Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 243 in window, 141521397 - 141521522, 126 bps 
B D                   Human  ggctgac------ttctgctaaa-tctcatg-acttc-ct-------tccagttagaccggctgctc---
B D                   Chimp  ggctgac------ttctgctaaa-tctcatg-acttc-ct-------tccagttagaccggctgctc---
B D                 Gorilla  ggctgac------ttctgctaaa-tctcatg-ccttc-ct-------tccagttagacctgctgctc---
B D               Orangutan  agctgtc------ttctgctaaa-tctcagg-ccttc-ct-------tccagttagacctgctgctc---
B D                  Gibbon  ggctgac------ttctgctaaa-tctcagg-ccttc-ct-------tccagttagacctgctgctc---
B D                  Rhesus  gggtgac------ttctgctaaa-tctcatg-ccttc-ct-------tccagttagacctgctgctc---
B D     Crab-eating macaque  gggtgac------ttctgctaaa-tctcatg-ccttc-ct-------tccagttagacctgctgctc---
B D                  Baboon  gggtgac------ttctgctaaa-tctcatg-ccttc-cc-------tccagttagacctgctgctc---
B D            Green monkey  ggatgac------ttctgctaaa-tctcatg-ccttc-cc-------tccagtcagacctgctgctc---
B D                Marmoset  ggctgac------ttctgctcaa-tc-cctg-cccgc-ct-------tccagttagacatgctgctc---
B D         Squirrel monkey  ggctgac------ttctgctaac-tctcctg-cctgc-ct-------tccagttagacacgctgctc---
B D                Bushbaby  ggttgat------ctctgctaaa-tc-cata-ccttc-tc-------tccaggtagacaccttgttcccc
         Chinese tree shrew  agctgcc------ttctgctgat-ttt--------------------------------ttctcccc---
B D                Squirrel  ggtggac------ctctgtgaca-tcg-----cctta-gac------agcg-------------ctc---
     Lesser Egyptian jerboa  gaccagt------tta-gttcac-tctgctg-cctcc-tccaccagttctg-------------ttc---
               Prairie vole  ggctacc------tcctgctgaa-tctccca-cgtcc-cac------tgta-------------ccc---
B D         Chinese hamster  ggccatc------tcctgctaaa-tctccca-ccttc-tcc------tgta-------------ccc---
             Golden hamster  ggccagc------tcctgctaaa-tctccca-ccttc-ccc------tgta-------------ccc---
B D                   Mouse  ggccagc------ttctgctgaa-tct-cca-ccttc-ccc------tcca-------------ctc---
B D                     Rat  ggccagc------ttctgctaaa-tct-cca-ccttc-ccc------tcca-------------ctc---
B D          Naked mole-rat  ggctaac------ttct-ctaca-tctcatg-cctcc-cc-------tctagttggactcactgctc---
B D              Guinea pig  agctagc------ttct-ctgca-tctcatg-cctcc-cct------cctagttggactcactgttc---
                 Chinchilla  ggctcac------ttct-ctgca-tctcatg-ccttc-ccg------tctagttggacttactgtct---
           Brush-tailed rat  ggctaac------ttca-cttcc-tctcata-ctttt-gcc------tctagttggacttgttgttc---
B D                     Pig  gggtgac---tttttctaccaaa-ttatgca-ttttc-tct------tcctgttagatatgctgttc---
B D                  Alpaca  ggctgac---tttttctgccaaa-tcacatatttttc-tcc------tccagatagttaggctgctc---
             Bactrian camel  ggctgac---tttttctgccaaa-tcacatatttttc-tcc------tccagatagttaggctgctc---
B D                 Dolphin  gcctgac---tttttctgccaaa-tcacaca-tttcc-tct------tccaattaaatatgctgttc---
               Killer whale  gcctgac---tttttctgccaaa-tcacaca-tttcc-tct------tccaattaaatatgctgttc---
           Tibetan antelope  ggcggacg--tttttttgctaaa-tcacgca-ttttc-tct------tccaattaagtacgctgcta---
B D                     Cow  ggctgacgtttttttttgctaaa-tcacgca-ttttc-tct------tccaattaagtacgctgtta---
B D                   Sheep  ggcggacg-ttttttttgctaaa-tcacgca-ttttc-tct------tccaattaagtatgctgcta---
              Domestic goat  ggcggacg-ttttttttgctaaa-tcacgca-ttttc-tct------tccaattaagtacgctgcta---
B D                   Horse  ggctggc---tttttctgccaaa-tcaaaca-tttttctct------ttcacttagaaatgctgctc---
B D        White rhinoceros  ggctgac---tttttctgccaaa---------------tct------tccagttggaaatgctgctc---
B D                     Cat  ggctgac---gttttctgccaaa-tcacacc-ttttc-tct------tccggttagaaatgctgctc---
B D                     Dog  ggctgac---gacatcttccaaa-tcacacg-ttttc-tct------tccagtcagatgtgctggtc---
B D                 Ferret   gcccgac---acatcttgccaag-tcacaca-ttttc-tct------tccagttaggtatcctggtc---
B D                   Panda  ggctgat---atttcctgccaaa-tcaca-a-ttttc-tct------ttcagttagatatgttggtc---
             Pacific walrus  ggctgac---atttcctgccaaa-ccacaca-ttttc-tct------tccagttagatatgttggtc---
               Weddell seal  ggctgac---atttcctgccaaa-ccacaca-ttttc-tct------tccagttagatatgttggtc---
           Black flying-fox  ggctgga---cgtttttgccaaa-gcaca-t-tttcc-tct------tccagttggaaattctgctc---
B D               Armadillo  ggctggc------ttccggtgaactcacccc-cttcc-cgc------tcccgg----------ggcc---
B D                   Shrew  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Hedgehog  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                 Wallaby  ======================================================================
B D                  Tenrec  ======================================================================
B D                 Manatee  ======================================================================
B D                    Pika  ======================================================================
B D                Elephant  ======================================================================
          Cape golden mole  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
               Spotted gar  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
                  Aardvark  ======================================================================

                      Human  --------------ccacagaaaagcat-ggtcagaaacgaccccaggctggagtctctgtc-ttttgtg
                      Chimp  --------------ccacagaaaagcat-ggtcagaaacgaccccaggctggagtctctgtc-ttttgtg
                    Gorilla  --------------acacagaaaaccat-ggtcagaaaggaccccaggctggagtccctgtc-ttttgtg
                  Orangutan  --------------ccacagaaaagcat-ggtcagaaacgacccctggctggagtctctgtc-ttttgtg
                     Gibbon  --------------ccacagaaaagcat-ggtgagaaacgaccccaggctggagtctctgtc-ttttgtg
                     Rhesus  --------------ccacagaaaagcac-ggtcagaaacgaccccaggctgaagtctctgtc---ttgtg
        Crab-eating macaque  --------------ccacagaaaagcac-ggtcagaaacgaccccaggctgaagtctctgtc---ttgtg
                     Baboon  --------------ccacagaagagcac-ggtcagaaacgacccccggctgaagtctctgtc---ttgtg
               Green monkey  --------------ccacagaaaagcat-ggtcagaaacgaccccaggctgaagtctctgtc---ttgtg
                   Marmoset  --------------ccatagaaaagcat-gatcagaaatggccccaggctggagtctctgtc-tcttgtg
            Squirrel monkey  --------------ccacagaaaagcat-gatcagaaatggccccgggctggagtctctgtc-ttttgtg
                   Bushbaby  ccccccccccccagccaaggagaggcac-agttaggactgggcatggtgtggggtttctgac-ttttgtg
         Chinese tree shrew  --------------ccgcgg--gagcac-agccag-agtggccacgag-tggggcctcag-c-ttccgag
                   Squirrel  --------------cccaggagcagcga-ggtccgaggtggtcacaggatggggtctcggac--tttgcg
     Lesser Egyptian jerboa  --------------acaggaaacatttc-atccca-----gccacagcgtgggctctctttc-ttttgta
               Prairie vole  --------------ccagggagcatgct-gtcttaaag-agctgcggactggggtctctgca-gtttgtg
            Chinese hamster  --------------tcagggagctttct-gtccccaaa-agccatggaat-gggcctctgca-gtttgtg
             Golden hamster  --------------tcagggagcattct-gtccccaaa-agctatggagt-gggcctctgtg-gtttgtg
                      Mouse  --------------ccagaga-----------cca----------------gggcctctatc-atctctg
                        Rat  --------------ccagggaacattct-gtccca----------------gggtctctacc-atttgtg
             Naked mole-rat  --------------ccagagaacagcat-ggtatgaagtggccccggggttgggtctctgcc-ttttgtg
                 Guinea pig  --------------ccagagagcaatat-ggtttgaagtagcca-aaggttggggctctgcc-ttttgtg
                 Chinchilla  --------------cagagagcc-atat-ggtttgaagtggtcacagggttgggtctctgcc-ttttgtg
           Brush-tailed rat  --------------ccagaaagc-atat-ggtttgaagtggcaacagggctgggtctctgcc-ttttgtg
                        Pig  --------------ccggggagaagcta-ggtcagaaatggccacag--caaggc-tctgctctttcacg
                     Alpaca  --------------cctgggagaagctg-catcagaagtggccacag--cgaggcttgtcccctttcgtg
             Bactrian camel  --------------cctgggagaagctc-catcagaagtggccacag--cgaggcttgtgccctttcgtg
                    Dolphin  --------------ccagggagaagctt-ggtcacaaatggccacag--caggtcctctgctgtttcatg
               Killer whale  --------------ccagggagaagctt-ggtcacaaatggccacag--caggtcctctgctgtttcatg
           Tibetan antelope  --------------ctggagagaagcttgggtcagaaatggccacag--caggacctctactctttcatg
                        Cow  --------------ttggagagcagcttgggtcagaaatggccacag--tgggacctctactgtttcatg
                      Sheep  --------------ctggagagaagcttgggtcagaaatggccacag--caggacctctactctttcatg
              Domestic goat  --------------ctggagagaagcttgggtcagaaatggccatag--cgggacctctactctttcatg
                      Horse  --------------ctagggagaagcat-gctcagaaac-------------------tgcccttttgtg
           White rhinoceros  --------------ccagggagaagcat-gctcagaagcagccccgg--gggggcctgtgcccttttgtg
                        Cat  --------------ccatggagaagcac-ggccagaaaa----------atgaacgtttgcccattggta
                        Dog  --------------ccacggaggagcgt-ggtcagaaaa----------actaacgtctgcccttcagtg
                    Ferret   --------------ccatggagaagcat-ggtcagaata----------atgagctgctgtcctttagtg
                      Panda  --------------ccgtggagaagcac-ggtcagaaaa----------atgaacttc------------
             Pacific walrus  --------------ccattgagaagcat-ggtcagaaaa----------atgaacttctaccctttagtg
               Weddell seal  --------------ccatggagaagcat-ggtcagaaaa----------atgaacttctaccctttagtg
           Black flying-fox  --------------ctggggagaagcat-gctcagaaacggccgcgg--cggggcctctgcccttttggg
                  Armadillo  --------------ccagggagaagcac-gggccgaacagcccagag--tgaggcctctgcc-ttgtgtg
                      Shrew  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
                    Wallaby  ======================================================================
                     Tenrec  ======================================================================
                    Manatee  ======================================================================
                       Pika  ======================================================================
                   Elephant  ======================================================================
           Cape golden mole  ======================================================================
            Tasmanian devil  ======================================================================
                   Platypus  ======================================================================
                Spotted gar  ======================================================================
         American alligator  ======================================================================
                    Opossum  ======================================================================
                   Aardvark  ======================================================================

                      Human  taaagcagagtcgataatctg
                      Chimp  taaagcagagtcgataatctg
                    Gorilla  taaagcagagtcgataatctg
                  Orangutan  taaagcagagtggataatctg
                     Gibbon  taaagcagagtggataatctg
                     Rhesus  taaagcagagtcgacaatctg
        Crab-eating macaque  taaagcagagtcgacaatctg
                     Baboon  taaagcagagtcgacaatctg
               Green monkey  taaagcagagtcgacaatctg
                   Marmoset  taaagcagcgtcgataatctg
            Squirrel monkey  taaaggaggctcgataatctg
                   Bushbaby  taaagcacagtcaattatcta
         Chinese tree shrew  gaaagcatcgtcgagaatcgg
                   Squirrel  t-gagcacagtc---------
     Lesser Egyptian jerboa  tctagcctggcc---------
               Prairie vole  gaaagtctggcc---------
            Chinese hamster  taaagcctggcc---------
             Golden hamster  taaagcctggcc---------
                      Mouse  taaagcatggtc---------
                        Rat  gaaagcccggcc---------
             Naked mole-rat  aaaagcacaatt---------
                 Guinea pig  tcaagcacagtt---------
                 Chinchilla  taaagcacagtt---------
           Brush-tailed rat  gaaagtacagtt---------
                        Pig  tgaggcagagttggttgtcta
                     Alpaca  tgaagca-gagtcatcatcta
             Bactrian camel  tgaagca-gagtcatcatcta
                    Dolphin  tgaaccagggttgatcatata
               Killer whale  tgaaccagggttgatcatata
           Tibetan antelope  tgaagcaagggtgatcatctg
                        Cow  tgaggcaagggtgatcatcta
                      Sheep  tgaagcaagggtgatcatctg
              Domestic goat  tgaagcaagggtgatcatctg
                      Horse  taaagc-------agaatct-
           White rhinoceros  taaagcagagttgagaatct-
                        Cat  taaagcagggttgagaatcta
                        Dog  tagagcggggtggaaaacctg
                    Ferret   taaagcaggtttgaaaatcta
                      Panda  ---------------------
             Pacific walrus  taaagcagggttgaaagtcta
               Weddell seal  taaagcagggttgaaagtcta
           Black flying-fox  cggagctgggctgagaacct-
                  Armadillo  gaaagcagggttggtgaccgg
                      Shrew  =====================
        Cape elephant shrew  =====================
                   Hedgehog  =====================
              Big brown bat  =====================
       David's myotis (bat)  =====================
                    Wallaby  =====================
                     Tenrec  =====================
                    Manatee  =====================
                       Pika  =====================
                   Elephant  =====================
           Cape golden mole  =====================
            Tasmanian devil  =====================
                   Platypus  =====================
                Spotted gar  =====================
         American alligator  =====================
                    Opossum  =====================
                   Aardvark  =====================

Inserts between block 1 and 2 in window
B D               Bushbaby 5bp
        Chinese tree shrew 5bp
B D                    Pig 5bp
B D                 Alpaca 5bp
            Bactrian camel 5bp
B D                Dolphin 5bp
              Killer whale 5bp
          Tibetan antelope 5bp
B D                    Cow 5bp
B D                  Sheep 5bp
             Domestic goat 5bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 5bp
B D                    Dog 5bp
B D                Ferret  5bp
B D                  Panda 3bp
            Pacific walrus 5bp
              Weddell seal 5bp
          Black flying-fox 1bp

Alignment block 2 of 243 in window, 141521523 - 141521610, 88 bps 
B D                   Human  -----ttttctcagcat--ctgttc---tgtgc-t-gtgc--------ctgatgctgaggctgggcattc
B D                   Chimp  -----ttttctcagcat--ctgttc---tgtgc-t-gtgc--------ctgatgccgaggctgggcattc
B D                 Gorilla  -----ttttctcagcat--ctgttc---tgtgc-t-gtgc--------ctgatgccgaggctgggcattc
B D               Orangutan  -----ttttctcagcat--ctgttc---tgtgc-t-gtgc--------ctgatgctgaggct-ggcattc
B D                  Rhesus  -----ttttctcagcat--ctgtt--------c-t-gtgc--------ctgatgctgaggctgggcattc
B D     Crab-eating macaque  -----ttttctcagcat--ctgtt--------c-t-gtgc--------ctgatgctgaggctgggcattc
B D                  Baboon  -----ttttctcagcat--ctgtt--------c-t-gtgc--------ctgatgctgaggctgggcattc
B D            Green monkey  -----ttttctcagcat--ctgtt--------c-t-gtgt--------ctgatgctgaggctgggcattc
B D                Marmoset  -----ttttttcagcac--gtgttc---tgtgc-t-gtgc--------ccggtgcagaggctgggtattc
B D         Squirrel monkey  -----ttttctcagcat--gtgttc---tgtgc-t-gtgc--------ccggtgctgaggctgggtattc
B D                Bushbaby  -----ttttctcaacat--tttttc---tgtgc-c-atgc--------tcagtgctgagtctggaca---
         Chinese tree shrew  -----tctttgtggcat--ctgctc---tgtgt-c-ttgg--------cc-atgctg-ggctggaccttc
B D                Squirrel  -----------cagtgt--ctgtgc---tgggc-g-gggtctggtgctgaggtgttgtgttcaga-----
     Lesser Egyptian jerboa  -----------cagtag--ctgttc---tgggc-t-gagt----------gatactgaggctggaggtgt
               Prairie vole  -----------acacac--ctatg----tgcgc-t-aggt----------ggtgttgaggctgtg-----
B D         Chinese hamster  -----------aaacac--ctatgtatgtgagc-t-gagc----------agtgttggggctgtg-----
             Golden hamster  -----------aaacac--ctgtgcacatgtgc-t-cggc----------agtgttgggactggg-----
B D                   Mouse  -----------agacat--ctgca----tatgc-c-aagt----------ggtgttgaggctgtg-----
B D                     Rat  -----------agacat--ctgca----tgcat-c-aagt----------tgccttgagtctgag-----
B D          Naked mole-rat  -----------tagcat--cggt-----tctgtgg-gagg------------------------------
B D              Guinea pig  -----------cagcat--ctg------tctgc-a-gagg------------------------------
                 Chinchilla  --------------cgt--ctgt-----tctgc-a-gagg------------------------------
           Brush-tailed rat  -----------cagcat--ctgt-----tctgc-a-gagg------------------------------
B D                     Pig  -----tctcctgaccac--ccactc---act-g-t-gggg--------ctggtgctgggaccaagcactc
B D                  Alpaca  -----tctcctgatc-c--ccactc---agagc-c-gggg--------ccagtgctggggttgagagccc
             Bactrian camel  -----tctcctgatc-c--ccactc---agggc-c-gggg--------ccagtgctggggttgagagccc
B D                 Dolphin  -----tctgctgaccac--ccactc---agtgc-t-gggt--------ccagtgctagggcagagcattt
               Killer whale  -----tctgctgaccac--ccactc---agtgc-t-gggt--------ccagtgctagggcagagcattt
           Tibetan antelope  -----tctcctgaccac--ccactc---agt---------------------------------------
B D                     Cow  -----tctcctgacctc--ccactc---agtga-g-g--------------------gggcggggcattc
B D                   Sheep  -----tctcctgaccac--ccactc---agt---------------------------------------
              Domestic goat  -----tctcctgaccac--ccactc---agt---------------------------------------
B D                   Horse  -----ttttctgagtgc--ctgctg---gttgt-g-gggt--------ccagttctggggctgagcatcc
B D        White rhinoceros  -----tttgctgagcgc--ctgctt---ggtgt-g-gggc--------ccagttctggggccgagcattc
B D                     Cat  -----ttttttgagcac--ctgctc---agtgc-t-gggt--------ccagttctggggctgagcgttc
B D                     Dog  -----tgttctgagcacggggggca---ggtgc-t-gggt--------ccagtgctggggccgagcgttc
B D                 Ferret   -----tcttttgagcac--cagctt---ggtgc-tgggct--------ccagggctggggctgagtgttt
B D                   Panda  -----ttttttgagcac--cggctc---agtgc-t-ggct--------ccagtgctggggctcagtgttc
             Pacific walrus  -----ttttttga-cac--cagctc---ggtgc-t-ggct--------ccactgctggggctgagtgttc
               Weddell seal  -----ttttttgagcac--cagctc---agtgc-t-ggct--------ccattgctggggctgagtgttc
           Black flying-fox  -----tttcctggg-ac--ctgctc---tctgc-a-gggt--------ccagtgctggagccaggc-ctc
B D               Armadillo  cggtgcgaacagagctc--ctgctc---agggc-g-gggt--------ccagccctggggcgggacatcc
B D                   Shrew  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Hedgehog  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                 Wallaby  ======================================================================
B D                  Tenrec  ======================================================================
B D                 Manatee  ======================================================================
B D                    Pika  ======================================================================
B D                Elephant  ======================================================================
          Cape golden mole  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
               Spotted gar  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
                  Aardvark  ======================================================================
B D                  Gibbon  ----------------------------------------------------------------------

                      Human  acg-gagggaagatgct-tcctgcctccaggagctggcag
                      Chimp  acg-gagggaagatgct-tcctgcctccaggagctggcag
                    Gorilla  acg-gaaggaagatgct-tcctgcctccaggagctggcag
                  Orangutan  aca-gagggaagatgct-tcctgccaccaggagctggcag
                     Rhesus  atg-gagggaagctgct-tcctgccaccaggagctggcag
        Crab-eating macaque  atg-gagggaagctgct-tcctgccaccaggagctggcag
                     Baboon  atg-gagggaagctgct-tcctgccaccaggagctggcag
               Green monkey  atg-gagggaagctgct-tcctgccactaggagctggcag
                   Marmoset  acg-gagggaagatgct-tcctgcttccaggagctggcag
            Squirrel monkey  acg-gagggaagatgct-tcctgctgccaggagctggcag
                   Bushbaby  ----gagaggggatg---tcctgcctcaaggagcctgcag
         Chinese tree shrew  agg-aagggaaga-----ccctgccccaaggagctccaag
                   Squirrel  ---------gacgaccc-cccagcctctcagagctctcca
     Lesser Egyptian jerboa  g-g-gaagtgaggaaac-ccttgcctctagatgttctcaa
               Prairie vole  ---------aaggtagc-ttcagccttgaggagctctcag
            Chinese hamster  ---------aaggcagc-ttcagcctcaaggagctctcag
             Golden hamster  ---------aaggcagc-ttcggcctctaggggctcttag
                      Mouse  ---------aaggtcga-ttctgcctctaggagctctgag
                        Rat  ---------aaggtaga-ttctgcctctaggagctggtgg
             Naked mole-rat  ---------aagacacc-tcctccctcaaggagctcttgg
                 Guinea pig  ---------atgacttc-tcctctctcaaggagctctttg
                 Chinchilla  ---------aagacatc-tcttctctcaaggagctctttg
           Brush-tailed rat  ---------aagatatc-tcctacctcaaggagccctttg
                        Pig  agg-gagggaag--actggcctgtatcaagaagcccacag
                     Alpaca  agg-gaggcgag--act-tcctgcatcaagcagcccacga
             Bactrian camel  agg-gaggcgag--act-tcctgcatcaagcagcccacgg
                    Dolphin  gga-gagggaag--act-tcctgcatcaagaagcccctgg
               Killer whale  gga-gagggaag--act-tcctgcatcaagaagcccctgg
           Tibetan antelope  ----gtgggaag--act-tcctgcatcaagaaacctgtgg
                        Cow  gggggtgggaag--act-tcctgcatc-agaaacctgtgg
                      Sheep  ----gtgggaag--act-tcctgcatcaagaaacccgtgg
              Domestic goat  ----gtgggaag--act-tcctgcatcaagaaacctgtgg
                      Horse  agg-cagggaagacact-gcctgcatcaaggggctcatgg
           White rhinoceros  ggg-gagggaagacact-gcctgtgtcaaggagctcatgg
                        Cat  agg-gagggaagacact-gcctgcgtcaaggagctcaggg
                        Dog  agg-cgggggaggcgc------------------------
                    Ferret   ggg-gagggaagacacc-gcctgcatgaaggagctcgggg
                      Panda  agg-aagga-agacact-gcatacatggagaagctcaggt
             Pacific walrus  agg-gaggagaaacact-gcctacatgaagaagctcgggg
               Weddell seal  agg-gaggaaagacact-gcccacatgaagaagctcgggg
           Black flying-fox  agg---gggaggacaca-gcctgcaccaaggagcgcgtgc
                  Armadillo  ag--gagggaccacgcc-ctctgcctcaagcagctcacgg
                      Shrew  ========================================
        Cape elephant shrew  ========================================
                   Hedgehog  ========================================
              Big brown bat  ========================================
       David's myotis (bat)  ========================================
                    Wallaby  ========================================
                     Tenrec  ========================================
                    Manatee  ========================================
                       Pika  ========================================
                   Elephant  ========================================
           Cape golden mole  ========================================
            Tasmanian devil  ========================================
                   Platypus  ========================================
                Spotted gar  ========================================
         American alligator  ========================================
                    Opossum  ========================================
                   Aardvark  ========================================
                     Gibbon  ----------------------------------------

