Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1557 in window, 75827226 - 75827228, 3 bps 
B D                     Human  t--t--t
B D                     Chimp  t--t--t
B D                   Gorilla  t--t--t
B D                 Orangutan  t--t--t
B D                    Gibbon  t--t--t
B D                    Rhesus  t--t--t
B D       Crab-eating macaque  t--t--t
B D                    Baboon  t--t--t
B D              Green monkey  t--t--t
B D                  Marmoset  t--ttct
B D           Squirrel monkey  t--ttct
B D                  Bushbaby  t--t--t
           Chinese tree shrew  c--tcct
B D                  Squirrel  c--c--t
                 Prairie vole  t--c--t
B D           Chinese hamster  t--t--t
               Golden hamster  t--t--t
B D                     Mouse  t--t--t
B D                       Rat  t--t--t
B D            Naked mole-rat  t--t--t
B D                Guinea pig  t--t--t
             Brush-tailed rat  t--t--t
B D                    Rabbit  t--t--t
B D                    Alpaca  t--c--t
               Bactrian camel  t--c--t
B D                   Dolphin  a--g--t
                 Killer whale  a--g--t
             Tibetan antelope  t--g--t
B D                       Cow  g--g--t
B D                     Sheep  t--a--t
                Domestic goat  t--g--t
B D                     Horse  t--c--t
B D          White rhinoceros  t--c--t
B D                       Cat  c--c--t
B D                       Dog  c--c--t
B D                   Ferret   c--c--t
B D                     Panda  c--c--t
               Pacific walrus  c--c--t
                 Weddell seal  c--c--t
             Black flying-fox  g--c--t
B D                   Megabat  g--c--t
                Big brown bat  t--c--t
         David's myotis (bat)  t--c--t
B D                  Microbat  t--c--t
B D                  Hedgehog  t--c--t
B D                     Shrew  tg-c--t
              Star-nosed mole  tgtc--t
             Cape golden mole  t--c--t
B D                 Armadillo  t--c--t
  D           Green seaturtle  ---c--t
B D                    Tenrec  =======
B D                  Elephant  =======
         Cape elephant shrew  =======
B D                      Pika  =======
B D                   Manatee  =======
                  Chinchilla  =======
      Lesser Egyptian jerboa  -------
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
                    Aardvark  =======
B D               Stickleback  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                    Medaka  =======
B D                Coelacanth  =======
B D                    Turkey  =======
                 Spotted gar  =======
  D              Mallard duck  =======
B D                Budgerigar  =======
B D                   Wallaby  =======
B D                    Lizard  =======
          Southern platyfish  =======
    Mexican tetra (cavefish)  =======
  D          Peregrine falcon  =======
B D                 Zebrafish  =======
  D               Rock pigeon  =======
B D              Nile tilapia  =======
  D            Painted turtle  =======
B D                 Tetraodon  =======
B D                   Chicken  =======
B D              Atlantic cod  =======
  D       Collared flycatcher  =======
  D  Chinese softshell turtle  =======
B D               Zebra finch  =======
  D              Saker falcon  =======
B D             X. tropicalis  =======
B D       Medium ground finch  =======
B D                   Opossum  =======
B D        American alligator  =======
  D    White-throated sparrow  =======
          Tibetan ground jay  =======
B D                       Pig  =======
B D           Tasmanian devil  -------

Alignment block 2 of 1557 in window, 75827229 - 75827231, 3 bps 
B D                     Human  a--ag
B D                     Chimp  a--ag
B D                   Gorilla  a--ag
B D                 Orangutan  a--ag
B D                    Gibbon  a--ag
B D                    Rhesus  a--ag
B D       Crab-eating macaque  a--ag
B D                    Baboon  a--ag
B D              Green monkey  a--ag
B D                  Marmoset  a--ag
B D           Squirrel monkey  a--ag
           Chinese tree shrew  a--aa
B D                  Squirrel  a--ag
                 Prairie vole  c--cg
B D           Chinese hamster  c--tg
               Golden hamster  c--tg
B D                     Mouse  c--tg
B D                       Rat  c--cg
B D            Naked mole-rat  caaag
B D                Guinea pig  caaag
             Brush-tailed rat  catag
B D                    Rabbit  g--tg
B D                    Alpaca  a--gc
               Bactrian camel  a--gc
B D                   Dolphin  a--ag
                 Killer whale  a--ag
             Tibetan antelope  g--ag
B D                       Cow  g--ag
B D                     Sheep  g--ag
                Domestic goat  g--ag
B D                     Horse  a--ag
B D          White rhinoceros  a--ag
B D                       Cat  t--ag
B D                       Dog  t--ac
B D                   Ferret   t--ag
B D                     Panda  t--ag
               Pacific walrus  t--ag
                 Weddell seal  t--ag
             Black flying-fox  a--ag
B D                   Megabat  a--ag
                Big brown bat  ----g
         David's myotis (bat)  ----g
B D                  Microbat  ----a
B D                  Hedgehog  a--ag
B D                     Shrew  a--tg
              Star-nosed mole  g--aa
B D                  Elephant  --agg
B D                   Manatee  --agg
             Cape golden mole  --aag
B D                 Armadillo  --aag
B D           Tasmanian devil  --aag
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                      Pika  =====
                  Chinchilla  =====
      Lesser Egyptian jerboa  -----
B D                  Bushbaby  -----
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
                    Aardvark  =====
B D               Stickleback  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                    Medaka  =====
B D                Coelacanth  =====
B D                    Turkey  =====
                 Spotted gar  =====
  D              Mallard duck  =====
B D                Budgerigar  =====
B D                   Wallaby  =====
B D                    Lizard  =====
          Southern platyfish  =====
    Mexican tetra (cavefish)  =====
  D          Peregrine falcon  =====
B D                 Zebrafish  =====
  D               Rock pigeon  =====
B D              Nile tilapia  =====
  D            Painted turtle  =====
B D                 Tetraodon  =====
B D                   Chicken  =====
B D              Atlantic cod  =====
  D       Collared flycatcher  =====
  D  Chinese softshell turtle  =====
B D               Zebra finch  =====
  D              Saker falcon  =====
B D             X. tropicalis  =====
  D           Green seaturtle  -----
B D       Medium ground finch  =====
B D                   Opossum  =====
B D        American alligator  =====
  D    White-throated sparrow  =====
          Tibetan ground jay  =====
B D                       Pig  =====

Alignment block 3 of 1557 in window, 75827232 - 75827247, 16 bps 
B D                     Human  aggacaatggat-tt-----gt-
B D                     Chimp  aggacaatggat-tt-----gt-
B D                   Gorilla  aggacaatagat-tt-----gt-
B D                 Orangutan  aggacaatggat-tg-----gt-
B D                    Gibbon  aggacaatggat-tg-----gt-
B D                    Rhesus  aggacaaaggat-tg-----g--
B D       Crab-eating macaque  aggacaaaggat-tg-----g--
B D                    Baboon  aagacaaaggat-tg-----a--
B D              Green monkey  aggacaaaggat-tg-----g--
B D                  Marmoset  aggacaatgggt-tc-----gt-
B D           Squirrel monkey  aggacaatggat-tg-----gt-
B D                  Bushbaby  -gggcaatggat-tg-----gt-
           Chinese tree shrew  cagacagtgggt-tg-----tt-
B D                  Squirrel  agggctgtggataaa-----tt-
       Lesser Egyptian jerboa  --------gaac-aa-----tg-
                 Prairie vole  agggcagtgggt-aa-----tg-
B D           Chinese hamster  agggcagtggat-aa-----tg-
               Golden hamster  agggcagtagat-ag-----tg-
B D                     Mouse  agggcagtggat-aa-----tg-
B D                       Rat  agggcagtggac-aa-----tg-
B D            Naked mole-rat  aggaacatggat-----------
B D                Guinea pig  aggtacatggat-----------
             Brush-tailed rat  aggaaaatgcat-----------
B D                    Rabbit  agatgactggaa-ca--------
B D                    Alpaca  aggacaatggat-ta-----tt-
               Bactrian camel  aggacaatggat-ta-----tt-
B D                   Dolphin  aggacgatgtat-tg-----tt-
                 Killer whale  aggacgatgtat-tg-----tt-
             Tibetan antelope  aggacagcagat-tg-----tt-
B D                       Cow  aggacagcagat-tg--------
B D                     Sheep  aggacagcagat-tg-----tt-
                Domestic goat  aggacagcagat-tg-----tt-
B D                     Horse  agaacaatggat-tg--------
B D          White rhinoceros  aggacaatggat-tg-----gt-
B D                       Cat  aggacaatgaat-tg-----tt-
B D                       Dog  aggacactgaca-tg-----tt-
B D                   Ferret   aggacaatggat--------tt-
B D                     Panda  aggacaatgaat-tg-----tt-
               Pacific walrus  aggacaatgaat-tg-----tt-
                 Weddell seal  aggacaatgaat-tg-----tt-
             Black flying-fox  aggacaatggat-tgtcaattt-
B D                   Megabat  aggacaatggat-tgtcaa--t-
                Big brown bat  aggacgagggat-tg-cga----
         David's myotis (bat)  aggacgacggat-tg-cga----
B D                  Microbat  aggacgatggat-tg-cga----
B D                  Hedgehog  aggacaatagag-ag----cgt-
B D                     Shrew  aggacagcaggt-tg-----gt-
              Star-nosed mole  aggacgacggat-tg-----gt-
B D                  Elephant  aggacagtggat-tt-----tt-
B D                   Manatee  aggacagtggat-tt-----tt-
             Cape golden mole  aggacaactgac-tg-----gt-
                     Aardvark  aggacggtggat-tt-----tt-
B D                 Armadillo  aggacaacagat-tt-----tt-
B D           Tasmanian devil  aagtccttaagt-tc-----ag-
  D           Green seaturtle  -----catgggt-cc-----tgc
B D                    Tenrec  =======================
         Cape elephant shrew  =======================
B D                      Pika  =======================
                  Chinchilla  =======================
      Yellowbelly pufferfish  =======================
B D                      Fugu  =======================
B D               Stickleback  =======================
         Pundamilia nyererei  =======================
                 Zebra mbuna  =======================
       Burton's mouthbreeder  =======================
         Princess of Burundi  =======================
B D                    Medaka  =======================
B D                Coelacanth  =======================
B D                    Turkey  =======================
                 Spotted gar  =======================
  D              Mallard duck  =======================
B D                Budgerigar  =======================
B D                   Wallaby  =======================
B D                    Lizard  =======================
          Southern platyfish  =======================
    Mexican tetra (cavefish)  =======================
  D          Peregrine falcon  =======================
B D                 Zebrafish  =======================
  D               Rock pigeon  =======================
B D              Nile tilapia  =======================
  D            Painted turtle  =======================
B D                 Tetraodon  =======================
B D                   Chicken  =======================
B D              Atlantic cod  =======================
  D       Collared flycatcher  =======================
  D  Chinese softshell turtle  =======================
B D               Zebra finch  =======================
  D              Saker falcon  =======================
B D             X. tropicalis  =======================
B D       Medium ground finch  =======================
B D                   Opossum  =======================
B D        American alligator  =======================
  D    White-throated sparrow  =======================
          Tibetan ground jay  =======================
B D                       Pig  =======================

Inserts between block 3 and 4 in window
          Chinese tree shrew 1bp
B D                 Elephant 11bp
B D                  Manatee 15bp
            Cape golden mole 760bp

Alignment block 4 of 1557 in window, 75827248 - 75827258, 11 bps 
B D                     Human  t----tttatta--at----t
B D                     Chimp  t----tttatta--at----t
B D                   Gorilla  t----tttatta--at----t
B D                 Orangutan  t----tttatta--at----t
B D                    Gibbon  t----tttatta--at----t
B D                    Rhesus  t----tttattatttt----t
B D       Crab-eating macaque  t----tttattatttt----t
B D                    Baboon  t----ttta-----tt----t
B D              Green monkey  t----tttattat-tt----t
B D                  Marmoset  t----ttta------------
B D           Squirrel monkey  t----ttta------------
B D                  Bushbaby  t----ttatttg--tt----t
           Chinese tree shrew  c----tttat----tt----a
B D                  Squirrel  t----tttttat--tt----t
       Lesser Egyptian jerboa  t----ttatttt--tt----a
                 Prairie vole  c----gttattt--tt----a
B D           Chinese hamster  gt---tttattt--tt----a
               Golden hamster  g----tttattt--tt----a
B D                     Mouse  t----tttattt--tt----a
B D                       Rat  t----tttattt--tt----a
B D            Naked mole-rat  t----ttctttt--ta----a
B D                Guinea pig  t----tttaaaa--ac----a
             Brush-tailed rat  t----tttaaaa--aa----a
B D                    Rabbit  -----tttattt--ct----g
B D                    Alpaca  t----a-tt-tt--tt-----
               Bactrian camel  a----attt-tt--tt-----
B D                   Dolphin  a----attt-tt--tt-----
                 Killer whale  a----attt-tt--tt-----
             Tibetan antelope  a----gtctgtt--tt-----
B D                       Cow  -----------t--tt-----
B D                     Sheep  a----gtttgtt--tt-----
                Domestic goat  a----gtttgtt--tt-----
B D                     Horse  t----tagtttt--tt-----
B D          White rhinoceros  t----tttttct--tt-----
B D                       Cat  t----ttggttt--tt-----
B D                       Dog  t----ttggttt--tt-----
B D                   Ferret   t----ttcttct--tt-----
B D                     Panda  t----ttggttt--tt-----
               Pacific walrus  t----ttctttt--tt-----
                 Weddell seal  t----ttgtttt--tt-----
             Black flying-fox  t----ttttttt--tt-----
B D                   Megabat  t----ttttttt--at-----
                Big brown bat  ---------ttt--tt-----
         David's myotis (bat)  --------tttt--tt-----
B D                  Microbat  --------tttt--tt-----
B D                  Hedgehog  t----tctaatg--tttatt-
B D                     Shrew  g-------gcct--ccgttt-
              Star-nosed mole  t----tc-gctt--ttgatt-
B D                  Elephant  -tctaattattt---------
B D                   Manatee  -tctaattattt---------
                     Aardvark  -gctttttatta---------
B D                 Armadillo  -attttctattg---------
B D           Tasmanian devil  -tcatcccattt---------
  D           Green seaturtle  ---atttgataa--at-----
B D                    Tenrec  =====================
         Cape elephant shrew  =====================
B D                      Pika  =====================
                  Chinchilla  =====================
            Cape golden mole  =====================
      Yellowbelly pufferfish  =====================
B D                      Fugu  =====================
B D               Stickleback  =====================
         Pundamilia nyererei  =====================
                 Zebra mbuna  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D                    Medaka  =====================
B D                Coelacanth  =====================
B D                    Turkey  =====================
                 Spotted gar  =====================
  D              Mallard duck  =====================
B D                Budgerigar  =====================
B D                   Wallaby  =====================
B D                    Lizard  =====================
          Southern platyfish  =====================
    Mexican tetra (cavefish)  =====================
  D          Peregrine falcon  =====================
B D                 Zebrafish  =====================
  D               Rock pigeon  =====================
B D              Nile tilapia  =====================
  D            Painted turtle  =====================
B D                 Tetraodon  =====================
B D                   Chicken  =====================
B D              Atlantic cod  =====================
  D       Collared flycatcher  =====================
  D  Chinese softshell turtle  =====================
B D               Zebra finch  =====================
  D              Saker falcon  =====================
B D             X. tropicalis  =====================
B D       Medium ground finch  =====================
B D                   Opossum  =====================
B D        American alligator  =====================
  D    White-throated sparrow  =====================
          Tibetan ground jay  =====================
B D                       Pig  =====================

Inserts between block 4 and 5 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp

Alignment block 5 of 1557 in window, 75827259 - 75827260, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  ta
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  at
           Chinese tree shrew  tt
B D                  Squirrel  tt
       Lesser Egyptian jerboa  tt
                 Prairie vole  tt
B D           Chinese hamster  tt
               Golden hamster  tt
B D                     Mouse  tt
B D                       Rat  tt
B D            Naked mole-rat  tt
B D                Guinea pig  tt
             Brush-tailed rat  tt
B D                    Rabbit  tt
B D                       Pig  tt
B D                    Alpaca  tt
               Bactrian camel  tt
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  tt
B D                       Cow  tt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  aa
B D          White rhinoceros  ta
B D                       Cat  ta
B D                       Dog  ta
B D                   Ferret   ta
B D                     Panda  ta
               Pacific walrus  ta
                 Weddell seal  ta
             Black flying-fox  ta
B D                   Megabat  ta
                Big brown bat  ta
         David's myotis (bat)  ta
B D                  Microbat  ta
B D                  Hedgehog  ta
B D                     Shrew  ta
              Star-nosed mole  ta
B D                  Elephant  ta
B D                   Manatee  ta
                     Aardvark  tt
B D                 Armadillo  tt
B D           Tasmanian devil  -t
  D           Green seaturtle  tc
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                      Pika  ==
                  Chinchilla  ==
            Cape golden mole  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
B D                   Wallaby  ==
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D               Zebra finch  ==
  D              Saker falcon  ==
B D             X. tropicalis  ==
B D       Medium ground finch  ==
B D                   Opossum  ==
B D        American alligator  ==
  D    White-throated sparrow  ==
          Tibetan ground jay  ==

Alignment block 6 of 1557 in window, 75827261 - 75827263, 3 bps 
B D                     Human  ttt
B D                     Chimp  ttt
B D                   Gorilla  ttt
B D                 Orangutan  ttt
B D                    Gibbon  ctt
B D                    Rhesus  ttt
B D       Crab-eating macaque  ttt
B D                    Baboon  ttt
B D              Green monkey  ttt
B D                  Marmoset  ttt
B D           Squirrel monkey  ttt
B D                  Bushbaby  ttt
           Chinese tree shrew  ttc
B D                  Squirrel  ttt
       Lesser Egyptian jerboa  ttc
                 Prairie vole  ttc
B D           Chinese hamster  ttc
               Golden hamster  ttc
B D                     Mouse  ttc
B D                       Rat  ttc
B D            Naked mole-rat  ttt
B D                Guinea pig  tgt
             Brush-tailed rat  tgt
B D                       Pig  ttt
B D                    Alpaca  ttt
               Bactrian camel  ttt
B D                   Dolphin  ttt
                 Killer whale  ttt
             Tibetan antelope  ttt
B D                       Cow  ttt
B D                     Sheep  ttt
                Domestic goat  ttt
B D                     Horse  ttt
B D          White rhinoceros  ttt
B D                       Cat  ttt
B D                       Dog  ttt
B D                   Ferret   ttt
B D                     Panda  -tt
               Pacific walrus  ttt
                 Weddell seal  ttt
             Black flying-fox  ttt
B D                   Megabat  ttt
                Big brown bat  ttt
         David's myotis (bat)  ttt
B D                  Microbat  ttt
B D                  Hedgehog  ttt
B D                     Shrew  -tt
              Star-nosed mole  ttt
B D                  Elephant  ttt
B D                   Manatee  ttt
                     Aardvark  ttt
B D                 Armadillo  ttt
B D           Tasmanian devil  tct
B D        American alligator  tct
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                      Pika  ===
B D                    Rabbit  ---
                  Chinchilla  ===
            Cape golden mole  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
B D                Budgerigar  ===
B D                   Wallaby  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ---
B D       Medium ground finch  ===
B D                   Opossum  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===

Inserts between block 6 and 7 in window
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 257bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp
B D                 Hedgehog 2bp
B D                    Shrew 2bp
             Star-nosed mole 2bp
B D          Tasmanian devil 3bp

Alignment block 7 of 1557 in window, 75827264 - 75827266, 3 bps 
B D                     Human  gct
B D                     Chimp  gct
B D                   Gorilla  gct
B D                 Orangutan  gct
B D                    Gibbon  gct
B D                    Rhesus  gct
B D       Crab-eating macaque  gct
B D                    Baboon  gct
B D              Green monkey  gct
B D                  Marmoset  gct
B D           Squirrel monkey  gct
B D                  Bushbaby  gct
           Chinese tree shrew  act
B D                  Squirrel  tct
       Lesser Egyptian jerboa  act
                 Prairie vole  act
B D           Chinese hamster  act
               Golden hamster  act
B D                     Mouse  tct
B D                       Rat  act
B D            Naked mole-rat  gct
B D                Guinea pig  gct
             Brush-tailed rat  ggt
B D                       Pig  gct
B D                    Alpaca  gct
               Bactrian camel  gct
B D                   Dolphin  gct
                 Killer whale  gct
             Tibetan antelope  gct
B D                       Cow  gct
B D                     Sheep  gct
                Domestic goat  gct
B D                     Horse  gct
B D          White rhinoceros  gtt
B D                       Cat  gct
B D                       Dog  gtt
B D                   Ferret   gct
B D                     Panda  gct
               Pacific walrus  gct
                 Weddell seal  gct
             Black flying-fox  gct
B D                   Megabat  gct
                Big brown bat  gct
         David's myotis (bat)  gct
B D                  Microbat  gct
B D                  Hedgehog  gct
B D                     Shrew  gtg
              Star-nosed mole  gcc
B D                  Elephant  gct
B D                   Manatee  gct
                     Aardvark  gct
B D                 Armadillo  gct
B D           Tasmanian devil  g--
B D        American alligator  gct
  D           Green seaturtle  tct
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                      Pika  ===
B D                    Rabbit  ---
                  Chinchilla  ===
            Cape golden mole  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
B D                Budgerigar  ===
B D                   Wallaby  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===

Inserts between block 7 and 8 in window
            Brush-tailed rat 89bp

Alignment block 8 of 1557 in window, 75827267 - 75827272, 6 bps 
B D                     Human  aagaaa--
B D                     Chimp  aagaaa--
B D                   Gorilla  aagaaa--
B D                 Orangutan  aagaaa--
B D                    Gibbon  aagaag--
B D                    Rhesus  aagaaa--
B D       Crab-eating macaque  aagaaa--
B D                    Baboon  aagaaa--
B D              Green monkey  aagaaa--
B D                  Marmoset  aggaaa--
B D           Squirrel monkey  aagaac--
B D                  Bushbaby  aagaaa--
           Chinese tree shrew  ---gaa--
B D                  Squirrel  aagaaa--
       Lesser Egyptian jerboa  aagaac--
                 Prairie vole  aggaac--
B D           Chinese hamster  aagaac--
               Golden hamster  gagaac--
B D                     Mouse  gagaac--
B D                       Rat  gagaac--
B D            Naked mole-rat  aagaaa--
B D                Guinea pig  aggaaa--
                   Chinchilla  aaagaa--
             Brush-tailed rat  aagaaa--
B D                    Rabbit  aagaag--
B D                       Pig  aagaaa--
B D                    Alpaca  aagaaa--
               Bactrian camel  cagaaa--
B D                   Dolphin  aagaaa--
                 Killer whale  aagaaa--
             Tibetan antelope  aagaca--
B D                       Cow  aaaaca--
B D                     Sheep  aagaca--
                Domestic goat  aagaca--
B D                     Horse  aagaaa--
B D          White rhinoceros  aataaa--
B D                       Cat  aagaaa--
B D                       Dog  aagaaa--
B D                   Ferret   aagaaa--
B D                     Panda  aaggaa--
               Pacific walrus  gagaaa--
                 Weddell seal  aagaaa--
             Black flying-fox  aagaaa--
B D                   Megabat  aagaaa--
                Big brown bat  cagaac--
         David's myotis (bat)  aagaac--
B D                  Microbat  aagaac--
B D                  Hedgehog  aagaaa--
B D                     Shrew  agg--a--
              Star-nosed mole  aagaaa--
B D                  Elephant  aatcta--
B D                   Manatee  gatcta--
                     Aardvark  aattta--
B D                 Armadillo  aagaaa--
B D           Tasmanian devil  aggaaa--
B D        American alligator  --gaaacc
  D           Green seaturtle  --ggcaca
B D                    Tenrec  ========
         Cape elephant shrew  ========
B D                      Pika  ========
            Cape golden mole  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D               Stickleback  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D                    Medaka  ========
B D                Coelacanth  ========
B D                    Turkey  ========
                 Spotted gar  ========
  D              Mallard duck  ========
B D                Budgerigar  ========
B D                   Wallaby  ========
B D                    Lizard  ========
          Southern platyfish  ========
    Mexican tetra (cavefish)  ========
  D          Peregrine falcon  ========
B D                 Zebrafish  ========
  D               Rock pigeon  ========
B D              Nile tilapia  ========
  D            Painted turtle  ========
B D                 Tetraodon  ========
B D                   Chicken  ========
B D              Atlantic cod  ========
  D       Collared flycatcher  ========
  D  Chinese softshell turtle  ========
B D               Zebra finch  ========
  D              Saker falcon  ========
B D             X. tropicalis  ========
B D       Medium ground finch  ========
B D                   Opossum  ========
  D    White-throated sparrow  ========
          Tibetan ground jay  ========

