Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 471 in window, 131778366 - 131778397, 32 bps 
B D                     Human  gagggagacaagttcctcttctgactctctga
B D                     Chimp  gagggagacaagttcctcttctgactctctga
B D                   Gorilla  gagggagacaagttcctcttctgactctctga
B D                    Gibbon  gagggagacaagttcctcttctgattctctga
B D                    Rhesus  gagggagaccagttcctcttctgactctctga
B D       Crab-eating macaque  gagggagaccagttcctcttctgactctctga
B D                    Baboon  gagggagaccagttcctcttctgactctctga
B D              Green monkey  gagggagaccagttcctcttctgactctctga
           Chinese tree shrew  cagagagaccggtttctcttactactctttga
B D             X. tropicalis  -aaggggc----ttgtttttctcattctctga
               Domestic goat  ================================
B D                     Sheep  ================================
B D                       Cow  ================================
            Tibetan antelope  ================================
               Big brown bat  --------------------------------
B D                  Microbat  ================================
        David's myotis (bat)  ================================
              Bactrian camel  ================================
B D                    Alpaca  ================================
B D                     Mouse  ================================
B D                     Panda  ================================
B D                       Dog  ================================
B D                       Rat  ================================
                Prairie vole  ================================
B D           Chinese hamster  ================================
              Golden hamster  ================================
                Killer whale  ================================
B D                   Ferret   ================================
B D                  Squirrel  ================================
B D                       Cat  ================================
              Pacific walrus  ================================
B D            Naked mole-rat  ================================
                  Chinchilla  ================================
B D                Guinea pig  ================================
B D                   Manatee  ================================
B D                  Elephant  ================================
B D                 Armadillo  ================================
      Lesser Egyptian jerboa  ================================
            Brush-tailed rat  ================================
B D                  Bushbaby  ================================
B D                     Horse  ================================
            Black flying-fox  ================================
B D          White rhinoceros  ================================
  D  Chinese softshell turtle  ================================
  D           Green seaturtle  ================================
B D           Squirrel monkey  --------------------------------
  D            Painted turtle  ================================
B D           Tasmanian devil  ================================
B D                   Wallaby  ================================
B D                   Opossum  ================================
                    Aardvark  ================================
                Weddell seal  ================================
            Cape golden mole  ================================
B D                   Dolphin  ================================
B D        American alligator  --------------------------------
B D                  Marmoset  ================================
B D                 Orangutan  ================================

Alignment block 2 of 471 in window, 131778398 - 131778462, 65 bps 
B D                     Human  accccaacccagtcatctctgagtccacaggaccccacctgtggagccag------tggtctcctccttt
B D                     Chimp  actccaacccagtcatctctgagtccacaggaccccacctgtggagccag------tggtctcctccttt
B D                   Gorilla  accccaacccagtcatctctgagtccacgggaccccacctgtggagccag------tggtctcctccttt
B D                    Gibbon  accccaacccagtcatctctgagtccatggcaccccacttgtggagccag------tggtctcctccttt
B D                    Rhesus  accccaacccagtcatctctgagtctatgggaccccacttgtggaaccag------gggtctcctccttt
B D       Crab-eating macaque  accccaacccagtcatctctgagtctatgggaccccacttgtggaaccag------gggtctcctccttt
B D                    Baboon  accccaacccagtcatctctgagtctatgggaccccacttgtggagccag------cggtctcctccttt
B D              Green monkey  accccaacccagtcatctctgagtctatgggatcccacttgtggagccag------cggcctcctccttt
           Chinese tree shrew  accccaccccagctgtccctcaactctcagtaccc--cttgaggtgcatgactgcacgggctttcccttt
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ======================================================================
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
B D                  Bushbaby  ======================================================================
B D                     Horse  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                    Aardvark  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
B D                  Marmoset  ======================================================================
B D                 Orangutan  ======================================================================

                        Human  t
                        Chimp  t
                      Gorilla  t
                       Gibbon  -
                       Rhesus  -
          Crab-eating macaque  -
                       Baboon  -
                 Green monkey  -
           Chinese tree shrew  -
                Domestic goat  =
                        Sheep  =
                          Cow  =
             Tibetan antelope  =
                Big brown bat  -
                     Microbat  =
         David's myotis (bat)  =
               Bactrian camel  =
                       Alpaca  =
                        Mouse  =
                        Panda  =
                          Dog  =
                          Rat  =
                 Prairie vole  =
              Chinese hamster  =
               Golden hamster  =
                 Killer whale  =
                      Ferret   =
                     Squirrel  =
                          Cat  =
               Pacific walrus  =
               Naked mole-rat  =
                   Chinchilla  =
                   Guinea pig  =
                      Manatee  =
                     Elephant  =
                    Armadillo  =
       Lesser Egyptian jerboa  =
             Brush-tailed rat  =
                     Bushbaby  =
                        Horse  =
             Black flying-fox  =
             White rhinoceros  =
     Chinese softshell turtle  =
              Green seaturtle  =
              Squirrel monkey  -
               Painted turtle  =
              Tasmanian devil  =
                      Wallaby  =
                      Opossum  =
                     Aardvark  =
                 Weddell seal  =
             Cape golden mole  =
                      Dolphin  =
           American alligator  -
                     Marmoset  =
                    Orangutan  =

Alignment block 3 of 471 in window, 131778463 - 131778610, 148 bps 
B D                     Human  gtctaagttaccactgggctcctggttgccagcagggggccctctgcgagagaca-agagagacgtgctt
B D                     Chimp  gtctaagttaccactgggctcctggttgccagcagggggccctctgcgagagaca-agagagacgtgctt
B D                   Gorilla  gtctaagttaccactgggctcctggttgccagcaggaggccctctgtgagagacg-agagagacgtgctt
B D                 Orangutan  gtctaagttaccactgggctcctggttgccagcagtgggccctctgcgagagaca-agagagacgtgctt
B D                    Gibbon  gtctaagttaccact-ggttcctggttgccagcagtgggccctctgcgagagaca-agagagacctgctt
B D                    Rhesus  gtctaagttaccactgggctcctggttgccagcagtgggccctctgcgagagaca-agagagacacgctt
B D       Crab-eating macaque  gtctaagttaccattgggctcctggttgccagcagtgggccctctgcgagagaca-agagagacacgctt
B D                    Baboon  gtctaagttaccattgggctcctggttgccagcagtgggccctctgtgagagaca-agagagacacgctt
B D              Green monkey  gtctaagttaccattgggctcctggttgccagcagc-ggccctctgggagagac---gagagacacgcgt
           Chinese tree shrew  gcctagcttagcattggtttccaggctgcaggcaacaggccctcagtgagagtgacaaattgacaaccat
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ======================================================================
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
B D                  Bushbaby  ======================================================================
B D                     Horse  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                    Aardvark  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
B D                  Marmoset  ======================================================================

                        Human  gtccccaggctggtggccccgggctgtgtgatga--ttgcagcatttgggagagcgtgtgtcgccttcca
                        Chimp  gtccccaggctggtggccccgggctgtgtgatga--ttgcagcatttgggagagcgtgtgtcgccttcca
                      Gorilla  gtccccaggctggtggccccgggctgtgtgatga--ttgcagcatttgggagagtgtgtgtcgccttcca
                    Orangutan  gtccccaggctggcggccccaggctgtgtgatga--ttgcagcatttgggagagcgtgtgtcaccttcca
                       Gibbon  gcccccaggctggcggccccgggctgtgtgatga--ttgcagcatttgggagagcgtgtgtcgccttcca
                       Rhesus  gcccccaggctggcggccccaggctgtgtgatga--ttgccgcatttgggagagcgtgtgtcgccttcca
          Crab-eating macaque  gcccccaggctggcggccccaggctgtgtgatga--ttgccgcatttgggagagcgtgtgtcgccttcca
                       Baboon  gcccccaggctggcggccccaggctgtgtgatga--ttgccgcatttgggagagcgtgtgtcgccttcca
                 Green monkey  g-ccccaggctggcagccgcaggctgtgtgatgattttgctgcatttgggagagcatgtgtcgccttcca
           Chinese tree shrew  tctctgaaggtgcaggcactgagatgaccg-tgt--ctgcagcatgtgaaggtatgttcattaccatcca
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                     Bushbaby  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  caggtttccat
                        Chimp  caggtttccat
                      Gorilla  caggtttccat
                    Orangutan  cgggtttccat
                       Gibbon  caggtttccat
                       Rhesus  caggtttccat
          Crab-eating macaque  caggtttccat
                       Baboon  caggtttccat
                 Green monkey  caggtttccat
           Chinese tree shrew  tagattattgc
                Domestic goat  ===========
                        Sheep  ===========
                          Cow  ===========
             Tibetan antelope  ===========
                Big brown bat  -----------
                     Microbat  ===========
         David's myotis (bat)  ===========
               Bactrian camel  ===========
                       Alpaca  ===========
                        Mouse  ===========
                        Panda  ===========
                          Dog  ===========
                          Rat  ===========
                 Prairie vole  ===========
              Chinese hamster  ===========
               Golden hamster  ===========
                 Killer whale  ===========
                      Ferret   ===========
                     Squirrel  ===========
                          Cat  ===========
               Pacific walrus  ===========
               Naked mole-rat  ===========
                   Chinchilla  ===========
                   Guinea pig  ===========
                      Manatee  ===========
                     Elephant  ===========
                    Armadillo  ===========
       Lesser Egyptian jerboa  ===========
             Brush-tailed rat  ===========
                     Bushbaby  ===========
                        Horse  ===========
             Black flying-fox  ===========
             White rhinoceros  ===========
     Chinese softshell turtle  ===========
              Green seaturtle  ===========
              Squirrel monkey  -----------
               Painted turtle  ===========
              Tasmanian devil  ===========
                      Wallaby  ===========
                      Opossum  ===========
                     Aardvark  ===========
                 Weddell seal  ===========
             Cape golden mole  ===========
                      Dolphin  ===========
           American alligator  -----------
                     Marmoset  ===========

Alignment block 4 of 471 in window, 131778611 - 131778618, 8 bps 
B D                     Human  cttaaaca
B D                     Chimp  cttaaaca
B D                   Gorilla  cttaaaca
B D                 Orangutan  cttaaaca
B D                    Gibbon  cttaaaca
B D                    Rhesus  cttaaaaa
B D       Crab-eating macaque  cttaaaca
B D                    Baboon  cttaaaca
B D              Green monkey  cttaaaca
           Chinese tree shrew  ctcaaaca
B D                   Opossum  ctcaggca
               Domestic goat  ========
B D                     Sheep  ========
B D                       Cow  ========
            Tibetan antelope  ========
               Big brown bat  --------
B D                  Microbat  ========
        David's myotis (bat)  ========
              Bactrian camel  ========
B D                    Alpaca  ========
B D                     Mouse  ========
B D                     Panda  ========
B D                       Dog  ========
B D                       Rat  ========
                Prairie vole  ========
B D           Chinese hamster  ========
              Golden hamster  ========
                Killer whale  ========
B D                   Ferret   ========
B D                  Squirrel  ========
B D                       Cat  ========
              Pacific walrus  ========
B D            Naked mole-rat  ========
                  Chinchilla  ========
B D                Guinea pig  ========
B D                   Manatee  ========
B D                  Elephant  ========
B D                 Armadillo  ========
      Lesser Egyptian jerboa  ========
            Brush-tailed rat  ========
B D                  Bushbaby  ========
B D                     Horse  ========
            Black flying-fox  ========
B D          White rhinoceros  ========
  D  Chinese softshell turtle  ========
  D           Green seaturtle  ========
B D           Squirrel monkey  --------
  D            Painted turtle  ========
B D           Tasmanian devil  ========
B D                   Wallaby  ========
                    Aardvark  ========
                Weddell seal  ========
            Cape golden mole  ========
B D                   Dolphin  ========
B D        American alligator  --------
B D                  Marmoset  ========

Alignment block 5 of 471 in window, 131778619 - 131778667, 49 bps 
B D                     Human  accagaggggccctgcagtgggggccagtgcagc----tggtggtggagtgca
B D                     Chimp  accagaggggctttgcagtgggggccagtgcagc----tggtggtggagtgca
B D                   Gorilla  accagaggggctctgcagtgggggccagtgcagc----tggtggtggagtgca
B D                 Orangutan  accagaggggctctgcagtgggggccagtgcagc----tggtggtggagtaca
B D                    Gibbon  actagaggggctttgcagtgggggccaatgtagc----tggtggtggagtgca
B D                    Rhesus  accagaggggctctgcagtgggggccaacacagc----tggtggtggagtgca
B D       Crab-eating macaque  accagaggggctctgcagtgggggccaacacagc----tggtggtggagtgca
B D                    Baboon  accaggggggctctgcagtggggaccaacgcagc----tggtggtggagtgca
B D              Green monkey  accagaggggctctgcagtggcggccaacacagc----tggtggtggagtgca
B D                   Opossum  gccaga--agtcccacagtctggagggaagcagccccgtgcatgtgggcca--
               Domestic goat  =====================================================
B D                     Sheep  =====================================================
B D                       Cow  =====================================================
            Tibetan antelope  =====================================================
               Big brown bat  -----------------------------------------------------
B D                  Microbat  =====================================================
        David's myotis (bat)  =====================================================
              Bactrian camel  =====================================================
B D                    Alpaca  =====================================================
B D                     Mouse  =====================================================
B D                     Panda  =====================================================
B D                       Dog  =====================================================
B D                       Rat  =====================================================
                Prairie vole  =====================================================
B D           Chinese hamster  =====================================================
              Golden hamster  =====================================================
                Killer whale  =====================================================
B D                   Ferret   =====================================================
B D                  Squirrel  =====================================================
B D                       Cat  =====================================================
          Chinese tree shrew  -----------------------------------------------------
              Pacific walrus  =====================================================
B D            Naked mole-rat  =====================================================
                  Chinchilla  =====================================================
B D                Guinea pig  =====================================================
B D                   Manatee  =====================================================
B D                  Elephant  =====================================================
B D                 Armadillo  =====================================================
      Lesser Egyptian jerboa  =====================================================
            Brush-tailed rat  =====================================================
B D                  Bushbaby  =====================================================
B D                     Horse  =====================================================
            Black flying-fox  =====================================================
B D          White rhinoceros  =====================================================
  D  Chinese softshell turtle  =====================================================
  D           Green seaturtle  =====================================================
B D           Squirrel monkey  -----------------------------------------------------
  D            Painted turtle  =====================================================
B D           Tasmanian devil  =====================================================
B D                   Wallaby  =====================================================
                    Aardvark  =====================================================
                Weddell seal  =====================================================
            Cape golden mole  =====================================================
B D                   Dolphin  =====================================================
B D        American alligator  -----------------------------------------------------
B D                  Marmoset  =====================================================

Alignment block 6 of 471 in window, 131778668 - 131778741, 74 bps 
B D                     Human  gacgagggggcagatcaccgctggggagcagcagctgccctctcagtcccagcctgccccgcaccctggt
B D                     Chimp  gacgagggggcagatcaccgctggggagcagcagctgccctctcagtcccagcctgccccgcaccctggt
B D                   Gorilla  gacgagggggcagatcactgctggggagcagcagctgacctctcagtcccagcctgccccacaccctggt
B D                 Orangutan  gaggagggagcagatcactgctggggagcagcagctgccccctgagtcccagcctgccctgcaccctggt
B D                    Gibbon  gaggagggagcagatcaccactggggagcagcagcttccctctgagtcccagcctgccctgcaccctgtt
B D                    Rhesus  gaggaggggacagatcaccgctgggaagcagcagctgccctctcagtcccagcctgcctgccaccctggt
B D       Crab-eating macaque  gaggaggggacagatcaccgctgggaagcagcagctgccctctcagtcccagcctgcctgccaccctggt
B D                    Baboon  gaggaggggacagatcaccgctgggaagcagcagctgccctctcagtcccagcctgcctgccaccctggt
B D              Green monkey  gaggaggggacagatcaccgctggggagcagcagctgccccctcagtcccagcctgcctgccaccctggt
B D                  Bushbaby  gagaagaggacagggtccagccagggacaag-------------agccccaggcagctgctcactgccgt
B D                   Opossum  -agcccggagggaggctcccttgggccaaagcatgcgtcctctcagcctcggcccagccagggtccttgt
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ======================================================================
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
          Chinese tree shrew  ----------------------------------------------------------------------
              Pacific walrus  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
B D                     Horse  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
                    Aardvark  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
B D                  Marmoset  ======================================================================

                        Human  ga-gg
                        Chimp  ga-gg
                      Gorilla  aa-gg
                    Orangutan  ga-gg
                       Gibbon  ga-gg
                       Rhesus  gaggg
          Crab-eating macaque  gaggg
                       Baboon  gaggg
                 Green monkey  gaggg
                     Bushbaby  cc-at
                      Opossum  ga-gg
                Domestic goat  =====
                        Sheep  =====
                          Cow  =====
             Tibetan antelope  =====
                Big brown bat  -----
                     Microbat  =====
         David's myotis (bat)  =====
               Bactrian camel  =====
                       Alpaca  =====
                        Mouse  =====
                        Panda  =====
                          Dog  =====
                          Rat  =====
                 Prairie vole  =====
              Chinese hamster  =====
               Golden hamster  =====
                 Killer whale  =====
                      Ferret   =====
                     Squirrel  =====
                          Cat  =====
           Chinese tree shrew  -----
               Pacific walrus  =====
               Naked mole-rat  =====
                   Chinchilla  =====
                   Guinea pig  =====
                      Manatee  =====
                     Elephant  =====
                    Armadillo  =====
       Lesser Egyptian jerboa  =====
             Brush-tailed rat  =====
                        Horse  =====
             Black flying-fox  =====
             White rhinoceros  =====
     Chinese softshell turtle  =====
              Green seaturtle  =====
              Squirrel monkey  -----
               Painted turtle  =====
              Tasmanian devil  =====
                      Wallaby  =====
                     Aardvark  =====
                 Weddell seal  =====
             Cape golden mole  =====
                      Dolphin  =====
           American alligator  -----
                     Marmoset  =====