Alignment block 3 of 243 in window, 141521611 - 141521625, 15 bps 
B D                   Human  ----------at-ggagggct---gg----gag
B D                   Chimp  ----------at-ggagggct---gg----gag
B D                 Gorilla  ----------at-ggagggct---gg----gag
B D               Orangutan  ----------at-ggagggct---gg----gag
B D                  Rhesus  ----------ac-ggagggct---gg----gag
B D     Crab-eating macaque  ----------ac-ggagggct---gg----gag
B D                  Baboon  ----------ac-ggagggct---gg----gag
B D            Green monkey  ----------ac-ggagggct---gg----gag
B D                Marmoset  ----------at-ggagggct---gg----gag
B D         Squirrel monkey  ----------at-ggagggct---gg----gag
B D                Bushbaby  ----------ac-ggagga-g---ga----gaa
         Chinese tree shrew  ----------ac-g----------gg----gtg
B D                Squirrel  ----------gt-gcggggtg---gg-cg----
     Lesser Egyptian jerboa  ----------at-gggggttg---gg-aa----
               Prairie vole  ----------at-ggaggtgg---ga-a-----
B D         Chinese hamster  ----------at-gaggatat---gg-agg---
             Golden hamster  ----------gt-gggggtgt---gg-agc---
B D                   Mouse  ----------ag-gagggcat------------
B D                     Rat  ----------at-gagggcat------------
B D          Naked mole-rat  ----------ag-agttgcgg---ga-------
B D              Guinea pig  ----------ag-catggcgg---ga-------
                 Chinchilla  ----------ag-gatggggg---ga-------
           Brush-tailed rat  ----------ag-gatggcgg---gag------
B D                  Alpaca  ----------gt-tgggggtt--ggt-------
             Bactrian camel  ----------gt-tgggggtt--ggc-------
B D                 Dolphin  ----------gc-tgggggtt-ggga-------
               Killer whale  ----------gc-tgggggtt-ggga-------
           Tibetan antelope  ----------gt-ggggcctt-ggga-------
B D                     Cow  ----------gtgggggagtc-ggga-------
B D                   Sheep  ----------gt-ggggcctt-ggga-------
              Domestic goat  ----------gt-ggggcctt-gggg-------
B D                   Horse  ----------ac-tgggggctgggca-------
B D        White rhinoceros  ----------at-ttggggttgggtg-------
B D                     Cat  ----------at-tgggggttgggag-------
B D                     Dog  ---------------agggttgggag-------
B D                 Ferret   ----------ac-tgggagtgcgggg-------
B D                   Panda  ----------ac-tgggggctgggag-------
             Pacific walrus  ----------gt-tgggggtt---ag-------
               Weddell seal  ----------at-tgggggttgggag-------
           Black flying-fox  ----------gc-tggcggtcggcgg-------
B D               Armadillo  ccggggcggggc-aggag---------------
B D                   Shrew  =================================
       Cape elephant shrew  =================================
B D                Hedgehog  =================================
             Big brown bat  =================================
      David's myotis (bat)  =================================
B D                 Wallaby  =================================
B D                  Tenrec  =================================
B D                 Manatee  =================================
B D                    Pika  =================================
B D                Elephant  =================================
          Cape golden mole  =================================
B D         Tasmanian devil  =================================
B D                Platypus  =================================
               Spotted gar  =================================
B D      American alligator  =================================
B D                 Opossum  =================================
                  Aardvark  =================================
B D                     Pig  =================================
B D                  Gibbon  ---------------------------------

Inserts between block 3 and 4 in window
B D               Squirrel 11bp
B D        Chinese hamster 1156bp
            Golden hamster 6bp

Alignment block 4 of 243 in window, 141521626 - 141521649, 24 bps 
B D                   Human  ggtgtcaagacaacagactg-cccg
B D                   Chimp  ggtgtcaagacaacagactg-cccg
B D                 Gorilla  ggtgtcaagacaacagactg-cccg
B D               Orangutan  ggtatcaagacaacagacag-cccg
B D                  Rhesus  gatatcaagacaataggctg-cccg
B D     Crab-eating macaque  gatatcaagacaataggctg-cccg
B D                  Baboon  ggtatcaagacaataggctg-cccg
B D            Green monkey  ggtatcaagacaataggctg-cccg
B D                Marmoset  ggtat---gacaagacactt-cccg
B D         Squirrel monkey  ggcattaagacaagacactg-ccca
B D                Bushbaby  ggcatccagatgacacacta-cttg
         Chinese tree shrew  ggcatgaaggtggctc-ctg-ctct
B D                Squirrel  ggcaccctctcactg--------cg
B D          Naked mole-rat  ggtatcaagacagtg--------ct
B D              Guinea pig  ggtatcaagatggtg--------tt
                 Chinchilla  ggtatcaataccatg--------ct
           Brush-tailed rat  ggtatcaagactgtg--------ct
B D                  Alpaca  gacattaggaca------tc-tgct
             Bactrian camel  gatatcaggaca------tc-tgct
B D                 Dolphin  gacatcaggaca------tc-tgct
               Killer whale  gacatcaggaca------tc-tgct
           Tibetan antelope  gac-ccaggacc------tc-tgct
B D                     Cow  ggcgtcaggacc------tcttgct
B D                   Sheep  gac-ccaggacc------tc-tgct
              Domestic goat  gac-ccaggact------tc-tgct
B D                   Horse  gacatcagaaca--a--ccc-cgct
B D        White rhinoceros  ggcatcagaacagcg--ccc-tgct
B D                     Cat  gacatcaggacaacg--ccc-tgcc
B D                     Dog  gatgtcaggacatcg--cc--tgcc
B D                 Ferret   gacatcaggacagca--ccc-tgcc
B D                   Panda  gacatcagcacaaca--ccc-tctc
             Pacific walrus  gacatgaggacaaca--ccc-tgcc
               Weddell seal  gacatgaggacaaca--cct-tgcc
           Black flying-fox  gacgccaggacgaca--tcc-tgct
B D               Armadillo  gatgtcaccgcaacgtcctg-ctct
B D                   Shrew  =========================
B D                     Rat  -------------------------
B D                   Mouse  -------------------------
       Cape elephant shrew  =========================
              Prairie vole  -------------------------
B D                Hedgehog  =========================
             Big brown bat  =========================
      David's myotis (bat)  =========================
B D                 Wallaby  =========================
    Lesser Egyptian jerboa  -------------------------
B D                  Tenrec  =========================
            Golden hamster  =========================
B D         Chinese hamster  =========================
B D                 Manatee  =========================
B D                    Pika  =========================
B D                Elephant  =========================
          Cape golden mole  =========================
B D         Tasmanian devil  =========================
B D                Platypus  =========================
               Spotted gar  =========================
B D      American alligator  =========================
B D                 Opossum  =========================
                  Aardvark  =========================
B D                     Pig  =========================
B D                  Gibbon  -------------------------

Alignment block 5 of 243 in window, 141521650 - 141521688, 39 bps 
B D                   Human  cattgccccttgaa-caacagcctggg----caat-tcct----------c-ct-a--g
B D                   Chimp  cattgccccttgaa-caacagcctggg----caat-gctt----------c-ct-a--g
B D                 Gorilla  cattgccccttgaa-caacagcctggg----caat-gcct----------c-ct-a--g
B D               Orangutan  cattgccccttgga-caacagcctggg----caag-gcct----------c-ct-g--g
B D                  Rhesus  cattgccccctgga-cgactgcctggg----caat-gtct----------c-ct-g--g
B D     Crab-eating macaque  cattgccccctgga-cgactgcctggg----caat-gtct----------c-ct-g--g
B D                  Baboon  cattgccccttgga-cgactacctggg----caat-ctct----------c-ct-g--g
B D            Green monkey  cattgccccctgga-cgactgcctggg----caat-gtct----------c-ct-g--g
B D                Marmoset  cattgctccttgga-tgagagcctggg----taat-gcct----------c-ct-g--g
B D         Squirrel monkey  cattgccccttgaa-tgagagcctggg----taat-gcct----------c-ct-g--g
B D                Bushbaby  c--tggtccttgga-tgagaacctggg----taat-tctt----------c-ct-g--a
         Chinese tree shrew  c--tgccccctgga-cgagagcctggc----ca-----cc----------c-ct-----
B D                Squirrel  ccttg------gac-a-agggcctggg----ccgc-actc----------c-tg-g---
     Lesser Egyptian jerboa  -------------------ggattaag----caat-ccct----------t-ct-ga--
               Prairie vole  -------------------atcctgggcagtcagt-cctt----------c-cg-g---
             Golden hamster  -------------------atcttggg----cagt-cctt----------c-ct-g---
B D                   Mouse  ------------------ggtggcagg----aagg-cctgctcagcccttc-ct-g---
B D                     Rat  ------------------ggtggtagg----aagg-ccta----------c-ct-g---
B D          Naked mole-rat  ccttgcttcttgga-c-aaggcctagg----caat-ccct----------c-ct-g-g-
B D              Guinea pig  catggctcccaaga-c-aaagcctagg----taat-tcc-------------ct-g-g-
                 Chinchilla  cattgctccaggga-c-aaaacccagg----caat-ccct----------g-ct-g-g-
           Brush-tailed rat  cattgctcctgcaa-c-aaaatctagg----cagt-tgct----------c-ct-g-c-
B D                  Alpaca  cgctgccccttgga-tgagtgtctggg----cagg-ccct----------c-ct-g---
             Bactrian camel  cgctaccccttgga-tgagtgtctggg----cagg-ccct----------c-ct-g---
B D                 Dolphin  cgttgccccttaga-cgcgtgtctggg----cagtgcctt----------c-tg-g---
               Killer whale  cgttgccccttaga-tgcgtgtctggg----cagtgcctt----------c-tg-g---
           Tibetan antelope  cattgctccttgga-tgagtgtctggg----cagc-ccct----------c-cc-g---
B D                     Cow  ccttgccccttgga-tgagcgtctggg----cagc-ccct----------t-cg-g---
B D                   Sheep  cattgccccttgga-tgagtgtctggg----cagc-ccct----------c-cc-a---
              Domestic goat  cattgccccttgga-tgagtgtctggg----cagc-ccct----------c-cc-g---
B D                   Horse  cactgtcctctcga-tgaaagcctggg----cagt-ccct----------c-tg-g---
B D        White rhinoceros  ctttacccctttga-cgagagcctggg----cagt-ccct----------c-tg-g---
B D                     Cat  cattgtcccttaga-tgag-------------agc-tgct----------ctgg-g---
B D                     Dog  tgtcaccccttaga-tgagcgcgtggg----cagt-cgct----------g--------
B D                 Ferret   c-ctgtctctggga-tgagcgcgtagg----cagc-tgct----------gttg-g---
B D                   Panda  cgttgtcgcttcga-tgaaagtgtggg----cagc-tgct----------g-tg-g---
             Pacific walrus  tgctgtcccttcag-tgagagtgtggg----cagt-tgca----------gctg-g---
               Weddell seal  cgctgtcccttcag-tgagagtgtggg----cagt-tgct----------ggtg-g---
           Black flying-fox  c-------ctggca-cgggagcctggg----cggc-tctc----------c-gg-g---
B D                Elephant  cagtgtcctttaga-tgagggcctgaa----cact-ccct----------c-cc-a---
B D                 Manatee  cactgccccttcga-taagggcctgca----cact-ccct----------c-cc-a---
                   Aardvark  cactgtcctttaga-tgggggcctcca----tagt-ccct----------c-gc-a---
B D               Armadillo  --ttgcccctgggactgagagcctggg----cagt-ccct----------c-ctgg---
B D                   Shrew  ===========================================================
       Cape elephant shrew  ===========================================================
B D                Hedgehog  ===========================================================
             Big brown bat  ===========================================================
      David's myotis (bat)  ===========================================================
B D                 Wallaby  ===========================================================
B D                  Tenrec  ===========================================================
B D         Chinese hamster  ===========================================================
B D                    Pika  ===========================================================
          Cape golden mole  ===========================================================
B D         Tasmanian devil  ===========================================================
B D                Platypus  ===========================================================
               Spotted gar  ===========================================================
B D      American alligator  ===========================================================
B D                 Opossum  ===========================================================
B D                     Pig  ===========================================================
B D                  Gibbon  -----------------------------------------------------------

Inserts between block 5 and 6 in window
B D                    Dog 1bp

Alignment block 6 of 243 in window, 141521689 - 141521695, 7 bps 
B D                   Human  g-actcag
B D                   Chimp  g-actcag
B D                 Gorilla  g-actcag
B D               Orangutan  g-actcag
B D                  Rhesus  g-actcag
B D     Crab-eating macaque  g-actcag
B D                  Baboon  g-actcag
B D            Green monkey  g-actcag
B D                Marmoset  g-actcag
B D         Squirrel monkey  g-actcag
B D                Bushbaby  a-------
B D                Squirrel  g-cgt---
     Lesser Egyptian jerboa  a-cctcag
               Prairie vole  g-cctccg
             Golden hamster  g-tctcag
B D                   Mouse  a-cctcag
B D                     Rat  a-cctcaa
B D              Guinea pig  t-cctcag
                 Chinchilla  t-ccccag
           Brush-tailed rat  a-ccccag
B D                  Alpaca  gcattcag
             Bactrian camel  gcactcag
B D                 Dolphin  g-acacag
               Killer whale  g-acacag
           Tibetan antelope  g-acgcag
B D                     Cow  g-acgcag
B D                   Sheep  g-acgcag
              Domestic goat  g-acgcag
B D                   Horse  g-actcag
B D        White rhinoceros  g-actcag
B D                     Cat  g-actcag
B D                 Ferret   g-atccaa
B D                   Panda  g-actca-
             Pacific walrus  g-actcgg
               Weddell seal  g-actcag
           Black flying-fox  a-actcag
B D                Elephant  g-cctcag
B D                 Manatee  g-ctgcag
                   Aardvark  g-ccccgg
B D               Armadillo  g-acctgg
B D                   Shrew  ========
       Cape elephant shrew  ========
B D                Hedgehog  ========
             Big brown bat  ========
      David's myotis (bat)  ========
B D                 Wallaby  ========
B D                  Tenrec  ========
B D         Chinese hamster  ========
B D          Naked mole-rat  --------
B D                     Dog  ========
B D                    Pika  ========
        Chinese tree shrew  --------
          Cape golden mole  ========
B D         Tasmanian devil  ========
B D                Platypus  ========
               Spotted gar  ========
B D      American alligator  ========
B D                 Opossum  ========
B D                     Pig  ========
B D                  Gibbon  --------

Inserts between block 6 and 7 in window
    Lesser Egyptian jerboa 244bp
              Prairie vole 1bp
            Golden hamster 1bp
B D                  Mouse 1bp
B D                    Rat 1bp
B D             Guinea pig 1bp
                Chinchilla 1bp
          Brush-tailed rat 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp

Alignment block 7 of 243 in window, 141521696 - 141521703, 8 bps 
B D                   Human  -tttccc----tg
B D                   Chimp  -tttccc----tg
B D                 Gorilla  -tttccc----tg
B D               Orangutan  -tttccc----tg
B D                  Rhesus  -cttcct----tg
B D     Crab-eating macaque  -cttcct----tg
B D                  Baboon  -cttcct----tg
B D            Green monkey  -cttcct----tg
B D                Marmoset  -tttccc----tg
B D         Squirrel monkey  -tttccc----tg
         Chinese tree shrew  -----cc----ag
B D                Squirrel  -tccccc----tg
               Prairie vole  -ttcccc----tg
             Golden hamster  -ttcccc----tg
B D                   Mouse  -ttcccctaatcg
B D                     Rat  -ttcctc----ag
B D              Guinea pig  -ttctcc----t-
                 Chinchilla  -tccttc----tg
           Brush-tailed rat  -ttctcc----tg
B D                  Alpaca  -ctcccc----tg
             Bactrian camel  -ctcccc----tg
B D                 Dolphin  -gtctct----tg
               Killer whale  -gtctct----tg
           Tibetan antelope  -gcctcc----tg
B D                     Cow  -gtctcc----tg
B D                   Sheep  -gcctcc----tg
              Domestic goat  -gcgtcc----tg
B D                   Horse  -ttctcc-----t
B D        White rhinoceros  -ttct-------g
B D                     Cat  -tc-tcc----tg
B D                     Dog  -tt----------
B D                 Ferret   -tccttc----tg
B D                   Panda  -ttctgc----tg
             Pacific walrus  -ttcttc----tg
               Weddell seal  -ttcttc----tg
           Black flying-fox  -tctctc-----g
B D                Elephant  catc---------
B D                 Manatee  cttctgc----t-
                   Aardvark  cttctcc----t-
B D               Armadillo  tttctcc----c-
B D                   Shrew  =============
       Cape elephant shrew  =============
B D                Hedgehog  =============
             Big brown bat  =============
      David's myotis (bat)  =============
B D                 Wallaby  =============
    Lesser Egyptian jerboa  =============
B D                  Tenrec  =============
B D         Chinese hamster  =============
B D          Naked mole-rat  -------------
B D                    Pika  =============
          Cape golden mole  =============
B D         Tasmanian devil  =============
B D                Platypus  =============
               Spotted gar  =============
B D                Bushbaby  -------------
B D      American alligator  =============
B D                 Opossum  =============
B D                     Pig  =============
B D                  Gibbon  -------------

Inserts between block 7 and 8 in window
B D                Manatee 1bp
                  Aardvark 1bp

Alignment block 8 of 243 in window, 141521704 - 141521704, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D         Squirrel monkey  c
         Chinese tree shrew  c
B D                Squirrel  c
               Prairie vole  t
             Golden hamster  t
                 Chinchilla  t
           Brush-tailed rat  t
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
           Tibetan antelope  c
B D                     Cow  c
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  c
B D        White rhinoceros  c
B D                     Cat  c
B D                 Ferret   c
B D                   Panda  c
             Pacific walrus  c
               Weddell seal  c
           Black flying-fox  c
B D                 Manatee  a
           Cape golden mole  c
                   Aardvark  c
B D                   Shrew  =
B D                     Rat  -
B D                   Mouse  -
       Cape elephant shrew  =
B D                Hedgehog  =
             Big brown bat  =
      David's myotis (bat)  =
B D                 Wallaby  =
    Lesser Egyptian jerboa  =
B D                  Tenrec  =
B D         Chinese hamster  =
B D              Guinea pig  -
B D          Naked mole-rat  -
B D               Armadillo  -
B D                     Dog  -
B D                    Pika  =
B D                Elephant  -
B D         Tasmanian devil  =
B D                Platypus  =
               Spotted gar  =
B D                Bushbaby  -
B D      American alligator  =
B D                 Opossum  =
B D                     Pig  =
B D                  Gibbon  -

Alignment block 9 of 243 in window, 141521705 - 141521717, 13 bps 
B D                   Human  ttccctcca--tc--a-c
B D                   Chimp  ttccctcca--tc--a-c
B D                 Gorilla  ttccctcca--cc--a-c
B D               Orangutan  ttccctcca--tc--a-c
B D                  Rhesus  tcccctcca--tc--a-c
B D     Crab-eating macaque  tcccctcca--tc--a-c
B D                  Baboon  tcccctcca--tc--a-c
B D            Green monkey  tcccctcca--tc--a-c
B D                Marmoset  tcccctcca--tc--a-c
B D         Squirrel monkey  tcccctctg--tc--a-c
B D                Bushbaby  ccccctcca--cc--a-c
         Chinese tree shrew  tcccttcca--tc--a-c
B D                Squirrel  ----tctcc--tc--a-c
               Prairie vole  ggcccctca--tt--a-c
             Golden hamster  ----tctta--tt--a-c
B D                   Mouse  ----cctca--tt--a-c
B D                     Rat  ----cctcc--tt--a-c
B D              Guinea pig  ------tca--tt--g-c
                 Chinchilla  tccccctca--tt--g-c
           Brush-tailed rat  tcccccaca--tt--g-c
B D                  Alpaca  tgccctcca--tcac---
             Bactrian camel  tgccctcca--tcgt---
B D                 Dolphin  tgccctcca--cc-----
               Killer whale  tgccctcca--cc-----
           Tibetan antelope  tgccttcc---tc-----
B D                     Cow  tgccctcc---tt-----
B D                   Sheep  tgcctttc---tc-----
              Domestic goat  cgcctttc---tc-----
B D                   Horse  ttccctccc--tc--a-c
B D        White rhinoceros  ttccctccc--tc--a-c
B D                     Cat  ctctttgca--tt--g-c
B D                     Dog  --------g--tc--c-c
B D                 Ferret   ctctctccg--cc--c-c
B D                   Panda  tgctctcca--tc--t-c
             Pacific walrus  ctctctcca--tc--c-c
               Weddell seal  ctctctcca--tc--c-c
           Black flying-fox  tcccgtcca--tc--c-c
B D                Hedgehog  tttcttccagctc-----
B D                Elephant  --------a--tc--a--
B D                 Manatee  ttccctctg--tc--ac-
           Cape golden mole  ttccctcca--tc--ac-
                   Aardvark  tgcccccca--cc--a--
B D               Armadillo  attccccca--tc--a--
B D                   Shrew  ==================
       Cape elephant shrew  ==================
             Big brown bat  ==================
      David's myotis (bat)  ==================
B D                 Wallaby  ==================
    Lesser Egyptian jerboa  ==================
B D                  Tenrec  ==================
B D         Chinese hamster  ==================
B D          Naked mole-rat  ------------------
B D                    Pika  ==================
B D         Tasmanian devil  ==================
B D                Platypus  ==================
               Spotted gar  ==================
B D      American alligator  ==================
B D                 Opossum  ==================
B D                     Pig  ==================
B D                  Gibbon  ------------------