Inserts between block 8 and 9 in window
                    Aardvark 25bp

Alignment block 9 of 1557 in window, 75827273 - 75827282, 10 bps 
B D                     Human  gtttctaggt
B D                     Chimp  gtttctaggt
B D                   Gorilla  gtttctaggt
B D                 Orangutan  gcttctaggt
B D                    Gibbon  gtttctaggt
B D                    Rhesus  gtttctaggt
B D       Crab-eating macaque  gtttctaggt
B D                    Baboon  gtttctaggt
B D              Green monkey  gtttctaggt
B D                  Marmoset  gtttcaaggt
B D           Squirrel monkey  gtttctaggt
B D                  Bushbaby  gtttctaggt
           Chinese tree shrew  gtccttaggt
B D                  Squirrel  gtttctagat
       Lesser Egyptian jerboa  agttctagtt
                 Prairie vole  atttctaggt
B D           Chinese hamster  atttctagat
               Golden hamster  atttctaggt
B D                     Mouse  atttctaggt
B D                       Rat  atttctaggt
B D            Naked mole-rat  gtttcttggt
B D                Guinea pig  atatttaggt
                   Chinchilla  atttctaggt
             Brush-tailed rat  atttctaggt
B D                    Rabbit  ggttctaggt
B D                       Pig  gtttctaggt
B D                    Alpaca  gtttctaggt
               Bactrian camel  gtttctaggt
B D                   Dolphin  atttctaggt
                 Killer whale  atttctaggt
             Tibetan antelope  gtttctaggt
B D                       Cow  gtttctaggt
B D                     Sheep  gtttctaggt
                Domestic goat  gtttctaggt
B D                     Horse  atttcttagt
B D          White rhinoceros  gtttctaagt
B D                       Cat  gtttctaagt
B D                       Dog  gttcttaagt
B D                   Ferret   gtccctaagt
B D                     Panda  gttcctaagt
               Pacific walrus  gttcctaagt
                 Weddell seal  gttcctaagt
             Black flying-fox  gtttctaggt
B D                   Megabat  gtttctaggt
                Big brown bat  atttttaggt
         David's myotis (bat)  atttttaggt
B D                  Microbat  atttttaggt
B D                  Hedgehog  ggttccaggt
B D                     Shrew  gtgtccaggt
              Star-nosed mole  gtttctaggt
B D                  Elephant  -tttatggat
B D                   Manatee  -tttacgaat
             Cape golden mole  gtttctgagt
                     Aardvark  ttctctgagt
B D                 Armadillo  acctctag--
B D           Tasmanian devil  ---ccgaggc
B D        American alligator  gtgcctgg--
  D           Green seaturtle  gcaccc----
B D                    Tenrec  ==========
         Cape elephant shrew  ==========
B D                      Pika  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
B D                Budgerigar  ==========
B D                   Wallaby  ==========
B D                    Lizard  ==========
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
  D          Peregrine falcon  ==========
B D                 Zebrafish  ==========
  D               Rock pigeon  ==========
B D              Nile tilapia  ==========
  D            Painted turtle  ==========
B D                 Tetraodon  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
  D       Collared flycatcher  ==========
  D  Chinese softshell turtle  ==========
B D               Zebra finch  ==========
  D              Saker falcon  ==========
B D             X. tropicalis  ==========
B D       Medium ground finch  ==========
B D                   Opossum  ==========
  D    White-throated sparrow  ==========
          Tibetan ground jay  ==========

Inserts between block 9 and 10 in window
B D                 Elephant 12bp
B D                  Manatee 29bp
                    Aardvark 5bp

Alignment block 10 of 1557 in window, 75827283 - 75827300, 18 bps 
B D                     Human  gg-------------------cagg-tgctgt--cc--gggg---------
B D                     Chimp  gg-------------------cagg-tgctgt--cc--gggg---------
B D                   Gorilla  gg-------------------cagg-tgctgt--cc--gggg---------
B D                 Orangutan  gg-------------------cagg-tgctgt--cc--gggg---------
B D                    Gibbon  gg-------------------cagg-tgctgt--cc--gggg---------
B D                    Rhesus  gg-------------------cagg-tgcttt--ct--gggg---------
B D       Crab-eating macaque  gg-------------------cagg-tgcttt--ct--gggg---------
B D                    Baboon  gg-------------------cagg-tgcttt--ct--gggg---------
B D              Green monkey  gg-------------------cagg-tgcttt--ct--gggg---------
B D                  Marmoset  ggcaggtgctatctggggtggcagg-tgcttt--ct--gggg---------
B D           Squirrel monkey  ggcaggtgctatctggggtgtcagg-tgctgt--ct--gggg---------
B D                  Bushbaby  gg-------------------caga-tgctgtc-ct--aggg---------
           Chinese tree shrew  gg-------------------caga-tgctgcc-ct--cggg---------
B D                  Squirrel  ga-------------------taga-tacctc--ct-gaagg---------
       Lesser Egyptian jerboa  gg-------------------cagg-tgccat--ct-gaggg---------
                 Prairie vole  gg-------------------cagg-tgctgt--ct-gaggg---------
B D           Chinese hamster  gg-------------------cagg-tgttgt--ct-gaggg---------
               Golden hamster  gg-------------------caga-tgttat--ct-gaggg---------
B D                     Mouse  gg-------------------cagg-tgctat--ct-gaggg---------
B D                       Rat  gg-------------------cagg-tgttat--ct-gaggg---------
B D            Naked mole-rat  gg-------------------cagg-agctat--cc-aaggg---------
B D                Guinea pig  g-----------------------------gt--gc-caggg---------
                   Chinchilla  ga-------------------cggg-agctgt--cc-aaggg---------
             Brush-tailed rat  gg-------------------cagg-tgctgt--tcaaaggg---------
B D                    Rabbit  ga-------------------cagg-tcctgt--cc---------------
B D                       Pig  gg-------------------cagg-tactgt--cc-cctgg---------
B D                    Alpaca  gg-------------------caag-gactgt--cc-caag----------
               Bactrian camel  gg-------------------cagg-gactgt--cc-caag----------
B D                   Dolphin  ---------------------------actgt--cc-caagg---------
                 Killer whale  ---------------------------actgt--cc-caagg---------
             Tibetan antelope  ag-------------------tagg-cac----------------------
B D                       Cow  gg-------------------tagg-cactgt--cc-caagg---------
B D                     Sheep  ag-------------------taag-cactgt--cc-tcagc---------
                Domestic goat  ag-------------------tagg-cactgt--cc-tcagc---------
B D                     Horse  ga-------------------tagg-tactgt--cc-caggg---------
B D          White rhinoceros  gg-------------------cagg-taccgt--cg-caggg---------
B D                       Cat  gt-------------------cagg-tactgt--cc-caggg---------
B D                       Dog  gg-------------------cagg-tactgt--cc-caggg---------
B D                   Ferret   gg-------------------caga-tactgt--cc-caggg---------
B D                     Panda  gg-------------------cagg-caccat--cc-caggg---------
               Pacific walrus  gg-------------------cagg-taccgt--ct-caggg---------
                 Weddell seal  gg-------------------cagg-tactgt--cc-caggg---------
             Black flying-fox  gg-------------------gagg-tactgg--cc-caggg---------
B D                   Megabat  gg-------------------gagg-tactgg--cc-caggg---------
                Big brown bat  gg-------------------ccgg-tactgg--ct-cggg----------
         David's myotis (bat)  -g-------------------ccgg-tactgg--ct-cggg----------
B D                  Microbat  gg-------------------ccag-tactgg--ct-cgggg---------
B D                  Hedgehog  gg-------------------caga-caaggt--tc-cagac---------
B D                     Shrew  gg-------------------cagg-tgctgt--cc---------------
              Star-nosed mole  ga-------------------cagacttctgt--cc-cag-----------
B D                  Elephant  ga-------------------tctg-ttgttt---c-cggtg---------
          Cape elephant shrew  gg-------------------caag-tgctgt---c-tgggg---------
B D                   Manatee  -----------------------------------------g---------
             Cape golden mole  gg-------------------tggg-agctat--gc-taggg---------
                     Aardvark  gt-------------------gggg-tgctgt--cc-taagg---------
B D           Tasmanian devil  ag-------------------aaag-acttgc--cc-ggag----------
B D        American alligator  --------------------------------agcc-tgggcctttcccgg
  D           Green seaturtle  ----------------------------------tc-tgtgtct-------
B D                    Tenrec  ===================================================
B D                      Pika  ===================================================
B D                 Armadillo  ---------------------------------------------------
      Yellowbelly pufferfish  ===================================================
B D                      Fugu  ===================================================
B D               Stickleback  ===================================================
         Pundamilia nyererei  ===================================================
                 Zebra mbuna  ===================================================
       Burton's mouthbreeder  ===================================================
         Princess of Burundi  ===================================================
B D                    Medaka  ===================================================
B D                Coelacanth  ===================================================
B D                    Turkey  ===================================================
                 Spotted gar  ===================================================
  D              Mallard duck  ===================================================
B D                Budgerigar  ===================================================
B D                   Wallaby  ===================================================
B D                    Lizard  ===================================================
          Southern platyfish  ===================================================
    Mexican tetra (cavefish)  ===================================================
  D          Peregrine falcon  ===================================================
B D                 Zebrafish  ===================================================
  D               Rock pigeon  ===================================================
B D              Nile tilapia  ===================================================
  D            Painted turtle  ===================================================
B D                 Tetraodon  ===================================================
B D                   Chicken  ===================================================
B D              Atlantic cod  ===================================================
  D       Collared flycatcher  ===================================================
  D  Chinese softshell turtle  ===================================================
B D               Zebra finch  ===================================================
  D              Saker falcon  ===================================================
B D             X. tropicalis  ===================================================
B D       Medium ground finch  ===================================================
B D                   Opossum  ===================================================
  D    White-throated sparrow  ===================================================
          Tibetan ground jay  ===================================================

Inserts between block 10 and 11 in window
B D          Tasmanian devil 45bp

Alignment block 11 of 1557 in window, 75827301 - 75827321, 21 bps 
B D                     Human  ----------aggggg--cgt---gcgcagcagac--------a
B D                     Chimp  ----------aggggg--cgt---gcgcagcagac--------a
B D                   Gorilla  ----------agggag--cat---gcgcagcagac--------a
B D                 Orangutan  ----------aggagg--cgt---gcgcagcagac--------a
B D                    Gibbon  ----------aggagg--cgt---gcgcagcagac--------a
B D                    Rhesus  ----------aggagg--cat---gcgtagcagac--------a
B D       Crab-eating macaque  ----------aggagg--cat---gcgtagcagac--------a
B D                    Baboon  ----------aggagg--cat---gcgtagcagac--------a
B D              Green monkey  ----------aggagg--cat---gcgtagcagac--------a
B D                  Marmoset  ----------aggagt--tga---gtgcagcagac--------a
B D           Squirrel monkey  ----------aggagt--cga---gtgcagcagac--------a
B D                  Bushbaby  ----------aggagg--tat---tctca-tacac--------a
           Chinese tree shrew  ----------aggtga--cat---ttgca-----c--------a
B D                  Squirrel  ----------aagaac--cc------tcagcagac--------g
       Lesser Egyptian jerboa  ----------aggagg--tgt---tctcatcaga----------
                 Prairie vole  ----------aggaag--cct---attctgtaga----------
B D           Chinese hamster  ----------aggaag--cct---actctgtaga----------
               Golden hamster  ----------aggaag--cct---actc--taga----------
B D                     Mouse  ----------aggaag--gct---attctgtaga----------
B D                       Rat  ----------aggaag--gct---cttctgtaga----------
B D            Naked mole-rat  ----------aggagg--tgt---tctcagcagac--------a
B D                Guinea pig  ----------atgta---------acttagcag-----------
                   Chinchilla  ----------aggagg--tggtgttctcagcagac--------a
             Brush-tailed rat  ----------aagaag--------acacagcaga----------
B D                    Rabbit  ------------ccag--tgt---tctcagcatag--------a
B D                       Pig  ----------aggaca--tgt---cctcagcagac--------a
B D                    Alpaca  ------------gagg--tgt---cctcagcagac--------a
               Bactrian camel  ------------gagg--tgt---cctcagcagac--------a
B D                   Dolphin  ----------aggagc--ggt---cctcagcagac--------a
                 Killer whale  ----------aggagc--ggt---cctcagcagac--------a
             Tibetan antelope  ------------------ggt---cctcagcagac--------a
B D                       Cow  ----------aggagg--ggt---cctcagcagaca-------a
B D                     Sheep  ----------a-gagt--ggt---cctcagcagac--------a
                Domestic goat  ----------a-gagt--ggt---cctcagcagac--------a
B D                     Horse  ----------aggccg--tgt---catcagcagac--------a
B D          White rhinoceros  ----------ag---g--tgt---cctcagcagac--------a
B D                       Cat  ----------agggg-----t---ctacagtagac--------a
B D                       Dog  ----------aggagg--tgt---cctcagtagac--------a
B D                   Ferret   ----------aggagg--tgt---cctcagcagac--------c
B D                     Panda  ----------aggagg--tgt---cctcagtagac--------a
               Pacific walrus  ----------aggcgg--tat---cctcagtagac--------a
                 Weddell seal  ----------aggagg--tgt---cctcagtagac--------a
             Black flying-fox  ----------aggaga--tgt---cctcagtggat--------a
B D                   Megabat  ----------aggaga--tgt---cctcagtggat--------a
                Big brown bat  ------------gaga--tgt---cctcagtagat--------a
         David's myotis (bat)  ------------gaga--tgt---cctcagtagat--------a
B D                  Microbat  ----------atgaga--tgt---cctcagtagat--------a
B D                  Hedgehog  ----------aggtga--tgt---cctcagcagac--------a
B D                     Shrew  -------------------ag---ccccaccatcccttctcttc
              Star-nosed mole  -----------ggagg--agg---tgacagcagac--------a
B D                  Elephant  ----------tcgggtactgc---cctagggatac--------a
          Cape elephant shrew  ----------aagagg--tgg---cctctgcagac--------a
B D                   Manatee  ----------tcgggtgctat---cttagggagac--------a
             Cape golden mole  ----------caggggtccct---ctcagaca------------
                     Aardvark  ----------aggtgg--ccg---cctctgcagac--------a
B D        American alligator  agtgaccatgcggggg--ctg---cat-----------------
  D           Green seaturtle  ----gctgcacgggga--cag---agt-----------------
B D                    Tenrec  ============================================
B D                      Pika  ============================================
B D                 Armadillo  --------------------------------------------
      Yellowbelly pufferfish  ============================================
B D                      Fugu  ============================================
B D               Stickleback  ============================================
         Pundamilia nyererei  ============================================
                 Zebra mbuna  ============================================
       Burton's mouthbreeder  ============================================
         Princess of Burundi  ============================================
B D                    Medaka  ============================================
B D                Coelacanth  ============================================
B D                    Turkey  ============================================
                 Spotted gar  ============================================
  D              Mallard duck  ============================================
B D                Budgerigar  ============================================
B D                   Wallaby  ============================================
B D                    Lizard  ============================================
          Southern platyfish  ============================================
    Mexican tetra (cavefish)  ============================================
  D          Peregrine falcon  ============================================
B D                 Zebrafish  ============================================
  D               Rock pigeon  ============================================
B D              Nile tilapia  ============================================
  D            Painted turtle  ============================================
B D                 Tetraodon  ============================================
B D                   Chicken  ============================================
B D              Atlantic cod  ============================================
  D       Collared flycatcher  ============================================
  D  Chinese softshell turtle  ============================================
B D               Zebra finch  ============================================
  D              Saker falcon  ============================================
B D             X. tropicalis  ============================================
B D       Medium ground finch  ============================================
B D                   Opossum  ============================================
  D    White-throated sparrow  ============================================
          Tibetan ground jay  ============================================
B D           Tasmanian devil  ============================================

Inserts between block 11 and 12 in window
         Cape elephant shrew 291bp

Alignment block 12 of 1557 in window, 75827322 - 75827348, 27 bps 
B D                     Human  cagc-agcca------aa-----ctgtcct--ttctgc---ttc
B D                     Chimp  cagc-ggcca------aa-----ctgtcct--ttctgc---ttc
B D                   Gorilla  cagc-ggcca------aa-----ctgtcct--ttctgc---ttc
B D                 Orangutan  cagc-ggcca------aa-----ctgtcct--ttctgc---ttc
B D                    Gibbon  cagt-ggcca------aa-----ctgtcct--ttctgc---ttc
B D                    Rhesus  cagc-ggcca------aa-----ctgtcct--ttctgc---ttc
B D       Crab-eating macaque  cagc-ggcca------aa-----ctgtcct--ttctgc---ttc
B D                    Baboon  cagc-ggcca------aa-----ctgtcct--ttctgc---ttc
B D              Green monkey  aagc-ggccc------aa-----ctgtcct--ttctgc---ttc
B D                  Marmoset  cagt-ggcca------aa-----cagtcct--ttctgc---ttc
B D           Squirrel monkey  cagt-ggcta------aa-----ctgtcct--ttctgc---ttc
B D                  Bushbaby  aagctagcca------aa-----ctggcct--tgctgc---ttc
           Chinese tree shrew  cagg-------------------cggtccc--ttctgc---ttc
B D                  Squirrel  ---c-agtca------ca-----ttgtctt--ttctgc---tg-
       Lesser Egyptian jerboa  ---c-agtaa------aa-----ctgtcct--ttctgt---t--
                 Prairie vole  ---a-agcca------aa-----ctgtcct--ttctgc---tgc
B D           Chinese hamster  ---c-agcca------aa-----ctgtcct--ttcggc---tgc
               Golden hamster  ---c-agcca------ga-----ctgtcct--ttcggc---tgc
B D                     Mouse  ---c-agcca------aa-----ctc-cct--ttctgc---ggc
B D                       Rat  ---c-agcca------aa-----ctctcct--gtgtgt---ggc
B D            Naked mole-rat  ---c-agcca------ga-----ctgccct--ttctcctgt---
B D                Guinea pig  --------ca------caagtatctgcctc--------------
                   Chinchilla  ---c-tgcca------ga-----ctgcctt--ttctcc------
             Brush-tailed rat  --------ca------ga-----ctacctttctccttc------
B D                    Rabbit  ---c-tgtcc------tg------tgtcct--ttctgc------
B D                       Pig  ca----gcca------aa-----ctgtccc--ttctgt---ttt
B D                    Alpaca  cagctcgcca------aa-----ctgtcct--tcgtgt---ttt
               Bactrian camel  cagctcgcca------aa-----ctgtcct--ttgtgt---ttt
B D                   Dolphin  cagatagcca------aa-----ctgt-----------------
                 Killer whale  cagatagcca------aa-----ctgt-----------------
             Tibetan antelope  t-----gcca------aa-----ctgt-----------------
B D                       Cow  c-----gcca------aa-----ccgt-----------------
B D                     Sheep  t-----gcca------aa-----ccgt-----------------
                Domestic goat  t-----gcca------aa-----ctgt-----------------
B D                     Horse  cagctagcca------ag-----ctgttct--tttt-----ttc
B D          White rhinoceros  cagctagcca------ag-----ctatccg--ttgt-----ttc
B D                       Cat  cagttggcca------ag-----ctgtcct--tcctgc---t--
B D                       Dog  tggctggcca------ag-----ctgtctt--ttctgc---ttc
B D                   Ferret   tggctggcca------ag-----ctgactt--ttctgc---ttc
B D                     Panda  tggctggcca------ag-----ctgtctt--ttctgc---ttc
               Pacific walrus  cggctggcca------ag-----ctgtctt--ttctgc---ttc
                 Weddell seal  cggctggcca------ag-----ccgtctt--ttctgc---ttc
             Black flying-fox  tggttagcca------ag-----ctgtcct--ctctgc---ttc
B D                   Megabat  tagttagcca------ag-----ctgtcct--ctctgc---ttc
                Big brown bat  aggttagcca------ag-----ctgtcct--ttccgc---ttc
         David's myotis (bat)  tggttagcca------ag-----ctggcct--ttcggc---ttc
B D                  Microbat  tggttagcca------ag-----ctgtccc--ttctgc---ttc
B D                  Hedgehog  cagctagtca------aa-----ctgc--t--ttctgc---ttc
B D                     Shrew  catctgtccgtgc---ag-----ctcc--c--ctccgg---ccc
              Star-nosed mole  cagctagcca------gg-----ctgg--c--ctctgc---gcc
B D                  Elephant  cagctagcca------ag-----ct-tcct--ttctgc---tct
B D                   Manatee  tagctagccg------ag-----ct-tcct--ttctgc---tct
             Cape golden mole  --actagcca------gg-----tt-tgct--tccagc---tct
                     Aardvark  ----cagcca------ga-----tt-tccc--tcctgc---tct
B D                 Armadillo  --cctagctg----------------tcct--tccggc---gtc
B D        American alligator  ------------cagcag-----cttctcc--tattcc------
  D           Green seaturtle  ------------cctgcg-----cttaccc--t-----------
B D                    Tenrec  ============================================
         Cape elephant shrew  ============================================
B D                      Pika  ============================================
      Yellowbelly pufferfish  ============================================
B D                      Fugu  ============================================
B D               Stickleback  ============================================
         Pundamilia nyererei  ============================================
                 Zebra mbuna  ============================================
       Burton's mouthbreeder  ============================================
         Princess of Burundi  ============================================
B D                    Medaka  ============================================
B D                Coelacanth  ============================================
B D                    Turkey  ============================================
                 Spotted gar  ============================================
  D              Mallard duck  ============================================
B D                Budgerigar  ============================================
B D                   Wallaby  ============================================
B D                    Lizard  ============================================
          Southern platyfish  ============================================
    Mexican tetra (cavefish)  ============================================
  D          Peregrine falcon  ============================================
B D                 Zebrafish  ============================================
  D               Rock pigeon  ============================================
B D              Nile tilapia  ============================================
  D            Painted turtle  ============================================
B D                 Tetraodon  ============================================
B D                   Chicken  ============================================
B D              Atlantic cod  ============================================
  D       Collared flycatcher  ============================================
  D  Chinese softshell turtle  ============================================
B D               Zebra finch  ============================================
  D              Saker falcon  ============================================
B D             X. tropicalis  ============================================
B D       Medium ground finch  ============================================
B D                   Opossum  ============================================
  D    White-throated sparrow  ============================================
          Tibetan ground jay  ============================================
B D           Tasmanian devil  ============================================