Inserts between block 6 and 7 in window
B D                  Opossum 131bp

Alignment block 7 of 471 in window, 131778742 - 131779739, 998 bps 
B D                     Human  tttctg----cacagcgacatttcttcttgac----aattctggcattcagtttcagatccacagtcgtc
B D                     Chimp  tttctg----cacaacgacattgcttcttgac----aattctggcattcagtttcagatccacagtcgtc
B D                   Gorilla  tttctg----cacagcgacatttcttcttgac----aattctggcattcagtttcagatccacagtcgcc
B D                 Orangutan  tttctg----cacagtgacatttcttcttgac----aattctggcatttgatttcagatccacagtcatc
B D                    Gibbon  tttctg----cacagcgacatttcttcttgac----aattctagcattcaatttcagatccacagtcatc
B D                    Rhesus  tttcta----cacagcgacatttcttcctgac----aattctggcattcaatttcagatc--cagtcgcc
B D       Crab-eating macaque  tttcta----cacagcgacatttcttcctgac----aattctggcattcaatttcagatc--cagtcgcc
B D                    Baboon  tttcta----cacagcgacatttcttcctgac----aattctggcattcaatttcagatc--cagtcgtc
B D              Green monkey  tttcta----cacagcgacatttcttcctgac----aattctggcattcaatttcagatc--cagtcgtc
B D                  Bushbaby  ctcctgtgcccatggtcaagtttcttattaactttaagtcacagaattagattcctggtctgctgcaatc
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ======================================================================
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
          Chinese tree shrew  ----------------------------------------------------------------------
              Pacific walrus  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
B D                     Horse  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                    Aardvark  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
B D                  Marmoset  ======================================================================

                        Human  cctggagatctcagtt---ttctctgggactggctgccccaaccacgccaacaatgcaggtgtttcagcc
                        Chimp  cctggagatctcagtt---ttctctgggactggctgccccaaccacgccaacaatgcaggtgtttcagcc
                      Gorilla  cctggagatctcagtt---ttctctgggactggctgccccaaccacgccaacaatgcagttgtttcagcc
                    Orangutan  cctggagatcccagtt---ttctctgggactggctgccccaaccacgccgacagcggagatgtttcagcc
                       Gibbon  cctggagatcccagtt---ttctctgggactggctgccccaaccacgctgacaatggagttgtttcagcc
                       Rhesus  cctggagatcccagtt---ttctctgggactggctgccccaaccacgccggcagtggaggtgcttcagcc
          Crab-eating macaque  cctggagatcccagtt---ttctctgggactggctgccccaaccacgccggcagtggaggtgcttcagcc
                       Baboon  cctggagatcccagtt---ttctctgggactggctgccccaaccacgccggcagtggaggtgcttcagcc
                 Green monkey  cctggagatcccagtt---ttctctgggactggctgccccaaccacgccggcagtggaggtgcttcagcc
                     Bushbaby  cctggag-tcagagccgggttctctggg--tagaggccc-------------------------tcaaaa
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  tcgggtctgagacacaaaaccaaacgcagtgaggaggagagtgagatgccaaagtccttcctaaggagta
                        Chimp  tcgggtctgagacacaaaaccaaacccagtgaggaggagagtgagatgccaaagtccttcctaaggagta
                      Gorilla  tcaggtctgagacacaaaaccaaacccagtgaggaggagagtgagatgccaaagtccttcctaaggagta
                    Orangutan  ttggatctgagacacaaaaccaaacccagtgaggaggagagtgagatgccaaagtccttcctaaaaagta
                       Gibbon  tcgggtctgagacacaaaagcaatcccagtgaggaggagagtgagatgccgaagtccttcctaagaagta
                       Rhesus  tcgggtctgagacacaaaaccaaacccagtcagcaggacagtgagacactgaagtccttcctaagaagta
          Crab-eating macaque  tcgggtctgagacacaaaaccaaacccagtcagcaggacagtgagacactgaagtccttcctaagaagta
                       Baboon  tcgggtctgagacacaaaaccaaacccagtcagcaggacagcgagacactgaagtccttcctaagaagta
                 Green monkey  tcaggtctgagacacaaaaccgaatccggtgaggagcagagcgagacgctgaagtccttcctaagaagta
                     Bushbaby  tcccgtttgaggcacagaactgaagccaacgaggaggc---tgaggcg-tgaggtccgtcctaactggta
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  cctgaccccagccctacccctgcctgaccccacagagagcacacgcagctcagcctgcaggaagggccca
                        Chimp  cctgattccagccctacccctgcctgaccccacagagagcacacgcagctcagcctgcaggaagggccca
                      Gorilla  cctgactccagccctacccctgcctgaccccacagagagcacacgcagctcagcctgcaggaagggccca
                    Orangutan  cctgactccagccctgcccccacctgaccccacggagagcacatgcggctcagcctgcaggacgggccca
                       Gibbon  cctgactccagccccgcccccgcctgaccccacagagagcacacgcagctcagcctgcaggacgggccca
                       Rhesus  tctgactcaagcccggctcccaccttaccccacagagaacacacgcggctcagcctgcaggatgggccca
          Crab-eating macaque  tctgactcaagcccggctcccacctcaccccacagagaacacacgcggctcagcctgcaggacgggccca
                       Baboon  tctgactcaagcctggctcccacctcaccccacagagaacacacgcggctcagcctgtaggacgggccca
                 Green monkey  tctgactcgagccctgctcctgcctcaccccacagagagcacacgcggctcagcctgcaggacgggccca
                     Bushbaby  c----------catggagcccacctgctccc----agagcactggca-------------aaggggctca
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  aggcctgtgggagttccaggcgtccagcttcggcctcctgacctctgctccacttgtcctccaccacctg
                        Chimp  aggcctgtgggagttccaggcgtccagcttcggcctcctgacctctgctccacttgtcctccaccacctg
                      Gorilla  aggcctgtgggagttccaggcgtccagcttcggcctcctgacctctgctccacttgtcctccaccacctg
                    Orangutan  aggcctgtgggagtgccaggcgtccagcttcagcctcctgacctctgctccacttgtcctccaccacctg
                       Gibbon  aggcctgtgggagtgccaagagtccagcgtcggcttcctgacctccactccacttgtcctccaccacctg
                       Rhesus  aggcctgtgggagtgcctggcatccagcttcagcctcctgaccactgcttcacttgtcctccaccacctg
          Crab-eating macaque  aggcctgtgggagtgcctggcatccagcttcagcctcctgaccactgcttcacttgtcctccaccacctg
                       Baboon  aggcctgtgggagtgcctggcatccagcttcagcctcctgaccactgcttcacttgtcctccaccacctg
                 Green monkey  aggcctgtgggagtgcctggcatccagcttcagcctcctgaccactgcttcacttgtcctccaccacctg
                     Bushbaby  caccagagggcagc--------tccaggtcaggcctcctcac--ctagtccactgg----ccatcaccag
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  a--cccttcaacagggc-aggcaagagggcactgcgggggtcccacaaaggcaaagcttctgtgaaacca
                        Chimp  a--cccttcaacagggc-aggcaagagggcactgcgggggtcccacaaaggcaaagcttctgtgaaacca
                      Gorilla  a--cccttcaacagggc-aggcaagagggcactgtgggggtcccacaaaggcaaagcttctgtgaaacca
                    Orangutan  a--cccttcaacagggc-aggcaagagggcaccgcgggggtcccacaaaggc-aagcttctgtgaaacca
                       Gibbon  a--cccttcaacagggc-aggcaagagggcactgcgggggtcccacaaaggcaaagcttctgtgaaacca
                       Rhesus  a--cccttcaacagggc-aggcaagagggcaccgcaggggtcccacaaaggcaaggcttctatgaaaccg
          Crab-eating macaque  a--cccttcaacagggc-aggcaagagggcaccgcaggggtcccacaaaggcaaggcttctatgaaaccg
                       Baboon  a--cccttcaacagggc-aggcaagagggcactacaggggtccaacaaaggcaaggcttctatgaaaccg
                 Green monkey  a--cccttcaacagggc-aggcaagagggcaccgcgggggtcccacaaaggcaaagcttctgtgaaaccg
                     Bushbaby  catccctcctacagggctgggccaggaggca------gagtccagcgcagcccagctctccgcagagcag
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  cagagcctccagagctgagagtcgtccaggtcaggaatcctaaccagtgtatcttctcccagggattgct
                        Chimp  cagagcctccagagctgagagtcgtccaggtcaggaatcctaaccagtgtatcttctcccagggattgct
                      Gorilla  cagagcctccagagctgagagtcatccaggtcaggaatcctaaccagtgtatcttctcccagggattgct
                    Orangutan  cggagactccagagctgagagtcattcaggtcaggtatcctgaccagtgtgtcttctcccagggatcgct
                       Gibbon  cagagcctccagagctgagagtcattcaggtgaggaatcctgaccagcgtgtcttctcccagggattgct
                       Rhesus  cagagcctccagagctgagagtcattcaggtcaggaatcctgaccagtgtatcttctcccagggatcgct
          Crab-eating macaque  cagagcctccagagctgagagtcattcaggtcaggaatcctgaccagtgtatcttctcccagggatcgct
                       Baboon  cagagtctccagagctgagagtcgttcaggtcaggaatcctgaccagtgtatcttctcccagggatcgct
                 Green monkey  cagaacctccagagctgagagtcgttcaggtcaggaatcctgaccagtgtatcttctcctagggatcgct
                     Bushbaby  cagtgccactgggac-----------aaagtcagggatcc---acagacttgcctcctctggggctcact
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  gcctttctgttgctatttggttttgtttggtttggatttttgtc--tcctcctgagaatcactgttataa
                        Chimp  gcctttctgttgctatttggttttgtttggtttggatttttgtc--tcctcctgagaatcactgttataa
                      Gorilla  gcctttctgttgctatttggttttgtttggtttggatttttgtc--tcctcctgagaatcactgttataa
                    Orangutan  gcctttctgttgctgtttggttttgtttggtttggatttttgtc--tcctcctgagaatcactgttataa
                       Gibbon  gcctttctgttgctgtttggttttgtttggtttggatttttgtc--tcctcctgagaatcactattataa
                       Rhesus  gcctttctgttgctgtttggttttgtttggtttctatttttgtc--tcctcctgagaatcactgttataa
          Crab-eating macaque  gcctttctgttgctgtttggttttgtttggtttctatttttgtc--tcctcctgagaatcactgttataa
                       Baboon  gcctttctgttgctgtttggttttgtttggtttctatttttgtc--tcctcctgagaatcactgttataa
                 Green monkey  gcctttctgttgctgtttggttttgtttggtttctatttttgtc--tcctcctgagaatcactgttacaa
                     Bushbaby  gcctttctctt-ctgtctggttttgttgggtttggacttttgtctttcctcctgagaattactgttgtaa
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  atatccaggaatttctacaaaacctctgggatgagaatgccaaacacctatgtgctattgctaggccata
                        Chimp  atatccaggaatttctacaaaaactctgggatgagaatgccaaacacctatgtgctattgctaggccata
                      Gorilla  atatccaggaatttctacaaaaactctgggatgagaatgccaaacacctatgtgctattgctaggccata
                    Orangutan  atatccaggaatttctatgaaaactctgggatgagaatgccaaacacctatgtgctatcgctaggctgta
                       Gibbon  acatccaggaatttctataaaaactctgggatgagaatgccaaacacctatgtgctattgctaggccaca
                       Rhesus  ataaccaggaatttctacaaaaactctgggatgagaataccaaacacctaagttctattgctagactgta
          Crab-eating macaque  ataaccaggaatttctacaaaaactctgggatgagaataccaaacacctaagttctattgctagactgta
                       Baboon  ataaccaggaatttctacaaaaactctgggatgagaataccaaacacctaagttctattgctagactgta
                 Green monkey  atatccaggaatttctacaaaaactctgggatgagaataccaaacacctaagttctactgctagactgta
                     Bushbaby  atatcgaggaatttctac-aaatctcca----aagagtactgagcacatccatcctgtc-ctaggcc-ta
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  gaggagaggcagccaaattcctggagtgcatgaatgaatgaatgaatgaatgaatgaatgaatg----aa
                        Chimp  gaggagaggcagccaaattcctggagtgc----------------atgaatgaatgaatgaatg----aa
                      Gorilla  gaggagaggcagccaaattcctggagtgc----atgaatgaatgaatgaatgaatgaatgaatg----aa
                    Orangutan  gaggagaggcagccaaattcctggagtgt------------------------atgaatgaatg----aa
                       Gibbon  gaggagaggcagccaaattcctggagcgc----------------atgaatgaatgaatgaatg----aa
                       Rhesus  gaggagagg-aaccaaaatcctggagtgt----atgaatgaatgaatgaatgaatgaatgaatgattaaa
          Crab-eating macaque  gaggagagg-aaccaaaatcctggagtgt----atgaatgaatgaatgaatgaatgaatgaatgattaaa
                       Baboon  gaggagaggcaaccaaaatcctggagtgt----atgaattaatgaattaattaattaattaatg----aa
                 Green monkey  gaggagaggcaaccaaaatcctggagtgt----atgaatgaatgaatgaatgaatgagtaaatg------
                     Bushbaby  gaggtgagatgcacagactgctgagctgt------------gtggatgaacaaaggaacaaatg----ag
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  tgaaggcattatctgtgtccctgtgaggtggaaaggggacagtactttgctcctccattagcctggaggg
                        Chimp  tgaaggcattatctgtgtccctgtgaggtggaaaggggacagtactttgctcctccattagcctggaggg
                      Gorilla  tgaagacattatctgtgtccctgtgaggtggaaaggggacagtactttgctcctccattagcctggaggg
                    Orangutan  tgaagtcattatctgtgtccctgtgaggtgggaaggggacagtactttgctcctccattagcctggaggg
                       Gibbon  tgaagtcattatctgtgtccctgtgaggtggaaaggggacagtactttgctcctccattcgcctggaggg
                       Rhesus  tgaatgcattatctgtgtctccgtgaggtgggaaggggacagtcctttgctcctccattagcctggaggg
          Crab-eating macaque  tgaatgcattatctgtgtctccgtgaggtgggaaggggacagtcctttgctcctccattagcctggaggg
                       Baboon  cgaatgcattatctgtgtctccgtgaggtgggaaggggacagtcctttgctcctccgttagcctggaggg
                 Green monkey  --aatgcattatctgtgtctccgtgaggtgggaaggggacagtcctttgctcctccattagcctggaggg
                     Bushbaby  tgaatgcatcctcggtg-ctccgtgaggtggg-aggggacagccctctg-tcctccactggcctg-----
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  gctggatgtccactagcctgcagggtcctgggaagcctggccagccttgtcatcttcatggtccccacat
                        Chimp  gctggatgtccactagcctgcagggtcctgggaagcctggccagccttgtcatcttcatggtccccacat
                      Gorilla  gctggatgtccactagcctgcagggtcctgggaagcctggccagccttgtcatcttcatggtccccacat
                    Orangutan  gctggatgcccactagcctgcagggtcctgggaagcctggccagccttgtcatcttcatggtccccacat
                       Gibbon  gctggatgcccactagcctgcagggtcctgggaagcctggccagccttgtcatcttcatggtccccacat
                       Rhesus  gccggatgcccactggcccacagggtcctgggaagcctggccagccttgttatcttcatgggccccacat
          Crab-eating macaque  gccggatgcccactggcccacagggtcctgggaagcctggccagccttgttatcttcatgggccccacat
                       Baboon  gccggatgcccactggcccacagggtcctgggaagcctggccaaccttgttatcttcatgggccccacat
                 Green monkey  gccggatgcccactggcccacagggtcctgggaagcctggccagccttgttatcttcatggtccccacat
                     Bushbaby  ------------------cacagcgtccccagagg----------------------acagacacctcac
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  gcattcaccctccattgactg----cctccctttcctccccaaaccgctccctccccagaacaagataca
                        Chimp  gcattcaccctccattgaccg----cctccctttcctccccaaactgctccctccccagaacaagataca
                      Gorilla  gcattcaccctccattgaccg----cctccctttcctccccaaaccgctccctccccagaacaagataca
                    Orangutan  gcattcaccctccattggccgcccccctccctttcctccccagcccgctccctccccagaacaagataca
                       Gibbon  gcattcaccctccgttggtca----cctccctttcttcccccacccgctccctccccagaacaagataca
                       Rhesus  gcattcaccctccattggcca----cctccttttcctcccccaccccctccctccccagaacgagataca
          Crab-eating macaque  gcattcaccctccattggcca----cctccttttcctcccccaccccctccctccccagaacgagataca
                       Baboon  gcattcaccctccattggcca----cctccttttcctcccccaccccctccctccccagaacgagataca
                 Green monkey  gcattcaccctccattggccg----cctccttttcctccccca-cccctccctccccagaacgagataca
                     Bushbaby  actctcacc----------------ctgccctgcccctcccga--------cttccccaaacaaggca--
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  cttcgggtactgacaagcaaccatacactttttatttaaaataatgagaagatgttgttattctgggggg
                        Chimp  cttcgggtactgacaagcaaccatacactttttatttaaaataatgagaagatgttgttattctgggggg
                      Gorilla  cttcaggtactgacaagcaaccatacactttttatttaaaataatgagaagatgttgttattctgggagg
                    Orangutan  cttcgggtactgaccagcaaccatacactttttatttaaaataatgagaagatgttgttattctgtgggg
                       Gibbon  cttcgggtactgacaagcaaccatacacgttttatttaaaataacgagaagatgttgttattctgggggg
                       Rhesus  cttcgtgtactgacaagcaatcatacacgttttatttaaaataatgagaagatgccgttattctggggga
          Crab-eating macaque  cttcgtgtactgacaagcaatcatacacgttttatttaaaataatgagaagatgccgttattctggggga
                       Baboon  cttcgtgtactgacaagcaatcatacacgttttatttaaaataatgagaagataccgttattctggggga
                 Green monkey  ctttgtgtactgacaagcaaccatacactttttatttaaaataatgagaagatgccattattctggggga
                     Bushbaby  ------gtaatgacg--------------------------------------gctgt------------
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  ttataaatggtgctacctcagcagccccagagctgctcttgg
                        Chimp  ttataaatggcgctacctcagcagccccagagctgctcttgg
                      Gorilla  ttataaatggcgctacctcagcagccccagagctgctcttgg
                    Orangutan  ttataaatggggctacctcagcagccccagagctgctcttgg
                       Gibbon  ttataaatggggctaccacagcagccccagagctgctcttgg
                       Rhesus  ttataaatggggctacctcagcagccccagagctgctctcgg
          Crab-eating macaque  ttataaatggggctacctcagcagccccagagctgctctcgg
                       Baboon  ttataaatggggctacctcagcagccccagagctgctctcgg
                 Green monkey  ttataaatggggctacctcagcagccccagagctgctcttgg
                     Bushbaby  -----------gccctgccaggggcgtcagg-----tcttga
                Domestic goat  ==========================================
                        Sheep  ==========================================
                          Cow  ==========================================
             Tibetan antelope  ==========================================
                Big brown bat  ------------------------------------------
                     Microbat  ==========================================
         David's myotis (bat)  ==========================================
               Bactrian camel  ==========================================
                       Alpaca  ==========================================
                        Mouse  ==========================================
                        Panda  ==========================================
                          Dog  ==========================================
                          Rat  ==========================================
                 Prairie vole  ==========================================
              Chinese hamster  ==========================================
               Golden hamster  ==========================================
                 Killer whale  ==========================================
                      Ferret   ==========================================
                     Squirrel  ==========================================
                          Cat  ==========================================
           Chinese tree shrew  ------------------------------------------
               Pacific walrus  ==========================================
               Naked mole-rat  ==========================================
                   Chinchilla  ==========================================
                   Guinea pig  ==========================================
                      Manatee  ==========================================
                     Elephant  ==========================================
                    Armadillo  ==========================================
       Lesser Egyptian jerboa  ==========================================
             Brush-tailed rat  ==========================================
                        Horse  ==========================================
             Black flying-fox  ==========================================
             White rhinoceros  ==========================================
     Chinese softshell turtle  ==========================================
              Green seaturtle  ==========================================
              Squirrel monkey  ------------------------------------------
               Painted turtle  ==========================================
              Tasmanian devil  ==========================================
                      Wallaby  ==========================================
                      Opossum  ==========================================
                     Aardvark  ==========================================
                 Weddell seal  ==========================================
             Cape golden mole  ==========================================
                      Dolphin  ==========================================
           American alligator  ------------------------------------------
                     Marmoset  ==========================================

