Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 152 in window, 53895375 - 53895378, 4 bps 
B D                     Human  tctt
B D                     Chimp  tctt
B D                   Gorilla  tctt
B D                 Orangutan  tctt
B D                    Gibbon  tctt
B D                    Rhesus  actt
B D       Crab-eating macaque  actt
B D                    Baboon  actt
B D              Green monkey  actt
B D                  Marmoset  cctt
B D           Squirrel monkey  cctt
B D                  Bushbaby  cctt
           Chinese tree shrew  cgtt
B D                  Squirrel  cttt
       Lesser Egyptian jerboa  cctt
                 Prairie vole  cttt
B D           Chinese hamster  tgtt
               Golden hamster  cgtt
B D                     Mouse  cctt
B D                       Rat  tctt
B D            Naked mole-rat  cctt
                   Chinchilla  ccct
             Brush-tailed rat  cctt
B D                    Rabbit  cctt
B D                       Pig  cctt
B D                    Alpaca  cctt
               Bactrian camel  cctt
B D                   Dolphin  cctt
                 Killer whale  cctt
             Tibetan antelope  ccct
B D                       Cow  cctt
B D                     Sheep  ccct
                Domestic goat  ccct
B D                     Horse  cctt
B D          White rhinoceros  cctt
B D                       Cat  cttt
B D                       Dog  catt
B D                   Ferret   cctt
B D                     Panda  cctt
               Pacific walrus  cgtt
                 Weddell seal  cctt
             Black flying-fox  tctt
                Big brown bat  cctt
         David's myotis (bat)  cctt
B D                  Microbat  cctt
B D                     Shrew  cctt
              Star-nosed mole  ccac
B D                  Elephant  cctt
          Cape elephant shrew  -ctt
B D                   Manatee  cctt
             Cape golden mole  cgtt
B D                    Tenrec  cctc
B D                 Armadillo  attt
B D                  Hedgehog  ====
B D                Guinea pig  ----
B D                      Pika  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
B D                Budgerigar  ====
  D               Rock pigeon  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                   Wallaby  ====
                    Aardvark  ----
B D                   Megabat  ====
  D  Chinese softshell turtle  ====

Inserts between block 1 and 2 in window
B D                   Rabbit 762bp

Alignment block 2 of 152 in window, 53895379 - 53895381, 3 bps 
B D                     Human  cag
B D                     Chimp  cag
B D                   Gorilla  cag
B D                 Orangutan  cag
B D                    Gibbon  cag
B D                    Rhesus  tag
B D       Crab-eating macaque  tag
B D                    Baboon  tag
B D              Green monkey  cag
B D                  Marmoset  ggg
B D           Squirrel monkey  ggg
B D                  Bushbaby  gga
           Chinese tree shrew  ggt
B D                  Squirrel  ggg
       Lesser Egyptian jerboa  agg
                 Prairie vole  ggg
B D           Chinese hamster  ggg
               Golden hamster  ggg
B D                     Mouse  gaa
B D                       Rat  gaa
B D            Naked mole-rat  ggg
                   Chinchilla  ggg
             Brush-tailed rat  ggg
B D                       Pig  ggg
B D                    Alpaca  agg
               Bactrian camel  agg
B D                   Dolphin  ggg
                 Killer whale  ggg
             Tibetan antelope  ggg
B D                       Cow  ggg
B D                     Sheep  ggg
                Domestic goat  ggg
B D                     Horse  ggg
B D          White rhinoceros  ggg
B D                       Cat  gag
B D                       Dog  gag
B D                   Ferret   gag
B D                     Panda  aag
               Pacific walrus  gag
                 Weddell seal  gag
             Black flying-fox  ggg
                Big brown bat  gag
         David's myotis (bat)  ggg
B D                  Microbat  ggg
B D                     Shrew  ggg
              Star-nosed mole  ggg
B D                  Elephant  ggg
          Cape elephant shrew  gct