Inserts between block 12 and 13 in window
B D               Guinea pig 128bp
B D                   Rabbit 3bp

Alignment block 13 of 1557 in window, 75827349 - 75827349, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  t
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  g
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  t
B D                       Rat  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                       Pig  t
B D                    Alpaca  c
               Bactrian camel  c
B D                     Horse  t
B D          White rhinoceros  c
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  t
              Star-nosed mole  c
B D        American alligator  t
B D                    Tenrec  =
B D                Guinea pig  =
B D                  Elephant  -
            Tibetan antelope  -
         Cape elephant shrew  =
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  -
B D                  Squirrel  -
B D                      Pika  =
B D                 Armadillo  -
B D                   Manatee  -
      Lesser Egyptian jerboa  -
B D                       Cat  -
B D            Naked mole-rat  -
                Killer whale  -
            Cape golden mole  -
B D                   Dolphin  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  -
B D       Medium ground finch  =
B D                   Opossum  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  =

Alignment block 14 of 1557 in window, 75827350 - 75827463, 114 bps 
B D                     Human  g-tctgtc---tgt---------gcca--------gc-----cctgccgcctgcca------gc------
B D                     Chimp  g-tctgtc---tgt---------gcca--------gc-----cccgctgcctgcca------gc------
B D                   Gorilla  g-tctgtc---tgt---------gcca--------gc-----cccgccgcctgcca------gc------
B D                 Orangutan  g-tctgtc---cgt---------gcca--------gc-----cccgccgcctgcca------gc------
B D                    Gibbon  g-tctgtc---cgt---------gcca--------gc-----cccgccgcctgcca------gc------
B D                    Rhesus  g-tctgtc---cgt---------gcca--------gc-----cccgccgcctgcca------gc------
B D       Crab-eating macaque  g-tctgtc---cgt---------gcca--------gc-----cccgccgcctgcca------gc------
B D                    Baboon  g-tctgtc---cgt---------gcca--------gc-----cccgccgcctgcca------gc------
B D              Green monkey  g-tctgtc---tgt---------gcca--------gc-----cccgccgcctgcca------gc------
B D                  Marmoset  g-tctgtc---tgt---------gcca--------tcc----cctgccacctgcca------gc------
B D           Squirrel monkey  g-tctgtc---tgt---------gcca--------cca----cctgccacctgcca------gc------
B D                  Bushbaby  a-tccctc---cat---------gcca--------gc-----cctgttgcctgcca------gc------
           Chinese tree shrew  g-tccctc---cat---------gcca--------gc-----ctcactgccc-cca------gc------
B D                  Squirrel  --tccatt---ggt---------gcca--------gc-----cctgctgcctgcca------gc------
       Lesser Egyptian jerboa  --tctatt---tgt---------gcca--------gc-----cgtgctgcctgcca------gc------
                 Prairie vole  gccccatc---tgt---------gcca--------ac-----cctgcttcctgcca------gc------
B D           Chinese hamster  a-tccatc---tgt---------gcca--------gc-----tctgcttcctgcca------gc------
               Golden hamster  a-tccatc---tg--------------------------------------tgcca------gc------
B D                     Mouse  g-tccatc---tgt---------gcct--------ac-----ccagcttcctgcca------gc------
B D                       Rat  c-tccatc---tgt---------gcct--------gc-----cctccttcctgcca------gc------
B D            Naked mole-rat  ---ctcct---ggt---------gtca--------gt-----cccactgccttcca------gc------
                   Chinchilla  g-ttccct---ggt---------gtca--------gt-----ctca-cgcctgcca------ac------
             Brush-tailed rat  g-ttccct---ggt---------gtca--------gt-----ctcgttgcctgcca------gc------
B D                    Rabbit  c-tcaccc---cat---------acca--------gc-----cctgctgtcggttg------ga------
B D                       Pig  g-tcccgc---tgt---------gcca--------gc-----cccactgcctgcca------gt------
B D                    Alpaca  g-cccttc---tgtgccagct--tcca--------gc-----cccactgctcacca------gt------
               Bactrian camel  g-cccttc---tgtgccagct--tcca--------gc-----cccactgctcacca------gt------
B D                   Dolphin  -----------------------gcca--------gc-----cccactgcccacca------gt------
                 Killer whale  -----------------------gcca--------gc-----cccactgcccacca------gt------
             Tibetan antelope  ------------------------------------c-----cccacggcctgcca------gt------
B D                       Cow  ------------------------------------c-----cccacggcctgcca------gt------
B D                     Sheep  ------------------------------------c-----cccacggcctacca------gt------
                Domestic goat  ------------------------------------c-----cccacggcctacca------gt------
B D                     Horse  g-ccccac---cgt---------ccca--------gc-----cccactgcctgcca------gt------
B D          White rhinoceros  a-ctcctc---cat---------gcta--------gc-----cccactgcctgcca------gc------
B D                       Cat  ----cctc---tat---------gcca--------gc-----cccactgcctgcca------gt------
B D                       Dog  g-cccctc---cac---------gcca--------gc-----cccattccctgcca------gc------
B D                   Ferret   g-cttctc---ctt---------gcca--------ac-----cccactgcctgcca------gc------
B D                     Panda  g-tccctc---cat---------gcca--------gc-----cccactgcctgcca------gc------
               Pacific walrus  g-ctcctc---cat---------gcca--------gc-----cccactgcctgcca------gc------
                 Weddell seal  g-cccctc---cat---------gcca--------gc-----cccactgcctgcca------gt------
             Black flying-fox  g-cccctc---cat---------gcca--------gc-----cccactgcctggca------gc------
B D                   Megabat  g-cccctc---cat---------gcca--------gc-----cccactgcctgcca------gc------
                Big brown bat  g--ccctc---cat---------gcca--------gcccactccccccgcctgcca------gc------
         David's myotis (bat)  a--ccctc---cat---------gcca--------gc-----ccccctgcctgcca------gc------
B D                  Microbat  g--ccctc---cgt---------ggca--------gc-----ccccctgcctgcca------gc------
B D                  Hedgehog  a-cccctc---caa---------acca--------gc-----cctgctgcctgctg------gc------
B D                     Shrew  g-acccctgaactc---------tcca--------tc-----cc--------------------------
              Star-nosed mole  c-acctct---cac---------gcca--------cc-----cc--------------------------
B D                  Elephant  -----------------------------------gc-----cc---tcagtgcca------gc------
B D                   Manatee  -----------------------------------gc-----cct--tccctgcca------gc------
             Cape golden mole  -----------------------------------gc-----tc---tccgtgcca------gc------
                     Aardvark  -----------------------------------gc-----cc---tccatgtca------gc------
B D                 Armadillo  -----------------------------------gc-----cc---ctcctgcca------gc------
B D           Tasmanian devil  --------------gtctggtgggctacccatgatgc-----tacgctgcttctca------gt------
B D        American alligator  ------------------------------------------ttccgtttctggcagcaccggcagagca
  D           Green seaturtle  ---------------------------------------------------tgaca------gcagctcc
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
         Cape elephant shrew  ======================================================================
B D                      Pika  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D               Stickleback  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                    Medaka  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Opossum  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================

                        Human  -----tcttgc-------------tccctcag---agccag--aag-g------------tt--------
                        Chimp  -----tcttgc-------------tccctcag---agccag--aag-g------------tt--------
                      Gorilla  -----tcttgc-------------tccctcag---agccag--aag-g------------tt--------
                    Orangutan  -----tcttgc-------------tccctcag---agccag--aag-g------------tt--------
                       Gibbon  -----tcttgc-------------t-cctcag---agccag--aag-g------------tt--------
                       Rhesus  -----tcttgc-------------tccctcag---agccag--aag-g------------tt--------
          Crab-eating macaque  -----tcttgc-------------tccctcag---agccag--aag-g------------tt--------
                       Baboon  -----tcttgc-------------tccctcag---agccag--aag-g------------tt--------
                 Green monkey  -----tcttgc-------------tccctcag---agccag--aag-g------------tt--------
                     Marmoset  -----tctcga-------------tccctcag---agccag--aag-g------------t---------
              Squirrel monkey  -----tctcgc-------------tccctcag---agccag--aag-g------------tt--------
                     Bushbaby  -----tct--c-------------tctctcag---ag---------------------------------
           Chinese tree shrew  -----tcgaac-------------ccctccag---agccag--cagtg------------tg--------
                     Squirrel  -----tctca----------------ttccag---agccaa--agt-c------------ct--------
       Lesser Egyptian jerboa  -----tgccc----------------tcccag---agccac--tgt-c------------cc--------
                 Prairie vole  -----tctca----------------cctc----------------------------------------
              Chinese hamster  -----tctca----------------cctcag---agccaa--agt-c------------tt--------
               Golden hamster  -----tctca----------------cctc-----agccag--agt-c------------tt--------
                        Mouse  -----tctca----------------cctcag---agccag--agt-c------------tc--------
                          Rat  -----tctca----------------cctcag---agccag--agt-c------------tc--------
               Naked mole-rat  -----t-----------------------cag---agccga--aaa-g------------tc--------
                   Chinchilla  -----t-----------------------cag---agtcaa--aaa-a------------tc--------
             Brush-tailed rat  -----t-----------------------cag---agccaa--aaa-g------------tc--------
                       Rabbit  -----ggcca----------------caccag---agccag--aag-g------------cc--------
                          Pig  -----tctca--------------tcccttcg---ggccagagaag-g------------tc--------
                       Alpaca  -----tctcac------------tcccttcac---agctag--aag-g------------cc--------
               Bactrian camel  -----tctcac------------ccccttcac---agctag--aag-g------------cc--------
                      Dolphin  -----tctcac-------------cccttcag---agccag---ag-g------------tc--------
                 Killer whale  -----tctcac-------------cccttcag---agccag--aag-g------------tc--------
             Tibetan antelope  -----tctca--------------ctcttctg---aaccag--aag-g------------tc--------
                          Cow  -----tctca--------------cccttctg---agtgag--aag-g------------tc--------
                        Sheep  -----tctca--------------cccttctg---agccag--aag-g------------tc--------
                Domestic goat  -----tctca--------------cccttctg---agccag--aag-g------------tc--------
                        Horse  -----gctcac-------------tccttcag---agccag--aag-g------------tc--------
             White rhinoceros  -----gctccc-------------tccttcag---agccag--aag-g------------tc--------
                          Cat  -----tctcac-------------ctcttcag---agccag--aag-g------------tt--------
                          Dog  -----tttcac-------------ctcttcag---agccag--aag-g------------tc--------
                      Ferret   -----cttcac-------------ctctg-aa---agccag--aag-g------------tc--------
                        Panda  -----tttcac-------------ctctgcag---ggcagg--aag-g------------tc--------
               Pacific walrus  -----tttcac-------------ctcttctg---agccag--aag-c------------tc--------
                 Weddell seal  -----tttcac-------------ctcttcag---agccag--aag-c------------tc--------
             Black flying-fox  -----tctcac-------------ttctc------agccag--aag-g------------tc--------
                      Megabat  -----tctcac-------------ttctc------agccag--aag-g------------tc--------
                Big brown bat  -----tctctc-------------ctg-------------------------------------------
         David's myotis (bat)  -----tctctc-------------ctggc------ag-agc--cgg-g------------tc--------
                     Microbat  -----tctctc-------------ctggc------ag-agc--cgg-g------------tc--------
                     Hedgehog  -----tatcat-------------cgtttcag---aactag--acg-g------------cc--------
                        Shrew  ----------------------------tgac---cacccg--gag-gcagctaaacaccct--------
              Star-nosed mole  ----------------------------ccag---aacctg--gag-g------------cc--------
                     Elephant  -----ccac--------------------------tgcctg--tag-c------------tctca-----
                      Manatee  -----ccgc--------------------------tgccag--caa-c------------tctca-----
             Cape golden mole  -----ccac--------------------------caccta--cag-c------------tctca-----
                     Aardvark  -----cccc--------------------------tgcctg--cag---------------ctca-----
                    Armadillo  -----tctcac--------------------a---cattca--gaa-c------------cttcagaggt
              Tasmanian devil  -----cctacccatgatgccatgctgcttctc---agtcac--cac-c------------tt--------
           American alligator  tcccntgctgc-------------tcctggagcagagctaa--ggg-c------------tg--------
              Green seaturtle  ccccttcccac-------------cctttcagctctgctcc------c------------tc--------
                       Tenrec  ======================================================================
                   Guinea pig  ======================================================================
          Cape elephant shrew  ======================================================================
                         Pika  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  -ctt------------------------g----gctcc------aggctt--------------------
                        Chimp  -ctt------------------------g----gctcc------aggctt--------------------
                      Gorilla  -ctt------------------------g----gctcc------aggcttcctggcctggatgctggc--
                    Orangutan  -ctt------------------------g----gctcc------aggctt--------------------
                       Gibbon  -ctt------------------------g----gctcc------aggctt--------------------
                       Rhesus  -ctt------------------------g----gctcc------aggcct--------------------
          Crab-eating macaque  -ctt------------------------g----gctcc------aggcct--------------------
                       Baboon  -ctt------------------------g----gctcc------aggcct--------------------
                 Green monkey  -ctt------------------------g----gctcc------aggcct--------------------
                     Marmoset  -----------------------------------tcc------aggctt--------------------
              Squirrel monkey  -ctt------------------------g----gctcc------agactt--------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  -cttgtttatgtgggggtgaggaggtggg----gccctcagcgagggcctttgaccaatggggtgggcca
                     Squirrel  -ttg------------------------g----tctct--------------------------------
       Lesser Egyptian jerboa  -tga------------------------t----tccca------gctc----------------------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  -ccc------------------------a----cctcc------cccc----------------------
               Golden hamster  -ccc------------------------a----cctcc------cctc----------------------
                        Mouse  --tt------------------------c----ttccc------acct----------------------
                          Rat  -ttt------------------------t----ttccc------actt----------------------
               Naked mole-rat  -cat------------------------a----ccagg------actg----------------------
                   Chinchilla  -cat------------------------a----ccagg------actg----------------------
             Brush-tailed rat  -ggt------------------------a----ct--g------gctg----------------------
                       Rabbit  -cag------------------------g----ctc----------------------------------
                          Pig  -ctt-----------------------------------------ggctt--------------------
                       Alpaca  -cct------------------------g----gctct------aggctc--------------------
               Bactrian camel  -cct------------------------g----gctct------aggctc--------------------
                      Dolphin  -cct------------------------g----gctct------aggctc--------------------
                 Killer whale  -cct------------------------g----gctct------aggctc--------------------
             Tibetan antelope  -cct------------------------g----gctcc------cggctt--------------------
                          Cow  -cct------------------------g----gctcc------cggctt--------------------
                        Sheep  -cct------------------------g----gctcc------cggctt--------------------
                Domestic goat  -cct------------------------g----gctcc------cggctt--------------------
                        Horse  -cct------------------------g----gctct------aggctc--------------------
             White rhinoceros  -cct------------------------a----gccct------aggctc--------------------
                          Cat  -c--------------------------------------------------------------------
                          Dog  -ctt------------------------g----gctct------aggctc--------------------
                      Ferret   -ctt------------------------g----gct----------------------------------
                        Panda  -ctt------------------------g----gctca------gggctc--------------------
               Pacific walrus  -ctt------------------------g----gctct------aggctc--------------------
                 Weddell seal  -ctt------------------------g----gctgt------aggctc--------------------
             Black flying-fox  -ccg------------------------g----gctcc------aggctc--------------------
                      Megabat  -ccg------------------------g----gctcc------aggctc--------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  -cct------------------------g----gctcc------aggctc--------------------
                     Microbat  -cct------------------------g----gctcc------aggctt--------------------
                     Hedgehog  -cca------------------------g----aaggg--ctctagactt--------------------
                        Shrew  -ctt------------------------g----ggggg------ggg-----------------------
              Star-nosed mole  -cgt------------------------g----gccgg------aggcac--------------------
                     Elephant  -ctc------------------------g----gctcc------aggctc--------------------
                      Manatee  -ccc------------------------a----gctcc------aggctc--------------------
             Cape golden mole  -cct------------------------a----gctgc------tggctc--------------------
                     Aardvark  -ccc------------------------a----gctcc------aggctc--------------------
                    Armadillo  ccct------------------------g----gctca------aggctc--------------------
              Tasmanian devil  -gct------------------------a----tcgcc------ttgctc--------------------
           American alligator  -cag------------------------ctgtggctgc------tgaggc--------------------
              Green seaturtle  -cag------------------------t----gctcg------tgaagt--------------------
                       Tenrec  ======================================================================
                   Guinea pig  ======================================================================
          Cape elephant shrew  ======================================================================
                         Pika  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  ----------------------------cctggcc--------tggatg-------------------ct
                        Chimp  ----------------------------cctggcc--------tggatg-------------------ct
                      Gorilla  --agcccctggggagaggaaccaggctccctggcc--------tggatg-------------------ct
                    Orangutan  ----------------------------cctggcc--------tggatg-------------------ct
                       Gibbon  ----------------------------cctggcc--------tggatg-------------------ct
                       Rhesus  ----------------------------cctggcc--------tggatg-------------------ct
          Crab-eating macaque  ----------------------------cctggcc--------tggatg-------------------ct
                       Baboon  ----------------------------cctggcc--------tggatg-------------------ct
                 Green monkey  ----------------------------cctggcc--------tggatg-------------------ct
                     Marmoset  ----------------------------cctggcc--------tgggtg-------------------ct
              Squirrel monkey  ----------------------------cctggcc--------tgggtg-------------------ct
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  agatccccaccttagccgtgggaacagcccacacc--------tgagtggtgaggcagctggggaagcct
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                          Pig  ----------------------------ctcagcc--------tgggtg-------------------ct
                       Alpaca  ----------------------------cttagcc----caggcgggtg-------------------ct
               Bactrian camel  ----------------------------cttagcc----ctggcgggtg-------------------ct
                      Dolphin  ----------------------------cttagcc--------tgggtg-------------------ct
                 Killer whale  ----------------------------cttagcc--------tgggtg-------------------ct
             Tibetan antelope  ----------------------------gtcagcc--------cgggtg-------------------ct
                          Cow  ----------------------------ctcagcc--------tgggtg-------------------cc
                        Sheep  ----------------------------gtcagcc--------tgggtg-------------------ct
                Domestic goat  ----------------------------gtcagct--------tgggtg-------------------ct
                        Horse  ----------------------------cttagct--------tgggtg-------------------ct
             White rhinoceros  ----------------------------cttagcc--------tgggtg-------------------ct
                          Cat  --------------------------------------------------------------------cc
                          Dog  ----------------------------cttagcc--------agggta-------------------ct
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------cttaacc--------tgggta-------------------ct
               Pacific walrus  ----------------------------cttagcc--------tgggca-------------------ct
                 Weddell seal  ----------------------------cttagcc--------tgggta-------------------ct
             Black flying-fox  ----------------------------cttagcc--------tgggtg-------------------tt
                      Megabat  ----------------------------cttagcc--------tgggtg-------------------tt
                Big brown bat  ----------------------------cttagcc--------tgggtg-------------------tt
         David's myotis (bat)  ----------------------------cttagct--------tgggtg-------------------tt
                     Microbat  ----------------------------cgtagcc--------tgggtg-------------------tt
                     Hedgehog  ----------------------------cttatct----------------------------------t
                        Shrew  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------ctcagcc----------------------------------t
                     Elephant  ----------------------------ctcagcc--------agggtg-------------------cc
                      Manatee  ----------------------------ctcagcc--------agggtg-------------------ct
             Cape golden mole  ----------------------------ctcagcc--------a-gttg-------------------ct
                     Aardvark  ----------------------------ctcagct--------cagggg-------------------ct
                    Armadillo  ----------------------------ctcacct--------g-ggtg-------------------ct
              Tasmanian devil  ----------------------------tcaggct--------tggggc---------------------
           American alligator  ----------------------------ttgggctgctgctgtttgctg-------------------tt
              Green seaturtle  ----------------------------ctcggacgct-ctgttctgct-------------------tc
                       Tenrec  ======================================================================
                   Guinea pig  ======================================================================
          Cape elephant shrew  ======================================================================
                         Pika  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  ggcagcc-----------------cctggggagaggacccagg
                        Chimp  ggcagcc-----------------cctggggagaggacccagg
                      Gorilla  ggcagcc-----------------cctggggagaggacccagg
                    Orangutan  ggcagcc-----------------cctggagagaggacccagg
                       Gibbon  ggcagcc-----------------cctggggagaggacccagg
                       Rhesus  ggcagcc-----------------cctggggagaggacccagg
          Crab-eating macaque  ggcagcc-----------------cctggggagaggacccagg
                       Baboon  ggcagcc-----------------cctggggagaggacccagg
                 Green monkey  ggcagcc-----------------cctggggagaggacccagg
                     Marmoset  ggcagtc-----------------cctggggagaagacccagc
              Squirrel monkey  ggtagcc-----------------cctggggagaagacccagg
                     Bushbaby  ---agcc-----------------cctggggaaagaaccaagg
           Chinese tree shrew  agaggct-----------------ccctgggagaggacctggg
                     Squirrel  -------------------------------------------
       Lesser Egyptian jerboa  -------------------------------------------
                 Prairie vole  -------------------------------------------
              Chinese hamster  -------------------------------------------
               Golden hamster  -------------------------------------------
                        Mouse  -------------------------------------------
                          Rat  -------------------------------------------
               Naked mole-rat  -------------------------------------------
                   Chinchilla  -------------------------------------------
             Brush-tailed rat  -------------------------------------------
                       Rabbit  -------------------------------------------
                          Pig  ggcagcc-----------c-----cctcaggagaggacccagg
                       Alpaca  ggcagcc-----------c-----ccgcaggagaggaccccag
               Bactrian camel  ggcagcc-----------c-----ccacaggagaggaccctgg
                      Dolphin  ggcagct-----------c-----ccgcaggagaggacccagg
                 Killer whale  ggcagct-----------c-----cctcaggagaggacccagg
             Tibetan antelope  ggcaggc-----------c-----cctcaggaggggacccagg
                          Cow  ggaaagc-----------c-----cctcaggagaggacccagg
                        Sheep  ggcaggc-----------c-----cctcaggaggggacccagg
                Domestic goat  ggcaggc-----------c-----cctcaggaggggacccagg
                        Horse  ggtagtc-----------a-----cctcaggagaggacccagg
             White rhinoceros  ggtagtc-----------a-----cctcaggagaggacccaag
                          Cat  agtagcc-----------g-----cctcaggagaggagccagg
                          Dog  ggcagcc-----------g-----ctccaggaggggagccagg
                      Ferret   --------------------------------------cgagg
                        Panda  ggtggcc-----------a-----cctcaggagaggggccagg
               Pacific walrus  ggcagcc-----------a-----cctcgggagaggagccagg
                 Weddell seal  ggcagcc-----------a-----cctcaggagaggagccagg
             Black flying-fox  ggcggcc-----------c-----cctcaggagaggacccggc
                      Megabat  ggcggcc-----------c-----cctcaggagaggacccggc
                Big brown bat  ggcagcc-----------c-----cgtcaggcggggacctggg
         David's myotis (bat)  ggcagcc-----------c-----cgtcaggaggggacctggg
                     Microbat  ggcagcc-----------c-----cgtcaggaggggacctggg
                     Hedgehog  ggggaca-----------cactgttctcaggagaggacctagg
                        Shrew  gagagcc-----------c-----cagtgggggcggg-gtagg
              Star-nosed mole  gggtgtc-----------c-----cctcaggagcgga-ctggg
                     Elephant  agaagca-----------c------------------------
                      Manatee  ggcagca-----------c------------------------
             Cape golden mole  ggcagcg-----------c------------------------
                     Aardvark  ggcagcc-----------c------------------------
                    Armadillo  ggcagcc-----------a------------------------
              Tasmanian devil  ------------------------cctggtgtgggggtccggg
           American alligator  ggcctcatgtggcactgtg-----ctcctgt------------
              Green seaturtle  gacagca-----------a-----ctcctggagcagg------
                       Tenrec  ===========================================
                   Guinea pig  ===========================================
          Cape elephant shrew  ===========================================
                         Pika  ===========================================
       Yellowbelly pufferfish  ===========================================
                         Fugu  ===========================================
                  Stickleback  ===========================================
          Pundamilia nyererei  ===========================================
                  Zebra mbuna  ===========================================
        Burton's mouthbreeder  ===========================================
          Princess of Burundi  ===========================================
                       Medaka  ===========================================
                   Coelacanth  ===========================================
                       Turkey  ===========================================
                  Spotted gar  ===========================================
                 Mallard duck  ===========================================
                   Budgerigar  ===========================================
                      Wallaby  ===========================================
                       Lizard  ===========================================
           Southern platyfish  ===========================================
     Mexican tetra (cavefish)  ===========================================
             Peregrine falcon  ===========================================
                    Zebrafish  ===========================================
                  Rock pigeon  ===========================================
                 Nile tilapia  ===========================================
               Painted turtle  ===========================================
                    Tetraodon  ===========================================
                      Chicken  ===========================================
                 Atlantic cod  ===========================================
          Collared flycatcher  ===========================================
     Chinese softshell turtle  ===========================================
                  Zebra finch  ===========================================
                 Saker falcon  ===========================================
                X. tropicalis  ===========================================
          Medium ground finch  ===========================================
                      Opossum  ===========================================
       White-throated sparrow  ===========================================
           Tibetan ground jay  ===========================================

