aaa---tg--------------------------------------------------------------
B D              Green monkey  aaa---tg--------------------------------------------------------------
B D                  Marmoset  aaa---tg--------------------------------------------------------------
B D           Squirrel monkey  aaa---tg--------------------------------------------------------------
B D                  Bushbaby  aaa-tcta--------------------------------------------------------------
           Chinese tree shrew  aaa---ta--------------------------------------------------------------
B D                  Squirrel  aaa-ttta--------------------------------------------------------------
       Lesser Egyptian jerboa  aca-ttta--------------------------------------------------------------
                 Prairie vole  aaa-ctta--------------------------------------------------------------
B D           Chinese hamster  aaa-ctta--------------------------------------------------------------
B D                     Mouse  aaatttta--------------------------------------------------------------
B D                       Rat  aaa-ttta--------------------------------------------------------------
B D            Naked mole-rat  aaa-ttta--------------------------------------------------------------
B D                Guinea pig  aaa-ttta--------------------------------------------------------------
                   Chinchilla  aaa-ttta--------------------------------------------------------------
             Brush-tailed rat  aaa-ttta--------------------------------------------------------------
B D                    Rabbit  aaa-ttta--------------------------------------------------------------
B D                      Pika  aaa-tttacttaccaatactgggcatttgtctggagattcctttagacattttaatgcacaattcatgct
B D                    Alpaca  aaa-ttta--------------------------------------------------------------
               Bactrian camel  aaa-ttta--------------------------------------------------------------
                 Killer whale  aca-ttta--------------------------------------------------------------
             Tibetan antelope  aaa-ttta--------------------------------------------------------------
B D                       Cow  aaa-ttta--------------------------------------------------------------
B D                     Sheep  aaa-ttta--------------------------------------------------------------
                Domestic goat  aaa-ttta--------------------------------------------------------------
B D                     Horse  aaa-ttta--------------------------------------------------------------
B D          White rhinoceros  aca-ttta--------------------------------------------------------------
B D                       Cat  aaa-ttta--------------------------------------------------------------
B D                       Dog  aaa-ctta--------------------------------------------------------------
B D                   Ferret   -aa-ttta--------------------------------------------------------------
B D                     Panda  aaa-ttca--------------------------------------------------------------
               Pacific walrus  aaa-ttta--------------------------------------------------------------
             Black flying-fox  aaa-ttca--------------------------------------------------------------
                Big brown bat  aaa-ttta--------------------------------------------------------------
         David's myotis (bat)  aaa-atta--------------------------------------------------------------
B D                  Microbat  aaa-ttta--------------------------------------------------------------
B D                  Hedgehog  aaa-ctta--------------------------------------------------------------
B D                     Shrew  aaa-ttta--------------------------------------------------------------
              Star-nosed mole  gaa-tttt--------------------------------------------------------------
B D                  Elephant  aaa-tctg--------------------------------------------------------------
          Cape elephant shrew  aaa-tctg--------------------------------------------------------------
B D                   Manatee  aaa-tctg--------------------------------------------------------------
B D                    Tenrec  ------tg--------------------------------------------------------------
B D                 Armadillo  gaa-ttta--------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D                  Platypus  aca-atta--------------------------------------------------------------
B D                Coelacanth  ----------------------------------------------------------------------
         Princess of Burundi  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D              Nile tilapia  ======================================================================
B D                    Medaka  ======================================================================
B D               Stickleback  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
              Golden hamster  ======================================================================

                        Human  -------------------------------t-tttt---------------------------------
                        Chimp  -------------------------------t-tttt---------------------------------
                    Orangutan  -------------------------------t-tttt---------------------------------
                       Gibbon  -------------------------------t-tttt---------------------------------
                       Rhesus  -------------------------------t-tttt---------------------------------
          Crab-eating macaque  -------------------------------t-tttt---------------------------------
                 Green monkey  -------------------------------t-tttt---------------------------------
                     Marmoset  -------------------------------t-tttt---------------------------------
              Squirrel monkey  -------------------------------t-tttt---------------------------------
                     Bushbaby  -------------------------------t-tttt---------------------------------
           Chinese tree shrew  -------------------------------t-tgct---------------------------------
                     Squirrel  -------------------------------t-tttt---------------------------------
       Lesser Egyptian jerboa  -------------------------------t-tttt---------------------------------
                 Prairie vole  -------------------------------t-tctt---------------------------------
              Chinese hamster  -------------------------------c-tttt---------------------------------
                        Mouse  -------------------------------c-tttt---------------------------------
                          Rat  -------------------------------c-cttt---------------------------------
               Naked mole-rat  ---------------------------------tttc---------------------------------
                   Guinea pig  ---------------------------------tttc---------------------------------
                   Chinchilla  ---------------------------------tttt---------------------------------
             Brush-tailed rat  ---------------------------------tcat---------------------------------
                       Rabbit  -------------------------------t-tttt---------------------------------
                         Pika  ataaatgaatactcgtaattttagttctttgt-ttta---------------------------------
                       Alpaca  -------------------------------a--------------------------------------
               Bactrian camel  -------------------------------a--------------------------------------
                 Killer whale  -------------------------------t---tt---------------------------------
             Tibetan antelope  -------------------------------a---tt---------------------------------
                          Cow  -------------------------------a---tt---------------------------------
                        Sheep  -------------------------------a---tt---------------------------------
                Domestic goat  -------------------------------a---tt---------------------------------