B D                   Manatee  ggg
             Cape golden mole  gag
B D                    Tenrec  agg
B D                 Armadillo  ggg
B D                  Hedgehog  ===
B D                Guinea pig  ---
B D                      Pika  ===
B D                    Rabbit  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                   Wallaby  ===
                    Aardvark  ---
B D                   Megabat  ===
  D  Chinese softshell turtle  ===

Alignment block 3 of 152 in window, 53895382 - 53895400, 19 bps 
B D                     Human  cacagc------catc----tcttcactc
B D                     Chimp  cacagc------catc----tcttcactc
B D                   Gorilla  cacagc------catc----tcttcactc
B D                 Orangutan  cacagc------catc----tcttcactc
B D                    Gibbon  cacagc------catc----tcttcactc
B D                    Rhesus  cacagc------catc----tcttcactc
B D       Crab-eating macaque  cacagc------catc----tcttcactc
B D                    Baboon  cacagc------catc----tcttcactc
B D              Green monkey  cacagc------catc----tcttcactc
B D                  Marmoset  cacagc------catc----tcttcattc
B D           Squirrel monkey  cacagc------catc----tcttcactc
B D                  Bushbaby  cacagc------catc----tgtttattc
           Chinese tree shrew  tata-------------------------
B D                  Squirrel  catattatcaaacacc----tccttgctc
       Lesser Egyptian jerboa  tgtggc------cacc----tccttcctc
                 Prairie vole  catatc------catc----tccttctgc
B D           Chinese hamster  cttagc------catc----tccttctga
               Golden hamster  cttagc------catc----tccttctga
B D                     Mouse  cacagc------catctgtgtcctcatgc
B D                       Rat  cacagc------catccgtgtccttgagc
B D            Naked mole-rat  catggc------cgcc----tccttattc
                   Chinchilla  catggc------cacc----tccttattc
             Brush-tailed rat  gatggc------cacc----tccttattc
B D                      Pika  cagggt------cctc----tctttattc
B D                       Pig  cttggc------catt----ttcttactc
B D                    Alpaca  cttgtc------tatc----ccctcactc
               Bactrian camel  cttgtc------tatc----ccctcactc
B D                   Dolphin  cttggc------catc----tccttgctc
                 Killer whale  cttggc------catc----tccttactc
             Tibetan antelope  cttggc------catc----tccttgctc
B D                       Cow  cttggc------catc----tccttgctc
B D                     Sheep  cttggc------catc----tccttgctc
                Domestic goat  cttggc------catc----tccttgctc
B D                     Horse  cttggc------catc----ttcttactc
B D          White rhinoceros  cttggc------tatc----ttcttactc
B D                       Cat  cttggc------cgtc----tgcttactc
B D                       Dog  cttagc------catc----tccttactc
B D                   Ferret   gttggc------catc----tccttactc
B D                     Panda  cttggc------catc----tccttactc
               Pacific walrus  cttggc------catc----tccttactc
                 Weddell seal  cttggc------catc----tccttactc
             Black flying-fox  cttggc------catc----tctttactg
                Big brown bat  tgtggc------catc----tccttgctc
         David's myotis (bat)  tgtggc------catc----tccttgctc
B D                  Microbat  tgtggc------catc----tccttgctc
B D                     Shrew  ctgggt------catc----tatca----
              Star-nosed mole  cttggt------tacc----ccttacttt
B D                  Elephant  catggt------catc----tccttagtc
          Cape elephant shrew  cctggt------tctc----tcctaagtc
B D                   Manatee  catggt------catc----tccttactc
             Cape golden mole  cctggt------catc----ttcttgctc
B D                    Tenrec  aacggt------catc----tccttacgt
                     Aardvark  catgac------catc----tccttactc
B D                 Armadillo  cacggc------catc----tcttcatgc
B D                  Hedgehog  =============================
B D                Guinea pig  -----------------------------
B D                    Rabbit  =============================
  D              Mallard duck  =============================
          Tibetan ground jay  =============================
B D           Tasmanian devil  =============================
  D            Painted turtle  =============================