Inserts between block 14 and 15 in window
  D          Green seaturtle 2bp

Alignment block 15 of 1557 in window, 75827464 - 75827466, 3 bps 
B D                     Human  ccc
B D                     Chimp  ctc
B D                   Gorilla  ctc
B D                 Orangutan  ctc
B D                    Gibbon  ctc
B D                    Rhesus  ctc
B D       Crab-eating macaque  ctc
B D                    Baboon  ctc
B D              Green monkey  ctc
B D                  Marmoset  ttc
B D           Squirrel monkey  ctc
B D                  Bushbaby  ctc
           Chinese tree shrew  ccc
B D                       Pig  ctc
B D                    Alpaca  ctt
               Bactrian camel  ctt
B D                   Dolphin  ctc
                 Killer whale  ctc
             Tibetan antelope  ttc
B D                       Cow  ttc
B D                     Sheep  ttc
                Domestic goat  ttc
B D                     Horse  ctc
B D          White rhinoceros  ctc
B D                       Cat  ctc
B D                       Dog  ctc
B D                   Ferret   ctc
B D                     Panda  ctc
               Pacific walrus  ctc
                 Weddell seal  ctc
             Black flying-fox  tcc
B D                   Megabat  tcc
                Big brown bat  ctc
         David's myotis (bat)  ctc
B D                  Microbat  ctc
B D                  Hedgehog  ccc
B D                     Shrew  cgg
              Star-nosed mole  cag
B D           Tasmanian devil  gtc
B D        American alligator  ccc
  D            Painted turtle  ccc
B D                    Tenrec  ===
B D                Guinea pig  ===
B D                       Rat  ---
B D                     Mouse  ---
              Golden hamster  ---
B D           Chinese hamster  ---
                Prairie vole  ---
B D                  Elephant  ---
         Cape elephant shrew  ===
B D                  Squirrel  ---
B D                      Pika  ===
B D                    Rabbit  ---
B D                 Armadillo  ---
B D                   Manatee  ---
                  Chinchilla  ---
      Lesser Egyptian jerboa  ---
            Brush-tailed rat  ---
B D            Naked mole-rat  ---
            Cape golden mole  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ---
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
B D                Budgerigar  ===
B D                   Wallaby  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D              Nile tilapia  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===

Alignment block 16 of 1557 in window, 75827467 - 75827512, 46 bps 
B D                     Human  --------------------------cct--ct---------agtaatggcca---ccac------cct-
B D                     Chimp  --------------------------cct--ct---------agtaatggcca---ccac------cct-
B D                   Gorilla  --------------------------cct--ct---------agtaatggcca---ccac------cct-
B D                 Orangutan  --------------------------cct--ct---------agtaatggcca---ccac------cct-
B D                    Gibbon  --------------------------cct--ct---------agtaatggcca---ccac------cct-
B D                    Rhesus  --------------------------cct--ct---------agtaatggcca---ccac------cct-
B D       Crab-eating macaque  --------------------------cct--ct---------agtaatggcca---ccac------cct-
B D                    Baboon  --------------------------cct--ct---------agtaatggcca---ccac------cct-
B D              Green monkey  --------------------------cct--ct---------agtaatggcca---ccac------cct-
B D                  Marmoset  --------------------------cct--ct---------agtaacggtca---ccac------ctt-
B D           Squirrel monkey  --------------------------cct--ct---------agtaatggtca---ccac------ctt-
B D                  Bushbaby  --------------------------cct--ct---------agtaatggaca---ccac-----tcct-
           Chinese tree shrew  --------------------------cct--gt---------agtcaaggtca---ctgc------ctc-
B D                  Squirrel  -------------------------------cc---------aataatggcca---ccac------cac-
       Lesser Egyptian jerboa  --------------------------cct--ct---------agtagtggcca---ccac------cct-
                 Prairie vole  ----------------------------------------------------------------------
B D           Chinese hamster  --------------------------cccctct---------agtaatggcca---cccc------gct-
               Golden hamster  --------------------------ccc--ct---------agtaatggcca---cccg------gct-
B D                     Mouse  --------------------------ccc--tc---------agtgatggcca---cccc------cgt-
B D                       Rat  --------------------------ccc--tc---------agtaatggcca---cccc------ctc-
B D            Naked mole-rat  --------------------------cct--cc---------agtaatggcca---tgcc------cct-
B D                Guinea pig  --------------------------cct--ct---------ggtaatagcca---ctct------cgt-
                   Chinchilla  --------------------------cct--ct---------aataatggtca---ctcc------ctt-
             Brush-tailed rat  --------------------------ttt--ct---------agtaatgacca---ctcc------cct-
B D                    Rabbit  --------------------------------------------------------------------c-
B D                       Pig  ---------------------------ct--tt---------catcatggctg---ct------------
B D                    Alpaca  ---------------------------cc--tt---------gattatggttg---ct------------
               Bactrian camel  ---------------------------cc--tt---------gattatggttg---ct------------
B D                   Dolphin  ---------------------------cc--tt---------cattatggctg---ct------------
                 Killer whale  ---------------------------cc--tt---------cattatggctg---ct------------
             Tibetan antelope  ---------------------------cc--tc---------catcacaggtg---ct------------
B D                       Cow  ---------------------------cc--tc---------catcacaggta---ct------------
B D                     Sheep  ---------------------------cc--tc---------catcacaggtg---ct------------
                Domestic goat  ---------------------------cc--tc---------catcacaggtg---ct------------
B D                     Horse  ---------------------------cc--tt---------cattatggcca---ccat------ccc-
B D          White rhinoceros  ---------------------------cc--tt---------cagtatggcca---ccac------ccc-
B D                       Cat  ---------------------------cc--tt---------cattatagctg---ccac------cct-
B D                       Dog  ---------------------------cc--tt---------cattagaactg---tcgc------cct-
B D                   Ferret   ---------------------------cc--ct---------catgacagccg---ctgc------cct-
B D                     Panda  ---------------------------cc--tc---------cattagagctg---ccac------cct-
               Pacific walrus  ---------------------------cc--tt---------cattagagctg---ccgc------cct-
                 Weddell seal  ---------------------------cc--tt---------ccttatagctg---ctgc------cct-
             Black flying-fox  ---------------------------ac-----------------------------------------
B D                   Megabat  ---------------------------cc--t--------------------------------------
                Big brown bat  ---------------------------ct--t----------ccttatggcta---cc------------
         David's myotis (bat)  ---------------------------ct--t----------cattatggcta---cc------------
B D                  Microbat  ---------------------------ct--t----------cattatggcta---cc------------
B D                  Hedgehog  ---------------------------ct--tta--------caacatgactg---ccac------tcc-
B D                     Shrew  ---------------------------------------------------gg---ccac------tgc-
              Star-nosed mole  ---------------------------cg--tt---------caccgcgacgg---ccac------ccc-
B D                  Elephant  ---------------------------cc--ct---------cagtgacgcca---ccac------cctg
B D                   Manatee  ---------------------------cc--ct---------taatgacacca---ccac------cgc-
             Cape golden mole  ---------------------------cc--ct---------ctgtgatgcca---cctc------ccta
                     Aardvark  ---------------------------cc--ct---------cagtgccgcca---ccac------ccc-
B D                 Armadillo  ---------------------------cc--tt---------ggaaggggccc---cgac------cct-
B D           Tasmanian devil  ---------------------------------aggggtgaccgtcggagcca---g-------------
B D        American alligator  cttctcctcccttgccagttgcag---cc--ca---------gagcagagcaggtcctgtggaaatggc-
  D           Green seaturtle  -----------ggaacagctgctgct-gc--tc---------cagcagggccag--ctggatagatttc-
  D            Painted turtle  cttcccat--cctttcagct-ctgctccc--tc---------cagca---------ctagtgaagtctt-
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                      Pika  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D               Stickleback  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                    Medaka  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
B D              Nile tilapia  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Opossum  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================

                        Human  ----------ccc----cc--c---------agggcagc-tggagcctc
                        Chimp  ----------ccc----cc--t---------agggcagc-tggagcctc
                      Gorilla  ----------ccc----cc--c---------agggcagc-tggagcctc
                    Orangutan  ----------ccc----cc--c---------agggcagc-tggagcctc
                       Gibbon  ----------ccc----cc--c---------agggcagc-tggagcctc
                       Rhesus  ----------ccc----ct--c---------agggcagc-tggagcctc
          Crab-eating macaque  ----------ccc----ct--c---------agggcagc-tggagcctc
                       Baboon  ----------cct----ct--c---------agggcagc-tggagcctc
                 Green monkey  ----------ccc----ct--c---------agggcagc-tggagcctc
                     Marmoset  ----------ccc----cc--c---------aggacagc-tggagcctc
              Squirrel monkey  ----------ccc----cc--c---------agggcagc-tggagcctc
                     Bushbaby  ----------cct----cccac---------agggcagg-tggagcctt
           Chinese tree shrew  ----------ctt----cc--c---------agcacagcgtgtggcctt
                     Squirrel  ----------cctt--ccc--c--------tggggca------------
       Lesser Egyptian jerboa  ----------tct-----c--c---------caggca------------
                 Prairie vole  -----------ctg--cac--c---------agggtg------------
              Chinese hamster  ----------cctg--cac--c---------agggca------------
               Golden hamster  ----------cctg--cac--c---------agggca------------
                        Mouse  ----------cctg--cac--c---------aggatg------------
                          Rat  ----------cctg--cac--c---------agggcg------------
               Naked mole-rat  ----------ccc-----t--c---------aggacagc-tggtacctc
                   Guinea pig  ----------ccc-----a--c---------agggcagc-aggcacctc
                   Chinchilla  ----------ccc-----t--t---------gggacaga-tggcacc--
             Brush-tailed rat  ----------ccc-----t--t---------aggacagc-tggcacctc
                       Rabbit  ----------tcc-----c--c---------agggca------------
                          Pig  -------------------------------------------------
                       Alpaca  -------------------------------------------------
               Bactrian camel  -------------------------------------------------
                      Dolphin  -------------------------------------------------
                 Killer whale  -------------------------------------------------
             Tibetan antelope  -------------------------------------------------
                          Cow  -------------------------------------------------
                        Sheep  -------------------------------------------------
                Domestic goat  -------------------------------------------------
                        Horse  ----------tacac-cgc--c---------agggcagc-tgtagcttc
             White rhinoceros  ----------tgcccaccc--c---------aaggcagc-tgtagcctc
                          Cat  ----------ccc---tct--c---------agggcagc-ggtagcccc
                          Dog  ----------ccc---cac--t---------agcgcagc-tgtagcctt
                      Ferret   ----------agc---cac--c---------agggcagc-tgtagcctg
                        Panda  ----------ccc---cac--c---------aggacagc-tgtagcctc
               Pacific walrus  ----------ccc---cac--c---------agggcagc-tgtagcctc
                 Weddell seal  ----------ccc---tgc--c---------agggcagc-tgtagcctc
             Black flying-fox  ----------------ccc--c---------agggcagc-tgtagcctc
                      Megabat  ----------------ccc--c---------agggcagc-tgtagcctc
                Big brown bat  ----------cgc---ccc--c---------agggcagt-tgtgcccac
         David's myotis (bat)  ----------cgc---ccc--c---------agggcact-tgtgcccac
                     Microbat  ----------agc---ccc--c---------agggcagt-tttgcccac
                     Hedgehog  ----------acc---tcc--c------ctcagtactga-ggtagcctc
                        Shrew  ----------ttg---tcc--cacagaggggaggggggc-tggggcctc
              Star-nosed mole  ----------cgg---gcc--t---------------gc-tgtggcct-
                     Elephant  -----gggggctc---cac--t---------caggcagc-t--------
                      Manatee  -----agggcctc---cac--c---------caggcagc-cgcagcctc
             Cape golden mole  cccctgggggctc---cac--c---------caggcagc-tgcagcctc
                     Aardvark  -----gggggctt---cac--c---------caggcagc-tgcagcctc
                    Armadillo  -----ttgtcctc---ca-------------tggacagc-tgcagcctt
              Tasmanian devil  -------------------------------------------------
           American alligator  -------------------------------------------------
              Green seaturtle  -------------------------------------------------
               Painted turtle  -------------------------------------------------
                       Tenrec  =================================================
          Cape elephant shrew  =================================================
                         Pika  =================================================
       Yellowbelly pufferfish  =================================================
                         Fugu  =================================================
                  Stickleback  =================================================
          Pundamilia nyererei  =================================================
                  Zebra mbuna  =================================================
        Burton's mouthbreeder  =================================================
          Princess of Burundi  =================================================
                       Medaka  =================================================
                   Coelacanth  =================================================
                       Turkey  =================================================
                  Spotted gar  =================================================
                 Mallard duck  =================================================
                   Budgerigar  =================================================
                      Wallaby  =================================================
                       Lizard  =================================================
           Southern platyfish  =================================================
     Mexican tetra (cavefish)  =================================================
             Peregrine falcon  =================================================
                    Zebrafish  =================================================
                  Rock pigeon  =================================================
                 Nile tilapia  =================================================
                    Tetraodon  =================================================
                      Chicken  =================================================
                 Atlantic cod  =================================================
          Collared flycatcher  =================================================
     Chinese softshell turtle  =================================================
                  Zebra finch  =================================================
                 Saker falcon  =================================================
                X. tropicalis  =================================================
          Medium ground finch  =================================================
                      Opossum  =================================================
       White-throated sparrow  =================================================
           Tibetan ground jay  =================================================

Inserts between block 16 and 17 in window
B D                    Shrew 14bp
             Star-nosed mole 7bp

Alignment block 17 of 1557 in window, 75827513 - 75827520, 8 bps 
B D                     Human  atctttgg-------
B D                     Chimp  atctttgg-------
B D                   Gorilla  atctttgg-------
B D                 Orangutan  atcttggg-------
B D                    Gibbon  atctttgg-------
B D                    Rhesus  atctttgg-------
B D       Crab-eating macaque  atctttgg-------
B D                    Baboon  atctttgg-------
B D              Green monkey  atctttgg-------
B D                  Marmoset  atctttgg-------
B D           Squirrel monkey  atctttgg-------
B D                  Bushbaby  atacttgg-------
           Chinese tree shrew  atctctga-------
B D                  Squirrel  -gct-----------
       Lesser Egyptian jerboa  -gctttgg-------
                 Prairie vole  -gctttga-------
B D           Chinese hamster  -tctggga-------
               Golden hamster  -attctga-------
B D                     Mouse  -cctttga-------
B D                       Rat  -gctttga-------
B D            Naked mole-rat  atctttgg-------
B D                Guinea pig  atcttgtt-------
                   Chinchilla  -tcttggg-------
             Brush-tailed rat  gtcttaga-------
B D                    Rabbit  -gcata---------
B D                     Horse  atctctgg-------
B D          White rhinoceros  atttttgg-------
B D                       Cat  agccccag-------
B D                       Dog  gtctttcg-------
B D                   Ferret   gtctctgg-------
B D                     Panda  gtctctgg-------
               Pacific walrus  gtctctgg-------
                 Weddell seal  gtctctgg-------
             Black flying-fox  atcttggg-------
B D                   Megabat  atcttggg-------
                Big brown bat  agccctgg-------
         David's myotis (bat)  agccctgg-------
B D                  Microbat  agccctgg-------
B D                  Hedgehog  -tccgtag-------
              Star-nosed mole  gtccgt---------
B D                  Elephant  -------g-------
B D                   Manatee  acagccgg-------
             Cape golden mole  atggccca-------
                     Aardvark  gtggc----------
B D                 Armadillo  gaccgtga-------
B D           Tasmanian devil  ggcactga-------
B D        American alligator  -------aaaacagc
  D           Green seaturtle  -------a-------
  D            Painted turtle  -------g-------
B D                    Tenrec  ===============
            Tibetan antelope  ---------------
         Cape elephant shrew  ===============
B D                     Shrew  ===============
               Domestic goat  ---------------
B D                     Sheep  ---------------
B D                       Cow  ---------------
B D                    Alpaca  ---------------
B D                      Pika  ===============
                Killer whale  ---------------
              Bactrian camel  ---------------
B D                   Dolphin  ---------------
      Yellowbelly pufferfish  ===============
B D                      Fugu  ===============
B D               Stickleback  ===============
         Pundamilia nyererei  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D                    Medaka  ===============
B D                Coelacanth  ===============
B D                    Turkey  ===============
                 Spotted gar  ===============
  D              Mallard duck  ===============
B D                Budgerigar  ===============
B D                   Wallaby  ===============
B D                    Lizard  ===============
          Southern platyfish  ===============
    Mexican tetra (cavefish)  ===============
  D          Peregrine falcon  ===============
B D                 Zebrafish  ===============
  D               Rock pigeon  ===============
B D              Nile tilapia  ===============
B D                 Tetraodon  ===============
B D                   Chicken  ===============
B D              Atlantic cod  ===============
  D       Collared flycatcher  ===============
  D  Chinese softshell turtle  ===============
B D               Zebra finch  ===============
  D              Saker falcon  ===============
B D             X. tropicalis  ===============
B D       Medium ground finch  ===============
B D                   Opossum  ===============
  D    White-throated sparrow  ===============
          Tibetan ground jay  ===============
B D                       Pig  ---------------

Alignment block 18 of 1557 in window, 75827521 - 75827600, 80 bps 
B D                     Human  c-agggtcccctctcccttttccagg--------------------------------------------
B D                     Chimp  c-agggtcccctctccctttcccagg--------------------------------------------
B D                   Gorilla  c-agggtaccctctccctttcccagg--------------------------------------------
B D                 Orangutan  c-agggtcccctctcccttccccagg--------------------------------------------
B D                    Gibbon  c-agggtcccctctcccttccccagg--------------------------------------------
B D                    Rhesus  c-agggtcttc-ctcccttccccagg--------------------------------------------
B D       Crab-eating macaque  c-agggtcctc-ctcccttccccagg--------------------------------------------
B D                    Baboon  c-agggtcctc-ctcccttccccagg--------------------------------------------
B D              Green monkey  c-agggtcccc-ctcccttccccagg--------------------------------------------
B D                  Marmoset  c-agggtcccctgtcccttccccagg--------------------------------------------
B D           Squirrel monkey  c-agggtcccctgtcccttccccagg--------------------------------------------
B D                  Bushbaby  c-agggtctcctctccctttcccaga--------------------------------------------
           Chinese tree shrew  c-agg-------tcccctctactagg--------------------------------------------
B D                  Squirrel  ---ggagccccag---------ggag--------------------------------------------
       Lesser Egyptian jerboa  t-agtatcctttc---------------------------------------------------------
                 Prairie vole  c-aggatcctctcgc--cctctaaag--------------------------------------------
B D           Chinese hamster  c-aggatcctctg----tctctaaag--------------------------------------------
               Golden hamster  c-aggatcctctg------tctaaag--------------------------------------------
B D                     Mouse  c-ag--tcctctc----tctctgaag--------------------------------------------
B D                       Rat  c-ag------agt----cctctgaag--------------------------------------------
B D            Naked mole-rat  t-agttcccctcttg--ttcctcagg--------------------------------------------
B D                Guinea pig  taaatttcccttttg----cctcagg--------------------------------------------
                   Chinchilla  t-agttcccctcttg--ttcctcagg--------------------------------------------
             Brush-tailed rat  t-agtttccctcttg--ttcctcatg--------------------------------------------
B D                    Rabbit  ----------------------------------------------------------------------
B D                      Pika  c-aggctcccctc------cctcaca--------------------------------------------
B D                       Pig  -------------------------g--------------------------------------------
B D                    Alpaca  -------------------------g--------------------------------------------
               Bactrian camel  -------------------------g--------------------------------------------
B D                   Dolphin  -------------------------g--------------------------------------------
                 Killer whale  -------------------------g--------------------------------------------
             Tibetan antelope  -------------------------g--------------------------------------------
B D                       Cow  -------------------------g--------------------------------------------
B D                     Sheep  -------------------------g--------------------------------------------
                Domestic goat  -------------------------g--------------------------------------------
B D                     Horse  c-gggatcccctctcccttccccagg--------------------------------------------
B D          White rhinoceros  c-aggatcccctctcccttccccaga--------------------------------------------
B D                       Cat  t-gaa----------------ccagg--------------------------------------------
B D                       Dog  c-agggtccc--ctccctcccccagg--------------------------------------------
B D                   Ferret   c-agggtccc--ctcccctccgcagg--------------------------------------------
B D                     Panda  t-ggggtccc--cttcctcccctagg--------------------------------------------
               Pacific walrus  c-agggtccc--ctccctcccccagg--------------------------------------------
                 Weddell seal  c-agggcccc--ctccctcccccagg--------------------------------------------
             Black flying-fox  c-agggtcacctctccctcccctagg--------------------------------------------
B D                   Megabat  c-agggtcacctctccctcccctagg--------------------------------------------
                Big brown bat  ------------------ccccaatg--------------------------------------------
         David's myotis (bat)  ------------------ccccagtgagtctgagtggggggctgaagaggcccaagggagcctcccccac
B D                  Microbat  ------------------ccccaatg--------------------------------------------
B D                  Hedgehog  c-agtggcctctctacctcccctggg--------------------------------------------
              Star-nosed mole  --------ctcctctccctgcctggg--------------------------------------------
B D                  Elephant  -cagggtgggc---ccctcccacagg--------------------------------------------
B D                   Manatee  -cagggtgccc---cctttcctcagg--------------------------------------------
             Cape golden mole  -cacggtgttt---cc-tccctcagg--------------------------------------------
                     Aardvark  --------ttc---ccctctcccaag--------------------------------------------
B D                 Armadillo  -ctgggtcccc--acccccactcagg--------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D               Stickleback  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                    Medaka  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
B D              Nile tilapia  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Opossum  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================

