Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 237 in window, 14028148 - 14028152, 5 bps 
B D                     Human  gcc----a--a
B D                     Chimp  gcc----a--a
B D                   Gorilla  gcc----a--a
B D                 Orangutan  gcc----a--a
B D                    Rhesus  gcc----a--a
B D       Crab-eating macaque  gcc----a--a
B D                    Baboon  gcc----a--a
B D              Green monkey  acc----a--a
B D                  Marmoset  gcc----a--g
B D           Squirrel monkey  gcc----a--g
B D                  Bushbaby  gcc----a--g
           Chinese tree shrew  acc----c--g
B D                  Squirrel  cca----g--g
       Lesser Egyptian jerboa  agc----c--c
                 Prairie vole  gac----a--g
B D           Chinese hamster  gac----a--g
               Golden hamster  ggc----a--g
B D                     Mouse  atc----g--g
B D                       Rat  att----g--g
B D            Naked mole-rat  ctc----c--g
B D                Guinea pig  ccc----t--g
                   Chinchilla  ctc----t--g
             Brush-tailed rat  ctc----t--a
B D                    Rabbit  aca----g--g
B D                      Pika  acc----a--g
B D                       Pig  tcc----a--g
B D                    Alpaca  gcc----a--g
               Bactrian camel  gcc----a--g
B D                   Dolphin  gcc----a--g
                 Killer whale  gcc----a--g
             Tibetan antelope  gcc----a--g
B D                       Cow  gcc----a--g
B D                     Sheep  gcc----a--g
                Domestic goat  gcc----a--g
B D                     Horse  gcc----a--g
B D          White rhinoceros  ccc----a--g
B D                       Cat  gcc----a--g
B D                       Dog  gcc----a--g
B D                   Ferret   gcc----a--g
B D                     Panda  gcc----a--g
               Pacific walrus  gcc----a--g
                 Weddell seal  gcc----a--g
             Black flying-fox  acc----a--g
B D                   Megabat  acc----a--g
                Big brown bat  gcc----a--g
         David's myotis (bat)  gcc----a--g
B D                  Microbat  gcc----a--g
B D                  Hedgehog  gcc----g--g
B D                     Shrew  tcc----g---
              Star-nosed mole  gcc----a---
B D                  Elephant  gcc----t--g
          Cape elephant shrew  gca----t--g
B D                   Manatee  gcc----t--a
             Cape golden mole  gcc----c--a
B D                    Tenrec  gtc----c--a
                     Aardvark  gcc-cctc--a
B D                 Armadillo  ccc----ccgg
B D                   Opossum  aac----t--g
B D           Tasmanian devil  agc----t--g
B D                   Wallaby  agc----t--g
B D                  Platypus  gcc----a--a
  D    White-throated sparrow  tctgctgg--g
B D        American alligator  gcc-ccac--a
  D           Green seaturtle  ctc----a--g
  D            Painted turtle  agc----a--g
  D  Chinese softshell turtle  ccc----c--g
B D             X. tropicalis  gtc----a--g
B D                      Fugu  -----------
B D                 Zebrafish  -----------
B D                    Lizard  ===========
B D                 Tetraodon  ===========
B D              Atlantic cod  ===========
B D               Stickleback  ===========
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
         Princess of Burundi  ===========
B D              Nile tilapia  ===========
B D                    Gibbon  ===========

Alignment block 2 of 237 in window, 14028153 - 14028190, 38 bps 
B D                     Human  gagg-------------cag---cag-ag-aca-ctgg--c------------cca---ct---------
B D                     Chimp  gagg-------------cag---cag-ag-aca-ctgg--c------------cca---ct---------
B D                   Gorilla  gaag-------------cag---cag-ag-aca-ctgg--c------------cca---ct---------
B D                 Orangutan  gaag-------------cag---cag-ag-acg-ctgg--c------------cca---ct---------
B D                    Rhesus  gagg-------------cag---cgg-ag-aca-ctgg--c------------cca---ct---------
B D       Crab-eating macaque  gagg-------------cag---cgg-ag-aca-ctgg--c------------cca---ct---------
B D                    Baboon  gagg-------------cag---cgg-ag-aca-ctgg--c------------cca---ct---------
B D              Green monkey  gagg-------------cag---cgg-ag-aca-ctgg--c------------cca---ct---------
B D                  Marmoset  gagg-------------cag---tgg-ag-aca-ctgg--c------------cca---ct---------
B D           Squirrel monkey  gagg-------------cag---cag-ag-aca-c-gg--c------------ccg---ct---------
B D                  Bushbaby  gagg-------------cag---tgg-aa-aca-gtgg--t------------cca---ct---------
           Chinese tree shrew  gagg-------------agg---aag-gg-acg-cgaa--c------------tcc---ca---------
B D                  Squirrel  -agg-------------cag---cgg-ag------gcgctg------------acc---ca---------
       Lesser Egyptian jerboa  -aag-------------cag---ccc-----------a--g------------atc---cc---------
                 Prairie vole  -agg-------------tgg---tgc-ag------aga--g------------agc---ca---------
B D           Chinese hamster  -agg-------------tgg---tgc-aa------gga--g------------agc---ca---------
               Golden hamster  -agg-------------tgg---tgc-ag------gga--g------------agc---ca---------
B D                     Mouse  -agg-------------tgg---tgc-ag------ata--g------------ag----ca---------
B D                       Rat  -agg-------------tgg---tgc-cg------aca--g------------agc---ca---------
B D            Naked mole-rat  -ggg-------------agg---cgc-----------g--g------------cgg---cc---------
B D                Guinea pig  -cag-------------agg---cgc-----------t--g------------tgc---tc---------
                   Chinchilla  -gcg-------------agg---tgc-----------t--g------------cgc---cc---------
             Brush-tailed rat  -gct-------------aga---cgc-----------t--g------------cac---cc---------
B D                    Rabbit  cagg-------------tgg---cag-ag-atc-cgag--c------------ggc---cc---------
B D                      Pika  gagg-------------cag---ggc-ag-acg-cgga--c------------tgg---ag---------
B D                       Pig  gagg---------------------------ca-ccaa--c-catcagaaagctgc---cttgc---tgc
B D                    Alpaca  gagg-------------gag---tgg--------------------aggaaactgc---ctcac---tgc
               Bactrian camel  gagg-------------gag---tgg--------------------aggaaactgc---ctcac---tgc
B D                   Dolphin  gagg-------------cgg---tgg-cg-gca-ccaa--c-ca-caggaagctgc---cttgc---tgt
                 Killer whale  gagg-------------cgg---tgg-cg-gca-ccaa--c-ca-caggaagctgc---cttgc---tgt
             Tibetan antelope  gagg-------------tgg---tag-aa-gca-ccag--t-caccaggaagctgc---cttgg---cgt
B D                       Cow  gagg-------------cag---tag-ag-gca-ccaa--t-caccaggaagctgc---cttgc---cgt
B D                     Sheep  gagg-------------tgg---tag-aa-gta-ccaa--t-caccaggaagctgc---cttgg---tgt
                Domestic goat  gagg-------------tgg---tag-aa-gta-ccaa--t-caccaggaagctgc---cttgg---cgt
B D                     Horse  gagg-------------cag---agg-ag-aca-ccga--c-cccaggaa--ctgc---ctcgc---tgc
B D          White rhinoceros  gcgg-------------cag---agg-ag-aca-tggc--c-cccaggaa-gctgc---ctcgc---tgt
B D                       Cat  gagg-------------cag---cag-ag-aca-caga--ctcccagggaggttgc---atcgc---tgt
B D                       Dog  gagg-------------cag---cag-cg-aca-caga--cacccaggggagttgc---cttgt---ctc
B D                   Ferret   gagg-------------cag---caa-ag-aca-caga--cacccagggaag-tgc---ctcgt---tgt
B D                     Panda  gaca-------------cag---cgg-ag-aca-caga--cacccagggaagttgc---cttgc---tgt
               Pacific walrus  gagg-------------cag---cag-ag-tca-caga--cacccagggaagttgc---ctcgc---tgt
                 Weddell seal  gagg-------------cag---cag-ag-tca-caga--cacccagggaagttgc---ctcgc---tgt
             Black flying-fox  ccgg-------------cag---cag-aa-gca-ccga--c-tccaagaaaactgc---ctcgc---tgt
B D                   Megabat  cagg-------------cag---cag-aa-gca-ccga--c-tccaagaaaactgc---ctcgc---tgt
                Big brown bat  gaag-------------cag---cag-ag-gca-ctga--c-cactggggaactgc---ctcgc---tgt
         David's myotis (bat)  gaag-------------cag---cag-ag-gca-ctga--c-cactgggaacctgc---cttgc---tgt
B D                  Microbat  gaag-------------cag---cag-ag-gca-ctga--c-cactgggaacctgc---cttgc---tct
B D                  Hedgehog  g---------------------------g-aca-c--a--c-ttctgggagctgcctggctgtc---acc
B D                     Shrew  ----------------------------------c--g--t-ggccgggaggcgcc-----------gcc
              Star-nosed mole  ----------------------------------ccaa--c-tcctgggaagcctc---cttgt---gcc
B D                  Elephant  gagc-------------cag---cag-ag-tca-tcac--t---ccaggaagctgc---tg-gc---caa
          Cape elephant shrew  gagg-------------cag---aac-ag-tca-gcac------ccaggacactgc---cc-gc---tga
B D                   Manatee  gagc-------------cag---cag-ag-tca-tcac--c---ccaggaagctgc---ta-gc---cta
             Cape golden mole  gaag-------------tat---tggtag-tca-ccac--c---ccagaaagctgc---ca-gc----tg
B D                    Tenrec  gcgg-------------ctg---tgg-aa-tca-ccac--c---cccagaagctgc---ca-gtgcagga
                     Aardvark  gagg-------------cag---tga-ag-tcacccat--c---ccaggaaggtgc---tg-gt---cga
B D                 Armadillo  gagg-------------cgg---cag-gg-ccacccgc--c---ccggg--gctgc---ct-cg---cct
B D                   Opossum  gacc-------------cga---cat-tgtgct-gcag--c-tgcaggacagg--c---tt---------
B D           Tasmanian devil  gacc-------------tga---cat-agcact-ctgg--t-tcca-gacaggtat---tt---------
B D                   Wallaby  gacc-------------cgacatcat-cgtgct-ctgg--c-tccagggcaggtgt---tt---------
B D                  Platypus  gaagctgggggtggcagcag---ggg-ag-gcg-caag--catctcagactgctcc---ct------ctt
  D    White-throated sparrow  -------------------------------------------------------------------aac
B D        American alligator  -------------------------------------------------------------------gcc
  D           Green seaturtle  -------------------------------------------------------------------gag
  D            Painted turtle  -------------------------------------------------------------------gag
  D  Chinese softshell turtle  -------------------------------------------------------------------gag
B D                    Lizard  ----------------------------------------------------------------------
B D             X. tropicalis  -----------------------------------------------------------------cagcc
B D                 Tetraodon  ----------------------------------------------------------------------
B D                      Fugu  -------------------------------------------------------------------ccc
B D                 Zebrafish  -------------------------------------------------------------------cag
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                    Gibbon  ======================================================================

                        Human  ------------ctcacg--ttc-aaag
                        Chimp  ------------ctcacg--ttc-aaag
                      Gorilla  ------------ctcacg--ttc-aaag
                    Orangutan  ------------ctcgcg--tcc-aaag
                       Rhesus  ------------cgcacg--tcc-aagg
          Crab-eating macaque  ------------cgcacg--tcc-aagg
                       Baboon  ------------cgcacg--tcc-gagg
                 Green monkey  ------------cacaca--tcg-gagg
                     Marmoset  ------------cttgaa--tcc-aagg
              Squirrel monkey  ------------ctcgaa--tcc-aagg
                     Bushbaby  ------------ctcctg--t-------
           Chinese tree shrew  ------------ctcgcg--gcg-gagg
                     Squirrel  ------------cgcgggcatcc-gagg
       Lesser Egyptian jerboa  ------------cccaag--gag-ccct
                 Prairie vole  ------------ccttgg--tcg-cagg
              Chinese hamster  ------------cctcgg--ttg-cagg
               Golden hamster  ------------cctcgg--tcg-aagg
                        Mouse  ------------cctggg--tcg-cagg
                          Rat  ------------cctggg--tcg-cagg
               Naked mole-rat  ------------cttcgt--ccc----g
                   Guinea pig  gc-----ccaggccccgg--ccc-----
                   Chinchilla  ------------cttcgt--ccc-----
             Brush-tailed rat  ------------ctgcgt--ccc----g
                       Rabbit  ------------ttgcag--tcc-gagg
                         Pika  ------------ttgtat--cct-gccc
                          Pig  gt-----ccactctcaca--tct-cagg
                       Alpaca  ac-----ccactctcaca--tct-cagg
               Bactrian camel  ac-----ccactctcacg--tct-cagg
                      Dolphin  gc-----cgcctctcaca--tct-cagg
                 Killer whale  gc-----cgcctctcaca--tct-cagg
             Tibetan antelope  gc-----ccattcttgcc--tct-cagg
                          Cow  gc-----ccattctcgcc--tct-cagg
                        Sheep  gc-----ccactctcgcc--tct-cagg
                Domestic goat  gc-----ccactctcgcc--tct-ccgg
                        Horse  gc-----tcccgctcgct--tcc-cagg
             White rhinoceros  gc-----gcacccttgcc--tcc-cagg
                          Cat  gc-----ccca----gcg--tcc-cagg
                          Dog  gc-----ccca-----ct--tgc-cagg
                      Ferret   gc-----ccca----gag--tca-cagg
                        Panda  gc-----cctg----gag--tcc-cagg
               Pacific walrus  gc-----ccca----gag--tcc-cagg
                 Weddell seal  gc-----tcca----gag--tcc-cagg
             Black flying-fox  gc-----ccacccttgca--ttc-cagg
                      Megabat  gc-----ccacccttgca--ttc-cagg
                Big brown bat  gc-----ccactctcccg--tcc-cagg
         David's myotis (bat)  gc-----cccctctcgcg--ctc-cagg
                     Microbat  gc-----ccactctcgcg--tcc-cagg
                     Hedgehog  gc-----ctgcacccccc--ctc-accc
                        Shrew  gc-----cgggaagccgc--cgc-----
              Star-nosed mole  ag-----cactgagccag--ccc-aggg
                     Elephant  gc-----cctctcctgcg--tct-gggg
          Cape elephant shrew  gc-----cctctcccagg--tca-gag-
                      Manatee  gc-----cctctcccggg--gct-gagg
             Cape golden mole  gc-----cctctccccag--tct-gagg
                       Tenrec  gc-----ctgttcctgcg--tcg-gagg
                     Aardvark  gc-----cctctccctgg--tct-gagg
                    Armadillo  tg-----ccggtcgcggg--tcc-gaac
                      Opossum  -----------------c--tcc-ctag
              Tasmanian devil  -----------------c--tcc-ccag
                      Wallaby  -----------------c--ttc-ttag
                     Platypus  gc-----tcattgcccct--ccg-ctgc
       White-throated sparrow  gc-----gcccgcgggac--acg-acgg
           American alligator  gt-----gccaggaggct--gct-ctgg
              Green seaturtle  gc-----agctgtgagct--ctt-ctgg
               Painted turtle  gc-----agctgtgagct--ctt-ctgg
     Chinese softshell turtle  gc-----agcggggagct--cct-ctgg
                       Lizard  ga-----agcagcaggct--aac-ggga
                X. tropicalis  ac-----tgggattcact--ttc-ctcg
                    Tetraodon  -------cgccgccgagg--gtg-cgag
                         Fugu  gcctcaacgccgccgccg--tcgccgcc
                    Zebrafish  gcatc--tgcttcccaaa--gca-cagg
                 Atlantic cod  ============================
                  Stickleback  ============================
          Pundamilia nyererei  ============================
                  Zebra mbuna  ============================
          Princess of Burundi  ============================
                 Nile tilapia  ============================
                       Gibbon  ============================