  D           Green seaturtle  =============================
B D        American alligator  =============================
B D                Budgerigar  =============================
  D               Rock pigeon  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
B D                   Wallaby  =============================
B D                   Megabat  =============================
  D  Chinese softshell turtle  =============================

Inserts between block 3 and 4 in window
B D                 Bushbaby 1bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                     Pika 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 290bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 4 of 152 in window, 53895401 - 53895453, 53 bps 
B D                     Human  atcatttggcaagggc-tagaataaaacaaa------t-c-t-tc---tgaa--tatttgttc-------
B D                     Chimp  atcatttggcaagggc-tagaataaaacaaa------t-c-t-tc---tgaa--tatttgttc-------
B D                   Gorilla  atcatttggcaagggc-tagaataaaacaaa------c-c-t-tc---tgaa--tatttgttc-------
B D                 Orangutan  atcatttggcgagggc-tagaataaaacaaa------c-c-t-tc---tgaa--tatttgttc-------
B D                    Gibbon  atcatttggcgagggc-tagaataaaacaaa------c-c-t-tc---tgaa--tatttgttc-------
B D                    Rhesus  atcatttggcgagggc-tagaataaaacaaa------c-c-t-tc---tgaa--tatttgttc-------
B D       Crab-eating macaque  atcatttggcgagggc-tagaataaaacaaa------c-c-t-tc---tgaa--tatttgttc-------
B D                    Baboon  atcatttggcgagggc-tagaataaaacaaa------t-c-t-tc---tgaa--tatttgttc-------
B D              Green monkey  atcatttggcgagggc-tagaataaaacaaa------c-c-t-tc---tgaa--tatttgttc-------
B D                  Marmoset  atcatttggtgaggtc-tagaatgaaacaaa------c-c-t-tc---cgaa--tatttcttc-------
B D           Squirrel monkey  atcatttggtgaggtc-tagaatgaaacaaa------c-c-t-tc---cgaa--tatttcttt-------
B D                  Bushbaby  gtcatttggtgagggc-tagaatgagcaaac------t-c-c-tc---caga--tatccattc-------
           Chinese tree shrew  ggcatttgatgaggac-tagaatgaaacaat------c-c-tctc---caaa--tatccattt-------
B D                  Squirrel  atcatgtggtgagggc-cagaatgaagcaga------c-ctc-tc---caaa--tattcattcaactt--
       Lesser Egyptian jerboa  atcattttataaaggc-cagaaggaaat--c------c-t-t-cc---aaaa--ggttcattcctgta--
                 Prairie vole  gt-atttaataaaggc-cagaatgaagcaaa------t-tcc-cc---caga--gatccattc-------
B D           Chinese hamster  accatttgataaaggc-aagagtgaaacaaa------t-t-t-cc---caga--gatccattc-------
               Golden hamster  atcctttgataaacgc-cagaatgaaacatc------t-t------------------cattc-------
B D                     Mouse  atcatttgataaat-c-cagaacgaaacaaa------t-t-c-cc---tgaa--gatccattc-------
B D                       Rat  atcatctgataaat-c-cagaacgaaacaaa------t-t-c-cc---caaa--gatccattc-------
B D            Naked mole-rat  atcatttggtgagtac-cagaatgaaacaat------ctc-c-cc---aaag--tatccattc-----at
                   Chinchilla  atcattttgtgagtac-cagaatggagcaac------c-c-c-cc---aaaa--tatccactc-----at
             Brush-tailed rat  atcctttggtgagtac-cagaataaagcaag------c-c-c-cc---aaaa--tatccattc-----at
B D                      Pika  gtcatttggtgaactc-tggaatgaaacagg------t-c-c-at-----------ttctttc-------
B D                       Pig  atcatttggtga-tgg-gaggaagaaacaaa------c-ccc-tt---ccga--gagcccctc-------
B D                    Alpaca  agtatttggtga-gagctggaatgaaacaaa------c-cct-tc---ctaa--tatccactc-------
               Bactrian camel  aatatttggtga-gagctggaatgaaacaaa------c-cct-tc---ctaa--tatccactc-------
B D                   Dolphin  atcatttggtga-gag-cagaatgaaaca------------c-tg---ctga--tagccactc-------
                 Killer whale  atcatttggtga-gag-cagaatgaaaca------------c-tg---ctga--tagccactc-------
             Tibetan antelope  atcatttggtga-gag-tagaagaaaacaaa------a-ccc-tc---ctga--tagcca----------
B D                       Cow  atcatttggtga-gag-tagaacaaaacaaa------c-ccc-tc---ctga--tagccactc-------
B D                     Sheep  atcatttggtaa-gag-tagaagaaaacaaa------a-ccc-tc---ctga--tagcca----------
                Domestic goat  atcatttggtga-gag-tagaagaaaaaaaa------a-ccc-tc---ctga--tagcca----------
B D                     Horse  atcatttggagagggc-taggatgaaacaaa------c-ccc-tc---ctga--gatccatta-------