Alignment block 8 of 471 in window, 131779740 - 131779789, 50 bps 
B D                     Human  a--gctgagctctccctgtgacgtcccagccccccaccagcttccaaggcct
B D                     Chimp  a--gctgagctctccctgtgacgtcccggccccccaccagcttccaaggcct
B D                   Gorilla  a--gctgagctttccctgtgacgtcccggccccccaccagctcccaaggcct
B D                 Orangutan  a--gctgagctctcccggtgatgccccagccccccaccagctcccaaggcct
B D                    Gibbon  a--gctgagctctcccagtgacaccctagccccccaccagctcccaaggcct
B D                    Rhesus  a--gctgagctctccctgcgacaccccagccctccaccagctcccaaggcct
B D       Crab-eating macaque  a--gctgagctctccctgcgacgccccggccctccaccagctcccaaggcct
B D                    Baboon  a--gctaagctctccctgcgacgccccggccctccaccagctcccaaggcct
B D              Green monkey  a--gctgagctctccctgcgacgccccggccctccaccagctcccaaggcct
B D                  Bushbaby  aagacggagttctcc-----agacttaggtcccccg--agc-cccaaggctt
B D                   Opossum  a--gctttgcctccctccgggcggcccagagcacgagccactgctcgggttt
               Domestic goat  ====================================================
B D                     Sheep  ====================================================
B D                       Cow  ====================================================
            Tibetan antelope  ====================================================
               Big brown bat  ----------------------------------------------------
B D                  Microbat  ====================================================
        David's myotis (bat)  ====================================================
              Bactrian camel  ====================================================
B D                    Alpaca  ====================================================
B D                     Mouse  ====================================================
B D                     Panda  ====================================================
B D                       Dog  ====================================================
B D                       Rat  ====================================================
                Prairie vole  ====================================================
B D           Chinese hamster  ====================================================
              Golden hamster  ====================================================
                Killer whale  ====================================================
B D                   Ferret   ====================================================
B D                  Squirrel  ====================================================
B D                       Cat  ====================================================
          Chinese tree shrew  ----------------------------------------------------
              Pacific walrus  ====================================================
B D            Naked mole-rat  ====================================================
                  Chinchilla  ====================================================
B D                Guinea pig  ====================================================
B D                   Manatee  ====================================================
B D                  Elephant  ====================================================
B D                 Armadillo  ====================================================
      Lesser Egyptian jerboa  ====================================================
            Brush-tailed rat  ====================================================
B D                     Horse  ====================================================
            Black flying-fox  ====================================================
B D          White rhinoceros  ====================================================
  D  Chinese softshell turtle  ====================================================
  D           Green seaturtle  ====================================================
B D           Squirrel monkey  ----------------------------------------------------
  D            Painted turtle  ====================================================
B D           Tasmanian devil  ====================================================
B D                   Wallaby  ====================================================
                    Aardvark  ====================================================
                Weddell seal  ====================================================
            Cape golden mole  ====================================================
B D                   Dolphin  ====================================================
B D        American alligator  ----------------------------------------------------
B D                  Marmoset  ====================================================

Alignment block 9 of 471 in window, 131779790 - 131779795, 6 bps 
B D                     Human  -ctccat
B D                     Chimp  -ctccat
B D                   Gorilla  -ctccat
B D                 Orangutan  -ctccgt
B D                    Gibbon  -ctccat
B D                    Rhesus  -ctccat
B D       Crab-eating macaque  -ctccat
B D                    Baboon  -ctccat
B D              Green monkey  -ctccat
B D                  Bushbaby  -c-ccat
B D                Guinea pig  -ctcagg
B D                   Opossum  cct----
               Domestic goat  =======
B D                     Sheep  =======
B D                       Cow  =======
            Tibetan antelope  =======
               Big brown bat  -------
B D                  Microbat  =======
        David's myotis (bat)  =======
              Bactrian camel  =======
B D                    Alpaca  =======
B D                     Mouse  =======
B D                     Panda  =======
B D                       Dog  =======
B D                       Rat  =======
                Prairie vole  =======
B D           Chinese hamster  =======
              Golden hamster  =======
                Killer whale  =======
B D                   Ferret   =======
B D                  Squirrel  =======
B D                       Cat  =======
          Chinese tree shrew  -------
              Pacific walrus  =======
B D            Naked mole-rat  =======
                  Chinchilla  =======
B D                   Manatee  =======
B D                  Elephant  =======
B D                 Armadillo  =======
      Lesser Egyptian jerboa  =======
            Brush-tailed rat  =======
B D                     Horse  =======
            Black flying-fox  =======
B D          White rhinoceros  =======
  D  Chinese softshell turtle  =======
  D           Green seaturtle  =======
B D           Squirrel monkey  -------
  D            Painted turtle  =======
B D           Tasmanian devil  =======
B D                   Wallaby  =======
                    Aardvark  =======
                Weddell seal  =======
            Cape golden mole  =======
B D                   Dolphin  =======
B D        American alligator  -------
B D                  Marmoset  =======

Alignment block 10 of 471 in window, 131779796 - 131779824, 29 bps 
B D                     Human  ctccacgactgtcaccatcactgccccca-
B D                     Chimp  ctccacgactgtcaccatcactgccccca-
B D                   Gorilla  ctccacgactgtcaccatcactgccccca-
B D                 Orangutan  ctccatgactgtcaccatcactgtcccca-
B D                    Gibbon  ctccacgactgtcaccatcactgtcccca-
B D                    Rhesus  ctcca-gactgtcaccattactgtcccca-
B D       Crab-eating macaque  ctcca-gactgtcaccattactgtcccca-
B D                    Baboon  ctcca-gactgtcaccatcactgtcccca-
B D              Green monkey  ctccacgactgtcaccatcactgtcccca-
B D                  Bushbaby  ccccactgctgtcaccaatactgtcacca-
B D            Naked mole-rat  ctctgccaccaactccacca-tgtctcta-
B D                Guinea pig  ctgtaccaccaactccacca-tgtctcta-
                   Chinchilla  ctctgcaaccaactccacca-tgtgtcta-
B D                   Opossum  cttggtgagtagttgtaaagccgacccaga
               Domestic goat  ==============================
B D                     Sheep  ==============================
B D                       Cow  ==============================
            Tibetan antelope  ==============================
               Big brown bat  ------------------------------
B D                  Microbat  ==============================
        David's myotis (bat)  ==============================
              Bactrian camel  ==============================
B D                    Alpaca  ==============================
B D                     Mouse  ==============================
B D                     Panda  ==============================
B D                       Dog  ==============================
B D                       Rat  ==============================
                Prairie vole  ==============================
B D           Chinese hamster  ==============================
              Golden hamster  ==============================
                Killer whale  ==============================
B D                   Ferret   ==============================
B D                  Squirrel  ==============================
B D                       Cat  ==============================
          Chinese tree shrew  ------------------------------
              Pacific walrus  ==============================
B D                   Manatee  ==============================
B D                  Elephant  ==============================
B D                 Armadillo  ==============================
      Lesser Egyptian jerboa  ==============================
            Brush-tailed rat  ==============================
B D                     Horse  ==============================
            Black flying-fox  ==============================
B D          White rhinoceros  ==============================
  D  Chinese softshell turtle  ==============================
  D           Green seaturtle  ==============================
B D           Squirrel monkey  ------------------------------
  D            Painted turtle  ==============================
B D           Tasmanian devil  ==============================
B D                   Wallaby  ==============================
                    Aardvark  ==============================
                Weddell seal  ==============================
            Cape golden mole  ==============================
B D                   Dolphin  ==============================
B D        American alligator  ------------------------------
B D                  Marmoset  ==============================

Alignment block 11 of 471 in window, 131779825 - 131779826, 2 bps 
B D                     Human  gc
B D                     Chimp  gc
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gc
B D              Green monkey  gc
B D                  Bushbaby  cc
B D           Chinese hamster  gc
B D            Naked mole-rat  gc
B D                Guinea pig  gc
                   Chinchilla  gc
B D                   Opossum  gc
               Domestic goat  ==
B D                     Sheep  ==
B D                       Cow  ==
            Tibetan antelope  ==
               Big brown bat  --
B D                  Microbat  ==
        David's myotis (bat)  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                     Mouse  ==
B D                     Panda  ==
B D                       Dog  ==
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
                Killer whale  ==
B D                   Ferret   ==
B D                  Squirrel  ==
B D                       Cat  ==
          Chinese tree shrew  --
              Pacific walrus  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D                 Armadillo  ==
      Lesser Egyptian jerboa  ==
            Brush-tailed rat  ==
B D                     Horse  ==
            Black flying-fox  ==
B D          White rhinoceros  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
B D           Squirrel monkey  --
  D            Painted turtle  ==
B D           Tasmanian devil  ==
B D                   Wallaby  ==
                    Aardvark  ==
                Weddell seal  ==
            Cape golden mole  ==
B D                   Dolphin  ==
B D        American alligator  --
B D                  Marmoset  ==

Alignment block 12 of 471 in window, 131779827 - 131779983, 157 bps 
B D                     Human  ---acagagggctcctgg-ggctctc-tgctgaccactcagaagcacaacct------aagtgctcttga
B D                     Chimp  ---acagagggctcctgg-ggctctc-tgctgaccactcagaagcacaacct------aagtgctcttga
B D                   Gorilla  ---acagagggctcctgg-ggctctc-tgctgaccactcagaagcacaacct------aagtgctcttga
B D                 Orangutan  ---acagagggctcctgg-ggctctc-tgctgaccacccagaagtacaacct------aagtgcccttgg
B D                    Gibbon  ---acagagggctcctgg-ggctctc-cactgaccacccagaagcacaacct------aagtgctcttgg
B D                    Rhesus  ---acagagggctcctgg-ggctctc-cgctgaccacccagaagcacaaccc------aagtgctcttgg
B D       Crab-eating macaque  ---acagagggctcctgg-ggctctc-cgctgaccacccagaagcacaaccc------aagtgctcttgg
B D                    Baboon  ---acagagcgctcctgg-ggctctc-cgctgaccacccagaagcacaaccc------aagtgctcttgg
B D              Green monkey  ---acagagggctcctgg-ggctctc-cactgaccccccagaagcacaaccc------aagtgctcttgg
B D                  Bushbaby  ---atggagggtttct-g-ggctctc-tgctgatccccaa------------------agatggtcttgg
B D           Chinese hamster  ---acacagggttcctcc-agctcct-gctggtct--cccaaggaacagcccaccccaaagtgttcttgg
B D                       Rat  ---acacagggctcctcc-agctcct-gctgatct--cctaaagaacagcccattgctaagtgttcttgg
B D            Naked mole-rat  ---acagagggttcctctgggttcc--ccttaactacccttaggtgcagtccatctagaagtggacatgg
B D                Guinea pig  ---atagagagttcatttgggctccctccttaactaccttcaggcacagctcatccagaagtggacatgg
                   Chinchilla  ---acagagggttcatcttggctccc-ccttaactagctttaggcacagcccatccacacatggatttgg
B D                   Opossum  cttccagagctctcctgg-gagtctc-cgaaggacgcccggcagagcgacct------gaggcatc----
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ======================================================================
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
          Chinese tree shrew  ----------------------------------------------------------------------
              Pacific walrus  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
B D                     Horse  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
                    Aardvark  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
B D                  Marmoset  ======================================================================

                        Human  ctgcccct----ctg-----actg--aatccactgaggttctctgtgggggcttcacgttcta-cctggt
                        Chimp  ctgcccct----ctg-----actg--aatccactgaggttctccgtgggggcttcacgttcta-cctggt
                      Gorilla  ctgcccct----ctg-----actg--aatccactgaggttctctgtgggggcttcacgttcta-cctggt
                    Orangutan  ctgccctt----ctg-----actg--aatccaccaaggttctctgtgggggcttcacgttcta-cctggt
                       Gibbon  ctgcccct----ctg-----actg--aatccaccgaggttctctgtgggggcttcacgttcta-cctggt
                       Rhesus  ctgcccct----ctg------ctg--aatctatcgaggttctctgtgggggcttcacgttcta-cctggt
          Crab-eating macaque  ctgcccct----ctg------ctg--aatctatcgaggttctctgtgggggcttcacgttcta-cctggt
                       Baboon  ctgcccct----ctg------ctg--aatccaccgaggttctctgtgggggcttcacgttcta-cctggt
                 Green monkey  ctgctcct----ctg------ctg--aatccactgaggttctctgtgggggcttcacgttcta-cctggt
                     Bushbaby  ctgcccct----c--------ccgacagtcccccaaggttccctgaggggggaccacctcctt-cct---
              Chinese hamster  catccccc---tctg-----actg--agcccactgaggatcctgtagggaggttcttgtctga-tcca--
                          Rat  cagcccct---tctg-----attc--ttcccactaaggatcctgtggaggggttcttatctga-ccca--
               Naked mole-rat  aagccccc-tctctg-----actg--agaccagcaagcttcttgtgcagagctccacatccaa-cctgg-
                   Guinea pig  aggcctcc-tctcta-----a-------accagcaagattcctgtgcagaggttcatgcccaa-cccgg-
                   Chinchilla  aggcccccacctccg-----actg--acaccagcaagattcctgtgcagaggttcacgtccaa-cctgg-
                      Opossum  -ggccctc----gtgcgggcgctg--gagagactgaagagcc--gaggcggtcccaggccagattcttgg
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                 Prairie vole  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
               Pacific walrus  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
           American alligator  ----------------------------------------------------------------------
                     Marmoset  ======================================================================

                        Human  agaggggcctccccac-----agcacggagctcactcaccaggac------------
                        Chimp  gaaggggcctccccac-----agcacggagctcactcaccaggac------------
                      Gorilla  ggaggggcctccccac-----agcacggagctcactcaccaggac------------
                    Orangutan  ggaggggcctccccac-----agcacagagctcactcaccaggac------------
                       Gibbon  ggaggggcctccccac-----agcatggagctcactcaccagggc------------
                       Rhesus  ggaggggcctccccac-----agcacggagctcactcaccaggac------------
          Crab-eating macaque  ggaggggcctccccac-----agcacggagctcactcaccaggac------------
                       Baboon  ggaggggcctccccac-----agcacggagctcactcaccaggac------------
                 Green monkey  ggaggggcctcccaac-----agcacggagctcaatcaccaggac------------
                     Bushbaby  ----gggcccctacct-----ggtgtggcactccctcaccagctc------------
              Chinese hamster  --------------------------tatgctgtcttgacagca-------------
                          Rat  --------------------------catgctctcttgtcagca-------------
               Naked mole-rat  ----------------------gtgcagtgctcattcactagcat------------
                   Guinea pig  ----------------------gagcagtgctcatttactagcgc------------
                   Chinchilla  ----------------------gtgcagtgctcactcattagcac------------
                      Opossum  gaagcgaagtccgcactgatgagcatcgccttctcttgcctgcaggctgagcgtgcc
                Domestic goat  =========================================================
                        Sheep  =========================================================
                          Cow  =========================================================
             Tibetan antelope  =========================================================
                Big brown bat  ---------------------------------------------------------
                     Microbat  =========================================================
         David's myotis (bat)  =========================================================
               Bactrian camel  =========================================================
                       Alpaca  =========================================================
                        Mouse  =========================================================
                        Panda  =========================================================
                          Dog  =========================================================
                 Prairie vole  =========================================================
               Golden hamster  =========================================================
                 Killer whale  =========================================================
                      Ferret   =========================================================
                     Squirrel  =========================================================
                          Cat  =========================================================
           Chinese tree shrew  ---------------------------------------------------------
               Pacific walrus  =========================================================
                      Manatee  =========================================================
                     Elephant  =========================================================
                    Armadillo  =========================================================
       Lesser Egyptian jerboa  =========================================================
             Brush-tailed rat  =========================================================
                        Horse  =========================================================
             Black flying-fox  =========================================================
             White rhinoceros  =========================================================
     Chinese softshell turtle  =========================================================
              Green seaturtle  =========================================================
              Squirrel monkey  ---------------------------------------------------------
               Painted turtle  =========================================================
              Tasmanian devil  =========================================================
                      Wallaby  =========================================================
                     Aardvark  =========================================================
                 Weddell seal  =========================================================
             Cape golden mole  =========================================================
                      Dolphin  =========================================================
           American alligator  ---------------------------------------------------------
                     Marmoset  =========================================================