Alignment block 3 of 237 in window, 14028191 - 14028202, 12 bps 
B D                     Human  c---atc--------tcc-------------------------g----t-cca
B D                     Chimp  c---gtc--------tcc-------------------------g----t-cca
B D                   Gorilla  c---gtc--------tcc-------------------------a----t-cca
B D                 Orangutan  c---gtc--------tcc-------------------------g----t-cca
B D                    Rhesus  c---atc--------tct-------------------------g----t-cca
B D       Crab-eating macaque  c---atc--------tct-------------------------g----t-cca
B D                    Baboon  c---atc--------tct-------------------------g----t-cca
B D              Green monkey  c---atc--------tct-------------------------g----t-cca
B D                  Marmoset  c---gtc--------tct-------------------------gtccat-cca
B D           Squirrel monkey  t---gtc--------tct-------------------------g----t-cca
B D                  Bushbaby  ----gac--------tct-------------------------g----t-cca
           Chinese tree shrew  c---gtc--------tct-------------------------g----t-ccg
B D                  Squirrel  c---gtc------g-tgt-------------------------g----c-tca
       Lesser Egyptian jerboa  c---atcacccgtg-tct-------------------------g----c-tca
                 Prairie vole  c---gtc--------tca-------------------------g----c-tga
B D           Chinese hamster  c---atc--------tca-------------------------g----c-tga
               Golden hamster  c---atc--------tca-------------------------g----c-tga
B D                     Mouse  c---atc--------tca-------------------------g----c-tga
B D                       Rat  c---atc--------tca-------------------------g----c-tga
B D            Naked mole-rat  c---gtc--------ctc-------------------------g----t-gag
B D                Guinea pig  c---gtc--------ccc--------------------------------gcg
                   Chinchilla  c---gtc--------tgc-------------------------g----t-gcg
             Brush-tailed rat  g---gtt--------tcc-------------------------t----t-gcg
B D                    Rabbit  c---gtc------gctct-------------------------g----t-cca
B D                      Pika  c---agt------gctgt-------------------------g----t-cca
B D                       Pig  c---agc--------cc--------------------------g----t-cca
B D                    Alpaca  c---agc--------ccc-------------------------g----t-cca
               Bactrian camel  c---agc--------ccc-------------------------g----t-cca
B D                   Dolphin  c---agc--------cct-------------------------g----t-cca
                 Killer whale  c---agc--------cct-------------------------g----t-cca
             Tibetan antelope  c---agc--------cca-------------------------g----t-cca
B D                       Cow  c---agc--------ccc-------------------------g----t-cca
B D                     Sheep  c---agc--------cca-------------------------g----t-cca
                Domestic goat  c---agc--------cca-------------------------g----t-cca
B D                     Horse  c---gtc--------cct-------------------------g----t-gcg
B D          White rhinoceros  c---gtc--------ctg-------------------------g----t-cca
B D                       Cat  t---gtt--------cct-------------------------g----t-cca
B D                       Dog  t---g-t--------tct-------------------------g----t-cca
B D                   Ferret   t---g-t--------cct-------------------------g----t-cca
B D                     Panda  t---gtt--------cct-------------------------g----t-cca
               Pacific walrus  t---gtt--------gct-------------------------g----t-cca
                 Weddell seal  t---gtt--------cct-------------------------g----t-cca
             Black flying-fox  c---atc--------tct-------------------------g----t-cca
B D                   Megabat  c---atc--------tct-------------------------g----t-cca
                Big brown bat  c---ctc--------cct-------------------------g----t-cca
         David's myotis (bat)  c---ctc--------cct-------------------------g----t-cca
B D                  Microbat  c---ctc--------cct-------------------------g----t-cca
B D                  Hedgehog  c---gga------t-tct-------------------------g----cacca
B D                     Shrew  ---------------ccc-------------------------g----t-ccg
              Star-nosed mole  c---gtg--------tct-------------------------a----t-cca
B D                  Elephant  t---gcc--------tct-------------------------a----t-cca
          Cape elephant shrew  ------------------------------------------------t-cca
B D                   Manatee  c---gcc--------tct-------------------------g----t-cta
             Cape golden mole  t---gcc--------tct-------------------------g----t-cca
B D                    Tenrec  c----tc--------tct-------------------------g----t-cca
                     Aardvark  t---gcc--------tct-------------------------g----t-cca
B D                 Armadillo  c---ggc--------gct-------------------------g----t-cca
B D                   Opossum  c---agt---------ct--------tgcctctt---------g----t-cca
B D           Tasmanian devil  c---aat--------tct--------tgcctttg---------g----t-cca
B D                   Wallaby  c---agt--------cct--------tacatctg---------g----t-cca
B D                  Platypus  c---atc--------aat-------------------------c----t-tct
  D    White-throated sparrow  ---------------cgc-------------------------g----a-tgg
B D        American alligator  g---ctc--------cgc-------------------------g----c-tct
  D           Green seaturtle  c---ctt--------ggc-------------------------g----t-cca
  D            Painted turtle  c---ctt--------ggc-------------------------g----t-ctc
  D  Chinese softshell turtle  c---ctg--------ggc-------------------------g----c-ccg
B D                    Lizard  g---ctt--------tgt-------------------------g----c-ctg
B D             X. tropicalis  ctcactg--------cct-------------------------g----c-cca
B D                 Tetraodon  g---atg--------ctg-cgcagggtggctctg---------g----c-cct
B D                      Fugu  t---gtg--------ccg-agggaagcgggtgtg---------g----c-cgc
B D                 Zebrafish  t---aga--------ccatcaggaaaccagtgtgtgagtatctg----c-tct
B D                   Lamprey  c---gcc--------tcg-------------------------c----t-cca
B D              Atlantic cod  =====================================================
B D               Stickleback  =====================================================
         Pundamilia nyererei  =====================================================
                 Zebra mbuna  =====================================================
         Princess of Burundi  =====================================================
B D              Nile tilapia  =====================================================
B D                    Gibbon  =====================================================

Inserts between block 3 and 4 in window
B D       American alligator 5bp
  D          Green seaturtle 12bp
  D           Painted turtle 12bp
  D Chinese softshell turtle 12bp
B D                   Lizard 28bp
B D            X. tropicalis 1bp
B D                Tetraodon 1bp
B D                     Fugu 2bp
B D                Zebrafish 2bp

Alignment block 4 of 237 in window, 14028203 - 14028215, 13 bps 
B D                     Human  ------gca--tggccag------gt-a
B D                     Chimp  ------gca--tggccag------gt-a
B D                   Gorilla  ------gca--tggccag------gt-a
B D                 Orangutan  ------gca--tggccag------gt-a
B D                    Rhesus  ------gca--tggccag------gt-a
B D       Crab-eating macaque  ------gca--tggccag------gt-a
B D                    Baboon  ------gca--tggccag------gt-a
B D              Green monkey  ------gca--tggccag------gt-a
B D                  Marmoset  ------gca--tggccag------gt-a
B D           Squirrel monkey  ------gca--tggccag------gt-a
B D                  Bushbaby  ------gca--tggccaa------gt-g
           Chinese tree shrew  ------tca--tggccag------gc-g
B D                  Squirrel  ------gca--tggccaa------gt-t
       Lesser Egyptian jerboa  ------cca--tggc----------c-c
                 Prairie vole  ------gca--tggcaac------cc-t
B D           Chinese hamster  ------gca--tggcaac------cc-t
               Golden hamster  ------gca--tggcaac------cc-g
B D                     Mouse  ------tca--tggcaat------gc-t
B D                       Rat  ------tca--tggcaa--------c-t
B D            Naked mole-rat  ------caa--tggctcg------gc-g
B D                Guinea pig  ------cga--tggcccc------gc-g
                   Chinchilla  ------caa--tggcccg------gc-g
             Brush-tailed rat  ------caa--tggcccg------gc-g
B D                    Rabbit  ------cca--tggccaa------gt-g
B D                      Pika  ------gca--tggccag------gc-t
B D                       Pig  ------gaa--tggccaa------ac-g
B D                    Alpaca  ------gca--tggccaa------gc-g
               Bactrian camel  ------gca--tggccaa------gc-g
B D                   Dolphin  ------gca--tggccaa------ac-g
                 Killer whale  ------gca--tggccaa------ac-g
             Tibetan antelope  ------gca--tggtcag------ac-a
B D                       Cow  ------gca--tggtcag------ac-a
B D                     Sheep  ------gca--tggtcag------ac-a
                Domestic goat  ------gca--tggtcag------ac-a
B D                     Horse  ------gca--tggccaa------gc-g
B D          White rhinoceros  ------gca--tggccac------gc-a
B D                       Cat  ------gca--tggccaa------gc-g
B D                       Dog  ------gca--tggccaa------gc-g
B D                   Ferret   ------gca--tggccaa------gc-g
B D                     Panda  ------gca--tggccaa------gc-a
               Pacific walrus  ------gca--tggccaa------gc-g
                 Weddell seal  ------gca--tggccaa------gt-g
             Black flying-fox  ------gca--tggccaa------gc-a
B D                   Megabat  ------gca--tggccaa------gc-a
                Big brown bat  ------gca--tggccaa------gc-a
         David's myotis (bat)  ------gca--tggccaa------gc-a
B D                  Microbat  ------gca--tggccaa------gc-a
B D                  Hedgehog  ------gca--tggcccg------at-g
B D                     Shrew  ------tta--tggcccagtgcccgc-t
              Star-nosed mole  ------gaa--tggccaa------gc-a
B D                  Elephant  ------gca--tggtcaa------gc-g
          Cape elephant shrew  ------gca--tggccaa------gc-g
B D                   Manatee  ------gca--tggccaa------gc-g
             Cape golden mole  ------aca--tggccaa------gc-g
B D                    Tenrec  ------gca--tggccaa------gc-g
                     Aardvark  ------tca--tggccaa------gc-g
B D                 Armadillo  ------gca--tggccaa------gc-g
B D                   Opossum  ------cca--tgcccaa------a---
B D           Tasmanian devil  ------cca--tgcccaa------g---
B D                   Wallaby  ------cca--tgcccaa------g---
B D                  Platypus  ------ccc--tcatcat------gc-c
  D    White-throated sparrow  ------gga--tggccaa------gc--
           Tibetan ground jay  ------gga--tggccaa------gc--
B D        American alligator  -------------gccat------gca-
  D           Green seaturtle  ------aag--cagccat------gc-a
  D            Painted turtle  ------aag--cagccat------gc-a
  D  Chinese softshell turtle  ------aag--cagccat------gc-c
B D                    Lizard  ------gtc--tagccat------gc-a
B D             X. tropicalis  ------taa--gagcctg------gc-a
B D                 Tetraodon  ------------gctctg------gt-g
B D                      Fugu  ------gga--tgctgtg------ga-g
B D                 Zebrafish  ------gta--tgatgtg------ga-a
B D                   Lamprey  gcagcagcagcgggcgag------gc-a
B D              Atlantic cod  ============================
B D               Stickleback  ============================
         Pundamilia nyererei  ============================
                 Zebra mbuna  ============================
         Princess of Burundi  ============================
B D              Nile tilapia  ============================
B D                    Gibbon  ============================

Inserts between block 4 and 5 in window
  D   White-throated sparrow 19bp
          Tibetan ground jay 19bp
B D       American alligator 9bp
  D          Green seaturtle 9bp
  D           Painted turtle 9bp
  D Chinese softshell turtle 9bp
B D                   Lizard 9bp
B D            X. tropicalis 8bp

Alignment block 5 of 237 in window, 14028216 - 14028217, 2 bps 
B D                     Human  -ca
B D                     Chimp  -ca
B D                   Gorilla  -ca
B D                 Orangutan  -ca
B D                    Rhesus  -ca
B D       Crab-eating macaque  -ca
B D                    Baboon  -ca
B D              Green monkey  -ca
B D                  Marmoset  -ca
B D           Squirrel monkey  -cg
B D                  Bushbaby  -ca
           Chinese tree shrew  -cg
B D                  Squirrel  -ca
       Lesser Egyptian jerboa  -ca
                 Prairie vole  -cg
B D           Chinese hamster  -cc
               Golden hamster  -cg
B D                     Mouse  -cg
B D                       Rat  -cg
B D            Naked mole-rat  -cg
B D                Guinea pig  -cg
                   Chinchilla  -cg
             Brush-tailed rat  -cg
B D                    Rabbit  -ct
B D                      Pika  -ct
B D                       Pig  -tc
B D                    Alpaca  -cc
               Bactrian camel  -cc
B D                   Dolphin  -tc
                 Killer whale  -tc
             Tibetan antelope  -cc
B D                       Cow  -cc
B D                     Sheep  -cc
                Domestic goat  -cc
B D                     Horse  -cc
B D          White rhinoceros  -c-
B D                       Cat  -ct
B D                       Dog  -cc
B D                   Ferret   -cc
B D                     Panda  -cc
               Pacific walrus  -cc
                 Weddell seal  -cc
             Black flying-fox  -cc
B D                   Megabat  -cc
                Big brown bat  -tt
         David's myotis (bat)  -cc
B D                  Microbat  -cc
B D                  Hedgehog  -cc
B D                     Shrew  -gc
              Star-nosed mole  -gc
B D                  Elephant  -ca
          Cape elephant shrew  -ca
B D                   Manatee  -ca
             Cape golden mole  -ca
B D                    Tenrec  -ca
                     Aardvark  -ca
B D                 Armadillo  -cc
B D                  Platypus  -ta
B D             X. tropicalis  -cg
B D                 Tetraodon  --t
B D                      Fugu  --g
B D                 Zebrafish  --g
B D                   Lamprey  gc-
B D                    Lizard  ===
B D                   Wallaby  ---
B D           Tasmanian devil  ---
B D                   Opossum  ---
  D    White-throated sparrow  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
  D            Painted turtle  ===
B D              Atlantic cod  ===
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
B D        American alligator  ===
          Tibetan ground jay  ===
B D                    Gibbon  ===

Inserts between block 5 and 6 in window
B D                Tetraodon 1bp
B D                     Fugu 1bp
B D                Zebrafish 1bp

Alignment block 6 of 237 in window, 14028218 - 14028225, 8 bps 
B D                     Human  t---g---------ctgctg---
B D                     Chimp  a---g---------ctgctg---
B D                   Gorilla  t---g---------ctgctg---
B D                 Orangutan  t---g---------ctgctg---
B D                    Rhesus  c---g---------ctgctg---
B D       Crab-eating macaque  c---g---------ctgctg---
B D                    Baboon  c---g---------ctgctg---
B D              Green monkey  c---g---------ctgctg---
B D                  Marmoset  g---g---------ctgctg---
B D           Squirrel monkey  g---g---------ctgctg---
B D                  Bushbaby  c---a---------ctgctt---
           Chinese tree shrew  c---t---------ctgctg---
B D                  Squirrel  c---g---------ctgctg---
       Lesser Egyptian jerboa  g---gacg--gctgctgctg---
                 Prairie vole  g---g------------ctg---
B D           Chinese hamster  g---g------------ctg---
               Golden hamster  g------------------g---
B D                     Mouse  g---g------------ctg---
B D                       Rat  g---g-------------gg---
B D            Naked mole-rat  c---gctgctgctgctgctc---
B D                Guinea pig  c---cccgctgctgctgctg---
                   Chinchilla  c---cctgctgctgctgctc---
             Brush-tailed rat  c---cctgctgctgcttccc---
B D                    Rabbit  g---ggtgctgctcctgctg---
B D                      Pika  c---tctgctgctgctgctg---
B D                       Pig  cactg---------ctgctg---
B D                    Alpaca  c---g---------ctgctg---
               Bactrian camel  c---g---------ctgctg---
B D                   Dolphin  c---t---------ctgctg---
                 Killer whale  c---t---------ctgctg---
             Tibetan antelope  t---g---------gtcctg---
B D                       Cow  t---g---------gtcctg---
B D                     Sheep  t---g---------gtcctg---
                Domestic goat  t---g---------gtcctg---
B D                     Horse  c---g---------ctgctg---
B D          White rhinoceros  --------------cggctg---
B D                       Cat  c---g---------ctgctg---
B D                       Dog  c---g---------ctgctg---
B D                   Ferret   c---g---------ctgctg---
B D                     Panda  c---g---------ctgctg---
               Pacific walrus  c---g---------ctgctg---
                 Weddell seal  c---g---------ctgctg---
             Black flying-fox  c---g---------ctgctg---
B D                   Megabat  c---a---------ctgctg---
                Big brown bat  c---a---------ctgctg---
         David's myotis (bat)  c---a---------ctgctg---
B D                  Microbat  c---a---------ctgctg---
B D                  Hedgehog  c---c---------gttctg---
B D                     Shrew  t---g---------ctgccg---
              Star-nosed mole  c---g---------ctgcta---
B D                  Elephant  c---a---------cggctg---
          Cape elephant shrew  c---a---------ctccta---
B D                   Manatee  t---g---------ctgctg---
             Cape golden mole  c---g---------ctactg---
B D                    Tenrec  c---g---------ctgctg---
                     Aardvark  c---g---------ttgctg---
B D                 Armadillo  c---g---------ctgctg---
B D                   Opossum  ----g---------ctg-tg---
B D           Tasmanian devil  ----g---------ctg-tg---
B D                   Wallaby  ----g---------cag-tg---
B D                  Platypus  a---a---------ctgggg---
  D    White-throated sparrow  -------------------c---
           Tibetan ground jay  -------------------c---
B D                   Chicken  -------------------c---
B D        American alligator  -------------------g---
  D           Green seaturtle  -------------------c---
  D            Painted turtle  -------------------c---
  D  Chinese softshell turtle  -------------------c---
B D                    Lizard  -------------------c---
B D             X. tropicalis  c---g---------tggctc---
B D                 Tetraodon  ------------------cg---
B D                      Fugu  ------------------tg---
B D                 Zebrafish  ---------------cctcg---
     Mexican tetra (cavefish)  ------------------tg---
B D                   Lamprey  ---------------tggtggcg
B D              Atlantic cod  =======================
B D               Stickleback  =======================
         Pundamilia nyererei  =======================
                 Zebra mbuna  =======================
         Princess of Burundi  =======================
B D              Nile tilapia  =======================
B D                    Gibbon  =======================

Inserts between block 6 and 7 in window
B D                Tetraodon 7bp
B D                     Fugu 4bp
B D                Zebrafish 1bp
    Mexican tetra (cavefish) 1bp

Alignment block 7 of 237 in window, 14028226 - 14028226, 1 bps 
B D                     Human  -c
B D                     Chimp  -c
B D                   Gorilla  -c
B D                 Orangutan  -c
B D                    Rhesus  -c
B D       Crab-eating macaque  -c
B D                    Baboon  -c
B D              Green monkey  -c
B D                  Marmoset  -c
B D           Squirrel monkey  -c
B D                  Bushbaby  -t
           Chinese tree shrew  -t
B D                  Squirrel  -c
       Lesser Egyptian jerboa  -c
                 Prairie vole  -c
B D           Chinese hamster  -c
               Golden hamster  -c
B D                     Mouse  -c
B D                       Rat  -c
B D            Naked mole-rat  -c
B D                Guinea pig  -c
                   Chinchilla  -c
             Brush-tailed rat  -c
B D                    Rabbit  -c
B D                      Pika  -c
B D                       Pig  -c
B D                    Alpaca  -c
               Bactrian camel  -c
B D                   Dolphin  -c
                 Killer whale  -c
             Tibetan antelope  -c
B D                       Cow  -c
B D                     Sheep  -c
                Domestic goat  -c
B D                     Horse  -c
B D          White rhinoceros  -c
B D                       Cat  -c
B D                       Dog  -c
B D                   Ferret   -c
B D                     Panda  -c
               Pacific walrus  -t
                 Weddell seal  -t
             Black flying-fox  -c
B D                   Megabat  -c
                Big brown bat  -c
         David's myotis (bat)  -c
B D                  Microbat  -c
B D                  Hedgehog  -c
B D                     Shrew  -c
              Star-nosed mole  -t
B D                  Elephant  -c
          Cape elephant shrew  -c
B D                   Manatee  -c
             Cape golden mole  -c
B D                    Tenrec  -c
                     Aardvark  -c
B D                 Armadillo  -c
B D                   Opossum  -c
B D           Tasmanian devil  -c
B D                   Wallaby  -c
B D                  Platypus  -t
  D    White-throated sparrow  -g
           Tibetan ground jay  -g
B D                   Chicken  -g
B D        American alligator  -g
  D           Green seaturtle  -c
  D            Painted turtle  -c
  D  Chinese softshell turtle  -c
B D                    Lizard  -t
B D             X. tropicalis  -c
B D                Coelacanth  -c
B D                   Lamprey  g-
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                      Fugu  ==
B D                 Tetraodon  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D                    Gibbon  ==