B D          White rhinoceros  accatttggagagggc-tcaaatgaaacaaa------c-ccc-tc---ctga--catccaatc-------
B D                       Cat  atcatgttgtga-gcc-cacaatgaaacaaa------t-ccc-tc---ctga--tatccatta-------
B D                       Dog  atgatattgtgt-ggc-taaaatgaaacaaa------c-acc-tc---caga--tatctattc-------
B D                   Ferret   ggcatgttgtaa-agc-tagaatgaaacaaa------t-gcc-tt---ccac--tatctattc-------
B D                     Panda  agcatgttgtga-ggc-ccgaatggaacaaa------g-gcc-tc---ctga--tatctattc-------
               Pacific walrus  agcatgttgtga-ggc-tagaatgaaacaaa------c-gcc-tc---ctgg--tatgtattc-------
                 Weddell seal  agcatgttgtga-ggc-tagaatgaaacaaa------c-gcc-tc---ctga--tatgtattc-------
             Black flying-fox  atcaatt-----gggc-tagaatgaaacaaa------c-ctc-tc---ctga--tatctattc-------
                Big brown bat  atcatttggtgagggc-tagaatgaaacaaa------c-tcc-tc---atga--tagccactc-------
         David's myotis (bat)  atcatttggtgagggc-tagaatgaaacaaa------c-tcc-tc---atga--tatccactc-------
B D                  Microbat  atcatttggtgagggt-tagaataaaacaaa------c-tcc-tc---atga--tatccactc-------
B D                     Shrew  atcacttggtgagagc-cagaataaaacagcacccccc-ccc-ccaaaccca--tacgtgttt-------
              Star-nosed mole  atcatttgatgagggc-cagaatga------------c-tgc-cc---ccca--tacagattt-------
B D                  Elephant  gttggttagtgagggc-tagactgaaacaaa------c-ctc-tc---ctaa--tatgaattc-------
          Cape elephant shrew  cttgtttagtgagaac-tggaatgaaacaaa------c-gcc-tc---ctaa--aatgcattc-------
B D                   Manatee  gttggttagtgagggc-tagactgaaacaaa------c-ccc-tc---ctaa--tatgcattc-------
             Cape golden mole  attgtttagtga-ggc-tagaataaagcaaa------c-tcc-tc---ccaa--tatgcattc-------
B D                    Tenrec  cgtgcatcgag--gac-cagcatgaaacaag------c-cca-tc---ctaa--cacgcgctc-------
                     Aardvark  attgtttagtgagagc-tagaatgaaacaaa------t-ccc-tc---ctaa--catgcattc-------
B D                 Armadillo  atcatttggtgaggac-tggattgaaacaaa------t-ccc-tc---ctaatttatccattc-------
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ----------------------------------------------------------------------
B D                    Rabbit  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Megabat  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ---ctctt
                        Chimp  ---ctctt
                      Gorilla  ---ctctt
                    Orangutan  ---ctctt
                       Gibbon  ---ctctt
                       Rhesus  ---ctctt
          Crab-eating macaque  ---ctctt
                       Baboon  ---ctctt
                 Green monkey  ---ctctt
                     Marmoset  ---gtctt
              Squirrel monkey  ---ctctt
                     Bushbaby  ---tttgt
           Chinese tree shrew  ---ctttt
                     Squirrel  --------
       Lesser Egyptian jerboa  --------
                 Prairie vole  --------
              Chinese hamster  --------
               Golden hamster  --------
                        Mouse  --------
                          Rat  --------
               Naked mole-rat  ctt-----
                   Chinchilla  ctt-----
             Brush-tailed rat  ctt-----
                         Pika  --------
                          Pig  ---cttct
                       Alpaca  ---ctcct
               Bactrian camel  ---ctcct
                      Dolphin  ---ctcct
                 Killer whale  ---ctcct
             Tibetan antelope  ---ctcct
                          Cow  ---ctcct
                        Sheep  ---ctcct
                Domestic goat  ---ctcct
                        Horse  ---gtcct
             White rhinoceros  ---ctcct
                          Cat  ---ctagt
                          Dog  ---ctcct
                      Ferret   ---ttcct
                        Panda  ---ctccc
               Pacific walrus  ---ttcct
                 Weddell seal  ---ttcct
             Black flying-fox  ---ctcct
                Big brown bat  ---ctcct
         David's myotis (bat)  ---ctcct
                     Microbat  ---ctcct
                        Shrew  ---cttgt
              Star-nosed mole  ---ctcct
                     Elephant  ---tcctt
          Cape elephant shrew  ---tcctt