Alignment block 13 of 471 in window, 131779984 - 131779993, 10 bps 
B D                     Human  aacactct-gg-
B D                     Chimp  aacactct-gg-
B D                   Gorilla  aacactct-gg-
B D                 Orangutan  aacactct-gg-
B D                    Gibbon  aacactct-gg-
B D                    Rhesus  aacactct-gg-
B D       Crab-eating macaque  aacactct-gg-
B D                    Baboon  aacactct-gg-
B D              Green monkey  aacactct-gg-
B D                  Bushbaby  gacactct----
B D           Chinese hamster  aacaccgt----
               Golden hamster  aacactct----
B D                       Rat  aacactct----
B D            Naked mole-rat  agcactcct---
B D                Guinea pig  agcactcct---
                   Chinchilla  agcactcct---
B D                   Opossum  -gagctcc-tgg
               Domestic goat  ============
B D                     Sheep  ============
B D                       Cow  ============
            Tibetan antelope  ============
               Big brown bat  ------------
B D                  Microbat  ============
        David's myotis (bat)  ============
              Bactrian camel  ============
B D                    Alpaca  ============
B D                     Mouse  ============
B D                     Panda  ============
B D                       Dog  ============
                Prairie vole  ============
                Killer whale  ============
B D                   Ferret   ============
B D                  Squirrel  ============
B D                       Cat  ============
          Chinese tree shrew  ------------
              Pacific walrus  ============
B D                   Manatee  ============
B D                  Elephant  ============
B D                 Armadillo  ============
      Lesser Egyptian jerboa  ============
            Brush-tailed rat  ============
B D                     Horse  ============
            Black flying-fox  ============
B D          White rhinoceros  ============
  D  Chinese softshell turtle  ============
  D           Green seaturtle  ============
B D           Squirrel monkey  ------------
  D            Painted turtle  ============
B D           Tasmanian devil  ============
B D                   Wallaby  ============
                    Aardvark  ============
                Weddell seal  ============
            Cape golden mole  ============
B D                   Dolphin  ============
B D        American alligator  ------------
B D                  Marmoset  ============

Alignment block 14 of 471 in window, 131779994 - 131780020, 27 bps 
B D                     Human  ---gtgaccactgcagcctcagt-ggagcca--
B D                     Chimp  ---gtgaccactgcagcctcagt-ggagcca--
B D                   Gorilla  ---gtgaccactgcagcctcagt-ggagcca--
B D                 Orangutan  ---atggccactgcagcctcagt-ggagcca--
B D                    Gibbon  ---gtggccactgcagcctcagt-ggagcca--
B D                    Baboon  ---gtggccactgcagcctcagt-ggagcca--
B D              Green monkey  ---gtggccactgaagcctcagt-ggagcca--
B D                  Bushbaby  ---------cttactgcctca------------
B D           Chinese hamster  --------cacttgagtgttggg-atagcca--
               Golden hamster  --------cacttgagtgttggg-atagcca--
B D            Naked mole-rat  ---cttcttgctggaacctcaga-gtagcca--
B D                Guinea pig  ---cttcatgctggggcctccag-gcagctg--
                   Chinchilla  ---cttcttgctggagccttgag-gcagctg--
B D                   Opossum  gaagttctccccgggggacgagtcagggccgag
               Domestic goat  =================================
B D                     Sheep  =================================
B D                       Cow  =================================
            Tibetan antelope  =================================
               Big brown bat  ---------------------------------
B D                  Microbat  =================================
        David's myotis (bat)  =================================
              Bactrian camel  =================================
B D                    Alpaca  =================================
B D                     Mouse  =================================
B D                     Panda  =================================
B D                       Dog  =================================
B D                       Rat  ---------------------------------
                Prairie vole  =================================
                Killer whale  =================================
B D                   Ferret   =================================
B D                  Squirrel  =================================
B D                       Cat  =================================
          Chinese tree shrew  ---------------------------------
              Pacific walrus  =================================
B D                   Manatee  =================================
B D                  Elephant  =================================
B D                 Armadillo  =================================
      Lesser Egyptian jerboa  =================================
            Brush-tailed rat  =================================
B D                     Horse  =================================
            Black flying-fox  =================================
B D          White rhinoceros  =================================
  D  Chinese softshell turtle  =================================
  D           Green seaturtle  =================================
B D           Squirrel monkey  ---------------------------------
  D            Painted turtle  =================================
B D           Tasmanian devil  =================================
B D                   Wallaby  =================================
                    Aardvark  =================================
                Weddell seal  =================================
            Cape golden mole  =================================
B D                   Dolphin  =================================
B D       Crab-eating macaque  ---------------------------------
B D                    Rhesus  ---------------------------------
B D        American alligator  ---------------------------------
B D                  Marmoset  =================================

Alignment block 15 of 471 in window, 131780021 - 131780126, 106 bps 
B D                     Human  caccttccccacaaggatgtccagggaggcctggccactgaggc--------agcacacaggaccc----
B D                     Chimp  caccttccccacaaggatgtccagggaggcctggccactgaggc--------agcacacaggaccc----
B D                   Gorilla  caccttccccacaaggatgtccagggaggcctggccactgaggc--------agcacacaggaccc----
B D                 Orangutan  cagcttccccacaaggatgtccagggaggcctggccaccgacgc--------agcacacaggaccc----
B D                    Gibbon  cagcttccccacaaggatgtccagggaagcctggccaccgaggc--------agcacacaggaccc----
B D                    Baboon  cagcttccccacaaggatgtccagggaggcccggccacccagac--------agcacagaggaccc----
B D              Green monkey  cagcttccccacaaggatgtccagggaggcccagccacccggac--------agcacacaggaccc----
B D                  Bushbaby  ---------------gatgtctagga------ggtcactc-ggc--------aggtcacagtaccctcct
                 Prairie vole  -caccgttctccagggatgcccagggaggccaggtcacagaacc--------agtggccagctcct----
B D           Chinese hamster  ---tcattctccagggatg----------ccaggtgacagaacc--------agtggccagctcct----
               Golden hamster  ---tcattctccagggatgcccagggagaccaggtcacagaacc--------agtggccagctcct----
B D                       Rat  ---------cacctgaatgttgaaggaagcaagttcacagagcc--------agtggccagcatcc----
B D            Naked mole-rat  -----------------------------ctgaaccccagca-g--------gatgtccagcactc----
B D                Guinea pig  -----------------------------ccacattccagaa-g--------gatgcccagtactc----
                   Chinchilla  -----------------------------ctgcatcccagaa-g--------attgtccagcattc----
B D                   Opossum  cgccgttcccgaggggacgtcccgggtgagcttgtcgccgaagctccgtgttgacgtggagagccc----
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
                Killer whale  ======================================================================
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
          Chinese tree shrew  ----------------------------------------------------------------------
              Pacific walrus  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
B D                     Horse  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
                    Aardvark  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
B D       Crab-eating macaque  ----------------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
B D                  Marmoset  ======================================================================

                        Human  aga----------cggtcttccctaagtgggagggtc-ggggcagggagctgtgctcc----------a
                        Chimp  aga----------cagtcttccctaagtgggagggtc-ggggcagggagctgtgctcc----------a
                      Gorilla  aga----------cggtcttccctaagtgagagggtc-ggggcagggagctgtgctcc----------a
                    Orangutan  aga----------cggtcttccctgagtgggagggtcgggggcagggagctgtgctcc----------a
                       Gibbon  aga----------cggtcttccctaagtgggagggtcgggggcaggcagctgtgctcc----------a
                       Baboon  gga----------tggtcttccctaagtgggagggtcaggggcagggagctgtgctcc----------a
                 Green monkey  aga----------tggtcttccctaagtgggagggtcgggggcagggagctatgctcc----------a
                     Bushbaby  ggg----------cagtcttccacatg-----------gcagctgggggctgtgctc------------
                 Prairie vole  --a----------tggcttttcccaaaacga-------gtgaagtgaggctggactctgtgatcca---
              Chinese hamster  --a----------tggctttccccaaaaggt-------atggagtgaggctggattcc-----------
               Golden hamster  --a----------tggcttttctcaaaaggt-------gtggagtgaagctggactcc-----------
                          Rat  --a----------tggctttccccaaaagga-------gtggtgtgagcctaaactct--------g--
               Naked mole-rat  aaa----------tggccttttgcaaatgga-------gtggttaagggtcaagttcc---------a-
                   Guinea pig  aaa----------cagccttttgcaattgga-------gtgggtgggggttaaga--------------
                   Chinchilla  aaa----------ggacatttttcaagtgga-------gtgggtggggattaagcccc---------a-
                      Opossum  tgaagtaaatgcctggatctgcaccggcgtcctgctcaggaatggtaggctcca---------------
                Domestic goat  =====================================================================
                        Sheep  =====================================================================
                          Cow  =====================================================================
             Tibetan antelope  =====================================================================
                Big brown bat  ---------------------------------------------------------------------
                     Microbat  =====================================================================
         David's myotis (bat)  =====================================================================
               Bactrian camel  =====================================================================
                       Alpaca  =====================================================================
                        Mouse  =====================================================================
                        Panda  =====================================================================
                          Dog  =====================================================================
                 Killer whale  =====================================================================
                      Ferret   =====================================================================
                     Squirrel  =====================================================================
                          Cat  =====================================================================
           Chinese tree shrew  ---------------------------------------------------------------------
               Pacific walrus  =====================================================================
                      Manatee  =====================================================================
                     Elephant  =====================================================================
                    Armadillo  =====================================================================
       Lesser Egyptian jerboa  =====================================================================
             Brush-tailed rat  =====================================================================
                        Horse  =====================================================================
             Black flying-fox  =====================================================================
             White rhinoceros  =====================================================================
     Chinese softshell turtle  =====================================================================
              Green seaturtle  =====================================================================
              Squirrel monkey  ---------------------------------------------------------------------
               Painted turtle  =====================================================================
              Tasmanian devil  =====================================================================
                      Wallaby  =====================================================================
                     Aardvark  =====================================================================
                 Weddell seal  =====================================================================
             Cape golden mole  =====================================================================
                      Dolphin  =====================================================================
          Crab-eating macaque  ---------------------------------------------------------------------
                       Rhesus  ---------------------------------------------------------------------
           American alligator  ---------------------------------------------------------------------
                     Marmoset  =====================================================================

Inserts between block 15 and 16 in window
                Prairie vole 13972bp

Alignment block 16 of 471 in window, 131780127 - 131780181, 55 bps 
B D                     Human  gggagtgaccaa---------------ccaaccatccaagttccagaggcact----gaggggcttcc-c
B D                     Chimp  gggagtgaccaa---------------ccaaccatccaagttccagaggcact----gaggggcttcc-c
B D                   Gorilla  gggagtgaccaa---------------ccaaccatccaagttccagaggcact----gaggggcttcc-c
B D                 Orangutan  gggagtgaccaa---------------ccaaccatccaagttccagaggcact----gaggggcttcc-c
B D                    Gibbon  gggagtgaccaa---------------ccaaccatccaagttccagaggcact----gaggggcttcc-c
B D                    Baboon  gggaatgaccaa---------------ccaaccacccaagttcgagaggccct----gaggggcttcc-c
B D              Green monkey  gggagtgaccaa---------------ccaaccacccaagttcgagaggccct----gaggggcttcc-c
B D                  Bushbaby  -----tggctga---------------gcgggtacc----------------------aggggctccc-c
B D           Chinese hamster  -----------------------------------cccagatt-ctcatcattaagctggggaggccc-t
               Golden hamster  -----------------------------------cccagatt-ctcaatagtaaactggggagaccc-t
B D                       Rat  ----tggacca---------------------tccgccagatt-ctcagcactaa-----ggtagccc-t
B D            Naked mole-rat  tgaaatgtcca-------------------gctatcctacatt-agaagcact----tggggtcttcc-c
B D                Guinea pig  -gaagtgtcta--------------------ctctcccaggtc-agaagcact----tgggggcttcc-c
                   Chinchilla  tgcagtgtcca-------------------gctatcccagatc-agaagtact----tgggggcttcc-c
B D                   Opossum  ggagctggcttaacaagcgaatgcacgtcaaatggccgag----gaagacagc----ggatgcctcccgg
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
                Prairie vole  ======================================================================
                Killer whale  ======================================================================
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
          Chinese tree shrew  ----------------------------------------------------------------------
              Pacific walrus  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
B D                     Horse  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
                    Aardvark  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
B D       Crab-eating macaque  ----------------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
B D                  Marmoset  ======================================================================

                        Human  aggac--------------
                        Chimp  aggac--------------
                      Gorilla  aggac--------------
                    Orangutan  aggac--------------
                       Gibbon  aggac--------------
                       Baboon  aggac--------------
                 Green monkey  aggac--------------
                     Bushbaby  caggc--------------
              Chinese hamster  agga---------------
               Golden hamster  agga---------------
                          Rat  aggc---------------
               Naked mole-rat  aggcc--------------
                   Guinea pig  agtct--------------
                   Chinchilla  aggcc--------------
                      Opossum  aggacagggagtttggcat
                Domestic goat  ===================
                        Sheep  ===================
                          Cow  ===================
             Tibetan antelope  ===================
                Big brown bat  -------------------
                     Microbat  ===================
         David's myotis (bat)  ===================
               Bactrian camel  ===================
                       Alpaca  ===================
                        Mouse  ===================
                        Panda  ===================
                          Dog  ===================
                 Prairie vole  ===================
                 Killer whale  ===================
                      Ferret   ===================
                     Squirrel  ===================
                          Cat  ===================
           Chinese tree shrew  -------------------
               Pacific walrus  ===================
                      Manatee  ===================
                     Elephant  ===================
                    Armadillo  ===================
       Lesser Egyptian jerboa  ===================
             Brush-tailed rat  ===================
                        Horse  ===================
             Black flying-fox  ===================
             White rhinoceros  ===================
     Chinese softshell turtle  ===================
              Green seaturtle  ===================
              Squirrel monkey  -------------------
               Painted turtle  ===================
              Tasmanian devil  ===================
                      Wallaby  ===================
                     Aardvark  ===================
                 Weddell seal  ===================
             Cape golden mole  ===================
                      Dolphin  ===================
          Crab-eating macaque  -------------------
                       Rhesus  -------------------
           American alligator  -------------------
                     Marmoset  ===================

Alignment block 17 of 471 in window, 131780182 - 131780261, 80 bps 
B D                     Human  ttcagacccacagtgcaaaaacgga--gacagtcccaggca-aat-----gggac-------agt-gggt
B D                     Chimp  tccagacccacagtgcaaaaacaga--gacagtcccaggca-aat-----gggac-------agt-gggt
B D                   Gorilla  ttcagacccacagtgcaaaaacgga--gacagtcccaggca-aat-----gggac-------agt-gggt
B D                 Orangutan  tccagacccacagtgcaaaaacaga--gacagtcccaggca-aat-----gggac-------agt-gggt
B D                    Gibbon  tccagacccacagtgcaaaaatgga--gacagtcccaggca-aat-----gggac-------agt-gggt
B D                    Baboon  tccagacacacagtgcaaaaacgga--gacagtcccaggc--aat-----gggac-------agt-gggt
B D              Green monkey  tccagaaccacagtgcaaaaacgga--gacagtcccaggc--aat-----gagac-------agt-gggt
B D                  Bushbaby  tacagacattcag----------------------caagct-aacccgtgggttc-------agc-aagc
           Chinese tree shrew  tccaggcatttagtgctaaacctgg--gaccgtc-caggcatacc-----aggac-------agt-gggt
B D           Chinese hamster  -----------------aaatc-----------------ca-cac-----aag---------ggt-agaa
               Golden hamster  -----------------aaatc-----------------ca-cac-----aag---------ggt-agag
B D                       Rat  -----------------aaa-c-----------------ca-cct-----aag---------gg------
B D            Naked mole-rat  tccagactttcagtgctaaacctgg--gactctcccaggca-aat-----cag---------gacagggg
B D                Guinea pig  tccagacttctggtaccaaacctga--ggctgtcccaagca-aat-----cag---------aat-agag
                   Chinchilla  tccagacttccagtgctgaa-ctgg--gactgccccaagca-aac-----cag---------aac-gggg
B D                   Opossum  -------------ctcgtaccctggacaacaggcccaagtg-acc-----agagaggggaggagg-aggg
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
                Prairie vole  ======================================================================
                Killer whale  ======================================================================
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
B D                     Horse  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
                    Aardvark  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
B D       Crab-eating macaque  ----------------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
B D                  Marmoset  ======================================================================

                        Human  c---------------accttagcagg----tcct---ctc----ccatctc
                        Chimp  c---------------accttagcaga----tcct---atc----ccatctc
                      Gorilla  c---------------accttagcagg----tcct---atc----ccatctc
                    Orangutan  c---------------accttagcagg----tcct---atc----ccatctc
                       Gibbon  c---------------accttagcagg----tcct---atc----ccatgtc
                       Baboon  c---------------accttagcagg----tcct---atc----ccatctc
                 Green monkey  c---------------accttagcagg----tcct---atc----ccatctc
                     Bushbaby  t---------------aactca-tgaa----tctg---agc----cctcccc
           Chinese tree shrew  c---------------atcccaactgg----tctt---agc----ccatctt
              Chinese hamster  ctggtctttgcctattgctaaaattggcatacctt---tacaacgttccctc
               Golden hamster  ctggtctttgcctattactaaaattggcatacctt---tacagtgttccctt
                          Rat  ------------------tagagctgg----tctt---tgc------ctatt
               Naked mole-rat  c---------------acccaagctgg----tctt---tgc----ctatgt-
                   Guinea pig  c---------------acccaacctgg----tctt-----------tatct-
                   Chinchilla  c---------------atccaacctgg----tctt---tgc----ctatct-
                      Opossum  c---------------gtcttcctggg----tctctagaac----ctg----
                Domestic goat  ====================================================
                        Sheep  ====================================================
                          Cow  ====================================================
             Tibetan antelope  ====================================================
                Big brown bat  ----------------------------------------------------
                     Microbat  ====================================================
         David's myotis (bat)  ====================================================
               Bactrian camel  ====================================================
                       Alpaca  ====================================================
                        Mouse  ====================================================
                        Panda  ====================================================
                          Dog  ====================================================
                 Prairie vole  ====================================================
                 Killer whale  ====================================================
                      Ferret   ====================================================
                     Squirrel  ====================================================
                          Cat  ====================================================
               Pacific walrus  ====================================================
                      Manatee  ====================================================
                     Elephant  ====================================================
                    Armadillo  ====================================================
       Lesser Egyptian jerboa  ====================================================
             Brush-tailed rat  ====================================================
                        Horse  ====================================================
             Black flying-fox  ====================================================
             White rhinoceros  ====================================================
     Chinese softshell turtle  ====================================================
              Green seaturtle  ====================================================
              Squirrel monkey  ----------------------------------------------------
               Painted turtle  ====================================================
              Tasmanian devil  ====================================================
                      Wallaby  ====================================================
                     Aardvark  ====================================================
                 Weddell seal  ====================================================
             Cape golden mole  ====================================================
                      Dolphin  ====================================================
          Crab-eating macaque  ----------------------------------------------------
                       Rhesus  ----------------------------------------------------
           American alligator  ----------------------------------------------------
                     Marmoset  ====================================================

