Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 73 in window, 99960466 - 99960470, 5 bps 
B D                     Human  c-ggag
B D                     Chimp  c-ggag
B D                   Gorilla  c-ggag
B D                 Orangutan  c-agag
B D                    Gibbon  c-ggag
B D                    Rhesus  c-ggag
B D       Crab-eating macaque  c-ggag
B D                    Baboon  cgggag
B D              Green monkey  c-ggag
B D                  Marmoset  t-ggag
B D           Squirrel monkey  -----g
B D                   Manatee  --gggg
                     Aardvark  --ggtg
              Golden hamster  ======
      Lesser Egyptian jerboa  ------
B D                       Rat  ======
                Prairie vole  ======
B D                     Mouse  ======
B D                      Pika  ======
B D                     Shrew  ======
B D                  Hedgehog  ======
B D                Guinea pig  ------
B D                    Rabbit  ------
B D                Coelacanth  ======
  D    Spiny softshell turtle  ======
            Cape golden mole  ======
B D                       Pig  ------
B D                   Megabat  ------
B D                   Dolphin  ------
                 Spotted gar  ======
B D               Stickleback  ======
      Yellowbelly pufferfish  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
B D                    Medaka  ======
  D            Painted turtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
                  Chinchilla  ------
B D            Naked mole-rat  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D                   Wallaby  ======
            Brush-tailed rat  ------
         Cape elephant shrew  ======
          Chinese tree shrew  ======
B D                  Platypus  ======
B D                  Elephant  ======
B D           Chinese hamster  ======
B D                    Tenrec  ------
  D           Green seaturtle  ======
B D                       Cat  ======
B D                  Bushbaby  NNNNNN
                Weddell seal  ------
  D  Chinese softshell turtle  ======
B D                   Ferret   ======
               Domestic goat  ------
B D                     Sheep  ------
            Tibetan antelope  ------
  D       Collared flycatcher  ======
             Star-nosed mole  ======
              Bactrian camel  ======
B D                    Alpaca  ======
               Big brown bat  ======
              Pacific walrus  ======
B D                     Panda  ------
B D                       Cow  ------
                Killer whale  ------
B D                       Dog  ======
            Black flying-fox  ======
B D          White rhinoceros  ======
B D                     Horse  ------
B D                  Squirrel  ------
        David's myotis (bat)  ======
B D                  Microbat  ======
B D                 Armadillo  ------

Inserts between block 1 and 2 in window
B D                  Manatee 1bp
                    Aardvark 3bp

Alignment block 2 of 73 in window, 99960471 - 99960503, 33 bps 
B D                     Human  tctc----actc-tgtcgcccaggctggaatgcagtgg
B D                     Chimp  tctc----actc-tgtcgcccaggctggaatgcagtgg
B D                   Gorilla  tctc----actcttgtcgcccaggctggaatgcagtgg
B D                 Orangutan  tctc----actc-tatcacccaggctggaatgcagtgg
B D                    Gibbon  tctc----actc-tgtcgcccaggctggaatgcagtgg
B D                    Rhesus  tctc----actc-tgtcgcccaggctggaatgcagtgg
B D       Crab-eating macaque  tctc----actc-tgtcgcccaggctggaatgcagtgg
B D                    Baboon  tctc----actc-tgtcacccaggctggaatgcagtgg
B D              Green monkey  tctc----actc-tgtcacccaggctggaatgcagtgg
B D                  Marmoset  tttttgagactc-tgttacccaggctggagtgcagtgg
B D           Squirrel monkey  tttttgagagtc-tgtcacccaggctggagtgcagtgg
B D                    Rabbit  ------------------tccgg-------tg----gg
B D                       Pig  ------------------------------tgcagtgg
             Tibetan antelope  ------------------------------tacagtgg
B D                       Cow  ------------------------------tacagtgg
B D                     Sheep  ------------------------------tacagtgg
B D                     Horse  ------------------------------------gg
                 Weddell seal  ------------------------------tatagtgg
B D                   Megabat  ------------------------------tacagtgg
              Star-nosed mole  -------------------------------gtgatgg
B D                   Manatee  ------------------------tctgacaagggtgg
B D                    Tenrec  ---------------------------------ggggg
B D                 Armadillo  --------------------------------cagtgg
              Golden hamster  ======================================
      Lesser Egyptian jerboa  --------------------------------------
B D                       Rat  ======================================
                Prairie vole  ======================================
B D                     Mouse  ======================================
B D                      Pika  ======================================
B D                     Shrew  ======================================
B D                  Hedgehog  ======================================
B D                Guinea pig  --------------------------------------
B D                Coelacanth  ======================================
  D    Spiny softshell turtle  ======================================
                    Aardvark  ======================================
            Cape golden mole  ======================================
B D                   Dolphin  --------------------------------------
                 Spotted gar  ======================================
B D               Stickleback  ======================================
      Yellowbelly pufferfish  ======================================
B D                    Turkey  ======================================
B D                   Chicken  ======================================
  D              Mallard duck  ======================================
          Tibetan ground jay  ======================================
B D               Zebra finch  ======================================
  D    White-throated sparrow  ======================================
B D           Tasmanian devil  ======================================
    Mexican tetra (cavefish)  ======================================
B D                 Zebrafish  ======================================
B D                    Medaka  ======================================
  D            Painted turtle  ======================================
B D        American alligator  ======================================
  D             Scarlet macaw  ======================================
B D                Budgerigar  ======================================
B D                   Opossum  ======================================
                  Chinchilla  --------------------------------------
B D            Naked mole-rat  ======================================
  D               Rock pigeon  ======================================
B D       Medium ground finch  ======================================
B D                    Lizard  ======================================
  D          Peregrine falcon  ======================================
  D              Saker falcon  ======================================
  D                    Parrot  ======================================
B D                   Wallaby  ======================================
            Brush-tailed rat  --------------------------------------
         Cape elephant shrew  ======================================
          Chinese tree shrew  ======================================
B D                  Platypus  ======================================
B D                  Elephant  ======================================
B D           Chinese hamster  ======================================
  D           Green seaturtle  ======================================
B D                       Cat  ======================================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================
B D                   Ferret   ======================================
               Domestic goat  --------------------------------------
  D       Collared flycatcher  ======================================
              Bactrian camel  ======================================
B D                    Alpaca  ======================================
               Big brown bat  ======================================
              Pacific walrus  ======================================
B D                     Panda  --------------------------------------
                Killer whale  --------------------------------------
B D                       Dog  ======================================
            Black flying-fox  ======================================
B D          White rhinoceros  ======================================
B D                  Squirrel  --------------------------------------
        David's myotis (bat)  ======================================
B D                  Microbat  ======================================

Inserts between block 2 and 3 in window
B D                      Pig 2bp
            Tibetan antelope 5bp
B D                      Cow 5bp
B D                    Sheep 5bp
B D                  Manatee 9bp
B D                   Tenrec 5bp

Alignment block 3 of 73 in window, 99960504 - 99960507, 4 bps 
B D                     Human  caca
B D                     Chimp  caca
B D                   Gorilla  caca
B D                 Orangutan  caca
B D                    Gibbon  caca
B D                    Rhesus  catg
B D       Crab-eating macaque  catg
B D                    Baboon  catg
B D              Green monkey  catg
B D                  Marmoset  catg
B D           Squirrel monkey  cacg
B D                Guinea pig  ---a
B D                    Rabbit  taaa
             Tibetan antelope  c---
B D                       Cow  cata
B D                     Sheep  cata
B D                     Horse  cact
              Star-nosed mole  caca
B D                   Manatee  taca
              Golden hamster  ====
      Lesser Egyptian jerboa  ----
B D                       Rat  ====
                Prairie vole  ====
B D                     Mouse  ====
B D                      Pika  ====
B D                     Shrew  ====
B D                  Hedgehog  ====
B D                Coelacanth  ====
  D    Spiny softshell turtle  ====
                    Aardvark  ====
            Cape golden mole  ====
B D                       Pig  ====
B D                   Megabat  ----
B D                   Dolphin  ----
                 Spotted gar  ====
B D               Stickleback  ====
      Yellowbelly pufferfish  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
  D            Painted turtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
                  Chinchilla  ----
B D            Naked mole-rat  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
B D                   Wallaby  ====
            Brush-tailed rat  ----
         Cape elephant shrew  ====
          Chinese tree shrew  ====
B D                  Platypus  ====
B D                  Elephant  ====
B D           Chinese hamster  ====
B D                    Tenrec  ====
  D           Green seaturtle  ====
B D                       Cat  ====
B D                  Bushbaby  NNNN
                Weddell seal  ----
  D  Chinese softshell turtle  ====
B D                   Ferret   ====
               Domestic goat  ----
  D       Collared flycatcher  ====
              Bactrian camel  ====
B D                    Alpaca  ====
               Big brown bat  ====
              Pacific walrus  ====
B D                     Panda  ----
                Killer whale  ----
B D                       Dog  ====
            Black flying-fox  ====
B D          White rhinoceros  ====
B D                  Squirrel  ----
        David's myotis (bat)  ====
B D                  Microbat  ====
B D                 Armadillo  ----

Alignment block 4 of 73 in window, 99960508 - 99960513, 6 bps 
B D                     Human  gtcttg
B D                     Chimp  gtcttg
B D                   Gorilla  gtcttg
B D                 Orangutan  gtcttg
B D                    Gibbon  gtcttg
B D                    Rhesus  gtcttg
B D       Crab-eating macaque  gtcttg
B D                    Baboon  gtcttg
B D              Green monkey  gtcttg
B D                  Marmoset  atctcg
B D           Squirrel monkey  atctcg
B D                Guinea pig  gtctaa
B D                    Rabbit  gacata
B D                       Cow  aacttg
B D                     Sheep  aacttg
B D                     Horse  gtctta
B D                    Tenrec  ggcttg
              Golden hamster  ======
      Lesser Egyptian jerboa  ------
B D                       Rat  ======
                Prairie vole  ======
B D                     Mouse  ======
B D                      Pika  ======
B D                     Shrew  ======
B D                  Hedgehog  ======
B D                Coelacanth  ======
  D    Spiny softshell turtle  ======
                    Aardvark  ======
            Cape golden mole  ======
B D                       Pig  ======
B D                   Megabat  ------
B D                   Dolphin  ------
                 Spotted gar  ======
B D               Stickleback  ======
      Yellowbelly pufferfish  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
B D                    Medaka  ======
  D            Painted turtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
                  Chinchilla  ------
B D            Naked mole-rat  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D                   Wallaby  ======
            Brush-tailed rat  ------
         Cape elephant shrew  ======
          Chinese tree shrew  ======
B D                  Platypus  ======
B D                   Manatee  ------
B D                  Elephant  ======
B D           Chinese hamster  ======
  D           Green seaturtle  ======
B D                       Cat  ======
B D                  Bushbaby  NNNNNN
                Weddell seal  ------
  D  Chinese softshell turtle  ======
B D                   Ferret   ======
               Domestic goat  ------
            Tibetan antelope  ------
  D       Collared flycatcher  ======
             Star-nosed mole  ------
              Bactrian camel  ======
B D                    Alpaca  ======
               Big brown bat  ======
              Pacific walrus  ======
B D                     Panda  ------
                Killer whale  ------
B D                       Dog  ======
            Black flying-fox  ======
B D          White rhinoceros  ======
B D                  Squirrel  ------
        David's myotis (bat)  ======
B D                  Microbat  ======
B D                 Armadillo  ------