                      Manatee  ---tcctt
             Cape golden mole  ---tcctt
                       Tenrec  ---tcctg
                     Aardvark  ---tcctt
                    Armadillo  ---ccctt
                     Hedgehog  ========
                   Guinea pig  --------
                       Rabbit  ========
                 Mallard duck  ========
           Tibetan ground jay  ========
              Tasmanian devil  ========
               Painted turtle  ========
              Green seaturtle  ========
           American alligator  ========
                   Budgerigar  ========
                  Rock pigeon  ========
             Peregrine falcon  ========
                 Saker falcon  ========
                      Wallaby  ========
                      Megabat  ========
     Chinese softshell turtle  ========

Inserts between block 4 and 5 in window
B D           Naked mole-rat 261bp

Alignment block 5 of 152 in window, 53895454 - 53895489, 36 bps 
B D                     Human  acagaaa-ctcttcttgc----taagtcagacccctcaggg
B D                     Chimp  acagaaa-ctcttcttgc----taagtcagacccctcaggg
B D                   Gorilla  acagaaa-ctcttcttgc----taagtcagacccctcaggg
B D                 Orangutan  acagaaa-cccttcttgc----taagttagacccctcaagg
B D                    Gibbon  acagaaa-cccttcttgc----taagtcagacccctcaggg
B D                    Rhesus  acagaaa-cccttcttgc----taagtcagacccctcaggg
B D       Crab-eating macaque  acagaaa-cccttcttgc----taagtcagacccctcaggg
B D                    Baboon  acagaaa-cccttcttgc----taagtcagacccctcaggg
B D              Green monkey  acagaaa-cccttcttgc----taagtcagacccctcaggg
B D                  Marmoset  acagaaa-cctttcttgc----ttggtcagacccctcagga
B D           Squirrel monkey  acagaaa-cccttcttgc----ttggtcagacccctcagag
B D                  Bushbaby  agagaaa-cgctccttgctccttgcgtcagacccctcaaag
           Chinese tree shrew  agagaaa-tccttcttgg----tagagcagactccttagag
B D                  Squirrel  --gagaaacccttcttgc----taggtcagacttctcagat
       Lesser Egyptian jerboa  --aagaaatccttcttgc----taagtcagacctctcaaag
                 Prairie vole  --------ttcctattcc----tgagtcaaacctatcagag
B D           Chinese hamster  --------ttcttcttgc----tgattcagacccatcagag
               Golden hamster  --------tcctttttgc----tgattcagacccatcagag
B D                     Mouse  --------ttc---ttgc----tgggtcagacccatcagag
B D                       Rat  --------ttc---ttgc----tgggtcagacccaccagag
B D            Naked mole-rat  agaaaag-tccttcttgc----taggttagaaccctcagaa
                   Chinchilla  -gaaaaa-cccttcttgc----taggtcagaatcctcagaa
             Brush-tailed rat  -gaaaaa-cctctcttgc----taagttagaatcctcagaa
B D                      Pika  -acaatg-tccttttcat----ggggctggactcctcagag
B D                       Pig  agagaaa-cgcttcctgc----tccgtcagatccctcaggg
B D                    Alpaca  agagaaa-cccttcttgc----tgggtcagacccctcagag
               Bactrian camel  agagaaa-cccttcttgc----tgggtcagacccctcagag
B D                   Dolphin  agagaaa-cccttcttgc----tggatcggacccctcagag
                 Killer whale  agagaaa-cccttcttgc----tggatcggacccctcagag
             Tibetan antelope  agagaaa-ctcttcctgc----tggatcagacccctcaagg
B D                       Cow  agagaaa-ctcttcatgc----tggatcagacccctcaagg
B D                     Sheep  agagaaa-ctcttcctgc----tggatcagacccctcaagg
                Domestic goat  agagaaa-ctcttcctgc----tggatcagacccctcaagg
B D                     Horse  agagaaa-cccttcttgt----tagatcagacccctcagag
B D          White rhinoceros  agagaaa-cccctcttgc----tagatcagacccctcagat
B D                       Cat  agagaaa-cacttcttgc----tagatcagaccctt-----
B D                       Dog  acagaaa-cccttcttgc----tagatcagacccct-----
B D                   Ferret   aaagaaa-cccttcttgc----tagatcagacccct-----
B D                     Panda  agagaaa-cccttcttgc----tagatcagacccctga---
               Pacific walrus  aaagaaa-ctcttcttgc----tagatcagacccct-----
                 Weddell seal  aaagaaa-cttttcttgc----tagatcagacccct-----
             Black flying-fox  aaagaaa-ccctttgtgc----tagatcagacccctcagag
                Big brown bat  aaggaaa-cccttcttgc----tagatcagacccctcagag
         David's myotis (bat)  aggggaa-cccttcatgc----cagatcagacccctcagag