Inserts between block 17 and 18 in window
B D          Chinese hamster 71bp

Alignment block 18 of 471 in window, 131780262 - 131780317, 56 bps 
B D                     Human  -------gcctgggtcaaggctgagg-ga-ccctgaactaatcctaaagccggagggggtcaccc
B D                     Chimp  -------tcctgggtcaaggctgagg-ga-ccctgaactaatcctaaagcctgagggggtcaccc
B D                   Gorilla  -------tcctgggtcaaggctgagg-ga-ccctgaactaatcctaaagcctgagggggtcaccc
B D                 Orangutan  -------tcgtgggtcaaggctaagg-ga-ccctgacctaatcctaaagcatgagggggtcaccc
B D                    Gibbon  -------tcctgggtcaaggctaagg-ga-ccctgaactaatcctaaagcatgagggggtcaccc
B D                    Baboon  -------tcctgggtcaaggctgagg-ga-ccccaaactaatcccaaagcatgagggggtcaccc
B D              Green monkey  -------tcctgggtcaaggctgagg-ga-ccccaaactaatcccaaagcatgagggggtcaccc
B D                  Bushbaby  -------tcctgggctgggtctgaaactc-ccccaaagtgctcccaaagca--agggcgtctccc
           Chinese tree shrew  -------tccttggctaagactaaag-tacccccaaagtcctcccagaaaa-gaggaattctcat
               Golden hamster  ---------------------------------------------------------gggtcccc
B D                       Rat  -------------gctaagattagca-ta-tcctcac-------------------agtgctccc
B D            Naked mole-rat  --------cctgggctaacactgaag-ca-ctctgaagcaa-----------aagggcttctctt
B D                Guinea pig  --------cctgagctaagactaaag-ca-ctcctaagaaa-----------gtggatttctccc
                   Chinchilla  --------cctgggctaa-agtgaag-ca-ctcctaagtaa-----------gacaagttctcct
B D                   Opossum  agatgggtcctgtggtaggtcctagg-cc-tcc--------------atcaggagggggtgaacc
               Domestic goat  =================================================================
B D                     Sheep  =================================================================
B D                       Cow  =================================================================
            Tibetan antelope  =================================================================
               Big brown bat  -----------------------------------------------------------------
B D                  Microbat  =================================================================
        David's myotis (bat)  =================================================================
              Bactrian camel  =================================================================
B D                    Alpaca  =================================================================
B D                     Mouse  =================================================================
B D                     Panda  =================================================================
B D                       Dog  =================================================================
                Prairie vole  =================================================================
B D           Chinese hamster  =================================================================
                Killer whale  =================================================================
B D                   Ferret   =================================================================
B D                  Squirrel  =================================================================
B D                       Cat  =================================================================
              Pacific walrus  =================================================================
B D                   Manatee  =================================================================
B D                  Elephant  =================================================================
B D                 Armadillo  =================================================================
      Lesser Egyptian jerboa  =================================================================
            Brush-tailed rat  =================================================================
B D                     Horse  =================================================================
            Black flying-fox  =================================================================
B D          White rhinoceros  =================================================================
  D  Chinese softshell turtle  =================================================================
  D           Green seaturtle  =================================================================
B D           Squirrel monkey  -----------------------------------------------------------------
  D            Painted turtle  =================================================================
B D           Tasmanian devil  =================================================================
B D                   Wallaby  =================================================================
                    Aardvark  =================================================================
                Weddell seal  =================================================================
            Cape golden mole  =================================================================
B D                   Dolphin  =================================================================
B D       Crab-eating macaque  -----------------------------------------------------------------
B D                    Rhesus  -----------------------------------------------------------------
B D        American alligator  -----------------------------------------------------------------
B D                  Marmoset  =================================================================

Inserts between block 18 and 19 in window
B D                  Opossum 8855bp

Alignment block 19 of 471 in window, 131780318 - 131780356, 39 bps 
B D                     Human  caggtcc-cc-ca---ccatacacatccattcacacaca---------c---ct--------ct
B D                     Chimp  caggtcc-cc-ca---ccatacacatgcattcacacaca---------c---ca--------ct
B D                   Gorilla  caggtcc-cc-ca---ccatacacatccattcacacaca---------c---ca--------ct
B D                 Orangutan  cagatcc-cc-ca---ccatacacatccactcacacaca---------c---ca--------ct
B D                    Gibbon  caagtcc-cc-ca---ccatacacatccactcacataca---------c---cactcccagcct
B D                    Baboon  ctgggcc-cc-ca---ccatacacacccactcacacaca---------t---ca--------ct
B D              Green monkey  ctggtcc-cc-ca---ccatacacacccactcacacaca---------c---ca--------ct
B D                  Bushbaby  cagctcc-ccaca---acacacacacacacacacacaca---------cacaca--------ca
           Chinese tree shrew  caactttgcc-ca---tca------------caaatgca---------a---ca--------ct
               Golden hamster  ctgggc--cc-ta---ccatttgtatacacacatacacacacacacac----------------
B D                       Rat  ttggat--cc-agggcccatccacaggtagatatacaaaca-----------------------
B D            Naked mole-rat  cagccc--tc-tg---ccac-----------tatgcata-------------------------
B D                Guinea pig  caggtc--tc-tg---ccac-----------tatgcaca-------------------------
                   Chinchilla  tagcct--cc-tg---ccat-----------taagcaca-------------------------
               Domestic goat  ================================================================
B D                     Sheep  ================================================================
B D                       Cow  ================================================================
            Tibetan antelope  ================================================================
               Big brown bat  ----------------------------------------------------------------
B D                  Microbat  ================================================================
        David's myotis (bat)  ================================================================
              Bactrian camel  ================================================================
B D                    Alpaca  ================================================================
B D                     Mouse  ================================================================
B D                     Panda  ================================================================
B D                       Dog  ================================================================
                Prairie vole  ================================================================
B D           Chinese hamster  ================================================================
                Killer whale  ================================================================
B D                   Ferret   ================================================================
B D                  Squirrel  ================================================================
B D                       Cat  ================================================================
              Pacific walrus  ================================================================
B D                   Manatee  ================================================================
B D                  Elephant  ================================================================
B D                 Armadillo  ================================================================
      Lesser Egyptian jerboa  ================================================================
            Brush-tailed rat  ================================================================
B D                     Horse  ================================================================
            Black flying-fox  ================================================================
B D          White rhinoceros  ================================================================
  D  Chinese softshell turtle  ================================================================
  D           Green seaturtle  ================================================================
B D           Squirrel monkey  ----------------------------------------------------------------
  D            Painted turtle  ================================================================
B D           Tasmanian devil  ================================================================
B D                   Wallaby  ================================================================
B D                   Opossum  ================================================================
                    Aardvark  ================================================================
                Weddell seal  ================================================================
            Cape golden mole  ================================================================
B D                   Dolphin  ================================================================
B D       Crab-eating macaque  ----------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------
B D                  Marmoset  ================================================================

Inserts between block 19 and 20 in window
              Golden hamster 5bp
B D                      Rat 4bp

Alignment block 20 of 471 in window, 131780357 - 131780410, 54 bps 
B D                     Human  cccagca-----accttat-------------------------------tcctccagcctc-----aat
B D                     Chimp  cccagca-----atcttac-------------------------------tcctccagcctc-----aat
B D                   Gorilla  cccagca-----accttat-------------------------------tcctccagcctc-----aat
B D                 Orangutan  cccagca-----accttac-------------------------------tcctccagcctc-----aat
B D                    Gibbon  cccagca-----accttac-------------------------------tcctccagcctc-----aat
B D                    Baboon  cccagca-----acctcac-------------------------------tcctccagcctc-----aat
B D              Green monkey  cccagca-----acctcgc-------------------------------tcctccagcctc-----aat
B D                  Bushbaby  aacagcacctcccctttgc-------------------------------tactctggccct-----gat
           Chinese tree shrew  c----ta-----tcattct-------------------------------tactccagcccc-----tat
B D           Chinese hamster  ----------------ccc-----------------------------agcatcctgactccaaacacat
               Golden hamster  ----------------cacaaagaaaagaacaaacaaaaaaaaatggaagcatcctgactccagacacat
B D                       Rat  ---------------------------------------------gccagcattctgacaccagcaacat
B D            Naked mole-rat  --------------------------------------------------ctctccagcccc-----cat
B D                Guinea pig  --------------------------------------------------cactccagcccc-----aat
                   Chinchilla  --------------------------------------------------cactccaacccc-----cat
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
                Prairie vole  ======================================================================
                Killer whale  ======================================================================
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
B D                     Horse  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                    Aardvark  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
B D       Crab-eating macaque  ----------------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
B D                  Marmoset  ======================================================================

                        Human  cgaaaggccgtagatgtggagctgg
                        Chimp  cgaaaagccgtagatgtggagctgg
                      Gorilla  tgaaaagccgtagatgtggagctgg
                    Orangutan  caaaaagccgtagatgtggagctgg
                       Gibbon  caaaaagctgtagatgtggagctgg
                       Baboon  caaaaaacc--------ggagctgg
                 Green monkey  caaaaagcc--------ggagctgg
                     Bushbaby  caaagaaccataggtgtgggcctgg
           Chinese tree shrew  caaagaatcatagatgtagagctat
              Chinese hamster  caaaaagcttttgctgtaaatctgg
               Golden hamster  aaaaaactttttgctgtaaatctgg
                          Rat  t--aaaccttttgttgtaaatctgg
               Naked mole-rat  taaggagctaccactgtggagctag
                   Guinea pig  gaaagagttaccagggtagagctgg
                   Chinchilla  caaagagttaccagtgtagaactgg
                Domestic goat  =========================
                        Sheep  =========================
                          Cow  =========================
             Tibetan antelope  =========================
                Big brown bat  -------------------------
                     Microbat  =========================
         David's myotis (bat)  =========================
               Bactrian camel  =========================
                       Alpaca  =========================
                        Mouse  =========================
                        Panda  =========================
                          Dog  =========================
                 Prairie vole  =========================
                 Killer whale  =========================
                      Ferret   =========================
                     Squirrel  =========================
                          Cat  =========================
               Pacific walrus  =========================
                      Manatee  =========================
                     Elephant  =========================
                    Armadillo  =========================
       Lesser Egyptian jerboa  =========================
             Brush-tailed rat  =========================
                        Horse  =========================
             Black flying-fox  =========================
             White rhinoceros  =========================
     Chinese softshell turtle  =========================
              Green seaturtle  =========================
              Squirrel monkey  -------------------------
               Painted turtle  =========================
              Tasmanian devil  =========================
                      Wallaby  =========================
                      Opossum  =========================
                     Aardvark  =========================
                 Weddell seal  =========================
             Cape golden mole  =========================
                      Dolphin  =========================
          Crab-eating macaque  -------------------------
                       Rhesus  -------------------------
           American alligator  -------------------------
                     Marmoset  =========================

Alignment block 21 of 471 in window, 131780411 - 131780416, 6 bps 
B D                     Human  ggccaa
B D                     Chimp  ggccaa
B D                   Gorilla  ggccaa
B D                 Orangutan  ggccaa
B D                    Gibbon  ggccaa
B D                    Baboon  ggccaa
B D              Green monkey  ggccaa
B D           Squirrel monkey  ggccaa
B D                  Bushbaby  ggctgg
           Chinese tree shrew  ggccaa
B D           Chinese hamster  gcccag
               Golden hamster  gcccag
B D                       Rat  gcccag
B D            Naked mole-rat  gtccag
B D                Guinea pig  gcccag
                   Chinchilla  gtccag
               Domestic goat  ======
B D                     Sheep  ======
B D                       Cow  ======
            Tibetan antelope  ======
               Big brown bat  ------
B D                  Microbat  ======
        David's myotis (bat)  ======
              Bactrian camel  ======
B D                    Alpaca  ======
B D                     Mouse  ======
B D                     Panda  ======
B D                       Dog  ======
                Prairie vole  ======
                Killer whale  ======
B D                   Ferret   ======
B D                  Squirrel  ======
B D                       Cat  ======
              Pacific walrus  ======
B D                   Manatee  ======
B D                  Elephant  ======
B D                 Armadillo  ======
      Lesser Egyptian jerboa  ======
            Brush-tailed rat  ======
B D                     Horse  ======
            Black flying-fox  ======
B D          White rhinoceros  ======
  D  Chinese softshell turtle  ======
  D           Green seaturtle  ======
  D            Painted turtle  ======
B D           Tasmanian devil  ======
B D                   Wallaby  ======
B D                   Opossum  ======
                    Aardvark  ======
                Weddell seal  ======
            Cape golden mole  ======
B D                   Dolphin  ======
B D       Crab-eating macaque  ------
B D                    Rhesus  ------
B D        American alligator  ------
B D                  Marmoset  ======

Inserts between block 21 and 22 in window
          Chinese tree shrew 14bp

Alignment block 22 of 471 in window, 131780417 - 131780439, 23 bps 
B D                     Human  -------------------agacacccctg-ctgccactgagc
B D                     Chimp  -------------------agacacccctg-ctgccactgagc
B D                   Gorilla  -------------------agacacccctg-ctgccactgagc
B D                 Orangutan  -------------------agacacccctg-ctgcctctgagc
B D                    Gibbon  -------------------agacacccctg-ctgccactgaac
B D                    Baboon  -------------------agacacccttg-cggccactgagc
B D              Green monkey  -------------------agacacccttg-cggccgctgagc
B D                  Marmoset  -------------------agaggcccctg-ctgcagctgagt
B D           Squirrel monkey  --------------------aggccccctg-ctgcagctgagc
B D                  Bushbaby  -------------------ggatgccctgt-ccaccacagagc
           Chinese tree shrew  -------------------agacaaccctacctgcccctgaac
B D           Chinese hamster  agggtggactctct----ggacacaaccac-ctggcactgtat
               Golden hamster  agggtggactcttcagagggacacaaccac-ctggcactgcat
B D                       Rat  agagtagactcact----ggacatatccac-ctacacctgcat
B D            Naked mole-rat  agggt-agcccctt----gagaggtttcta-ttcctggtggat
B D                Guinea pig  agggtgggcctcca----ggg-gacttctg-ctcctgctggac
                   Chinchilla  agggtgggtcccct----gggagaccgctg-ttccggctacac
               Domestic goat  ===========================================
B D                     Sheep  ===========================================
B D                       Cow  ===========================================
            Tibetan antelope  ===========================================
               Big brown bat  -------------------------------------------
B D                  Microbat  ===========================================
        David's myotis (bat)  ===========================================
              Bactrian camel  ===========================================
B D                    Alpaca  ===========================================
B D                     Mouse  ===========================================
B D                     Panda  ===========================================
B D                       Dog  ===========================================
                Prairie vole  ===========================================
                Killer whale  ===========================================
B D                   Ferret   ===========================================
B D                  Squirrel  ===========================================
B D                       Cat  ===========================================
              Pacific walrus  ===========================================
B D                   Manatee  ===========================================
B D                  Elephant  ===========================================
B D                 Armadillo  ===========================================
      Lesser Egyptian jerboa  ===========================================
            Brush-tailed rat  ===========================================
B D                     Horse  ===========================================
            Black flying-fox  ===========================================
B D          White rhinoceros  ===========================================
  D  Chinese softshell turtle  ===========================================
  D           Green seaturtle  ===========================================
  D            Painted turtle  ===========================================
B D           Tasmanian devil  ===========================================
B D                   Wallaby  ===========================================
B D                   Opossum  ===========================================
                    Aardvark  ===========================================
                Weddell seal  ===========================================
            Cape golden mole  ===========================================
B D                   Dolphin  ===========================================
B D       Crab-eating macaque  -------------------------------------------
B D                    Rhesus  -------------------------------------------
B D        American alligator  -------------------------------------------

Inserts between block 22 and 23 in window
B D           Naked mole-rat 6bp
B D               Guinea pig 6bp
                  Chinchilla 6bp

Alignment block 23 of 471 in window, 131780440 - 131780467, 28 bps 
B D                     Human  ctcacagccacagccccaaatccgtggc
B D                     Chimp  ctcacagccacagccccaaatctgttgc
B D                   Gorilla  ctcacagccatagccccaaatccgtggc
B D                 Orangutan  atcacagccacagccccaaatccgtggc
B D                    Gibbon  atcacagccacagccccaaatctgtggc
B D                    Baboon  atcacagccacagccccgaatccgtggc
B D              Green monkey  atcacagccacagccccaaatccgtggc
B D                  Marmoset  gtcacagccacagccccaagtccgtggc
B D           Squirrel monkey  gtcacagccacag-cccagatccgtggc
B D                  Bushbaby  atcacggccacagcctgaaatccatggc
           Chinese tree shrew  tttacggccacagttccaaatccatggc
B D           Chinese hamster  tgtgtggtcataactccccatcagtgtc
               Golden hamster  tgtgtggccataactccccatcagtgtc
B D                       Rat  tgtatggacagaactccccatcagtgtc
B D            Naked mole-rat  gccatgggcagaatc-------ggtggt
B D                Guinea pig  gccataggcagaatt-------ggtggc
                   Chinchilla  gccacaggcagaaca--------gtggc
             Brush-tailed rat  ctcacaagcacagcactcc-ttgctgga
               Domestic goat  ============================
B D                     Sheep  ============================
B D                       Cow  ============================
            Tibetan antelope  ============================
               Big brown bat  ----------------------------
B D                  Microbat  ============================
        David's myotis (bat)  ============================
              Bactrian camel  ============================
B D                    Alpaca  ============================
B D                     Mouse  ============================
B D                     Panda  ============================
B D                       Dog  ============================
                Prairie vole  ============================
                Killer whale  ============================
B D                   Ferret   ============================
B D                  Squirrel  ============================
B D                       Cat  ============================
              Pacific walrus  ============================
B D                   Manatee  ============================
B D                  Elephant  ============================
B D                 Armadillo  ============================
      Lesser Egyptian jerboa  ============================
B D                     Horse  ============================
            Black flying-fox  ============================
B D          White rhinoceros  ============================
  D  Chinese softshell turtle  ============================
  D           Green seaturtle  ============================
  D            Painted turtle  ============================
B D           Tasmanian devil  ============================
B D                   Wallaby  ============================
B D                   Opossum  ============================
                    Aardvark  ============================
                Weddell seal  ============================
            Cape golden mole  ============================
B D                   Dolphin  ============================
B D       Crab-eating macaque  ----------------------------
B D                    Rhesus  ----------------------------
B D        American alligator  ----------------------------