Alignment block 8 of 237 in window, 14028227 - 14028232, 6 bps 
B D                     Human  tgctcc
B D                     Chimp  tgctcc
B D                   Gorilla  tgctcc
B D                 Orangutan  tgctcc
B D                    Rhesus  tgctcc
B D       Crab-eating macaque  tgctcc
B D                    Baboon  tgctcc
B D              Green monkey  tgctcc
B D                  Marmoset  tgctcc
B D           Squirrel monkey  tgctcc
B D                  Bushbaby  tgctgc
           Chinese tree shrew  ccctgc
B D                  Squirrel  tgctgc
       Lesser Egyptian jerboa  tgctgc
                 Prairie vole  tgctgc
B D           Chinese hamster  tgctgc
               Golden hamster  tgctgc
B D                     Mouse  tgctgc
B D                       Rat  tgctgc
B D            Naked mole-rat  tgctgc
B D                Guinea pig  tgctgc
                   Chinchilla  tgctgc
             Brush-tailed rat  tgctac
B D                    Rabbit  cgctcc
B D                       Pig  tgctgc
B D                    Alpaca  tcctgc
               Bactrian camel  tcctgc
B D                   Dolphin  tgctgc
                 Killer whale  tgctgc
             Tibetan antelope  tgctac
B D                       Cow  tgctgc
B D                     Sheep  tgctgc
                Domestic goat  tgctgc
B D                     Horse  tgctgc
B D          White rhinoceros  tgctgc
B D                       Cat  tgctgc
B D                       Dog  tgctgc
B D                   Ferret   tgctgc
B D                     Panda  tactgt
               Pacific walrus  tgctgc
                 Weddell seal  tgctgc
             Black flying-fox  tgctgc
B D                   Megabat  tgctgt
                Big brown bat  tgctgc
         David's myotis (bat)  tgctgc
B D                  Microbat  tgctgc
B D                  Hedgehog  tgctgc
B D                     Shrew  tgctgc
              Star-nosed mole  tactgc
B D                  Elephant  tgctgc
          Cape elephant shrew  tgctgc
B D                   Manatee  tgctgc
             Cape golden mole  tgctgc
B D                    Tenrec  tgctgc
                     Aardvark  tgctgc
B D                 Armadillo  tgctgc
B D                   Opossum  tgttcc
B D           Tasmanian devil  tgctcc
B D                   Wallaby  tgcttc
B D                  Platypus  tgatcc
  D    White-throated sparrow  tggcac
           Tibetan ground jay  tggcac
B D                   Chicken  cggcgc
B D        American alligator  cagtgc
  D           Green seaturtle  tggctc
  D            Painted turtle  tggcgt
  D  Chinese softshell turtle  tggccc
B D                    Lizard  tggctt
B D             X. tropicalis  cgccct
B D                Coelacanth  ttgttt
B D              Nile tilapia  tggtgc
          Princess of Burundi  tggtgc
                  Zebra mbuna  tggtgc
          Pundamilia nyererei  tggtgc
B D               Stickleback  tgctac
B D                 Zebrafish  ---ctc
     Mexican tetra (cavefish)  ---tgc
B D                   Lamprey  agctgg
B D                      Pika  ------
B D                      Fugu  ======
B D                 Tetraodon  ======
B D              Atlantic cod  ======
B D                    Gibbon  ======

Inserts between block 8 and 9 in window
B D                Zebrafish 3bp
    Mexican tetra (cavefish) 3bp

Alignment block 9 of 237 in window, 14028233 - 14028255, 23 bps 
B D                     Human  t-----g---g---------cgg---tatgggtgct----------------------------------
B D                     Chimp  t-----g---g---------cgg---tatgggtgct----------------------------------
B D                   Gorilla  t-----g---g---------cgg---tatgggtgct----------------------------------
B D                 Orangutan  t-----g---g---------cgg---tatgggtgct----------------------------------
B D                    Rhesus  t-----g---g---------cgg---cgtgggtgct----------------------------------
B D       Crab-eating macaque  t-----g---g---------cgg---cgtgggtgct----------------------------------
B D                    Baboon  t-----g---g---------cgg---cgtgggtgct----------------------------------
B D              Green monkey  t-----g---g---------cgg---cgtgggtgct----------------------------------
B D                  Marmoset  t-----g---g---------cga---tgtgggtgct----------------------------------
B D           Squirrel monkey  t-----g---g---------cgg---tgtgggtgct----------------------------------
B D                  Bushbaby  t-----t---g---------cag---tgggggtgct----------------------------------
           Chinese tree shrew  t-----g---a---------cgc---tgtgggtgct----------------------------------
B D                  Squirrel  t-----g---g---------ccc---tggtggtgct----------------------------------
       Lesser Egyptian jerboa  t-----g---a---------ccc---tgtgcgtgct----------------------------------
                 Prairie vole  t-----g---g---------ctt---cctgggctct----------------------------------
B D           Chinese hamster  t-----g---g---------ctt---gctgggctct----------------------------------
               Golden hamster  t-----g---g---------ctt---cctgggctct----------------------------------
B D                     Mouse  t-----g---g---------ctt---cctgggctct----------------------------------
B D                       Rat  t-----g---g---------ctt---cctgggctct----------------------------------
B D            Naked mole-rat  t-----g---g---------cgg---tgtggacgcg----------------------------------
B D                Guinea pig  t-----g---ttg---ctgcccg---cgtggac-------------------------------------
                   Chinchilla  t-----g---g---------cgg---tgtggacacg----------------------------------
             Brush-tailed rat  t-----g---g---------ctg---tgtggat-------------------------------------
B D                    Rabbit  t-----g---a---------gcg---ggtgggcgct----------------------------------
B D                      Pika  --------------------------------tgct----------------------------------
B D                       Pig  t-----g---g---------ccg---tatgggtgct----------------------------------
B D                    Alpaca  t-----g---g---------ctg---tgtgggtgct----------------------------------
               Bactrian camel  t-----g---g---------ctg---tgtgggtgct----------------------------------
B D                   Dolphin  t-----g---g---------cca---tgggggtgct----------------------------------
                 Killer whale  t-----g---g---------cca---tgggggtgct----------------------------------
             Tibetan antelope  t-----g---g---------ccc---tgggggtgct----------------------------------
B D                       Cow  t-----g---g---------ccc---tgggggtgct----------------------------------
B D                     Sheep  t-----a---g---------ccc---tgggggtgct----------------------------------
                Domestic goat  t-----g---g---------ccc---tgggggtgct----------------------------------
B D                     Horse  t-----g---g---------cct---tgtgggtgct----------------------------------
B D          White rhinoceros  t-----g---g---------ccg---tgtgggtgct----------------------------------
B D                       Cat  t-----g---g---------ccg---tgtgggtgct----------------------------------
B D                       Dog  t-----a---g---------ccg---tgtgggtact----------------------------------
B D                   Ferret   t-----gctaa---------ctg---tgtgggtgct----------------------------------
B D                     Panda  t-----a---a---------ccg---tgtgggtgct----------------------------------
               Pacific walrus  t-----g---a---------cca---tgtgggtgct----------------------------------
                 Weddell seal  t-----g---a---------cca---tgtgggtgct----------------------------------
             Black flying-fox  t-----g---g---------ctg---tgtgggtgct----------------------------------
B D                   Megabat  t-----g---g---------ctg---tgtgggtgct----------------------------------
                Big brown bat  t-----g---g---------ccg---tgtgggtgct----------------------------------
         David's myotis (bat)  t-----g---g---------ccg---tgtgggtgct----------------------------------
B D                  Microbat  t-----g---g---------ccg---tgtgggtgct----------------------------------
B D                  Hedgehog  t-----g---g---------ccc---tgtgggtgct----------------------------------
B D                     Shrew  t-----g---c---------tgc---cgccgctgct----------------------------------
              Star-nosed mole  t-----a---g---------cgg---tatgggtgct----------------------------------
B D                  Elephant  t-----c---g---------cgg---tgtgggtgct----------------------------------
          Cape elephant shrew  t-----a---g---------cag---tgtgggtgct----------------------------------
B D                   Manatee  t-----g---g---------agg---tgtgggtgct----------------------------------
             Cape golden mole  t-----g---g---------cag---tgtgggtgct----------------------------------
B D                    Tenrec  t-----------------------------gctgct----------------------------------
                     Aardvark  t-----a---g---------cgg---tgtgggtgct----------------------------------
B D                 Armadillo  t-----g---c---------tggctttctgggtgct----------------------------------
B D                   Opossum  t-----g---g---------tac---tgtgggcttt----------------------------------
B D           Tasmanian devil  t-----g---a---------tac---tgtgggcttt----------------------------------
B D                   Wallaby  t-----g---g---------tac---tgtgggcttt----------------------------------
B D                  Platypus  t-----g---a---------ccc---tgtgggtgct----------------------------------
  D    White-throated sparrow  t-----g---c---------tgt---gcgcggcacc----------------------------------
           Tibetan ground jay  t-----g---c---------tgt---gtgcggcccc----------------------------------
B D                   Chicken  t-----g---c---------tga---gcgtggccgt----------------------------------
B D        American alligator  t-----g---g---------tgc---ttgggactct----------------------------------
  D           Green seaturtle  t-----g---g---------ctt---ttgggtcact----------------------------------
  D            Painted turtle  t-----g---g---------ctt---ttgggatgct----------------------------------
  D  Chinese softshell turtle  t-----g---g---------cgt---tcgggacgct----------------------------------
B D                    Lizard  t-----a---g---------tcc---tgggggtgct----------------------------------
B D             X. tropicalis  tctcgtg---g---------tcc---tgtggctcct----------------------------------
B D                Coelacanth  t-----g---a---------cga---tctgggtgct----------------------------------
B D                 Tetraodon  c-----g---t---------ctg---cagctgcgcgaaggctgacctga---------------------
B D                      Fugu  t-----g---g---------ccg---tggctctgctgtg--tggc-------------------------
B D              Nile tilapia  t-----g---g---------ctg---tgtgtctgct----------------------------------
          Princess of Burundi  t-----g---g---------ctg---tgtgtctgct----------------------------------
                  Zebra mbuna  t-----g---g---------ctg---tgtgtctgct----------------------------------
          Pundamilia nyererei  t-----g---g---------ctg---tgtgtctgct----------------------------------
B D               Stickleback  t-----g---g---------ctg---tgtgcctgct-------------ggtggct--------------
B D              Atlantic cod  t-----g---g---------tgg---tgtgtctgct--------------------ggtggcggg-----
B D                 Zebrafish  --------------------tag---tgtgtctgct-----------------------------gctgg
     Mexican tetra (cavefish)  --------------------tgc---tgggggtggt-----------------------------gttgg
B D                   Lamprey  -----------agggctctctgg---cggggacgct----------------------------------
B D                    Gibbon  ======================================================================

                        Human  --------ga--------ccggg
                        Chimp  --------ga--------ccggg
                      Gorilla  --------ga--------ccggg
                    Orangutan  --------ga--------ccggg
                       Rhesus  --------ga--------cgggg
          Crab-eating macaque  --------ga--------cgggg
                       Baboon  --------ga--------cgggg
                 Green monkey  --------ga--------ctggg
                     Marmoset  --------ga--------ccggg
              Squirrel monkey  --------ga--------ccggg
                     Bushbaby  --------gg--------gtgga
           Chinese tree shrew  --------gg--------ctggg
                     Squirrel  --------gg--------ccggg
       Lesser Egyptian jerboa  --------gt--------ccagg
                 Prairie vole  --------cc--------ttggg
              Chinese hamster  --------ca--------ctggg
               Golden hamster  --------cg--------ttgcg
                        Mouse  --------cc--------tcggg
                          Rat  --------cc--------tcggg
               Naked mole-rat  --------gc--------ccggc
                   Guinea pig  -----------------------
                   Chinchilla  --------gc--------ctggc
             Brush-tailed rat  -----------------------
                       Rabbit  --------gg--------ccggc
                         Pika  --------gg--------ctggg
                          Pig  --------gg--------ctggg
                       Alpaca  --------gg--------ctggg
               Bactrian camel  --------gg--------ctggg
                      Dolphin  --------gg--------ctggg
                 Killer whale  --------gg--------ctggg
             Tibetan antelope  --------gg--------ctggg
                          Cow  --------ga--------ctggg
                        Sheep  --------gg--------ctggg
                Domestic goat  --------gg--------ctggg
                        Horse  --------gg--------ctggg
             White rhinoceros  --------gg--------ctgcc
                          Cat  --------gg--------ctggg
                          Dog  --------gg--------ctggg
                      Ferret   --------gg--------ctggg
                        Panda  --------gg--------ctggg
               Pacific walrus  --------gg--------ctggg
                 Weddell seal  --------gg--------ctggg
             Black flying-fox  --------gg--------ttggg
                      Megabat  --------gg--------ttggg
                Big brown bat  --------gg--------ccggg
         David's myotis (bat)  --------gg--------ccggg
                     Microbat  --------gg--------ccggg
                     Hedgehog  --------gg--------ctggg
                        Shrew  --------gg--------ccgcc
              Star-nosed mole  --------gg--------ctggg
                     Elephant  --------gg--------ctggg
          Cape elephant shrew  --------gg--------ccggg
                      Manatee  --------gg--------ctggg
             Cape golden mole  --------gg--------ctggg
                       Tenrec  --------gg--------ccggg
                     Aardvark  --------gg--------cgggg
                    Armadillo  --------gg--------ccggg
                      Opossum  --------gc--------tggga
              Tasmanian devil  --------gc--------tgggg
                      Wallaby  --------gc--------tgggg
                     Platypus  --------gg--------tgtgg
       White-throated sparrow  --------cc-cggggtaccctg
           Tibetan ground jay  --------gc-cggggcagcccg
                      Chicken  --------gc-cgggacagcccg
           American alligator  --------gctcgtgacacc---
              Green seaturtle  --------gt--------tctcg
               Painted turtle  --------gc--------tctcg
     Chinese softshell turtle  --------gc--------tctgg
                       Lizard  --------gc--------tcttg
                X. tropicalis  --------ag--------cctgg
                   Coelacanth  --------gg--------tgtcg
                    Tetraodon  -----------------------
                         Fugu  -----------------------
                 Nile tilapia  -----------------------
          Princess of Burundi  -----------------------
                  Zebra mbuna  -----------------------
          Pundamilia nyererei  -----------------------
                  Stickleback  -----------------------
                 Atlantic cod  -----------------------
                    Zebrafish  c---tgga---------------
     Mexican tetra (cavefish)  tgtgtggg---------------
                      Lamprey  --------g--------------
                       Gibbon  =======================

Inserts between block 9 and 10 in window
B D                Tetraodon 26bp
B D                     Fugu 21bp
B D             Nile tilapia 4bp
         Princess of Burundi 4bp
                 Zebra mbuna 4bp
         Pundamilia nyererei 4bp
B D                Zebrafish 3bp
    Mexican tetra (cavefish) 3bp