Inserts between block 4 and 5 in window
B D               Guinea pig 1bp
B D                   Rabbit 4bp

Alignment block 5 of 73 in window, 99960514 - 99960514, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  t
B D           Squirrel monkey  t
                   Chinchilla  g
B D                    Rabbit  g
B D                       Cow  g
B D                     Sheep  g
B D                     Horse  g
B D                    Tenrec  g
              Golden hamster  =
      Lesser Egyptian jerboa  -
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
B D                      Pika  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                Guinea pig  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
                    Aardvark  =
            Cape golden mole  =
B D                       Pig  =
B D                   Megabat  -
B D                   Dolphin  -
                 Spotted gar  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
  D            Painted turtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                   Wallaby  =
            Brush-tailed rat  -
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Manatee  -
B D                  Elephant  =
B D           Chinese hamster  =
  D           Green seaturtle  =
B D                       Cat  =
B D                  Bushbaby  N
                Weddell seal  -
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  -
            Tibetan antelope  -
  D       Collared flycatcher  =
             Star-nosed mole  -
              Bactrian camel  =
B D                    Alpaca  =
               Big brown bat  =
              Pacific walrus  =
B D                     Panda  -
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                  Squirrel  -
        David's myotis (bat)  =
B D                  Microbat  =
B D                 Armadillo  -

Inserts between block 5 and 6 in window
B D                    Sheep 1bp
B D                    Horse 57bp

Alignment block 6 of 73 in window, 99960515 - 99960517, 3 bps 
B D                     Human  -ctc
B D                     Chimp  -ctc
B D                   Gorilla  -ctc
B D                 Orangutan  -ctc
B D                    Gibbon  -ctc
B D                    Rhesus  -ctc
B D       Crab-eating macaque  -ctc
B D                    Baboon  -ctc
B D              Green monkey  -ctc
B D                  Marmoset  -cta
B D           Squirrel monkey  -cta
                   Chinchilla  -ctc
B D                    Rabbit  -atc
B D                     Sheep  -cc-
B D                    Tenrec  acc-
              Golden hamster  ====
      Lesser Egyptian jerboa  ----
B D                       Rat  ====
                Prairie vole  ====
B D                     Mouse  ====
B D                      Pika  ====
B D                     Shrew  ====
B D                  Hedgehog  ====
B D                Guinea pig  ====
B D                Coelacanth  ====
  D    Spiny softshell turtle  ====
                    Aardvark  ====
            Cape golden mole  ====
B D                       Pig  ====
B D                   Megabat  ----
B D                   Dolphin  ----
                 Spotted gar  ====
B D               Stickleback  ====
      Yellowbelly pufferfish  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
  D            Painted turtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
B D            Naked mole-rat  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
B D                   Wallaby  ====
            Brush-tailed rat  ----
         Cape elephant shrew  ====
          Chinese tree shrew  ====
B D                  Platypus  ====
B D                   Manatee  ----
B D                  Elephant  ====
B D           Chinese hamster  ====
  D           Green seaturtle  ====
B D                       Cat  ====
B D                  Bushbaby  NNNN
                Weddell seal  ----
  D  Chinese softshell turtle  ====
B D                   Ferret   ====
               Domestic goat  ----
            Tibetan antelope  ----
  D       Collared flycatcher  ====
             Star-nosed mole  ----
              Bactrian camel  ====
B D                    Alpaca  ====
               Big brown bat  ====
              Pacific walrus  ====
B D                     Panda  ----
B D                       Cow  ----
                Killer whale  ----
B D                       Dog  ====
            Black flying-fox  ====
B D          White rhinoceros  ====
B D                     Horse  ====
B D                  Squirrel  ----
        David's myotis (bat)  ====
B D                  Microbat  ====
B D                 Armadillo  ----

Inserts between block 6 and 7 in window
B D                    Sheep 428bp

Alignment block 7 of 73 in window, 99960518 - 99960522, 5 bps 
B D                     Human  ---actgc
B D                     Chimp  ---actgc
B D                   Gorilla  ---actgc
B D                 Orangutan  ---actgc
B D                    Gibbon  ---actgc
B D                    Rhesus  ---actgc
B D       Crab-eating macaque  ---actgc
B D                    Baboon  ---actgc
B D              Green monkey  ---actgc
B D                  Marmoset  ---actgc
B D           Squirrel monkey  ---actgc
                   Chinchilla  ---accat
B D                    Rabbit  ---ccaac
B D                    Tenrec  tcaac---
              Golden hamster  ========
      Lesser Egyptian jerboa  --------
B D                       Rat  ========
                Prairie vole  ========
B D                     Mouse  ========
B D                      Pika  ========
B D                     Shrew  ========
B D                  Hedgehog  ========
B D                Guinea pig  ========
B D                Coelacanth  ========
  D    Spiny softshell turtle  ========
                    Aardvark  ========
            Cape golden mole  ========
B D                       Pig  ========
B D                   Megabat  --------
B D                   Dolphin  --------
                 Spotted gar  ========
B D               Stickleback  ========
      Yellowbelly pufferfish  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
  D    White-throated sparrow  ========
B D           Tasmanian devil  ========
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  ========
B D                    Medaka  ========
  D            Painted turtle  ========
B D        American alligator  ========
  D             Scarlet macaw  ========
B D                Budgerigar  ========
B D                   Opossum  ========
B D            Naked mole-rat  ========
  D               Rock pigeon  ========
B D       Medium ground finch  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D                    Parrot  ========
B D                   Wallaby  ========
            Brush-tailed rat  --------
         Cape elephant shrew  ========
          Chinese tree shrew  ========
B D                  Platypus  ========
B D                   Manatee  --------
B D                  Elephant  ========
B D           Chinese hamster  ========
  D           Green seaturtle  ========
B D                       Cat  ========
B D                  Bushbaby  NNNNNNNN
                Weddell seal  --------
  D  Chinese softshell turtle  ========
B D                   Ferret   ========
               Domestic goat  --------
B D                     Sheep  ========
            Tibetan antelope  --------
  D       Collared flycatcher  ========
             Star-nosed mole  --------
              Bactrian camel  ========
B D                    Alpaca  ========
               Big brown bat  ========
              Pacific walrus  ========
B D                     Panda  --------
B D                       Cow  --------
                Killer whale  --------
B D                       Dog  ========
            Black flying-fox  ========
B D          White rhinoceros  ========
B D                     Horse  ========
B D                  Squirrel  --------
        David's myotis (bat)  ========
B D                  Microbat  ========
B D                 Armadillo  --------

Alignment block 8 of 73 in window, 99960523 - 99960525, 3 bps 
B D                     Human  aac
B D                     Chimp  aac
B D                   Gorilla  aac
B D                 Orangutan  aac
B D                    Gibbon  aac
B D                    Rhesus  aac
B D       Crab-eating macaque  aac
B D                    Baboon  aac
B D              Green monkey  aac
B D                  Marmoset  aac
B D           Squirrel monkey  aac
B D                    Tenrec  aac
              Golden hamster  ===
      Lesser Egyptian jerboa  ---
B D                       Rat  ===
                Prairie vole  ===
B D                     Mouse  ===
B D                      Pika  ===
B D                     Shrew  ===
B D                  Hedgehog  ===
B D                Guinea pig  ===
B D                    Rabbit  ---
B D                Coelacanth  ===
  D    Spiny softshell turtle  ===
                    Aardvark  ===
            Cape golden mole  ===
B D                       Pig  ===
B D                   Megabat  ---
B D                   Dolphin  ---
                 Spotted gar  ===
B D               Stickleback  ===
      Yellowbelly pufferfish  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
  D            Painted turtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
                  Chinchilla  ---
B D            Naked mole-rat  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
B D                   Wallaby  ===
            Brush-tailed rat  ---
         Cape elephant shrew  ===
          Chinese tree shrew  ===
B D                  Platypus  ===
B D                   Manatee  ---
B D                  Elephant  ===
B D           Chinese hamster  ===
  D           Green seaturtle  ===
B D                       Cat  ===
B D                  Bushbaby  NNN
                Weddell seal  ---
  D  Chinese softshell turtle  ===
B D                   Ferret   ===
               Domestic goat  ---
B D                     Sheep  ===
            Tibetan antelope  ---
  D       Collared flycatcher  ===
             Star-nosed mole  ---
              Bactrian camel  ===
B D                    Alpaca  ===
               Big brown bat  ===
              Pacific walrus  ===
B D                     Panda  ---
B D                       Cow  ---
                Killer whale  ---
B D                       Dog  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D                  Squirrel  ---
        David's myotis (bat)  ===
B D                  Microbat  ===
B D                 Armadillo  ---