Inserts between block 23 and 24 in window
B D                   Baboon 1bp
B D             Green monkey 1bp
B D                 Marmoset 487bp
B D          Squirrel monkey 83bp
B D                 Bushbaby 1bp
          Chinese tree shrew 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 24 of 471 in window, 131780468 - 131780871, 404 bps 
B D                     Human  catt-caga-------gccaggcactgtccacag-aacaaagacctgtgcattccttgctaattagtcca
B D                     Chimp  catt-caga-------gccaggcactgtccacag-aacaaagacctgtgcattccttgctaattagtcca
B D                   Gorilla  catt-caga-------gccaggcactgtccacag-aacaaagacctgtgcattccttgctaattagtcca
B D                 Orangutan  catt-caga-------gccaggcactgtccacag-aacaaagacctgtgcgttccttgctaattagtcca
B D                    Gibbon  catt-caga-------gccaggcactgtccacag-aacaaagacctgtgcgttccttgctaattagtcca
B D                    Baboon  catt-caga-------gccaggcagtgtccacag-aacaaagacccgtgtgttccttgctaattagtcca
B D              Green monkey  catt-caga-------gccaggcagtgtccacag-aagaaagacccgtgcgttccttgctaattagtcca
B D                  Marmoset  catt-caga-------cccaggcactgtccacag-agcagaggcccgtgcattccctgctaactagtcta
B D           Squirrel monkey  catt-caga-------cctgggcacagtccacaa-aacaaaggcccgtgcgttccttgctaattagtcta
B D                  Bushbaby  cact-cgga-------gtcaggcactgccccttg-agtaagggtcagtgtgtctctcattaactagccca
           Chinese tree shrew  catt-caca-------gtcaaaccctgtccactg-aataagaacccgtgactttccca-taattaatcca
B D           Chinese hamster  tatt-ctat-------gacagattccaaccacct-agcaagaa-ctgtacatt-----cctattagccct
               Golden hamster  catt-ctat-------gacagattccaaccacca-agcaagaacctgtacatt-----cccattagccct
B D                       Rat  ttttcctgt-------gtcagattccattcacttgagcaagaaccaatgcatt-----cctat--gtcaa
B D            Naked mole-rat  catt-ctaa-------gtcagggcctgtccattg-agcaagaactctca---------ttaattagtcca
B D                Guinea pig  catt-caga-------gtcaggccctgtctattg-agcaagaactctca---------ctaattagtcca
                   Chinchilla  catt-ctga------gtccaggccctgtccactg-ggcaagaactctca---------ctaattagtcca
             Brush-tailed rat  cctt-gagataactggaccaggccccatccactg-aggaaaggcctcca---------ttaattaatcca
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
                Prairie vole  ======================================================================
                Killer whale  ======================================================================
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                     Horse  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                    Aardvark  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
B D       Crab-eating macaque  ----------------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------

                        Human  cctttcagtgtgca--gagtgcagcatctttaacttcccaaggagcaaatggagccaattaattcagcag
                        Chimp  cctttcagtgtgca--gagtgcagcatctttaacttcccaaggagcaaatggagccaattaattcagcag
                      Gorilla  cctttcagtgtgca--gagcgcagcatctttaacttcccaaggagcaaatggagccaattaattcagcag
                    Orangutan  cctttcagtgtgca--gagtgcagcatctttaacttcccaaggagcgaatggagccaattaattcagcag
                       Gibbon  cctttcagtgtgca--gagtgcagcatctttaacttcccaaggagcgaatggagccaattaattcagcag
                       Baboon  cctttcagtgtgct--gagtgcaccatctttaacttcccaaggagcgaatggagccaattaattcagcag
                 Green monkey  cctttcagtgtgct--gagtgcaccatctttaacttcccaaggagcgaatggagccaattaattcagcag
                     Marmoset  cctgacagcatgca--aagtgcagcatctttaacttcccaaggagaaaaaggggccaattaattcagcag
              Squirrel monkey  cctgccagtgtgca--aagtgcagcatctttaacttcccaagaagcaaaaggggccaattaattcagcag
                     Bushbaby  ccttccagtgggcaccaagtgcagtgtctttagctgtccac--aatgaat-gcgacaattaattcggcag
           Chinese tree shrew  ccttctagt-caca--gagtg----gtctctaattttccaagcagtgaatgaggccaattaattcggcag
              Chinese hamster  tgtccca--gtcaaccaaatag---------aatttctcaagcagtgactgcggtcaattagttggacaa
               Golden hamster  tgtcccggtgtcaaccaaatag---------aatttccccagcaatgactgcggtcaattagtcggacaa
                          Rat  tgtctcagtgtctaccaaaaag---------aatttcccaagcagtgactgaggccaattggttacacaa
               Naked mole-rat  ctttctaatatgcacagagtacagcatggtcaatttctcaagcagtga-tgaggccaattaattgagcag
                   Guinea pig  ctttccaatgtgcacaga-tataacctggtcaatttctcaagcagtga-tgaagccagctaactgagcag
                   Chinchilla  ctttccaatgtgcacagagtacagtctggtcaaattctgaagcagtga-tgaggctaattaatttagtag
             Brush-tailed rat  ctttctgatgtgcacagagaacagctgagtcaatttgtcaagcagtgc-tgaggccaatttctcgagcag
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                 Prairie vole  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
          Crab-eating macaque  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------

                        Human  gaggagaccaaatcaatttcccaaacagcttgttataggacttgcaacttcacagacaaatctcatgcct
                        Chimp  gaggagaccaaatcaatttcccaaactgcttgttataggacttgtgacttcacagacgaatctcatgcct
                      Gorilla  gaggagaccaaatcaatttcccaaacagcttgttataggacttgcgacttcacggacaaatctcatgcct
                    Orangutan  gaggagaccaaatcaatttcccaaaccgcttgttataggacttgcgacttcacagacaaatctcctgcct
                       Gibbon  gaggagaccaaattaatttcccaaacagcttgttataggatttgcgacttcacagacgaatctcctgcct
                       Baboon  gaagagaccaaatcaatttcccaaacagcttgttataggacttgcgacttcacagatgagtctcctacct
                 Green monkey  gaagagaccaaatcaatttcccaaacagcttgttataggacttgcaacttcacagatgagtctcctacct
                     Marmoset  aagga-accaaatcaatttccccagtcacttgatacaggacttccaacttcacagatgaatctcctgctt
              Squirrel monkey  gaggagaccaaatcaatttcccaagccgcttggtacaggacttgcgagttcagggatgaatctcctgcct
                     Bushbaby  gagattaccaaatccatgtcctaagccactagatgtaa------taatattatggatagatctcactcct
           Chinese tree shrew  gaggataccaaatcaatttcccacgccacttgataaaaggtttctaacttcacagatgaatctcctacct
              Chinese hamster  gcagatacca--tccatttcccaggctactcaatagaac-tttataacctcacaaatagctcccttccct
               Golden hamster  tcagatacca--tccatttcccaggctactcaatggaac-tttgtaacctcacaaataactcccttcccc
                          Rat  gcagatacca--tccatttcccaaggcgttcaatagaac-tttataacctcacacataattcccttcccc
               Naked mole-rat  gcagatatcacatcagtttctcaggccacttggtagaaggcttccatctttacctatggctctcctgctc
                   Guinea pig  gaagatactacatcagtttctcaggtcacttgttggaaggtttccattctcactgatgactctcctaatc
                   Chinchilla  gcagataccacatcattttctcaggccacttggtggaaagcttccatcctcactggtgactctcatactc
             Brush-tailed rat  gcagataccatgccagtttctcagaccacttggtggaaggttcgcatccccactaatgactctcctgctc
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                 Prairie vole  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
          Crab-eating macaque  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------

                        Human  ---------------ccacctaacccaccaa-tcatcct-cgtgtccaaaca----gcctcgccattaac
                        Chimp  ---------------ccacctaacccaccaa-tcatcct-cgtgtccaaaca----gcctcaccattaac
                      Gorilla  ---------------ccacctaacccaccaa-tcatcct-cgtgtccaaaca----gcctcgccattaac
                    Orangutan  ---------------ccacctaacccaccaa-acatcct-catgtccaaaca----gcctcgccattaac
                       Gibbon  ---------------ccacctaacccaccaa-acatcct-cgtgtccaaaca----gcctcaccattaac
                       Baboon  ---------------ccacctaacccaccaa-atatcct-cacgtccaaaca----gcctcgccattaac
                 Green monkey  ---------------ccacctaaccaaccaa-atatcct-cgtgtccaaaca----gcctcgccattaac
                     Marmoset  ---------------ccac----------ta-acatcct--gcgtccagaca----gcctcaccactaac
              Squirrel monkey  ---------------ccacagaacccactaa-acatcct--gtgtccgaaca----gcctggctgctaac
                     Bushbaby  ---------------ctacccatcccgcc----caaact-ggtgtccccaca----gcctcac-actgac
           Chinese tree shrew  ---------------ccacccaacctactta-aaatgtttcaaatccaaaca----acctcattactaat
              Chinese hamster  --------------------------------------------------ca----gcct-gtctctaag
               Golden hamster  --------------------------------------------------ca----gcct-gtctctaag
                          Rat  --------------------------------------------------ca----gcct-gtttctaac
               Naked mole-rat  -cccccacctctgccccagccaacctgctgacacattct-ggaatcccaaca----gcta-atctctaaa
                   Guinea pig  acctccagctttgccccagccaacctgttaacacattct-g-aatcccatca----gtcc-atctctaaa
                   Chinchilla  -cacccagctttgcccc-gccaacctgctggcacattct-ggaatcccaaca----atcc-atctctaaa
             Brush-tailed rat  -ccctcggctttgccccagccaacctgctggcacattct-gcaatcctaccagtccatcc-atctctaaa
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                 Prairie vole  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
          Crab-eating macaque  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------

                        Human  atcagagcca--c-t-----------------------------------------------tgcctctt
                        Chimp  atcagagcca--c-t-----------------------------------------------tgcctctt
                      Gorilla  atcagagcca--c-t-----------------------------------------------tgcctctt
                    Orangutan  atcagagcca--c-t-----------------------------------------------tgcctctc
                       Gibbon  atcagagcca--c-t-----------------------------------------------tgcctctc
                       Baboon  atcagagcca--c-t-----------------------------------------------tgcatctc
                 Green monkey  atcagagcca--c-t-----------------------------------------------tgcgtctc
                     Marmoset  atcagcacca--c-t-----------------------------------------------tggctccc
              Squirrel monkey  atcggtgccc--c-t-----------------------------------------------cgcctctc
                     Bushbaby  atcgggccca--c-tgcctctgcaccctcagatgtggagggtgaggacaggctagcacgtcctggccctg
           Chinese tree shrew  actacagtccatt-t-----------------------------------------------ttcttttc
              Chinese hamster  agcaaaaccc--c-a-----------------------------------------------tacttctc
               Golden hamster  agcaaagccc--c-a-----------------------------------------------tgcttctc
                          Rat  agcaaagacc--c-------------------------------------------------tgcttctc
               Naked mole-rat  ggcagagccc--ctt-----------------------------------------------tgtgtctc
                   Guinea pig  ggcagagcca--ctt-----------------------------------------------tgtgtctc
                   Chinchilla  ggtagagaca--ctt-----------------------------------------------tgggtctc
             Brush-tailed rat  tgcagagcca--ctt-----------------------------------------------tgtgtctc
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                 Prairie vole  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
          Crab-eating macaque  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------

                        Human  ttt--gtgca---------------------------taaccc------actacctcaga---------c
                        Chimp  ttt--gtgca---------------------------taaccc------actatct--ga---------c
                      Gorilla  ttt--gtgca---------------------------taaccc------actatctcaga---------c
                    Orangutan  ttt--gtgca---------------------------taaccc------actacctcaga---------c
                       Gibbon  ttt--gtgca---------------------------taaccc------actacctcaga---------c
                       Baboon  ttt--gtgca---------------------------taaccc------actacctcgga---------c
                 Green monkey  ttt--gtgca---------------------------taaccc------actaccttgga---------c
                     Marmoset  --t--ccata---------------------------caacct------gctccttcaga---------t
              Squirrel monkey  --t--gcaca---------------------------caaccc------gctccctcaga---------c
                     Bushbaby  tct--gtccagagcagcagttctcaacctgtgggtcgcaacccacaggaactgtcttaaagggccccagc
           Chinese tree shrew  ttt--gtata---------------------------caactt------gctcccttgga---------c
              Chinese hamster  ctt-ggaaca---------------------------cagctg------atccat--ggc---------t
               Golden hamster  ctt-ggaaca---------------------------cagcag------ctccat--ggc---------t
                          Rat  ctt-ggaaca---------------------------cagcta------gtcatt--ggc---------c
               Naked mole-rat  ctc-agggca---------------------------tagtct------gctcctgtgaa---------t
                   Guinea pig  cttgaagtca---------------------------cagtct------gattttgtgta---------t
                   Chinchilla  ctc-agcaca---------------------------cagttc------ccacttgtgta---------t
             Brush-tailed rat  ctc-agggca---------------------------cgatct------gcccttgagta---------t
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                 Prairie vole  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
          Crab-eating macaque  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------

                        Human  gctgggaagaactcaaact----------aggactgactggtgagttcttccc--------------aag
                        Chimp  actgggaagaactcaaact----------aggactgactggtgagttcttccc--------------aag
                      Gorilla  gctgggaaggactcaaact----------aggactgactggtgagttcttccc--------------aag
                    Orangutan  actgggaaaaactcaaatt----------aggactggctggtgagttcttccc--------------aag
                       Gibbon  gctgggaagaactcaagct----------aggactggctggtgagttctcccc--------------aag
                       Baboon  actgggaagaactgaaact----------aggactggctgatgagttcttccc--------------aaa
                 Green monkey  gctgggaagaactgaaact----------atgactggctggtgagtttttccc--------------aaa
                     Marmoset  gctgggaagaacttagagt----------aggactggctggtaggttcg---------------------
              Squirrel monkey  tctgggaagagcttagact----------cggactggctgggacgttcg---------------------
                     Bushbaby  attaggaaggttgagaaccactggtccagaggaatgaggggaaagtcctccttgaagagtaatgatgaga
           Chinese tree shrew  ac----aagagctctttat----------gagacaggctggtgtgtcca---------------------
              Chinese hamster  tctg---aggtcatatgct----------ggggcagactggca---------------------------
               Golden hamster  gctg---aggtcatacgct----------ggggcagactggca---------------------------
                          Rat  aatg---agatcaaatgct----------ggaacagattgtca---------------------------
               Naked mole-rat  ggta---aggatttatgct----------gatacaagctggca---------------------------
                   Guinea pig  gtgt---aggatttatact----------tgtacaagctggca---------------------------
                   Chinchilla  gctg---aggatttacact----------ggtagaagctggca---------------------------
             Brush-tailed rat  gctg---aagagtcaagct----------ggcacaagctgaca---------------------------
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                 Prairie vole  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
          Crab-eating macaque  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------

                        Human  actcac---------tctct--agagacctaaatcctggc------------------cctgt-------
                        Chimp  actcac---------tctct--agagacctatatcctggc------------------cctgt-------
                      Gorilla  actcac---------tctct--agagacctaaatcctggc------------------cctgt-------
                    Orangutan  actcac---------tccct--agagacctgaatccttgc------------------cctgt-------
                       Gibbon  actcac---------tctcta-agagacctgaatcctggc------------------cctgt-------
                       Baboon  actcac---------tctct--agagacctgaatcctggc------------------cctgt-------
                 Green monkey  actcac---------tctct--agagacctgaatcctggc------------------cctgt-------
                     Marmoset  ----------------------tgagacctgaatcctggc------------------cctgt-------
              Squirrel monkey  ----------------------tgagacctgaatcgcggc------------------cctgt-------
                     Bushbaby  actcacctggccttgtctctacagagaactgtctcttggcggggcgccgtggctcacacctgtgatccca
           Chinese tree shrew  ----------------------tgaagtctgaatcccgtc------------------tccat-------
              Chinese hamster  ---------------tgtgt--agag-cctgaagacct-c------------------cccat-------
               Golden hamster  ---------------tctga--agat-cctgaagacct--------------------ctcat-------
                          Rat  ---------------tctgt--agat-cctgaaggcta-c------------------cctat-------
               Naked mole-rat  ---------------tccct--aggg-cctgaatggtg-c------------------cctgg-------
                   Guinea pig  ---------------tctcc--ttgg-tctcaacagcg-c------------------cctgg-------
                   Chinchilla  ---------------cctcc--atgg-tctgaatggca-c------------------cctgg-------
             Brush-tailed rat  ---------------tctgc--aggg-cccaaatagtg-c------------------cctga-------
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                 Prairie vole  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
          Crab-eating macaque  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------

                        Human  ---------------------------------------------------ccaaccagggg-atgag-g
                        Chimp  ---------------------------------------------------ccaaccagggg-atgag-g
                      Gorilla  ---------------------------------------------------ccaaccagggg-atgag-g
                    Orangutan  ---------------------------------------------------ccatccagggg-atgag-g
                       Gibbon  ---------------------------------------------------ccatccaggga-atgag-g
                       Baboon  ---------------------------------------------------ccatccagggg-atgag-g
                 Green monkey  ---------------------------------------------------ccatccagggg-atgag-g
                     Marmoset  ---------------------------------------------------ccatccagggg--tgag-g
              Squirrel monkey  ---------------------------------------------------ccacccagggg--tgag-g
                     Bushbaby  gaactctgggagaccgaggcagatggataacctgagctaaggagttcaagactagccagagc-aagag-c
           Chinese tree shrew  ---------------------------------------------------tcatccagactcaagagtg
              Chinese hamster  ---------------------------------------------------cca-tcaagca-ttaag-g
               Golden hamster  ---------------------------------------------------cca-tcaaaca-ataag-g
                          Rat  ---------------------------------------------------tcattcaaaag-atgag-a
               Naked mole-rat  ---------------------------------------------------ccatctaagtg-aagag-g
                   Guinea pig  ---------------------------------------------------ccatgtaagtg-atgag-g
                   Chinchilla  ---------------------------------------------------ttatctaagtg-atggg-g
             Brush-tailed rat  ---------------------------------------------------ccatctaaatg-atgag-g
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                 Prairie vole  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
          Crab-eating macaque  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------