Inserts between block 9 and 10 in window
B D                 Alpaca 103bp
            Bactrian camel 33bp

Alignment block 10 of 243 in window, 141521718 - 141521730, 13 bps 
B D                   Human  aca--gaga--g--agcca
B D                   Chimp  aca--gaga--g--agcca
B D                 Gorilla  aca--gaga--g--agcca
B D               Orangutan  aca--gata--g--agcca
B D                  Rhesus  at----aga--g--agcca
B D     Crab-eating macaque  at----aga--g--agcca
B D                  Baboon  at----aga--g--agcca
B D            Green monkey  ata--gaga--g--agcca
B D                Marmoset  aga--gagagcg--agcca
B D         Squirrel monkey  aga--gaga--g--agcca
B D                Bushbaby  aca--cagg--g--ag---
         Chinese tree shrew  cga---gca--g--agccc
B D                Squirrel  acc--gaga--gcca----
               Prairie vole  aca--gggg--g--agta-
             Golden hamster  aca-ggggg--g--agca-
B D                   Mouse  aca--gtgg--a--gg---
B D                     Rat  aca--gttg--g--gg---
B D              Guinea pig  aca--ggga--g--agcca
                 Chinchilla  aca--ggga--g--aacca
           Brush-tailed rat  aca--ggga--g--agcca
B D                  Alpaca  acg--gaga--g--agcca
             Bactrian camel  acg--gaga--g--agcca
B D                 Dolphin  aca--ggga--g--agcca
               Killer whale  aca--ggga--g--agcca
           Tibetan antelope  aca--gaca--g--tgcca
B D                     Cow  gca--gata--g--cgcca
B D                   Sheep  aca--gaca--g--cacta
              Domestic goat  aca--gaca--g--cgcca
B D                   Horse  acatgggga--g--agctg
B D        White rhinoceros  aca--ggga--g--aacca
B D                     Cat  aca--ggga--a--agcca
B D                     Dog  gcg--ggga--g--agcc-
B D                 Ferret   aca--ggga--c--tgtcc
B D                   Panda  aca--ggga--g--tgccg
             Pacific walrus  aca--gggg--g--cgcca
               Weddell seal  aca--gggg--g--cgcca
           Black flying-fox  atg--ggga--g--agcca
B D                Hedgehog  aca--ggta--g--a----
B D                Elephant  cat--ggga--g--aaccc
B D                 Manatee  caa--ggga--g--aatcc
           Cape golden mole  cca--aaga--g--aagcc
                   Aardvark  -ca--cggc--g--agccc
B D               Armadillo  cac--tgga--g--agcca
B D                   Shrew  ===================
       Cape elephant shrew  ===================
             Big brown bat  ===================
      David's myotis (bat)  ===================
B D                 Wallaby  ===================
    Lesser Egyptian jerboa  ===================
B D                  Tenrec  ===================
B D         Chinese hamster  ===================
B D          Naked mole-rat  -------------------
B D                    Pika  ===================
B D         Tasmanian devil  ===================
B D                Platypus  ===================
               Spotted gar  ===================
B D      American alligator  ===================
B D                 Opossum  ===================
B D                     Pig  ===================
B D                  Gibbon  -------------------

Inserts between block 10 and 11 in window
              Prairie vole 24bp
            Golden hamster 1703bp

Alignment block 11 of 243 in window, 141521731 - 141521742, 12 bps 
B D                   Human  ggtagc---------cctcat
B D                   Chimp  ggtagc---------cctcat
B D                 Gorilla  ggtagc---------cctcat
B D               Orangutan  ggtagc---------cctcat
B D                  Rhesus  ggtagc---------cctcat
B D     Crab-eating macaque  ggtagc---------cctcat
B D                  Baboon  ggtagc---------cctcat
B D            Green monkey  ggtagc---------cctcat
B D                Marmoset  gatacc---------cctcac
B D         Squirrel monkey  gatagccctcacattcctcac
B D                Bushbaby  ---agc---------------
         Chinese tree shrew  gggagc---------cctcgg
B D                Squirrel  ---gga---------gcccat
               Prairie vole  ggcagc---------actcac
B D                   Mouse  -gtagc---------actcac
B D                     Rat  ----gc---------actccc
B D              Guinea pig  ggtgac---------cctcac
                 Chinchilla  gatggc---------cctcac
           Brush-tailed rat  ggtggc---------cctaac
B D                  Alpaca  gggacc---------tctt-c
             Bactrian camel  ggggcc---------tctt-c
B D                 Dolphin  cggagc---------cctcac
               Killer whale  tggagc---------cctcac
           Tibetan antelope  tggagc---------cctc-c
B D                     Cow  tggagc---------ctcc-c
B D                   Sheep  tggagc---------cctc-c
              Domestic goat  tggagc---------cctc-c
B D                   Horse  tggatc---------cctcgc
B D        White rhinoceros  tggagc---------cctcac
B D                     Cat  tggagc---------cctcaa
B D                     Dog  cggggc---------cctcgc
B D                 Ferret   tggagc---------cctcac
B D                   Panda  tggagc---------cctcac
             Pacific walrus  tggagc---------cctcat
               Weddell seal  tggagc---------cctcac
           Black flying-fox  tggagc---------cctcac
B D                Hedgehog  --gagc---------cctt--
B D                Elephant  tgta-c---------cctccc
B D                 Manatee  tgta-c---------cctccc
           Cape golden mole  tgta-c---------ccttgg
                   Aardvark  tcta-c---------tctccc
B D               Armadillo  tgcagc---------cctcat
B D                   Shrew  =====================
       Cape elephant shrew  =====================
             Big brown bat  =====================
      David's myotis (bat)  =====================
B D                 Wallaby  =====================
    Lesser Egyptian jerboa  =====================
B D                  Tenrec  =====================
            Golden hamster  =====================
B D         Chinese hamster  =====================
B D          Naked mole-rat  ---------------------
B D                    Pika  =====================
B D         Tasmanian devil  =====================
B D                Platypus  =====================
               Spotted gar  =====================
B D      American alligator  =====================
B D                 Opossum  =====================
B D                     Pig  =====================
B D                  Gibbon  ---------------------

Alignment block 12 of 243 in window, 141521743 - 141521789, 47 bps 
B D                   Human  attgccc--tttttgctatggctgctgggatgctcaaagcacatttgtg
B D                   Chimp  attgccc--tttttgctatggctgctgggatgctcaaagcacatttgtg
B D                 Gorilla  atttccc--tttttgctatggctgctgggatgctcaaagcacatttgtg
B D               Orangutan  attgccc--tttttgctatggctgctgggatgctcaaagcacatttgtg
B D                  Rhesus  attgccc--tttttgctatggctgctgggatgctcaaagcatgtttgtg
B D     Crab-eating macaque  attgccc--tttttgctatggctgctgggatgctcaaagcacatttgtg
B D                  Baboon  gttgccc--tttttgctatggctgctgggatgctcaaagcacatttgtg
B D            Green monkey  attgccc--tttttgctatggctgctgggatgctcaaagcacatttgtg
B D                Marmoset  attgccc--tttttgctatggctgctgggatgctcaaagcacatttgtg
B D         Squirrel monkey  attgccc--tttttgctatggctgctgggctgctcaaagcacatttgtg
B D                Bushbaby  attgccc--tttttgctatggctactgggatgctcaaatgacatttgtg
         Chinese tree shrew  acc-----------------gctgctgggatgctc-aggcccattggtg
B D                Squirrel  gtttccc--tttctgctgtggttgctgggatg-----------------
     Lesser Egyptian jerboa  atttccc--ttttggctatagccactgggatgctccaagcacatttg--
               Prairie vole  agtgctg--tttttgctatggccactggcatg-----------------
B D                   Mouse  agagctgtttttttgctatggcccctggcata-----------------
B D                     Rat  agagctg--tttatgctatggcccctggcata-----------------
B D              Guinea pig  attacca--tttctgccatagctgttag-gtg-----------------
                 Chinchilla  attaccc--tttctgccatagctggtag-gtg-----------------
           Brush-tailed rat  attaccc--cctctgccatagctaggta-atg-----------------
B D                  Alpaca  t-tgccc--tttttgctctgactgctgggatgcttagaacacac---tg
             Bactrian camel  t-tgccc--ttttcgctctggctgctgggatgcttagaatacac-tgtg
B D                 Dolphin  cttgccc--tttttgctctggctgctgggatgctcaaagcacatctgtg
               Killer whale  cttgccc--tttttgctctggctgctgggatgctcaaagcacatctgtg
           Tibetan antelope  ctgggcc--tttttgctctggctgctagggtgctcaaagcccatttgtg
B D                     Cow  c-gggcc--tgtttgctctggctgttagggtgctcagagccc-cctgtg
B D                   Sheep  ctgggcc--tttttgctctggctgctagggtgcccaaagcccactggtg
              Domestic goat  c-gggcc--tttttgctctggctgctagggtgcccagagcccacctgtg
B D                   Horse  cttgccc--tttttgctctggctgctgggatgctcagagcacattcgtg
B D        White rhinoceros  cttgccc--tttttgctgtggctgccaggatgctcag-------ttgtg
B D                     Cat  tttgccc--tttttgctctggctgctgggatgctcagagcacatttgtg
B D                     Dog  t-----------------tggccactgggatggtcagagctcatctgtg
B D                 Ferret   gtcgccc--tttttgctctggctgttgggatgctctaaggacatttatg
B D                   Panda  tttgccc--tttttgctctggctgctgggatgctctgagcacatttgtg
             Pacific walrus  tttgccc--tttttgctctggctgctgggatgcttggagcacatttgtg
               Weddell seal  tttgccc--tttttgctctggctgctgggatgctcggagcacatttgtg
           Black flying-fox  cttgccc--tttttgccctggctgctgggatgctcagtgaccattggtg
B D                Hedgehog  --ttttt--tatttgctttggctgacaggatgatcagggcatatccatg
B D                Elephant  gttgccc--tttttttcttggctgccaggatgctcagagcacattagtg
B D                 Manatee  gtcgccc--tttctgccttggctg-tgcgacgttcagagcacgttagcg
           Cape golden mole  gtttccc--tttttgccttggttgccaggctgctcagagcacatcaac-
                   Aardvark  gttgccc--tttctgccttggctgccgggatgctcagagcacc------
B D               Armadillo  gttgctc--tcttcgctctggctgccgggatgctcagagcacctttgtg
B D                   Shrew  =================================================
       Cape elephant shrew  =================================================
             Big brown bat  =================================================
      David's myotis (bat)  =================================================
B D                 Wallaby  =================================================
B D                  Tenrec  =================================================
            Golden hamster  =================================================
B D         Chinese hamster  =================================================
B D          Naked mole-rat  -------------------------------------------------
B D                    Pika  =================================================
B D         Tasmanian devil  =================================================
B D                Platypus  =================================================
               Spotted gar  =================================================
B D      American alligator  =================================================
B D                 Opossum  =================================================
B D                     Pig  =================================================
B D                  Gibbon  -------------------------------------------------

Inserts between block 12 and 13 in window
B D                    Cat 1bp
B D                    Dog 53bp

Alignment block 13 of 243 in window, 141521790 - 141521879, 90 bps 
B D                   Human  cccc-attgttctgaccttcc-caggcttgcca----------------ttttg-------------ggg
B D                   Chimp  cccc-attgttctgaccttcc-caggcttgcca----------------ttttg-------------ggg
B D                 Gorilla  cccc-attgttctgactttcc-caagcttgcca----------------ttttg-------------ggg
B D               Orangutan  cccc-attgttctgactttcc-caggcttgcca----------------ttttg-------------ggg
B D                  Rhesus  ctcc-attgttctgactttgc-caggcttgcca----------------t--------------------
B D     Crab-eating macaque  ctcc-attgttctgactttgc-caggcttgcca----------------t--------------------
B D                  Baboon  ctcc-attgttctgactttgc-caggcttgcca----------------t--------------------
B D            Green monkey  ctcc-attgttctgactttgc-caggcttgcca----------------ttttg-------------ggg
B D                Marmoset  cccc-gttgttcagactttcc-taaacatgcca----------------ttttg-------------ggg
B D         Squirrel monkey  ccct-gttgttcagactttcc-taaacatgcca----------------ttttg-------------ggg
B D                Bushbaby  c-----tggttttagtgtccctcaggcatgaca----------------ctgtg-------------ggt
         Chinese tree shrew  cctcggctctcgcggcctgca-ggcactagccc----------------c--cg-------------ggg
B D                Squirrel  ---------------ctcaccgtgcgttttctcagctcctctgtcaccgctctg-------------ggg
     Lesser Egyptian jerboa  ---c------tctcatgttcctgaagttccatc----------------ttatg-------------aga
               Prairie vole  --------------gctttccttgggcttcatc----------------ttctg-------------gga
B D                   Mouse  --------------actctccttgtgtttcatc----------------atctg-------------gga
B D                     Rat  --------------actttccttgtgcttcatc----------------ttctg-------------gaa
B D              Guinea pig  ---c------tcaaactttccccaagcatcatc----------------atctg-------------gga
                 Chinchilla  ---c------tcaaattttccccaggcaccatc----------------ttctg-------------gga
           Brush-tailed rat  ---c------tcagactttccccaggca-cgtc----------------ttctg-------------ggt
B D                  Alpaca  cccc-actgctctaatattcttcaggcctgac-----------------ctctc-----------tgggg
             Bactrian camel  cccc-actgctctaatattcttcaggcctgac-----------------ctttc-----------tgggg
B D                 Dolphin  cccc-gcagctctaaccttcctcaggcatgat-----------------ctccc-------------agg
               Killer whale  cccc-gcagctctaaccttcctcaggcatgat-----------------ctccc-------------agg
           Tibetan antelope  cccc-tctgccctagctttccttgggcgtgat-----------------ctccc-------------agg
B D                     Cow  -ccc-tccgccctagctttcctcaggcgtgat-----------------ctccc-------------agc
B D                   Sheep  cccc-tctgccctagctttccctgggcgtgat-----------------ctccc-------------agg
              Domestic goat  cccc-tctgccctagctttccttgggcgtgat-----------------cgccc-------------agg
B D                   Horse  cctg-gttgctctaactttcctcaggcatgatc----------------ttccg-------------ggg
B D        White rhinoceros  ccca-gttgctgtaactttcctcaggcatgatc----------------ttctg-------------ggg
B D                     Cat  cccg-attgctctaactgtccttaggcacggtc----------------ctctg-------------ggt
B D                 Ferret   ccca-actgctctagctttccttaggcacgatc----------------cttgg-------------ggg
B D                   Panda  ccca-attgctctagctttcctcaggcatgat-----------------ctcgg-------------ggg
             Pacific walrus  ccca-attgccctagctttccttaggcatgatc----------------ctcgg-------------ggg
               Weddell seal  ccca-attgccctagctttccttaggcatgatc----------------ctcgg-------------ggg
           Black flying-fox  ccta-gctgctctaagtctcctcaggcgtgat-----------------ctcct-------------ggg
B D                Hedgehog  cctg-gttgctctaactttcccca-gcaggat-----------------cttgggggggtgtgtgggggg
B D                Elephant  ctca-gtggctttaaccttgctcaggcactgtc----------------ttctg-------------ggg
B D                 Manatee  ctcc-gtggctgtcactttgctcaggcactatc----------------ttctg-------------ggg
           Cape golden mole  ------------------------------atc----------------ttctg-------------ggg
                   Aardvark  ------------------------------atc----------------tcctg-------------ggt
B D               Armadillo  ctca-gctgtgctagtgctccctaggcatgggc----------------ttctg-------------ggg
B D                   Shrew  ======================================================================
       Cape elephant shrew  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                 Wallaby  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
B D          Naked mole-rat  ----------------------------------------------------------------------
B D                     Dog  ======================================================================
B D                    Pika  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
               Spotted gar  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
B D                     Pig  ======================================================================
B D                  Gibbon  ----------------------------------------------------------------------

                      Human  cagcttgcccgtctgctctggatttgtggtcccctccagctgcctggcttt
                      Chimp  cagcttgcccgtctgctctggctttgcggccccctcccgctgcctggctct
                    Gorilla  cagcttgcccgtctgctctggctttgtggtcccctcaagctgcctggcttt
                  Orangutan  cagcttgcccgtctgctctggctttgtggtcccctgcagctgcctggcttt
                     Rhesus  cagcttgcccct------------------cctctccagctgcctggatt-
        Crab-eating macaque  cagcttgcccct------------------cctctccagctgcctggatt-
                     Baboon  cagcttgcccct------------------cctctccagctgcctggatt-
               Green monkey  cagcttgcccct------------------cctctccagctgcctggatt-
                   Marmoset  -agattgccctttcactctggctttgtggtcccctccagctgcctggcttt
            Squirrel monkey  -agattgccccttcgctctggctttgtggtcccctccagctgcctggcttt
                   Bushbaby  cagtttgcccctcctttctgcctttgtgt-gtcctctagctgtctggcttt
         Chinese tree shrew  cagcctgccctt---ctctggcgtgttg----cccccacctgtttggcttc
                   Squirrel  tac----ccaccctaccccagtgctggtgcttcgtgcagctgcctggc---
     Lesser Egyptian jerboa  cactcggacccctctctctggagttgctgtcatttctagctgcttgtc---
               Prairie vole  cttctggcccctcctctctagcaccgatgctgcctccagctgtctgcc---
                      Mouse  ctcttggcccctcctctgtaccactgatgctgcctccagctgtctgcc---
                        Rat  ctcttggtccctcctctgtatcactgacgctgcctccagctgtctgcc---
                 Guinea pig  tgcttttctcctc---tctggcattgttacttcttgttgctgtttggc---
                 Chinchilla  tacttctcccctcctctctggcattgttgcttcttcctgctgcctggc---
           Brush-tailed rat  tatgtttcccctctattctgg---tgttgcttcctcctgctgcctgac---
                     Alpaca  cagcgtgcctctcccgtctgattttgttaacttctctgg--ggct------
             Bactrian camel  cagcgtgcctctcccgtctgactttgttaacttctctgg--ggct------
                    Dolphin  cagtgtgcctct-ccctctggcttcactgttttatcctg--ggctggcttt
               Killer whale  cagtgtgcctct-ccctctggcttcactgtcttatcctg--ggctggcttt
           Tibetan antelope  tgctgtgcttctgccttctggcctcactgttttatcctg--gactggcttt
                        Cow  tgcggtgcctctgccttctggcctcactgtttcatcctg--gactggcttt
                      Sheep  tgctgtgcctgtgccttctggcctcactgttttatcctg--gactggcttt
              Domestic goat  tgctgtgcctgtgccttctggcctcactgttttatcctg--gactggcttt
                      Horse  caacgtgcctctcccg-ctggctccgttgtcttctccggctgtctggcttt
           White rhinoceros  caacgtgctctccctg-ctggcgtcgttgtcttctccagctgtctggcttt
                        Cat  cagtgtgcctctcctgtgtggctttattgtcctcctcagttggctggcttt
                    Ferret   caatgtgtctctcctgtctggtgtcactgtccccctcgtt----tggctcc
                      Panda  caatgtgcctctcctgtctggcttcattgtc---ctcatttggctggcttt
             Pacific walrus  caatgtgcctctcatgtttggcttcactgtcttgctcatttggctggcttt
               Weddell seal  caatgtgcctctcatgtctggcttcattgtcttcctcatttggctggcttt
           Black flying-fox  caatgtgcttctccct-ctggcttcgtcgtctt-cccggctgtctggctct
                   Hedgehog  caatttgcctgttccctctagaagccttgtcatcttctc--tgatgactat
                   Elephant  cagttttctcctga---------------tctcctctggctgcctggc---
                    Manatee  caagtttctccttc---------------tctcctctggctgcctggc---
           Cape golden mole  tgatttcccccttc---------------tcccctctggctgcc-agc---
                   Aardvark  ga----tccccttc---------------tcttctctggctgcctggt---
                  Armadillo  taacctgcccttgctctggggttgtggggtctcctctggccgttgggc---
                      Shrew  ===================================================
        Cape elephant shrew  ===================================================
              Big brown bat  ===================================================
       David's myotis (bat)  ===================================================
                    Wallaby  ===================================================
                     Tenrec  ===================================================
             Golden hamster  ===================================================
            Chinese hamster  ===================================================
             Naked mole-rat  ---------------------------------------------------
                        Dog  ===================================================
                       Pika  ===================================================
            Tasmanian devil  ===================================================
                   Platypus  ===================================================
                Spotted gar  ===================================================
         American alligator  ===================================================
                    Opossum  ===================================================
                        Pig  ===================================================
                     Gibbon  ---------------------------------------------------

Inserts between block 13 and 14 in window
B D               Marmoset 4bp
B D        Squirrel monkey 4bp
B D               Bushbaby 4bp
B D                Dolphin 5bp
              Killer whale 5bp
          Tibetan antelope 5bp
B D                    Cow 5bp
B D                  Sheep 5bp
             Domestic goat 5bp
B D                  Horse 5bp
B D       White rhinoceros 5bp
B D                    Cat 5bp
B D                Ferret  5bp
B D                  Panda 5bp
            Pacific walrus 5bp
              Weddell seal 5bp
          Black flying-fox 5bp
B D               Hedgehog 13bp