B D                  Microbat  agggaaa-cccttcatgc----tagatcagacccctcagag
B D                     Shrew  agagaaa-tccttcttg-----taagttagacagtttaaag
              Star-nosed mole  agagaaa-cccttctt---------actggtcaccttctga
B D                  Elephant  ggagaaa-ctcttcttgc----taggtcagatccctcaggg
          Cape elephant shrew  agagaaa-atattcttgc----tagacctaat--ctcaaag
B D                   Manatee  ggagaaa-catttcttgc----taggtcagatccctcagag
             Cape golden mole  agagaaa-tctatcttac----taga-----ttcttcagac
B D                    Tenrec  ggagaaa-tcagtcttgt----taggtcaacttccttcgag
                     Aardvark  agagaaa-ctcttcttgc----tgggttagatccttcagag
B D                 Armadillo  agaaaag-cccttcatgt----taaatgagactcctcagag
B D                  Hedgehog  =========================================
B D                Guinea pig  -----------------------------------------
B D                    Rabbit  =========================================
  D              Mallard duck  =========================================
          Tibetan ground jay  =========================================
B D           Tasmanian devil  =========================================
  D            Painted turtle  =========================================
  D           Green seaturtle  =========================================
B D        American alligator  =========================================
B D                Budgerigar  =========================================
  D               Rock pigeon  =========================================
  D          Peregrine falcon  =========================================
  D              Saker falcon  =========================================
B D                   Wallaby  =========================================
B D                   Megabat  =========================================
  D  Chinese softshell turtle  =========================================

Inserts between block 5 and 6 in window
B D                      Pig 286bp

Alignment block 6 of 152 in window, 53895490 - 53895511, 22 bps 
B D                     Human  a----gcaccttcctg-----tgttgtatct
B D                     Chimp  a----gcaccttcctg-----tgttgtatct
B D                   Gorilla  a----gcaccttcctg-----tgttgtatct
B D                 Orangutan  a----gcaccttcctg-----tgttgtatct
B D                    Gibbon  a----gcaccttcctg-----tgctgtatct
B D                    Rhesus  a----gcaccttccta-----tgttgtatct
B D       Crab-eating macaque  a----gcaccttccta-----tgttgtatct
B D                    Baboon  a----gcaccttccta-----tgttgtatct
B D              Green monkey  a----gcaccttccta-----tgttgtatct
B D                  Marmoset  a----gcaccttcttg-----tgttgtatct
B D           Squirrel monkey  a----gcaccttcttg-----tgttatagct
B D                  Bushbaby  a----gcacctttccg-----tgttgtaaca
           Chinese tree shrew  a----gcaccttccca-----tgtcttacca
B D                  Squirrel  a----atgccttccca-----cattgtatca
       Lesser Egyptian jerboa  a----atactttccca-----tgtttagtct
                 Prairie vole  a----ctgccttccca-----tgacagagat
B D           Chinese hamster  a----ctgccttccta-----tgacagatct
               Golden hamster  a----ctgccttccca-----tgacagatct
B D                     Mouse  a----ctgccttctca-----tgacaaatct
B D                       Rat  a----ctgccttctcg-----tgacaaatct
B D            Naked mole-rat  a----atatcttgcca-----tgttacatca
                   Chinchilla  g----ctatcttccca-----tgttgtacca
             Brush-tailed rat  a----atatcttctca-----tgttgtatca
B D                      Pika  agaaggtactttctca-----ggtaccactg
B D                    Alpaca  a----acaccttccca-----ggctgcatca
               Bactrian camel  a----acaccttccca-----ggctgcatca
B D                   Dolphin  a----acaccttctca-------ctgcatcg
                 Killer whale  a----acaccttctca-------ctgcatca
             Tibetan antelope  a----acacctttcca------tctgtatca
B D                       Cow  a----acacctttcca------tctgtatca
B D                     Sheep  a----acacctttcca------tctgtatca
                Domestic goat  a----acacctttcca------tctgtatca
B D                     Horse  a----acaccttcccatggtgcattgcatta
B D          White rhinoceros  a----acatgttccca-----cactgcatta
B D                       Cat  -----------tcc-a-----cactgcatca