                        Human  --------------aga-----------------------------ctct---gt---------------
                        Chimp  --------------aga-----------------------------ctct---gt---------------
                      Gorilla  --------------aga-----------------------------ctct---gt---------------
                    Orangutan  --------------aga-----------------------------ctct---gt---------------
                       Gibbon  --------------aga-------------------------------ct---gt---------------
                       Rhesus  --------------aga-----------------------------ctct---gc---------------
          Crab-eating macaque  --------------aga-----------------------------ctct---gc---------------
                       Baboon  --------------aga-----------------------------ctct---gc---------------
                 Green monkey  --------------aga-----------------------------ccct---gc---------------
                     Marmoset  --------------agg-----------------------------ctct---gt---------------
              Squirrel monkey  --------------agg-----------------------------ctct---gt---------------
                     Bushbaby  --------------agg-----------------------------tttt---gt---------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  -----------------------------------------------gct---ct---------------
       Lesser Egyptian jerboa  -----------------------------------------------ttt---gt---------------
                 Prairie vole  -----------------------------------------------tct---g----------------
              Chinese hamster  -----------------------------------------------tct---gt---------------
               Golden hamster  -----------------------------------------------tct---g----------------
                        Mouse  ------------------------------------------------tt---gt---------------
                          Rat  -----------------------------------------------ttt---gt---------------
               Naked mole-rat  -----------------------------------------------------ag---------------
                   Guinea pig  -----------------------------------------------------gt---------------
                   Chinchilla  -----------------------------------------------------gt---------------
             Brush-tailed rat  -----------------------------------------------------gt---------------
                       Rabbit  -----------------------------------------------------gc---------------
                         Pika  -----------------------------------------------gctgtcac---------------
                          Pig  --------------aag-----------------------------------------------------
                       Alpaca  --------------aag-----------------------------------------------------
               Bactrian camel  --------------aag-----------------------------------------------------
                      Dolphin  --------------aag-----------------------------------------------------
                 Killer whale  --------------aag-----------------------------------------------------
             Tibetan antelope  --------------aag-----------------------------------------------------
                          Cow  --------------aac-----------------------------------------------------
                        Sheep  --------------aag-----------------------------------------------------
                Domestic goat  --------------aag-----------------------------------------------------
                        Horse  --------------agg-----------------------------cttt---gt---------------
             White rhinoceros  --------------aga-----------------------------cttt---gt---------------
                          Cat  --------------gaa-----------------------------------------------------
                          Dog  --------------agg-----------------------------cttt---gt---------------
                      Ferret   --------------agg-----------------------------cttt---gt---------------
                        Panda  --------------agg-----------------------------cttt---gt---------------
               Pacific walrus  --------------agg-----------------------------cttt---gt---------------
                 Weddell seal  --------------cta-------------------------------tt---gt---------------
             Black flying-fox  --------------ag------------------------------------------------------
                      Megabat  --------------ag------------------------------------------------------
                Big brown bat  --------------agt-----------------------------ctga---gt---------------
         David's myotis (bat)  ccccacacacacacagtggctggaataggtttcgggagacagatggctga---gtccctgctttgccagc
                     Microbat  --------------agt-----------------------------ctga---gt---------------
                     Hedgehog  --------------aga-----------------------------------------------------
              Star-nosed mole  --------------agc-----------------------------------------------------
                     Elephant  --------------agg-----------------------------atct---g----------------
                      Manatee  --------------agg-----------------------------atct---g----------------
             Cape golden mole  --------------agg-----------------------------ctc---------------------
                     Aardvark  --------------agg-----------------------------ctct---a----------------
                    Armadillo  --------------agg-----------------------------ccct---gt---------------
              Tasmanian devil  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------
              Green seaturtle  ----------------------------------------------------------------------
               Painted turtle  ----------------------------------------------------------------------
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  -----------------------------------------------------------------g----
                        Chimp  -----------------------------------------------------------------g----
                      Gorilla  -----------------------------------------------------------------g----
                    Orangutan  -----------------------------------------------------------------g----
                       Gibbon  -----------------------------------------------------------------g----
                       Rhesus  -----------------------------------------------------------------a----
          Crab-eating macaque  -----------------------------------------------------------------a----
                       Baboon  -----------------------------------------------------------------a----
                 Green monkey  -----------------------------------------------------------------a----
                     Marmoset  -----------------------------------------------------------------g----
              Squirrel monkey  -----------------------------------------------------------------g----
                     Bushbaby  -----------------------------------------------------------------g----
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  -----------------------------------------------------------------g----
       Lesser Egyptian jerboa  -----------------------------------------------------------------t----
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  -----------------------------------------------------------------g----
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  -----------------------------------------------------------------g----
                          Rat  -----------------------------------------------------------------g----
               Naked mole-rat  -----------------------------------------------------------------c----
                   Guinea pig  -----------------------------------------------------------------a----
                   Chinchilla  -----------------------------------------------------------------a----
             Brush-tailed rat  -----------------------------------------------------------------a----
                       Rabbit  -----------------------------------------------------------------g----
                         Pika  -----------------------------------------------------------------t----
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                        Horse  -----------------------------------------------------------------g----
             White rhinoceros  -----------------------------------------------------------------g----
                          Cat  ----------------------------------------------------------------------
                          Dog  -----------------------------------------------------------------g----
                      Ferret   ----------------------------------------------------------------------
                        Panda  -----------------------------------------------------------------g----
               Pacific walrus  -----------------------------------------------------------------g----
                 Weddell seal  -----------------------------------------------------------------g----
             Black flying-fox  -----------------------------------------------------------------ggagg
                      Megabat  -----------------------------------------------------------------ggagg
                Big brown bat  -----------------------------------------------------------------ggggg
         David's myotis (bat)  acttcccagaggagaagggcaggagatgcacagccacctccccgcccctggtgtgggatttggccgagaa
                     Microbat  -----------------------------------------------------------------ggggg
                     Hedgehog  -----------------------------------------------------------------t----
              Star-nosed mole  -----------------------------------------------------------------c----
                     Elephant  -----------------------------------------------------------------a----
                      Manatee  -----------------------------------------------------------------a----
             Cape golden mole  -----------------------------------------------------------------g----
                     Aardvark  -----------------------------------------------------------------g----
                    Armadillo  -----------------------------------------------------------------g----
              Tasmanian devil  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------
              Green seaturtle  ----------------------------------------------------------------------
               Painted turtle  ----------------------------------------------------------------------
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  ---------------------------------------cctgtag-ccct-ggtccc-a----------
                        Chimp  ---------------------------------------cctgtag-ccct-ggtccc-a----------
                      Gorilla  ---------------------------------------cctgtag-ccct-ggtccc-a----------
                    Orangutan  ---------------------------------------cctgtag-ccct-ggtccc-a----------
                       Gibbon  ---------------------------------------cctgcag-ccct-ggtccc-a----------
                       Rhesus  ---------------------------------------cctgtag-ccct-ggttcc-a----------
          Crab-eating macaque  ---------------------------------------cctgtag-ccct-ggttcc-a----------
                       Baboon  ---------------------------------------cctgtag-ccct-ggttcc-a----------
                 Green monkey  ---------------------------------------cctgtag-ccct-ggttcc-a----------
                     Marmoset  ---------------------------------------cctgcag-ccct-gctccc-a----------
              Squirrel monkey  ---------------------------------------cctgcag-ccct-gctccc-a----------
                     Bushbaby  ---------------------------------------tctatag-ccct-ggaccc-a----------
           Chinese tree shrew  -------------------------------------------------------tcc-a----------
                     Squirrel  ---------------------------------------ctcacag-cctg-ggtcct-g----------
       Lesser Egyptian jerboa  ---------------------------------------cacacag-ccct-g-----------------
                 Prairie vole  ---------------------------------------ctcacag-ccct-ggtccc-a----------
              Chinese hamster  ---------------------------------------cccacag-cccg-ggtccc-a----------
               Golden hamster  ------------------------------------------acagttctg-gaaggc-a----------
                        Mouse  ---------------------------------------gccacag-ctct-gatccc-a----------
                          Rat  ---------------------------------------cccacag-ctct-ggtcct-a----------
               Naked mole-rat  -----------------------------ctctc--tgtcccccag-ttcc-agtgcg-a----------
                   Guinea pig  ---------------------------------------cccccag-ttcc-agagcc-a----------
                   Chinchilla  ---------------------------------------cccccag-tt-------cc-a----------
             Brush-tailed rat  ---------------------------------------cccctag-tt-------cc-a----------
                       Rabbit  ---------------------------------------tctgcag-cc---------------------
                         Pika  ---------------------------------------tctgcag-gc---------------------
                          Pig  -----------------------------------------------agca-gcctca-a----------
                       Alpaca  -----------------------------------------------aaca-ggccca-a----------
               Bactrian camel  -----------------------------------------------aaca-ggccca-a----------
                      Dolphin  -----------------------------------------------aatagggccca-a----------
                 Killer whale  -----------------------------------------------aatagggccca-a----------
             Tibetan antelope  -----------------------------------------------aaca-ggcccc-a----------
                          Cow  -----------------------------------------------aaca-ggcccc-a----------
                        Sheep  -----------------------------------------------aaca-ggcccc-a----------
                Domestic goat  -----------------------------------------------aata-ggcccc-a----------
                        Horse  -tctgcaggcctgaccccaataggccc--------------------aaca-ggcaca-a----------
             White rhinoceros  -tctgcagacctggctccaatgggcctgggtagg--agtactgaag-aaca-ggcaca-a----------
                          Cat  --------------------------------gg--agagctaaag-agca-ggcccc-a----------
                          Dog  --ctgtagctctagccccagtgaaccaaggtagg--ggtgctaaag-gata-ggccca-a----------
                      Ferret   -------tcactagccccagtgaaccaaggt-ta--ggtgctcaag-aata-ggccca-a----------
                        Panda  --ccgtagccccagccacagtgacccaaggtagg--ggtgctaaag-aata-ggccag------------
               Pacific walrus  --ccatagccctagcccgagtgacccaaggtagg--ggtgctaaag-aaca-ggcccg-t----------
                 Weddell seal  --ccatagccctagccccagtgaaccaaggtagg--ggtgttaaag-aaca-ggccca-c----------
             Black flying-fox  ttctgtgc-------------------------------------c-caca-gccctg-a----------
                      Megabat  ttctgtgc-------------------------------------c-caca-gccctg-a----------
                Big brown bat  tgctgaa--------------------------------------g-aaga-ggccca-a----------
         David's myotis (bat)  tgctgagc---tggccccagtgagtctgagt-gg--ggggct---g-aaga-ggccca-a----------
                     Microbat  tgctgaa--------------------------------------g-aaga-ggccca-a----------
                     Hedgehog  -------------------------------------------------tg-tgtcta-c----------
              Star-nosed mole  -----------------------------------------------cgtg-tgcctg-c----------
                     Elephant  ---------------------------------------gccacag----------cc-a----------
                      Manatee  ---------------------------------------gccacag-ccct-ggc-cc-a----------
             Cape golden mole  ---------------------------------------gctgcag-cttt-ggc-ccaa----------
                     Aardvark  ---------------------------------------gctgcag-ccct-g---cc------------
                    Armadillo  ---------------------------------------cccacag-ccct-ggtgcc-a----------
              Tasmanian devil  ---------------------------------------ccttcac-tttc-tctccc-a----------
           American alligator  ---------cacggcccaggcccttgtctctttag-tctcctgtga-gcta-aggagc-agtgtggggcc
              Green seaturtle  ----------accctcctcccccgtcccccccca--tccccagtgg-cttt-ggttgc-a----------
               Painted turtle  ---------cacgctccgtgcggcttagacagcagctccccaatgg-cgtt-ggttgc-a----------
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  ------------gt----gaacct---gg----------c----ccc--ca-c--c-----c-----c--
                        Chimp  ------------gt----gaacct---gg----------c----ccc--ca-c--c-----c-----c--
                      Gorilla  ------------gt----gaacct---gg----------c----ccc--ca-c--c-----c-----c--
                    Orangutan  ------------gt----gaacct---gg----------c----ccc--ca-c--c-----c-----c--
                       Gibbon  ------------gt----gaacct---gg----------c----ccc--ca-c--c-----c-----c--
                       Rhesus  ------------gt----gaacct---gg----------c----ccc--ca-c--c-----c-----c--
          Crab-eating macaque  ------------gt----gaacct---gg----------c----ccc--ca-c--c-----c-----c--
                       Baboon  ------------gt----gaacct---gg----------c----ccc--ca-c--c-----c-----c--
                 Green monkey  ------------gt----gaacct---gg----------c----ccc--ca-c--c-----c-----c--
                     Marmoset  ------------gt----gaacct---gg----------c----ccc--ca-c--c-----c-----c--
              Squirrel monkey  ------------at----gaacct---gg----------c----ccc--ca-c--c-----c-----c--
                     Bushbaby  ------------gt----gagcct---cc----------c----ctc--ct-c--ttgctgc-----c--
           Chinese tree shrew  ------------gt----gagcct---gg----------c----ccc--ca-t--g-----cagtgtc--
                     Squirrel  ------------ac-----agtct---gg----------g----ccc---a-c--c-----a-----c--
       Lesser Egyptian jerboa  ---------------------------gg----------c----tcc---a-t--t-----c-----c--
                 Prairie vole  ------------ac-----tgcct--ggg----------c----cct---g-c--c-----c-----c--
              Chinese hamster  ------------ac-----tgtct---ga----------g----cct---a-c--c-----t-----c--
               Golden hamster  ------------gg-----tagctctaga----------t----gat---a-c--c-----t-----ttg
                        Mouse  ------------gt-----ggtct---gg----------c----ccc---a-c--c-----c-----c--
                          Rat  ------------gt-----agtct---gg----------c----ccc---a-c--c-----c-----c--
               Naked mole-rat  ------------ac-----cacct---gg----------t----ctccgca-c--c-----c-----c--
                   Guinea pig  ------------gc-----cacct---gg----------t----ccc--caac--c-----c-----c--
                   Chinchilla  ------------gc-----cacct---gg----------t----ccctgcacc--c-----c-----c--
             Brush-tailed rat  ------------ac-----cacct---ga----------t----ctctgta-a--c-----c-----c--
                       Rabbit  ----------------------ct---gg-----------------------c--a-----c-----c--
                         Pika  ----------------------ct---gg----------t----tcc-----c--t-----c-----c--
                          Pig  -------------g----gaacgg---ggc---------c----ctc--ca-c--c-----c-----c--
                       Alpaca  -------------g----gagcct---gg----------c----ccc--cagc--c-----c-----c--
               Bactrian camel  -------------g----gagcct---gg----------c----ccc--cagc--c-----c-----c--
                      Dolphin  -------------g----gcacct---ggc---------c----ccc--ca-c--t-----t-----c--
                 Killer whale  -------------g----gcacct---ggc---------c----ccc--ca-c--t-----t-----c--
             Tibetan antelope  -------------g----gagcct---gg----------c----ctc--ca-c--c-----c-----c--
                          Cow  -------------g----gagcct---gg----------c----ccc--ca-c--c-----c-----c--
                        Sheep  -------------g----gagcct---gg----------c----ccc--ca-c--c-----c-----c--
                Domestic goat  -------------g----gagcct---gg----------c----ccc--ca-c--c-----c-----c--
                        Horse  ------------ga----gaacct---gc----------ccgctccc--ca-ctac-----c-----c--
             White rhinoceros  ------------gg----gagcct---gg----------c----ccc--ca-c--c-----c-----c--
                          Cat  ------------gg----gagcct---agc---------c----ccc--ca-c--c-----c-----c--
                          Dog  ------------gg----gagccg---ag----------c----ccc--ca-c--c-----c-----c--
                      Ferret   ------------gg----gagcct---aa----------c----ctc--ca-c--c-----c-----c--
                        Panda  ------------gg----aagcct---aa----------c----gtc--ca-c--c-----c-----c--
               Pacific walrus  ------------gg----gagcct---aa----------c----ctc--ca-c--c-----c-----c--
                 Weddell seal  ------------gg----gagcct---aa----------c----ctc--ca-c--c-----c-----c--
             Black flying-fox  ---------------------------------------c----cct--ga----c-----t-----c--
                      Megabat  ---------------------------------------c----cct--ga----c-----t-----c--
                Big brown bat  ------------gg----gagccc---a-----------c----cca--ca----c-----c-----c--
         David's myotis (bat)  ------------gg----gagcct---cccccacccccac----aca--ca----c-----a-----c--
                     Microbat  ------------gg----gagcct---acccc-------c----cca--ca----c-----c-----c--
                     Hedgehog  ---------------------------ag----------c----ctt--ga-c--c-----c-----c--
              Star-nosed mole  ---------------------------ag----------c----ctc--tg-t--c-----c-----c--
                     Elephant  ------------gt----aagcct---gg----------g----tgg--gg-g--g-----c-----t--
                      Manatee  ------------gt----gagcct---gg----------g----tgg--gg-t--g-----c-----t--
             Cape golden mole  ------------gt----cgaacc---ag----------g----tag--gg-t--g-----c-----t--
                     Aardvark  --------------------------------------------tgg--gg-g--g-----c-----c--
                    Armadillo  ------------gt----gagcct---gg----------g----t-g--gg-t--g-----c-----t--
              Tasmanian devil  ------------ggatttggaccc---gg----------a----ttt--ga-g--g-----a-----c--
           American alligator  aaacagctgtgggc----tcgtgc---tg----------g----agg--gc-t--g-----a-----t--
              Green seaturtle  ------------gc----tttttt---tg----------g----cct--cc-c--c-----c-----c--
               Painted turtle  ------------gc----tttttt---tg----------g----cct--ct-c--c-----c-----c--
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  -------a-------gtggct
                        Chimp  -------a-------gtggct
                      Gorilla  -------a-------gtggct
                    Orangutan  -------a-------gtggct
                       Gibbon  -------a-------gtggct
                       Rhesus  -------a-------gtggct
          Crab-eating macaque  -------a-------gtggct
                       Baboon  -------a-------gtggct
                 Green monkey  -------a-------gtggct
                     Marmoset  -------a-------ataggt
              Squirrel monkey  -------a-------atggct
                     Bushbaby  -------a-------gtggtt
           Chinese tree shrew  -------t-------gtggct
                     Squirrel  -------accctagcaaagct
       Lesser Egyptian jerboa  -------a-------gaagct
                 Prairie vole  -------a-------gtagcc
              Chinese hamster  -------a-------gtagct
               Golden hamster  ggggcggg-------ggagca
                        Mouse  -------a-------gtagct
                          Rat  -------a-------gtctct
               Naked mole-rat  -------a-------ggggct
                   Guinea pig  -------a-------gt----
                   Chinchilla  -------a-------gtggct
             Brush-tailed rat  -------a-------gtagct
                       Rabbit  -------a-------ggcgct
                         Pika  -------a-------gagcct
                          Pig  -------a-------gtggct
                       Alpaca  -------a-------gtggct
               Bactrian camel  -------a-------gtggct
                      Dolphin  -------a-------gtggct
                 Killer whale  -------a-------gtggct
             Tibetan antelope  -------a-------gtggct
                          Cow  -------a-------gcggct
                        Sheep  -------a-------gcggct
                Domestic goat  -------a-------gcggct
                        Horse  -------t-catcgagtggct
             White rhinoceros  -------t-------gtggct
                          Cat  -------a-------gtgact
                          Dog  -------a-------gtgact
                      Ferret   -------g-------gtgact
                        Panda  -------a-------gggact
               Pacific walrus  -------a-------gtgact
                 Weddell seal  -------a-------gtgact
             Black flying-fox  -------a-------gtggct
                      Megabat  -------a-------gtggct
                Big brown bat  -------a-------gtggct
         David's myotis (bat)  -------a-------gtggct
                     Microbat  -------a-------gtggct
                     Hedgehog  -------c------agtggac
              Star-nosed mole  -------t-------gtgagc
                     Elephant  -------g-------aagaac
                      Manatee  -------a-------aagaac
             Cape golden mole  -------a-------aagaac
                     Aardvark  ---------------------
                    Armadillo  -------g-------aagatg
              Tasmanian devil  -------g-------gctgct
           American alligator  -------a-------caggct
              Green seaturtle  -------a-------ttttct
               Painted turtle  -------a-------ttttcc
                       Tenrec  =====================
          Cape elephant shrew  =====================
                        Shrew  =====================
       Yellowbelly pufferfish  =====================
                         Fugu  =====================
                  Stickleback  =====================
          Pundamilia nyererei  =====================
                  Zebra mbuna  =====================
        Burton's mouthbreeder  =====================
          Princess of Burundi  =====================
                       Medaka  =====================
                   Coelacanth  =====================
                       Turkey  =====================
                  Spotted gar  =====================
                 Mallard duck  =====================
                   Budgerigar  =====================
                      Wallaby  =====================
                       Lizard  =====================
           Southern platyfish  =====================
     Mexican tetra (cavefish)  =====================
             Peregrine falcon  =====================
                    Zebrafish  =====================
                  Rock pigeon  =====================
                 Nile tilapia  =====================
                    Tetraodon  =====================
                      Chicken  =====================
                 Atlantic cod  =====================
          Collared flycatcher  =====================
     Chinese softshell turtle  =====================
                  Zebra finch  =====================
                 Saker falcon  =====================
                X. tropicalis  =====================
          Medium ground finch  =====================
                      Opossum  =====================
       White-throated sparrow  =====================
           Tibetan ground jay  =====================

Inserts between block 18 and 19 in window
B D                 Hedgehog 27bp
             Star-nosed mole 11bp
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                Armadillo 1bp
B D          Tasmanian devil 5bp
B D       American alligator 23bp
  D          Green seaturtle 15bp
  D           Painted turtle 15bp