                        Human  ag-aagccttcttc
                        Chimp  ag-aagccttcttc
                      Gorilla  ag-aagccttcttc
                    Orangutan  ag-aagccttcctc
                       Gibbon  ag-aagccttcctc
                       Baboon  ag-aagccttcccc
                 Green monkey  ag-aagccttcctc
                     Marmoset  ag-aagccttcctc
              Squirrel monkey  ag-aagcctccctc
                     Bushbaby  aa-gaccccatctc
           Chinese tree shrew  aa-aatccttcctc
              Chinese hamster  aa-aaat---cttt
               Golden hamster  aa-aaac---cttt
                          Rat  tg-aagc---cttt
               Naked mole-rat  agcaagccttcttt
                   Guinea pig  agcaagccttcttc
                   Chinchilla  agcaagc---cttc
             Brush-tailed rat  aaccagccttcttc
                Domestic goat  ==============
                        Sheep  ==============
                          Cow  ==============
             Tibetan antelope  ==============
                Big brown bat  --------------
                     Microbat  ==============
         David's myotis (bat)  ==============
               Bactrian camel  ==============
                       Alpaca  ==============
                        Mouse  ==============
                        Panda  ==============
                          Dog  ==============
                 Prairie vole  ==============
                 Killer whale  ==============
                      Ferret   ==============
                     Squirrel  ==============
                          Cat  ==============
               Pacific walrus  ==============
                      Manatee  ==============
                     Elephant  ==============
                    Armadillo  ==============
       Lesser Egyptian jerboa  ==============
                        Horse  ==============
             Black flying-fox  ==============
             White rhinoceros  ==============
     Chinese softshell turtle  ==============
              Green seaturtle  ==============
               Painted turtle  ==============
              Tasmanian devil  ==============
                      Wallaby  ==============
                      Opossum  ==============
                     Aardvark  ==============
                 Weddell seal  ==============
             Cape golden mole  ==============
                      Dolphin  ==============
          Crab-eating macaque  --------------
                       Rhesus  --------------
           American alligator  --------------

Inserts between block 24 and 25 in window
B D                 Bushbaby 155bp

Alignment block 25 of 471 in window, 131780872 - 131780873, 2 bps 
B D                     Human  -ag
B D                     Chimp  -ag
B D                   Gorilla  -ag
B D                 Orangutan  -ag
B D                    Gibbon  -ag
B D                    Baboon  -cg
B D              Green monkey  -cg
B D                  Marmoset  -ag
B D           Squirrel monkey  -ag
           Chinese tree shrew  -at
B D           Chinese hamster  ta-
               Golden hamster  ta-
B D                       Rat  ca-
B D            Naked mole-rat  ca-
B D                Guinea pig  ca-
                   Chinchilla  ca-
             Brush-tailed rat  ca-
               Domestic goat  ===
B D                     Sheep  ===
B D                       Cow  ===
            Tibetan antelope  ===
               Big brown bat  ---
B D                  Microbat  ===
        David's myotis (bat)  ===
              Bactrian camel  ===
B D                    Alpaca  ===
B D                     Mouse  ===
B D                     Panda  ===
B D                       Dog  ===
                Prairie vole  ===
                Killer whale  ===
B D                   Ferret   ===
B D                  Squirrel  ===
B D                       Cat  ===
              Pacific walrus  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D                 Armadillo  ===
      Lesser Egyptian jerboa  ===
B D                  Bushbaby  ===
B D                     Horse  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
  D            Painted turtle  ===
B D           Tasmanian devil  ===
B D                   Wallaby  ===
B D                   Opossum  ===
                    Aardvark  ===
                Weddell seal  ===
            Cape golden mole  ===
B D                   Dolphin  ===
B D       Crab-eating macaque  ---
B D                    Rhesus  ---
B D        American alligator  ---

Inserts between block 25 and 26 in window
B D          Chinese hamster 2bp
              Golden hamster 2bp
B D                      Rat 2bp

Alignment block 26 of 471 in window, 131780874 - 131780920, 47 bps 
B D                     Human  gaagtaatgacctggaccggccaatctcagttgaccttgtcttcttt
B D                     Chimp  gaagtaatgacctggaccggccaatctcagttgaccttgtcctcttt
B D                   Gorilla  gaagtaatgacctggaccagccaatctcagttgaccttgtcttcttt
B D                 Orangutan  gaagtaatgacctggaccggccaatctcagttgaccttgtcctcttt
B D                    Gibbon  gaagtaatgacctggaccggccaatctcagttgaccttgtcctcttt
B D                    Baboon  gaagtaatgacctggaccagccaatctcagttgaccttgtcctcttt
B D              Green monkey  gaagtaatgacctggaccagccaatctcagttgaccttgtcctcttt
B D                  Marmoset  gcagtgacgacctggactggccaatctcagctgcccttgtcctcttt
B D           Squirrel monkey  gacgtgctgacctggaccggccaatctcagctgcccttgtcctcttt
           Chinese tree shrew  agactaatgaccaaggccagcacactttatctggctttgctgtcttt
       Lesser Egyptian jerboa  ggagcagtgagcagcaccgggagacatcacctggctttgtcatcttg
B D           Chinese hamster  ggaacagtgaccagcacaagcagatctcgactagatgtgtcttcttt
               Golden hamster  ggaacaatgaccagcacaagcagatctggactgga--tgtcttcttt
B D                       Rat  gaagcagtgaccagcaccagcaaatctcagctgaatttgatctcttt
B D            Naked mole-rat  -gaacaatgagcaggacgagcagatctcagctggctttctcatattt
B D                Guinea pig  -gagcaatgagcaggaccagcagacatcagctggctttcccatcttt
                   Chinchilla  -gagcaatgagaaggaccagcagatctcagctggctttctcatctgt
             Brush-tailed rat  -gagcaatgagcaggatcaaaagatctcagctggctttctcatctg-
               Domestic goat  ===============================================
B D                     Sheep  ===============================================
B D                       Cow  ===============================================
            Tibetan antelope  ===============================================
               Big brown bat  -----------------------------------------------
B D                  Microbat  ===============================================
        David's myotis (bat)  ===============================================
              Bactrian camel  ===============================================
B D                    Alpaca  ===============================================
B D                     Mouse  ===============================================
B D                     Panda  ===============================================
B D                       Dog  ===============================================
                Prairie vole  ===============================================
                Killer whale  ===============================================
B D                   Ferret   ===============================================
B D                  Squirrel  ===============================================
B D                       Cat  ===============================================
              Pacific walrus  ===============================================
B D                   Manatee  ===============================================
B D                  Elephant  ===============================================
B D                 Armadillo  ===============================================
B D                  Bushbaby  ===============================================
B D                     Horse  ===============================================
            Black flying-fox  ===============================================
B D          White rhinoceros  ===============================================
  D  Chinese softshell turtle  ===============================================
  D           Green seaturtle  ===============================================
  D            Painted turtle  ===============================================
B D           Tasmanian devil  ===============================================
B D                   Wallaby  ===============================================
B D                   Opossum  ===============================================
                    Aardvark  ===============================================
                Weddell seal  ===============================================
            Cape golden mole  ===============================================
B D                   Dolphin  ===============================================
B D       Crab-eating macaque  -----------------------------------------------
B D                    Rhesus  -----------------------------------------------
B D        American alligator  -----------------------------------------------

Alignment block 27 of 471 in window, 131780921 - 131780942, 22 bps 
B D                     Human  agagagaattgtctccaagtcc
B D                     Chimp  agagagaattgtctccaagtcc
B D                   Gorilla  agagagaattgtctccaagtcc
B D                 Orangutan  agagagaattgtctccaagtcc
B D                    Gibbon  agagagaattgtctccaagtcc
B D                    Baboon  agaaagaattgtctccaagtcc
B D              Green monkey  agagataattgtctccaagtcc
B D                  Marmoset  agagagaattgtctccaagccc
B D           Squirrel monkey  agagagaattgtctccaagccc
B D                  Bushbaby  aaaaagaaccgtctccaaaccc
           Chinese tree shrew  acagagaagtgcttccaaaccc
       Lesser Egyptian jerboa  acagggaagagtctccaacccc
B D           Chinese hamster  a-aaggaagtagccccagacct
               Golden hamster  ataagggagtggccccaaacct
B D                       Rat  acaaagtagtgatcccaaacct
B D            Naked mole-rat  acagtgaaata-ccctacaccc
B D                Guinea pig  acagtggagtgtccccaa----
                   Chinchilla  acggcgaaatatcctcaaacct
             Brush-tailed rat  -cagtgaagtgtcccgaaaccc
               Domestic goat  ======================
B D                     Sheep  ======================
B D                       Cow  ======================
            Tibetan antelope  ======================
               Big brown bat  ----------------------
B D                  Microbat  ======================
        David's myotis (bat)  ======================
              Bactrian camel  ======================
B D                    Alpaca  ======================
B D                     Mouse  ======================
B D                     Panda  ======================
B D                       Dog  ======================
                Prairie vole  ======================
                Killer whale  ======================
B D                   Ferret   ======================
B D                  Squirrel  ======================
B D                       Cat  ======================
              Pacific walrus  ======================
B D                   Manatee  ======================
B D                  Elephant  ======================
B D                 Armadillo  ======================
B D                     Horse  ======================
            Black flying-fox  ======================
B D          White rhinoceros  ======================
  D  Chinese softshell turtle  ======================
  D           Green seaturtle  ======================
  D            Painted turtle  ======================
B D           Tasmanian devil  ======================
B D                   Wallaby  ======================
B D                   Opossum  ======================
                    Aardvark  ======================
                Weddell seal  ======================
            Cape golden mole  ======================
B D                   Dolphin  ======================
B D       Crab-eating macaque  ----------------------
B D                    Rhesus  ----------------------
B D        American alligator  ----------------------

Inserts between block 27 and 28 in window
      Lesser Egyptian jerboa 901bp
B D          Chinese hamster 1bp
              Golden hamster 811bp
B D                      Rat 2bp
B D           Naked mole-rat 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 28 of 471 in window, 131780943 - 131780944, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  aa
           Chinese tree shrew  aa
               Domestic goat  ==
B D                     Sheep  ==
B D                       Cow  ==
            Tibetan antelope  ==
               Big brown bat  --
B D                  Microbat  ==
        David's myotis (bat)  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                     Mouse  ==
B D                     Panda  ==
B D                       Dog  ==
B D                       Rat  ==
                Prairie vole  ==
B D           Chinese hamster  ==
              Golden hamster  ==
                Killer whale  ==
B D                   Ferret   ==
B D                  Squirrel  ==
B D                       Cat  ==
              Pacific walrus  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                Guinea pig  --
B D                   Manatee  ==
B D                  Elephant  ==
B D                 Armadillo  ==
      Lesser Egyptian jerboa  ==
            Brush-tailed rat  ==
B D                     Horse  ==
            Black flying-fox  ==
B D          White rhinoceros  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D           Tasmanian devil  ==
B D                   Wallaby  ==
B D                   Opossum  ==
                    Aardvark  ==
                Weddell seal  ==
            Cape golden mole  ==
B D                   Dolphin  ==
B D       Crab-eating macaque  --
B D                    Rhesus  --
B D        American alligator  --

Alignment block 29 of 471 in window, 131780945 - 131780948, 4 bps 
B D                     Human  atcc
B D                     Chimp  atcc
B D                   Gorilla  atcc
B D                 Orangutan  atcc
B D                    Gibbon  attc
B D                    Baboon  atcc
B D              Green monkey  atcc
B D                  Marmoset  atcc
B D           Squirrel monkey  atcc
B D                  Bushbaby  actc
           Chinese tree shrew  atcc
B D           Chinese hamster  atcc
B D            Naked mole-rat  aaag
                   Chinchilla  attc
             Brush-tailed rat  atcc
               Domestic goat  ====
B D                     Sheep  ====
B D                       Cow  ====
            Tibetan antelope  ====
               Big brown bat  ----
B D                  Microbat  ====
        David's myotis (bat)  ====
              Bactrian camel  ====
B D                    Alpaca  ====
B D                     Mouse  ====
B D                     Panda  ====
B D                       Dog  ====
B D                       Rat  ====
                Prairie vole  ====
              Golden hamster  ====
                Killer whale  ====
B D                   Ferret   ====
B D                  Squirrel  ====
B D                       Cat  ====
              Pacific walrus  ====
B D                Guinea pig  ----
B D                   Manatee  ====
B D                  Elephant  ====
B D                 Armadillo  ====
      Lesser Egyptian jerboa  ====
B D                     Horse  ====
            Black flying-fox  ====
B D          White rhinoceros  ====
  D  Chinese softshell turtle  ====
  D           Green seaturtle  ====
  D            Painted turtle  ====
B D           Tasmanian devil  ====
B D                   Wallaby  ====
B D                   Opossum  ====
                    Aardvark  ====
                Weddell seal  ====
            Cape golden mole  ====
B D                   Dolphin  ====
B D       Crab-eating macaque  ----
B D                    Rhesus  ----
B D        American alligator  ----

Inserts between block 29 and 30 in window
B D          Chinese hamster 848bp

Alignment block 30 of 471 in window, 131780949 - 131780959, 11 bps 
B D                     Human  catgtaagact
B D                     Chimp  catgtaagact
B D                   Gorilla  catgtaagact
B D                 Orangutan  catgtaagact
B D                    Gibbon  catgtaagact
B D                    Baboon  catgtatgact
B D              Green monkey  catgtatgact
B D                  Marmoset  tgtttatgact
B D           Squirrel monkey  cgtgtgtgact
B D                  Bushbaby  cttgtgtgac-
           Chinese tree shrew  tatct--gact
B D            Naked mole-rat  tatgtgtgact
                   Chinchilla  cacatgtta--
             Brush-tailed rat  tatgtgtgact
               Domestic goat  ===========
B D                     Sheep  ===========
B D                       Cow  ===========
            Tibetan antelope  ===========
               Big brown bat  -----------
B D                  Microbat  ===========
        David's myotis (bat)  ===========
              Bactrian camel  ===========
B D                    Alpaca  ===========
B D                     Mouse  ===========
B D                     Panda  ===========
B D                       Dog  ===========
B D                       Rat  ===========
                Prairie vole  ===========
B D           Chinese hamster  ===========
              Golden hamster  ===========
                Killer whale  ===========
B D                   Ferret   ===========
B D                  Squirrel  ===========
B D                       Cat  ===========
              Pacific walrus  ===========
B D                Guinea pig  -----------
B D                   Manatee  ===========
B D                  Elephant  ===========
B D                 Armadillo  ===========
      Lesser Egyptian jerboa  ===========
B D                     Horse  ===========
            Black flying-fox  ===========
B D          White rhinoceros  ===========
  D  Chinese softshell turtle  ===========
  D           Green seaturtle  ===========
  D            Painted turtle  ===========
B D           Tasmanian devil  ===========
B D                   Wallaby  ===========
B D                   Opossum  ===========
                    Aardvark  ===========
                Weddell seal  ===========
            Cape golden mole  ===========
B D                   Dolphin  ===========
B D       Crab-eating macaque  -----------
B D                    Rhesus  -----------
B D        American alligator  -----------

Inserts between block 30 and 31 in window
            Brush-tailed rat 509bp

Alignment block 31 of 471 in window, 131780960 - 131781005, 46 bps 
B D                     Human  tttgtcctccccagggg-agtacgctgtgcccagagcagtggatccc
B D                     Chimp  tttgtcctccccagggg-agaacgctgtgcccagagcagtggatccc
B D                   Gorilla  tttgtcctccccagggg-agtacgctgtgcccagagcagtggatccc
B D                 Orangutan  tttgtcctgcccagggg-attaccctgtccccagagcagtggatccc
B D                    Gibbon  tttgtcctgcccagggg-agtacgttggacccagagcagtggatccc
B D                    Baboon  tttgttctgcccagggg-agtacgctgtccccagagcagtggatccc
B D              Green monkey  tttgtcctgcccagggg-agtacgctgtccccagagcagtggatccc
B D                  Marmoset  tttaccctgcccagggg-tgtacgctgtccccagagcaatggaaccc
B D           Squirrel monkey  ttgaccccgcctggggg-cgtacgctgtccccagagcagtggagccc
B D                  Bushbaby  atggtccagcccaaggg-cagccactatccttggaacagtgggactg
           Chinese tree shrew  ttcgttcagcccaagggcaacatactattcctaaaatggtggacctt
B D                       Rat  ---cccctcatgagatt--------cgtttccagaacagtgaatttt
B D            Naked mole-rat  -------------------------tgtgcctgaaataatgggtcat
B D                Guinea pig  ---atcctgcccaaaat--------tgtgcccaaaatgacggatcat
                   Chinchilla  ----------------c--------tgtgccaaaaatgacagatcac
               Domestic goat  ===============================================
B D                     Sheep  ===============================================
B D                       Cow  ===============================================
            Tibetan antelope  ===============================================
               Big brown bat  -----------------------------------------------
B D                  Microbat  ===============================================
        David's myotis (bat)  ===============================================
              Bactrian camel  ===============================================
B D                    Alpaca  ===============================================
B D                     Mouse  ===============================================
B D                     Panda  ===============================================
B D                       Dog  ===============================================
                Prairie vole  ===============================================
B D           Chinese hamster  ===============================================
              Golden hamster  ===============================================
                Killer whale  ===============================================
B D                   Ferret   ===============================================
B D                  Squirrel  ===============================================
B D                       Cat  ===============================================
              Pacific walrus  ===============================================
B D                   Manatee  ===============================================
B D                  Elephant  ===============================================
B D                 Armadillo  ===============================================
      Lesser Egyptian jerboa  ===============================================
            Brush-tailed rat  ===============================================
B D                     Horse  ===============================================
            Black flying-fox  ===============================================
B D          White rhinoceros  ===============================================
  D  Chinese softshell turtle  ===============================================
  D           Green seaturtle  ===============================================
  D            Painted turtle  ===============================================
B D           Tasmanian devil  ===============================================
B D                   Wallaby  ===============================================
B D                   Opossum  ===============================================
                    Aardvark  ===============================================
                Weddell seal  ===============================================
            Cape golden mole  ===============================================
B D                   Dolphin  ===============================================
B D       Crab-eating macaque  -----------------------------------------------
B D                    Rhesus  -----------------------------------------------
B D        American alligator  -----------------------------------------------