Inserts between block 8 and 9 in window
B D                   Tenrec 10bp

Alignment block 9 of 73 in window, 99960526 - 99960552, 27 bps 
B D                     Human  ctccgcctcccagattcaagcgatttg
B D                     Chimp  ctccgcctcccagattcaagcaatttg
B D                   Gorilla  ctccgccttccagattcaagcgatttg
B D                 Orangutan  ctctgcctcccagattcaagggatttg
B D                    Gibbon  ctccgcctcccagattcaagcaatttg
B D                    Rhesus  ctcggcctcctggattcaagtgatttg
B D       Crab-eating macaque  ctcggcctcctggattcaagtgatttg
B D                    Baboon  ctccgcctcctggattcaagtgatttg
B D              Green monkey  ctccgcctcctggattcaagtgatttg
B D                  Marmoset  ttccacctcccgggttcaagcaattct
B D           Squirrel monkey  tttcacctcccaggttcaagcaattct
B D                Guinea pig  --------------------------g
B D                       Pig  ---------------accataagtttg
             Tibetan antelope  ------------------ataaacttg
              Star-nosed mole  ----------------caggtgatttg
              Golden hamster  ===========================
      Lesser Egyptian jerboa  ---------------------------
B D                       Rat  ===========================
                Prairie vole  ===========================
B D                     Mouse  ===========================
B D                      Pika  ===========================
B D                     Shrew  ===========================
B D                  Hedgehog  ===========================
B D                    Rabbit  ---------------------------
B D                Coelacanth  ===========================
  D    Spiny softshell turtle  ===========================
                    Aardvark  ===========================
            Cape golden mole  ===========================
B D                   Megabat  ---------------------------
B D                   Dolphin  ---------------------------
                 Spotted gar  ===========================
B D               Stickleback  ===========================
      Yellowbelly pufferfish  ===========================
B D                    Turkey  ===========================
B D                   Chicken  ===========================
  D              Mallard duck  ===========================
          Tibetan ground jay  ===========================
B D               Zebra finch  ===========================
  D    White-throated sparrow  ===========================
B D           Tasmanian devil  ===========================
    Mexican tetra (cavefish)  ===========================
B D                 Zebrafish  ===========================
B D                    Medaka  ===========================
  D            Painted turtle  ===========================
B D        American alligator  ===========================
  D             Scarlet macaw  ===========================
B D                Budgerigar  ===========================
B D                   Opossum  ===========================
                  Chinchilla  ---------------------------
B D            Naked mole-rat  ===========================
  D               Rock pigeon  ===========================
B D       Medium ground finch  ===========================
B D                    Lizard  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ===========================
  D                    Parrot  ===========================
B D                   Wallaby  ===========================
            Brush-tailed rat  ---------------------------
         Cape elephant shrew  ===========================
          Chinese tree shrew  ===========================
B D                  Platypus  ===========================
B D                   Manatee  ---------------------------
B D                  Elephant  ===========================
B D           Chinese hamster  ===========================
B D                    Tenrec  ===========================
  D           Green seaturtle  ===========================
B D                       Cat  ===========================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ---------------------------
  D  Chinese softshell turtle  ===========================
B D                   Ferret   ===========================
               Domestic goat  ---------------------------
B D                     Sheep  ===========================
  D       Collared flycatcher  ===========================
              Bactrian camel  ===========================
B D                    Alpaca  ===========================
               Big brown bat  ===========================
              Pacific walrus  ===========================
B D                     Panda  ---------------------------
B D                       Cow  ---------------------------
                Killer whale  ---------------------------
B D                       Dog  ===========================
            Black flying-fox  ===========================
B D          White rhinoceros  ===========================
B D                     Horse  ===========================
B D                  Squirrel  ---------------------------
        David's myotis (bat)  ===========================
B D                  Microbat  ===========================
B D                 Armadillo  ---------------------------

Inserts between block 9 and 10 in window
B D                      Pig 9bp
            Tibetan antelope 3bp
             Star-nosed mole 93bp

Alignment block 10 of 73 in window, 99960553 - 99960573, 21 bps 
B D                     Human  cctccctcagcctcctgagta
B D                     Chimp  cctgcctcagcctcctgagta
B D                   Gorilla  cctgcctcagcctcctgagta
B D                 Orangutan  cctgcctcagcctcctgaata
B D                    Gibbon  tctatctcagcctcctgagta
B D                    Rhesus  cctgcctcagcctcctgagta
B D       Crab-eating macaque  cctgcctcagcctcctgagta
B D                    Baboon  cctgcctcagcctcctgagta
B D              Green monkey  cctgcctcaccctcctgagta
B D                  Marmoset  tctgcctcagtctcctgagta
B D           Squirrel monkey  cctgcctcagcctcctgagta
B D                Guinea pig  tcttcctta------------
B D                    Rabbit  --------aac----------
B D                       Pig  --------a------------
              Golden hamster  =====================
      Lesser Egyptian jerboa  ---------------------
B D                       Rat  =====================
                Prairie vole  =====================
B D                     Mouse  =====================
B D                      Pika  =====================
B D                     Shrew  =====================
B D                  Hedgehog  =====================
B D                Coelacanth  =====================
  D    Spiny softshell turtle  =====================
                    Aardvark  =====================
            Cape golden mole  =====================
B D                   Megabat  ---------------------
B D                   Dolphin  ---------------------
                 Spotted gar  =====================
B D               Stickleback  =====================
      Yellowbelly pufferfish  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
  D    White-throated sparrow  =====================
B D           Tasmanian devil  =====================
    Mexican tetra (cavefish)  =====================
B D                 Zebrafish  =====================
B D                    Medaka  =====================
  D            Painted turtle  =====================
B D        American alligator  =====================
  D             Scarlet macaw  =====================
B D                Budgerigar  =====================
B D                   Opossum  =====================
                  Chinchilla  ---------------------
B D            Naked mole-rat  =====================
  D               Rock pigeon  =====================
B D       Medium ground finch  =====================
B D                    Lizard  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D                    Parrot  =====================
B D                   Wallaby  =====================
            Brush-tailed rat  ---------------------
         Cape elephant shrew  =====================
          Chinese tree shrew  =====================
B D                  Platypus  =====================
B D                   Manatee  ---------------------
B D                  Elephant  =====================
B D           Chinese hamster  =====================
B D                    Tenrec  =====================
  D           Green seaturtle  =====================
B D                       Cat  =====================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ---------------------
  D  Chinese softshell turtle  =====================
B D                   Ferret   =====================
               Domestic goat  ---------------------
B D                     Sheep  =====================
            Tibetan antelope  =====================
  D       Collared flycatcher  =====================
             Star-nosed mole  =====================
              Bactrian camel  =====================
B D                    Alpaca  =====================
               Big brown bat  =====================
              Pacific walrus  =====================
B D                     Panda  ---------------------
B D                       Cow  ---------------------
                Killer whale  ---------------------
B D                       Dog  =====================
            Black flying-fox  =====================
B D          White rhinoceros  =====================
B D                     Horse  =====================
B D                  Squirrel  ---------------------
        David's myotis (bat)  =====================
B D                  Microbat  =====================
B D                 Armadillo  ---------------------

Alignment block 11 of 73 in window, 99960574 - 99960623, 50 bps 
B D                     Human  gctgggattacaggcacgtgccaccatgcccagctagtttttgtattttt
B D                     Chimp  gctgggattacaggcacgtgccaccatgcccagctagtttttgtattttt
B D                   Gorilla  gctgggattacaggcacgtgccaccatgcccagctagtttttgtattttt
B D                 Orangutan  gctgggattacaggcacatgccaccatgcccagctagtttttgtattttt
B D                    Gibbon  gctgggattacaggcacgtgccaccatccccagctagtttttgtattttt
B D                    Rhesus  gctgggattacaggcacatgccaccatgcccagctagtttttgtattttt
B D       Crab-eating macaque  gctgggattacaggcacatgccaccatgcccagctagtttttgtattttt
B D                    Baboon  gctgggattacaggcacatgccaccatgcccagctagtttttgtattttt
B D              Green monkey  gctgggattacaggcacatgccaccatgcccagctagtttttgtattttt
B D                  Marmoset  gctggggctacagatgtgcactaccatggctggctaatttttgcattctt
B D           Squirrel monkey  actgtggctacagatgtgtgccaccatgcctggctaatttttgcattttt
B D                    Rabbit  ---------------------------------tgaattttt--------
B D                      Pika  gctagg-ccacagccccgggcccaaattccagattaattcttattttttt
B D                       Pig  actgaaatttcaatca--------------------------atattgtt
             Tibetan antelope  --------ttca--------------------------------------
              Golden hamster  ==================================================
      Lesser Egyptian jerboa  --------------------------------------------------
B D                       Rat  ==================================================
                Prairie vole  ==================================================
B D                     Mouse  ==================================================
B D                     Shrew  ==================================================
B D                  Hedgehog  ==================================================
B D                Guinea pig  --------------------------------------------------
B D                Coelacanth  ==================================================
  D    Spiny softshell turtle  ==================================================
                    Aardvark  ==================================================
            Cape golden mole  ==================================================
B D                   Megabat  --------------------------------------------------
B D                   Dolphin  --------------------------------------------------
                 Spotted gar  ==================================================
B D               Stickleback  ==================================================
      Yellowbelly pufferfish  ==================================================
B D                    Turkey  ==================================================
B D                   Chicken  ==================================================
  D              Mallard duck  ==================================================
          Tibetan ground jay  ==================================================
B D               Zebra finch  ==================================================
  D    White-throated sparrow  ==================================================
B D           Tasmanian devil  ==================================================
    Mexican tetra (cavefish)  ==================================================
B D                 Zebrafish  ==================================================
B D                    Medaka  ==================================================
  D            Painted turtle  ==================================================
B D        American alligator  ==================================================
  D             Scarlet macaw  ==================================================
B D                Budgerigar  ==================================================
B D                   Opossum  ==================================================
                  Chinchilla  --------------------------------------------------
B D            Naked mole-rat  ==================================================
  D               Rock pigeon  ==================================================
B D       Medium ground finch  ==================================================
B D                    Lizard  ==================================================
  D          Peregrine falcon  ==================================================
  D              Saker falcon  ==================================================
  D                    Parrot  ==================================================
B D                   Wallaby  ==================================================
            Brush-tailed rat  --------------------------------------------------
         Cape elephant shrew  ==================================================
          Chinese tree shrew  ==================================================
B D                  Platypus  ==================================================
B D                   Manatee  --------------------------------------------------
B D                  Elephant  ==================================================
B D           Chinese hamster  ==================================================
B D                    Tenrec  ==================================================
  D           Green seaturtle  ==================================================
B D                       Cat  ==================================================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  --------------------------------------------------
  D  Chinese softshell turtle  ==================================================
B D                   Ferret   ==================================================
               Domestic goat  --------------------------------------------------
B D                     Sheep  ==================================================
  D       Collared flycatcher  ==================================================
             Star-nosed mole  ==================================================
              Bactrian camel  ==================================================
B D                    Alpaca  ==================================================
               Big brown bat  ==================================================
              Pacific walrus  ==================================================
B D                     Panda  --------------------------------------------------
B D                       Cow  --------------------------------------------------
                Killer whale  --------------------------------------------------
B D                       Dog  ==================================================
            Black flying-fox  ==================================================
B D          White rhinoceros  ==================================================
B D                     Horse  ==================================================
B D                  Squirrel  --------------------------------------------------
        David's myotis (bat)  ==================================================
B D                  Microbat  ==================================================
B D                 Armadillo  --------------------------------------------------

Inserts between block 11 and 12 in window
B D                     Pika 162bp

Alignment block 12 of 73 in window, 99960624 - 99960624, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                    Rabbit  a
B D                       Pig  a
              Golden hamster  =
      Lesser Egyptian jerboa  -
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
B D                      Pika  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                Guinea pig  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  -
B D                   Dolphin  -
                 Spotted gar  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
  D            Painted turtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
                  Chinchilla  -
B D            Naked mole-rat  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                   Wallaby  =
            Brush-tailed rat  -
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Manatee  -
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  =
  D           Green seaturtle  =
B D                       Cat  =
B D                  Bushbaby  N
                Weddell seal  -
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  -
B D                     Sheep  =
            Tibetan antelope  -
  D       Collared flycatcher  =
             Star-nosed mole  =
              Bactrian camel  =
B D                    Alpaca  =
               Big brown bat  =
              Pacific walrus  =
B D                     Panda  -
B D                       Cow  -
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  -
        David's myotis (bat)  =
B D                  Microbat  =
B D                 Armadillo  -