Alignment block 14 of 243 in window, 141521880 - 141521901, 22 bps 
B D                   Human  tttttttttttttttttttttt
B D                   Chimp  tttttttttttttttttttttt
B D                 Gorilla  tttttttttttttttttttttt
B D               Orangutan  tttttt----------------
B D                Bushbaby  tctt------------------
         Chinese tree shrew  tgt-------------------
B D                Squirrel  -tt-------------------
     Lesser Egyptian jerboa  -ac-------------------
               Prairie vole  -tt-------------------
B D                   Mouse  -tt-------------------
B D                     Rat  -tt-------------------
B D              Guinea pig  -tt-------------------
                 Chinchilla  -tt-------------------
           Brush-tailed rat  -tt-------------------
B D                 Dolphin  ctt-------------------
               Killer whale  ctt-------------------
           Tibetan antelope  ctt-------------------
B D                     Cow  ctt-------------------
B D                   Sheep  ctt-------------------
              Domestic goat  ctt-------------------
B D                   Horse  cgt-------------------
B D        White rhinoceros  ctt-------------------
B D                     Cat  ctt-------------------
B D                 Ferret   ctc-------------------
B D                   Panda  ctt-------------------
             Pacific walrus  ctt-------------------
               Weddell seal  ctt-------------------
           Black flying-fox  cct-------------------
B D                Hedgehog  ttt-------------------
B D               Armadillo  -cc-------------------
B D                   Shrew  ======================
       Cape elephant shrew  ======================
             Big brown bat  ======================
      David's myotis (bat)  ======================
            Bactrian camel  ----------------------
B D                  Alpaca  ----------------------
B D                 Wallaby  ======================
B D                  Tenrec  ======================
            Golden hamster  ======================
B D         Chinese hamster  ======================
B D          Naked mole-rat  ----------------------
B D                 Manatee  ----------------------
B D                     Dog  ======================
B D                    Pika  ======================
B D                Elephant  ----------------------
          Cape golden mole  ----------------------
B D         Tasmanian devil  ======================
B D                Platypus  ======================
               Spotted gar  ======================
B D      American alligator  ======================
B D                Marmoset  ======================
B D         Squirrel monkey  ======================
B D                 Opossum  ======================
B D                  Baboon  ----------------------
                  Aardvark  ----------------------
B D                  Rhesus  ----------------------
B D                     Pig  ======================
B D            Green monkey  ----------------------
B D     Crab-eating macaque  ----------------------
B D                  Gibbon  ----------------------

Alignment block 15 of 243 in window, 141521902 - 141521957, 56 bps 
B D                   Human  ttttttt-ttacaat-gcctggattataattgtaagaat-------------------g--atgct----
B D                 Gorilla  ----------acaat-gcctggattataatcgtaagaat-------------------g--ttgct----
B D               Orangutan  tttttcc-ccacaat-gcctgcattataattgtaagaat-------------------g--atgct----
B D                  Rhesus  tccagtc-ttacaat-gcctggattataattgtaagaat-------------------g--atgct----
B D     Crab-eating macaque  tccagtc-ttataat-gcctggattataattgtaagaat-------------------g--atgct----
B D                  Baboon  tccagtc-ttgcaat-gcctggattataattgtaagaat-------------------g--atgct----
B D            Green monkey  tccagtc-ttacaat-gcctggattataattgtaagaat-------------------g--atgtt----
B D                Bushbaby  ----------atgat-gcctggactgtaattatacaaag-------------------g--atgct----
         Chinese tree shrew  ------------------------------------aaa-------------------g--gcgct----
B D                Squirrel  tcaggcc-tcttgct-gtctgt-ccgtgagcagaggaat-------------------a--agact----
     Lesser Egyptian jerboa  ccaagta-tcacgat-gcctgggtcctaggtataagtat-------------------g--aggtt----
               Prairie vole  ccaagtc-tcctgac-gtctggatcataaata----tat-------------------g--aggca----
B D                   Mouse  ccaagtc-tcatgat-gtctggatcataaata----tat-------------------g--aggca----
B D                     Rat  ccaagtc-tcatgat-gcctggatcataaata----tat-------------------g--aggca----
B D              Guinea pig  ttatggc-tcacaat-gcctgggctgtaagaa----t-------------------------gagt----
                 Chinchilla  ttaaggc-tcatgct-gcttgggctgtaagaa----t-------------------------ggtt----
           Brush-tailed rat  ttaagtc-tcttgct-gcctgggttgtaagaa----t-------------------------gatt----
B D                  Alpaca  -------------gc-tcaggggttagaattttaagaac-------------------g--atgct----
             Bactrian camel  -------------gc-tcaggggttagaattttaagaac-------------------g--atgct----
B D                 Dolphin  -----------aggc-tgaggagttagaattttaagaat-------------------g--atgct----
               Killer whale  -----------aggc-tgaggagtt---------agaat-------------------g--atgct----
           Tibetan antelope  -----------aggc-tgaggggataaaatcttaaacat-------------------g--atgct----
B D                     Cow  -----------aggc-tgaggggctaaaatcttaaaaat-------------------g--atgct----
B D                   Sheep  -----------aggc-tgaggggataaaatcttaaaaat-------------------g--atgct----
              Domestic goat  -----------aggc-tgaggggataaaatcttaaaaat-------------------g--atgct----
B D                   Horse  -----------agga-ggcggggctagagctataagaat-------------------t--attgt----
B D        White rhinoceros  -----------agga-ggcggggctaggattataagaat-------------------g--atgct----
B D                     Cat  -----------agga-gctgaggctagaattctaagaat-------------------g--acact----
B D                 Ferret   -----------agga-cctggggctagaacgataagagt-------------------g--acacc----
B D                   Panda  -----------agga-actggggctagaattacaagaat-------------------g--acacc----
             Pacific walrus  -----------agga-actggggctagaattataagaa--------------------------------
               Weddell seal  -----------agga-actggggctagaattataagaat-------------------g--acact----
           Black flying-fox  -----------gggacaccagggctaaaccgatcagaat-------------------g--tcacc----
B D                Hedgehog  -----------acga-ttgttgagtatattaataagaattttgcctttcacattttagg--atgctggca
B D                Elephant  ----gtt-ttaggat-gccggggctatagttataagacc-------------------g--atgct----
B D                 Manatee  ----ggt-ttaggat-gcctgggctatagttaagagaat-------------------g--acgcc----
           Cape golden mole  ----cct-ttaggat-gtctgggttcta-ttgtaagaat-------------------g--atgct----
                   Aardvark  ----attgtcaggat-gcctaggctatagctacaaggtc-------------------t--atact----
B D               Armadillo  ccgagtc-tcaggag-gcctgggctcca---aggaggac-------------------agtatgct----
B D                   Shrew  ======================================================================
       Cape elephant shrew  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                 Wallaby  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
B D          Naked mole-rat  ----------------------------------------------------------------------
B D                     Dog  ======================================================================
B D                    Pika  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
               Spotted gar  ======================================================================
B D      American alligator  ======================================================================
B D                Marmoset  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ======================================================================
B D                     Pig  ======================================================================
B D                  Gibbon  ----------------------------------------------------------------------

                      Human  -------------------tc-a-att-atttttg
                    Gorilla  -------------------tc-a-att-atttttg
                  Orangutan  -------------------tc-a-att-atttttg
                     Rhesus  -------------------tc-a-att-atttttg
        Crab-eating macaque  -------------------tc-a-att-atttttg
                     Baboon  -------------------tc-a-att-atttttg
               Green monkey  -------------------tc-a-att-atttttg
                   Bushbaby  -------------------tcaa-att-atttttc
         Chinese tree shrew  -------------------tc-acatt-aggtgtg
                   Squirrel  -------------------tc-a-catcagttttc
     Lesser Egyptian jerboa  -------------------tc-a-aat-gatctcc
               Prairie vole  -------------------tg-t-cct-agtttcc
                      Mouse  -------------------tg-g-cct-agtttca
                        Rat  -------------------tg-t-cct-agtttca
                 Guinea pig  -------------------cc-a-aat-tattttt
                 Chinchilla  -------------------cc-a-aa--cattttt
           Brush-tailed rat  -------------------cc-a-aat-tattttt
                     Alpaca  -------------------tcca-att-atttttg
             Bactrian camel  -------------------tcca-att-atttttg
                    Dolphin  -------------------tcca-att-atttttg
               Killer whale  -------------------tcca-att-atttttg
           Tibetan antelope  -------------------tcca-att-atttttg
                        Cow  -------------------tcca-att-atttttg
                      Sheep  -------------------tcca-att-atttttg
              Domestic goat  -------------------tcca-att-atttttg
                      Horse  -------------------tctt-gtt-atttttg
           White rhinoceros  -------------------tcaa-att-atttttg
                        Cat  -------------------cgta-gtc-atttttg
                    Ferret   -------------------tgga-atc-acctttg
                      Panda  -------------------taga-atc-agttttg
             Pacific walrus  ---------------------ga-atc-atttttg
               Weddell seal  -------------------tgga-atc-atttttg
           Black flying-fox  -------------------gcga-att-actcttg
                   Hedgehog  ctagtgtcgacaaagaatatagg-att-attttgg
                   Elephant  -------------------tcac-att-atttttg
                    Manatee  -------------------tggc-att-atttttg
           Cape golden mole  -------------------tcac-att-atttttg
                   Aardvark  -------------------tcac-att-atttttg
                  Armadillo  -------------------tcgg-att-atttttg
                      Shrew  ===================================
        Cape elephant shrew  ===================================
              Big brown bat  ===================================
       David's myotis (bat)  ===================================
                    Wallaby  ===================================
                     Tenrec  ===================================
             Golden hamster  ===================================
            Chinese hamster  ===================================
             Naked mole-rat  -----------------------------------
                        Dog  ===================================
                       Pika  ===================================
            Tasmanian devil  ===================================
                   Platypus  ===================================
                Spotted gar  ===================================
         American alligator  ===================================
                   Marmoset  ===================================
            Squirrel monkey  ===================================
                      Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Opossum  ===================================
                        Pig  ===================================
                     Gibbon  -----------------------------------

Inserts between block 15 and 16 in window
    Lesser Egyptian jerboa 1bp
              Prairie vole 33bp
B D                  Mouse 56bp
B D                    Rat 663bp
B D             Guinea pig 1bp
                Chinchilla 1bp
          Brush-tailed rat 1bp

Alignment block 16 of 243 in window, 141521958 - 141521962, 5 bps 
B D                   Human  gaaag
B D                 Gorilla  gaaat
B D               Orangutan  gaaat
B D                  Rhesus  gaaat
B D     Crab-eating macaque  gaaat
B D                  Baboon  gaaat
B D            Green monkey  gaaat
B D                Bushbaby  gacat
         Chinese tree shrew  ggg--
B D                Squirrel  catgt
     Lesser Egyptian jerboa  ggagc
               Prairie vole  caact
B D                   Mouse  caact
B D              Guinea pig  gaaac
                 Chinchilla  gaaac
           Brush-tailed rat  gaaac
B D                  Alpaca  gaaat
             Bactrian camel  gaaat
B D                 Dolphin  gaaat
               Killer whale  gaaat
           Tibetan antelope  aaaat
B D                     Cow  aaaat
B D                   Sheep  aaaat
              Domestic goat  aaaat
B D                   Horse  ggagg
B D        White rhinoceros  gaaat
B D                     Cat  tcgat
B D                 Ferret   tcatc
B D                   Panda  tatat
             Pacific walrus  taaat
               Weddell seal  taaat
           Black flying-fox  ggaag
B D                Hedgehog  gaaat
B D                Elephant  gaaat
B D                 Manatee  gaaat
           Cape golden mole  gaaat
                   Aardvark  gaaat
B D               Armadillo  gaaat
B D                   Shrew  =====
B D                     Rat  =====
       Cape elephant shrew  =====
             Big brown bat  =====
      David's myotis (bat)  =====
B D                 Wallaby  =====
B D                  Tenrec  =====
            Golden hamster  =====
B D         Chinese hamster  =====
B D          Naked mole-rat  -----
B D                     Dog  =====
B D                    Pika  =====
B D         Tasmanian devil  =====
B D                Platypus  =====
               Spotted gar  =====
B D      American alligator  =====
B D                Marmoset  =====
B D         Squirrel monkey  =====
B D                   Chimp  NNNNN
B D                 Opossum  =====
B D                     Pig  =====
B D                  Gibbon  -----

Alignment block 17 of 243 in window, 141521963 - 141521965, 3 bps 
B D                   Human  tgg
B D                 Gorilla  tgg
B D               Orangutan  tag
B D                  Rhesus  tcg
B D     Crab-eating macaque  tcg
B D                  Baboon  tag
B D            Green monkey  tag
B D                Bushbaby  tag
         Chinese tree shrew  -tg
B D                Squirrel  tgg
     Lesser Egyptian jerboa  cag
               Prairie vole  tag
B D                   Mouse  tag
B D              Guinea pig  tgg
                 Chinchilla  tgg
           Brush-tailed rat  tgg
B D                  Alpaca  tgg
             Bactrian camel  tgg
B D                 Dolphin  tgg
               Killer whale  tgg
           Tibetan antelope  tgg
B D                     Cow  tgg
B D                   Sheep  tgg
              Domestic goat  tgg
B D                   Horse  tgg
B D        White rhinoceros  tgg
B D                     Cat  tgg
B D                 Ferret   cgg
B D                   Panda  tgg
             Pacific walrus  tgg
               Weddell seal  tgg
           Black flying-fox  tgg
B D                Hedgehog  caa
B D                Elephant  cgg
B D                 Manatee  tgg
           Cape golden mole  tgg
                   Aardvark  tgg
B D               Armadillo  tgg
B D                   Shrew  ===
B D                     Rat  ===
       Cape elephant shrew  ===
             Big brown bat  ===
      David's myotis (bat)  ===
B D                 Wallaby  ===
B D                  Tenrec  ===
            Golden hamster  ===
B D         Chinese hamster  ===
B D          Naked mole-rat  ---
B D                     Dog  ===
B D                    Pika  ===
B D         Tasmanian devil  ===
B D                Platypus  ===
               Spotted gar  ===
B D      American alligator  ===
B D                Marmoset  ===
B D         Squirrel monkey  ===
B D                   Chimp  NNN
B D                 Opossum  ===
B D                     Pig  ===
B D                  Gibbon  ---

Inserts between block 17 and 18 in window
B D               Hedgehog 1bp

Alignment block 18 of 243 in window, 141521966 - 141521980, 15 bps 
B D                   Human  ggggaaa-------tacc--tttt
B D                 Gorilla  ggggaaa-------tacc--tttt
B D               Orangutan  ggggaaa-------tacc--tttt
B D                  Rhesus  agggaaa-------tacc--tttt
B D     Crab-eating macaque  agggaaa-------tacc--tttt
B D                  Baboon  agggaaa-------tacc--tttt
B D            Green monkey  agggaaa-------tacc--tttt
B D                Bushbaby  gggaa----------atc--ttct
         Chinese tree shrew  gagggaa-------cact------
B D                Squirrel  aggga---------cctt--c---
     Lesser Egyptian jerboa  aggaaaa-------cctt--t---
               Prairie vole  gggagaaaggatttattc--a---
B D                   Mouse  gggagaaagggtttattt--g---
B D              Guinea pig  aggaaat-------catc--a---
                 Chinchilla  aggaaat-------cttc--t---
           Brush-tailed rat  tggaaat-------catc--t---
B D                     Pig  ggaggga-------cccc--attc
B D                  Alpaca  agggaag-------cacc--ttct
             Bactrian camel  agggaag-------cacc--ttct
B D                 Dolphin  agggaaa-------cact--ttct
               Killer whale  agggaaa-------cact--ttct
           Tibetan antelope  agagaaa-------cacc--ttct
B D                     Cow  agagcaa-------tacc--ttct
B D                   Sheep  agagaaa-------cacc--ttct
              Domestic goat  agagaag-------cacc--ttct
B D                   Horse  agggaaa-------cacc--tcct
B D        White rhinoceros  agggaaa-------cacc--tcct
B D                     Cat  aaggaaa-------cgcc--tttt
B D                 Ferret   a---------------tc------
B D                   Panda  aaggaaa-------tgcc--tttt
             Pacific walrus  aaggaaa-------tgcc------
               Weddell seal  aaggaaa-------tgcc------
           Black flying-fox  agggaac-------aacc--tcct
B D                Hedgehog  aggacaa-------cagaagtcct
B D                Elephant  agggaaa-------cacc--gtct
B D                 Manatee  agggaaa-------cacc--atct
           Cape golden mole  agggaaa-------catt--at-g
                   Aardvark  agggaaa-------cact--gtca
B D               Armadillo  agggagg-------cact--ttct
B D                   Shrew  ========================
B D                     Rat  ========================
       Cape elephant shrew  ========================
             Big brown bat  ========================
      David's myotis (bat)  ========================
B D                 Wallaby  ========================
B D                  Tenrec  ========================
            Golden hamster  ========================
B D         Chinese hamster  ========================
B D          Naked mole-rat  ------------------------
B D                     Dog  ========================
B D                    Pika  ========================
B D         Tasmanian devil  ========================
B D                Platypus  ========================
               Spotted gar  ========================
B D      American alligator  ========================
B D                Marmoset  ========================
B D         Squirrel monkey  ========================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ========================
B D                  Gibbon  ------------------------

Inserts between block 18 and 19 in window
B D               Squirrel 1bp
    Lesser Egyptian jerboa 1bp
              Prairie vole 1bp
B D                  Mouse 1bp
B D             Guinea pig 3bp
                Chinchilla 3bp
          Brush-tailed rat 3bp

Alignment block 19 of 243 in window, 141521981 - 141522004, 24 bps 
B D                   Human  ttgtaaagtcacggattccagctc
B D                 Gorilla  ttgtaaagtcacggattccagctc
B D               Orangutan  ttgtaaagtcacggattccagctc
B D                  Rhesus  tggtaaagtcacggattccagttc
B D     Crab-eating macaque  ttgtaaagtcacggattccagttc
B D                  Baboon  ttgtaaagtcacggattccagttc
B D            Green monkey  ttgtaaagtcacggattccagttc
B D                Bushbaby  ttctaaagtcacagatcctggctc
         Chinese tree shrew  ---taccatcacagaccctggctc
B D                Squirrel  ttgtcagcccctggctc-------
     Lesser Egyptian jerboa  tcatgaagtctcagagcctgccc-
               Prairie vole  tgaacagttctgggttgcagtcc-
B D                   Mouse  tgaacaattctaggttacagtcc-
B D          Naked mole-rat  tcacaaagtcacagaccctggctc
B D              Guinea pig  tcatgaagtcataagtcctggatc
                 Chinchilla  tcataaagtcatagatccta----
           Brush-tailed rat  tcataaagtgacagattctggctc
B D                     Pig  ttttaaagttgcagatcctagatc
B D                  Alpaca  tttaaaagtcacaaaa--------
             Bactrian camel  tttagaagtcacaaaa--------
B D                 Dolphin  tttgaaagttgcagaccccggatc
               Killer whale  tttgaaagttgcagaccccggatc
           Tibetan antelope  tttgaatgttgcagac--------
B D                     Cow  tttgaatgttgcagac--------
B D                   Sheep  tttgaatgttgcagac--------
              Domestic goat  tttgaatgttgcagac--------
B D                   Horse  tt-taaagtcatagatcctgggtc
B D        White rhinoceros  ttctaaagtcacaggtcctggatc
B D                     Cat  tg-----gttccagatcctggatc
B D                 Ferret   ------------------tgggtc
B D                   Panda  tg-----gccccagatcgtgggtc
             Pacific walrus  ------------------tggatc
               Weddell seal  ------------------tgaatc
           Black flying-fox  tcttaaaggtgcaaaccctggctc
B D                Hedgehog  tgttgaagttgtatattcccaatc
B D                Elephant  ttttcaagtcacagatcttggatc
B D                 Manatee  ttttcaagttacagatcttggctc
           Cape golden mole  ttttcaagtcacagatcttggatc
                   Aardvark  tttgcaagtcacacaccttggatc
B D               Armadillo  tttaaaagtcacagatcttggatc
B D                   Shrew  ========================
B D                     Rat  ========================
       Cape elephant shrew  ========================
             Big brown bat  ========================
      David's myotis (bat)  ========================
B D                 Wallaby  ========================
B D                  Tenrec  ========================
            Golden hamster  ========================
B D         Chinese hamster  ========================
B D                     Dog  ========================
B D                    Pika  ========================
B D         Tasmanian devil  ========================
B D                Platypus  ========================
               Spotted gar  ========================
B D      American alligator  ========================
B D                Marmoset  ========================
B D         Squirrel monkey  ========================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ========================
B D                  Gibbon  ------------------------

Inserts between block 19 and 20 in window
    Lesser Egyptian jerboa 1bp
              Prairie vole 475bp
B D                  Mouse 5bp

Alignment block 20 of 243 in window, 141522005 - 141522015, 11 bps 
B D                   Human  tggttg----gcagc
B D                 Gorilla  tggttg----gcagc
B D               Orangutan  tggttg----gcagc
B D                  Rhesus  tggtta----gcagc
B D     Crab-eating macaque  tggtta----gcagc
B D                  Baboon  tggtta----gcagc
B D            Green monkey  tggtta----gcagc
B D                Bushbaby  c-tttg----acagc
         Chinese tree shrew  tgggtgcgacacggc
B D                Squirrel  tgggag----gtgac
     Lesser Egyptian jerboa  tgggcg----gtgac
B D                   Mouse  tgtatg----gagtc
B D          Naked mole-rat  tggatg----gcgat
B D              Guinea pig  tggatg----gtgac
           Brush-tailed rat  tggatt----gggat
B D                     Pig  tgagtg----gcaac
B D                  Alpaca  ---gca----gcaag
             Bactrian camel  ---gca----gcaag
B D                 Dolphin  tgggtg----gcaac
               Killer whale  tgggtg----gcaac
           Tibetan antelope  --------------c
B D                     Cow  --------------c
B D                   Sheep  --------------c
              Domestic goat  --------------c
B D                   Horse  tgggag----gcatc
B D        White rhinoceros  tgggag----gcatc
B D                     Cat  cgggtg----gcaac
B D                 Ferret   ccggtg----gcagc
B D                   Panda  caggtg----gcaac
             Pacific walrus  caggtg----gcaac
               Weddell seal  caggtg----gcgac
           Black flying-fox  tgggag----acaac
B D                Hedgehog  ----tg----ataac
B D                Elephant  tgggtg----tcaac
B D                 Manatee  t-ggtg----tcaac
           Cape golden mole  tgggtg----tcaac
                   Aardvark  cgagtg----tcaac
B D               Armadillo  tggctg----tcaac
B D                   Shrew  ===============
B D                     Rat  ===============
       Cape elephant shrew  ===============
              Prairie vole  ===============
             Big brown bat  ===============
      David's myotis (bat)  ===============
B D                 Wallaby  ===============
B D                  Tenrec  ===============
            Golden hamster  ===============
B D         Chinese hamster  ===============
                Chinchilla  ---------------
B D                     Dog  ===============
B D                    Pika  ===============
B D         Tasmanian devil  ===============
B D                Platypus  ===============
               Spotted gar  ===============
B D      American alligator  ===============
B D                Marmoset  ===============
B D         Squirrel monkey  ===============
B D                   Chimp  NNNNNNNNNNNNNNN
B D                 Opossum  ===============
B D                  Gibbon  ---------------