Alignment block 19 of 1557 in window, 75827601 - 75827610, 10 bps 
B D                     Human  ---gg-aacag-g----------aa
B D                     Chimp  ---gg-aacag-g----------aa
B D                   Gorilla  ---gg-aacag-g----------aa
B D                 Orangutan  ---gg-aacag-g----------aa
B D                    Gibbon  ---gg-aacag-g----------aa
B D                    Rhesus  ---gg-aacag-g----------aa
B D       Crab-eating macaque  ---gg-aacag-g----------aa
B D                    Baboon  ---gg-aacag-g----------aa
B D              Green monkey  ---gg-aacag-g----------aa
B D                  Marmoset  ---gg-aacag-g----------aa
B D           Squirrel monkey  ---gg-aacagaa----------aa
B D                  Bushbaby  ---gg-aacag-g----------ca
           Chinese tree shrew  ---gg-aacag--------------
B D                  Squirrel  ---ga-aggag-g----------aa
       Lesser Egyptian jerboa  ---gg-aaca-------------ca
                 Prairie vole  ---gg-aactg-g----------ca
B D           Chinese hamster  ---gg-aactg-g----------ca
               Golden hamster  ---gg-gacag-gagacgctcctct
B D                     Mouse  ---gg-aactg-g----------ca
B D                       Rat  ---gg-aactg-g----------ca
B D            Naked mole-rat  ---gg-agcac-a----------ca
                   Chinchilla  ---ga-ag--c-a----------ca
             Brush-tailed rat  ---ga-agcac-a----------ca
B D                    Rabbit  ---ga-gacag-g------------
B D                      Pika  ---gg-aacag-g----------tg
B D                       Pig  ---gg-agcgg-g----------cc
B D                    Alpaca  ---gg-actag-t----------cc
               Bactrian camel  ---gg-actag-t----------cc
B D                   Dolphin  ---gg-aacag-g----------cc
                 Killer whale  ---gg-aacag-g----------cc
             Tibetan antelope  ---ag-aacag-g----------ac
B D                       Cow  ---ag-aacag-g----------ac
B D                     Sheep  ---ag-aacag-g----------ac
                Domestic goat  ---aa-aacag-g----------ac
B D                     Horse  ---gg-aacag-g----------ca
B D          White rhinoceros  ---gg-aatag-g----------ca
B D                       Cat  ---gg-aatag-g----------ca
B D                       Dog  ---gg-aatag-a----------ta
B D                   Ferret   ---gg-agtgg-g----------cc
B D                     Panda  ---gg-aatag-g----------tg
               Pacific walrus  ---ggaaatag-g----------ca
                 Weddell seal  ---gg-aatag-g----------ca
             Black flying-fox  ---gg-aatag-g----------ca
B D                   Megabat  ---gg-aatag-g----------ca
                Big brown bat  ---gg-aatcg-g----------tt
         David's myotis (bat)  ---gg-aatag-g----------tt
B D                  Microbat  ---gg-aatag-g----------tt
B D                  Hedgehog  ---gg-gcctg-g----------cc
              Star-nosed mole  ---gc-accgg-g----------ct
B D                  Elephant  ---gg-accag-g----------ga
B D                   Manatee  ---ag-accag-g----------ga
             Cape golden mole  ---gg-atcag-g----------ga
                     Aardvark  ----------t-g----------ca
B D                 Armadillo  ---ga-caaag-g----------ga
B D           Tasmanian devil  ---gg-agtga-g----------ta
  D       Collared flycatcher  ---ga-aa-----------------
B D        American alligator  gctgt-aa-----------------
  D           Green seaturtle  --gga-ga-----------------
  D            Painted turtle  --gga-ga-----------------
B D                    Tenrec  =========================
B D                Guinea pig  -------------------------
         Cape elephant shrew  =========================
B D                     Shrew  =========================
      Yellowbelly pufferfish  =========================
B D                      Fugu  =========================
B D               Stickleback  =========================
         Pundamilia nyererei  =========================
                 Zebra mbuna  =========================
       Burton's mouthbreeder  =========================
         Princess of Burundi  =========================
B D                    Medaka  =========================
B D                Coelacanth  =========================
B D                    Turkey  =========================
                 Spotted gar  =========================
  D              Mallard duck  =========================
B D                Budgerigar  =========================
B D                   Wallaby  =========================
B D                    Lizard  =========================
          Southern platyfish  =========================
    Mexican tetra (cavefish)  =========================
  D          Peregrine falcon  =========================
B D                 Zebrafish  =========================
  D               Rock pigeon  =========================
B D              Nile tilapia  =========================
B D                 Tetraodon  =========================
B D                   Chicken  =========================
B D              Atlantic cod  =========================
  D  Chinese softshell turtle  =========================
B D               Zebra finch  =========================
  D              Saker falcon  =========================
B D             X. tropicalis  =========================
B D       Medium ground finch  =========================
B D                   Opossum  =========================
  D    White-throated sparrow  =========================
          Tibetan ground jay  =========================

Inserts between block 19 and 20 in window
B D                 Hedgehog 24bp
             Star-nosed mole 7bp
  D      Collared flycatcher 6bp
B D       American alligator 3bp
  D          Green seaturtle 14bp
  D           Painted turtle 14bp

Alignment block 20 of 1557 in window, 75827611 - 75827621, 11 bps 
B D                     Human  g----------------gcca-------------------gga---ggc-
B D                     Chimp  g----------------gcca-------------------gga---ggc-
B D                   Gorilla  g----------------gcca-------------------gga---gg--
B D                 Orangutan  g----------------gcca-------------------gga---gg--
B D                    Gibbon  g----------------gcca-------------------gga---gg--
B D                    Rhesus  g----------------gcta-------------------gga---ggc-
B D       Crab-eating macaque  g----------------gcta-------------------gga---ggc-
B D                    Baboon  g----------------gcta-------------------gga---ggc-
B D              Green monkey  g----------------gcta-------------------gga---ggc-
B D                  Marmoset  g----------------acca-------------------gga---ga--
B D           Squirrel monkey  g----------------gcca-------------------gga---ga--
B D                  Bushbaby  g----------------gctg-------------------gga---aa--
           Chinese tree shrew  -----------------acgt-------------------gga---ga--
B D                  Squirrel  g----------------gcca-------------------gga---ga--
       Lesser Egyptian jerboa  gt---------------tccc-------------------ggg---gg--
                 Prairie vole  gt---------------ccct-------------------gaa---gg--
B D           Chinese hamster  gt---------------tctg-------------------gaa---gg--
               Golden hamster  gt---------------gctg-------------------gactatgg--
B D                     Mouse  gt---------------tcca-------------------aaa---gg--
B D                       Rat  gt---------------tcta-------------------gaa---gg--
B D            Naked mole-rat  g----------------gcca-------------------gga---gg--
B D                Guinea pig  ----------------------------------------ggg---aa--
                   Chinchilla  g----------------gcca-------------------gga---gg--
             Brush-tailed rat  g----------------gcca-------------------gga---ag--
B D                    Rabbit  ------------------------------------------c-------
B D                      Pika  g----------------------------------------ac-------
B D                    Alpaca  t----------------gcca-------------------gaa---ga--
               Bactrian camel  t----------------gcca-------------------gaa---ga--
B D                   Dolphin  t----------------gcca-------------------gga---ga--
                 Killer whale  t----------------gcca-------------------gga---ga--
B D                     Horse  t----------------gcca-------------------gga---aa--
B D          White rhinoceros  t----------------gcca-------------------gga---aa--
B D                       Cat  g----------------gcca--------------------ga---aa--
B D                       Dog  t----------------gctg--------------------ga---aa--
B D                   Ferret   t----------------gcca--------------------ga---a---
B D                     Panda  t----------------gcca--------------------ga---aa--
               Pacific walrus  t----------------gcca--------------------ga---aa--
                 Weddell seal  t----------------gcca--------------------ga---aa--
             Black flying-fox  t----------------gcca-------------------gga---ga--
B D                   Megabat  t----------------gcca-------------------gga---ga--
                Big brown bat  t----------------ccgg-------------------ggg---ga--
         David's myotis (bat)  t----------------c--g-------------------gga---ga--
B D                  Microbat  t----------------ccgg-------------------ggg---ga--
B D                  Hedgehog  t----------------gcct-------------------gga---ga--
              Star-nosed mole  g----------------ggcc-------------------ggg---gt--
B D                  Elephant  g----------------cttgcaccc--------------cca---cc--
B D                   Manatee  g----------------cctgcatcc--------------cca---cc--
             Cape golden mole  gc--------cagcacccctgccccc--------------atg---gc--
                     Aardvark  c----------------cccaccctc--------------gtg---gc--
B D                 Armadillo  gcccatgccac------ccca-------------------gtg---gc--
B D           Tasmanian devil  g----------------gtcggagacagagcctggactgggga---ag--
  D              Saker falcon  ----------------ggaca-------------------gga---gg-c
  D          Peregrine falcon  ----------------ggaca-------------------gga---gg-c
  D       Collared flycatcher  ------------------gaa-------------------gaa---gg-c
B D        American alligator  ----------------ggcca-------------------agc---ag-a
  D           Green seaturtle  ----------------ggccc-------------------gcg---gg-g
  D            Painted turtle  ----------------ggcct-------------------gcg---gg-g
B D                    Tenrec  ==================================================
            Tibetan antelope  --------------------------------------------------
         Cape elephant shrew  ==================================================
B D                     Shrew  ==================================================
               Domestic goat  --------------------------------------------------
B D                     Sheep  --------------------------------------------------
B D                       Cow  --------------------------------------------------
      Yellowbelly pufferfish  ==================================================
B D                      Fugu  ==================================================
B D               Stickleback  ==================================================
         Pundamilia nyererei  ==================================================
                 Zebra mbuna  ==================================================
       Burton's mouthbreeder  ==================================================
         Princess of Burundi  ==================================================
B D                    Medaka  ==================================================
B D                Coelacanth  ==================================================
B D                    Turkey  ==================================================
                 Spotted gar  ==================================================
  D              Mallard duck  ==================================================
B D                Budgerigar  ==================================================
B D                   Wallaby  ==================================================
B D                    Lizard  ==================================================
          Southern platyfish  ==================================================
    Mexican tetra (cavefish)  ==================================================
B D                 Zebrafish  ==================================================
  D               Rock pigeon  ==================================================
B D              Nile tilapia  ==================================================
B D                 Tetraodon  ==================================================
B D                   Chicken  ==================================================
B D              Atlantic cod  ==================================================
  D  Chinese softshell turtle  ==================================================
B D               Zebra finch  ==================================================
B D             X. tropicalis  ==================================================
B D       Medium ground finch  ==================================================
B D                   Opossum  ==================================================
  D    White-throated sparrow  ==================================================
          Tibetan ground jay  ==================================================
B D                       Pig  --------------------------------------------------

Inserts between block 20 and 21 in window
  D             Saker falcon 4bp
  D         Peregrine falcon 4bp
  D      Collared flycatcher 5bp

Alignment block 21 of 1557 in window, 75827622 - 75827682, 61 bps 
B D                     Human  --------agatgggccagggccaggagacag--------------------atgg--c------cc---
B D                     Chimp  --------agatgggccagggccaggagacag--------------------atgg--c------cc---
B D                   Gorilla  -----------------------------cag--------------------atgg--c------cc---
B D                 Orangutan  -----------------------------cag--------------------atgg--c------cc---
B D                    Gibbon  -----------------------------cag--------------------atgg--c------cc---
B D                    Rhesus  --------agatgggccaggaga------cag--------------------atgg--c------cc---
B D       Crab-eating macaque  --------agatgggccaggaga------cag--------------------atgg--c------cc---
B D                    Baboon  --------agatgggccaggaga------cag--------------------atgg--c------cc---
B D              Green monkey  --------agatgggccaggaga------cag--------------------atgg--c------cc---
B D                  Marmoset  -----------------------------cgg--------------------atgg--c------ca---
B D           Squirrel monkey  -----------------------------tga--------------------atgg--c------ct---
B D                  Bushbaby  -----------------------------cag--------------------atgg--c------ct---
           Chinese tree shrew  -----------------------------cag--------------------atgg--c------cc---
B D                  Squirrel  -----------------------------cgg--------------------aggg--c------tc---
       Lesser Egyptian jerboa  -----------------------------cag--------------------atgg--c------cc---
                 Prairie vole  -----------------------------cag--------------------atag--c------cc---
B D           Chinese hamster  -----------------------------cag--------------------atgg--c------ac---
               Golden hamster  -----------------------------cag--------------------agaa--c------acaga
B D                     Mouse  -----------------------------cag--------------------atgg--c------cc---
B D                       Rat  -----------------------------cag--------------------atgg--c------cc---
B D            Naked mole-rat  -----------------------------tag--------------------gtgg--c------cc---
B D                Guinea pig  -----------------------------ttg--------------------atga--c------cc---
                   Chinchilla  -----------------------------tag--------------------atga--c------ga---
             Brush-tailed rat  -----------------------------taa--------------------atggccc------ag---
B D                    Rabbit  ----------------------------------------------------------t------ag---
B D                      Pika  ----------------------------------------------------------t------ag---
B D                       Pig  ----------------------------------------------------------------------
B D                    Alpaca  -----------------------------cgg--------------------aggg--c------t----
               Bactrian camel  -----------------------------cag--------------------aggg--c------t----
B D                   Dolphin  -----------------------------gga--------------------aggg--c------t----
                 Killer whale  -----------------------------gga--------------------aggg--c------t----
             Tibetan antelope  -----------------------------acg--------------------gggg--c------t----
B D                       Cow  -----------------------------atg--------------------gggg--c------t----
B D                     Sheep  -----------------------------aca--------------------aggg--c------t----
                Domestic goat  -----------------------------acg--------------------gggg--c------t----
B D                     Horse  -----------------------------cag--------------------gtgg--c------t----
B D          White rhinoceros  -----------------------------cag--------------------gcag--c------t----
B D                       Cat  -----------------------------cgc--------------------aggg--------------
B D                       Dog  -----------------------------cag--------------------atgg--c------t----
B D                   Ferret   ------------------------------ag--------------------gggg--c------t----
B D                     Panda  -----------------------------cag--------------------atgg--t------t----
               Pacific walrus  -----------------------------cag--------------------gtgg--c------c----
                 Weddell seal  -----------------------------cag--------------------gtgg--c------c----
             Black flying-fox  -----------------------------cag--------------------acgc--c------c----
B D                   Megabat  -----------------------------cag--------------------acgc--c------c----
                Big brown bat  -----------------------------cag--------------------atgg--c------t----
         David's myotis (bat)  -----------------------------cag--------------------atgg--c------t----
B D                  Microbat  -----------------------------cag--------------------atgg--c------t----
B D                  Hedgehog  -----------------------------ca---------------------------c------t----
              Star-nosed mole  -----------------------------ca------------------------g--c------t----
B D                  Elephant  ----------------------------------------------------------c------cc---
B D                   Manatee  -----------------------------cct--------------------gtgg--c------cc---
             Cape golden mole  -----------------------------cagagcaggcgggaaagggacaaaggg--c------cc---
                     Aardvark  -----------------------------cagagcaggcag-----------ggga--c------ct---
B D                 Armadillo  -----------------------------tggggcatggaatgtg-------aaga--g------ag---
B D           Tasmanian devil  -----------------------------caa--------------------aggg--a------g----
  D              Saker falcon  -----------------------------gga--------------------catg--a------c----
  D          Peregrine falcon  -----------------------------gga--------------------catg--a------c----
  D       Collared flycatcher  -----------------------------agg--------------------cagg--t------c----
  D    White-throated sparrow  -----------------------------agg--------------------ccgg--t------t----
B D        American alligator  ------aagg-------------------ggg--------------------tagg--taggaagc----
  D           Green seaturtle  atcgcagccg-------------------ggg--------------------cacg--t------cg---
  D            Painted turtle  aacgcagccg-------------------ggg--------------------caca--t------cg---
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D               Stickleback  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                    Medaka  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
B D              Nile tilapia  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D              Atlantic cod  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Opossum  ======================================================================
          Tibetan ground jay  ======================================================================

                        Human  ----------------------aatc-----c----cctg-cc--cacc-----aca----------gca
                        Chimp  ----------------------aatc-----c----cctg-cc--cacc-----aca----------gca
                      Gorilla  ----------------------aatc-----c----cctg-cc--cacc-----aca----------gca
                    Orangutan  ----------------------aatc-----c----cctg-cc--cacc-----aca----------gca
                       Gibbon  ----------------------aatc-----c----cctg-cc--cacc-----aca----------gca
                       Rhesus  ----------------------aatc-----c----cctg-cc--cacc-----aga----------gca
          Crab-eating macaque  ----------------------aatc-----c----cctg-cc--cacc-----aga----------gca
                       Baboon  ----------------------aatc-----c----cctg-cc--cacc-----aga----------gca
                 Green monkey  ----------------------aatc-----a----cctg-cc--cacc-----aga----------gca
                     Marmoset  ----------------------gatc-----c----cctg-tc--cacc-----aga----------gca
              Squirrel monkey  ----------------------gatc-----c----cctg-cc--cacc-----aga----------gca
                     Bushbaby  ----------------------aaga-----c----cctg-ac--cacc-----aga----------gca
           Chinese tree shrew  ----------------------cagg-----c----cctgccc--cacc-----aga----------g-a
                     Squirrel  ----------------------taga-----c----cctggcc--cacc-----aga----------gca
       Lesser Egyptian jerboa  ----------------------tggg-----c----cgtgtcc--ca-c-----aga----------aca
                 Prairie vole  ----------------------tcaa-----t----gattcct-ttccc-----aaa----------gca
              Chinese hamster  ----------------------taga-----t----gatacct--tacc-----aaa----------gca
               Golden hamster  ccagggcaagagggaaggacaagaaa-----t----gataaatactgcc-----aggtggtggtggcgca
                        Mouse  ----------------------tagacgctat----gctatcc--tacc-----aaa----------gca
                          Rat  ----------------------tagacactct----gctaacc--tacc-----aag----------gca
               Naked mole-rat  ----------------------aaga-----c----cccccacttcacc-----aga-----------ca
                   Guinea pig  ----------------------aaga-----c----tccaccc--cacc-----aga----------gca
                   Chinchilla  ----------------------aaga-----c----ccca-----cacc-----aga----------gca
             Brush-tailed rat  ----------------------agga-----c----ccca-----cacc-----aga----------gca
                       Rabbit  ----------------------ccga-----c----cccgccc--cgcc-----gaa----------ccg
                         Pika  ----------------------aaga-----c----cccattc--cacta----aaa----------cta
                          Pig  --------------------------------------------------------------------tc
                       Alpaca  ----------------------gaga-----c----cctgctc--tgct-----aaa----------gca
               Bactrian camel  ----------------------gaga-----c----cctgctc--tgct-----aaa----------gca
                      Dolphin  ----------------------gagc-----c----cctcctc--tgcc-----aga----------gcg
                 Killer whale  ----------------------gagc-----c----cctcctc--tgcc-----aga----------gca
             Tibetan antelope  ----------------------gaga-----c----cctgctc--tgcc-----aga----------gta
                          Cow  ----------------------gaga-----c----cctgctc--tgcc-----aga----------gta
                        Sheep  ----------------------gaga-----c----cctgctc--tgcc-----aga----------gta
                Domestic goat  ----------------------gaga-----c----cctgctc--tgcc-----aaa----------gta
                        Horse  ----------------------gaga-----t----cctgctc--tgcc-----aga----------gca
             White rhinoceros  ----------------------gaga-----c----cctgctc--tgcc-----aga----------gca
                          Cat  -----------------------aga-----c----ag--ctc--tgcc-----aga----------gca
                          Dog  ----------------------gaga-----g----gt--ctc--tgcc-----aga----------gca
                      Ferret   ----------------------gagc-----c----gc--ctc--tgcc-----aga----gcccgcgcg
                        Panda  ----------------------gagg-----g----gt--ctc--tgcc-----agg----------gca
               Pacific walrus  ----------------------gaga-----g----gt--ctc--tgcc-----aga----------gca
                 Weddell seal  ----------------------aaga-----c----gt--ctc--tgcc-----cga----------gca
             Black flying-fox  ----------------------aaga-----c----cctgctc--cacc-----agg----------gca
                      Megabat  ----------------------aaga-----c----cctgctc--catc-----agg----------gca
                Big brown bat  ----------------------gagc-----c----cctgctg--tgcc-----agc----------ac-
         David's myotis (bat)  ----------------------gagt-----c----cctgctt--tgcc-----agc----------ac-
                     Microbat  ----------------------gagc-----c----cctgctt--tgcc-----agc----------ac-
                     Hedgehog  ----------------------gaga-----cacacgctgctt--tgcc-----tga----------gca
              Star-nosed mole  ----------------------gagc-----c-----ctgctc--t-tc-----agg----------gca
                     Elephant  ----------------------aaga-----c----cctgctc--tgct-----gga----------gca
                      Manatee  ----------------------gaga-----c----cctacta--tgcg-----gga----------gca
             Cape golden mole  ----------------------aaga-----c----cctgctt--ttcc-----aga----------gct
                     Aardvark  ----------------------gaga-----c----cctccta--tgcc-----aca----------gca
                    Armadillo  ----------------------aaaa-----a----tatgct---tgcc-----aga----------gca
              Tasmanian devil  ----------------------gggg-----t----ggggctc--tcct-----g---------------
                 Saker falcon  ----------------------cagg-----a----gacgcag--caccggcagtga----------caa
             Peregrine falcon  ----------------------cagg-----a----gacgcag--caccggcagtga----------caa
          Collared flycatcher  ----------------------tggc-----c----atggctgccccccagcctgaa----------tca
       White-throated sparrow  ----------------------tggc-----c----atggctg-tccccagcctgaa----------tca
           American alligator  ----------------------catt-----t----cctgcct--ccctgaaacaaa----------tgc
              Green seaturtle  ----------------------caca-----c----cctgctg-gcacc-----tga----------cag
               Painted turtle  ----------------------caca-----c----cctgctg-gcacc-----tga----------caa
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  -gc---tt-ttctg
                        Chimp  -gc---tt-ttctg
                      Gorilla  -gc---tt-ttctg
                    Orangutan  -gc---tt-ttctg
                       Gibbon  -gc---tt-ttctg
                       Rhesus  -gc---tt-ttccg
          Crab-eating macaque  -gc---tt-ttccg
                       Baboon  -gc---tt-ttccg
                 Green monkey  -gc---tt-ttccg
                     Marmoset  -gg---tt-ttccg
              Squirrel monkey  -gc---tt-tcccg
                     Bushbaby  -gt---tt-ttcca
           Chinese tree shrew  -gc---tt-ttcct
                     Squirrel  -gt---tt-ttgcg
       Lesser Egyptian jerboa  -gc---tt-tttgc
                 Prairie vole  -gc---tt-ttctg
              Chinese hamster  -gc---tt-ttggg
               Golden hamster  cgc---ct-ttaat
                        Mouse  -gc---gt-ttctg
                          Rat  -gc---tt-ttctg
               Naked mole-rat  -gc---tt-ttcca
                   Guinea pig  -g----tt-ttcca
                   Chinchilla  -gc---tt-ttcca
             Brush-tailed rat  -gc---tt-tccca
                       Rabbit  -cc---tt-ttccg
                         Pika  -gt---tt-ttcca
                          Pig  -cc---tt-ttccc
                       Alpaca  -gc---tt-ttccc
               Bactrian camel  -gc---tt-ttccc
                      Dolphin  -gc---tt-ttccc
                 Killer whale  -gc---tt-ttccc
             Tibetan antelope  -ac---tt-ctccc
                          Cow  -ac---tt-ctccc
                        Sheep  -ac---tt-ctccc
                Domestic goat  -ac---tt-ctccc
                        Horse  -gc---tt-ttccc
             White rhinoceros  -gc----t-ttacc
                          Cat  -gg-----------
                          Dog  -gc---tt-ct---
                      Ferret   -gc---gt-ctccc
                        Panda  -gcagtgc-ctccc
               Pacific walrus  -gc---tt-acacc
                 Weddell seal  -gc---tt-ccccc
             Black flying-fox  -ga---tt-ttccc
                      Megabat  -ga---tt-ttccc
                Big brown bat  ------tt-ttccc
         David's myotis (bat)  ---------ttccc
                     Microbat  ---------ttccc
                     Hedgehog  -tc---tt-ttccc
              Star-nosed mole  -gc---tg-ttccc
                     Elephant  -ga---tt-ttcca
                      Manatee  -ga---tt-ttccc
             Cape golden mole  -gc---tt-ctcca
                     Aardvark  -gc---tt-ttcca
                    Armadillo  -cc---tt-ttgca
              Tasmanian devil  --------------
                 Saker falcon  -gc---ta-atg--
             Peregrine falcon  -gc---ta-atg--
          Collared flycatcher  -gt---catgtt--
       White-throated sparrow  -gt---cgtgtt--
           American alligator  -tc---ca-gtc--
              Green seaturtle  -gc---tg-ccg--
               Painted turtle  -gc---tg-ctg--
                       Tenrec  ==============
          Cape elephant shrew  ==============
                        Shrew  ==============
       Yellowbelly pufferfish  ==============
                         Fugu  ==============
                  Stickleback  ==============
          Pundamilia nyererei  ==============
                  Zebra mbuna  ==============
        Burton's mouthbreeder  ==============
          Princess of Burundi  ==============
                       Medaka  ==============
                   Coelacanth  ==============
                       Turkey  ==============
                  Spotted gar  ==============
                 Mallard duck  ==============
                   Budgerigar  ==============
                      Wallaby  ==============
                       Lizard  ==============
           Southern platyfish  ==============
     Mexican tetra (cavefish)  ==============
                    Zebrafish  ==============
                  Rock pigeon  ==============
                 Nile tilapia  ==============
                    Tetraodon  ==============
                      Chicken  ==============
                 Atlantic cod  ==============
     Chinese softshell turtle  ==============
                  Zebra finch  ==============
                X. tropicalis  ==============
          Medium ground finch  ==============
                      Opossum  ==============
           Tibetan ground jay  ==============