Alignment block 10 of 237 in window, 14028256 - 14028291, 36 bps 
B D                     Human  gag----c------tg-tggc----------cgg--------gagctg---aggcc---cgg--------
B D                     Chimp  gag----c------tg-tggc----------cag--------gagccg---aggcc---cgg--------
B D                   Gorilla  gag----c------tg-tggc----------cgg--------gagccg---aggcc---cgg--------
B D                 Orangutan  gag----c------tg-tggc----------cag--------gggccg---aggcc---cgg--------
B D                    Rhesus  gag----c------tg-tggc----------cgg--------ggactg---aagcc---cgg--------
B D       Crab-eating macaque  gag----c------tg-tggc----------cgg--------ggactg---aagcc---cgg--------
B D                    Baboon  gag----c------tg-tggc----------cgg--------ggactg---aagcc---cgg--------
B D              Green monkey  gag----c------tg-tggc----------cgg--------ggactg---aggcc---cgg--------
B D                  Marmoset  gag----t------tg-tggc----------cgg--------ggaccg---aggcc---cgg--------
B D           Squirrel monkey  gag----c------tg-tggc----------cgg--------gggctg---aggcc---cgg--------
B D                  Bushbaby  gag----c------tc-tggc----------ttg--------tagccc---aggcc---cgg--------
           Chinese tree shrew  gac----c------tg-ccgc----------tgg--------ggcccg---gggcc---cga--------
B D                  Squirrel  cag----c------tg-tggc----------tgg--------tggccg---aggcc---cgg--------
       Lesser Egyptian jerboa  g-----------------agc----------tgc--------aggccc---g------------------
                 Prairie vole  act----c------tg-cagc----------tgc--------aagccg---atgcg---agg--------
B D           Chinese hamster  gct----c------tg-cagc----------tgc--------aggctg---atgcg---agg--------
               Golden hamster  gct----t------tg-cagt----------tgc--------agactg---atgcg---agg--------
B D                     Mouse  gct----c------tg-gggc----------tgc--------aggccg---aggcg---agg--------
B D                       Rat  gct----c------tg-gtgc----------tgc--------aggccg---aggcg---agg--------
B D            Naked mole-rat  caa----c------gg-gttc----------cca--------gggctg---aggcc---cgg--------
B D                Guinea pig  --g----c------gg-ttcc----------ccg--------gggccc---aggcc---cgg--------
                   Chinchilla  cgg----c------gg-gttc----------ctg--------gagccg---aggcc---cgg--------
             Brush-tailed rat  --g----c------gg-gatc----------ccg--------gggccg---agggc---cgg--------
B D                    Rabbit  gag----c------gc-tggc----------tcg--------gggccgccgaggcc---cgg--------
B D                      Pika  gag----c------ga-tggc-----------ca--------gggacgc--aggcc---cgg--------
B D                       Pig  gag----c------tg-tggc----------tga--------ggactg---aggcc---cgg--------
B D                    Alpaca  gag----c------tg-tggc----------tga--------ggaccg---aggcc---cga--------
               Bactrian camel  gag----c------tg-tggc----------tga--------ggaccg---aggcc---cga--------
B D                   Dolphin  gag----c------tg-t------------------------ggacag---aggcc---cag--------
                 Killer whale  gag----c------tg-t------------------------ggacag---aggcc---cag--------
             Tibetan antelope  gag----c------tg-ttgc----------cga--------ggaccg---aggcc---cag--------
B D                       Cow  gag----c------tc-ttgc----------caa--------ggaccg---aggcc---cgg--------
B D                     Sheep  gag----c------tg-ttgc----------cga--------ggaccg---aggcc---cgg--------
                Domestic goat  gag----c------tg-ttgc----------cga--------ggaccg---aggcc---cag--------
B D                     Horse  gag----c------tg-tggc----------tga--------gcgccg---aagcc---cgg--------
B D          White rhinoceros  gag----c------tg-cggc----------tga--------gggccg---aggcc---ggg--------
B D                       Cat  gag----c------tg-tggc----------tga--------gcaccg---aggcc---cgg--------
B D                       Dog  gag----c------tg-tggc----------tga--------gggctg---aggcc---cgg--------
B D                   Ferret   gag----c------tg-tggc----------tga--------cgtctg---aggcc---cga--------
B D                     Panda  gag----c------tg-tggc----------tga--------ggactg---aggcc---cgg--------
               Pacific walrus  gag----c------ta-tggc----------tga--------gggctg---aggcc---cgg--------
                 Weddell seal  gag----c------tg-tggc----------tga--------gggctg---aggcc---tgg--------
             Black flying-fox  gag----c------tg-tggc----------ttg--------gggctg---aggcc---cgg--------
B D                   Megabat  gag----c------tg-tggc----------ttg--------gggctg---aggcc---cgg--------
                Big brown bat  ggg----c------tg-tggc----------tgg--------aagccg---aagcc---cgg--------
         David's myotis (bat)  ggg----c------tg-tggc----------tgg--------aagccg---aagcc---cgg--------
B D                  Microbat  ggg----c------tg-tggc----------tgg--------aagccg---aagcc---cgg--------
B D                  Hedgehog  ggg----c------cg-gggc----------tgc--------aggctg---aggct---cgg--------
B D                     Shrew  gagagtcc------gg-ccgc----------ggacccggcatgggcgg---cgtccccgcgg--------
              Star-nosed mole  gag----c------tg-tggc----------tga--------gggcgg---aggcc---cgg--------
B D                  Elephant  gag----t------tg-tggc----------tac--------aggctg---aggca---cgg--------
          Cape elephant shrew  gaa----c------tg-tggc----------tgc--------aggctg---aggcc---cgg--------
B D                   Manatee  gag----t------tg-tggc----------tgc--------gggctg---aggtg---cag--------
             Cape golden mole  gag----c------tg-tggc----------tgc--------aagctg---aagcc---cgg--------
B D                    Tenrec  gag----c------tg-tggc----------tgc--------aggccg---aggcc---agg--------
                     Aardvark  gag----c------tg-tggc----------tgc--------aggcag---aggcc---cgg--------
B D                 Armadillo  gag----c------tg-tggc----------tgg--------ggaccg---acgcc---cgg--------
B D                   Opossum  gat----c------tg----c----------cag--------cagctg---agggc---cgg--------
B D           Tasmanian devil  aat----c------tg----c----------cag--------cagctg---agggc---cgg--------
B D                   Wallaby  gat----c------tg----c----------cag--------cagctg---agggc---cgg--------
B D                  Platypus  gat----c------tg-cgca----------cgg--------cagccg---aggct---cgg--------
  D    White-throated sparrow  gcg----c------cg-t-gc---------------------tgcccg---cgggc---gag--------
           Tibetan ground jay  gag----c------cg-t-gc---------------------cccccg---cggga---gag--------
B D                   Chicken  gag----cgcagggcg-c-gc----------tgg--------tccctg---cgggc---gac--------
B D        American alligator  --------------ca-a-gc----------tgg--------aggctg---aggcc---cgg--------
  D           Green seaturtle  gag----c------tg-aggc----------tgg--------gggctg---agggc---cgg--------
  D            Painted turtle  gag----c------cg-aggc----------tgg--------gggctg---agggc---cgg--------
  D  Chinese softshell turtle  gaa----c------tg-aggc----------tgg--------gggccc---tgggc---cgg--------
B D                    Lizard  gag----a------tg-aggt----------tgg--------ggagtg---aggcc---agg--------
B D             X. tropicalis  ca-----c------ag-cggca---------ccc--------aggcca---ccagc---aga--------
B D                Coelacanth  gag----g------tg-aggc----------aag--------gcaccg---aggct---cgg--------
B D                      Fugu  ---------------------ggggc-cgacctg--------atgagc---agcct---c----------
B D              Nile tilapia  ---------------------g---------ctg--------gtgttc---agccc---atg--------
          Princess of Burundi  ---------------------g---------ctg--------gcgttc---agccc---atg--------
                  Zebra mbuna  ---------------------g---------ctg--------gcgttc---agccc---atg--------
          Pundamilia nyererei  ---------------------g---------ctg--------gcgttc---agccc---atg--------
B D               Stickleback  ---------------------------------g--------aggtcc---agccc---atg--------
B D              Atlantic cod  -------------------------------------------gatcc---atggc---atg--------
B D                 Zebrafish  ---------------------aaggcgc---tgg--------acgccg---ggccc---tcg--------
     Mexican tetra (cavefish)  ---------------------ggggtgtgtgcgg--------gtgagg---gggct---ctgcagagaga
B D                   Lamprey  gag----c------tgatggc----------tgg--------tggcgg---gagcc---cggcggaacag
B D                 Tetraodon  ======================================================================
B D                    Gibbon  ======================================================================

                        Human  --------g-------cagcgcct-------------------
                        Chimp  --------g-------cagcgcct-------------------
                      Gorilla  --------g-------cagcgcct-------------------
                    Orangutan  --------g-------cagcgcct-------------------
                       Rhesus  --------g-------cagcgcct-------------------
          Crab-eating macaque  --------g-------cagcgcct-------------------
                       Baboon  --------g-------cagcgcct-------------------
                 Green monkey  --------g-------cagcgcct-------------------
                     Marmoset  --------g-------cagcacct-------------------
              Squirrel monkey  --------g-------cagcgcct-------------------
                     Bushbaby  --------g-------cagcaccc-------------------
           Chinese tree shrew  --------ggcccgccctgcaccg-------------------
                     Squirrel  --------g-------cagcgccc-------------------
       Lesser Egyptian jerboa  --------------------gccc-------------------
                 Prairie vole  --------c-------cagcgccc-------------------
              Chinese hamster  --------c-------cagcgccc-------------------
               Golden hamster  --------c-------ccgcgccc-------------------
                        Mouse  --------c-------cggcgccc-------------------
                          Rat  --------c-------ccgcgccc-------------------
               Naked mole-rat  --------g-------ccgcgccc-------------------
                   Guinea pig  --------g-------cggcgccc-------------------
                   Chinchilla  --------g-------ccgcgcct-------------------
             Brush-tailed rat  --------g-------cggcgccc-------------------
                       Rabbit  --------a-------ctgcgccc-------------------
                         Pika  --------g-------cagcgccc-------------------
                          Pig  --------g-------cgtcaccc-------------------
                       Alpaca  --------a-------cagcaccc-------------------
               Bactrian camel  --------a-------cagcaccc-------------------
                      Dolphin  --------g-------tagcaccc-------------------
                 Killer whale  --------g-------cagcaccc-------------------
             Tibetan antelope  --------g-------caacaccc-------------------
                          Cow  --------g-------caacagcc-------------------
                        Sheep  --------g-------caacaccc-------------------
                Domestic goat  --------g-------caacaccc-------------------
                        Horse  --------g-------cagcaccc-------------------
             White rhinoceros  --------g-------cggcaccc-------------------
                          Cat  --------g-------catcaccc-------------------
                          Dog  --------c-------catcaccc-------------------
                      Ferret   --------g-------catcacca-------------------
                        Panda  --------g-------cgtcaccc-------------------
               Pacific walrus  --------g-------catcgccc-------------------
                 Weddell seal  --------g-------catcgccc-------------------
             Black flying-fox  --------g-------cagcaccc-------------------
                      Megabat  --------g-------cagcaccc-------------------
                Big brown bat  --------g-------gagcaccc-------------------
         David's myotis (bat)  --------g-------gagcaccc-------------------
                     Microbat  --------g-------gagcaccc-------------------
                     Hedgehog  --------g-------gcgccccg-------------------
                        Shrew  --------g-------cagcaccg-------------------
              Star-nosed mole  --------g-------caacaccc-------------------
                     Elephant  --------g-------ctgcaccc-------------------
          Cape elephant shrew  --------g-------ctgcaccc-------------------
                      Manatee  --------g-------cagcaccc-------------------
             Cape golden mole  --------g-------ctgcaccc-------------------
                       Tenrec  --------g-------cggccccc-------------------
                     Aardvark  --------g-------ctgcacct-------------------
                    Armadillo  --------g-------ccggcccc-------------------
                      Opossum  --------a-------cttctccc-------------------
              Tasmanian devil  --------a-------catctccc-------------------
                      Wallaby  --------a-------catctcca-------------------
                     Platypus  --------a-------gcccctcg-------------------
       White-throated sparrow  --------g-------gggacggg-------------------
           Tibetan ground jay  --------g-------gggacggc-------------------
                      Chicken  --------g-------gggacgga-------------------
           American alligator  --------g-------gtcccccc-------------------
              Green seaturtle  --------a-------acccaccc-------------------
               Painted turtle  --------a-------acccaccc-------------------
     Chinese softshell turtle  --------a-------acccaccc-------------------
                       Lizard  --------a-------caccccct-------------------
                X. tropicalis  --------g-------tccccacg-------------------
                   Coelacanth  --------a-------atcctacc-------------------
                         Fugu  ----------------atcattcc-------------------
                 Nile tilapia  --------g-------atgaccca-------------------
          Princess of Burundi  --------g-------atgaccca-------------------
                  Zebra mbuna  --------g-------atgaccca-------------------
          Pundamilia nyererei  --------g-------atgaccca-------------------
                  Stickleback  --------g-------tagaccca-------------------
                 Atlantic cod  --------g-------agggaccg-------------------
                    Zebrafish  -------------------------------------------
     Mexican tetra (cavefish)  t------------------------------------------
                      Lamprey  cagcaacag-------cagcatcagcagcagcagcacagcgac
                    Tetraodon  ===========================================
                       Gibbon  ===========================================

Inserts between block 10 and 11 in window
B D                     Fugu 7bp
B D             Nile tilapia 3bp
         Princess of Burundi 3bp
                 Zebra mbuna 3bp
         Pundamilia nyererei 3bp
B D              Stickleback 3bp
B D             Atlantic cod 3bp

Alignment block 11 of 237 in window, 14028292 - 14028303, 12 bps 
B D                     Human  tacggggtcagg
B D                     Chimp  tacggggtcagg
B D                   Gorilla  tacggggtcagg
B D                 Orangutan  tacagggtcaag
B D                    Rhesus  tacggagtgaag
B D       Crab-eating macaque  tacggagtgaag
B D                    Baboon  tacggagtgaag
B D              Green monkey  tacggagtgaag
B D                  Marmoset  tatggagtgaaa
B D           Squirrel monkey  tacggagtgaag
B D                  Bushbaby  tatggagtgaag
           Chinese tree shrew  tatggcgtgaag
B D                  Squirrel  tacggggtgaag
       Lesser Egyptian jerboa  ttcgccgtgaag
                 Prairie vole  tacgtggtgaag
B D           Chinese hamster  tatggggtgaag
               Golden hamster  tacggggtgaag
B D                     Mouse  tacggggtgaag
B D                       Rat  tatggggtgaag
B D            Naked mole-rat  tatggggtgaaa
B D                Guinea pig  ttcggggtgcgg
                   Chinchilla  tacggggtgaaa
             Brush-tailed rat  tacggagtgaaa
B D                    Rabbit  tacgccgtgaaa
B D                      Pika  tatggggtgaag
B D                       Pig  tatggagtgaag
B D                    Alpaca  tatggagtgaag
               Bactrian camel  tacagagtgaag
B D                   Dolphin  tacggagctcgg
                 Killer whale  tacggagtgaag
             Tibetan antelope  tacggagtgaaa
B D                       Cow  tatggagtgaaa
B D                     Sheep  tacggagtgaaa
                Domestic goat  tacggagtgaaa
B D                     Horse  tacggcgtgaag
B D          White rhinoceros  tacggagtgaag
B D                       Cat  tacggagtgaag
B D                       Dog  tacggagtgaag
B D                   Ferret   tacggggtgaag
B D                     Panda  ttcggagtgaaa
               Pacific walrus  tacggagtgaag
                 Weddell seal  tacggagtgaag
             Black flying-fox  tacggagtgaag
B D                   Megabat  tacggagtgaag
                Big brown bat  tatggggtgaag
         David's myotis (bat)  tatggggtgaag
B D                  Microbat  tatggggtgaag
B D                  Hedgehog  tacggggtgaag
B D                     Shrew  gtgcgcctgaag
              Star-nosed mole  tatggagtgaag
B D                  Elephant  tacggtgtgaag
          Cape elephant shrew  tacggcgtgaag
B D                   Manatee  tacagcgtgaag
             Cape golden mole  tacggtgtgaag
B D                    Tenrec  tacggcgtgaag
                     Aardvark  tatggcataaag
B D                 Armadillo  tacggcgtgaag
B D                   Opossum  tatgccgtaaaa
B D           Tasmanian devil  tatgcagtaaag
B D                   Wallaby  tatgcagtaaag
B D                  Platypus  tacggaatgaag
  D    White-throated sparrow  tacggggtgaaa
           Tibetan ground jay  tacggggtgaag
B D                   Chicken  tacggggtgaag
B D        American alligator  tatggtgtcaag
  D           Green seaturtle  tatggcgtcaag
  D            Painted turtle  tacggcgtcaag
  D  Chinese softshell turtle  tatggcgtcaag
B D                    Lizard  tacggtgtgaaa
B D             X. tropicalis  tttggggtgaag
B D                Coelacanth  tatggggtgaag
B D                 Tetraodon  tacggcgtcaaa
B D                      Fugu  tacggcgtcaag
B D              Nile tilapia  tatggggtgaag
          Princess of Burundi  tatggggtgaag
                  Zebra mbuna  tatggggtgaag
          Pundamilia nyererei  tatggggtgaag
B D               Stickleback  tatggggtgaaa
B D              Atlantic cod  tacggcgtgaag
B D                 Zebrafish  tatggagtcaaa
     Mexican tetra (cavefish)  tatggggtgaag
B D                   Lamprey  tacggggtcaag
B D                    Gibbon  ============