Inserts between block 20 and 21 in window
B D               Squirrel 2bp
    Lesser Egyptian jerboa 28bp
B D                  Mouse 1bp

Alignment block 21 of 243 in window, 141522016 - 141522017, 2 bps 
B D                   Human  aa
B D                 Gorilla  ac
B D               Orangutan  ac
B D                  Rhesus  ac
B D     Crab-eating macaque  ac
B D                  Baboon  ac
B D            Green monkey  ac
B D                Bushbaby  at
         Chinese tree shrew  ac
B D                   Mouse  a-
B D          Naked mole-rat  a-
B D              Guinea pig  a-
           Brush-tailed rat  a-
B D                     Pig  -c
B D                  Alpaca  -c
             Bactrian camel  -c
B D                 Dolphin  -c
               Killer whale  -c
           Tibetan antelope  -c
B D                     Cow  -c
B D                   Sheep  -c
              Domestic goat  -c
B D                   Horse  -a
B D        White rhinoceros  -a
B D                     Cat  -a
B D                 Ferret   -a
B D                   Panda  -a
             Pacific walrus  -a
               Weddell seal  -a
           Black flying-fox  -a
B D                Hedgehog  -a
B D                Elephant  ac
B D                 Manatee  ac
           Cape golden mole  ac
                   Aardvark  ac
B D               Armadillo  cc
B D                   Shrew  ==
B D                     Rat  ==
       Cape elephant shrew  ==
              Prairie vole  ==
             Big brown bat  ==
      David's myotis (bat)  ==
B D                 Wallaby  ==
    Lesser Egyptian jerboa  ==
B D                  Tenrec  ==
            Golden hamster  ==
B D         Chinese hamster  ==
                Chinchilla  --
B D                Squirrel  ==
B D                     Dog  ==
B D                    Pika  ==
B D         Tasmanian devil  ==
B D                Platypus  ==
               Spotted gar  ==
B D      American alligator  ==
B D                Marmoset  ==
B D         Squirrel monkey  ==
B D                   Chimp  NN
B D                 Opossum  ==
B D                  Gibbon  --

Inserts between block 21 and 22 in window
B D                  Mouse 140bp
B D         Naked mole-rat 1bp
B D             Guinea pig 1bp
          Brush-tailed rat 1bp
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D               Hedgehog 1bp

Alignment block 22 of 243 in window, 141522018 - 141522090, 73 bps 
B D                   Human  ttcaccc--ccgagct-tcttcccactgacctgccaggagactctgcca-tcttttctgaacaaaacccg
B D                 Gorilla  ttcaccc--ccgagct-tcttcccactgacctgccaggagactctgcca-tcttttctgaatgaaacccg
B D               Orangutan  ttcactc--ccgagct-tcttcccactgacctgccaggagactctgcca-tcttttctgaacaaaaccca
B D                  Rhesus  ttcaccc--ccgagct-tcctcccactgacctgccgggagactctgcca-tgttttctaaacaaagcccg
B D     Crab-eating macaque  ttcaccc--ccgagct-tcctcccactgacctgccgggagactctgcca-tcttttctaaacaaagcccg
B D                  Baboon  ttcaccc--ccgagct-tcctcccactgacctgccaggagactctgcca-tcttttctaaacaaagcccg
B D            Green monkey  ttcaccc--ctgagct-tcctcccactgacctgccaggagactctgcca-tcttttctaaacaaagcccg
B D                Bushbaby  ttcaccc--gc-acct-tcctcccactgactggccaggagactttgcca-tcttttctgcacaaagcccc
         Chinese tree shrew  tgca-----------------------gacctgccgggc-cccctgcca-gctgtg-tgaatgtggcctg
B D                Squirrel  tgcaccc--t--accc-tcctcccactggctagccagaggac-ctgcca-tcctttcccacc-aagcct-
B D          Naked mole-rat  tccaccc--c--acct-tcttcctactgacttgccagaggtctctgcca-tcttttctgagc-aagccta
B D              Guinea pig  tcctccc--c--acct-tcttcctactgacttgctagaagactctgctgtttttttctgagc-aaggcca
                 Chinchilla  ------c--t--gaca-ccttcctactgacttgctagaggactct--------------------gccca
           Brush-tailed rat  tccaccc--c--acct-tcttccttctgactttctaaaggactctgccatttttttgtgagc-aagcctg
B D                     Pig  tccaccc--cc-acca-tcctccctttgacttgccagaagattcggccg-tcttctcagaaccaagccc-
B D                  Alpaca  ttcaccc--cc-tcct-tcctcccactgacttgct-gaagatttggcca-tcttctcagagccaagcccg
             Bactrian camel  ttcatcc--cc-gcct-tcctcccactgacttgct-gaagattcggcca-tcttctcagagccaagcccg
B D                 Dolphin  ttcatcc--cc-accg-tcctcccattgacttgccagaaggttctgctg-tcttctcggaaccacgcctg
               Killer whale  ttcatcc--ac-accg-tcctcccattgacttgccagaaggttctgctg-tcttctcggaaccacgcctg
           Tibetan antelope  ttcaccc--cc-tc------------tgatttgccagaagattccgctg-tattctaagaaccaagtctg
B D                     Cow  ttcaccc--cc-tc------------tgacttgccagaagattccaccg-tattctcagaatcaagcctg
B D                   Sheep  ttcaccc--cc-tc------------tgaattgccagaagattccgctg-tattctaagaaccaagcctg
              Domestic goat  ttcaccc--cc-tc------------tgacttgccagaagattctgctg-tattctaagaaccaagcctg
B D                   Horse  tgtgccc--cc-ac---ccccaccactgacttgccagaagattctgccg-tattctcagagcaaagcccc
B D        White rhinoceros  tttgccc--cc-acctgctcccccattgacttgccaggagattctgccg-tcttctcagaacaaagcccc
B D                     Cat  gtca-cc--cc-acct-tcctcccactgatttgccacaagacactgccc-tcttctgagaatcaggccgg
B D                 Ferret   ttca-cc--cc-acct-tcctcccactgagttgtcgcaaggttcttcca-ccttctgagaatcctgctgg
B D                   Panda  ttga-cc--cc-acct-tcctcccatggagttgccggaagat-----------tctgagactctggctgg
             Pacific walrus  ttca-cc--cc-acct-tcctcccactgagttgccggaagat----ctg-ccacctgagaatccggctgg
               Weddell seal  ttca-cc--cc-acct-tcctcccactgagttgccgtaagat----ctg-ccacctgagaatccagctgg
           Black flying-fox  gtcgccc--cc-acct-tcctcccgcctatttgccagaagatt---ctg-ccatttcagaagcaagttca
B D                Hedgehog  ccagccctgcc-tctt-tcctcctctggagttcccaggagggtcctcca-tctcctcagcataaaccctg
B D                Elephant  tttgccc--cc-gcct-tcctccctctgacttgccagaaga--ctgaca-gc-tgtcagaacaaagcctg
B D                 Manatee  ttcgccc--cc-acct-tcctccctctgacttgccagaaga--ctgaca-gcttttcagagcaaagcctg
           Cape golden mole  ttcgccc--cc-gcct-tcctccctctgacttgccggaagcctctgaca-gcttttcagaacaaaccctg
                   Aardvark  cttgccc--cc-gcct-tc--ccctctgacttgcccgaggc-tctgaca-gcttttgggagcaaagcctg
B D               Armadillo  ttcaccc--cc-cctt-gtgtcccgctgacttgccagaagattgtgaca-ccttttcagaacaaagcctg
B D                   Shrew  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
       Cape elephant shrew  ======================================================================
              Prairie vole  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                 Wallaby  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
B D                     Dog  ======================================================================
B D                    Pika  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
               Spotted gar  ======================================================================
B D      American alligator  ======================================================================
B D                Marmoset  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ======================================================================
B D                  Gibbon  ----------------------------------------------------------------------

                      Human  gtggcct
                    Gorilla  gtggcct
                  Orangutan  gtggcct
                     Rhesus  gtggcct
        Crab-eating macaque  gtggcct
                     Baboon  gtggcct
               Green monkey  gtggcct
                   Bushbaby  gtgatct
         Chinese tree shrew  ctggtcc
                   Squirrel  gcgctcc
             Naked mole-rat  ggagtct
                 Guinea pig  ggagtct
                 Chinchilla  ggagtct
           Brush-tailed rat  gtagtct
                        Pig  ctggtct
                     Alpaca  gtgggct
             Bactrian camel  gtggtct
                    Dolphin  gtggtct
               Killer whale  gtggtct
           Tibetan antelope  gtggtct
                        Cow  gtggtct
                      Sheep  gtggtct
              Domestic goat  gtggtct
                      Horse  gtggtct
           White rhinoceros  gtagtct
                        Cat  gcggtct
                    Ferret   ggggtgt
                      Panda  gtggtgt
             Pacific walrus  gtggtgc
               Weddell seal  gtggtgc
           Black flying-fox  gaggtct
                   Hedgehog  gtggtct
                   Elephant  gtggtcc
                    Manatee  gtggtcc
           Cape golden mole  gtggtct
                   Aardvark  gtgatcc
                  Armadillo  gtggtct
                      Shrew  =======
                        Rat  =======
                      Mouse  =======
        Cape elephant shrew  =======
               Prairie vole  =======
              Big brown bat  =======
       David's myotis (bat)  =======
                    Wallaby  =======
     Lesser Egyptian jerboa  =======
                     Tenrec  =======
             Golden hamster  =======
            Chinese hamster  =======
                        Dog  =======
                       Pika  =======
            Tasmanian devil  =======
                   Platypus  =======
                Spotted gar  =======
         American alligator  =======
                   Marmoset  =======
            Squirrel monkey  =======
                      Chimp  NNNNNNN
                    Opossum  =======
                     Gibbon  -------

Alignment block 23 of 243 in window, 141522091 - 141522146, 56 bps 
B D                   Human  atgtgga------------aa-taccgtggct----atttccttgggagccagccactgt--gtcgt--t
B D                 Gorilla  atgtgga------------aa-taccgtggct----atttccctgggagccagccactgt--gtcgt--t
B D               Orangutan  atgtggg------------aa-taccgtggct----atttcctcgggagccagccactgc--atcgt--t
B D                  Rhesus  atgtgga------------aa-taccgtggct----atttcctcaggagccagccactgt--gtcgt--t
B D     Crab-eating macaque  atgtgga------------aa-taccgtggct----atttcctcaggagccagccactgt--gtcgt--t
B D                  Baboon  atgtgga------------aa-taccatggct----atttcctcaggagccagccactgt--gtcgt--t
B D            Green monkey  atgtgga------------aa-taccgtggct----gtttcctcaggagccagccacagt--gtcgt--t
B D                Marmoset  atgtgga------------ca-tatcatggcg----atttccttgggagccagctgctgt----------
B D         Squirrel monkey  atgtgga------------aa-tatcatggct----atttcctcgggagccagccgctgt----------
B D                Bushbaby  atgctga------------aa-tattgtggct----atttccttgggggtcaggtgttgt--gatat--c
         Chinese tree shrew  gtgctga------------aa--gccatggcg----gttgcatcggg-gctggctgctgt--ggt-----
B D                Squirrel  aggctgg------------aa-tagtgtggct----actgcccccgggcctgg---ctgt--gacct--t
B D          Naked mole-rat  gtgctgg------------aa-tgtcgtgggc--------------------------------------
B D              Guinea pig  gtgct-g------------aa-tgttgtgagc----a---------------------------------
                 Chinchilla  gtgct-g------------aa-tgttgtgggc----a---------------------------------
           Brush-tailed rat  gtgct-g------------aa-tgttgtgggc----a---------------------------------
B D                     Pig  atgctga------------aa-tatcttggct----gttgtgtcaggggccagctgctgt--gacct--c
B D                  Alpaca  gcactga------------aa-tgttgtggcc----gttgtgtcaggggccaagcgct-a--gacgt--c
             Bactrian camel  gcactga------------aa-tgttgtggcc----gttgtgtcaggggccaagtgct-c--gacgt--c
B D                 Dolphin  gcactg-------------ag-tattgtggct----gctgtgtcaggggccgacggctgt--gatgt--t
               Killer whale  gcactg-------------ag-tattgtggct----gctgtgtcaggggccgacggctgt--gatgt--t
           Tibetan antelope  gcactg-------------aa-tactggaggt----gttgtgtcaggggctgactgctgt--ggcat--t
B D                     Cow  gcactg-------------aa-tactgtgggt----gttgtgtcaggggctgaccgctgt--gacat--t
B D                   Sheep  gcactg-------------aa-tattgtgggt----gctgtgtcaggggctgactgctgt--gacat--t
              Domestic goat  gcactg-------------aa-tattgtgggg----gtggtgtcaggggctgactgctgt--gacat--t
B D                   Horse  gtgctgg------------aa-tatggtggct----gtcatgtcaggggccacctgctgt--gacgt--c
B D        White rhinoceros  gtgttgt------------ca-tattgtggct----gccgtgtcaggggccggccgctgt--gacct--c
B D                     Cat  gtgctgg------------aa-tgttgtggct----gttgtgtcagcggcctactgctgt--gacac--g
B D                 Ferret   gtgctgg------------ac-tg-tgtggct----ctcgtggtcgggacctgcccctgt--ga-----c
B D                   Panda  gtgttgg------------ac-tg-tgtggct----gttgtggccagggcctacccctgt--gatgc--t
             Pacific walrus  gggctgg------------ac-tg-tgtggct----ctggtgtcaggggcctacccctgt--gatgt--t
               Weddell seal  gggctgg------------ac-tg-tgtggct----ctggtgtcaggggcctacccctgt--gatgt--t
           Black flying-fox  ctgctga------------aa-tggtgtggctgtaggtagtgtcaggggctgacctctgt--gatct--c
B D                Hedgehog  gggcggg------------aa-cactgag--t----gctgagtctggtgctgaccact------------
B D                Elephant  tgtctga------------tg-atcc-tgtct----gctgtgcctggcg-------ctgt--gacgtg--
B D                 Manatee  tggctgattatgtgcctggtg-gtcc-tgtct----gctgtgcctgggg-------ctgt--gacat---
           Cape golden mole  gggctga------------tgaagac-agcct----gctgtgcccgggg-------atgt--gacat---
                   Aardvark  gagctgg------------tc--------gct----gctgtgcctggga-------ctgc--ggcat---
B D               Armadillo  gagctcg------------ag-gcccgaggct----gcggtgccgggag-------ctggcagccgtgct
B D                   Shrew  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
       Cape elephant shrew  ======================================================================
              Prairie vole  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                 Wallaby  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
B D                     Dog  ======================================================================
B D                    Pika  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
               Spotted gar  ======================================================================
B D      American alligator  ======================================================================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ======================================================================
B D                  Gibbon  ----------------------------------------------------------------------

                      Human  gggccct
                    Gorilla  gggccct
                  Orangutan  gggccct
                     Rhesus  gggccct
        Crab-eating macaque  gggccct
                     Baboon  gggccct
               Green monkey  gggccct
                   Marmoset  -------
            Squirrel monkey  -------
                   Bushbaby  aggccct
         Chinese tree shrew  -ggtccc
                   Squirrel  gggtcct
             Naked mole-rat  -------
                 Guinea pig  -------
                 Chinchilla  -------
           Brush-tailed rat  -------
                        Pig  aggccct
                     Alpaca  aggccc-
             Bactrian camel  aggccc-
                    Dolphin  gggccct
               Killer whale  gggccct
           Tibetan antelope  gggccct
                        Cow  gggccct
                      Sheep  gggccct
              Domestic goat  gggccct
                      Horse  aggctct
           White rhinoceros  aggctct
                        Cat  gggca-t
                    Ferret   gagcact
                      Panda  ggtcact
             Pacific walrus  gggcact
               Weddell seal  gggcact
           Black flying-fox  gagccct
                   Hedgehog  -ggcact
                   Elephant  gagcttc
                    Manatee  -------
           Cape golden mole  -------
                   Aardvark  -------
                  Armadillo  gggccct
                      Shrew  =======
                        Rat  =======
                      Mouse  =======
        Cape elephant shrew  =======
               Prairie vole  =======
              Big brown bat  =======
       David's myotis (bat)  =======
                    Wallaby  =======
     Lesser Egyptian jerboa  =======
                     Tenrec  =======
             Golden hamster  =======
            Chinese hamster  =======
                        Dog  =======
                       Pika  =======
            Tasmanian devil  =======
                   Platypus  =======
                Spotted gar  =======
         American alligator  =======
                      Chimp  NNNNNNN
                    Opossum  =======
                     Gibbon  -------

Inserts between block 23 and 24 in window
B D                    Pig 7bp
B D               Hedgehog 3bp

Alignment block 24 of 243 in window, 141522147 - 141522159, 13 bps 
B D                   Human  ggtg---ccactgggg
B D                 Gorilla  ggtg---ccactgggg
B D               Orangutan  ggtg---ccagtgggg
B D                  Rhesus  ggtg---ccactgggg
B D     Crab-eating macaque  ggtg---ctactgggg
B D                  Baboon  ggtg---ccactgggg
B D            Green monkey  ggtg---ccactgggg
B D                Bushbaby  ggaa--cccactgcgg
         Chinese tree shrew  tgca---ccagtggtg
B D                Squirrel  ggag-----tctgagg
B D                  Alpaca  ggta--ctggctgggg
             Bactrian camel  ggta--ctggctgggg
B D                 Dolphin  gcta--ctccctgggg
               Killer whale  gcta--ctccctgggg
           Tibetan antelope  ggta--cttgctgggg
B D                     Cow  ggta--ctcactgggg
B D                   Sheep  ggtg--cttgctgggg
              Domestic goat  ggtg--cttgctgggg
B D                   Horse  gcgt--cacagagg--
B D        White rhinoceros  ggga--cccactggct
B D                     Cat  ggtg--ttcgctgggg
B D                 Ferret   ggta--ctcgctgggg
B D                   Panda  ggta--ctcgtggggg
             Pacific walrus  ggta--ctcactgggg
               Weddell seal  ggta--cttgctgggg
           Black flying-fox  ggtagtcccccggggt
B D                Hedgehog  ggga------ctgagg
B D                Elephant  ggtg--cccgctgtg-
B D                 Manatee  cata--cccactggg-
           Cape golden mole  ------------ggg-
                   Aardvark  ctgg--cccctgggg-
B D               Armadillo  ggga--cccgccggg-
B D                   Shrew  ================
B D                     Rat  ================
B D                   Mouse  ================
       Cape elephant shrew  ================
              Prairie vole  ================
             Big brown bat  ================
      David's myotis (bat)  ================
B D                 Wallaby  ================
    Lesser Egyptian jerboa  ================
          Brush-tailed rat  ----------------
B D                  Tenrec  ================
            Golden hamster  ================
B D         Chinese hamster  ================
                Chinchilla  ----------------
B D              Guinea pig  ----------------
B D          Naked mole-rat  ----------------
B D                     Dog  ================
B D                    Pika  ================
B D         Tasmanian devil  ================
B D                Platypus  ================
               Spotted gar  ================
B D      American alligator  ================
B D                Marmoset  ----------------
B D         Squirrel monkey  ----------------
B D                   Chimp  NNNNNNNNNNNNNNNN
B D                 Opossum  ================
B D                     Pig  ================
B D                  Gibbon  ----------------

Inserts between block 24 and 25 in window
B D               Hedgehog 573bp

Alignment block 25 of 243 in window, 141522160 - 141522176, 17 bps 
B D                   Human  tgggcaggggcta-cagc
B D                 Gorilla  tgggcaggggcta-cagc
B D               Orangutan  tgggcaggggcta-cagc
B D                  Rhesus  tgggcaggggcta-cagc
B D     Crab-eating macaque  tgggcaggggcta-cagc
B D                  Baboon  tgggcaggggcta-cagc
B D            Green monkey  tgggcaggggcta-cagc
B D                Marmoset  --------------gagc
B D         Squirrel monkey  --------------cagc
B D                Bushbaby  tgggcagttgtta-tagt
         Chinese tree shrew  tgggtggctgctg-tgg-
B D                Squirrel  tgggcaaatggctgtggc
B D          Naked mole-rat  -------atggcc-cagc
B D              Guinea pig  taaacaaatggcc-cagc
                 Chinchilla  tgagcaaatgccc-cggc
           Brush-tailed rat  tgagcgaatggcc-cagc
B D                  Alpaca  tgggcagtggcta-cagc
             Bactrian camel  tgggcagtggcta-cagc
B D                 Dolphin  tgggcagcggctg-cagt
               Killer whale  ttggcagcggctg-cagt
           Tibetan antelope  tgggcagtggctg-cctc
B D                     Cow  tgggtaatggctg-cctc
B D                   Sheep  tgagcagtggctg-cctt
              Domestic goat  tgggcagtggctg-cctc
B D                   Horse  -gggcagcagcta-ccgc
B D        White rhinoceros  -gggcagcagcta-cagc
B D                     Cat  -tggcagcggcta-cagg
B D                 Ferret   -tggcagcagctg-caac
B D                   Panda  -caccagcagcta-cggc
             Pacific walrus  -cagcagcggcta-cagc
               Weddell seal  -cagcagcggcta-tagc
           Black flying-fox  -gggcagtggcta-cagc
B D                Elephant  tgagtggggcctg-tagc
B D                 Manatee  tgggcggggccta-cagc
           Cape golden mole  ttggctggggagg-ctgc
                   Aardvark  tgggtgggggcta-cagc
B D               Armadillo  cgggcggcagctc-cggc
B D                   Shrew  ==================
B D                     Rat  ==================
B D                   Mouse  ==================
       Cape elephant shrew  ==================
              Prairie vole  ==================
B D                Hedgehog  ==================
             Big brown bat  ==================
      David's myotis (bat)  ==================
B D                 Wallaby  ==================
    Lesser Egyptian jerboa  ==================
B D                  Tenrec  ==================
            Golden hamster  ==================
B D         Chinese hamster  ==================
B D                     Dog  ==================
B D                    Pika  ==================
B D         Tasmanian devil  ==================
B D                Platypus  ==================
               Spotted gar  ==================
B D      American alligator  ==================
B D                   Chimp  NNNNNNNNNNNNNNNNNN
B D                 Opossum  ==================
B D                     Pig  ==================
B D                  Gibbon  ------------------