                        Horse  -------------------------------t-tttt---------------------------------
             White rhinoceros  -------------------------------t-tttt---------------------------------
                          Cat  -------------------------------tgtctt---------------------------------
                          Dog  -------------------------------t-ttgt---------------------------------
                      Ferret   -------------------------------t-tttt---------------------------------
                        Panda  -------------------------------t-tttt---------------------------------
               Pacific walrus  -------------------------------t-tttt---------------------------------
             Black flying-fox  -------------------------------t-tttt---------------------------------
                Big brown bat  -------------------------------g-tttc---------------------------------
         David's myotis (bat)  -------------------------------g-tttt---------------------------------
                     Microbat  -------------------------------g-tttc---------------------------------
                     Hedgehog  -------------------------------t-tttt---------------------------------
                        Shrew  -------------------------------t-ttct---------------------------------
              Star-nosed mole  -------------------------------tattct---------------------------------
                     Elephant  -------------------------------t-tttta--------------------------------
          Cape elephant shrew  -------------------------------a-tttt---------------------------------
                      Manatee  -------------------------------t-ttgt---------------------------------
                       Tenrec  -------------------------------a-ttttgctactgttatgaatcaggtgacccctgtgaaa
                    Armadillo  -------------------------------t-tttt---------------------------------
                      Opossum  -------------------------caatact-tcct---------------------------------
                     Platypus  -------------------------------t-tgtt---------------------------------
                   Coelacanth  ---------------------------------catt---------------------------------
          Princess of Burundi  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
                       Medaka  ======================================================================
                  Stickleback  ======================================================================
     Chinese softshell turtle  ======================================================================
                       Lizard  ======================================================================
               Painted turtle  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
               Golden hamster  ======================================================================

                        Human  ----------------------------------------------attttt-ctt--------------
                        Chimp  ----------------------------------------------attttt-ctt--------------
                    Orangutan  ----------------------------------------------a--ttt-ctt--------------
                       Gibbon  ----------------------------------------------a--ttt-ctt--------------
                       Rhesus  ----------------------------------------------a--ttt-ctt--------------
          Crab-eating macaque  ----------------------------------------------a--ttt-ctt--------------
                 Green monkey  ----------------------------------------------a--ttt-ctt--------------
                     Marmoset  ----------------------------------------------a--ttt-ctt--------------
              Squirrel monkey  ----------------------------------------------a--ttt-ctt--------------
                     Bushbaby  ----------------------------------------------a--ttc-ctt--------------
           Chinese tree shrew  ----------------------------------------------t--cct-ctt--------------
                     Squirrel  ----------------------------------------------a--ttt-ctc--------------
       Lesser Egyptian jerboa  ----------------------------------------------a--ttc-ctt--------------
                 Prairie vole  ----------------------------------------------a--tct-ctg--------------
              Chinese hamster  ----------------------------------------------g--ccc-ctg--------------
                        Mouse  ----------------------------------------------a--ttc-ctt--------------
                          Rat  ----------------------------------------------a--ttc-ctt--------------
               Naked mole-rat  ----------------------------------------------a--ttc-att--------------
                   Guinea pig  ----------------------------------------------a--ttc-atg--------------
                   Chinchilla  ----------------------------------------------c--ttc-atg--------------
             Brush-tailed rat  ----------------------------------------------a--ttc-atg--------------
                       Rabbit  ----------------------------------------------a--ttc-ctt--------------
                         Pika  ----------------------------------------------a--atc-cttatgctgtttgtatc
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------a--tt---tt--------------
             Tibetan antelope  ----------------------------------------------a--tt---tt--------------
                          Cow  ----------------------------------------------a--tt---tt--------------
                        Sheep  ----------------------------------------------a--tt---tt--------------
                Domestic goat  ----------------------------------------------a--tt---tt--------------
                        Horse  -------------------------------------------------ttc-ctt--------------
             White rhinoceros  ----------------------------------------------a--ttc-ctt--------------
                          Cat  ----------------------------------------------a--ctc-ctt--------------
                          Dog  ----------------------------------------------a--ttc-ctt--------------
                      Ferret   ----------------------------------------------a--ttc-ctt--------------
                        Panda  ----------------------------------------------a--ttc-ctt--------------
               Pacific walrus  ----------------------------------------------a--ttc-ctt--------------
             Black flying-fox  ----------------------------------------------a--ttc-ttt--------------
                Big brown bat  ----------------------------------------------a--ttc--ct--------------
         David's myotis (bat)  ----------------------------------------------a--ttc--ct--------------
                     Microbat  ----------------------------------------------a--ttc--ct--------------
                     Hedgehog  ----------------------------------------------a--ttt-cat--------------
                        Shrew  ----------------------------------------------a--tat-ctt--------------
              Star-nosed mole  ----------------------------------------------t--tat------------------
                     Elephant  ----------------------------------------------a--ttc-cct--------------
          Cape elephant shrew  ----------------------------------------------a--ttc-ctt--------------
                      Manatee  ----------------------------------------------a--ttc-cct--------------
                       Tenrec  ggagcgttcgatccccaagggggtcgcaacccacaagttgagaacca--ctg-ctt--------------
                    Armadillo  ----------------------------------------------a--ttt-cat--------------
                      Opossum  ----------------------------------------------a--ttggctc--------------
                     Platypus  ----------------------------------------------a--t---atg--------------
                   Coelacanth  ----------------------------------------------g--ctt-ctt--------------
          Princess of Burundi  ======================================================================
          Pundamilia nyererei  ==================================================