Alignment block 12 of 237 in window, 14028304 - 14028361, 58 bps 
B D                     Human  ctttgcggccgagaattcatccgagcagtcatcttcacctgcgggggctcccggtgga
B D                     Chimp  ctttgcggccgagaattcatccgagcagtcatcttcacctgcgggggctcccggtgga
B D                   Gorilla  ctttgcggccgagaattcatccgagcagtcatcttcacctgcgggggctcccggtgga
B D                 Orangutan  ctttgcggccgagaattcatccgagcagtcatcttcacctgcggaggctcccggtgga
B D                    Rhesus  ctttgcgggcgagaattcatccgagcagtcatcttcacctgcgggggatcccggtgga
B D       Crab-eating macaque  ctttgcgggcgagaattcatccgagcagtcatcttcacctgcgggggatcccggtgga
B D                    Baboon  ctttgcgggcgagaattcatccgagcagtcatcttcacctgcgggggatcccggtgga
B D              Green monkey  ctttgcgggcgagaattcatccgagcagtcatcttcacctgcgggggatcccggtgga
B D                  Marmoset  ctctgcggccgagagttcatccgagcagtcatcttcacctgtgggggctcccggtgga
B D           Squirrel monkey  ctctgcggccgagagttcatccgagcagtcatcttcacctgcgggggctcccggtgga
B D                  Bushbaby  ctttgtggccgtgaattcatcagagcagtgatcttcacgtgtgggggctctcgatgga
           Chinese tree shrew  ctctgcggccgcgaattcatccgcgccgtcatcttcacctgcgggggctcgcggtgga
B D                  Squirrel  ctttgtggccgtgaattcatccgggcggtcatcttcacctgcggaggctcccggtgga
       Lesser Egyptian jerboa  ctctgcggacgggagttcatccgcgccgtcatctttacctgcgggggctcccgctggc
                 Prairie vole  ctgtgcgggcgcgagttcatccgagcggtcatcttcacctgcgggggctcgcgatggc
B D           Chinese hamster  ttgtgcggccgagaattcatccgtgcggtcatcttcacctgcgggggctcacgatggc
               Golden hamster  ttgtgcggccgcgaattcatccgtgcggtcatcttcacctgtgggggctcacgatggc
B D                     Mouse  ctctgcggtcgggagttcatccgcgcggtcatcttcacttgcggaggctcacgatggc
B D                       Rat  ctctgcggtcgggagttcatccgcgcggtcatcttcacctgcgggggctcacgatggc
B D            Naked mole-rat  ctgtgcggccgtgagttcattcgcgcagtcatcttcacctgcgggggctcgcggtgga
B D                Guinea pig  ctgtgcggccgcgagttcatccgtgccgtgatcttcacctgcgggggctcgcggtgga
                   Chinchilla  ctgtgcggccgcgagttcatccgcgccgtcatctttacctgcggaggctcgcggtgga
             Brush-tailed rat  ctgtgcggccgcgagttcatccgcgccgtcatctttacctgcgggggctcacggtgga
B D                    Rabbit  ctctgcggccgtgaattcatccgcgctgttatctacacgtgcggcagctcccgctggc
B D                      Pika  ctctgtggccgggagttcattcgggctgtcatctttacctgcggcggctcccgctgga
B D                       Pig  ctttgcggccgtgaattcatccgagcggtcatctttacctgcgggggctcccggtgga
B D                    Alpaca  ctttgcggccgtgaattcatccgagcagtcatctttacctgcgggggctcccggtgga
               Bactrian camel  ctttgcggccgtgaattcatccgagcagtcatctttacctgcggggggtcccggtgga
                 Killer whale  ctttgcggccgtgaattcatccgagcagtcatcttcacctgtgggggctcctggtgga
             Tibetan antelope  ctttgcggccgtgaattcatccgagcggtcatcttcacctgtgggggctcccggtgga
B D                       Cow  ctctgcggccgtgaattcatccgagcggtcatcttcacctgtgggggctcccggtgga
B D                     Sheep  ctttgtggccgtgaattcatccgagcggtcatcttcacctgtgggggctctcggtgga
                Domestic goat  ctttgtggccgtgaattcatccgagcggtcatcttcacctgtgggggctcccggtgga
B D                     Horse  ctttgcggccgggagttcatccgagctgtcatcttcacctgtgggggctcccggtgga
B D          White rhinoceros  ctttgcggcagggaattcatccgagccgtcatcttcacctgcggaggctcccggtgga
B D                       Cat  ctttgcggccgggaattcatccgggccgtcatcttcacctgcgggggctcccgatgga
B D                       Dog  ctctgcggccgggaattcatccgagcagtcatcttcacctgcggaggctcccgctgga
B D                   Ferret   ctctgcggcagggaattcatccgggcagtcatcttcacctgcgggggctcccggtgga
B D                     Panda  ctttgtggccgggaattcatccgggcggtcatcttcacctgcgggggctcccggtgga
               Pacific walrus  ctttgcggccgggaattcatccgggcagtcatcttcacctgcgggggctcccggtgga
                 Weddell seal  ctttgcggccgggaattcatccgggcagtcatcttcacctgcgggggctcccggtgga
             Black flying-fox  ctttgtggccgggaattcatccgagcagtcatctttacctgtgggggctcccggtgga
B D                   Megabat  ctttgtggccgggaattcatccgagcagtcatctttacctgcgggggctcccggtgga
                Big brown bat  ctttgcggccgggaattcatccgagcagtcatcttcacctgcggaggctcccgatgga
         David's myotis (bat)  ctttgcggccgggaattcatccgagcagtcatcttcacctgtggaggctcccgatgga
B D                  Microbat  ctttgcggccgggaattcatccgagcagtcatcttcacctgcggaggctcccgatgga
B D                  Hedgehog  ctctgcggaagagagtttatccgtgctgtcatcttcacgtgtgggggttcccgctgga
B D                     Shrew  ctgtgcggccgagagttcgtgcgcgccgtcatcttctcctgcgggggctcccgctggc
              Star-nosed mole  ctttgtggcagagagttcatcagagcagtcattttcacctgcgggggctcccggtgga
B D                  Elephant  ctttgcggccgggagttcatccgagcagtcattttcatctgtggaggctccaggtgga
          Cape elephant shrew  ctttgcggccgcgagttcatccgagccgtcatcttcatctgcgggggctcacggtgga
B D                   Manatee  ctttgcggccgtgagttcatccgagcagtcgttttcatctgcgggggctcgcgatgga
             Cape golden mole  ctttgtggccgcgagttcatcagagcagtcattttcatctgtgggggttcaaggtgga
B D                    Tenrec  ctctgcggccgagagtttatccgagctgtcattttcatctgcgggggctcccggtgga
                     Aardvark  ctgtgtggccgcgagttcatccgagcagtcattttcatctgcgggggctcgcggtgga
B D                 Armadillo  ctttgcggccgcgagttcatccgggcagtcatcttcacgtgcggcggctcgcgctgga
B D                   Opossum  ctgtgtggccgagagttcatccgggctgtcatctttacctgtgggggttctcgatgga
B D           Tasmanian devil  ctatgcggtcgagagttcatccgggctgtcatctttacctgtgggggatctcgatgga
B D                   Wallaby  ctgtgtggccgagaattcatccgggctgtcatctttacctgtgggggatctcgatgga
B D                  Platypus  ctctgcggccgggagttcatccgggccgtcatcttcacctgcggtggttcccgctgga
  D    White-throated sparrow  ctgtgcggccgcgagttcatccgcgccgtcatcttcacctgcggcgggtcccgctgga
           Tibetan ground jay  ctgtgcggccgcgagttcatccgcgccgtcatcttcacctgcggagggtcccgctgga
B D                   Chicken  ctgtgcggccgggagttcatccgtgccgtcatcttcacctgcggcgggtcccgctgga
B D        American alligator  ctttgtggccgtgagttcatccgtgccgtcatcttcacctgtggtggatcccgctggc
  D           Green seaturtle  ctgtgtgggagggagttcatccgggccgtcatcttcacctgtgggggctcccgctgga
  D            Painted turtle  ctgtgcgggagggaatttatccgggccgtcatcttcacctgtgggggctcccgctgga
  D  Chinese softshell turtle  ctgtgcggccgggagttcatccgggccgtcatcttcacctgtgggggctcccgctgga
B D                    Lizard  ctgtgtggcagagagttcatccgagcggttatcttcacctgcgggggatctcgctgga
B D             X. tropicalis  ctctgcggccgagagttcatacgagccgttatcttcacatgtgggggttcccggtgga
B D                Coelacanth  ctgtgtggcagagaatttatccgcgctgtcattttcacctgtggagggtctcgatgga
B D                 Tetraodon  ctgtgcgggcgggagttcatccgagccgtcattttcacctgcggaggctcccggtgga
B D                      Fugu  ctgtgcgggcgggagttcatcagagccgtcattttcacctgcgggggctcccggtggc
B D              Nile tilapia  ctctgtggccgtgagttcatccgggcggtcatcttcacctgcgggggttcacgatgga
          Princess of Burundi  ctctgtggccgcgagttcatccgggcggtcatcttcacctgcgggggttcacgatgga
                  Zebra mbuna  ctctgtggccgcgagttcatccgggcagtcatcttcacctgcgggggttcacgatgga
          Pundamilia nyererei  ctatgtggccgcgagttcatccgggcggtcatcttcacctgcgggggttcacgatgga
B D               Stickleback  ctgtgtggccgagagttcatccgggccgtcatcttcacctgcggaggttcacgatgga
B D              Atlantic cod  ctctgcgggcgggagttcatccgagcagtcatattcacctgtgggggttcccgctgga
B D                 Zebrafish  ttatgcggcagggagttcatccgtgctgtcatcttcacctgcggaggatcccgatgga
     Mexican tetra (cavefish)  ctgtgcgggagggagttcatcagagccgttatcttcacctgcgggggatccaggtgga
B D                   Lamprey  ttgtgcggccgggagttcatccgcgccgtgatctacacgtgcggaggctctcggtgga
B D                   Dolphin  ----------------------------------------------------------
B D                    Gibbon  ==========================================================

Inserts between block 12 and 13 in window
B D               Coelacanth 3252bp
B D                  Lamprey 1bp

Alignment block 13 of 237 in window, 14028362 - 14028363, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  ga
           Chinese tree shrew  ga
B D                  Squirrel  gg
       Lesser Egyptian jerboa  gc
                 Prairie vole  gc
B D           Chinese hamster  gc
               Golden hamster  gc
B D                     Mouse  gc
B D                       Rat  gc
B D            Naked mole-rat  ga
B D                Guinea pig  ag
                   Chinchilla  ga
             Brush-tailed rat  ga
B D                    Rabbit  gg
B D                      Pika  gg
B D                       Pig  ga
B D                    Alpaca  ga
               Bactrian camel  ga
                 Killer whale  ga
             Tibetan antelope  ga
B D                       Cow  ga
B D                     Sheep  ga
                Domestic goat  ga
B D                     Horse  ga
B D          White rhinoceros  ga
B D                       Cat  gg
B D                       Dog  ga
B D                   Ferret   ga
B D                     Panda  ga
               Pacific walrus  ga
                 Weddell seal  ga
             Black flying-fox  ga
B D                   Megabat  ga
                Big brown bat  gg
         David's myotis (bat)  gg
B D                  Microbat  gg
B D                  Hedgehog  gg
B D                     Shrew  gc
              Star-nosed mole  ag
B D                  Elephant  ga
          Cape elephant shrew  ga
B D                   Manatee  ga
             Cape golden mole  ga
B D                    Tenrec  ga
                     Aardvark  ga
B D                 Armadillo  ga
B D                   Opossum  ga
B D           Tasmanian devil  ga
B D                   Wallaby  ga
B D                  Platypus  ga
  D    White-throated sparrow  ag
           Tibetan ground jay  ag
B D                   Chicken  ag
B D        American alligator  gg
  D           Green seaturtle  ga
  D            Painted turtle  ga
  D  Chinese softshell turtle  ga
B D                    Lizard  ga
B D             X. tropicalis  ga
B D                 Tetraodon  ga
B D                      Fugu  gc
B D              Nile tilapia  aa
          Princess of Burundi  ga
                  Zebra mbuna  ga
          Pundamilia nyererei  ga
B D               Stickleback  ga
B D              Atlantic cod  ag
B D                 Zebrafish  aa
     Mexican tetra (cavefish)  gg
B D                   Lamprey  ga
B D                Coelacanth  ==
B D                   Dolphin  --
B D                    Gibbon  ==

Inserts between block 13 and 14 in window
B D                  Wallaby 634bp
B D            X. tropicalis 3bp

Alignment block 14 of 237 in window, 14028364 - 14028368, 5 bps 
B D                     Human  cgatc-
B D                     Chimp  cgatc-
B D                   Gorilla  cgatc-
B D                 Orangutan  cgatc-
B D                    Rhesus  cgatc-
B D       Crab-eating macaque  cgatc-
B D                    Baboon  cgatc-
B D              Green monkey  cgatc-
B D                  Marmoset  cgatc-
B D           Squirrel monkey  cgatc-
B D                  Bushbaby  cggtc-
           Chinese tree shrew  cgctc-
B D                  Squirrel  cggtc-
       Lesser Egyptian jerboa  cgagc-
                 Prairie vole  cgggc-
B D           Chinese hamster  cgggc-
               Golden hamster  cgggc-
B D                     Mouse  cgggc-
B D                       Rat  cgggc-
B D            Naked mole-rat  cgcgc-
B D                Guinea pig  cgcct-
                   Chinchilla  cgcac-
             Brush-tailed rat  cgcgc-
B D                    Rabbit  cgctc-
B D                      Pika  cggtc-
B D                       Pig  cggtc-
B D                    Alpaca  cggtc-
               Bactrian camel  cggtc-
                 Killer whale  cggtc-
             Tibetan antelope  cg----
B D                       Cow  cg----
B D                     Sheep  cg----
                Domestic goat  cg----
B D                     Horse  cggtc-
B D          White rhinoceros  cggtc-
B D                       Cat  cggtc-
B D                       Dog  cggtc-
B D                   Ferret   cggtc-
B D                     Panda  cgggc-
               Pacific walrus  cggtc-
                 Weddell seal  cggtc-
             Black flying-fox  cggtc-
B D                   Megabat  cggtc-
                Big brown bat  cgctc-
         David's myotis (bat)  cggtc-
B D                  Microbat  cggtc-
B D                  Hedgehog  cgcgc-
B D                     Shrew  cgcgc-
              Star-nosed mole  cgttc-
B D                  Elephant  cgggc-
          Cape elephant shrew  cgggc-
B D                   Manatee  cgggc-
             Cape golden mole  cgggc-
B D                    Tenrec  cgggc-
                     Aardvark  cgtgc-
B D                 Armadillo  cggtc-
B D                  Platypus  cgagc-
B D                 Tetraodon  cgct--
B D                      Fugu  cgctc-
B D              Nile tilapia  cggtc-
          Princess of Burundi  cggtc-
                  Zebra mbuna  cggtc-
          Pundamilia nyererei  cggtc-
B D               Stickleback  cgatc-
B D              Atlantic cod  cgatc-
B D                 Zebrafish  cgctc-
     Mexican tetra (cavefish)  agagg-
B D                   Lamprey  -gggcc
B D             X. tropicalis  ======
B D                    Lizard  ------
B D                   Wallaby  ======
B D           Tasmanian devil  ------
B D                   Opossum  ------
  D    White-throated sparrow  ------
B D                   Chicken  ------
B D                Coelacanth  ======
  D  Chinese softshell turtle  ------
  D           Green seaturtle  ------
  D            Painted turtle  ------
B D        American alligator  ------
          Tibetan ground jay  ------
B D                   Dolphin  ------
B D                    Gibbon  ======

Inserts between block 14 and 15 in window
B D             Atlantic cod 601bp
B D                Zebrafish 2937bp
    Mexican tetra (cavefish) 4bp

Alignment block 15 of 237 in window, 14028369 - 14028369, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  a
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  a
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  c
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
                 Killer whale  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  t
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  g
         David's myotis (bat)  a
B D                  Microbat  g
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  a
          Cape elephant shrew  c
B D                   Manatee  a
             Cape golden mole  t
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  c
B D                  Platypus  a
B D                      Fugu  c
B D              Nile tilapia  a
          Princess of Burundi  a
                  Zebra mbuna  a
          Pundamilia nyererei  a
B D               Stickleback  a
B D                 Zebrafish  g
     Mexican tetra (cavefish)  g
B D                   Lamprey  a
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  -
B D             X. tropicalis  =
B D                    Lizard  -
B D                   Wallaby  =
B D           Tasmanian devil  -
B D                   Opossum  -
  D    White-throated sparrow  -
B D                   Chicken  -
B D                Coelacanth  =
  D  Chinese softshell turtle  -
  D           Green seaturtle  -
  D            Painted turtle  -
B D                 Tetraodon  -
B D              Atlantic cod  =
B D        American alligator  -
          Tibetan ground jay  -
            Tibetan antelope  -
B D                   Dolphin  -
B D                    Gibbon  =

Inserts between block 15 and 16 in window
         Pundamilia nyererei 1435bp
B D              Stickleback 557bp

Alignment block 16 of 237 in window, 14028370 - 14028372, 3 bps 
B D                     Human  gac
B D                     Chimp  gac
B D                   Gorilla  gac
B D                 Orangutan  gac
B D                    Rhesus  gac
B D       Crab-eating macaque  gac
B D                    Baboon  gac
B D              Green monkey  gac
B D                  Marmoset  gac
B D           Squirrel monkey  gac
B D                  Bushbaby  gac
           Chinese tree shrew  gat
B D                  Squirrel  ggc
       Lesser Egyptian jerboa  gaa
                 Prairie vole  gac
B D           Chinese hamster  gac
               Golden hamster  gac
B D                     Mouse  gac
B D                       Rat  gac
B D            Naked mole-rat  gac
B D                Guinea pig  gat
                   Chinchilla  gac
             Brush-tailed rat  gac
B D                    Rabbit  gac
B D                      Pika  gag
B D                       Pig  gac
B D                    Alpaca  gac
               Bactrian camel  gac
                 Killer whale  gac
B D                     Horse  gac
B D          White rhinoceros  gac
B D                       Cat  gac
B D                       Dog  gac
B D                   Ferret   gac
B D                     Panda  gac
               Pacific walrus  gac
                 Weddell seal  gac
             Black flying-fox  gac
B D                   Megabat  gac
                Big brown bat  gac
         David's myotis (bat)  gac
B D                  Microbat  gac
B D                  Hedgehog  cag
B D                     Shrew  ggc
              Star-nosed mole  gac
B D                  Elephant  gat
          Cape elephant shrew  gat
B D                   Manatee  gac
             Cape golden mole  gac
B D                    Tenrec  gac
                     Aardvark  gac
B D                 Armadillo  gac
B D                  Platypus  ggg
B D                      Fugu  -gc
B D                 Zebrafish  gac
     Mexican tetra (cavefish)  agc
B D                   Lamprey  ggc
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ---
B D             X. tropicalis  ===
B D                    Lizard  ---
B D                   Wallaby  ===
B D           Tasmanian devil  ---
B D                   Opossum  ---
  D    White-throated sparrow  ---
B D                   Chicken  ---
B D                Coelacanth  ===
  D  Chinese softshell turtle  ---
  D           Green seaturtle  ---
  D            Painted turtle  ---
B D                 Tetraodon  ---
B D              Atlantic cod  ===
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ---
         Princess of Burundi  ---
B D              Nile tilapia  ---
B D        American alligator  ---
          Tibetan ground jay  ---
            Tibetan antelope  ---
B D                   Dolphin  ---
B D                    Gibbon  ===

Inserts between block 16 and 17 in window
B D                    Shrew 8bp
B D                     Fugu 4875bp

Alignment block 17 of 237 in window, 14028373 - 14028378, 6 bps 
B D                     Human  -atcctg-
B D                     Chimp  -atcctg-
B D                   Gorilla  -atcctg-
B D                 Orangutan  -atcctg-
B D                    Rhesus  -atcctg-
B D       Crab-eating macaque  -atcctg-
B D                    Baboon  -atcctg-
B D              Green monkey  -atcctg-
B D                  Marmoset  -atcctg-
B D           Squirrel monkey  -atcctg-
B D                  Bushbaby  -atcctg-
           Chinese tree shrew  -tccctg-
B D                  Squirrel  -ctcctg-
       Lesser Egyptian jerboa  -gccctg-
                 Prairie vole  -gtcttg-
B D           Chinese hamster  -accttg-
               Golden hamster  -atcttg-
B D                     Mouse  -atcttg-
B D                       Rat  -atcttg-
B D            Naked mole-rat  -gccctg-
B D                Guinea pig  -gccccg-
                   Chinchilla  -gccctg-
             Brush-tailed rat  -gccctg-
B D                    Rabbit  -atcctg-
B D                      Pika  -agtctg-
B D                       Pig  -atgctg-
B D                    Alpaca  -atcatg-
               Bactrian camel  -atcctg-
                 Killer whale  -atcctg-
             Tibetan antelope  ------t-
B D                       Cow  ------t-
B D                     Sheep  ------t-
                Domestic goat  ------t-
B D                     Horse  -atcctg-
B D          White rhinoceros  -gccctg-
B D                       Cat  -atcctg-
B D                       Dog  -atcctg-
B D                   Ferret   -atcctg-
B D                     Panda  -gtcctg-
               Pacific walrus  -atcctg-
                 Weddell seal  -atcgtg-
             Black flying-fox  -ctcttg-
B D                   Megabat  -ctcttg-
                Big brown bat  -aacctg-
         David's myotis (bat)  -aacctg-
B D                  Microbat  -aacctg-
B D                  Hedgehog  -ctgctg-
B D                     Shrew  -gtcccg-
              Star-nosed mole  -atcctg-
B D                  Elephant  -gccctg-
          Cape elephant shrew  -gtcctg-
B D                   Manatee  -gtcctg-
             Cape golden mole  -gtcttg-
B D                    Tenrec  -atcctg-
                     Aardvark  -attctg-
B D                 Armadillo  -accctg-
B D                  Platypus  -atcctg-
  D    White-throated sparrow  -----cg-
           Tibetan ground jay  -----cg-
B D                   Chicken  -----cg-
B D        American alligator  -----cg-
  D           Green seaturtle  -----cg-
  D            Painted turtle  -----cg-
  D  Chinese softshell turtle  -----cg-
B D                    Lizard  -----cg-
B D             X. tropicalis  -aacgag-
B D                 Zebrafish  ------a-
     Mexican tetra (cavefish)  ------a-
B D                   Lamprey  agccgtgg
B D                      Fugu  ========
B D                   Wallaby  ========
B D           Tasmanian devil  --------
B D                   Opossum  --------
B D                Coelacanth  ========
B D                 Tetraodon  --------
B D              Atlantic cod  ========
B D               Stickleback  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  --------
         Princess of Burundi  --------
B D              Nile tilapia  --------
B D                   Dolphin  --------
B D                    Gibbon  ========