Alignment block 26 of 243 in window, 141522177 - 141522177, 1 bps 
B D                   Human  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D                Squirrel  c
B D          Naked mole-rat  a
B D              Guinea pig  c
                 Chinchilla  c
           Brush-tailed rat  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
           Tibetan antelope  c
B D                     Cow  c
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  c
B D        White rhinoceros  c
B D                     Cat  c
B D                 Ferret   c
B D                   Panda  c
             Pacific walrus  c
               Weddell seal  c
           Black flying-fox  c
B D                Elephant  a
B D                 Manatee  c
           Cape golden mole  a
                   Aardvark  a
B D               Armadillo  g
                Spotted gar  a
B D                   Shrew  =
B D                     Rat  =
B D                   Mouse  =
       Cape elephant shrew  =
              Prairie vole  =
B D                Hedgehog  =
             Big brown bat  =
      David's myotis (bat)  =
B D                 Wallaby  =
    Lesser Egyptian jerboa  =
B D                  Tenrec  =
            Golden hamster  =
B D         Chinese hamster  =
B D                     Dog  =
B D                    Pika  =
B D         Tasmanian devil  =
B D                Platypus  =
B D      American alligator  =
B D                   Chimp  N
B D                 Opossum  =
B D                     Pig  =
B D                  Gibbon  -

Alignment block 27 of 243 in window, 141522178 - 141522184, 7 bps 
B D                   Human  cgggct--c
B D                 Gorilla  tgggct--c
B D               Orangutan  cgggct--c
B D                  Rhesus  caggct--c
B D     Crab-eating macaque  caggct--c
B D                  Baboon  caggct--c
B D            Green monkey  caggct--t
B D                Marmoset  caggct--c
B D         Squirrel monkey  cagcct--c
B D                Bushbaby  tgaac----
         Chinese tree shrew  cagacc--t
B D                Squirrel  cagatt--t
B D                   Mouse  tgggtt--t
B D          Naked mole-rat  caggat--t
B D              Guinea pig  caggtt--t
                 Chinchilla  caggtt--t
           Brush-tailed rat  caggtt--t
B D                  Alpaca  caggct--c
             Bactrian camel  caggct--c
B D                 Dolphin  caggct--c
               Killer whale  caggct--c
           Tibetan antelope  aaggct--c
B D                     Cow  caggct--c
B D                   Sheep  caggct--c
              Domestic goat  caggct--c
B D                   Horse  caggct--t
B D        White rhinoceros  t-ggct--t
B D                     Cat  a-ggct--t
B D                 Ferret   a-gtct--t
B D                   Panda  a-ggat--g
             Pacific walrus  a-ggtt--t
               Weddell seal  a-ggct--t
           Black flying-fox  caggct--t
B D                Elephant  caggct---
B D                 Manatee  caggct---
           Cape golden mole  ctggctt--
                   Aardvark  caggca---
B D               Armadillo  caggct-t-
                Spotted gar  ctggcc--t
B D                   Shrew  =========
B D                     Rat  =========
       Cape elephant shrew  =========
              Prairie vole  =========
B D                Hedgehog  =========
             Big brown bat  =========
      David's myotis (bat)  =========
B D                 Wallaby  =========
    Lesser Egyptian jerboa  =========
B D                  Tenrec  =========
            Golden hamster  =========
B D         Chinese hamster  =========
B D                     Dog  =========
B D                    Pika  =========
B D         Tasmanian devil  =========
B D                Platypus  =========
B D      American alligator  =========
B D                   Chimp  NNNNNNNNN
B D                 Opossum  =========
B D                     Pig  =========
B D                  Gibbon  ---------

Inserts between block 27 and 28 in window
          Cape golden mole 44bp

Alignment block 28 of 243 in window, 141522185 - 141522201, 17 bps 
B D                   Human  -tgggaggtgacagaact
B D                 Gorilla  -tgggagatgacagaact
B D               Orangutan  -tgggagatgacagaact
B D                  Rhesus  -tgggagatgacagaact
B D     Crab-eating macaque  -tgggagatgacagaact
B D                  Baboon  -tgggagatgacagaact
B D            Green monkey  -tgggagatgacagaact
B D                Marmoset  -tgcgagatgacagaact
B D         Squirrel monkey  -tgt---atgacagaact
         Chinese tree shrew  -tggg-gccgacatgcct
B D                Squirrel  -gggaggacaatagaact
B D                   Mouse  -tcctagggaatggaact
B D          Naked mole-rat  -ttg--------ggtgct
B D              Guinea pig  -tca--------gaagct
                 Chinchilla  -tca--------ggtgct
           Brush-tailed rat  -tca--------ggagcc
B D                  Alpaca  -tgggggacagcgaactt
             Bactrian camel  -tggggtacagcgaattt
B D                 Dolphin  -gggggtacgacggacct
               Killer whale  -gggggtacgacggacct
           Tibetan antelope  -cgggagacaatgtacct
B D                     Cow  -cgggagacaacgtacct
B D                   Sheep  -cgggagacaacgtacct
              Domestic goat  -cgggagacaacgtacct
B D                   Horse  -tgggagaccacagacct
B D        White rhinoceros  -tcggggaccacagacct
B D                     Cat  -t-ggggacgacagacct
B D                 Ferret   -t-ggggaccacagagct
B D                   Panda  -t-ggggaccac------
             Pacific walrus  -t-ggggagcacagacct
               Weddell seal  -t-ggggagcacagacct
           Black flying-fox  -tggggaacgacagaccg
B D                Elephant  -------------gatgt
B D                 Manatee  -------------ggggt
B D               Armadillo  ------------cgggcc
                Spotted gar  ctaggggaaaagtggcc-
B D                   Shrew  ==================
B D                     Rat  ==================
       Cape elephant shrew  ==================
              Prairie vole  ==================
B D                Hedgehog  ==================
             Big brown bat  ==================
      David's myotis (bat)  ==================
B D                 Wallaby  ==================
    Lesser Egyptian jerboa  ==================
B D                  Tenrec  ==================
            Golden hamster  ==================
B D         Chinese hamster  ==================
B D                     Dog  ==================
B D                    Pika  ==================
          Cape golden mole  ==================
B D         Tasmanian devil  ==================
B D                Platypus  ==================
B D                Bushbaby  ------------------
B D      American alligator  ==================
B D                   Chimp  NNNNNNNNNNNNNNNNNN
B D                 Opossum  ==================
                  Aardvark  ------------------
B D                     Pig  ==================
B D                  Gibbon  ------------------

Inserts between block 28 and 29 in window
B D               Elephant 2bp
B D                Manatee 3bp
B D              Armadillo 10bp

Alignment block 29 of 243 in window, 141522202 - 141522207, 6 bps 
B D                   Human  t--ggctt
B D                 Gorilla  t--ggctt
B D               Orangutan  t--ggctt
B D                  Rhesus  t--ggctt
B D     Crab-eating macaque  t--ggctt
B D                  Baboon  t--ggctt
B D            Green monkey  t--ggctt
B D         Squirrel monkey  t--ggctt
         Chinese tree shrew  t--ggtct
B D                Squirrel  g--ggctg
B D                   Mouse  gcctactg
B D          Naked mole-rat  g--gtctt
B D              Guinea pig  g--gcctt
                 Chinchilla  g--ggctt
           Brush-tailed rat  a--ggctt
B D                  Alpaca  --ctggta
             Bactrian camel  --ctggta
B D                 Dolphin  --ctgcta
               Killer whale  --ctgcta
           Tibetan antelope  --ctgcta
B D                     Cow  --ctttta
B D                   Sheep  --ctgcta
              Domestic goat  --ctgcga
B D                   Horse  --cggttt
B D        White rhinoceros  --cagctt
B D                     Cat  --t-gctg
B D                 Ferret   --t-gttg
             Pacific walrus  --t-gtgg
               Weddell seal  --t-gtgg
           Black flying-fox  --tggctt
B D                Elephant  ----gtgg
B D                 Manatee  ---agtag
B D               Armadillo  --cggctg
                Spotted gar  --tggtgt
B D                   Shrew  ========
B D                     Rat  ========
       Cape elephant shrew  ========
              Prairie vole  ========
B D                Hedgehog  ========
             Big brown bat  ========
      David's myotis (bat)  ========
B D                 Wallaby  ========
    Lesser Egyptian jerboa  ========
B D                   Panda  --------
B D                  Tenrec  ========
            Golden hamster  ========
B D         Chinese hamster  ========
B D                     Dog  ========
B D                    Pika  ========
          Cape golden mole  ========
B D         Tasmanian devil  ========
B D                Platypus  ========
B D                Bushbaby  --------
B D      American alligator  ========
B D                Marmoset  --------
B D                   Chimp  NNNNNNNN
B D                 Opossum  ========
                  Aardvark  --------
B D                     Pig  ========
B D                  Gibbon  --------

Alignment block 30 of 243 in window, 141522208 - 141522219, 12 bps 
B D                   Human  gcgtgctgggtc--
B D                 Gorilla  gcgtgctgggtc--
B D               Orangutan  gcgtgctgggtc--
B D                  Rhesus  gcgtgctgggtc--
B D     Crab-eating macaque  gcgtgctgggtc--
B D                  Baboon  gcgtgctgggtc--
B D            Green monkey  gcgtgctgggtc--
B D                Bushbaby  ----actggggc--
B D                Squirrel  -ggcactgggtc--
B D                   Mouse  -tgggctgggtt--
B D          Naked mole-rat  -gaatagagatc--
B D              Guinea pig  -gaatgcaggtc--
                 Chinchilla  -gtgtacgggtc--
           Brush-tailed rat  -gagtatgggtc--
B D                  Alpaca  gaacatggggtc--
             Bactrian camel  gaacatggggtc--
B D                 Dolphin  ggatactgggtc--
               Killer whale  ggatactgggtc--
           Tibetan antelope  gaaagctgggtc--
B D                     Cow  gaaagctgcgtc--
B D                   Sheep  gaaagctgggtc--
              Domestic goat  gaaagctgggtc--
B D                   Horse  gaatactgggtc--
B D        White rhinoceros  gaatactaggtc--
B D                     Cat  ggatactgagtc--
B D                 Ferret   gaatactgagtc--
B D                   Panda  ----actgagtc--
             Pacific walrus  gaatactgagtc--
               Weddell seal  gaatact--gtc--
           Black flying-fox  gaatcctgggtc--
B D                Elephant  gggtggggggct--
B D                 Manatee  ggggagggggct--
                   Aardvark  ggaggggggg----
B D               Armadillo  ggggacaggacc--
                Spotted gar  ---gagtgtgtgca
B D                   Shrew  ==============
B D                     Rat  ==============
       Cape elephant shrew  ==============
              Prairie vole  ==============
B D                Hedgehog  ==============
             Big brown bat  ==============
      David's myotis (bat)  ==============
B D                 Wallaby  ==============
    Lesser Egyptian jerboa  ==============
B D                  Tenrec  ==============
            Golden hamster  ==============
B D         Chinese hamster  ==============
B D                     Dog  ==============
B D                    Pika  ==============
        Chinese tree shrew  --------------
          Cape golden mole  ==============
B D         Tasmanian devil  ==============
B D                Platypus  ==============
B D      American alligator  ==============
B D                Marmoset  --------------
B D         Squirrel monkey  --------------
B D                   Chimp  NNNNNNNNNNNNNN
B D                 Opossum  ==============
B D                     Pig  ==============
B D                  Gibbon  --------------

Inserts between block 30 and 31 in window
B D               Elephant 1bp
B D                Manatee 1bp
B D              Armadillo 55bp

Alignment block 31 of 243 in window, 141522220 - 141522239, 20 bps 
B D                   Human  c----------tccac------ccactgaccgg-------gca
B D                 Gorilla  c----------tccac------ccactgaccgg-------gca
B D               Orangutan  c----------tccac------ccactgaccgg-------gca
B D                  Rhesus  c----------tccaa------ccactgactgg-------gca
B D     Crab-eating macaque  c----------tccaa------ccactgactgg-------gca
B D                  Baboon  c----------tccaa------ccactgactgg-------gca
B D            Green monkey  c----------tccaa------ccactgactgg-------gc-
B D                Bushbaby  c----------tctgg------cctctgactca-------gaa
         Chinese tree shrew  --------------ga------ctccagactcc-------atg
B D                Squirrel  c----------tccac------ccactgactcc-------atg
B D                   Mouse  t----------tccaca-----tcaatgaacttaactcagaca
B D          Naked mole-rat  c----------tctac-------catggattct-------gca
B D              Guinea pig  ctctaccatcttctac-------catggactct-------ata
                 Chinchilla  c----------cctgc-------catggactct-------gca
           Brush-tailed rat  c----------tctgc-------catggactct-------gca
B D                  Alpaca  c----------tccat------ccactggcctg-------gct
             Bactrian camel  c----------tccat------ccactggcctg-------gct
B D                 Dolphin  c----------t-------------------------------
               Killer whale  c----------t-------------------------------
           Tibetan antelope  c----------t-------------------------------
B D                     Cow  c----------tctat------gccccagt----------gct
B D                   Sheep  c----------t-------------------------------
              Domestic goat  c----------t-------------------------------
B D                   Horse  c----------cccac------ccactgactc-----------
B D        White rhinoceros  c----------tccac------ccactcactc-----------
B D                     Cat  a----------c----------ctcttcactcg--------cg
B D                 Ferret   t----------ctcct------gtcctgactca-------tca
B D                   Panda  t----------ctcct------ctcctgacttg-------gta
             Pacific walrus  t----------ctctt------ctcctgactcg-------gca
               Weddell seal  t----------atcct------ctcctgactcg-------gca
           Black flying-fox  t----------tccac------ccgctgacgtg-------gca
B D                Elephant  -----------------------tgctgtctct-------gcc
B D                 Manatee  -----------------------cactgacttg-------gcc
                   Aardvark  ------------------------------------------c
                Spotted gar  ----------------tgccccacaatggactg-------gcg
B D                   Shrew  ===========================================
B D                     Rat  ===========================================
       Cape elephant shrew  ===========================================
              Prairie vole  ===========================================
B D                Hedgehog  ===========================================
             Big brown bat  ===========================================
      David's myotis (bat)  ===========================================
B D                 Wallaby  ===========================================
    Lesser Egyptian jerboa  ===========================================
B D                  Tenrec  ===========================================
            Golden hamster  ===========================================
B D         Chinese hamster  ===========================================
B D               Armadillo  ===========================================
B D                     Dog  ===========================================
B D                    Pika  ===========================================
          Cape golden mole  ===========================================
B D         Tasmanian devil  ===========================================
B D                Platypus  ===========================================
B D      American alligator  ===========================================
B D                Marmoset  -------------------------------------------
B D         Squirrel monkey  -------------------------------------------
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ===========================================
B D                     Pig  ===========================================
B D                  Gibbon  -------------------------------------------

Alignment block 32 of 243 in window, 141522240 - 141522245, 6 bps 
B D                   Human  gccctc--
B D                 Gorilla  gccctc--
B D               Orangutan  gccctc--
B D                  Rhesus  gccctc--
B D     Crab-eating macaque  gccctc--
B D                  Baboon  gccctc--
B D            Green monkey  gccctc--
B D                Bushbaby  aac-----
         Chinese tree shrew  gacctc--
B D                Squirrel  accctc--
B D                   Mouse  accctc--
B D          Naked mole-rat  gccctc--
B D              Guinea pig  gccc----
                 Chinchilla  gccctc--
           Brush-tailed rat  gccctg--
B D                  Alpaca  gcttcc--
             Bactrian camel  gcttcc--
B D                     Cow  gcagcc--
B D                     Cat  acccgt--
B D                 Ferret   gctctt--
B D                   Panda  gctctt--
             Pacific walrus  gccctt--
               Weddell seal  gccctt--
           Black flying-fox  gccttc--
B D                Elephant  aacctc--
B D                 Manatee  accctc--
                   Aardvark  acactt--
B D      American alligator  gcccta--
                Spotted gar  tcccttcc
B D                   Shrew  ========
B D                     Rat  ========
       Cape elephant shrew  ========
              Prairie vole  ========
B D                Hedgehog  ========
             Big brown bat  ========
      David's myotis (bat)  ========
B D                 Wallaby  ========
    Lesser Egyptian jerboa  ========
B D                  Tenrec  ========
            Golden hamster  ========
B D         Chinese hamster  ========
B D               Armadillo  ========
B D                     Dog  ========
             Domestic goat  --------
B D                    Pika  ========
B D                   Sheep  --------
          Tibetan antelope  --------
              Killer whale  --------
B D                   Horse  --------
          Cape golden mole  ========
B D         Tasmanian devil  ========
B D                Platypus  ========
B D                Marmoset  --------
B D         Squirrel monkey  --------
B D                 Dolphin  --------
B D        White rhinoceros  --------
B D                   Chimp  NNNNNNNN
B D                 Opossum  ========
B D                     Pig  ========
B D                  Gibbon  --------

Inserts between block 32 and 33 in window
B D                  Mouse 336bp

Alignment block 33 of 243 in window, 141522246 - 141522252, 7 bps 
B D                   Human  -------agccgcc------
B D                 Gorilla  -------agccgcc------
B D               Orangutan  -------agccacc------
B D                  Rhesus  -------agctgcc------
B D     Crab-eating macaque  -------agctgcc------
B D                  Baboon  -------agctgcc------
B D            Green monkey  -------agctgct------
B D                Bushbaby  ---------tcacc------
         Chinese tree shrew  -------agccgtt------
B D                Squirrel  -------agcctcc------
B D          Naked mole-rat  -------agccatc------
B D              Guinea pig  --------accatc------
                 Chinchilla  -------agccatc------
           Brush-tailed rat  -------agccatc------
B D                  Alpaca  -------agaggc-------
             Bactrian camel  -------agaggct------
B D                     Cow  -------cttggtc------
B D                     Cat  -------ggccagc------
B D                 Ferret   -------ggccagc------
B D                   Panda  -------gggcagg------
             Pacific walrus  -------ggccagc------
               Weddell seal  -------ggccagc------
           Black flying-fox  -------ggccagc------
B D                Elephant  -------aaccaat------
B D                 Manatee  -------aaccaac------
                   Aardvark  -------ggccaac------
B D      American alligator  -------ctccaca------
                Spotted gar  agggtgtaccctgcctcgca
B D                   Shrew  ====================
B D                     Rat  ====================
B D                   Mouse  ====================
       Cape elephant shrew  ====================
              Prairie vole  ====================
B D                Hedgehog  ====================
             Big brown bat  ====================
      David's myotis (bat)  ====================
B D                 Wallaby  ====================
    Lesser Egyptian jerboa  ====================
B D                  Tenrec  ====================
            Golden hamster  ====================
B D         Chinese hamster  ====================
B D               Armadillo  ====================
B D                     Dog  ====================
             Domestic goat  --------------------
B D                    Pika  ====================
B D                   Sheep  --------------------
          Tibetan antelope  --------------------
              Killer whale  --------------------
B D                   Horse  --------------------
          Cape golden mole  ====================
B D         Tasmanian devil  ====================
B D                Platypus  ====================
B D                Marmoset  --------------------
B D         Squirrel monkey  --------------------
B D                 Dolphin  --------------------
B D        White rhinoceros  --------------------
B D                   Chimp  NNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ====================
B D                     Pig  ====================
B D                  Gibbon  --------------------

Inserts between block 33 and 34 in window
            Bactrian camel 35bp
B D                    Cow 3bp
B D               Elephant 2bp
B D                Manatee 2bp
                  Aardvark 2bp

Alignment block 34 of 243 in window, 141522253 - 141522268, 16 bps 
B D                   Human  actgctgattttc--gtg
B D                 Gorilla  actgctgattttc--gtg
B D               Orangutan  actgctgattttc--gtg
B D                  Rhesus  gctgctgattttc--gtg
B D     Crab-eating macaque  gctgctgattttc--gtg
B D                  Baboon  gctgctgattttc--gtg
B D            Green monkey  gctgctgattttc--gtg
B D                Bushbaby  atcatgggtcttt--ggg
         Chinese tree shrew  gctgctgcttttagggtg
B D                Squirrel  atggcttc-ttta--ggc
B D          Naked mole-rat  actgctgctttta--ggg
B D              Guinea pig  actgctgcttttg--agg
                 Chinchilla  actgttgcttttg--ggg
           Brush-tailed rat  actgctgcttttg--ggg
B D                  Alpaca  ---------tcgg--g--
B D                 Dolphin  ----c-cacccac--c--
               Killer whale  ----c-cacccac--c--
           Tibetan antelope  ----cttatccag--g--
B D                     Cow  ---gcttatccag--g--
B D                   Sheep  ----cttcttcag--g--
              Domestic goat  ----cttatccag--g--
B D                   Horse  ------tcttctc--c--
B D        White rhinoceros  ------tcttccc--t--
B D                     Cat  ---atttcccccg--a--
B D                 Ferret   ---acttcctctg--g--
B D                   Panda  ---actccccctg--g--
             Pacific walrus  ---actccttctg--g--
               Weddell seal  ---actccttctg--g--
           Black flying-fox  ---gctgcttctg--a--
B D                Elephant  tttagggacttgg--g--
B D                 Manatee  cgtagagac-cag--g--
                   Aardvark  tttagggactcag--g--
B D      American alligator  gctcctgatgcc------
                Spotted gar  gctgttgcttgct--ggg
B D                   Shrew  ==================
B D                     Rat  ==================
B D                   Mouse  ==================
       Cape elephant shrew  ==================
              Prairie vole  ==================
B D                Hedgehog  ==================
             Big brown bat  ==================
      David's myotis (bat)  ==================
            Bactrian camel  ==================
B D                 Wallaby  ==================
    Lesser Egyptian jerboa  ==================
B D                  Tenrec  ==================
            Golden hamster  ==================
B D         Chinese hamster  ==================
B D               Armadillo  ==================
B D                     Dog  ==================
B D                    Pika  ==================
          Cape golden mole  ==================
B D         Tasmanian devil  ==================
B D                Platypus  ==================
B D                Marmoset  ------------------
B D         Squirrel monkey  ------------------
B D                   Chimp  NNNNNNNNNNNNNNNNNN
B D                 Opossum  ==================
B D                     Pig  ==================
B D                  Gibbon  ------------------