Alignment block 13 of 73 in window, 99960625 - 99960625, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
                 Weddell seal  g
B D                   Megabat  g
B D                 Armadillo  g
              Golden hamster  =
      Lesser Egyptian jerboa  -
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
B D                      Pika  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                Guinea pig  -
B D                    Rabbit  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
                    Aardvark  =
            Cape golden mole  =
B D                       Pig  -
B D                   Dolphin  -
                 Spotted gar  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
  D            Painted turtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
                  Chinchilla  -
B D            Naked mole-rat  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                   Wallaby  =
            Brush-tailed rat  -
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Manatee  -
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  =
  D           Green seaturtle  =
B D                       Cat  =
B D                  Bushbaby  N
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  -
B D                     Sheep  =
            Tibetan antelope  -
  D       Collared flycatcher  =
             Star-nosed mole  =
              Bactrian camel  =
B D                    Alpaca  =
               Big brown bat  =
              Pacific walrus  =
B D                     Panda  -
B D                       Cow  -
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  -
        David's myotis (bat)  =
B D                  Microbat  =

Alignment block 14 of 73 in window, 99960626 - 99960631, 6 bps 
B D                     Human  tgaaga
B D                     Chimp  tgaaga
B D                   Gorilla  tgaaga
B D                 Orangutan  tgaaga
B D                    Gibbon  tgaaga
B D                    Rhesus  taaaga
B D       Crab-eating macaque  taaaga
B D                    Baboon  taaaga
B D              Green monkey  taaaga
B D                  Marmoset  tagaga
B D           Squirrel monkey  tagaga
                 Weddell seal  tggaga
B D                   Megabat  tggag-
B D                   Manatee  tgaag-
B D                 Armadillo  tggag-
              Golden hamster  ======
      Lesser Egyptian jerboa  ------
B D                       Rat  ======
                Prairie vole  ======
B D                     Mouse  ======
B D                      Pika  ======
B D                     Shrew  ======
B D                  Hedgehog  ======
B D                Guinea pig  ------
B D                    Rabbit  ------
B D                Coelacanth  ======
  D    Spiny softshell turtle  ======
                    Aardvark  ======
            Cape golden mole  ======
B D                       Pig  ------
B D                   Dolphin  ------
                 Spotted gar  ======
B D               Stickleback  ======
      Yellowbelly pufferfish  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
B D                    Medaka  ======
  D            Painted turtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
                  Chinchilla  ------
B D            Naked mole-rat  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D                   Wallaby  ======
            Brush-tailed rat  ------
         Cape elephant shrew  ======
          Chinese tree shrew  ======
B D                  Platypus  ======
B D                  Elephant  ======
B D           Chinese hamster  ======
B D                    Tenrec  ======
  D           Green seaturtle  ======
B D                       Cat  ======
B D                  Bushbaby  NNNNNN
  D  Chinese softshell turtle  ======
B D                   Ferret   ======
               Domestic goat  ------
B D                     Sheep  ======
            Tibetan antelope  ------
  D       Collared flycatcher  ======
             Star-nosed mole  ======
              Bactrian camel  ======
B D                    Alpaca  ======
               Big brown bat  ======
              Pacific walrus  ======
B D                     Panda  ------
B D                       Cow  ------
                Killer whale  ------
B D                       Dog  ======
            Black flying-fox  ======
B D          White rhinoceros  ======
B D                     Horse  ======
B D                  Squirrel  ------
        David's myotis (bat)  ======
B D                  Microbat  ======

Alignment block 15 of 73 in window, 99960632 - 99960632, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  t
B D                  Marmoset  c
B D           Squirrel monkey  c
                 Weddell seal  t
              Golden hamster  =
      Lesser Egyptian jerboa  -
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
B D                      Pika  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                Guinea pig  -
B D                    Rabbit  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
                    Aardvark  =
            Cape golden mole  =
B D                       Pig  -
B D                   Megabat  -
B D                   Dolphin  -
                 Spotted gar  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
  D            Painted turtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
                  Chinchilla  -
B D            Naked mole-rat  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                   Wallaby  =
            Brush-tailed rat  -
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Manatee  -
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  =
  D           Green seaturtle  =
B D                       Cat  =
B D                  Bushbaby  N
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  -
B D                     Sheep  =
            Tibetan antelope  -
  D       Collared flycatcher  =
             Star-nosed mole  =
              Bactrian camel  =
B D                    Alpaca  =
               Big brown bat  =
              Pacific walrus  =
B D                     Panda  -
B D                       Cow  -
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  -
        David's myotis (bat)  =
B D                  Microbat  =
B D                 Armadillo  -

Alignment block 16 of 73 in window, 99960633 - 99960644, 12 bps 
B D                     Human  ggggtttcacca
B D                     Chimp  ggggtttcacca
B D                   Gorilla  ggggtttcacca
B D                 Orangutan  ggggtttcaccg
B D                    Gibbon  ggggtttcgcca
B D                    Rhesus  ggggtttcacca
B D       Crab-eating macaque  agggtttcacca
B D                    Baboon  ggggtttcacca
B D              Green monkey  gaggtttcacca
B D                  Marmoset  agggtttcacca
B D           Squirrel monkey  agggtttcacca
B D                Guinea pig  agggtt------
                   Chinchilla  tggggt------
             Tibetan antelope  ---gtttcacca
B D                       Cow  ---accacacca
               Pacific walrus  ggggtctgacaa
                 Weddell seal  ----------aa
              Golden hamster  ============
      Lesser Egyptian jerboa  ------------
B D                       Rat  ============
                Prairie vole  ============
B D                     Mouse  ============
B D                      Pika  ============
B D                     Shrew  ============
B D                  Hedgehog  ============
B D                    Rabbit  ------------
B D                Coelacanth  ============
  D    Spiny softshell turtle  ============
                    Aardvark  ============
            Cape golden mole  ============
B D                       Pig  ------------
B D                   Megabat  ------------
B D                   Dolphin  ------------
                 Spotted gar  ============
B D               Stickleback  ============
      Yellowbelly pufferfish  ============
B D                    Turkey  ============
B D                   Chicken  ============
  D              Mallard duck  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
  D    White-throated sparrow  ============
B D           Tasmanian devil  ============
    Mexican tetra (cavefish)  ============
B D                 Zebrafish  ============
B D                    Medaka  ============
  D            Painted turtle  ============
B D        American alligator  ============
  D             Scarlet macaw  ============
B D                Budgerigar  ============
B D                   Opossum  ============
B D            Naked mole-rat  ============
  D               Rock pigeon  ============
B D       Medium ground finch  ============
B D                    Lizard  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
  D                    Parrot  ============
B D                   Wallaby  ============
            Brush-tailed rat  ------------
         Cape elephant shrew  ============
          Chinese tree shrew  ============
B D                  Platypus  ============
B D                   Manatee  ------------
B D                  Elephant  ============
B D           Chinese hamster  ============
B D                    Tenrec  ============
  D           Green seaturtle  ============
B D                       Cat  ============
B D                  Bushbaby  NNNNNNNNNNNN
  D  Chinese softshell turtle  ============
B D                   Ferret   ============
               Domestic goat  ------------
B D                     Sheep  ============
  D       Collared flycatcher  ============
             Star-nosed mole  ============
              Bactrian camel  ============
B D                    Alpaca  ============
               Big brown bat  ============
B D                     Panda  ------------
                Killer whale  ------------
B D                       Dog  ============
            Black flying-fox  ============
B D          White rhinoceros  ============
B D                     Horse  ============
B D                  Squirrel  ------------
        David's myotis (bat)  ============
B D                  Microbat  ============
B D                 Armadillo  ------------

Inserts between block 16 and 17 in window
B D                      Cow 6bp

Alignment block 17 of 73 in window, 99960645 - 99960690, 46 bps 
B D                     Human  tgttggtcaggctggtctcaaactcctgacctcatgatccacccgc
B D                     Chimp  tgttggtcaggctggtctcaaactcctgacctcatgatccacccgc
B D                   Gorilla  tgttggtcaggctggtctcaaattcctgacctcatgatccacccat
B D                 Orangutan  tgttggtcaggctggtctcaaactcctgacctcatgatccatccgc
B D                    Gibbon  tgttggtcaggcttgtctcaaactcctgacctcatgatccacccgc
B D                    Rhesus  tgttggtctggctggtctcgaa---ctgacatcatgatccacctgc
B D       Crab-eating macaque  tgttggtctggctggtctcgaa---ctgacatcatgatccacctgc
B D                    Baboon  tgttggtctggctggtctcgaa---ctgacatcatgatccacctgc
B D              Green monkey  tgttggtctggctggtctcgaa---ctaacatcatgatccacctgc
B D                  Marmoset  tgttgttcaggctggtctcaaactcctgacctcatgatccctcagc
B D           Squirrel monkey  tgttggtcaggctggtctcaaactcctgacctcatgatccacctgc
               Pacific walrus  ---------ggttag-------------------------------
                 Weddell seal  ---------gtttgg-------------------------------
B D                   Manatee  ----------gctgctctc---------------------------
              Golden hamster  ==============================================
      Lesser Egyptian jerboa  ----------------------------------------------
B D                       Rat  ==============================================
                Prairie vole  ==============================================
B D                     Mouse  ==============================================
B D                      Pika  ==============================================
B D                     Shrew  ==============================================
B D                  Hedgehog  ==============================================
B D                Guinea pig  ----------------------------------------------
B D                    Rabbit  ----------------------------------------------
B D                Coelacanth  ==============================================
  D    Spiny softshell turtle  ==============================================
                    Aardvark  ==============================================
            Cape golden mole  ==============================================
B D                       Pig  ----------------------------------------------
B D                   Megabat  ----------------------------------------------
B D                   Dolphin  ----------------------------------------------
                 Spotted gar  ==============================================
B D               Stickleback  ==============================================
      Yellowbelly pufferfish  ==============================================
B D                    Turkey  ==============================================
B D                   Chicken  ==============================================
  D              Mallard duck  ==============================================
          Tibetan ground jay  ==============================================
B D               Zebra finch  ==============================================
  D    White-throated sparrow  ==============================================
B D           Tasmanian devil  ==============================================
    Mexican tetra (cavefish)  ==============================================
B D                 Zebrafish  ==============================================
B D                    Medaka  ==============================================
  D            Painted turtle  ==============================================
B D        American alligator  ==============================================
  D             Scarlet macaw  ==============================================
B D                Budgerigar  ==============================================
B D                   Opossum  ==============================================
                  Chinchilla  ----------------------------------------------
B D            Naked mole-rat  ==============================================
  D               Rock pigeon  ==============================================
B D       Medium ground finch  ==============================================
B D                    Lizard  ==============================================
  D          Peregrine falcon  ==============================================
  D              Saker falcon  ==============================================
  D                    Parrot  ==============================================
B D                   Wallaby  ==============================================
            Brush-tailed rat  ----------------------------------------------
         Cape elephant shrew  ==============================================
          Chinese tree shrew  ==============================================
B D                  Platypus  ==============================================
B D                  Elephant  ==============================================
B D           Chinese hamster  ==============================================
B D                    Tenrec  ==============================================
  D           Green seaturtle  ==============================================
B D                       Cat  ==============================================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ==============================================
B D                   Ferret   ==============================================
               Domestic goat  ----------------------------------------------
B D                     Sheep  ==============================================
            Tibetan antelope  ----------------------------------------------
  D       Collared flycatcher  ==============================================
             Star-nosed mole  ==============================================
              Bactrian camel  ==============================================
B D                    Alpaca  ==============================================
               Big brown bat  ==============================================
B D                     Panda  ----------------------------------------------
B D                       Cow  ==============================================
                Killer whale  ----------------------------------------------
B D                       Dog  ==============================================
            Black flying-fox  ==============================================
B D          White rhinoceros  ==============================================
B D                     Horse  ==============================================
B D                  Squirrel  ----------------------------------------------
        David's myotis (bat)  ==============================================
B D                  Microbat  ==============================================
B D                 Armadillo  ----------------------------------------------