Inserts between block 17 and 18 in window
B D                Zebrafish 2811bp
    Mexican tetra (cavefish) 1bp

Alignment block 18 of 237 in window, 14028379 - 14028399, 21 bps 
B D                     Human  gcccacgaggc-tatgggtg---ag------
B D                     Chimp  gcccacgaggc-tatgggtg---ag------
B D                   Gorilla  gcccacgaggc-tatgggtg---ag------
B D                 Orangutan  gcccaggaggc-tatgggtg---ag------
B D                    Rhesus  gcccacgagac-tatgggtg---ag------
B D       Crab-eating macaque  gcccacgagac-tatgggtg---ag------
B D                    Baboon  gcccacgagac-tatgggtg---ag------
B D              Green monkey  gcccacgagac-tatgggtg---ag------
B D                  Marmoset  gcccggaaagc-tatgggtg---ag------
B D           Squirrel monkey  gcccgtgaagc-tatgggtg---ag------
B D                  Bushbaby  gcccagatagc-tatgggtg---ag------
           Chinese tree shrew  gccggagaagc-tgtgggtg---ag------
B D                  Squirrel  gcccccgaagc-tatgggtg---ag------
       Lesser Egyptian jerboa  ccccgccaaga-tgctggtg---ag------
                 Prairie vole  gcccatgactc-tctgggtg---ag------
B D           Chinese hamster  gcccacaacac-tcttggtg---ag------
               Golden hamster  gcccaggacac-tctgggtg---ag------
B D                     Mouse  gcccacgaatc-tctgggtg---ag------
B D                       Rat  gcccacgaccc-tctgggtg---ag------
B D            Naked mole-rat  gagcacgcggc-cgccggtg---ag------
B D                Guinea pig  gaacccggggc-cgtgggtg---a-------
                   Chinchilla  gagctccaggc-cgccggtg---ag------
             Brush-tailed rat  gagctcgaggc-cgcgggtg---ag------
B D                    Rabbit  gcccgggaagc-caccggtg---ag------
B D                      Pika  ---------gg-cacaggtgcgcag------
B D                       Pig  gcccatgaagc-tctgggtg---ag------
B D                    Alpaca  gcccatgaagc-tctgggtg---ag------
               Bactrian camel  gcccatgaagc-tctgggtg---ag------
                 Killer whale  gtctatgaagc-tatgggtg---ag------
             Tibetan antelope  gcccgcgacgc-tgtgggta---ag------
B D                       Cow  gcccacgacgc-tgtgggta---ag------
B D                     Sheep  gcccgcgatgc-tgtgggta---ag------
                Domestic goat  gcccgcgatgc-tgtgggta---ag------
B D                     Horse  gcccgcgaagc-tatgggtg---ag------
B D          White rhinoceros  gcccacgaagc-tatgggtg---ag------
B D                       Cat  gcccatgaagc-tacgggtg---ag------
B D                       Dog  actcatgaagc-tccaggtg---ag------
B D                   Ferret   gcctctgaagc-tacaggtg---ag------
B D                     Panda  gctcctgaagc-tacaggtg---ag------
               Pacific walrus  gctcctgaagc-tacgggtg---ag------
                 Weddell seal  gctcctgaagc-tacgggtg---ag------
             Black flying-fox  gctcatgaagt-gatgggtg---ag------
B D                   Megabat  gctcatgaagt-gatgggtg---ag------
                Big brown bat  gcccaggaagc-aatgggtg---ag------
         David's myotis (bat)  gcccaggaagc-tatgggtg---ag------
B D                  Microbat  gcccaggaagc-aatgggtg---ag------
B D                  Hedgehog  gaccacgaggc-cctgggtg---ag------
B D                     Shrew  cgtcg-ggcgc-ga---ggg---ag------
              Star-nosed mole  gctcatgatgc-tattggta---ag------
B D                  Elephant  acccaggaagc-tatgggtg---ag------
          Cape elephant shrew  acccatgaagc-cataggtg---ag------
B D                   Manatee  acctacgaagc-tatgggtg---ag------
             Cape golden mole  acccatgaagc-tatgggta---ag------
B D                    Tenrec  acccacgaagc-tataggtg---ag------
                     Aardvark  acacacgaagc-tatgggtg---ag------
B D                 Armadillo  ggccacccggg-cgcgggta---ag------
B D                   Opossum  ---cgggctag-aactggtg---ag------
B D           Tasmanian devil  ---cgagatag-ggcaggtg---ag------
B D                  Platypus  ---------tc-tgcaggta---ag------
  D    White-throated sparrow  gctctccctgctggcggtgg---ag------
           Tibetan ground jay  gctctccctgctggcggtgg---ag------
B D                   Chicken  gctctccctcatggcgatgg---ag------
B D        American alligator  ------------ggcaggtg---ag------
  D           Green seaturtle  ------------gacaggtg---ag------
  D            Painted turtle  ------------ggcaggtg---ag------
  D  Chinese softshell turtle  ------------gacaggtg---ag------
B D                    Lizard  ------------ggcaggtg---ag------
B D             X. tropicalis  gctctgcaagc-a------------------
B D                 Tetraodon  ---cccccgag-ctc-ggtg---ag------
B D              Nile tilapia  ---ctcgggag-tttaggta---ag------
          Princess of Burundi  ---ctcaggag-tttaggta---ag------
                  Zebra mbuna  ---ctcaggag-tttaggta---ag------
     Mexican tetra (cavefish)  gagcgcgagag-gatcgacc---ag------
B D                   Lamprey  ------gtcgg-tgcggctg---agagctgg
B D                 Zebrafish  ===============================
B D                      Fugu  ===============================
B D                   Wallaby  ===============================
B D                Coelacanth  ===============================
B D              Atlantic cod  ===============================
B D               Stickleback  ===============================
         Pundamilia nyererei  ===============================
B D                   Dolphin  -------------------------------
B D                    Gibbon  ===============================

Inserts between block 18 and 19 in window
B D                 Squirrel 3bp
      Lesser Egyptian jerboa 4bp
                Prairie vole 16bp
B D          Chinese hamster 6bp
              Golden hamster 1394bp
B D                    Mouse 4bp
B D                      Rat 5bp
B D           Naked mole-rat 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                 Hedgehog 1bp
B D                  Opossum 15bp
B D          Tasmanian devil 10bp
  D   White-throated sparrow 12bp
          Tibetan ground jay 12bp
B D                  Chicken 12bp
B D       American alligator 11bp
  D          Green seaturtle 7bp
  D           Painted turtle 7bp
  D Chinese softshell turtle 5bp
B D                   Lizard 19bp

Alignment block 19 of 237 in window, 14028400 - 14028405, 6 bps 
B D                     Human  gct-----------------gg--g
B D                     Chimp  gct-----------------gg--g
B D                   Gorilla  gct-----------------gg--g
B D                 Orangutan  gct-----------------gg--g
B D                    Rhesus  gct-----------------gg--g
B D       Crab-eating macaque  gct-----------------gg--g
B D                    Baboon  gct-----------------gg--g
B D              Green monkey  gct-----------------gg--g
B D                  Marmoset  gct-----------------gg--g
B D           Squirrel monkey  gct-----------------gg--g
B D                  Bushbaby  gct-----------------gg--t
           Chinese tree shrew  gct-----------------gc--a
B D                  Squirrel  ggg-----------------gg--g
       Lesser Egyptian jerboa  gga-----------------gg--g
                 Prairie vole  gtg-----------------gg--g
B D           Chinese hamster  gtg-----------------gg--g
B D                     Mouse  ------------------------a
B D                       Rat  agg-----------------ga--a
B D            Naked mole-rat  ctg-----------------gg--c
B D                Guinea pig  gcg-----------------gg--c
                   Chinchilla  gcg-----------------gg--c
             Brush-tailed rat  gcg-----------------gg--c
B D                    Rabbit  ctg-----------------gggcc
B D                      Pika  ctg-----------------gg--c
B D                       Pig  gct-----------------gg--g
B D                    Alpaca  act-----------------gg--g
               Bactrian camel  act-----------------tg--g
                 Killer whale  gct-----------------gg--g
             Tibetan antelope  gct-----------------gg--g
B D                       Cow  gct-----------------ga--g
B D                     Sheep  gct-----------------gg--g
                Domestic goat  gct-----------------gg--g
B D                     Horse  gct-----------------gg--g
B D          White rhinoceros  gct-----------------gg--g
B D                       Cat  gctgggggggggtgcggctggg--g
B D                       Dog  gct----------------ggg--g
B D                   Ferret   gct-----------------gc--g
B D                     Panda  gct-----------------gg--g
               Pacific walrus  gct-----------------gg--g
                 Weddell seal  gct------------------g--g
             Black flying-fox  gct-----------------gg--g
B D                   Megabat  gct-----------------gg--g
                Big brown bat  gcg------------------g--g
         David's myotis (bat)  gca------------------g--g
B D                  Microbat  gca---------------------c
B D                  Hedgehog  ggc-----------------gg--g
B D                     Shrew  gcc-----------------gg--g
              Star-nosed mole  gct-----------------gg--g
B D                  Elephant  act-----------------gg--g
          Cape elephant shrew  gct----------------------
B D                   Manatee  gct-----------------gg--g
             Cape golden mole  gct-----------------gg--g
B D                    Tenrec  gct-----------------gg--g
                     Aardvark  gct-----------------gg--g
B D                 Armadillo  gct-----------------g----
B D                   Opossum  -----------------ctagg--g
B D           Tasmanian devil  -----------------ggagg--g
B D                  Platypus  -----------------aaggg--g
  D    White-throated sparrow  gcc-----------------gg--t
           Tibetan ground jay  gcc-----------------gg--t
B D                   Chicken  gcc-----------------gg--t
B D        American alligator  act-----------------cc--t
  D           Green seaturtle  gtt-----------------gt--g
  D            Painted turtle  gct-----------------gg--g
  D  Chinese softshell turtle  --t-----------------gg--g
B D                    Lizard  gct-----------------gg--g
B D             X. tropicalis  ggt-----------------ag--g
B D                 Tetraodon  tct-----------------gg--g
B D              Nile tilapia  ccc-----------------gg--t
          Princess of Burundi  ccc-----------------gg--t
                  Zebra mbuna  ccc-----------------gg--t
     Mexican tetra (cavefish)  gac-----------------ag--t
B D                   Lamprey  gat-----------------gg--t
              Golden hamster  =========================
B D                 Zebrafish  =========================
B D                      Fugu  =========================
B D                   Wallaby  =========================
B D                Coelacanth  =========================
B D              Atlantic cod  =========================
B D               Stickleback  =========================
         Pundamilia nyererei  =========================
B D                   Dolphin  -------------------------
B D                    Gibbon  =========================

Inserts between block 19 and 20 in window
B D                Tetraodon 107bp

Alignment block 20 of 237 in window, 14028406 - 14028407, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  ga
           Chinese tree shrew  ga
B D                  Squirrel  aa
       Lesser Egyptian jerboa  ag
                 Prairie vole  ag
B D           Chinese hamster  gg
B D                     Mouse  gg
B D                       Rat  ag
B D            Naked mole-rat  ag
B D                Guinea pig  ag
                   Chinchilla  gg
             Brush-tailed rat  gg
B D                    Rabbit  ag
B D                      Pika  gg
B D                       Pig  ga
B D                    Alpaca  ga
               Bactrian camel  ga
                 Killer whale  ga
             Tibetan antelope  ga
B D                       Cow  ga
B D                     Sheep  ga
                Domestic goat  ga
B D                     Horse  ga
B D          White rhinoceros  ga
B D                       Cat  gg
B D                       Dog  ga
B D                   Ferret   aa
B D                     Panda  ga
               Pacific walrus  ga
                 Weddell seal  ga
             Black flying-fox  ga
B D                   Megabat  ga
                Big brown bat  ga
         David's myotis (bat)  ga
B D                  Microbat  ga
B D                  Hedgehog  aa
B D                     Shrew  gc
              Star-nosed mole  ga
B D                  Elephant  ca
B D                   Manatee  ca
             Cape golden mole  ca
B D                    Tenrec  ca
                     Aardvark  ca
B D                   Opossum  ga
B D           Tasmanian devil  ga
B D                  Platypus  aa
  D    White-throated sparrow  ga
           Tibetan ground jay  ga
B D                   Chicken  ga
B D        American alligator  gg
  D           Green seaturtle  gg
  D            Painted turtle  gc
  D  Chinese softshell turtle  gg
B D                    Lizard  ga
B D             X. tropicalis  gg
B D              Nile tilapia  ga
          Princess of Burundi  ga
                  Zebra mbuna  ga
     Mexican tetra (cavefish)  ga
B D                   Lamprey  ga
         Cape elephant shrew  --
              Golden hamster  ==
B D                 Zebrafish  ==
B D                      Fugu  ==
B D                   Wallaby  ==
B D                Coelacanth  ==
B D                 Tetraodon  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
B D                   Dolphin  --
B D                 Armadillo  --
B D                    Gibbon  ==

Inserts between block 20 and 21 in window
B D             Nile tilapia 1bp
         Princess of Burundi 1272bp
                 Zebra mbuna 1bp

Alignment block 21 of 237 in window, 14028408 - 14028408, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  a
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
B D           Chinese hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  a
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   a
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  a
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                   Opossum  t
B D           Tasmanian devil  c
B D                  Platypus  t
  D    White-throated sparrow  g
           Tibetan ground jay  g
B D                   Chicken  g
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  g
  D  Chinese softshell turtle  g
B D                    Lizard  g
B D             X. tropicalis  g
     Mexican tetra (cavefish)  g
B D                   Lamprey  g
         Cape elephant shrew  -
              Golden hamster  =
                Prairie vole  -
B D                 Zebrafish  =
B D                      Fugu  =
B D                   Wallaby  =
B D                Coelacanth  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D                   Dolphin  -
B D                 Armadillo  -
B D                    Gibbon  =

Inserts between block 21 and 22 in window
  D   White-throated sparrow 7bp
          Tibetan ground jay 7bp
B D                  Chicken 7bp
B D       American alligator 10bp
  D          Green seaturtle 10bp
  D           Painted turtle 10bp
  D Chinese softshell turtle 8bp
B D                   Lizard 6021bp
B D            X. tropicalis 1975bp
    Mexican tetra (cavefish) 3180bp

Alignment block 22 of 237 in window, 14028409 - 14028409, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  t
           Chinese tree shrew  g
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  g
B D           Chinese hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  c
              Star-nosed mole  g
B D                  Elephant  g
B D                   Manatee  a
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                   Opossum  g
B D           Tasmanian devil  a
B D                  Platypus  g
B D              Nile tilapia  a
                  Zebra mbuna  a
B D                   Lamprey  a
         Cape elephant shrew  -
              Golden hamster  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D             X. tropicalis  =
B D                    Lizard  =
B D                      Fugu  =
B D                   Wallaby  =
  D    White-throated sparrow  =
B D                   Chicken  =
B D                Coelacanth  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
         Pundamilia nyererei  =
         Princess of Burundi  =
B D        American alligator  =
          Tibetan ground jay  =
B D                   Dolphin  -
B D                 Armadillo  -
B D                    Gibbon  =

Inserts between block 22 and 23 in window
B D                 Squirrel 2bp
      Lesser Egyptian jerboa 3bp
B D             Nile tilapia 1366bp
                 Zebra mbuna 1357bp

Alignment block 23 of 237 in window, 14028410 - 14028412, 3 bps 
B D                     Human  ga--g
B D                     Chimp  ga--g
B D                   Gorilla  ga--g
B D                 Orangutan  ga--a
B D                    Rhesus  ga--g
B D       Crab-eating macaque  ga--g
B D                    Baboon  ga--g
B D              Green monkey  ga--g
B D                  Marmoset  aa--g
B D           Squirrel monkey  aa--g
B D                  Bushbaby  gg--g
           Chinese tree shrew  gc--g
B D                  Squirrel  ag--g
       Lesser Egyptian jerboa  at--g
                 Prairie vole  at--c
B D           Chinese hamster  at--c
B D                     Mouse  at--c
B D                       Rat  at--g
B D            Naked mole-rat  gg--a
B D                Guinea pig  cg--g
                   Chinchilla  gg--g
             Brush-tailed rat  ag--g
B D                    Rabbit  gg--g
B D                      Pika  tg--t
B D                       Pig  ta--a
B D                    Alpaca  ta--g
               Bactrian camel  ta--g
                 Killer whale  tgctg
             Tibetan antelope  ta--g
B D                       Cow  ta--g
B D                     Sheep  ta--g
                Domestic goat  ta--g
B D                     Horse  gc--g
B D          White rhinoceros  ga--g
B D                       Cat  ta--g
B D                       Dog  ta--g
B D                   Ferret   ga--g
B D                     Panda  ca--g
               Pacific walrus  ta--g
                 Weddell seal  ta--g
             Black flying-fox  ta--g
B D                   Megabat  ta--g
                Big brown bat  tg--g
         David's myotis (bat)  tg--g
B D                  Microbat  ta--g
B D                  Hedgehog  gg--g
B D                     Shrew  gc--g
              Star-nosed mole  tg--g
B D                  Elephant  tg--c
B D                   Manatee  tg--g
             Cape golden mole  tg--t
B D                    Tenrec  tg---
                     Aardvark  gg--t
B D                   Opossum  gg--g
B D           Tasmanian devil  cc--t
B D                  Platypus  gg--t
B D                   Lamprey  ga--g
         Cape elephant shrew  -----
              Golden hamster  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D             X. tropicalis  =====
B D                    Lizard  =====
B D                      Fugu  =====
B D                   Wallaby  =====
  D    White-throated sparrow  =====
B D                   Chicken  =====
B D                Coelacanth  =====
  D  Chinese softshell turtle  =====
  D           Green seaturtle  =====
  D            Painted turtle  =====
B D                 Tetraodon  =====
B D              Atlantic cod  =====
B D               Stickleback  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
B D        American alligator  =====
          Tibetan ground jay  =====
B D                   Dolphin  -----
B D                 Armadillo  -----
B D                    Gibbon  =====