Inserts between block 34 and 35 in window
B D                Dolphin 2bp
              Killer whale 2bp
          Tibetan antelope 2bp
B D                    Cow 2bp
B D                  Sheep 2bp
             Domestic goat 2bp
B D                  Horse 3bp
B D       White rhinoceros 3bp
B D                    Cat 3bp
B D                Ferret  3bp
B D                  Panda 3bp
            Pacific walrus 3bp
              Weddell seal 3bp
          Black flying-fox 3bp

Alignment block 35 of 243 in window, 141522269 - 141522305, 37 bps 
B D                   Human  --------------cctta--gtcct------cagctgtgag-----ggggaaca-c-agcaacag
B D                 Gorilla  --------------cctta--gtcct------cagctgtgag-----ggggaaca-c-agcaacag
B D               Orangutan  --------------cctta--gtcct------cagctgtgag-----ggggaaca-c-agcaacgg
B D                  Rhesus  --------------cctta--gtcct------cagctgtgag-----ggggaaca-c-agcaacag
B D     Crab-eating macaque  --------------cctta--gtcct------cagctgtgag-----ggggaaca-c-agcaacag
B D                  Baboon  --------------cctta--gtcct------cggctgtgag-----ggggaaca-c-agcaacag
B D            Green monkey  --------------cctta--gtcct------cggctgtgag-----ggggaaca-c-agcaacag
B D                Bushbaby  --------------gcgcagggccct------cagctgtagt-----ccagaata-c-aacaccag
         Chinese tree shrew  --------------tctgg--gtcct------cagccgctag----tgggggaca-cgagctgt--
B D                Squirrel  --------------ctccagagtcctagagaaaaactgcagagcccctctgggct-c---------
B D          Naked mole-rat  --------------gtttgggatcct------ca-ctgaaaa--------------c---------
B D              Guinea pig  --------------gttttggatcct------cagctgaaaa--------------c---------
                 Chinchilla  --------------gttcaggatcct------cagctgaaaa--------------c---------
           Brush-tailed rat  --------------atgt-gggtcct------cagctgaaaa---------gatg-t---------
B D                  Alpaca  ----------------------ccct------cagccttagg-----tgggagct----gccacag
             Bactrian camel  ---------------cttgg-gccct------cagccgtagg-----tggaagct----gccacaa
B D                 Dolphin  ---------------cctgg-ggctt------cagcagtagg-----taggagca------tacgg
               Killer whale  ---------------cctgg-ggctt------cagcagtagg-----taggagca------tacgg
           Tibetan antelope  ---------------ctcag-gtcct------cagtggtagg-----tgggggcaac-ggtcacgg
B D                     Cow  ---------------ctcag-gtcct------cagtggtagg-----tgggggca-t-gatcatgg
B D                   Sheep  ---------------ctcag-gtcct------cagtggtagg-----tgggggcaac-ggtcacgg
              Domestic goat  ---------------ctcag-gtcct------cagtggtagg-----tgggggcagc-ggtcacgg
B D                   Horse  ---------------ctcgg-gtcct------cagctgtcag-----tgggagca-c-ggtcacag
B D        White rhinoceros  ---------------ctcgg-gtcct------cggctgtcag-----caggagca-c-agtcacag
B D                     Cat  ---------------cttgg-gtcct------cagctgggag-----ggggagca-c-ggtcatgg
B D                 Ferret   ---------------cctg---------------------------------------ggtcgtgg
B D                   Panda  ---------------cttg---------------------------------------ggtcgtgg
             Pacific walrus  ---------------tttg---------------------------------------ggttgtgg
               Weddell seal  ---------------cttg---------------------------------------ggttgtgg
           Black flying-fox  ---------------ccggg-gtcct------cagccataag-----tgggagca-c-cgtcgcag
B D                Elephant  ---------------------gtcct------catccattca-----caggaaca-c-----acag
B D                 Manatee  ---------------------gccct------cgtctgtaca-----cgggaaca-c-tctagcgg
                   Aardvark  ---------------------gtcct------ggtctgtaca-----ca-gaaca-c-attggcgg
B D      American alligator  ----------------------cctt------tcccccctga-----cgtgggca-c-acccg---
                Spotted gar  ctaggctccggttctcctggcaccct----------------------------------------
B D                   Shrew  ==================================================================
B D                     Rat  ==================================================================
B D                   Mouse  ==================================================================
       Cape elephant shrew  ==================================================================
              Prairie vole  ==================================================================
B D                Hedgehog  ==================================================================
             Big brown bat  ==================================================================
      David's myotis (bat)  ==================================================================
B D                 Wallaby  ==================================================================
    Lesser Egyptian jerboa  ==================================================================
B D                  Tenrec  ==================================================================
            Golden hamster  ==================================================================
B D         Chinese hamster  ==================================================================
B D               Armadillo  ==================================================================
B D                     Dog  ==================================================================
B D                    Pika  ==================================================================
          Cape golden mole  ==================================================================
B D         Tasmanian devil  ==================================================================
B D                Platypus  ==================================================================
B D                Marmoset  ------------------------------------------------------------------
B D         Squirrel monkey  ------------------------------------------------------------------
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ==================================================================
B D                     Pig  ==================================================================
B D                  Gibbon  ------------------------------------------------------------------

Inserts between block 35 and 36 in window
B D               Elephant 1bp
B D                Manatee 1bp
                  Aardvark 1bp

Alignment block 36 of 243 in window, 141522306 - 141522352, 47 bps 
B D                   Human  gacct-ctggggagct--gctgag-ggg-atcatg-agagagactgttggtca
B D                 Gorilla  gacct-ctggggagct--gctgag-ggg-atcatg-agagagactgttggtca
B D               Orangutan  gacct-ccggggagct--gctggg-ggg-atcatg-agagagactgtcggtca
B D                  Rhesus  gacctcctggggagct--gctggg-ggg-atcatg-agagagactgtcggtca
B D     Crab-eating macaque  gacctcctggggagct--gctggg-ggg-atcatg-agagagactgtcggtca
B D                  Baboon  gacctcctggggagct--gctggg-ggg-atcatg-agagagactgtcggtca
B D            Green monkey  gacctcctggggagct--gctggg-ggg-atcatg-agagagactgttggtca
B D                Bushbaby  --cctcctggaga------ctgtgcagg-gttggg-agagagatgg--ggttg
         Chinese tree shrew  --catcttgggg------gctgtg-ggg-gccatg-tcag----tgtcggcca
B D                Squirrel  -------------------------ctg-gggttg-tgggggac-gtgggtga
B D          Naked mole-rat  -------------------------aag-ggtgtgatgaggtactgcttgtca
B D              Guinea pig  -------------------------aag-gatgtg-tgaggtagtcctggtca
                 Chinchilla  -------------------------aac-gatgtg-tgaggtactgctggtca
           Brush-tailed rat  -------------------------aaa-gatgtg-tgaagtcctgctggaga
B D                  Alpaca  cgcctccgtgcgggcc--actggg-gg--aaggtg-tggggtct-gctgctcc
             Bactrian camel  cgcctccgtgcgggcc--tccggg-gg--aaggtg-tggggtct-gctgctcc
B D                 Dolphin  tggctccgggtgggtt--gctggg-ggtggaggcg-ggcgatcccgttggtct
               Killer whale  tggctccgggcgggtt--gctggg-ggtggaggcg-ggcgatcccgttggtct
           Tibetan antelope  tgcttccaggcaggcc--gctggg-ggt-gaggtg-ggagagctcattgttca
B D                     Cow  tgcttccgggtgagac--gctgaa-ggg-gaggtg-ggagagctcattgttta
B D                   Sheep  tgcttcgaggcaggcc--gctggg-ggt-gaggtg-ggacagctcactgttca
              Domestic goat  tgcttccaggcaggcc--gctggg-ggt-gaggtg-ggagagctcattgttca
B D                   Horse  tgcctcctcgaggatt--actggc-ag--catgtg-ggggatctgggcgggca
B D        White rhinoceros  agcctcctggcagggt--gctggg-ag--gatgcg-ggcgatctggctggtca
B D                     Cat  ggtctccttgcgggct--g-tggg-gg--g-tgtg-ga---tctcctcggtcg
B D                 Ferret   ggtctcctcctgggct--gttggg-gg--gatgcg-gg---gcccatcagtca
B D                   Panda  gaccatctcctgggct--g-tagg-ga--aatgtg-gg---tctcatcggtca
             Pacific walrus  ggcctcctcctgggct--g-tggg-ag--gatgcg-gg---tctcgtcggtca
               Weddell seal  ggcctcctcctgggct--g-tggg-ag--gatgtg-gg---tctcgtcggtca
           Black flying-fox  tgtctgcttgcgggtc--actgga-gg--ggcgag-ag--agcttacaggtca
B D                Elephant  -gtctcctcatgggtt--gctggg-gtg-ac--tg-tgagatattggcggtca
B D                 Manatee  -gtctcctcatgggtt--gctggg-gtg-attgtg-tgagacacggttggtca
           Cape golden mole  -gtctcctcatgggtt--gctggg-gcg-attgga-tgagatactgtctgtca
                   Aardvark  -gtctctccgcaggtt--gctggg-gtg-at-----tgagatcccatcggtca
B D      American alligator  ggtctct-------ca--actcgg-ggt-gtcgca-gggccccccatggtgca
                Spotted gar  ------------gacttggatgaa-gcg-gttaga-aaagaaagggttggtgg
B D                   Shrew  =====================================================
B D                     Rat  =====================================================
B D                   Mouse  =====================================================
       Cape elephant shrew  =====================================================
              Prairie vole  =====================================================
B D                Hedgehog  =====================================================
             Big brown bat  =====================================================
      David's myotis (bat)  =====================================================
B D                 Wallaby  =====================================================
    Lesser Egyptian jerboa  =====================================================
B D                  Tenrec  =====================================================
            Golden hamster  =====================================================
B D         Chinese hamster  =====================================================
B D               Armadillo  =====================================================
B D                     Dog  =====================================================
B D                    Pika  =====================================================
B D         Tasmanian devil  =====================================================
B D                Platypus  =====================================================
B D                Marmoset  -----------------------------------------------------
B D         Squirrel monkey  -----------------------------------------------------
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  =====================================================
B D                     Pig  =====================================================
B D                  Gibbon  -----------------------------------------------------

Inserts between block 36 and 37 in window
B D     American alligator 5bp
               Spotted gar 4bp

Alignment block 37 of 243 in window, 141522353 - 141522358, 6 bps 
B D                   Human  ---tgcccc
B D                 Gorilla  ---tgcccc
B D               Orangutan  ---tgcccc
B D                  Rhesus  ---cccccc
B D     Crab-eating macaque  ---cgcccc
B D                  Baboon  ---cgcccc
B D            Green monkey  ---cgcccc
B D                Marmoset  ---tggctt
B D                Bushbaby  ---ggcttc
         Chinese tree shrew  ---tac---
B D                Squirrel  ---ggcccc
B D          Naked mole-rat  ---gtcctc
B D              Guinea pig  ---ggcctc
                 Chinchilla  ---ggcctc
           Brush-tailed rat  ---gagaga
B D                  Alpaca  ---accccc
             Bactrian camel  ---agcccg
B D                 Dolphin  ---ggcccc
               Killer whale  ---ggcccc
           Tibetan antelope  ---ggcccc
B D                     Cow  ---gacccc
B D                   Sheep  ---ggcccc
              Domestic goat  ---ggcccc
B D                   Horse  ---ggtccc
B D        White rhinoceros  ---ggcccc
B D                     Cat  ---ggtccc
B D                 Ferret   ---ggtccc
B D                   Panda  ---ggtccg
             Pacific walrus  ---agtccc
               Weddell seal  ---ggtccc
           Black flying-fox  ----gcccc
B D                Elephant  ---ggcccc
B D                 Manatee  ---tgcccc
           Cape golden mole  ---gatccc
                   Aardvark  ---ggcccc
B D      American alligator  ----ttccc
                Spotted gar  tataac---
B D                   Shrew  =========
B D                     Rat  =========
B D                   Mouse  =========
       Cape elephant shrew  =========
              Prairie vole  =========
B D                Hedgehog  =========
             Big brown bat  =========
      David's myotis (bat)  =========
B D                 Wallaby  =========
    Lesser Egyptian jerboa  =========
B D                  Tenrec  =========
            Golden hamster  =========
B D         Chinese hamster  =========
B D               Armadillo  =========
B D                     Dog  =========
B D                    Pika  =========
B D         Tasmanian devil  =========
B D                Platypus  =========
B D         Squirrel monkey  ---------
B D                   Chimp  NNNNNNNNN
B D                 Opossum  =========
B D                     Pig  =========
B D                  Gibbon  ---------

Inserts between block 37 and 38 in window
B D     American alligator 2bp

Alignment block 38 of 243 in window, 141522359 - 141522430, 72 bps 
B D                   Human  cgatccc-agcctggcacg--------------------gtgagagcccaa----cagagaga-gggcag
B D                 Gorilla  cgatccc-agcctggcaca--------------------gtgagagcccaa----cagagaga-gggcag
B D               Orangutan  cagtccc-agcctggcaca--------------------gtgagagcccga----cagagaga-gggcag
B D                  Rhesus  cggtttc-agcctggca----------------------gtgagagcccaa----cagagaga-gggcag
B D     Crab-eating macaque  cggtttc-agcctggca----------------------gtgagagcccaa----cagagaga-gggcag
B D                  Baboon  cggtttc-agcctggta----------------------gtgagagcccaa----cagagaga-gggcag
B D            Green monkey  cggtttc-agcctggca----------------------gtgagagcccaa----cagagaga-gggcat
B D                Marmoset  cgattcc-agcctggcaca--------------------gagaaagcccca----cagagaga-gggcgg
B D         Squirrel monkey  cgattcc-agcctggcac----------------------------------------agtga-gagcag
B D                Bushbaby  tgggctc-agcctgctg--------------------------------------ccaagaga-gggaag
         Chinese tree shrew  ----cct-ggcctggctca--------------------gggaaag-ccag----cagagaga-ggccag
B D                Squirrel  tgggcct---gctgggaca--------------------gtg--agcccag----caggtaga-g-gcaa
B D          Naked mole-rat  tgggccc-tgcctagcatg--------------------gtgacagcccga----cagagaga-gggcag
B D              Guinea pig  tgggcccttgcctagcatg--------------------gggacagccgac-----agagaga-gggcag
                 Chinchilla  tgggccc-tgcttagcatg--------------------gggatagcctta-----cgagaga-gggcag
           Brush-tailed rat  gagagag-agagagagaga--------------------gagagagagagagagagagagaga-gagaga
B D                  Alpaca  tgggccg--gcctggctcc------------------cggtgggagcctgg----cagaga----ggcag
             Bactrian camel  tgggccg--gcctggctcc------------------cggtgggagcccgg----tagaga----ggcag
B D                 Dolphin  tgggtcg--gcctggcaca------------------cggtgagagccc-a----caggga----ggcag
               Killer whale  tgggtcg--gcctggcaca------------------cggtgagagccc-a----cagaga----ggcag
           Tibetan antelope  tgggttg--gcctggcatg------------------cagtgacagccc-a----cagag-----gccag
B D                     Cow  tgggtcg--gcctggcatg------------------caatgccagccc-a----cagag-----gccag
B D                   Sheep  tggctcg--gcctggcatg------------------cagtgacacccc-a----cagag-----gccag
              Domestic goat  tggctcg--ggctggcacg------------------cagcgacacccc-a----cagag-----gccag
B D                   Horse  tgggcca--gcctggcaca------------------tggcaggaacccag----cagagaga-gggcag
B D        White rhinoceros  tgggccg--gcctggcaca------------------tggagagagcctga----cagagaga-gggcag
B D                     Cat  tgggctc-cacctggccca--------------------gtgggagcccga----cagagaga-ggacag
B D                 Ferret   taggccg-cgcctggccca------------------cagtgagaacccaa----cagggaga-cgacag
B D                   Panda  tgggccc-cgcctggccca------------------cggtgagagcccga----cagggaga-ggacag
             Pacific walrus  tgggccc-tgcctggccca------------------cggtgagagcctga----cggggaga-ggacag
               Weddell seal  tgggccc-tgcctggccca------------------cggtgagagcctga----cagggaga-ggacag
           Black flying-fox  caggctt-ggcctggcccc------------------tggcgagagccgga----cagggagc-gg--ag
B D                Elephant  tgggcct-ggcct-gtgca------------------aggcaagagccaca----cagtgagg-gagctg
B D                 Manatee  tgggccc-agcct-gcaaa------------------aggcaagagtcaca----cagc-----aagctg
           Cape golden mole  tgggcct-ggact-gcaca------------------tgtcag---------------------gaacaa
                   Aardvark  tgagttc-agcct-gcaca------------------tggcaa---------------------gagc--
B D      American alligator  gcggcca-gcgctggct----------------------ctgggtctccag----ctgacccctgtgctg
                Spotted gar  caatccc-gctccggaaaaaagaattccctgcggaacaggtcagcgcttaa----aagaggcc-ccgcag
B D                   Shrew  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
       Cape elephant shrew  ======================================================================
              Prairie vole  ======================================================================
B D                Hedgehog  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                 Wallaby  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
B D               Armadillo  ======================================================================
B D                     Dog  ======================================================================
B D                    Pika  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ======================================================================
B D                     Pig  ======================================================================
B D                  Gibbon  ----------------------------------------------------------------------

                      Human  ctgtttctcc----atgatgggccgcactccc
                    Gorilla  ctgtttctcc----atgatgggccgcactccc
                  Orangutan  ctgtttctcc----atgatggggcacactccc
                     Rhesus  ctgtttcccc----atgacgggccacactccc
        Crab-eating macaque  ctgtttcccc----atgacgggccacactccc
                     Baboon  ctgtttcccc----atgacggg----------
               Green monkey  ctgtttcccc----atgatgggccacactccc
                   Marmoset  ctgtttcccc----gtgatgggccatgctccc
            Squirrel monkey  ctgtttcccc----gtgatgggccacgctccc
                   Bushbaby  ttgcctccct----gccatgggcccctctctc
         Chinese tree shrew  ccatttcccc--------tgggcc--------
                   Squirrel  cagtctcctc----cc--ctgcccactc--tg
             Naked mole-rat  ctgtttccac----ag--ctgtccactc--tg
                 Guinea pig  ctgtttccac----ag--ctgtctactctctg
                 Chinchilla  ctgtttccac----ac--ctgtccactctttg
           Brush-tailed rat  ctgttcctac----ag--ctgtccactctttg
                     Alpaca  ctgtttccgc----aggaccgcccactctccc
             Bactrian camel  ctgtttccgc----aggaccgcccactctccc
                    Dolphin  atgattccac---cgggatcgtccactctgcc
               Killer whale  atgattccac---cgggatcgtccactctgcc
           Tibetan antelope  ctgtttccac---tgggactgtgcactct-ct
                        Cow  ctatttccgc---tgggactgtgcactct-ct
                      Sheep  ctgtttccac---tgggactgtgcactct-ct
              Domestic goat  ctgttcccac---tgggactgcgcactct-ct
                      Horse  ccatttccac---caggattggctattctccc
           White rhinoceros  ccgtgtccac---caggattgtccactctccc
                        Cat  ccgtgtccac---tggg---------------
                    Ferret   ccatttccac---cgtgactgtccactctccc
                      Panda  ctctttccac---cgtgactgtccactctccc
             Pacific walrus  -tgtttccac---tgcgactgcccactctccc
               Weddell seal  -ggtttccac---catgactgtccactctccc
           Black flying-fox  ctgcttcc------------------------
                   Elephant  gcactgccattgctgtgattgtcccctccc--
                    Manatee  gggctgccacttctgtgattgctccctccc--
           Cape golden mole  gcacatctactattgtgactg-tcccttcc--
                   Aardvark  -------------tgtgactgtcctctctc--
         American alligator  cacgtggcac---cggcacggaccc-------
                Spotted gar  taat----------------------------
                      Shrew  ================================
                        Rat  ================================
                      Mouse  ================================
        Cape elephant shrew  ================================
               Prairie vole  ================================
                   Hedgehog  ================================
              Big brown bat  ================================
       David's myotis (bat)  ================================
                    Wallaby  ================================
     Lesser Egyptian jerboa  ================================
                     Tenrec  ================================
             Golden hamster  ================================
            Chinese hamster  ================================
                  Armadillo  ================================
                        Dog  ================================
                       Pika  ================================
            Tasmanian devil  ================================
                   Platypus  ================================
                      Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Opossum  ================================
                        Pig  ================================
                     Gibbon  --------------------------------

Inserts between block 38 and 39 in window
B D                Ferret  61bp
B D                  Panda 5bp
            Pacific walrus 113bp
              Weddell seal 113bp

Alignment block 39 of 243 in window, 141522431 - 141522464, 34 bps 
B D                   Human  tgccctatat-------------------gc-aggctggcacagacaccttccc
B D                 Gorilla  tgccctatat-------------------gc-aggctggcacagacaccttccc
B D               Orangutan  tgccccatat-------------------gc-aggctggcacagacaccttccc
B D                  Rhesus  tgccc-atat-------------------gc-aggctggcacagacaccttccc
B D     Crab-eating macaque  tgccc-atat-------------------gc-aggctggcacagacaccttccc
B D            Green monkey  tgccc-atat-------------------gc-aggctggcacagacaccttccc
B D                Marmoset  tgccccacat-------------------gg-agtctggcacagacaccttccc
B D         Squirrel monkey  tgccccacat-------------------aacgggctggcacagacaccttccc
B D                Bushbaby  tctcctacct-------------------gt-aggctgctccag---cccctcc
         Chinese tree shrew  --------------------------------ggtctg----------------
B D                Squirrel  cctccccgg---------------------c-aggctggtctagct--cttcct
B D          Naked mole-rat  tctcccacac-------------------tc-aggctggcccagctgccttcct
B D              Guinea pig  tctgccctgc-------------------tc-aggctggctcagcggccttcct
                 Chinchilla  tctcccatac-------------------tc-aggctggcccagctgccttcct
           Brush-tailed rat  tctcccacac-------------------tc-aggctggcccagccgccttcct
B D                  Alpaca  -----------------------------gg-cagctggtgcacgtcccggcgt
             Bactrian camel  -----------------------------gg-cagctagtgcgcgt--------
B D                 Dolphin  -----------------------------ag-cggctagca-------------
               Killer whale  -----------------------------ag-cggctagca-------------
           Tibetan antelope  -----------------------------tt-cagctagc--------------
B D                     Cow  -----------------------------gg-cagctagc--------------
B D                   Sheep  -----------------------------tt-cagctagc--------------
              Domestic goat  -----------------------------ct-cagctagc--------------
B D                   Horse  -----------------------------ag-gggccatca-------------
B D        White rhinoceros  -----------------------------gg-tggctatca-------------
B D                     Cat  ------------aga--------------gt-ggacagtca-------------
           Black flying-fox  --------agcaggaccgtccacccgcccag-gggctgata-------------
B D                Elephant  tccttcatgt-------------------gc-cgcctggcctaggc--------
B D                 Manatee  tcctccatgt-------------------gc-cacctggactaggc--------
           Cape golden mole  tcctccatgt-------------------gt-agtctggcctgggt--------
                   Aardvark  ccctccatgt-------------------gc-tg-ctgtcctgggc--------
B D      American alligator  --cgtcctgg-------------------ac-tggccggtgcaggcgctggacc
                Spotted gar  -------------------------------aacttcatttcgttttcctttcc
B D                   Shrew  ======================================================
B D                     Rat  ======================================================
B D                   Mouse  ======================================================
       Cape elephant shrew  ======================================================
              Prairie vole  ======================================================
B D                Hedgehog  ======================================================
             Big brown bat  ======================================================
      David's myotis (bat)  ======================================================
B D                 Wallaby  ======================================================
    Lesser Egyptian jerboa  ======================================================
B D                   Panda  ======================================================
B D                  Tenrec  ======================================================
            Golden hamster  ======================================================
B D         Chinese hamster  ======================================================
B D                 Ferret   ======================================================
B D               Armadillo  ======================================================
B D                     Dog  ======================================================
B D                    Pika  ======================================================
B D         Tasmanian devil  ======================================================
B D                Platypus  ======================================================
              Weddell seal  ======================================================
            Pacific walrus  ======================================================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ======================================================
B D                  Baboon  ------------------------------------------------------
B D                     Pig  ======================================================
B D                  Gibbon  ------------------------------------------------------