Inserts between block 21 and 22 in window
            Cape golden mole 9bp
                    Aardvark 1bp
B D                Armadillo 2bp

Alignment block 22 of 1557 in window, 75827683 - 75827719, 37 bps 
B D                     Human  aga--g----------------gcgggcaggggcagggt-----ttg----------------c------
B D                     Chimp  aga--g----------------gcgggcaggggcagggt-----ttg----------------c------
B D                   Gorilla  aga--g----------------gcgggcaggggcagggt-----ttg----------------c------
B D                 Orangutan  aga--g----------------gcgggtaggggcagggt-----ttc----------------c------
B D                    Gibbon  aga--g----------------gcgggcaggggcagggt-----ttg----------------c------
B D                    Rhesus  aaa--g----------------gggggcaggggcagggt-----ttg----------------c------
B D       Crab-eating macaque  aaa--g----------------gggggcaggggcagggt-----ttg----------------c------
B D                    Baboon  aaa--g----------------gggggcaggggcagggt-----ttg----------------c------
B D              Green monkey  aaa-gg----------------gggggcaggggcagggt-----ttg----------------c------
B D                  Marmoset  aga--g----------------gtgggcaggggcagggt-----ttg----------------c------
B D           Squirrel monkey  aga--g----------------gtgggcaggggcagggt-----ttg----------------c------
B D                  Bushbaby  aga--g----------------gggatcagggtcccgag-----atg----------------c------
           Chinese tree shrew  agg--g----------------ggggacagg--caggag-----ccc----------------c------
B D                  Squirrel  gg--------------------ggaagcaggggcaggag-----tta----------------t------
       Lesser Egyptian jerboa  agg--gt---------------ggcggcaggactaggag-----atg----------------c------
                 Prairie vole  gag--gg---------------aggagcagagacaggaa-----gta----------------c------
B D           Chinese hamster  ggc--ag---------------gggagcagggacaggag-----aca----------------c------
               Golden hamster  ccc--agcac------tca---ggaggcagaggcaggcg-----ga------------------------
B D                     Mouse  ggg--gg-acgggggtgca---gggagcagagacaggag-----atg----------------t------
B D                       Rat  gg--------------gca---gggggaggagcagagag-----atg----------------t------
B D            Naked mole-rat  gga-------------------tggagcaggggcaggag-----atg----------------c------
B D                Guinea pig  gga-------------------tggagaaagggt---gg-----atg----------------t------
                   Chinchilla  gga-------------------tggagcagaggcgggag-----atg----------------t------
             Brush-tailed rat  gga-------------------cggagcaggggc---ag-----atg----------------t------
B D                    Rabbit  ag--------------------aggagagggggcaggag-----gtg----------------ccctccc
B D                      Pika  ag--------------------aggaga----gcagga--------------------------------
B D                       Pig  taagag----------------gggagcacgggcaaggg-----atgcagatagccgcctcc-c------
B D                    Alpaca  taa-aa----------------ggtagcaggggcaaggc-----gtgcagacagctgtctcc-c------
               Bactrian camel  taa-aa----------------ggtagcaggggcaagga-----gtgcagacagctgtctcc-c------
B D                   Dolphin  tacgag----------------gggagcaggggtaaggg-----gtgcagacagctgtctccgc------
                 Killer whale  tacgag----------------gggagcaggggtaaggg-----gtgcagacagctgtctccgc------
             Tibetan antelope  caagag----------------gggggcaggggtgaggg-----aagcagaccgctgtcccc-c------
B D                       Cow  caagag----------------gggggcaggggtaaggg-----aagcagactgctgtcccc-c------
B D                     Sheep  caagag----------------gggggcaggggtgaggg-----aagcagaccgctgtcccc-c------
                Domestic goat  caagag----------------gggggcaggggtgaggg-----aagcagaccgctgtcccc-c------
B D                     Horse  caggag----------------gggagcaggggcaggag-----atgcagacagctgcctcc-c------
B D          White rhinoceros  caggag----------------gggatcagggactggag-----atgcagacagctgcctcc-c------
B D                       Cat  --------------------------------------------------------gc--cc-c------
B D                       Dog  --agag----------------ggaagcaggggtgagag-----ctgcagacagctgc---c-c------
B D                   Ferret   c--------------------------------cagggg-----ccacagaccgctgc---c-c------
B D                     Panda  acaggg----------------ggaagcaggggcaggag-----ccgcagacagctgc--cc-c------
               Pacific walrus  aaagaa----------------ggaagcaggggcgggag-----ccgcagacagccgc--ac-c------
                 Weddell seal  aaagag----------------ggaagcgggggcgggag-----ccgcagacagctgc--cc-c------
             Black flying-fox  agaggg----------------g--aacggggccaagag-----gtgcagatggctgcctcc-c------
B D                   Megabat  agaggg----------------g--aacggggccaagag-----gtgcagatggctgcctcc-c------
                Big brown bat  agagga----------------g----caggggcaggag-----atgcaca--gctgc--cc-c------
         David's myotis (bat)  agagga----------------g-----aagggcaggag-----atgcaca--gccacctcc-c------
B D                  Microbat  aaagga----------------g----caggggcaggag-----atgcaca--gccgcctcc-c------
B D                  Hedgehog  caa-gg----------------ggccgtgggagagcaag-------------agttgc---c-t------
              Star-nosed mole  aag-ag----------------gggagcaggacaggaggtgccatgccagatggctgc---c-g------
B D                  Elephant  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
B D                    Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
  D              Saker falcon  ------------ggggacaggcagggacagccacac----------------------------------
  D          Peregrine falcon  ------------ggggacaggcagggacagccacac----------------------------------
  D       Collared flycatcher  ------------gcagacagg-agggctggggacat----------------------------------
  D    White-throated sparrow  ------------gcagacagg-agggctggggacac----------------------------------
B D        American alligator  ------------ctcagcatgccagg--------ac----------------------------------
  D           Green seaturtle  ------------ctgactagccaaggctgctgatgc----------------------------------
  D            Painted turtle  ------------ccaactagccaaggttgctgatgc----------------------------------
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D               Stickleback  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                    Medaka  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
B D              Nile tilapia  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D              Atlantic cod  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Opossum  ======================================================================
          Tibetan ground jay  ======================================================================

                        Human  -tcc------cc-ct-ggtgc
                        Chimp  -tcc------cc-ct-ggtgc
                      Gorilla  -tcc------cc-ct-ggtgc
                    Orangutan  -tcc------cc-ct-ggtgc
                       Gibbon  -tcc------cc-ct-ggtgc
                       Rhesus  -tcc------cc-ct-ggggc
          Crab-eating macaque  -tcc------cc-ct-ggggc
                       Baboon  -tcc------cc-ct-ggggc
                 Green monkey  -tcc------cc-ct-ggtgc
                     Marmoset  -ttc------cc-ct-ggtgc
              Squirrel monkey  -ttc------cc-ct-ggtgc
                     Bushbaby  -tcc------ct-ct-gctgc
           Chinese tree shrew  -tcc------ca-ct-ggtgc
                     Squirrel  -t--------cc-tc-tgtgc
       Lesser Egyptian jerboa  -t--------gg-gc-tgtgg
                 Prairie vole  -t--------cc-tc-tgtgc
              Chinese hamster  -t--------cc-tc-tgtgg
               Golden hamster  ----------tc-tc-tg---
                        Mouse  -t--------cc-tc-tgtgc
                          Rat  -t--------cc-tc-tgaac
               Naked mole-rat  -tactc----at-ac-catgc
                   Guinea pig  -tacacatccat-tg-catgc
                   Chinchilla  -tacccatggac-tc-catgc
             Brush-tailed rat  -tac------ac-tc-ggtgc
                       Rabbit  cc--------tc-tc-tgtgc
                         Pika  -c--------ac-cc-aagtc
                          Pig  -ctc------cc-ta-ggggc
                       Alpaca  -ttc------cc-cc-gaggc
               Bactrian camel  -ttc------cc-cctgaggc
                      Dolphin  -tcc------cc-ca-ggggc
                 Killer whale  -tcc------cc-ca-ggggc
             Tibetan antelope  -cac------cc-ct-gggac
                          Cow  -cac------cc-ct-tggac
                        Sheep  -cac------cc-ct-gggac
                Domestic goat  -cac------cc-ct-gggac
                        Horse  -ctc------cccct-ggtgc
             White rhinoceros  -ctt------tccct-ggtgc
                          Cat  -ctc------cccct-ggtgc
                          Dog  -ctc------cacct-ggtgc
                      Ferret   -cgc------ccccc-ggcgc
                        Panda  -cta------cccct-ggtgc
               Pacific walrus  -ctc------cccct-ggtgc
                 Weddell seal  -ctc------cccct-ggtgc
             Black flying-fox  -ctc------ctgct-ggtgc
                      Megabat  -ctc------ctgct-ggtgc
                Big brown bat  -cgc------cc----ggtgc
         David's myotis (bat)  -cgc------cc-ct-ggtg-
                     Microbat  -cac------cc-ct-ggtgc
                     Hedgehog  -ctc------cc-ct-gcggc
              Star-nosed mole  -ccc------cc-cc-cgtgc
                     Elephant  -----------a-aa-gggga
                      Manatee  -----------a-aa-gggga
             Cape golden mole  -------------ag-gggca
                       Tenrec  -------------ag-aggcc
                     Aardvark  ----------ag-tg-agaaa
                    Armadillo  ----------ag-ac-aggga
              Tasmanian devil  -----ggttacc-cc-ggggg
                 Saker falcon  ---------------------
             Peregrine falcon  ---------------------
          Collared flycatcher  ---------------------
       White-throated sparrow  ---------------------
           American alligator  ---------------------
              Green seaturtle  ---------------------
               Painted turtle  ---------------------
          Cape elephant shrew  =====================
                        Shrew  =====================
       Yellowbelly pufferfish  =====================
                         Fugu  =====================
                  Stickleback  =====================
          Pundamilia nyererei  =====================
                  Zebra mbuna  =====================
        Burton's mouthbreeder  =====================
          Princess of Burundi  =====================
                       Medaka  =====================
                   Coelacanth  =====================
                       Turkey  =====================
                  Spotted gar  =====================
                 Mallard duck  =====================
                   Budgerigar  =====================
                      Wallaby  =====================
                       Lizard  =====================
           Southern platyfish  =====================
     Mexican tetra (cavefish)  =====================
                    Zebrafish  =====================
                  Rock pigeon  =====================
                 Nile tilapia  =====================
                    Tetraodon  =====================
                      Chicken  =====================
                 Atlantic cod  =====================
     Chinese softshell turtle  =====================
                  Zebra finch  =====================
                X. tropicalis  =====================
          Medium ground finch  =====================
                      Opossum  =====================
           Tibetan ground jay  =====================

Inserts between block 22 and 23 in window
  D             Saker falcon 18bp
  D         Peregrine falcon 18bp
  D      Collared flycatcher 6bp
  D   White-throated sparrow 6bp
B D       American alligator 21bp
  D          Green seaturtle 10bp
  D           Painted turtle 10bp

Alignment block 23 of 1557 in window, 75827720 - 75827784, 65 bps 
B D                     Human  tggg-atg-------tggta-g-aga--------------c-----------------a--ttgcag---
B D                     Chimp  tggg-atg-------tggta-g-aga--------------c-----------------a--ttgcag---
B D                   Gorilla  tggg-atg-------tggta-g-aga--------------c-----------------a--ttgcag---
B D                 Orangutan  tggg-atg-------tggtg-g-aga--------------c-----------------a--ttgcag---
B D                    Gibbon  tggg-atg-------tggtg-g-aga--------------c-----------------a--ttgcag---
B D                    Rhesus  tggg-gtg-------tggtg-g-aga--------------c-----------------a--ttgcag---
B D       Crab-eating macaque  tggg-gtg-------tggtg-g-aga--------------c-----------------a--ttgcag---
B D                    Baboon  tggg-gtg-------tggtg-g-aga--------------c-----------------a--ttgcag---
B D              Green monkey  tggg-gtg-------tggtg-g-aga--------------c-----------------a--ttgcag---
B D                  Marmoset  tggg-agg-------tggcg-g-aga--------------a-----------------a--ttgcag---
B D           Squirrel monkey  tggg-agg-------tggca-g-aga--------------a-----------------a--ttgcag---
B D                  Bushbaby  tggg-ata-------tggca-gaaaa--------------t-----------------g--ttacgg---
           Chinese tree shrew  tggc-atg-------tggtg-g-agg--------------a-----------------g----gagg---
B D                  Squirrel  tggg-atg-------tgtca-g-aga--------------a-----------------t-----gct---
       Lesser Egyptian jerboa  caga-------------gct-g-agg--------------c-----------------c-----agt---
                 Prairie vole  tgga-atg-------tggca-g-aga--------------a-----------------c-----aga---
B D           Chinese hamster  taga-ata-------tggca-g-aga--------------a-----------------c---acaga---
               Golden hamster  ----------------------------------------------------------------agt---
B D                     Mouse  taca-ata-------tggca-g-aga--------------g-----------------c-----------
B D                       Rat  taga-ata-------cggca-g-aga--------------a-----------------c-----------
B D            Naked mole-rat  tggg-gtg-------tggca-g-aga--------------------------------------------
B D                Guinea pig  tggg-atg-------tggca-g-aga--------------g-----------------c---tgagg---
                   Chinchilla  tggg-atg-------tggca-c-aga--------------g-----------------c---tgagg---
             Brush-tailed rat  tggg-atg-------tggca-g-aga--------------g-----------------t---tgagg---
B D                    Rabbit  cggg-ctg-------aa-----------------------------------------------------
B D                      Pika  aggg-ctg-------cg-----------------------------------------------------
B D                       Pig  c----------------gca-g-gga--------------g-----------------ga-c--------
B D                    Alpaca  tgga-ttt--------ggca-g-aga--------------a-----------------tg-ctgagg---
               Bactrian camel  tgga-ttt--------ggca-g-aga--------------a-----------------tg-ctgagg---
B D                   Dolphin  tgga-ctt--------ggca-g-aga--------------a-----------------tg-ctgagg---
                 Killer whale  tgga-ctt--------ggca-g-aga--------------a-----------------tg-ctgagg---
             Tibetan antelope  gggg-ctt---------gca-c-aga--------------a-----------------tg-ctgagg---
B D                       Cow  gggg-ctt---------gca-g-gga--------------a-----------------tg-ctgagg---
B D                     Sheep  gggg-ttt---------gca-g-gta--------------a-----------------tg-ctgagg---
                Domestic goat  gggg-ctt---------gca-c-gta--------------a-----------------tg-ctgagg---
B D                     Horse  tgga-atc-------tggca-g-agg--------------a-----------------tg-ctgagg---
B D          White rhinoceros  tgga-atc-------tggca-g-aga--------------a-----------------tg-ctgaca---
B D                       Cat  tgaa-att-------tggta-g-aga--------------a-----------------tg-ctgagg---
B D                       Dog  tggg-gtt-------tggta-g-aga--------------a-----------------cg-ctgag----
B D                   Ferret   tgcc-ggc-------cgtca-g-aga--------------a-----------------gg-cagagg---
B D                     Panda  tgag-att-------tggta-g-aga--------------g-----------------tg-ctgagg---
               Pacific walrus  tgag-att-------cggta-g-aga--------------a-----------------tg-ctgagg---
                 Weddell seal  tgag-att-------cggta-g-aga--------------a-----------------tg-ctgagg---
             Black flying-fox  tggg-att-------gggca-g-gga--------------a-----------------tg-ctgggg---
B D                   Megabat  tggg-att-------gggca-g-gga--------------a-----------------tg-ctgggg---
                Big brown bat  tggg-att-------tggca-g-aga--------------a-----------------tg-ctgagg---
         David's myotis (bat)  tggg-att-------tggcc-g-aga--------------a-----------------tg-ctga-g---
B D                  Microbat  tggg-att-------tggca-g-aga--------------a-----------------tg-ctga-g---
B D                  Hedgehog  tgat-ttg---------gca-g-aga--------------a-----------------ga-ctcggg---
              Star-nosed mole  tggg-act---------g-a-g-cgg--------------a-----------------gg-ccgcgg---
B D                  Elephant  aagg------------ggca-c-a---------------------------------------gctg---
B D                   Manatee  aagg------------ggca-c-agg--------------g---------atggtgcaga-cggctg---
             Cape golden mole  caag------------ggca-g-tgc--------------c-----------------aa-cagctgccg
B D                    Tenrec  ggag---g-------aggca-g-agg--------------cccactttccagaagggaga-cagctg-gg
                     Aardvark  gagg------------ggct-t-agg--------------g---------gtggtgtggg-cggcag---
B D                 Armadillo  caggaaag-------aggca-g-act--------------c---------agtggagacg-cggagg---
B D           Tasmanian devil  aggt-ttcgttccactgaca-g-tat--------------g-----------------cc-cacagg---
  D              Saker falcon  ----------------agtg-t-tgc--------------t-----------------agtccagac---
  D          Peregrine falcon  ----------------agtg-t-tgc--------------t-----------------agtccagac---
  D       Collared flycatcher  -gag-atg-------cagca-g-tgg--------------c-----------------agtgacaag---
  D    White-throated sparrow  -gac-atg-------cagca-c-tgg--------------c-----------------agtgacaaa---
B D                Budgerigar  tgag-atg-------tggta-c-cag--------------c-----------------agtgacaag---
B D        American alligator  ------tc-------cnctgcc-tgg--------------c-----------------ag---caac---
  D           Green seaturtle  tggg-aag-------cagca-c-agaactcc-cccgtcctc-----------------agcctgaag---
  D            Painted turtle  tggg-aag-------cagca-c-agggctcctcccatcctc-----------------ggcctgaag---
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D               Stickleback  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                    Medaka  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
B D              Nile tilapia  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D              Atlantic cod  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Opossum  ======================================================================
          Tibetan ground jay  ======================================================================