Alignment block 24 of 237 in window, 14028413 - 14028416, 4 bps 
B D                     Human  tgga---------
B D                     Chimp  tgga---------
B D                   Gorilla  tgga---------
B D                 Orangutan  tgga---------
B D                    Rhesus  tgga---------
B D       Crab-eating macaque  tgga---------
B D                    Baboon  tgga---------
B D              Green monkey  tgga---------
B D                  Marmoset  agga---------
B D           Squirrel monkey  agga---------
B D                  Bushbaby  tgtg---------
           Chinese tree shrew  tgca---------
B D                  Squirrel  agga---------
       Lesser Egyptian jerboa  agcg---------
                 Prairie vole  accc---------
B D           Chinese hamster  aacc---------
B D                     Mouse  aacc---------
B D                       Rat  gacc---------
B D            Naked mole-rat  gtgg---------
B D                Guinea pig  agct---------
                   Chinchilla  cgcg---------
             Brush-tailed rat  caca---------
B D                       Pig  tgtg---------
B D                    Alpaca  tgtg---------
               Bactrian camel  tgtg---------
                 Killer whale  tgtg---------
             Tibetan antelope  tgtg---------
B D                       Cow  tatg---------
B D                     Sheep  tgtg---------
                Domestic goat  tgtg---------
B D                     Horse  tgtg---------
B D          White rhinoceros  tgtg---------
B D                       Cat  tgt----------
B D                       Dog  tgtg---------
B D                   Ferret   ggtg---------
B D                     Panda  tgt----------
               Pacific walrus  cgtg---------
                 Weddell seal  cgtg---------
             Black flying-fox  tgat---------
B D                   Megabat  tgat---------
                Big brown bat  tgga---------
         David's myotis (bat)  tgga---------
B D                  Microbat  tgga---------
B D                  Hedgehog  agcg---------
B D                     Shrew  cgca---------
              Star-nosed mole  tggg---------
B D                  Elephant  gggg---------
B D                   Manatee  tgg----------
             Cape golden mole  ggga---------
B D                    Tenrec  gggc---------
                     Aardvark  ggg----------
B D                   Opossum  gaga---------
B D           Tasmanian devil  gaga---------
B D                  Platypus  tgga---------
  D    White-throated sparrow  -gga----gcgag
           Tibetan ground jay  -gga----gcggg
B D                   Chicken  -ggacggcgcgga
B D        American alligator  -gga----gcggg
  D           Green seaturtle  -ggc---tgctgg
  D            Painted turtle  -ggc---tgctgg
  D  Chinese softshell turtle  ---------ctgg
         Cape elephant shrew  -------------
              Golden hamster  =============
    Mexican tetra (cavefish)  =============
B D                      Pika  -------------
B D                 Zebrafish  =============
B D             X. tropicalis  =============
B D                    Lizard  =============
B D                      Fugu  =============
B D                   Wallaby  =============
B D                Coelacanth  =============
B D                 Tetraodon  =============
B D              Atlantic cod  =============
B D               Stickleback  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  =============
         Princess of Burundi  =============
B D              Nile tilapia  =============
B D                    Rabbit  -------------
B D                   Dolphin  -------------
B D                 Armadillo  -------------
B D                    Gibbon  =============

Inserts between block 24 and 25 in window
B D                  Opossum 20bp
B D          Tasmanian devil 488bp

Alignment block 25 of 237 in window, 14028417 - 14028419, 3 bps 
B D                     Human  --------tgt
B D                     Chimp  --------tgt
B D                   Gorilla  --------tgt
B D                 Orangutan  --------tgt
B D                    Rhesus  --------tgt
B D       Crab-eating macaque  --------tgt
B D                    Baboon  --------tgt
B D              Green monkey  --------tat
B D                  Marmoset  --------tgt
B D           Squirrel monkey  --------tgg
B D                  Bushbaby  --------tgt
           Chinese tree shrew  --------t--
B D                  Squirrel  --------gg-
       Lesser Egyptian jerboa  --------gg-
                 Prairie vole  --------tg-
B D           Chinese hamster  --------tg-
B D                     Mouse  --------tg-
B D                       Rat  --------tg-
B D            Naked mole-rat  --------gga
B D                Guinea pig  --------gg-
                   Chinchilla  --------gga
             Brush-tailed rat  --------gga
B D                       Pig  --------tgt
B D                    Alpaca  --------tat
               Bactrian camel  --------tat
                 Killer whale  --------tgt
             Tibetan antelope  --------tgt
B D                       Cow  --------tgt
B D                     Sheep  --------tgt
                Domestic goat  --------tgt
B D                     Horse  --------tgc
B D          White rhinoceros  --------t--
B D                       Cat  ---------gg
B D                       Dog  --------tag
B D                   Ferret   --------tgg
               Pacific walrus  --------tag
                 Weddell seal  --------cgg
             Black flying-fox  --------ggt
B D                   Megabat  --------ggt
B D                  Hedgehog  --------t--
B D                     Shrew  --------cgt
              Star-nosed mole  --------tgt
B D                  Elephant  --------cg-
             Cape golden mole  --------gc-
B D                    Tenrec  --------ca-
B D                   Opossum  --------t--
B D                  Platypus  ---------ga
  D    White-throated sparrow  -----caag--
           Tibetan ground jay  g---ccgag--
B D                   Chicken  g---ctgca--
B D        American alligator  -----cagg--
  D           Green seaturtle  gtactcaat--
  D            Painted turtle  gtacccaat--
  D  Chinese softshell turtle  attcccact--
         Cape elephant shrew  -----------
              Golden hamster  ===========
    Mexican tetra (cavefish)  ===========
B D                      Pika  -----------
               Big brown bat  -----------
B D                 Zebrafish  ===========
B D             X. tropicalis  ===========
B D                    Lizard  ===========
B D                      Fugu  ===========
B D                   Wallaby  ===========
B D           Tasmanian devil  ===========
B D                Coelacanth  ===========
B D                 Tetraodon  ===========
B D              Atlantic cod  ===========
B D               Stickleback  ===========
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
         Princess of Burundi  ===========
B D              Nile tilapia  ===========
B D                    Rabbit  -----------
B D                   Dolphin  -----------
                    Aardvark  -----------
B D                  Microbat  -----------
        David's myotis (bat)  -----------
B D                     Panda  -----------
B D                 Armadillo  -----------
B D                   Manatee  -----------
B D                    Gibbon  ===========

Inserts between block 25 and 26 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 5bp
B D         White rhinoceros 5bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  5bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 9bp
B D                  Megabat 17bp
B D                    Shrew 696bp
B D                 Platypus 1bp

Alignment block 26 of 237 in window, 14028420 - 14028422, 3 bps 
B D                     Human  aga-
B D                     Chimp  aga-
B D                   Gorilla  agg-
B D                 Orangutan  agg-
B D                    Rhesus  agg-
B D       Crab-eating macaque  agg-
B D                    Baboon  agg-
B D              Green monkey  ggg-
B D                  Marmoset  agg-
B D           Squirrel monkey  agg-
B D                  Bushbaby  ggg-
B D            Naked mole-rat  cag-
B D                Guinea pig  --g-
                   Chinchilla  cgg-
             Brush-tailed rat  cag-
B D                       Pig  -gg-
B D                    Alpaca  -ac-
               Bactrian camel  -ac-
                 Killer whale  -tt-
             Tibetan antelope  -gc-
B D                       Cow  -gc-
B D                     Sheep  -gc-
                Domestic goat  -gc-
B D                     Horse  -gc-
B D          White rhinoceros  -g--
B D                       Cat  -gg-
B D                       Dog  -gg-
B D                   Ferret   -gg-
B D                     Panda  --g-
               Pacific walrus  -gg-
                 Weddell seal  -gg-
             Black flying-fox  -cg-
B D                   Megabat  -gg-
                Big brown bat  -ag-
         David's myotis (bat)  -cg-
B D                  Microbat  -ag-
B D                  Hedgehog  -ag-
              Star-nosed mole  -gg-
B D                  Elephant  -gg-
             Cape golden mole  -gg-
B D                    Tenrec  -gg-
                     Aardvark  --g-
B D                   Opossum  -ag-
B D                  Platypus  agg-
  D    White-throated sparrow  -cgc
           Tibetan ground jay  -ggg
B D                   Chicken  -ggg
B D        American alligator  -ggg
  D           Green seaturtle  -ggg
  D            Painted turtle  -gga
  D  Chinese softshell turtle  -ggg
         Cape elephant shrew  ----
              Golden hamster  ====
                Prairie vole  ----
B D                     Mouse  ----
B D                       Rat  ----
    Mexican tetra (cavefish)  ====
B D           Chinese hamster  ----
      Lesser Egyptian jerboa  ----
B D                      Pika  ----
          Chinese tree shrew  ----
B D                     Shrew  ====
B D                 Zebrafish  ====
B D             X. tropicalis  ====
B D                    Lizard  ====
B D                      Fugu  ====
B D                   Wallaby  ====
B D           Tasmanian devil  ====
B D                Coelacanth  ====
B D                 Tetraodon  ====
B D              Atlantic cod  ====
B D               Stickleback  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D                    Rabbit  ----
B D                   Dolphin  ----
B D                 Armadillo  ----
B D                   Manatee  ----
B D                  Squirrel  ----
B D                    Gibbon  ====

Inserts between block 26 and 27 in window
B D                      Pig 2bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                 Hedgehog 11248bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                  Opossum 1bp
B D                 Platypus 1bp

Alignment block 27 of 237 in window, 14028423 - 14028426, 4 bps 
B D                     Human  aggg
B D                     Chimp  aggg
B D                   Gorilla  aggg
B D                 Orangutan  aggg
B D                    Rhesus  aggg
B D       Crab-eating macaque  aggg
B D                    Baboon  aggg
B D              Green monkey  agag
B D                  Marmoset  cggg
B D           Squirrel monkey  cggg
B D                  Bushbaby  ag-g
B D            Naked mole-rat  aggg
B D                Guinea pig  aggg
                   Chinchilla  aggg
             Brush-tailed rat  aggg
B D                       Pig  aggg
B D                    Alpaca  aggg
               Bactrian camel  aggg
                 Killer whale  aggg
             Tibetan antelope  caca
B D                       Cow  cgcg
B D                     Sheep  cacg
                Domestic goat  cacg
B D                     Horse  gggg
B D          White rhinoceros  gggg
B D                       Cat  ggag
B D                       Dog  cagg
B D                   Ferret   gggt
B D                     Panda  gggg
               Pacific walrus  gagg
                 Weddell seal  gagg
             Black flying-fox  gggg
B D                   Megabat  ggcg
                Big brown bat  ggag
         David's myotis (bat)  ggag
B D                  Microbat  ggag
              Star-nosed mole  tgga
B D                  Elephant  -ggg
          Cape elephant shrew  -gga
B D                   Manatee  -agg
             Cape golden mole  -ggg
B D                    Tenrec  -ggg
                     Aardvark  -gga
B D                 Armadillo  -ggg
B D                   Opossum  aggg
B D                  Platypus  aga-
  D    White-throated sparrow  cagg
           Tibetan ground jay  cagg
B D                   Chicken  cggg
B D        American alligator  gagt
  D           Green seaturtle  agcg
  D            Painted turtle  aggg
  D  Chinese softshell turtle  aggg
              Golden hamster  ====
                Prairie vole  ----
B D                     Mouse  ----
B D                       Rat  ----
    Mexican tetra (cavefish)  ====
B D           Chinese hamster  ----
      Lesser Egyptian jerboa  ----
B D                      Pika  ----
          Chinese tree shrew  ----
B D                  Hedgehog  ====
B D                     Shrew  ====
B D                 Zebrafish  ====
B D             X. tropicalis  ====
B D                    Lizard  ====
B D                      Fugu  ====
B D                   Wallaby  ====
B D           Tasmanian devil  ====
B D                Coelacanth  ====
B D                 Tetraodon  ====
B D              Atlantic cod  ====
B D               Stickleback  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D                    Rabbit  ----
B D                   Dolphin  ----
B D                  Squirrel  ----
B D                    Gibbon  ====

Inserts between block 27 and 28 in window
B D           Naked mole-rat 207bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 28 of 237 in window, 14028427 - 14028427, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
B D                     Mouse  g
B D                       Rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  a
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
              Star-nosed mole  g
B D                  Elephant  a
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D                  Platypus  g
  D    White-throated sparrow  c
           Tibetan ground jay  c
B D                   Chicken  c
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  g
  D  Chinese softshell turtle  g
              Golden hamster  =
    Mexican tetra (cavefish)  =
          Chinese tree shrew  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                 Zebrafish  =
B D             X. tropicalis  =
B D                    Lizard  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D                Coelacanth  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D                   Dolphin  -
B D            Naked mole-rat  =
B D                    Gibbon  =

Inserts between block 28 and 29 in window
                  Chinchilla 1bp
            Brush-tailed rat 809bp

Alignment block 29 of 237 in window, 14028428 - 14028431, 4 bps 
B D                     Human  -------aac-----a
B D                     Chimp  -------aac-----a
B D                   Gorilla  -------aac-----a
B D                 Orangutan  -------aac-----a
B D                    Rhesus  -------aat-----g
B D       Crab-eating macaque  -------aac-----g
B D                    Baboon  -------aac-----g
B D              Green monkey  -------aac-----g
B D                  Marmoset  -------aac-----g
B D           Squirrel monkey  -------aac-----a
B D                  Bushbaby  -------agc-----a
B D                  Squirrel  -------aac-----a
       Lesser Egyptian jerboa  -------cag-----c
                 Prairie vole  -------agc-----a
B D           Chinese hamster  -------aac-----a
B D                     Mouse  -------aac-----a
B D                       Rat  -------aac-----a
B D                Guinea pig  -------acc-----t
                   Chinchilla  -------agc-----a
B D                    Rabbit  -------gac-----g
B D                      Pika  -------tgc-----a
B D                       Pig  -------ggt-----g
B D                    Alpaca  -------gat-----t
               Bactrian camel  -------gat-----t
                 Killer whale  -------cat-----t
             Tibetan antelope  -------gat-----t
B D                       Cow  -------gat-----t
B D                     Sheep  -------gat-----t
                Domestic goat  -------gat-----t
B D                     Horse  -------tgt-----g
B D          White rhinoceros  -------tgc-----g
B D                       Cat  -------ggt-----g
B D                       Dog  -------ggt-----g
B D                   Ferret   -------ggt-----g
B D                     Panda  -------ggt-----g
               Pacific walrus  -------ggt-----g
                 Weddell seal  -------ggt-----g
             Black flying-fox  -------gat-----g
B D                   Megabat  -------tat-----a
                Big brown bat  -------aaa-----g
         David's myotis (bat)  -------aaa-----g
B D                  Microbat  -------aaa-----g
              Star-nosed mole  -------ggt-----g
B D                  Elephant  --------gc-----g
          Cape elephant shrew  --------gt-----g
B D                   Manatee  --------gt-----g
             Cape golden mole  --------gtagaatg
B D                    Tenrec  --------gt------
                     Aardvark  --------at-----g
B D                 Armadillo  --------gt-----g
B D                   Opossum  -------aac-----a
  D    White-throated sparrow  ggctgtcga-------
           Tibetan ground jay  ggctgtcgg-------
B D                   Chicken  g-----cgg-------
B D        American alligator  agc---cga-------
  D           Green seaturtle  agc---ggg-------
  D            Painted turtle  agt---ggg-------
  D  Chinese softshell turtle  agc---agg-------
              Golden hamster  ================
    Mexican tetra (cavefish)  ================
          Chinese tree shrew  ----------------
B D                  Hedgehog  ================
B D                     Shrew  ================
B D                 Zebrafish  ================
B D             X. tropicalis  ================
B D                    Lizard  ================
B D                      Fugu  ================
B D                   Wallaby  ================
B D           Tasmanian devil  ================
B D                Coelacanth  ================
B D                 Tetraodon  ================
B D              Atlantic cod  ================
B D               Stickleback  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
B D                  Platypus  ----------------
B D                   Dolphin  ----------------
            Brush-tailed rat  ================
B D            Naked mole-rat  ================
B D                    Gibbon  ================

Inserts between block 29 and 30 in window
B D               Guinea pig 1bp
                  Chinchilla 832bp
            Black flying-fox 2bp
B D                  Megabat 2bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 30 of 237 in window, 14028432 - 14028436, 5 bps 
B D                     Human  ggtg-g----
B D                     Chimp  ggtg-g----
B D                   Gorilla  ggtg-g----
B D                 Orangutan  ggtg-g----
B D                    Rhesus  ggtg-g----
B D       Crab-eating macaque  ggtg-g----
B D                    Baboon  ggtg-g----
B D              Green monkey  ggtg-g----
B D                  Marmoset  ggtg-c----
B D           Squirrel monkey  ggtg-c----
B D                  Bushbaby  gatg-g----
B D                  Squirrel  gagg-g----
       Lesser Egyptian jerboa  gggg-g----
                 Prairie vole  ggtg-g----
B D           Chinese hamster  ggtg-g----
B D                     Mouse  ggtg-t----
B D                       Rat  ggtg-t----
B D                Guinea pig  gctg-t----
B D                    Rabbit  ggtga-----
B D                      Pika  ggtg------
B D                       Pig  -----g----
B D                    Alpaca  -----g----
               Bactrian camel  -----g----
                 Killer whale  -----g----
             Tibetan antelope  -----g----
B D                       Cow  -----g----
B D                     Sheep  -----g----
                Domestic goat  -----g----
B D                     Horse  -----g----
B D          White rhinoceros  -----g----
B D                       Cat  -----g----
B D                       Dog  -----g----
B D                   Ferret   -----g----
B D                     Panda  -----g----
               Pacific walrus  -----g----
                 Weddell seal  -----g----
             Black flying-fox  -----g----
B D                   Megabat  -----g----
                Big brown bat  -----g----
         David's myotis (bat)  -----g----
B D                  Microbat  -----g----
              Star-nosed mole  -----g----
B D                  Elephant  -----g----
          Cape elephant shrew  -----g----
B D                   Manatee  -----g----
             Cape golden mole  -----g----
                     Aardvark  -----a----
B D                 Armadillo  -----g----
B D                   Opossum  --ca-g----
  D    White-throated sparrow  -----ggctc
           Tibetan ground jay  -----ggcgc
B D                   Chicken  -----ggctc
B D        American alligator  -----gtttc
  D           Green seaturtle  -----gtctg
  D            Painted turtle  -----gtctg
  D  Chinese softshell turtle  -----gtctt
              Golden hamster  ==========
    Mexican tetra (cavefish)  ==========
B D                    Tenrec  ----------
          Chinese tree shrew  ----------
B D                  Hedgehog  ==========
B D                     Shrew  ==========
B D                 Zebrafish  ==========
B D             X. tropicalis  ==========
B D                    Lizard  ==========
B D                      Fugu  ==========
B D                   Wallaby  ==========
B D           Tasmanian devil  ==========
B D                Coelacanth  ==========
B D                 Tetraodon  ==========
B D              Atlantic cod  ==========
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
         Princess of Burundi  ==========
B D              Nile tilapia  ==========
B D                  Platypus  ----------
B D                   Dolphin  ----------
            Brush-tailed rat  ==========
B D            Naked mole-rat  ==========
                  Chinchilla  ==========
B D                    Gibbon  ==========