Inserts between block 17 and 18 in window
B D                  Manatee 3bp

Alignment block 18 of 73 in window, 99960691 - 99960693, 3 bps 
B D                     Human  ctc
B D                     Chimp  ctc
B D                   Gorilla  ctc
B D                 Orangutan  ctc
B D                    Gibbon  ctc
B D                    Rhesus  ctc
B D       Crab-eating macaque  ctc
B D                    Baboon  ctc
B D              Green monkey  ctc
B D                  Marmoset  ctc
B D           Squirrel monkey  ctc
B D          White rhinoceros  ctc
              Golden hamster  ===
      Lesser Egyptian jerboa  ---
B D                       Rat  ===
                Prairie vole  ===
B D                     Mouse  ===
B D                      Pika  ===
B D                     Shrew  ===
B D                  Hedgehog  ===
B D                Guinea pig  ---
B D                    Rabbit  ---
B D                Coelacanth  ===
  D    Spiny softshell turtle  ===
                    Aardvark  ===
            Cape golden mole  ===
B D                       Pig  ---
B D                   Megabat  ---
B D                   Dolphin  ---
                 Spotted gar  ===
B D               Stickleback  ===
      Yellowbelly pufferfish  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
  D            Painted turtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
                  Chinchilla  ---
B D            Naked mole-rat  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
B D                   Wallaby  ===
            Brush-tailed rat  ---
         Cape elephant shrew  ===
          Chinese tree shrew  ===
B D                  Platypus  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D           Chinese hamster  ===
B D                    Tenrec  ===
  D           Green seaturtle  ===
B D                       Cat  ===
B D                  Bushbaby  NNN
                Weddell seal  ---
  D  Chinese softshell turtle  ===
B D                   Ferret   ===
               Domestic goat  ---
B D                     Sheep  ===
            Tibetan antelope  ---
  D       Collared flycatcher  ===
             Star-nosed mole  ===
              Bactrian camel  ===
B D                    Alpaca  ===
               Big brown bat  ===
              Pacific walrus  ---
B D                     Panda  ---
B D                       Cow  ===
                Killer whale  ---
B D                       Dog  ===
            Black flying-fox  ===
B D                     Horse  ===
B D                  Squirrel  ---
        David's myotis (bat)  ===
B D                  Microbat  ===
B D                 Armadillo  ---

Alignment block 19 of 73 in window, 99960694 - 99960694, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                       Rat  a
B D            Naked mole-rat  a
              Golden hamster  =
      Lesser Egyptian jerboa  -
                Prairie vole  =
B D                     Mouse  =
B D                      Pika  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                Guinea pig  -
B D                    Rabbit  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
                    Aardvark  =
            Cape golden mole  =
B D                       Pig  -
B D                   Megabat  -
B D                   Dolphin  -
                 Spotted gar  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
  D            Painted turtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
                  Chinchilla  -
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                   Wallaby  =
            Brush-tailed rat  -
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Manatee  =
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  =
  D           Green seaturtle  =
B D                       Cat  =
B D                  Bushbaby  N
                Weddell seal  -
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  -
B D                     Sheep  =
            Tibetan antelope  -
  D       Collared flycatcher  =
             Star-nosed mole  =
              Bactrian camel  =
B D                    Alpaca  =
               Big brown bat  =
              Pacific walrus  -
B D                     Panda  -
B D                       Cow  =
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  -
B D                     Horse  =
B D                  Squirrel  -
        David's myotis (bat)  =
B D                  Microbat  =
B D                 Armadillo  -

Alignment block 20 of 73 in window, 99960695 - 99960696, 2 bps 
B D                     Human  gc
B D                     Chimp  gc
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gc
B D              Green monkey  gc
B D                  Marmoset  gc
B D           Squirrel monkey  gc
B D                     Mouse  gt
B D                       Rat  gt
B D            Naked mole-rat  gt
              Golden hamster  ==
      Lesser Egyptian jerboa  --
                Prairie vole  ==
B D                      Pika  ==
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                Guinea pig  --
B D                    Rabbit  --
B D                Coelacanth  ==
  D    Spiny softshell turtle  ==
                    Aardvark  ==
            Cape golden mole  ==
B D                       Pig  --
B D                   Megabat  --
B D                   Dolphin  --
                 Spotted gar  ==
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
  D            Painted turtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
                  Chinchilla  --
  D               Rock pigeon  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                   Wallaby  ==
            Brush-tailed rat  --
         Cape elephant shrew  ==
          Chinese tree shrew  ==
B D                  Platypus  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D           Chinese hamster  ==
B D                    Tenrec  ==
  D           Green seaturtle  ==
B D                       Cat  ==
B D                  Bushbaby  NN
                Weddell seal  --
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
               Domestic goat  --
B D                     Sheep  ==
            Tibetan antelope  --
  D       Collared flycatcher  ==
             Star-nosed mole  ==
              Bactrian camel  ==
B D                    Alpaca  ==
               Big brown bat  ==
              Pacific walrus  --
B D                     Panda  --
B D                       Cow  ==
                Killer whale  --
B D                       Dog  ==
            Black flying-fox  ==
B D          White rhinoceros  --
B D                     Horse  ==
B D                  Squirrel  --
        David's myotis (bat)  ==
B D                  Microbat  ==
B D                 Armadillo  --

Alignment block 21 of 73 in window, 99960697 - 99960702, 6 bps 
B D                     Human  ctccca
B D                     Chimp  ctccca
B D                   Gorilla  ctccca
B D                 Orangutan  ctccta
B D                    Gibbon  ctccca
B D                    Rhesus  ctcgca
B D       Crab-eating macaque  ctcgca
B D                    Baboon  ctcgca
B D              Green monkey  ctcgca
B D                  Marmoset  ctccca
B D           Squirrel monkey  ctccca
B D                     Mouse  ctgaca
B D                       Rat  ctgaca
B D            Naked mole-rat  ctgaca
B D                Guinea pig  ctgcaa
                   Chinchilla  ctgaca
B D                       Cow  -----a
B D                   Ferret   -----g
          Cape elephant shrew  ctccaa
B D                   Manatee  cttcaa
              Golden hamster  ======
      Lesser Egyptian jerboa  ------
                Prairie vole  ======
B D                      Pika  ======
B D                     Shrew  ======
B D                  Hedgehog  ======
B D                    Rabbit  ------
B D                Coelacanth  ======
  D    Spiny softshell turtle  ======
                    Aardvark  ======
            Cape golden mole  ======
B D                       Pig  ------
B D                   Megabat  ------
B D                   Dolphin  ------
                 Spotted gar  ======
B D               Stickleback  ======
      Yellowbelly pufferfish  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
B D                    Medaka  ======
  D            Painted turtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D                   Wallaby  ======
            Brush-tailed rat  ------
          Chinese tree shrew  ======
B D                  Platypus  ======
B D                  Elephant  ======
B D           Chinese hamster  ======
B D                    Tenrec  ======
  D           Green seaturtle  ======
B D                       Cat  ======
B D                  Bushbaby  NNNNNN
                Weddell seal  ------
  D  Chinese softshell turtle  ======
               Domestic goat  ------
B D                     Sheep  ======
            Tibetan antelope  ------
  D       Collared flycatcher  ======
             Star-nosed mole  ======
              Bactrian camel  ======
B D                    Alpaca  ======
               Big brown bat  ======
              Pacific walrus  ------
B D                     Panda  ------
                Killer whale  ------
B D                       Dog  ======
            Black flying-fox  ======
B D          White rhinoceros  ------
B D                     Horse  ======
B D                  Squirrel  ------
        David's myotis (bat)  ======
B D                  Microbat  ======
B D                 Armadillo  ------