B D                       Dog  -----------tcctg-----caccacattg
B D                   Ferret   -----------tccca-----taccacatca
B D                     Panda  -----------tccca-----caccacacca
               Pacific walrus  -----------tccca-----caccacatca
                 Weddell seal  -----------tccca-----caccacatca
             Black flying-fox  a----acaccttccca-----cactgcatca
                Big brown bat  a----acaccttccca-----cactgcatca
         David's myotis (bat)  a----acaccgttcca-----cactgcacca
B D                  Microbat  a----acaccgttcca-----cattgcatca
B D                     Shrew  g----acatcttttca-----cacctcatca
              Star-nosed mole  g----at-cctttcca-----ctctgtgtca
B D                  Elephant  a----ataccttccaa--------tgtatca
          Cape elephant shrew  a----ccaccttctga---ttttttttatca
B D                   Manatee  a----gcaccttccaa--------tgtatca
             Cape golden mole  a----gcaccttccaa-----tgttggatga
B D                    Tenrec  a----gcaccctccaa-----ggccgcatca
                     Aardvark  a----tcaccttccca-----tgttgtatca
B D                 Armadillo  a----gcatgttctat-----ttttatatca
B D                  Hedgehog  ===============================
B D                Guinea pig  -------------------------------
B D                    Rabbit  ===============================
  D              Mallard duck  ===============================
          Tibetan ground jay  ===============================
B D           Tasmanian devil  ===============================
  D            Painted turtle  ===============================
  D           Green seaturtle  ===============================
B D        American alligator  ===============================
B D                Budgerigar  ===============================
  D               Rock pigeon  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
B D                   Wallaby  ===============================
B D                   Megabat  ===============================
B D                       Pig  ===============================
  D  Chinese softshell turtle  ===============================

Alignment block 7 of 152 in window, 53895512 - 53895516, 5 bps 
B D                     Human  gaaat
B D                     Chimp  gaaat
B D                   Gorilla  gaaat
B D                 Orangutan  gaaat
B D                    Gibbon  gaaat
B D                    Rhesus  gaaat
B D       Crab-eating macaque  gaaat
B D                    Baboon  gaaat
B D              Green monkey  gaaat
B D                  Marmoset  gaaat
B D           Squirrel monkey  gaaat
B D                  Bushbaby  gaaat
           Chinese tree shrew  gaaat
B D                  Squirrel  gatat
       Lesser Egyptian jerboa  gaaat
                 Prairie vole  gaaat
B D           Chinese hamster  gaaat
               Golden hamster  g-aat
B D                     Mouse  gaaat
B D                       Rat  aaaat
B D            Naked mole-rat  caaat
                   Chinchilla  gaaat
             Brush-tailed rat  gaaat
B D                      Pika  gaaat
B D                       Pig  gaaat
B D                    Alpaca  caaat
               Bactrian camel  caaat
B D                   Dolphin  gaaat
                 Killer whale  gaaat
             Tibetan antelope  gaaat
B D                       Cow  gaaat
B D                     Sheep  gaaat
                Domestic goat  gaaat
B D                     Horse  gaaat
B D          White rhinoceros  gatat
B D                       Cat  gagat
B D                       Dog  gaaat
B D                   Ferret   gaaat
B D                     Panda  gaaat
               Pacific walrus  gaaat
                 Weddell seal  gaaat
             Black flying-fox  gaaat
                Big brown bat  gaaat
         David's myotis (bat)  gaaat
B D                  Microbat  gaaat
B D                     Shrew  aaaat
              Star-nosed mole  gaaac
B D                  Elephant  gaaat
          Cape elephant shrew  gaaat
B D                   Manatee  gaaat
             Cape golden mole  gcaat
B D                    Tenrec  gaaat
                     Aardvark  gaaat
B D                 Armadillo  gaaat
B D                  Hedgehog  =====
B D                Guinea pig  -----