Inserts between block 30 and 31 in window
      Lesser Egyptian jerboa 4bp
                Prairie vole 1008bp
B D               Guinea pig 2bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                  Ferret  3bp
B D                    Panda 3bp
              Pacific walrus 3bp
                Weddell seal 3bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
             Star-nosed mole 1bp
B D                 Elephant 4bp
         Cape elephant shrew 4bp
B D                  Manatee 4bp
            Cape golden mole 4bp
                    Aardvark 4bp
B D                Armadillo 1bp
B D                  Opossum 2bp

Alignment block 31 of 237 in window, 14028437 - 14028445, 9 bps 
B D                     Human  ct-gg----atggg
B D                     Chimp  ct-ggctggatgga
B D                   Gorilla  ct-gg----atggg
B D                 Orangutan  ct-gg----atgga
B D                    Rhesus  ct-gg----atggg
B D       Crab-eating macaque  ct-gg----atggg
B D                    Baboon  ct-gg----atggg
B D              Green monkey  ct-gg----atggg
B D                  Marmoset  cc-gg----atggg
B D           Squirrel monkey  cc-gg----atggg
B D                  Bushbaby  ct-gg----ataga
           Chinese tree shrew  ct-gg----gtgga
B D                  Squirrel  cc-cc----atggg
       Lesser Egyptian jerboa  at-gg----ctggg
B D           Chinese hamster  tc-ag----atggg
B D                     Mouse  cc-tg----gtaag
B D                       Rat  cc-tg----gtggg
B D                Guinea pig  cc-tc----gcggg
B D                    Rabbit  -c-ct----gcagg
B D                      Pika  ----t----gtgtg
B D                       Pig  cg-ag----acagg
B D                    Alpaca  tg-gg----atgtg
               Bactrian camel  tg-gg----atgtg
                 Killer whale  ca-gg----acaca
             Tibetan antelope  tg-gg----acatg
B D                       Cow  tg-gg-----catg
B D                     Sheep  tg-gg----acatg
                Domestic goat  tg-gg----acatg
B D                     Horse  ---gg----acagg
B D          White rhinoceros  ---gc----acagg
B D                       Cat  at-gg----atggg
B D                       Dog  gt-gg----atggg
B D                   Ferret   gt-gg----atgga
B D                     Panda  gt-gg----atggg
               Pacific walrus  gt-gg----atggg
                 Weddell seal  gt-gg----atggg
             Black flying-fox  ag-gg----gtagg
B D                   Megabat  ag-gg----atagg
                Big brown bat  gg-ac----atggg
         David's myotis (bat)  gg-at----acggg
B D                  Microbat  gg-at----acggg
              Star-nosed mole  tg------------
B D                  Elephant  ca-gg----atggg
          Cape elephant shrew  ca-ga----a-ggg
B D                   Manatee  ca-gg----atggg
             Cape golden mole  ca-ag----atgga
B D                    Tenrec  ----------tggg
                     Aardvark  ca-gg----gtggg
B D                 Armadillo  ---------acggg
B D                   Opossum  ct-gc----aaagg
  D    White-throated sparrow  tt-cg----ctcgc
           Tibetan ground jay  tt-gg----ctcgc
B D                   Chicken  ----g----tccgt
B D        American alligator  ctggg----ttcca
  D           Green seaturtle  ct-gg----ttgga
  D            Painted turtle  ct-gg----ttgga
  D  Chinese softshell turtle  ct-gg----ttggc
              Golden hamster  ==============
                Prairie vole  ==============
    Mexican tetra (cavefish)  ==============
B D                  Hedgehog  ==============
B D                     Shrew  ==============
B D                 Zebrafish  ==============
B D             X. tropicalis  ==============
B D                    Lizard  ==============
B D                      Fugu  ==============
B D                   Wallaby  ==============
B D           Tasmanian devil  ==============
B D                Coelacanth  ==============
B D                 Tetraodon  ==============
B D              Atlantic cod  ==============
B D               Stickleback  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
B D                  Platypus  --------------
B D                   Dolphin  --------------
            Brush-tailed rat  ==============
B D            Naked mole-rat  ==============
                  Chinchilla  ==============
B D                    Gibbon  ==============

Inserts between block 31 and 32 in window
B D          Chinese hamster 1313bp
B D               Guinea pig 6bp

Alignment block 32 of 237 in window, 14028446 - 14028451, 6 bps 
B D                     Human  t---------c-ccag
B D                     Chimp  t---------c-ccag
B D                   Gorilla  t---------c-ccag
B D                 Orangutan  t---------c-ccag
B D                    Rhesus  t---------c-ccag
B D       Crab-eating macaque  t---------c-ccag
B D                    Baboon  t---------c-ccag
B D              Green monkey  t---------c-ccag
B D                  Marmoset  t---------c-ccag
B D           Squirrel monkey  t-----------ccag
B D                  Bushbaby  g---------c-caac
           Chinese tree shrew  c---------c-cggg
B D                  Squirrel  t---------c-cagg
       Lesser Egyptian jerboa  t---------c-cagg
B D                     Mouse  ------------cgca
B D                       Rat  ------------gaca
B D                Guinea pig  a---------c-ccgg
B D                    Rabbit  t---------c-gcag
B D                      Pika  tgtgtgtgtgt-gtgt
B D                       Pig  ---------ac-aagg
B D                    Alpaca  ---------gg-atag
               Bactrian camel  ---------gg-atag
                 Killer whale  ---------ag-atgg
             Tibetan antelope  ---------ag-gtgg
B D                       Cow  ---------ag-gtgg
B D                     Sheep  ---------ag-gtgg
                Domestic goat  ---------ag-gtgg
B D                     Horse  ---------ac-gcgg
B D          White rhinoceros  ---------ac-acgg
B D                       Cat  ---------ac-atgg
B D                       Dog  ---------ac-atgg
B D                   Ferret   ---------ac-acgg
B D                     Panda  ---------ac-atgg
               Pacific walrus  ---------ac-atgg
                 Weddell seal  ---------ac-atgg
             Black flying-fox  ---------ac-atgg
B D                   Megabat  ---------ac-atgg
                Big brown bat  ---------ac-atgg
         David's myotis (bat)  ---------ac-atgg
B D                  Microbat  ---------ac-atgg
B D                  Elephant  ----------c-ccaa
          Cape elephant shrew  ----------c-ccaa
B D                   Manatee  ----------c-ccaa
             Cape golden mole  ----------c-ctgg
B D                    Tenrec  ----------c-ccta
                     Aardvark  ----------c-tcaa
B D                 Armadillo  ----------caccaa
B D                   Opossum  --------tcc-tta-
  D    White-throated sparrow  ---------cg-ccga
           Tibetan ground jay  ---------tg-ccga
B D                   Chicken  ---------cc-gcga
B D        American alligator  ---------tc-ccca
  D           Green seaturtle  ---------at-ggga
  D            Painted turtle  ---------at-ggga
  D  Chinese softshell turtle  ---------ac-gggg
              Golden hamster  ================
                Prairie vole  ================
    Mexican tetra (cavefish)  ================
B D           Chinese hamster  ================
B D                  Hedgehog  ================
B D                     Shrew  ================
B D                 Zebrafish  ================
B D             X. tropicalis  ================
B D                    Lizard  ================
B D                      Fugu  ================
B D                   Wallaby  ================
B D           Tasmanian devil  ================
B D                Coelacanth  ================
B D                 Tetraodon  ================
B D              Atlantic cod  ================
B D               Stickleback  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
B D                  Platypus  ----------------
B D                   Dolphin  ----------------
            Brush-tailed rat  ================
             Star-nosed mole  ----------------
B D            Naked mole-rat  ================
                  Chinchilla  ================
B D                    Gibbon  ================

Inserts between block 32 and 33 in window
B D                      Pig 7bp
B D                   Alpaca 7bp
              Bactrian camel 7bp
                Killer whale 7bp
            Tibetan antelope 7bp
B D                      Cow 7bp
B D                    Sheep 7bp
               Domestic goat 7bp
B D                    Horse 11bp
B D         White rhinoceros 11bp
B D                      Cat 11bp
B D                      Dog 11bp
B D                  Ferret  11bp
B D                    Panda 11bp
              Pacific walrus 11bp
                Weddell seal 11bp
            Black flying-fox 12bp
B D                  Megabat 12bp
               Big brown bat 15005bp
        David's myotis (bat) 10bp
B D                 Microbat 10bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 33 of 237 in window, 14028452 - 14028454, 3 bps 
B D                     Human  -----------gag
B D                     Chimp  -----------gag
B D                   Gorilla  -----------gag
B D                 Orangutan  -----------gag
B D                    Rhesus  -----------gag
B D       Crab-eating macaque  -----------gag
B D                    Baboon  -----------gag
B D              Green monkey  -----------gag
B D                  Marmoset  -----------gag
B D           Squirrel monkey  -----------gag
B D                  Bushbaby  -----------gat
B D                  Squirrel  -----------gag
       Lesser Egyptian jerboa  -----------gag
B D                     Mouse  -----------aag
B D                       Rat  -----------aag
B D                Guinea pig  -----------gag
B D                    Rabbit  -----------gag
B D                      Pika  -----------gtg
B D                       Pig  -----------gag
B D                    Alpaca  -----------ga-
               Bactrian camel  -----------ga-
                 Killer whale  -----------gag
             Tibetan antelope  -----------aaa
B D                       Cow  -----------aaa
B D                     Sheep  -----------aaa
                Domestic goat  -----------aaa
B D                     Horse  -----------gag
B D          White rhinoceros  -----------gag
B D                       Cat  -----------gag
B D                       Dog  -----------gag
B D                   Ferret   -----------gag
B D                     Panda  -----------gcg
               Pacific walrus  -----------gag
                 Weddell seal  -----------gag
             Black flying-fox  -----------gag
B D                   Megabat  -----------gag
         David's myotis (bat)  -----------gag
B D                  Microbat  -----------gag
B D                  Elephant  -----------gag
          Cape elephant shrew  -----------gaa
B D                   Manatee  -----------gag
             Cape golden mole  -----------gag
B D                    Tenrec  -----------gag
                     Aardvark  -----------gag
B D                 Armadillo  -----------gag
B D                   Opossum  -----------gag
  D    White-throated sparrow  g-ccacgggctg--
           Tibetan ground jay  gcccatggcctg--
B D                   Chicken  g----------g--
B D        American alligator  g---------ct--
  D           Green seaturtle  g-----tgggtg--
  D            Painted turtle  g-----agggag--
  D  Chinese softshell turtle  c-----ggggag--
              Golden hamster  ==============
                Prairie vole  ==============
    Mexican tetra (cavefish)  ==============
B D           Chinese hamster  ==============
          Chinese tree shrew  --------------
B D                  Hedgehog  ==============
               Big brown bat  ==============
B D                     Shrew  ==============
B D                 Zebrafish  ==============
B D             X. tropicalis  ==============
B D                    Lizard  ==============
B D                      Fugu  ==============
B D                   Wallaby  ==============
B D           Tasmanian devil  ==============
B D                Coelacanth  ==============
B D                 Tetraodon  ==============
B D              Atlantic cod  ==============
B D               Stickleback  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
B D                  Platypus  --------------
B D                   Dolphin  --------------
            Brush-tailed rat  ==============
             Star-nosed mole  --------------
B D            Naked mole-rat  ==============
                  Chinchilla  ==============
B D                    Gibbon  ==============

Inserts between block 33 and 34 in window
B D                   Rabbit 354bp
B D                     Pika 1bp
B D                  Opossum 471bp

Alignment block 34 of 237 in window, 14028455 - 14028459, 5 bps 
B D                     Human  ctaag
B D                     Chimp  ctaag
B D                   Gorilla  ctaag
B D                 Orangutan  ctaag
B D                    Rhesus  ctaag
B D       Crab-eating macaque  ctaag
B D                    Baboon  ctaag
B D              Green monkey  ctaag
B D                  Marmoset  ctaag
B D           Squirrel monkey  ctaag
B D                  Bushbaby  ccaag
           Chinese tree shrew  ---ag
B D                  Squirrel  cccgg
       Lesser Egyptian jerboa  ccagg
B D                     Mouse  ccaaa
B D                       Rat  ccaaa
B D                Guinea pig  gcagg
B D                      Pika  gttgg
B D                       Pig  ccagg
                 Killer whale  ccagg
             Tibetan antelope  ccaga
B D                       Cow  ccaga
B D                     Sheep  ccaga
                Domestic goat  ccaga
B D                     Horse  ccacg
B D          White rhinoceros  ccagg
B D                       Cat  ccagg
B D                       Dog  caggg
B D                   Ferret   ccagg
B D                     Panda  ccaag
               Pacific walrus  ccagg
                 Weddell seal  ccagg
             Black flying-fox  ccagg
B D                   Megabat  ccagg
         David's myotis (bat)  acagg
B D                  Microbat  acagg
              Star-nosed mole  ----g
B D                  Elephant  ccagg
          Cape elephant shrew  ctggg
B D                   Manatee  ccagg
             Cape golden mole  gcagg
B D                    Tenrec  ccaga
                     Aardvark  ccagg
B D                 Armadillo  c--ga
  D    White-throated sparrow  cgagg
           Tibetan ground jay  ccagg
B D                   Chicken  cgaaa
B D        American alligator  ctagg
  D           Green seaturtle  ctgag
  D            Painted turtle  ctgag
  D  Chinese softshell turtle  ctggg
              Golden hamster  =====
                Prairie vole  =====
    Mexican tetra (cavefish)  =====
B D           Chinese hamster  =====
B D                  Hedgehog  =====
               Big brown bat  =====
B D                     Shrew  =====
B D                 Zebrafish  =====
B D             X. tropicalis  =====
B D                    Lizard  =====
B D                      Fugu  =====
B D                   Wallaby  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
B D                Coelacanth  =====
B D                 Tetraodon  =====
B D              Atlantic cod  =====
B D               Stickleback  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
B D                  Platypus  -----
B D                    Rabbit  =====
B D                   Dolphin  -----
            Brush-tailed rat  =====
B D            Naked mole-rat  =====
                  Chinchilla  =====
              Bactrian camel  -----
B D                    Alpaca  -----
B D                    Gibbon  =====

Inserts between block 34 and 35 in window
  D   White-throated sparrow 3bp
          Tibetan ground jay 3bp
B D                  Chicken 3bp
B D       American alligator 1bp
  D Chinese softshell turtle 1138bp

Alignment block 35 of 237 in window, 14028460 - 14028461, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
           Chinese tree shrew  ga
B D                  Squirrel  ga
       Lesser Egyptian jerboa  aa
B D                     Mouse  ca
B D                       Rat  a-
B D                Guinea pig  ag
B D                      Pika  c-
B D                       Pig  aa
                 Killer whale  ga
             Tibetan antelope  ga
B D                       Cow  ga
B D                     Sheep  ga
                Domestic goat  ga
B D                     Horse  ga
B D          White rhinoceros  ga
B D                       Cat  ga
B D                       Dog  ga
B D                   Ferret   ga
B D                     Panda  ga
               Pacific walrus  ga
                 Weddell seal  ga
             Black flying-fox  ga
B D                   Megabat  ga
         David's myotis (bat)  ga
B D                  Microbat  ga
              Star-nosed mole  ga
B D                  Elephant  ga
          Cape elephant shrew  aa
B D                   Manatee  ga
             Cape golden mole  aa
B D                    Tenrec  ga
                     Aardvark  ga
B D                 Armadillo  ga
  D    White-throated sparrow  ga
           Tibetan ground jay  ga
B D                   Chicken  ga
B D        American alligator  -a
  D           Green seaturtle  ga
  D            Painted turtle  aa
              Golden hamster  ==
                Prairie vole  ==
    Mexican tetra (cavefish)  ==
B D           Chinese hamster  ==
B D                  Hedgehog  ==
               Big brown bat  ==
B D                     Shrew  ==
B D                 Zebrafish  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
B D                      Fugu  ==
B D                   Wallaby  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
B D                Coelacanth  ==
  D  Chinese softshell turtle  ==
B D                 Tetraodon  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D                  Platypus  --
B D                    Rabbit  ==
B D                   Dolphin  --
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
              Bactrian camel  --
B D                    Alpaca  --
B D                    Gibbon  ==

Inserts between block 35 and 36 in window
      Lesser Egyptian jerboa 1646bp
B D                    Mouse 49bp

Alignment block 36 of 237 in window, 14028462 - 14028464, 3 bps 
B D                     Human  cag
B D                     Chimp  cag
B D                   Gorilla  cag
B D                 Orangutan  cag
B D                    Rhesus  cag
B D       Crab-eating macaque  cag
B D                    Baboon  cag
B D              Green monkey  cag
B D                  Marmoset  ccg
B D           Squirrel monkey  cag
B D                  Bushbaby  cag
           Chinese tree shrew  ca-
B D                  Squirrel  --g
B D                     Mouse  cag
B D                Guinea pig  cag
B D                      Pika  cag
B D                       Pig  ggg
                 Killer whale  cag
             Tibetan antelope  cgg
B D                       Cow  cag
B D                     Sheep  cgg
                Domestic goat  cgg
B D                     Horse  cag
B D          White rhinoceros  cag
B D                       Cat  tgg
B D                       Dog  tgg
B