Alignment block 22 of 73 in window, 99960703 - 99960714, 12 bps 
B D                     Human  aagttct---gggat
B D                     Chimp  aagttct---gggat
B D                   Gorilla  aagttct---gggat
B D                 Orangutan  aagttct---gggat
B D                    Gibbon  aagttct---gggat
B D                    Rhesus  aagtgct---gggat
B D       Crab-eating macaque  aagtgct---gggat
B D                    Baboon  aagtgct---gggat
B D              Green monkey  aagtgct---gggat
B D                  Marmoset  aaatgct---gggaa
B D           Squirrel monkey  aagtgct---gggaa
                 Prairie vole  aagttgc---a----
B D                     Mouse  aagttgt---t----
B D                       Rat  aagtttt---t----
B D            Naked mole-rat  aggttga---a----
B D                Guinea pig  taggcgg---a----
                   Chinchilla  aagttga---a----
B D                       Cow  aatttca---agaat
B D          White rhinoceros  tgccttc---aggag
B D                   Ferret   gaccccc---aaaac
               Pacific walrus  ---ctat---agaaa
          Cape elephant shrew  aaactgaaat-----
B D                   Manatee  caattgt--------
              Golden hamster  ===============
      Lesser Egyptian jerboa  ---------------
B D                      Pika  ===============
B D                     Shrew  ===============
B D                  Hedgehog  ===============
B D                    Rabbit  ---------------
B D                Coelacanth  ===============
  D    Spiny softshell turtle  ===============
                    Aardvark  ===============
            Cape golden mole  ===============
B D                       Pig  ---------------
B D                   Megabat  ---------------
B D                   Dolphin  ---------------
                 Spotted gar  ===============
B D               Stickleback  ===============
      Yellowbelly pufferfish  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
          Tibetan ground jay  ===============
B D               Zebra finch  ===============
  D    White-throated sparrow  ===============
B D           Tasmanian devil  ===============
    Mexican tetra (cavefish)  ===============
B D                 Zebrafish  ===============
B D                    Medaka  ===============
  D            Painted turtle  ===============
B D        American alligator  ===============
  D             Scarlet macaw  ===============
B D                Budgerigar  ===============
B D                   Opossum  ===============
  D               Rock pigeon  ===============
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
  D                    Parrot  ===============
B D                   Wallaby  ===============
            Brush-tailed rat  ---------------
          Chinese tree shrew  ===============
B D                  Platypus  ===============
B D                  Elephant  ===============
B D           Chinese hamster  ===============
B D                    Tenrec  ===============
  D           Green seaturtle  ===============
B D                       Cat  ===============
B D                  Bushbaby  NNNNNNNNNNNNNNN
                Weddell seal  ---------------
  D  Chinese softshell turtle  ===============
               Domestic goat  ---------------
B D                     Sheep  ===============
            Tibetan antelope  ---------------
  D       Collared flycatcher  ===============
             Star-nosed mole  ===============
              Bactrian camel  ===============
B D                    Alpaca  ===============
               Big brown bat  ===============
B D                     Panda  ---------------
                Killer whale  ---------------
B D                       Dog  ===============
            Black flying-fox  ===============
B D                     Horse  ===============
B D                  Squirrel  ---------------
        David's myotis (bat)  ===============
B D                  Microbat  ===============
B D                 Armadillo  ---------------

Alignment block 23 of 73 in window, 99960715 - 99960715, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
                 Prairie vole  c
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
          Cape elephant shrew  t
      Lesser Egyptian jerboa  -
B D                      Pika  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                    Rabbit  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
                    Aardvark  =
            Cape golden mole  =
B D                       Pig  -
B D                   Megabat  -
B D                   Dolphin  -
                 Spotted gar  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
  D            Painted turtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                   Wallaby  =
            Brush-tailed rat  -
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Manatee  -
B D                  Elephant  =
B D                    Tenrec  =
  D           Green seaturtle  =
B D                       Cat  =
B D                  Bushbaby  N
                Weddell seal  -
  D  Chinese softshell turtle  =
B D                   Ferret   -
               Domestic goat  -
B D                     Sheep  =
            Tibetan antelope  -
  D       Collared flycatcher  =
             Star-nosed mole  =
              Bactrian camel  =
B D                    Alpaca  =
               Big brown bat  =
              Pacific walrus  -
B D                     Panda  -
B D                       Cow  -
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  -
B D                     Horse  =
B D                  Squirrel  -
        David's myotis (bat)  =
B D                  Microbat  =
B D                 Armadillo  -

Alignment block 24 of 73 in window, 99960716 - 99960733, 18 bps 
B D                     Human  acaggcatgagcca---ccac
B D                     Chimp  acaggcatgagcca---gcac
B D                   Gorilla  acaggcatgagcca---ccac
B D                 Orangutan  acaggcatgagcca---ccgc
B D                    Gibbon  acaggcatgagtca---ccac
B D                    Rhesus  acaggtgtgagtca---ccac
B D       Crab-eating macaque  acaggtgtgagtca---ccac
B D                    Baboon  acaggtgtgagtca---ccac
B D              Green monkey  acaggtgtgagtca---ccac
B D                  Marmoset  acaggtgttagcca---tcat
B D           Squirrel monkey  acaggtgtgagcca---tcat
                 Prairie vole  atagacataaatcaagtcta-
B D           Chinese hamster  acaggcataaatcaaatcta-
               Golden hamster  acaggcataattcaagtcca-
B D                     Mouse  atagatataaataaagtcca-
B D                       Rat  atagacataaataaagtcca-
B D            Naked mole-rat  atagaaat-aatgaagtcta-
B D                Guinea pig  ccaga----------------
                   Chinchilla  atagaaataaatgaagtctg-
B D                       Cow  --------------------t
B D          White rhinoceros  --------------------t
B D                   Ferret   --------------------t
               Pacific walrus  --------------------t
          Cape elephant shrew  gtaagcatg------------
                     Aardvark  ataggcgtgggcct---cca-
B D                 Armadillo  atagacttgaaccc---cca-
      Lesser Egyptian jerboa  ---------------------
B D                      Pika  =====================
B D                     Shrew  =====================
B D                  Hedgehog  =====================
B D                    Rabbit  ---------------------
B D                Coelacanth  =====================
  D    Spiny softshell turtle  =====================
            Cape golden mole  =====================
B D                       Pig  ---------------------
B D                   Megabat  ---------------------
B D                   Dolphin  ---------------------
                 Spotted gar  =====================
B D               Stickleback  =====================
      Yellowbelly pufferfish  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
  D    White-throated sparrow  =====================
B D           Tasmanian devil  =====================
    Mexican tetra (cavefish)  =====================
B D                 Zebrafish  =====================
B D                    Medaka  =====================
  D            Painted turtle  =====================
B D        American alligator  =====================
  D             Scarlet macaw  =====================
B D                Budgerigar  =====================
B D                   Opossum  =====================
  D               Rock pigeon  =====================
B D       Medium ground finch  =====================
B D                    Lizard  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D                    Parrot  =====================
B D                   Wallaby  =====================
            Brush-tailed rat  ---------------------
          Chinese tree shrew  =====================
B D                  Platypus  =====================
B D                   Manatee  ---------------------
B D                  Elephant  =====================
B D                    Tenrec  =====================
  D           Green seaturtle  =====================
B D                       Cat  =====================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ---------------------
  D  Chinese softshell turtle  =====================
               Domestic goat  ---------------------
B D                     Sheep  =====================
            Tibetan antelope  ---------------------
  D       Collared flycatcher  =====================
             Star-nosed mole  =====================
              Bactrian camel  =====================
B D                    Alpaca  =====================
               Big brown bat  =====================
B D                     Panda  ---------------------
                Killer whale  ---------------------
B D                       Dog  =====================
            Black flying-fox  =====================
B D                     Horse  =====================
B D                  Squirrel  ---------------------
        David's myotis (bat)  =====================
B D                  Microbat  =====================

Inserts between block 24 and 25 in window
B D         White rhinoceros 1bp
B D                  Ferret  3bp
              Pacific walrus 6bp

Alignment block 25 of 73 in window, 99960734 - 99960735, 2 bps 
B D                     Human  gc
B D                     Chimp  gc
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gc
B D              Green monkey  gc
B D                  Marmoset  gc
B D           Squirrel monkey  gc
               Bactrian camel  gc
               Pacific walrus  gg
              Golden hamster  --
      Lesser Egyptian jerboa  --
B D                       Rat  --
                Prairie vole  --
B D                     Mouse  --
B D                      Pika  ==
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                Guinea pig  --
B D                    Rabbit  --
B D                Coelacanth  ==
  D    Spiny softshell turtle  ==
                    Aardvark  --
            Cape golden mole  ==
B D                       Pig  --
B D                   Megabat  --
B D                   Dolphin  --
                 Spotted gar  ==
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
  D            Painted turtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
                  Chinchilla  --
B D            Naked mole-rat  --
  D               Rock pigeon  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                   Wallaby  ==
            Brush-tailed rat  --
         Cape elephant shrew  --
          Chinese tree shrew  ==
B D                  Platypus  ==
B D                   Manatee  --
B D                  Elephant  ==
B D           Chinese hamster  --
B D                    Tenrec  ==
  D           Green seaturtle  ==
B D                       Cat  ==
B D                  Bushbaby  NN
                Weddell seal  --
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
               Domestic goat  --
B D                     Sheep  ==
            Tibetan antelope  --
  D       Collared flycatcher  ==
             Star-nosed mole  ==
B D                    Alpaca  ==
               Big brown bat  ==
B D                     Panda  --
B D                       Cow  --
                Killer whale  --
B D                       Dog  ==
            Black flying-fox  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Squirrel  --
        David's myotis (bat)  ==
B D                  Microbat  ==
B D                 Armadillo  --

Alignment block 26 of 73 in window, 99960736 - 99960737, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  cc
B D           Squirrel monkey  ct
                 Prairie vole  ct
B D           Chinese hamster  at
               Golden hamster  ct
B D                     Mouse  ct
B D                       Rat  ct
B D            Naked mole-rat  ct
                   Chinchilla  ct
B D                      Pika  ct
               Bactrian camel  tc
               Pacific walrus  cc
      Lesser Egyptian jerboa  --
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                Guinea pig  --
B D                    Rabbit  --
B D                Coelacanth  ==
  D    Spiny softshell turtle  ==
                    Aardvark  --
            Cape golden mole  ==
B D                       Pig  --
B D                   Megabat  --
B D                   Dolphin  --
                 Spotted gar  ==
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
  D            Painted turtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                   Wallaby  ==
            Brush-tailed rat  --
         Cape elephant shrew  --
          Chinese tree shrew  ==
B D                  Platypus  ==
B D                   Manatee  --
B D                  Elephant  ==
B D                    Tenrec  ==
  D           Green seaturtle  ==
B D                       Cat  ==
B D                  Bushbaby  NN
                Weddell seal  --
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
               Domestic goat  --
B D                     Sheep  ==
            Tibetan antelope  --
  D       Collared flycatcher  ==
             Star-nosed mole  ==
B D                    Alpaca  ==
               Big brown bat  ==
B D                     Panda  --
B D                       Cow  --
                Killer whale  --
B D                       Dog  ==
            Black flying-fox  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Squirrel  --
        David's myotis (bat)  ==
B D                  Microbat  ==
B D                 Armadillo  --

Alignment block 27 of 73 in window, 99960738 - 99960739, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  cg
B D       Crab-eating macaque  cg
B D                    Baboon  ca
B D              Green monkey  cg
B D                  Marmoset  cg
B D           Squirrel monkey  gg
           Chinese tree shrew  tt
                 Prairie vole  tt
B D           Chinese hamster  tg
               Golden hamster  tg
B D                     Mouse  tt
B D                       Rat  tt
B D            Naked mole-rat  ct
                   Chinchilla  ct
B D                      Pika  gt
               Bactrian camel  -t
               Pacific walrus  -t
      Lesser Egyptian jerboa  --
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                Guinea pig  --
B D                    Rabbit  --
B D                Coelacanth  ==
  D    Spiny softshell turtle  ==
                    Aardvark  --
            Cape golden mole  ==
B D                       Pig  --
B D                   Megabat  --
B D                   Dolphin  --
                 Spotted gar  ==
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
  D            Painted turtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                   Wallaby  ==
            Brush-tailed rat  --
         Cape elephant shrew  --
B D                  Platypus  ==
B D                   Manatee  --
B D                  Elephant  ==
B D                    Tenrec  ==
  D           Green seaturtle  ==
B D                       Cat  ==
B D                  Bushbaby  NN
                Weddell seal  --
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
               Domestic goat  --
B D                     Sheep  ==
            Tibetan antelope  --
  D       Collared flycatcher  ==
             Star-nosed mole  ==
B D                    Alpaca  ==
               Big brown bat  ==
B D                     Panda  --
B D                       Cow  --
                Killer whale  --
B D                       Dog  ==
            Black flying-fox  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Squirrel  --
        David's myotis (bat)  ==
B D                  Microbat  ==
B D                 Armadillo  --