Inserts between block 39 and 40 in window
B D     American alligator 12bp

Alignment block 40 of 243 in window, 141522465 - 141522501, 37 bps 
B D                   Human  cagggctaaggggggccatcag--ctttt-ccc----------------------------cagcacc
B D                 Gorilla  cagggctaaggggggccatcag--ctttt-ccc----------------------------cagcacc
B D               Orangutan  cagggctaaggggggccatcgg--ctttt-ccc----------------------------cagcacc
B D                  Rhesus  cagggctaaggggggccatcgg--ctttt-ccc----------------------------cagcacc
B D     Crab-eating macaque  cagggctaaggggggccatcgg--ctttt-ccc----------------------------cagcacc
B D                  Baboon  --------------------------------c----------------------------cagcacc
B D            Green monkey  cagggctaaggggggccatcgg--ctttt-ccc----------------------------cagcacc
B D                Marmoset  cggggctaa-gggggccatggg--cttct-ccc----------------------------cagcatc
B D         Squirrel monkey  cagggctaa-gggggccatggg--cttct-ccc----------------------------cagcacc
B D                Bushbaby  ctgggctg----------------------ccc----------------------------cgacacc
         Chinese tree shrew  ------------------------ctctc-ctc----------------------------caccgcc
B D                Squirrel  -ggagctcc-ga--gccactgg--cttct-ccc----------------------------caacccc
B D          Naked mole-rat  --gagctaa-gaaggtcatcgg--cttct-cct----------------------------cagtgcc
B D              Guinea pig  --gggctga-gaaggccatccg--cttct-ctt----------------------------cagtgcc
                 Chinchilla  --gagctaa-gaaggccatcag--ctttt-cct----------------------------tggtgcc
           Brush-tailed rat  --gagctaa-gaaggccattgg--cttct-cct----------------------------cagtgcc
B D                  Alpaca  cttaacccagggtggccaccctcctctgt-ccc---------ggctcc--------------------
             Bactrian camel  ---------------ccaccctcctctgt-cct---------ggctcc--------------------
B D                 Dolphin  ------------------------cttgt-tcc-----------------------------------
               Killer whale  ------------------------cttgt-tcc-----------------------------------
           Tibetan antelope  ------------------------cttgt-ccc-----------------------------------
B D                     Cow  ------------------------cttgt-ccc-----------------------------------
B D                   Sheep  ------------------------cttgt-ccc-----------------------------------
              Domestic goat  ------------------------cttgt-ccc-----------------------------------
B D                   Horse  ------------------------cttgtcccc-----------------------------------
B D        White rhinoceros  ------------------------cttgt-ccc-----------------------------------
B D                     Cat  ------------------------ctcgt-gcc-----------------------------------
           Black flying-fox  ------------------------ttgtc-ctc-----------------------------------
B D                Elephant  -------------------tag--tttca-ccc-----------------------------agcccc
B D                 Manatee  -------------------tgg--cttca-ccc-----------------------------agcgcc
           Cape golden mole  -------------------cag--cttca-ccc-----------------------------agctgc
                   Aardvark  -------------------cgg--cttca-tcc-----------------------------ag-tcc
B D                Platypus  cagggattatgcatatcatcag--ctctt-ccc----------------------------aaaaact
B D      American alligator  gcaggctgctgtgggcccgatc--cttgt-cccctcccagccggctcctgccccagtcccgcagcgc-
                Spotted gar  tagtgctggggagaagctgcgc--cattt-cct----------------------------cagcacc
B D                   Shrew  ====================================================================
B D                     Rat  ====================================================================
B D                   Mouse  ====================================================================
       Cape elephant shrew  ====================================================================
              Prairie vole  ====================================================================
B D                Hedgehog  ====================================================================
             Big brown bat  ====================================================================
      David's myotis (bat)  ====================================================================
B D                 Wallaby  ====================================================================
    Lesser Egyptian jerboa  ====================================================================
B D                   Panda  ====================================================================
B D                  Tenrec  ====================================================================
            Golden hamster  ====================================================================
B D         Chinese hamster  ====================================================================
B D                 Ferret   ====================================================================
B D               Armadillo  ====================================================================
B D                     Dog  ====================================================================
B D                    Pika  ====================================================================
B D         Tasmanian devil  ====================================================================
              Weddell seal  ====================================================================
            Pacific walrus  ====================================================================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ====================================================================
B D                     Pig  ====================================================================
B D                  Gibbon  --------------------------------------------------------------------

Alignment block 41 of 243 in window, 141522502 - 141522523, 22 bps 
B D                   Human  agct-ggcccttg--tgctcag----a-gg
B D                 Gorilla  agct-ggcccttg--tgctcag----a-gg
B D               Orangutan  agct-ggcccttg--tgctcag----a-gg
B D                  Rhesus  agct-g------g--ggaaaag----a-gg
B D     Crab-eating macaque  agct-g------g--ggaaaag----a-gg
B D                  Baboon  agct-g------g--ggaaaag----a-gg
B D            Green monkey  agct-a------g--ggaaaag----a-gg
B D                Marmoset  agct-ggcccttg--tgtttag----a-ga
B D         Squirrel monkey  agct-ggcccttg--tgtttag----a-ga
B D                Bushbaby  agcc-ctgtcttg--gactatg----a-gg
         Chinese tree shrew  --ct-t----------------------gg
B D                Squirrel  tgatgtccctgggctcggatcg----a-gg
B D          Naked mole-rat  agac-tgcctcagctcagacag----a-aa
B D              Guinea pig  agat-tgcctcagctgagacag----a-aa
                 Chinchilla  agac-tgcctcagctgagacag----a-ag
           Brush-tailed rat  agat-tgcctcagccgaggcaga---a-aa
B D                Elephant  aggc-cacccttg--ggctcaggtcaacgg
B D                 Manatee  aggc-cacccctg--ggctcagatcga-gg
           Cape golden mole  aggc-cactggtg--ggcttggatcca-ga
                   Aardvark  aggc-cccctttg--ggctcagattga-gg
B D                Platypus  acgg-gtcccttg--ggcaaag----a-gg
B D                   Shrew  ==============================
B D                     Rat  ==============================
B D                   Mouse  ==============================
       Cape elephant shrew  ==============================
              Prairie vole  ==============================
B D                Hedgehog  ==============================
             Big brown bat  ==============================
      David's myotis (bat)  ==============================
            Bactrian camel  ------------------------------
B D                  Alpaca  ------------------------------
B D                 Wallaby  ==============================
    Lesser Egyptian jerboa  ==============================
B D                   Panda  ==============================
B D                  Tenrec  ==============================
            Golden hamster  ==============================
B D         Chinese hamster  ==============================
B D                 Ferret   ==============================
B D               Armadillo  ==============================
B D                     Cat  ------------------------------
B D                     Dog  ==============================
             Domestic goat  ------------------------------
B D                    Pika  ==============================
B D                   Sheep  ------------------------------
B D                     Cow  ------------------------------
          Tibetan antelope  ------------------------------
              Killer whale  ------------------------------
          Black flying-fox  ------------------------------
B D                   Horse  ------------------------------
B D         Tasmanian devil  ==============================
B D      American alligator  ------------------------------
B D                 Dolphin  ------------------------------
              Weddell seal  ==============================
            Pacific walrus  ==============================
B D        White rhinoceros  ------------------------------
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ==============================
B D                     Pig  ==============================
B D                  Gibbon  ------------------------------

Inserts between block 41 and 42 in window
B D               Platypus 5667bp

Alignment block 42 of 243 in window, 141522524 - 141522532, 9 bps 
B D                   Human  gttctggaa
B D                 Gorilla  gttctggaa
B D               Orangutan  gttctggaa
B D                  Rhesus  gttctggaa
B D     Crab-eating macaque  gttctggaa
B D                  Baboon  gttctggaa
B D            Green monkey  gttctggaa
B D                Marmoset  gctctggaa
B D         Squirrel monkey  gctctggag
B D                Bushbaby  gttctgggg
         Chinese tree shrew  gctcaggag
B D                Squirrel  gctctggcg
B D          Naked mole-rat  gcccaggag
B D              Guinea pig  gcttaggag
                 Chinchilla  tctcaggag
           Brush-tailed rat  cctcagaag
B D                Elephant  gctc--gtg
B D                 Manatee  gttc-----
           Cape golden mole  gt-------
                   Aardvark  gctttggag
B D      American alligator  cccctg---
B D                   Shrew  =========
B D                     Rat  =========
B D                   Mouse  =========
       Cape elephant shrew  =========
              Prairie vole  =========
B D                Hedgehog  =========
             Big brown bat  =========
      David's myotis (bat)  =========
            Bactrian camel  ---------
B D                  Alpaca  ---------
B D                 Wallaby  =========
    Lesser Egyptian jerboa  =========
B D                   Panda  =========
B D                  Tenrec  =========
            Golden hamster  =========
B D         Chinese hamster  =========
B D                 Ferret   =========
B D               Armadillo  =========
B D                     Cat  ---------
B D                     Dog  =========
             Domestic goat  ---------
B D                    Pika  =========
B D                   Sheep  ---------
B D                     Cow  ---------
          Tibetan antelope  ---------
              Killer whale  ---------
          Black flying-fox  ---------
B D                   Horse  ---------
B D         Tasmanian devil  =========
B D                Platypus  =========
B D                 Dolphin  ---------
              Weddell seal  =========
            Pacific walrus  =========
B D        White rhinoceros  ---------
B D                   Chimp  NNNNNNNNN
B D                 Opossum  =========
B D                     Pig  =========
B D                  Gibbon  ---------

Inserts between block 42 and 43 in window
B D               Elephant 10bp
B D                Manatee 5bp
          Cape golden mole 3bp
                  Aardvark 20bp

Alignment block 43 of 243 in window, 141522533 - 141522565, 33 bps 
B D                   Human  tcaga---agcagacatgttccccctctttgc----agct
B D                 Gorilla  tcaga---agcacacacgttccccctctttgc----agct
B D               Orangutan  tcaga---agcacacgtgttccccctctttgc----ggct
B D                  Rhesus  tcaga---agcacacatgttcccccattttgc----aact
B D     Crab-eating macaque  tcaga---agcacacatgttcccccattttgc----aact
B D                  Baboon  tcaga---agcacacatgttcccccactttgc----aact
B D            Green monkey  tcaga---agcacacatgttcccccattttgc----agct
B D                Marmoset  tcaga---agcacacaggttctctc--ttggc----agct
B D         Squirrel monkey  tcaga---agcacacaggttctctc--tcggc----agct
B D                Bushbaby  tcagg---agcgtgctgggtctgcctctcagc----agct
         Chinese tree shrew  tcagg---agcatgctggtccctcctctcagt----gggt
B D                Squirrel  --------tgagcgcgtgctgctcctcctgtt----agct
               Prairie vole  tcagaagtcggggaagtgtctcttctagggtcatagagct
B D          Naked mole-rat  tcaga---agcacatgggttcctcctggtagc----agct
B D              Guinea pig  tcaga---agctcactggttccttccggtggc----acct
                 Chinchilla  tcaga---agcacattggctccttcccgtagc----actt
           Brush-tailed rat  tcaga---agcacactag-tccttccggtagc----ac--
B D                  Alpaca  --------tgcttctctgcctggagcct------------
             Bactrian camel  --------tgcttctctgcctggagcct------------
              Domestic goat  --------------cttgtcttaaccca------------
B D                   Horse  ---------------tcgtcttaa----------------
B D        White rhinoceros  ---------------ttgtcttaaccca------------
B D                     Cat  ---------------ctgtcttaaccca------------
           Black flying-fox  ---------------ttgtctga---cg------------
B D                Elephant  ------------tcctggttccttc---------------
B D                 Manatee  ------------tcctagttcctcctctcccc----agct
           Cape golden mole  ------------ccaacatccctcctcttccc----agct
                   Aardvark  ------------ccctggagcctcctctttcc----tgct
B D      American alligator  -ccgg---agcaactgggacctgccgcgggcc----agct
B D                   Shrew  ========================================
B D                     Rat  ========================================
B D                   Mouse  ========================================
       Cape elephant shrew  ========================================
B D                Hedgehog  ========================================
             Big brown bat  ========================================
      David's myotis (bat)  ========================================
B D                 Wallaby  ========================================
    Lesser Egyptian jerboa  ========================================
B D                   Panda  ========================================
B D                  Tenrec  ========================================
            Golden hamster  ========================================
B D         Chinese hamster  ========================================
B D                 Ferret   ========================================
B D               Armadillo  ========================================
B D                     Dog  ========================================
B D                    Pika  ========================================
B D                   Sheep  ----------------------------------------
B D                     Cow  ----------------------------------------
          Tibetan antelope  ----------------------------------------
              Killer whale  ----------------------------------------
B D         Tasmanian devil  ========================================
B D                Platypus  ========================================
B D                 Dolphin  ----------------------------------------
              Weddell seal  ========================================
            Pacific walrus  ========================================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  ========================================
B D                     Pig  ========================================
B D                  Gibbon  ----------------------------------------

Alignment block 44 of 243 in window, 141522566 - 141522571, 6 bps 
B D                   Human  gtgtgg
B D                 Gorilla  gtgtgg
B D               Orangutan  gtgtgg
B D                  Rhesus  gtgtgg
B D     Crab-eating macaque  gtgtgg
B D                  Baboon  gtgtgg
B D            Green monkey  atgtgg
B D                Marmoset  gtgtag
B D         Squirrel monkey  gtgtgg
B D                Bushbaby  atgtgg
         Chinese tree shrew  gtgtgg
B D                Squirrel  gtgagc
B D          Naked mole-rat  gtgtgg
B D              Guinea pig  gtgtgt
                 Chinchilla  ttgtgt
           Brush-tailed rat  ctgtgt
B D                  Alpaca  gggctg
             Bactrian camel  gggctg
              Domestic goat  ggg---
B D        White rhinoceros  gggtgg
B D                     Cat  gcgtgg
           Black flying-fox  gcgtgg
B D                 Manatee  --t---
           Cape golden mole  --g---
                   Aardvark  --g---
B D                   Shrew  ======
B D                     Rat  ======
B D                   Mouse  ======
       Cape elephant shrew  ======
              Prairie vole  ------
B D                Hedgehog  ======
             Big brown bat  ======
      David's myotis (bat)  ======
B D                 Wallaby  ======
    Lesser Egyptian jerboa  ======
B D                   Panda  ======
B D                  Tenrec  ======
            Golden hamster  ======
B D         Chinese hamster  ======
B D                 Ferret   ======
B D               Armadillo  ======
B D                     Dog  ======
B D                    Pika  ======
B D                Elephant  ------
B D                   Sheep  ------
B D                     Cow  ------
          Tibetan antelope  ------
              Killer whale  ------
B D                   Horse  ------
B D         Tasmanian devil  ======
B D                Platypus  ======
B D      American alligator  ------
B D                 Dolphin  ------
              Weddell seal  ======
            Pacific walrus  ======
B D                   Chimp  NNNNNN
B D                 Opossum  ======
B D                     Pig  ======
B D                  Gibbon  ------

Inserts between block 44 and 45 in window
        Chinese tree shrew 1223bp

Alignment block 45 of 243 in window, 141522572 - 141522616, 45 bps 
B D                   Human  ccttggacaagcctcttgacctctctagggtac-----ca-----tg--tcctcacc
B D                 Gorilla  ccttggacaagcctcttgacctctctgaggtac-----ca-----tg--tcctcacc
B D               Orangutan  ccttggacaagcctcttgacctctctgaggtac-----ca-----tg--tcctcacc
B D                  Rhesus  ccttggacaagcctcttgacctctctgaggtac-----ca-----tg--tcctcacc
B D     Crab-eating macaque  ccttggacaagactcttgacctctctgaggtac-----ca-----tg--tcctcacc
B D                  Baboon  ccttggacaagtctcttgacctctttgaggtac-----ca-----tg--tcctcacc
B D            Green monkey  ccttggacaagcctcttgacctctctgaggtac-----ca-----tg--tcctcacc
B D                Marmoset  ctttggacaagactctggacatctctgaggtac-----ca-----tg--tcctcacc
B D         Squirrel monkey  ctttggacaagcctgttgacgtctctgatgtac-----ca-----cg--tcctcacc
B D                Bushbaby  ccttggacgagcctctcggcctctgtgaggtac-------------a--gcatcatc
         Chinese tree shrew  ccttggac-agcctcttgacctctctgaggtgc-----ag-----tc--ttctcacc
B D                Squirrel  ctgggacaagc-ctctgggcccctctgaggagt-----gg---------tctgcact
               Prairie vole  -------------------tggccttgaatggt-----ggcacttca--cctccacc
B D                   Mouse  ----------------gggttgccttggatggt-----gggacttca--ccctcatc
B D          Naked mole-rat  ccttgaacaag-ctcccggcctttctgtggtgt-----ga-----tc--tccacacc
B D              Guinea pig  ccttgaacaag-ctctcggccttcctgtgacgt-----ga-----ta--tccacact
                 Chinchilla  ccttgaacatg-ctcttggtctttctgtggtgt-----ga-----tc--tgcacacc
           Brush-tailed rat  ccttgaacaaa-ctcctggcctttctgtggtgg-----ga-----tg--gctgcatt
B D                  Alpaca  ---------------cttgctgcttggcctc-agcacacc-----tt--tctccacg
             Bactrian camel  ---------------cttgctgcttggccccaagcacacc-----tt--tctccacg
B D                 Dolphin  --------------------------------------ct-----tg--tcttcacc
               Killer whale  --------------------------------------ct-----tg--tcttcacc
           Tibetan antelope  --------------------------------------ct-----tg--tcttaacc
B D                     Cow  --------------------------------------ct-----tg--tcttaacc
B D                   Sheep  --------------------------------------ct-----tg--tcttaacc
              Domestic goat  ----------------tggctgctcctcctc-tgt---cc-----tgcctctccacc
B D                   Horse  --------------------------------------gc-----tg--t---ggtg
B D        White rhinoceros  ---------------ccgcccctcc-------------tc-----tg--tccagggt
B D                     Cat  ---------------tcacccctcc-------------tc-----tg--tccagggt
           Black flying-fox  ---------------ccaccccc---------------tc-----tg--tccagggt
B D                Elephant  ---------------------tctccaaggcac-----ca-----tc--actgcgtc
B D                 Manatee  -------------------cttctccaaggtgc-----tg-----tc--tccatagc
           Cape golden mole  -------------------tctctccaaggcac-----ga-----gt--tccacatc
                   Aardvark  -------------------cccctctaaggcgg-----cg-----tc--tccatgtc
B D      American alligator  -cttgcccaggcc------cccctccggagcgccc---cg-----ca--ccctggtc
B D                   Shrew  =========================================================
B D                     Rat  =========================================================
       Cape elephant shrew  =========================================================
B D                Hedgehog  =========================================================
             Big brown bat  =========================================================
      David's myotis (bat)  =========================================================
B D                 Wallaby  =========================================================
    Lesser Egyptian jerboa  =========================================================
B D                   Panda  =========================================================
B D                  Tenrec  =========================================================
            Golden hamster  =========================================================
B D         Chinese hamster  =========================================================
B D                 Ferret   =========================================================
B D               Armadillo  =========================================================
B D                     Dog  =========================================================
B D                    Pika  =========================================================
B D         Tasmanian devil  =========================================================
B D                Platypus  =========================================================
              Weddell seal  =========================================================
            Pacific walrus  =========================================================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Opossum  =========================================================
B D                     Pig  =========================================================
B D                  Gibbon  ---------------------------------------------------------

Inserts between block 45 and 46 in window
B D                  Horse 94bp
B D       White rhinoceros 50bp
B D                    Cat 3bp
          Black flying-fox 6bp

Alignment block 46 of 243 in window, 141522617 - 141522654, 38 bps 
B D                   Human  tgtaaaacgggagt----------cagaagcatgtctggtgtacagcc
B D                 Gorilla  tgtaaaacgggagt----------cagaagcatgtctggtgtacagcc
B D               Orangutan  tgtaaaacgggagc----------cagaagcatgtctggtgtatggcc
B D                  Rhesus  tgtaaaacgggaag----------cagaagcatgtctggtgtacggcc
B D     Crab-eating macaque  tgtaaaacgggaag----------cagaagcatgtctggtgtacggcc
B D                  Baboon  tgtaaaacgggaag----------cagaagcatgtctggtgtacggcc
B D            Green monkey  tgtaaaacgggaag----------cagaagcatgtctggtgtacggcc
B D                Marmoset  tgtaagacgggagt----------cagaagcaggtctggtgtgtggcc
B D         Squirrel monkey  tgtaaaatgggagt----------cagacgcaggtctggtgtatggcc
B D                Bushbaby  tgtggaacagcagc---------acagagg---gtct-gtgaacagcc
         Chinese tree shrew  tgtgggacaggtggg------ccacaaaagcaggcatggttggtgtcc
B D                Squirrel  tggcaagac---------------------------------------
               Prairie vole  ttacaagga---------------------------------------
B D                   Mouse  tt----------------------------------------------
B D