                        Human  ---------cc-----agg--------gc-----------------------------------------
                        Chimp  ---------cc-----agg--------gc-----------------------------------------
                      Gorilla  ---------cc-----agg--------gc-----------------------------------------
                    Orangutan  ---------cc-----agg--------gc-----------------------------------------
                       Gibbon  ---------cc-----agg--------gc-----------------------------------------
                       Rhesus  ---------cc-----agg--------gc-----------------------------------------
          Crab-eating macaque  ---------cc-----agg--------gc-----------------------------------------
                       Baboon  ---------cc-----agg--------gc-----------------------------------------
                 Green monkey  ---------cc-----agg--------gc-----------------------------------------
                     Marmoset  ---------cc-----agg--------gc-----------------------------------------
              Squirrel monkey  ---------cc-----agg--------gc-----------------------------------------
                     Bushbaby  ---------cc-----tgg--------at-----------------------------------------
           Chinese tree shrew  ---------cc-----aga--------cc-----------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ---------c------------------------------------------------------------
                 Prairie vole  ---------cc-----agg--------gcaagaggg----------------------gaggggcaag--
              Chinese hamster  ---------cc-----agg--------gcaagagtggggacacacacaagaaatgattaatatccaggtg
               Golden hamster  ---------tc-----gag--------gccaggctg-gtatacatag----------tgagttccagg--
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Guinea pig  ---------cc-----agg--------ac-----------------------------------------
                   Chinchilla  ---------cc-----aag--------ac-----------------------------------------
             Brush-tailed rat  ---------cc-----agg--------ac-----------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ---------cc-----agg--------gc-----------------------------------------
               Bactrian camel  ---------cc-----agg--------gc-----------------------------------------
                      Dolphin  ---------ct-----ggg--------gc-----------------------------------------
                 Killer whale  ---------ct-----ggg--------gc-----------------------------------------
             Tibetan antelope  ---------cc-----tgg--------ac-----------------------------------------
                          Cow  ---------cc-----agg--------ac-----------------------------------------
                        Sheep  ---------cc-----agg--------at-----------------------------------------
                Domestic goat  ---------cc-----agg--------ac-----------------------------------------
                        Horse  ---------cc-----agg--------gc-----------------------------------------
             White rhinoceros  ---------cc-----gga--------gc-----------------------------------------
                          Cat  ---------cc-----ggg--------gc-----------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ---------cc-----acg--------gc-----------------------------------------
                        Panda  ---------cc-----ccg--------gc-----------------------------------------
               Pacific walrus  ---------cc-----agg--------gc-----------------------------------------
                 Weddell seal  ---------cc-----agg--------gc-----------------------------------------
             Black flying-fox  ---------cc-----agg--------gc-----------------------------------------
                      Megabat  ---------cc-----agg--------gc-----------------------------------------
                Big brown bat  ---------cc-----aag--------gc-----------------------------------------
         David's myotis (bat)  ---------cc-----aag--------gc-----------------------------------------
                     Microbat  ---------cc-----aag--------gc-----------------------------------------
                     Hedgehog  ---------ca-----agg--------gc-----------------------------------------
              Star-nosed mole  ---------cc-----agt--------gc-----------------------------------------
                     Elephant  cctccccttct-----ggg--------gc-----------------------------------------
                      Manatee  cctcccctcct-----ggg--------gc-----------------------------------------
             Cape golden mole  ccccccatttt-----ggg--------ac-----------------------------------------
                       Tenrec  cccttcct---------gg--------gc-----------------------------------------
                     Aardvark  ccgccccatcg-----ggg--------gc-----------------------------------------
                    Armadillo  ----------c-----agg--------gc-----------------------------------------
              Tasmanian devil  ---------cccatggggc--------ac-----------------------------------------
                 Saker falcon  ---------at----------------gc-----------------------------------------
             Peregrine falcon  ---------at----------------gc-----------------------------------------
          Collared flycatcher  ---------ct----------------cc-----------------------------------------
       White-throated sparrow  ---------ct----------------cc-----------------------------------------
                   Budgerigar  ---------ct-----a----------at-----------------------------------------
           American alligator  ---------ct-----a----------ac-----------------------------------------
              Green seaturtle  ---------ct-----gggtcaattccac-----------------------------------------
               Painted turtle  ---------cc-----aggtcaattccac-----------------------------------------
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  -------tg-g-----------------------a-----------ggc-----a---------------
                        Chimp  -------tg-g-----------------------a-----------ggc-----a---------------
                      Gorilla  -------tg-g-----------------------a-----------ggc-----a---------------
                    Orangutan  -------tg-g-----------------------a-----------ggc-----a---------------
                       Gibbon  -------tg-g-----------------------a-----------ggc-----a---------------
                       Rhesus  -------tg-g-----------------------a-----------ggc-----a---------------
          Crab-eating macaque  -------tg-g-----------------------a-----------ggc-----a---------------
                       Baboon  -------tg-g-----------------------a-----------ggc-----a---------------
                 Green monkey  -------tg-g-----------------------a-----------ggc-----a---------------
                     Marmoset  -------tg-g-----------------------c-----------agc-----a---------------
              Squirrel monkey  -------tg-g-----------------------a-----------ggc-----a---------------
                     Bushbaby  ----------------------------------a-----------ggt-----a---------------
           Chinese tree shrew  -------tc-a-------------------------------------------a---------------
                     Squirrel  -------ga-g-----------------------g-----------cca-----g---------------
       Lesser Egyptian jerboa  -------gc-a-----------------------a-----------gga-----t---------------
                 Prairie vole  -------aa-a---------tgataacc------a-----------tct-----a---------------
              Chinese hamster  gtggtgcac-acctttaatcccagcactcaggtga-----------cag-----a---------------
               Golden hamster  -------ac-a--------gccagaact------a-----------cat-----a---------------
                        Mouse  -------ac-a-----------------------g-----------cca-----g---------------
                          Rat  -------ac-a-----------------------g-----------ccg-----t---------------
               Naked mole-rat  -------tc---------------------------------------a-----g---------------
                   Guinea pig  -------tcaa-----------------------a-----------agg-----g---------------
                   Chinchilla  -------tc-a-----------------------a-----------agg-----g---------------
             Brush-tailed rat  -------tc-a-----------------------a-----------agg-----g---------------
                       Rabbit  -------gt-a-----------------------g-----------------------------------
                         Pika  -------gt-g-----------------------g-----------gga-----g---------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  -------tg-a-----------------------------------------------------------
               Bactrian camel  -------tg-a-------------------------------------g-----a---------------
                      Dolphin  -------tg-a-----------------------g-----------ggg-----a---------------
                 Killer whale  -------tg-a-----------------------g-----------ggg-----a---------------
             Tibetan antelope  -------cg-a-----------------------a-----------agg-----a---------------
                          Cow  -------tg-a-----------------------a-----------ggg-----a---------------
                        Sheep  -------cg-a-----------------------a-----------agg-----a---------------
                Domestic goat  -------ca-a-----------------------a-----------agg-----a---------------
                        Horse  -------tg-a-----------------------a-----------ggg-----a---------------
             White rhinoceros  -------tg-a-----------------------a-----------ggg-----a---------------
                          Cat  -------tg-g-----------------------a-----------ggc-----a---------------
                          Dog  ----------------------------------------------ggc-----a---------------
                      Ferret   -------tg-a-----------------------aggcggcctcagggc-----g---------------
                        Panda  -------tg-a-----------------------g-----------ggc-----a---------------
               Pacific walrus  -------tg-a-----------------------a-----------ggc-----a---------------
                 Weddell seal  -------tg-a-----------------------a-----------ggc-----a---------------
             Black flying-fox  -------tg-a-----------------------a-----------ggg-----a---------------
                      Megabat  -------tg-a-----------------------a-----------ggg-----a---------------
                Big brown bat  -------tg-a-----------------------------------agg-----g---------------
         David's myotis (bat)  -------tg-a-------------------ggcgg-----------ggg-----g---------------
                     Microbat  -------tg-a-------------------ggcgg-----------ggg-----g---------------
                     Hedgehog  -------tg-a-----------------------g-----------agg-----a---------------
              Star-nosed mole  -------ca-c-----------------------a-----------gtg-----a---------------
                     Elephant  -------t--------------------------------------------------------------
                      Manatee  -------tg-g-----------------------a-----------ggg-----a---------------
             Cape golden mole  -------ta-g-----------------------a-----------gca-----gtaaatataaatattg
                       Tenrec  -------t--g-----------------------a-----------gct-----g---------------
                     Aardvark  -------tg-a-----------------------a-----------ggg-----a---------------
                    Armadillo  -------tc-g-----------------------t-----------ggc-----a---------------
              Tasmanian devil  -------ta-t-----------------------g-----------aag-----a---------------
                 Saker falcon  -------aa-a-----------------------g-----------aaaaccctg---------------
             Peregrine falcon  -------aa-a-----------------------g-----------aaaaccctg---------------
          Collared flycatcher  -------ag-g-----------------------g-----------gga-----t---------------
       White-throated sparrow  -------ag-a-----------------------g-----------gga-----t---------------
                   Budgerigar  -------ag-g-----------------------g-----------agg-----t---------------
           American alligator  -------aa-a-----------------------t-----------ggc-----t---------------
              Green seaturtle  -------ac-a-----------------------c-----------agc-----t---------------
               Painted turtle  -------aa-a-----------------------c-----------agc-----t---------------
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  --gg------------------------------------------------------------------
                        Chimp  --gg------------------------------------------------------------------
                      Gorilla  --gg------------------------------------------------------------------
                    Orangutan  --gg------------------------------------------------------------------
                       Gibbon  --gg------------------------------------------------------------------
                       Rhesus  --gg------------------------------------------------------------------
          Crab-eating macaque  --gg------------------------------------------------------------------
                       Baboon  --gg------------------------------------------------------------------
                 Green monkey  --gg------------------------------------------------------------------
                     Marmoset  --gg------------------------------------------------------------------
              Squirrel monkey  --gg------------------------------------------------------------------
                     Bushbaby  --tg------------------------------------------------------------------
           Chinese tree shrew  --gg------------------------------------------------------------------
                     Squirrel  --gg------------------------------------------------------------------
       Lesser Egyptian jerboa  --gg------------------------------------------------------------------
                 Prairie vole  --ga------------------------------------------------------------------
              Chinese hamster  --gacaggcagatctctgagttcgagctagcctggtctacatagtgagttccaggactgccagaactaca
               Golden hamster  --gaga-----aaccctgtct-------------------------------------------------
                        Mouse  --gg------------------------------------------------------------------
                          Rat  --gg------------------------------------------------------------------
               Naked mole-rat  --ag------------------------------------------------------------------
                   Guinea pig  --ag------------------------------------------------------------------
                   Chinchilla  --ag------------------------------------------------------------------
             Brush-tailed rat  --gg------------------------------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  --gc------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ---g------------------------------------------------------------------
               Bactrian camel  --gg------------------------------------------------------------------
                      Dolphin  --gg------------------------------------------------------------------
                 Killer whale  --gg------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  --gg------------------------------------------------------------------
                        Sheep  --gg------------------------------------------------------------------
                Domestic goat  --gg------------------------------------------------------------------
                        Horse  --gg------------------------------------------------------------------
             White rhinoceros  --gg------------------------------------------------------------------
                          Cat  --gg------------------------------------------------------------------
                          Dog  --gg------------------------------------------------------------------
                      Ferret   --gg------------------------------------------------------------------
                        Panda  --gg------------------------------------------------------------------
               Pacific walrus  --gg------------------------------------------------------------------
                 Weddell seal  --gg------------------------------------------------------------------
             Black flying-fox  --gg------------------------------------------------------------------
                      Megabat  --gg------------------------------------------------------------------
                Big brown bat  --gg------------------------------------------------------------------
         David's myotis (bat)  --gg------------------------------------------------------------------
                     Microbat  --gg------------------------------------------------------------------
                     Hedgehog  --gg------------------------------------------------------------------
              Star-nosed mole  --gg------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                      Manatee  ---g------------------------------------------------------------------
             Cape golden mole  ctga------------------------------------------------------------------
                       Tenrec  -tgg------------------------------------------------------------------
                     Aardvark  ---g------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
              Tasmanian devil  --gg------------------------------------------------------------------
                 Saker falcon  --aa------------------------------------------------------------------
             Peregrine falcon  --aa------------------------------------------------------------------
          Collared flycatcher  --gg------------------------------------------------------------------
       White-throated sparrow  --gg------------------------------------------------------------------
                   Budgerigar  --ga------------------------------------------------------------------
           American alligator  --gg------------------------------------------------------------------
              Green seaturtle  --gg------------------------------------------------------------------
               Painted turtle  --gg------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  -----------------------g------agg------cg---------gga---g-------------
                        Chimp  -----------------------g------agg------ca---------gga---g-------------
                      Gorilla  -----------------------g------agg------cg---------gga---g-------------
                    Orangutan  -----------------------g------agg------cg---------gga---g-------------
                       Gibbon  -----------------------g------agg------cg---------gga---g-------------
                       Rhesus  -----------------------c------ggg------tg---------gga---g-------------
          Crab-eating macaque  -----------------------c------ggg------tg---------gga---g-------------
                       Baboon  -----------------------c------ggg------tg---------gga---g-------------
                 Green monkey  -----------------------c------ggg------tg---------gga---g-------------
                     Marmoset  -----------------------g------agg------c----------gga---g-------------
              Squirrel monkey  -----------------------a------agg------tg---------gga---g-------------
                     Bushbaby  -----------------------g------tgg-----------------aga---g-------------
           Chinese tree shrew  -----------------------g------agg------ag---------gga---g-------------
                     Squirrel  -----------------------c------tgg------ag---------gga---g-------------
       Lesser Egyptian jerboa  -----------------------g------caa------gg---------agt---g-------------
                 Prairie vole  -----------------------c------agt------gg---------tgg---a-------------
              Chinese hamster  tagagaaagcccaatctcaacaac------aac------aa---------aaa---a-------------
               Golden hamster  -----------------------c------aac------aa---------caa---a-------------
                        Mouse  -----------------------c------aca------ag---------aaa---g-------------
                          Rat  -----------------------c------aca------ag---------aaa---g-------------
               Naked mole-rat  -----------------------g------gat------ga---------aaa---g-------------
                   Guinea pig  -----------------------g------gat------ga---------aga---g-------------
                   Chinchilla  -----------------------g------gat------ga---------aga---g-------------
             Brush-tailed rat  -----------------------a------gat------ga---------aga---g-------------
                       Rabbit  --------------------------------g------ag---------gga---g-------------
                         Pika  -----------------------g------gag------aa---------gga---g-------------
                          Pig  ------------------------------ggc------gg---------gga---g-------------
                       Alpaca  -----------------------g------tgg------gg---------gga---g-------------
               Bactrian camel  -----------------------a------ggg------gg---------gga---g-------------
                      Dolphin  -----------------------a------agg------ag---------ggg---g-------------
                 Killer whale  -----------------------a------agg------ag---------ggg---g-------------
             Tibetan antelope  ------------------------------ggg------ag---------gga---a-------------
                          Cow  -----------------------a------ggg------ag---------gga---g-------------
                        Sheep  -----------------------t------ggg------ag---------gga---g-------------
                Domestic goat  -----------------------t------ggg------ag---------gga---g-------------
                        Horse  -----------------------c------agg------ag---------gga---g-------------
             White rhinoceros  -----------------------a------aga------ag---------gga---a-------------
                          Cat  -----------------------g------gga------gg---------gg------------------
                          Dog  -----------------------a------agg------ag---------gga---a-------------
                      Ferret   -----------------------a------agg------ag---------gga---a-------------
                        Panda  -----------------------a------agg------ag---------gga---a-------------
               Pacific walrus  -----------------------a------aga------ag---------gga---a-------------
                 Weddell seal  -----------------------a------aga------ag---------gga---a-------------
             Black flying-fox  -----------------------g------agc------ag---------gga---g-------------
                      Megabat  -----------------------g------agc------ag---------gga---g-------------
                Big brown bat  -----------------------g------ggc------gg---------gta---g-------------
         David's myotis (bat)  -----------------------g------ggg------gg---------ggg---ggggagggagcgca
                     Microbat  -----------------------g------ggg------gg---------gta---g-------------
                     Hedgehog  -----------------------g---------------aa---------tga---g-------------
              Star-nosed mole  -----------------------gtcgaagggc------ag---------aga---g-------------
                     Elephant  -------------------------------gg------ag---------gga---g-------------
                      Manatee  -----------------------c------agg------ag---------gga---g-------------
             Cape golden mole  -----------------------c------ggc------agcccgtctcaggg---g-------------
                       Tenrec  -----------------------g------ggc------ag---------gga---g-------------
                     Aardvark  -----------------------c------agg------ag---------gga---g-------------
                    Armadillo  -----------------------g------aga------ag---------ggg---g-------------
              Tasmanian devil  -----------------------t------ggaattgtcag---------agacctg-------------
                 Saker falcon  -----------------------a------cac------ag---------tgt---g-------------
             Peregrine falcon  -----------------------a------cac------ag---------tgt---g-------------
          Collared flycatcher  -----------------------a------cag------gg---------aca---g-------------
       White-throated sparrow  -----------------------a------cag------gg---------aca---g-------------
                   Budgerigar  -----------------------g------cag------gg---------aca---g-------------
           American alligator  -----------------------a------agc------ag---------aaa---c-------------
              Green seaturtle  -----------------------gac----tgg------ag---------act---g-------------
               Painted turtle  -----------------------gac----cag------ag---------act---g-------------
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ctcctatatgacaggtatccttttaggaagaggaaagttggacacagacatacacagatggaagatactg
                     Microbat  ----------------------------------------------------------------------
                     Hedgehog  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
              Tasmanian devil  ----------------------------------------------------------------------
                 Saker falcon  ----------------------------------------------------------------------
             Peregrine falcon  ----------------------------------------------------------------------
          Collared flycatcher  ----------------------------------------------------------------------
       White-throated sparrow  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------
              Green seaturtle  ----------------------------------------------------------------------
               Painted turtle  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                  Stickleback  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                       Medaka  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Nile tilapia  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Atlantic cod  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
           Tibetan ground jay  ======================================================================

                        Human  ----------tagagat-gtcgc----tg
                        Chimp  ----------tagagat-gtcgc----tg
                      Gorilla  ----------tagagat-gtcgc----tg
                    Orangutan  ----------tagagat-gtcgc----tg
                       Gibbon  ----------tagagac-ggcgc----ta
                       Rhesus  ----------tagagat-atcga----tg
          Crab-eating macaque  ----------tagagat-atcga----tg
                       Baboon  ----------tagagag-atcgc----tg
                 Green monkey  ----------tagagag-atcgc----tg
                     Marmoset  ----------tagagat-atctc----tg
              Squirrel monkey  ----------tagagat-acctc----tg
                     Bushbaby  ----------cagagac-aatgc----ca
           Chinese tree shrew  ----------tatagat-actgc----tg
                     Squirrel  ----------tgtaaat-attgt----ta
       Lesser Egyptian jerboa  ----------gattagc-attg-------
                 Prairie vole  ----------gcacacc-tttaa----tt
              Chinese hamster  ----------gataaat-actgg----tc
               Golden hamster  ----------gataaat-actgg----tc
                        Mouse  ----------gataaaa-cctgg----cc
                          Rat  ----------gataaag-cctgg----tc
               Naked mole-rat  ----------tataaat-actgc----tg
                   Guinea pig  ----------tataaat-attgc----t-
                   Chinchilla  ----------tataaat-attgc----ta
             Brush-tailed rat  ----------tataaat-attgcttatta
                       Rabbit  ----------tgggaac-ccagc----ag
                         Pika  ----------tataaac-acagc----tg
                          Pig  ----------tataagc-actgc----cg
                       Alpaca  ----------cataaat-actgc----ga
               Bactrian camel  ----------cataaat-actgc----ga
                      Dolphin  ----------tataaat-actgc----ga
                 Killer whale  ----------tataaat-actgc----ga
             Tibetan antelope  ----------tataaat-actgt----ga
                          Cow  ----------tataaat-actgg----ga
                        Sheep  ----------tataaat-actgt----ga
                Domestic goat  ----------tataaat-actgt----ga
                        Horse  ----------tataaat-actgc----ta
             White rhinoceros  ----------tataaat-actgc----tg
                          Cat  -----------------------------
                          Dog  ----------tataaat-a---c----ta
                      Ferret   ----------gataaat-a---c----ta
                        Panda  ----------tataaat-a---c----ta
               Pacific walrus  ----------tataaat-a---c----ta
                 Weddell seal  ----------tataaat-a---c----ta
             Black flying-fox  ----------tataaataactgc----ta
                      Megabat  ----------tataaataactgc----ta
                Big brown bat  ----------tataaat-actgc----tg
         David's myotis (bat)  tgaaaacacatataagt-actgc----tg
                     Microbat  ----------tataaat-actgc----tg
                     Hedgehog  ----------tatacgg-attac----ta
              Star-nosed mole  ----------tataaat-actgc----ca
                     Elephant  ----------tatagat-ttttc----ta
                      Manatee  ----------tgtaaag-actgc----ca
             Cape golden mole  ----------tcttggt-----c----tg
                       Tenrec  ----------tataaat-atcgc----ta
                     Aardvark  ----------catcagt-gttgc----ta
                    Armadillo  ----------tacaaac-actga----tc
              Tasmanian devil  ----------tgtgaac-cctgg----a-
                 Saker falcon  ----------cccac--------------
             Peregrine falcon  ----------cccac--------------
          Collared flycatcher  ----------gcaca--------------
       White-throated sparrow  ----------ccaca--------------
                   Budgerigar  ----------ccaga--------------
           American alligator  ----------ca-----------------
              Green seaturtle  ----------cctca--------------
               Painted turtle  ----------ccgca--------------
          Cape elephant shrew  =============================
                        Shrew  =============================
       Yellowbelly pufferfish  =============================
                         Fugu  =============================
                  Stickleback  =============================
          Pundamilia nyererei  =============================
                  Zebra mbuna  =============================
        Burton's mouthbreeder  =============================
          Princess of Burundi  =============================
                       Medaka  =============================
                   Coelacanth  =============================
                       Turkey  =============================
                  Spotted gar  =============================
                 Mallard duck  =============================
                      Wallaby  =============================
                       Lizard  =============================
           Southern platyfish  =============================
     Mexican tetra (cavefish)  =============================
                    Zebrafish  =============================
                  Rock pigeon  =============================
                 Nile tilapia  =============================
                    Tetraodon  =============================
                      Chicken  =============================
                 Atlantic cod  =============================
     Chinese softshell turtle  =============================
                  Zebra finch  =============================
                X. tropicalis  =============================
          Medium ground finch  =============================
                      Opossum  =============================
           Tibetan ground jay  =============================

Inserts between block 23 and 24 in window
  D             Saker falcon 14bp
  D         Peregrine falcon 14bp
  D      Collared flycatcher 14bp
  D   White-throated sparrow 14bp
B D               Budgerigar 16bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp

Alignment block 24 of 1557 in window, 75827785 - 75827803, 19 bps 
B D                     Human  ctgagc--c-c-----cca---------------tca-------------------ccatg---
B D                     Chimp  ctgagc--c-c-----cca---------------tca-------------------ccatg---
B D                   Gorilla  ctgagc--c-c-----cca---------------tca-------------------ccatg---
B D                 Orangutan  ctgagc--c-c-----cca---------------tca-------------------ccatg---
B D                    Gibbon  ctgagc--c-c-----aca---------------tca-------------------ccatg---
B D                    Rhesus  ctgagc--c-c-----cca---------------tca-------------------ctgtg---
B D       Crab-eating macaque  ctgagc--c-c-----cca---------------tca-------------------ctgtg---
B D                    Baboon  ctgagc--c-c-----cca---------------tca-------------------ccgtg---
B D              Green monkey  ctgagc--c-c-----cca---------------tca-------------------ccgtg---
B D                  Marmoset  ctgagc--c-a-----tca---------------tca-------------------ctgtg---
B D           Squirrel monkey  ctgagc--c-c-----cca---------------tca-------------------ctgtg---
B D                  Bushbaby  atgtgc--c-c-----ctc---------------tca-------------------ctg-----
           Chinese tree shrew  gcggta--c-c-----ctg---------------tca-------------------c-------
B D                  Squirrel  ataatg--cac-----cca---------------tca-------ctgtgg------ccatg---
       Lesser Egyptian jerboa  atgctg--c-t-----cca---------------tca-------------------ccgcg---
                 Prairie vole  a----a--t-c-----cca---------------gca-------------------ctcag---
B D           Chinese hamster  acggta--c-t-----cca---------------tca-------------------ccaag---
               Golden hamster  acgtta--c-t-----cca---------------tca-------------------ccaag---
B D                     Mouse  acggt------------ca---------------tca-------------------ccaag---
B D                       Rat  atggtg--c-t-----cca---------------tca-------------------ccaag---
B D            Naked mole-rat  atggtg--c-t-----------------------------------------------------
B D                Guinea pig  gtgctg--c-c-----ctg---------------tggtcccacgct----------tgggc---
                   Chinchilla  atagtg--c-c----gcaa---------------ggg-accacact----------ctgga---
             Brush-tailed rat  atagtg--c-c-----cca---------------tag-accacact----------ctgga---
B D                    Rabbit  acggtgccc-c-----cca---------------tcg-------------------ccgtg---
B D                      Pika  ctggtg--c-t-----cca---------------tca-------------------caggg---
B D                       Pig  gtgggg--ccc-----cca---------------tca-------------------ccgtg---
B D                    Alpaca  atgggg--c-c-----cca---------------tca-------------------cagtg---
               Bactrian camel  atgggg--c-c-----cca---------------tca-------------------cagtg---
B D                   Dolphin  atgggg--ccc-----cca---------------tca-------------------ctgtg---
                 Killer whale  atgggg--ccc-----cca---------------tca-------------------ctgtg---
             Tibetan antelope  accggg--ttc-----cca---------------tca-------------------ctgtg---
B D                       Cow  accggg--ctc-----cca---------------tca-------------------ctgtg---
B