Inserts between block 27 and 28 in window
              Pacific walrus 5bp

Alignment block 28 of 73 in window, 99960740 - 99960740, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
           Chinese tree shrew  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
                   Chinchilla  c
B D                      Pika  a
               Bactrian camel  c
B D                     Horse  c
B D                       Cat  c
               Pacific walrus  c
             Cape golden mole  c
      Lesser Egyptian jerboa  -
B D                     Shrew  =
B D                  Hedgehog  =
B D                Guinea pig  -
B D                    Rabbit  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
                    Aardvark  -
B D                       Pig  -
B D                   Megabat  -
B D                   Dolphin  -
                 Spotted gar  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
  D            Painted turtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                   Wallaby  =
            Brush-tailed rat  -
         Cape elephant shrew  -
B D                  Platypus  =
B D                   Manatee  -
B D                  Elephant  =
B D                    Tenrec  =
  D           Green seaturtle  =
B D                  Bushbaby  N
                Weddell seal  -
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  -
B D                     Sheep  =
            Tibetan antelope  -
  D       Collared flycatcher  =
             Star-nosed mole  =
B D                    Alpaca  =
               Big brown bat  =
B D                     Panda  -
B D                       Cow  -
                Killer whale  -
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                  Squirrel  -
        David's myotis (bat)  =
B D                  Microbat  =
B D                 Armadillo  -

Alignment block 29 of 73 in window, 99960741 - 99960751, 11 bps 
B D                     Human  tgcctttgagc
B D                     Chimp  cgcctttgagc
B D                   Gorilla  cgcctttgagc
B D                 Orangutan  cgcctttgagc
B D                    Gibbon  cgcctttgagc
B D                    Rhesus  ctcctttgagc
B D       Crab-eating macaque  ctcctttgagc
B D                    Baboon  ctcctttgagc
B D              Green monkey  ctcctttgagc
B D                  Marmoset  cgcctttgagg
B D           Squirrel monkey  cgcctttgagg
           Chinese tree shrew  tgcctttggga
                 Prairie vole  tgcctttgggg
B D           Chinese hamster  tgcctttgggg
               Golden hamster  tgcctttgggg
B D                     Mouse  tgccttttgga
B D                       Rat  tgccttttgga
B D            Naked mole-rat  tg--cttaagg
B D                Guinea pig  ----tttgagc
                   Chinchilla  ttcctttaagg
B D                      Pika  tgccctcaggg
B D                    Alpaca  tgcctttaagg
               Bactrian camel  tgcctttaagg
B D                     Horse  tgccttcaggg
B D                       Cat  tgctttcaagg
B D                   Ferret   --atttcaagc
               Pacific walrus  tgcctttaagg
             Cape golden mole  taccttttagg
      Lesser Egyptian jerboa  -----------
B D                     Shrew  ===========
B D                  Hedgehog  ===========
B D                    Rabbit  -----------
B D                Coelacanth  ===========
  D    Spiny softshell turtle  ===========
                    Aardvark  -----------
B D                       Pig  -----------
B D                   Megabat  -----------
B D                   Dolphin  -----------
                 Spotted gar  ===========
B D               Stickleback  ===========
      Yellowbelly pufferfish  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
  D              Mallard duck  ===========
          Tibetan ground jay  ===========
B D               Zebra finch  ===========
  D    White-throated sparrow  ===========
B D           Tasmanian devil  ===========
    Mexican tetra (cavefish)  ===========
B D                 Zebrafish  ===========
B D                    Medaka  ===========
  D            Painted turtle  ===========
B D        American alligator  ===========
  D             Scarlet macaw  ===========
B D                Budgerigar  ===========
B D                   Opossum  ===========
  D               Rock pigeon  ===========
B D       Medium ground finch  ===========
B D                    Lizard  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D                    Parrot  ===========
B D                   Wallaby  ===========
            Brush-tailed rat  -----------
         Cape elephant shrew  -----------
B D                  Platypus  ===========
B D                   Manatee  -----------
B D                  Elephant  ===========
B D                    Tenrec  ===========
  D           Green seaturtle  ===========
B D                  Bushbaby  NNNNNNNNNNN
                Weddell seal  -----------
  D  Chinese softshell turtle  ===========
               Domestic goat  -----------
B D                     Sheep  ===========
            Tibetan antelope  -----------
  D       Collared flycatcher  ===========
             Star-nosed mole  ===========
               Big brown bat  ===========
B D                     Panda  -----------
B D                       Cow  -----------
                Killer whale  -----------
B D                       Dog  ===========
            Black flying-fox  ===========
B D          White rhinoceros  ===========
B D                  Squirrel  -----------
        David's myotis (bat)  ===========
B D                  Microbat  ===========
B D                 Armadillo  -----------

Alignment block 30 of 73 in window, 99960752 - 99960755, 4 bps 
B D                     Human  att-c
B D                     Chimp  att-c
B D                   Gorilla  ctt-c
B D                 Orangutan  att-c
B D                    Gibbon  act-c
B D                    Rhesus  att-c
B D       Crab-eating macaque  att-c
B D                    Baboon  att-c
B D              Green monkey  att-c
B D                  Marmoset  att-c
B D           Squirrel monkey  att-c
           Chinese tree shrew  att-c
B D                  Squirrel  att-c
       Lesser Egyptian jerboa  att-c
                 Prairie vole  att-c
B D           Chinese hamster  att-c
               Golden hamster  att-c
B D                     Mouse  att-t
B D                       Rat  att-c
B D            Naked mole-rat  att-c
B D                Guinea pig  c----
                   Chinchilla  att-c
B D                      Pika  att-c
B D                    Alpaca  att--
               Bactrian camel  att--
B D                     Horse  gtt--
B D                       Cat  att--
B D                       Dog  ctt--
B D                   Ferret   atta-
               Pacific walrus  att--
             Cape golden mole  att-c
B D                     Shrew  =====
B D                  Hedgehog  =====
B D                    Rabbit  -----
B D                Coelacanth  =====
  D    Spiny softshell turtle  =====
                    Aardvark  -----
B D                       Pig  -----
B D                   Megabat  -----
B D                   Dolphin  -----
                 Spotted gar  =====
B D               Stickleback  =====
      Yellowbelly pufferfish  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D                    Medaka  =====
  D            Painted turtle  =====
B D        American alligator  =====
  D             Scarlet macaw  =====
B D                Budgerigar  =====
B D                   Opossum  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
B D                   Wallaby  =====
            Brush-tailed rat  -----
         Cape elephant shrew  -----
B D                  Platypus  =====
B D                   Manatee  -----
B D                  Elephant  =====
B D                    Tenrec  =====
  D           Green seaturtle  =====
B D                  Bushbaby  NNNNN
                Weddell seal  -----
  D  Chinese softshell turtle  =====
               Domestic goat  -----
B D                     Sheep  =====
            Tibetan antelope  -----
  D       Collared flycatcher  =====
             Star-nosed mole  =====
               Big brown bat  =====
B D                     Panda  -----
B D                       Cow  -----
                Killer whale  -----
            Black flying-fox  =====
B D          White rhinoceros  =====
        David's myotis (bat)  =====
B D                  Microbat  =====
B D                 Armadillo  -----

Alignment block 31 of 73 in window, 99960756 - 99960759, 4 bps 
B D                     Human  t-aca
B D                     Chimp  t-aca
B D                   Gorilla  t-aca
B D                 Orangutan  t-aca
B D                    Gibbon  t-aca
B D                    Rhesus  t-aca
B D       Crab-eating macaque  t-aca
B D                    Baboon  t-aca
B D              Green monkey  t-aca
B D                  Marmoset  taaca
B D           Squirrel monkey  t-aca
           Chinese tree shrew  c-aaa
B D                  Squirrel  t-gca
       Lesser Egyptian jerboa  t-ata
                 Prairie vole  c-atg
B D           Chinese hamster  c-ata
               Golden hamster  c-ata
B D                     Mouse  c-aca
B D                       Rat  c-ata
B D            Naked mole-rat  t-gca
                   Chinchilla  t-aca
             Brush-tailed rat  t-aca
B D                      Pika  t-cta
B D                    Alpaca  t-aca
               Bactrian camel  t-aca
B D                   Dolphin  t-aca
                 Killer whale  t-aca
                Domestic goat  t-aca
B D                     Horse  t-aca
B D          White rhinoceros  t-aca
B D                       Cat  t-aca
B D                       Dog  a-ata
B D                     Panda  t-ata
               Pacific walrus  t-ata
             Cape golden mole  t----
B D                     Shrew  =====
B D                  Hedgehog  =====
B D                Guinea pig  -----
B D                    Rabbit  -----
B D                Coelacanth  =====
  D    Spiny softshell turtle  =====
                    Aardvark  -----
B D                       Pig  -----
B D                   Megabat  -----
                 Spotted gar  =====
B D               Stickleback  =====
      Yellowbelly pufferfish  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D                    Medaka  =====
  D            Painted turtle  =====
B D        American alligator  =====
  D             Scarlet macaw  =====
B D                Budgerigar  =====
B D                   Opossum  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
B D                   Wallaby  =====
         Cape elephant shrew  -----
B D                  Platypus  =====
B D                   Manatee  -----
B D                  Elephant  =====
B D                    Tenrec  =====
  D           Green seaturtle  =====
B D                  Bushbaby  NNNNN
                Weddell seal  -----
  D  Chinese softshell turtle  =====
B D                   Ferret   -----
B D                     Sheep  =====
            Tibetan antelope  -----
  D       Collared flycatcher  =====
             Star-nosed mole  =====
               Big brown bat  =====
B D                       Cow  -----
            Black flying-fox  =====
        David's myotis (bat)  =====
B D                  Microbat  =====
B D                 Armadillo  -----