Alignment block 32 of 471 in window, 131781006 - 131781017, 12 bps 
B D                     Human  agatgtccacag--
B D                     Chimp  agatgtccacag--
B D                   Gorilla  agatgtccacag--
B D                 Orangutan  agatgtccacag--
B D                    Gibbon  agatgtccacag--
B D                    Baboon  agatgtccacag--
B D              Green monkey  agatgtccacag--
B D                  Marmoset  agctgtccacag--
B D           Squirrel monkey  atatggccccag--
B D                  Bushbaby  agacatccttag--
           Chinese tree shrew  agacagctacag--
B D                       Rat  agagacccttag--
B D            Naked mole-rat  aggagtcctcag--
B D                Guinea pig  aagagtcttcag--
                   Chinchilla  aggagtcctcag--
             Brush-tailed rat  agaaattcaggt--
             Cape golden mole  agacg--ctcagtt
               Domestic goat  ==============
B D                     Sheep  ==============
B D                       Cow  ==============
            Tibetan antelope  ==============
               Big brown bat  --------------
B D                  Microbat  ==============
        David's myotis (bat)  ==============
              Bactrian camel  ==============
B D                    Alpaca  ==============
B D                     Mouse  ==============
B D                     Panda  ==============
B D                       Dog  ==============
                Prairie vole  ==============
B D           Chinese hamster  ==============
              Golden hamster  ==============
                Killer whale  ==============
B D                   Ferret   ==============
B D                  Squirrel  ==============
B D                       Cat  ==============
              Pacific walrus  ==============
B D                   Manatee  ==============
B D                  Elephant  ==============
B D                 Armadillo  ==============
      Lesser Egyptian jerboa  ==============
B D                     Horse  ==============
            Black flying-fox  ==============
B D          White rhinoceros  ==============
  D  Chinese softshell turtle  ==============
  D           Green seaturtle  ==============
  D            Painted turtle  ==============
B D           Tasmanian devil  ==============
B D                   Wallaby  ==============
B D                   Opossum  ==============
                    Aardvark  ==============
                Weddell seal  ==============
B D                   Dolphin  ==============
B D       Crab-eating macaque  --------------
B D                    Rhesus  --------------
B D        American alligator  --------------

Inserts between block 32 and 33 in window
          Chinese tree shrew 3049bp

Alignment block 33 of 471 in window, 131781018 - 131781020, 3 bps 
B D                     Human  gct
B D                     Chimp  gct
B D                   Gorilla  gct
B D                 Orangutan  gct
B D                    Gibbon  gct
B D                    Baboon  gct
B D              Green monkey  gct
B D                  Marmoset  act
B D           Squirrel monkey  act
B D                  Bushbaby  gca
           Chinese tree shrew  gct
B D                       Rat  tct
B D            Naked mole-rat  gct
B D                Guinea pig  gct
                   Chinchilla  gct
             Brush-tailed rat  gcc
B D                  Elephant  gct
B D                   Manatee  gct
             Cape golden mole  gct
                     Aardvark  gct
               Domestic goat  ===
B D                     Sheep  ===
B D                       Cow  ===
            Tibetan antelope  ===
               Big brown bat  ---
B D                  Microbat  ===
        David's myotis (bat)  ===
              Bactrian camel  ===
B D                    Alpaca  ===
B D                     Mouse  ===
B D                     Panda  ===
B D                       Dog  ===
                Prairie vole  ===
B D           Chinese hamster  ===
              Golden hamster  ===
                Killer whale  ===
B D                   Ferret   ===
B D                  Squirrel  ===
B D                       Cat  ===
              Pacific walrus  ===
B D                 Armadillo  ===
      Lesser Egyptian jerboa  ===
B D                     Horse  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
  D            Painted turtle  ===
B D           Tasmanian devil  ===
B D                   Wallaby  ===
B D                   Opossum  ===
                Weddell seal  ===
B D                   Dolphin  ===
B D       Crab-eating macaque  ---
B D                    Rhesus  ---
B D        American alligator  ---

Inserts between block 33 and 34 in window
B D               Guinea pig 534bp

Alignment block 34 of 471 in window, 131781021 - 131781021, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                  Elephant  c
B D                   Manatee  c
             Cape golden mole  g
                     Aardvark  g
               Domestic goat  =
B D                     Sheep  =
B D                       Cow  =
            Tibetan antelope  =
               Big brown bat  -
B D                  Microbat  =
        David's myotis (bat)  =
              Bactrian camel  =
B D                    Alpaca  =
B D                     Mouse  =
B D                     Panda  =
B D                       Dog  =
                Prairie vole  =
B D           Chinese hamster  =
              Golden hamster  =
                Killer whale  =
B D                   Ferret   =
B D                  Squirrel  =
B D                       Cat  =
              Pacific walrus  =
B D                 Armadillo  =
      Lesser Egyptian jerboa  =
B D                     Horse  =
            Black flying-fox  =
B D          White rhinoceros  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                   Opossum  =
                Weddell seal  =
B D                   Dolphin  =
B D       Crab-eating macaque  -
B D                    Rhesus  -
B D        American alligator  -

Inserts between block 34 and 35 in window
B D                      Rat 931bp

Alignment block 35 of 471 in window, 131781022 - 131781022, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  g
               Domestic goat  =
B D                     Sheep  =
B D                       Cow  =
            Tibetan antelope  =
               Big brown bat  -
B D                  Microbat  =
        David's myotis (bat)  =
              Bactrian camel  =
B D                    Alpaca  =
B D                     Mouse  =
B D                     Panda  =
B D                       Dog  =
B D                       Rat  =
                Prairie vole  =
B D           Chinese hamster  =
              Golden hamster  =
                Killer whale  =
B D                   Ferret   =
B D                  Squirrel  =
B D                       Cat  =
              Pacific walrus  =
B D                 Armadillo  =
      Lesser Egyptian jerboa  =
B D                     Horse  =
            Black flying-fox  =
B D          White rhinoceros  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                   Opossum  =
                Weddell seal  =
B D                   Dolphin  =
B D       Crab-eating macaque  -
B D                    Rhesus  -
B D        American alligator  -

Inserts between block 35 and 36 in window
B D           Naked mole-rat 8447bp
                  Chinchilla 524bp

Alignment block 36 of 471 in window, 131781023 - 131781231, 209 bps 
B D                     Human  ggttaaaatccaagcggaatcactcaatgtcagaactactgacatttgg-gccgcattgttctgc----a
B D                     Chimp  ggttaaaatccaagcggaatcagtcaatgtcagaactactgacatttgg-gccgcattgttctgc----a
B D                   Gorilla  ggttaaaatccaagcagaatcagtcaatgtcagaactactgacatttcg-gccgcattgttctgc----a
B D                 Orangutan  ggttaaaatccaagtggaatcagccaatgtcagaactactgacatttgg-gccacattgttctgc----a
B D                    Gibbon  ggttaaaatccaagcagaatcagccagtgtcagaactactgacatttgt-gccgcattgctctgc----a
B D                    Baboon  ggttaaaatccaagcggaatcagccaatgtcagaactactgacatttgg-gctgcattgttctgc----a
B D              Green monkey  ggttaaaatccaagcagaatcagccaatgtcagaactactgacatttgg-gccgcattgttctgc----a
B D                  Marmoset  ggttaaaatccaagcggcctcagccagtgtcaga---gctgacgtttgg-gcctcattgctctgc----a
B D           Squirrel monkey  ggtgaaaatccaagcggactcagccagtgtcaga---actggcatttgg-gccacattgctctgc----a
B D                  Bushbaby  ggt-aaagtccaggccacctt-----------------------ttgga-gccgggtcatactg-----a
           Chinese tree shrew  agtcaacatccaaactgtctcagcc----tcacagctactgccatttggagttggatcatcctgg----g
B D                Guinea pig  ggatgaaattcaatctagttcagcc----tcagaattagtgacatgtgagatcagatca-----------
             Brush-tailed rat  ggagaaaatccagtctggctcagcc----tcagaattagagtcatgtggggccagaacac----------
B D                  Elephant  ggctgaaatccaggctttctcaacc----tcagaactattgacatttgggaccagaaaatgcttc----g
B D                   Manatee  ggttgaaatccaggctttctcaacc----tcagaactattgacagttgggacccgatcatgcttt----g
             Cape golden mole  ggttgaaatccaggccttctc-acc----tcagaactattgaccctgggggtcagaccaggctta----g
                     Aardvark  ggtcaaaattcaggttttctc-acc----ttagaatgattgagattgggagccaggttgggctttggggg
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ======================================================================
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                     Horse  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ======================================================================
B D       Crab-eating macaque  ----------------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------

                        Human  ctg-ggagag-------ctgccct-tacac-------tgttgagtg-----gcatccctggct-ccaccc
                        Chimp  ccg-ggagag-------ctgccct-tgcac-------tgttgagtg-----gcatccctggct-ccaccc
                      Gorilla  cag-ggagag-------ctgccct-tgcac-------tgttgagtg-----gcatccctggct-ccaccc
                    Orangutan  cca-ggagag-------ctgccct-cgcac-------tgttgagtg-----gcatcgctggct-ccaccc
                       Gibbon  ccg-ggagag-------ctgccct-tgcac-------tgttgagtg-----gcatccctggct-ccaccc
                       Baboon  ccg-ggagag-------ctgtcct-tgcac-------tgttgagtg-----gcatccctggct-gcatcc
                 Green monkey  ccg-ggagag-------ctgtcct-tgcac-------tgttgagtg-----gcatccctggct-gcatcc
                     Marmoset  ccg-tgagag-------ctgccct-tgcac-------cactgagca-----gcgtccctggct-ccaccc
              Squirrel monkey  ccg-tgagag-------ctgccct-taccc-------cgctgagca-----gcgtccctggct-ccgccc
                     Bushbaby  gtg-tgagagccatcccctacccc-tggga-------cacttatca-----gcaccccaacct-cc-ccc
           Chinese tree shrew  tggtggagac-------agacctc-tgcattataggatgtttagta-----gcacccctagcc-tctact
                   Guinea pig  ----ttggac-------cta-----tgctc-------tgtggaatgtttccacacctctgtcttccaccc
             Brush-tailed rat  ----ttgaag-------cca-------------------------------acatccctggctcccaccc
                     Elephant  tgg-taggga-------ctgtcctgtgcatcccagggtgttgagca-----acatccctgata-------
                      Manatee  tgg-tagggg-------ctgtcctgtgtgttctagggtattgagca-----atattcctggta-------
             Cape golden mole  tgg-taggga-------ctgtcctgtgtattcgagggtgctgagca-----gcatcccc-----------
                     Aardvark  ggg-gggggg-------ctggcctgtgcatcctaggggattgagta-----gcatccct-aca-------
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ======================================================================
                      Dolphin  ======================================================================
          Crab-eating macaque  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------

                        Human  accacatggcaggagcaccccccac-tagtaacagccaaaaccacccagaggcattgcccgatgtctccc
                        Chimp  accacatggcaggagcaccccccac-tactaatagccaaaaccacccagaggcattgcccgatgtctccc
                      Gorilla  accacatggcaggagcaccccccac-tagtaatagccaaaaccacccagaggcattgtccgatgtctccc
                    Orangutan  accacatggcaggagcacccccgac-tagtaacagccaaaaccacccagaggcattgcccgatgtctccc
                       Gibbon  accacatggcaggagcaccccctac-tagtaacagccaaaaccacccagaggcattgcccaatgtctccc
                       Baboon  accacatggccagagcaccctcgac-tagtaacagccaaaaccacccagaggca-tgcccgatgtctccc
                 Green monkey  accacatggccagagcacccccgac-tagtaacaaccaaaaccacccagaggca-tgcccgatgtctccc
                     Marmoset  accacacggcaggagtacctcccac-tcataccagccaaaagcacccagaggcattgcccggtgt-cccc
              Squirrel monkey  accacacggcagaagtacctcccac-ttgtaccagccaaaagcacccggaggcattgcccgatgtccccc
                     Bushbaby  tctaga-ggccagagcacttccctg-aggtaacagctg----tgtctagaggcactgccaaacat-ccca
           Chinese tree shrew  gctaggagccaagagcacctctcaa-ttatgacaaccaaaattgtctctagacattgccagatgtcccct
                   Guinea pig  actgaacacaaggaattcctcccaa-ttgtgacaagttaaagcatctccagacactatcacatgttccag
             Brush-tailed rat  actgaacaccagaaattccacccaa-ctgtgacaagcgaaagcatctctagacattaccacatattccct
                     Elephant  ----ggtgtcagtaacaccctccaagctgcaacaaccgagcatgtccccaggcattgcc-aatgtt----
                      Manatee  ----gatgccagtaacacccctgaagttgtgacaaccatacatgt-cccaggcattgcc-aatgtc----
             Cape golden mole  -----------------ccaccaaagtcctgataagaacacacggcctcaggaattgcc-aatgtccct-
                     Aardvark  ----gatgccagaaacaccccccaaattgtgataaccaaacatgtgcccaggcacatcc-tggggt----
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ======================================================================
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Horse  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ======================================================================
                      Dolphin  ======================================================================
          Crab-eating macaque  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------

                        Human  aggggcagaatc-----------gtgccactgaatt-gg
                        Chimp  aggggcagaatc-----------gtgccactgaatt-gg
                      Gorilla  aggggcagaatc-----------atgccactgaatt-gg
                    Orangutan  aggagcagaatc-----------gtgccactgaatt-gg
                       Gibbon  aggggcagaatt-----------gtgccactaaatt-gg
                       Baboon  aggggcagaatc-----------gtgccactgaatt-gg
                 Green monkey  agggtcagaatc-----------gtgccactgaatt-gg
                     Marmoset  aggggcagaatc-----------gtgccactgaatt-gg
              Squirrel monkey  aggggcagaatc-----------gtgtcactgaatt-gg
                     Bushbaby  aagggcagaacc---ccagctgaaaaccactgagttaag
           Chinese tree shrew  gggagatgaacc----aattaaagaaccactgagtt-ag
                   Guinea pig  ag-gtcagagtcaccctgactgagaact--agagtt-ag
             Brush-tailed rat  ggcagcatagcaaccctgtttgagaactacagagtt-aa
                     Elephant  ----------------------------cctggggg---
                      Manatee  -----------------------atccacttgagaa---
             Cape golden mole  -gggtcatagtc-----------attcggttgagaa---
                     Aardvark  -----catagtc-----------acccagcagagag---
                Domestic goat  =======================================
                        Sheep  =======================================
                          Cow  =======================================
             Tibetan antelope  =======================================
                Big brown bat  ---------------------------------------
                     Microbat  =======================================
         David's myotis (bat)  =======================================
               Bactrian camel  =======================================
                       Alpaca  =======================================
                        Mouse  =======================================
                        Panda  =======================================
                          Dog  =======================================
                          Rat  =======================================
                 Prairie vole  =======================================
              Chinese hamster  =======================================
               Golden hamster  =======================================
                 Killer whale  =======================================
                      Ferret   =======================================
                     Squirrel  =======================================
                          Cat  =======================================
               Pacific walrus  =======================================
               Naked mole-rat  =======================================
                   Chinchilla  =======================================
                    Armadillo  =======================================
       Lesser Egyptian jerboa  =======================================
                        Horse  =======================================
             Black flying-fox  =======================================
             White rhinoceros  =======================================
     Chinese softshell turtle  =======================================
              Green seaturtle  =======================================
               Painted turtle  =======================================
              Tasmanian devil  =======================================
                      Wallaby  =======================================
                      Opossum  =======================================
                 Weddell seal  =======================================
                      Dolphin  =======================================
          Crab-eating macaque  ---------------------------------------
                       Rhesus  ---------------------------------------
           American alligator  ---------------------------------------

Alignment block 37 of 471 in window, 131781232 - 131781258, 27 bps 
B D                     Human  a-----ctga---------------------gt--agatatcatgcatcagacat
B D                     Chimp  a-----ctga---------------------gt--agacatcatgcatcagacat
B D                   Gorilla  a-----ctga---------------------gt--agacatcatgcatcggacat
B D                 Orangutan  a-----ctga---------------------gt--agacatcatgcatcagacat
B D                    Gibbon  g-----ctga---------------------gt--agacatcatgcatcagacat
B D                    Baboon  a-----ctga---------------------gt--agacatcatacatcagacat
B D              Green monkey  a-----ttga---------------------gt--agacatcatacatcagacat
B D                  Marmoset  a-----ctca---------------------gc--agacatcatgcatgggacag
B D           Squirrel monkey  a-----ctca---------------------gc--agacatcatgcattggacag
B D                  Bushbaby  c-----ctca---------------------gc--aaagggcacacattggacgt
           Chinese tree shrew  a-----ctca---------------------gtgaagaca----ggactggctgg
B D                Guinea pig  g-----ctga---------------------gc--aaaga--------caggc-t
             Brush-tailed rat  a-----ctca---------------------gc--aaaga--------caggc-t
B D          White rhinoceros  a-----ctga---------------------gc--aaagc--------ctggcat
B D                  Elephant  cagtcactca---------------------------------------------
B D                   Manatee  c-----cccg---------------------------------------------
             Cape golden mole  t-----ccca---------------------------------------------
                     Aardvark  c-----cccagtaggctcatgccttggagag------------------------
               Domestic goat  =======================================================
B D                     Sheep  =======================================================
B D                       Cow  =======================================================
            Tibetan antelope  =======================================================
               Big brown bat  -------------------------------------------------------
B D                  Microbat  =======================================================
        David's myotis (bat)  =======================================================
              Bactrian camel  =======================================================
B D                    Alpaca  =======================================================
B D                     Mouse  =======================================================
B D                     Panda  =======================================================
B D                       Dog  =======================================================
B D                       Rat  =======================================================
                Prairie vole  =======================================================
B D           Chinese hamster  =======================================================
              Golden hamster  =======================================================
                Killer whale  =======================================================
B D                   Ferret   =======================================================
B D                  Squirrel  =======================================================
B D                       Cat  =======================================================
              Pacific walrus  =======================================================
B D            Naked mole-rat  =======================================================
                  Chinchilla  =======================================================
B D                 Armadillo  =======================================================
      Lesser Egyptian jerboa  =======================================================
B D                     Horse  =======================================================
            Black flying-fox  =======================================================
  D  Chinese softshell turtle  =======================================================