Alignment block 32 of 73 in window, 99960760 - 99960760, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                      Pika  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                     Panda  g
               Pacific walrus  g
              Star-nosed mole  g
B D                     Shrew  =
B D                  Hedgehog  =
B D                Guinea pig  -
B D                    Rabbit  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
                    Aardvark  -
            Cape golden mole  -
B D                       Pig  -
B D                   Megabat  -
                 Spotted gar  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
  D            Painted turtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                   Wallaby  =
         Cape elephant shrew  -
B D                  Platypus  =
B D                   Manatee  -
B D                  Elephant  =
B D                    Tenrec  =
  D           Green seaturtle  =
B D                  Bushbaby  N
                Weddell seal  -
  D  Chinese softshell turtle  =
B D                   Ferret   -
B D                     Sheep  =
            Tibetan antelope  -
  D       Collared flycatcher  =
               Big brown bat  =
B D                       Cow  -
            Black flying-fox  =
        David's myotis (bat)  =
B D                  Microbat  =
B D                 Armadillo  -

Alignment block 33 of 73 in window, 99960761 - 99960786, 26 bps 
B D                     Human  tgagt--ggagataggcctggac--ccc--ag
B D                     Chimp  tgagt--ggagataggcctggac--ccc--ag
B D                   Gorilla  tgagt--ggagataggcctggac--ccc--ag
B D                 Orangutan  tgagt--ggagataggcctggac--ccc--ag
B D                    Gibbon  tgagt--gaagataggcctggac--ccc--ag
B D                    Rhesus  tgagt--ggagataggcctggac--ccc--ag
B D       Crab-eating macaque  tgagt--ggagataggcctggac--ccc--ag
B D                    Baboon  tgagt--ggagataggcccggac--ccc--ag
B D              Green monkey  tgagt--ggagataggcccggac--ccc--ag
B D                  Marmoset  tgagt--agaaataggcctgcac--ccc--ag
B D           Squirrel monkey  tgagt--agagataggcctgcac--ccc--ag
           Chinese tree shrew  tgggt--ggagataggcttggac--tcc--aa
B D                  Squirrel  tggat--ggagataaactttgaaccccc--cc
       Lesser Egyptian jerboa  taggcataggggaggcttgagt---tcc--tc
                 Prairie vole  gagga--agacgtgggctgtga---ctc--tc
B D           Chinese hamster  aaaga--agaggtgggctggaa---ctc--tc
               Golden hamster  aagga--ggaggtggtttggga---ctc--tc
B D                     Mouse  aagga--agaaggaggctggga---ctc--cc
B D                       Rat  aagga--agaagaaggcttgaa---ttc--cc
B D            Naked mole-rat  taggt--ggatatagacttggact-ccc--ca
B D                Guinea pig  ---------------------------c--ca
                   Chinchilla  taggt--ggctgtagacttgggc--ccc--ca
             Brush-tailed rat  taggt--ggatgtagacttgagt--ccc--ca
B D                      Pika  tggga--aaatatatgtttagac--cct--cc
B D                    Alpaca  tgggc--gaccataagcttggac--ccc--ca
               Bactrian camel  taggt--gaccataagcttggac--tcc--aa
B D                   Dolphin  tgggt--ggccataagcttggac--tca--cc
                 Killer whale  tgggt--ggccataagcttggac--tca--cc
                Domestic goat  tgggt--ggccataaacttggac--ccc--ac
B D                     Horse  tgggt--ggagatatgcttggac--ccc--ca
B D          White rhinoceros  tgggt--gaagataagcttggac--ccc--ta
B D                       Cat  tgggt--ggagataagcttggac--ccc--aa
B D                       Dog  tggct--gttgataaggttggac--ccc--ca
B D                     Panda  tgggt--ggagataagcttggac--ccc--aa
               Pacific walrus  tgggt--ggaggtaagtttggac--ccc--ta
                 Weddell seal  ---------------------ac--ccc--aa
             Black flying-fox  -----------ataagcttggac--ccccaca
B D                   Megabat  -----------ataagcttggac--ccccaca
              Star-nosed mole  ttggt--ggaggtaaacctgtat--cta--aa
B D                  Elephant  tgggt--ggagataggcttgggc--ccc--aa
B D                   Manatee  tgggt--agagataggcttggac--ccc--ag
             Cape golden mole  tgggt--ggagataggtgtggac--ccc--ca
B D                     Shrew  ================================
B D                  Hedgehog  ================================
B D                    Rabbit  --------------------------------
B D                Coelacanth  ================================
  D    Spiny softshell turtle  ================================
                    Aardvark  --------------------------------
B D                       Pig  --------------------------------
                 Spotted gar  ================================
B D               Stickleback  ================================
      Yellowbelly pufferfish  ================================
B D                    Turkey  ================================
B D                   Chicken  ================================
  D              Mallard duck  ================================
          Tibetan ground jay  ================================
B D               Zebra finch  ================================
  D    White-throated sparrow  ================================
B D           Tasmanian devil  ================================
    Mexican tetra (cavefish)  ================================
B D                 Zebrafish  ================================
B D                    Medaka  ================================
  D            Painted turtle  ================================
B D        American alligator  ================================
  D             Scarlet macaw  ================================
B D                Budgerigar  ================================
B D                   Opossum  ================================
  D               Rock pigeon  ================================
B D       Medium ground finch  ================================
B D                    Lizard  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
  D                    Parrot  ================================
B D                   Wallaby  ================================
         Cape elephant shrew  --------------------------------
B D                  Platypus  ================================
B D                    Tenrec  ================================
  D           Green seaturtle  ================================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ================================
B D                   Ferret   --------------------------------
B D                     Sheep  ================================
            Tibetan antelope  --------------------------------
  D       Collared flycatcher  ================================
               Big brown bat  ================================
B D                       Cow  --------------------------------
        David's myotis (bat)  ================================
B D                  Microbat  ================================
B D                 Armadillo  --------------------------------

Inserts between block 33 and 34 in window
B D                  Dolphin 2bp
                Killer whale 2bp
               Domestic goat 2bp
             Star-nosed mole 2bp

Alignment block 34 of 73 in window, 99960787 - 99960800, 14 bps 
B D                     Human  aaactgagctttca
B D                     Chimp  aaactgagctttca
B D                   Gorilla  aaactgagctttca
B D                 Orangutan  aaactgagctttca
B D                    Gibbon  aaactgagcgttca
B D                    Rhesus  aaactgagctttca
B D       Crab-eating macaque  aaactgagctttca
B D                    Baboon  aaactgagctttca
B D              Green monkey  aaactgagctttca
B D                  Marmoset  aaactgagctttca
B D           Squirrel monkey  aaacggagctttca
           Chinese tree shrew  aaattgagcttttg
B D                  Squirrel  aaactgagcttttg
       Lesser Egyptian jerboa  aaactgagttttca
                 Prairie vole  acacttagttttca
B D           Chinese hamster  aaactcagttttca
               Golden hamster  agactcagttttca
B D                     Mouse  agactcagttttca
B D                       Rat  agactcagttttca
B D            Naked mole-rat  aaattgagctttca
B D                Guinea pig  agactgagctctta
                   Chinchilla  aaactgagctttca
             Brush-tailed rat  aaattgagctgtca
B D                      Pika  aaaccaatctttta
B D                    Alpaca  aaac--agatttca
               Bactrian camel  aaac--agatttca
B D                   Dolphin  aaactgaaatttca
                 Killer whale  aaactgaaatttca
             Tibetan antelope  aaactgaaatttca
                Domestic goat  aaactgaaatttca
B D                     Horse  aaactgaaatttca
B D          White rhinoceros  aaactgaaatttca
B D                       Cat  aaactgaaatttca
B D                       Dog  aaactgaaatttca
B D                     Panda  aaactgaaatttca
               Pacific walrus  aaactgaaatttca
                 Weddell seal  aaactgaaatttca
             Black flying-fox  aaactgaaatttca
B D                   Megabat  aaactgaaatttca
              Star-nosed mole  aaatggaaatttca
B D                  Elephant  aaactgatatttca
B D                   Manatee  aaactgaaatttta
             Cape golden mole  aaactaatatttca
                     Aardvark  aaactgcaatttca
B D                 Armadillo  gaactgaaatttca
B D                     Shrew  ==============
B D                  Hedgehog  ==============
B D                    Rabbit  --------------
B D                Coelacanth  ==============
  D    Spiny softshell turtle  ==============
B D                       Pig  --------------
                 Spotted gar  ==============
B D               Stickleback  ==============
      Yellowbelly pufferfish  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
  D              Mallard duck  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
  D    White-throated sparrow  ==============
B D           Tasmanian devil  ==============
    Mexican tetra (cavefish)  ==============
B D                 Zebrafish  ==============
B D                    Medaka  ==============
  D            Painted turtle  ==============
B D        American alligator  ==============
  D             Scarlet macaw  ==============
B D                Budgerigar  ==============
B D                   Opossum  ==============
  D               Rock pigeon  ==============
B D       Medium ground finch  ==============
B D                    Lizard  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D                    Parrot  ==============
B D                   Wallaby  ==============
         Cape elephant shrew  --------------
B D                  Platypus  ==============
B D                    Tenrec  ==============
  D           Green seaturtle  ==============
B D                  Bushbaby  NNNNNNNNNNNNNN
  D  Chinese softshell turtle  ==============
B D                   Ferret   --------------
B D                     Sheep  ==============
  D       Collared flycatcher  ==============
               Big brown bat  ==============
B D                       Cow  --------------
        David's myotis (bat)  ==============
B D                  Microbat  ==============

Alignment block 35 of 73 in window, 99960801 - 99960803, 3 bps 
B D                     Human  agc
B D                     Chimp  agc
B D                   Gorilla  agc
B D                 Orangutan  agc
B D                    Gibbon  agc
B D                    Rhesus  agc
B D       Crab-eating macaque  agc
B D                    Baboon  agc
B D              Green monkey  agt
B D                  Marmoset  agc
B D           Squirrel monkey  agc
           Chinese tree shrew  agc
B D                  Squirrel  agc
       Lesser Egyptian jerboa  aag
                 Prairie vole  agc
B D           Chinese hamster  agc
               Golden hamster  agc
B D                     Mouse  agc
B D                       Rat  agc
B D            Naked mole-rat  gct
B D                Guinea pig  ggc
                   Chinchilla  gac
             Brush-tailed rat  ggc
B D                    Rabbit  agc
B D                      Pika  aac
B D                    Alpaca  agc
               Bactrian camel  agc
B D                   Dolphin  agc
                 Killer whale  agc
             Tibetan antelope  aga
                Domestic goat  aga
B D                     Horse  agt
B D          White rhinoceros  agc
B D                       Cat  aac
B D                       Dog  agc
B D                     Panda  agc
               Pacific walrus  agc
                 Weddell seal  agc
             Black flying-fox  acc
B D                   Megabat  acc
         David's myotis (bat)  agc
              Star-nosed mole  aa-
B D                  Elephant  aga
B