B D                    Rabbit  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D           Tasmanian devil  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
B D                Budgerigar  =====
  D               Rock pigeon  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                   Wallaby  =====
B D                   Megabat  =====
  D  Chinese softshell turtle  =====

Inserts between block 7 and 8 in window
B D                      Pig 3bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                  Ferret  3bp
B D                    Panda 3bp
              Pacific walrus 3bp
                Weddell seal 205bp
            Black flying-fox 3bp
               Big brown bat 3bp
        David's myotis (bat) 3bp
B D                 Microbat 3bp
B D                    Shrew 3bp
             Star-nosed mole 3bp

Alignment block 8 of 152 in window, 53895517 - 53895522, 6 bps 
B D                     Human  ---c-tcc-t-g
B D                     Chimp  ---c-tcc-t-g
B D                   Gorilla  ---c-tcc-t-g
B D                 Orangutan  ---c-tcc-t-g
B D                    Gibbon  ---c-tcc-t-g
B D                    Rhesus  ---c-tcc-t-g
B D       Crab-eating macaque  ---c-tcc-t-g
B D                    Baboon  ---c-tcc-t-g
B D              Green monkey  ---c-ccc-t-g
B D                  Marmoset  ---c-tcc-t-g
B D           Squirrel monkey  ---c-tcc-t-g
B D                  Bushbaby  ---c-tcagc-g
           Chinese tree shrew  ---c-tcc-t-g
B D                  Squirrel  ---ctcct-g--
       Lesser Egyptian jerboa  ---c-ctt-g--
                 Prairie vole  ---c-cct-g--
B D           Chinese hamster  ---c-cct-g--
               Golden hamster  ---c-tct-g--
B D                     Mouse  ---c-cct-g--
B D                       Rat  ---c-cct-g--
B D            Naked mole-rat  ---c-tcc-t--
                   Chinchilla  ---c-tcc-g--
             Brush-tailed rat  ---c-tcc-t--
B D                      Pika  ---c-ttc-tc-
B D                       Pig  ---c-tc-----
B D                    Alpaca  ---c-tc-----
               Bactrian camel  ---c-tc-----
B D                   Dolphin  ---c-tc-----
                 Killer whale  ---c-tc-----
             Tibetan antelope  ---c-tc-----
B D                       Cow  ---c-tc-----
B D                     Sheep  ---c-tc-----
                Domestic goat  ---c-tc-----
B D                     Horse  ---c-tg-----
B D                       Cat  ---c-ta-----
B D                       Dog  ---c-tg-----
B D                   Ferret   ---c-tg-----
B D                     Panda  ---c-tg-----
               Pacific walrus  ---c-tg-----
                 Weddell seal  ---c-tg-----
             Black flying-fox  ---c-gg-----
B D                   Megabat  ---c-tg-----
                Big brown bat  ---c-ta-----
         David's myotis (bat)  ---c-ta-----
B D                  Microbat  ---c-ta-----
B D                     Shrew  ---c-ta-----
              Star-nosed mole  ---c-tg-----
B D                  Elephant  ctct-tg-----
          Cape elephant shrew  atct-gg-----
B D                   Manatee  ctcc-tg-----
             Cape golden mole  cttc-tg-----
B D                    Tenrec  cttc-tg-----
                     Aardvark  ctcc-tg-----
B D                 Armadillo  ctcc-cg-----
B D                  Hedgehog  ============
B D                Guinea pig  ------------
B D                    Rabbit  ============
  D              Mallard duck  ============
          Tibetan ground jay  ============
B D           Tasmanian devil  ============
  D            Painted turtle  ============
  D           Green seaturtle  ============
B D        American alligator  ============
B D                Budgerigar  ============
  D               Rock pigeon  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
B D                   Wallaby  ============
  D  Chinese softshell turtle  ============
B D          White rhinoceros  ============

Inserts between block 8 and 9 in window
B D           Naked mole-rat 1bp
                  Chinchilla 1bp
            Brush-tailed rat 115bp
B D                    Shrew 1bp

Alignment block 9 of 152 in window, 53895523 - 53895525, 3 bps 
B D                     Human  ttt
B D                     Chimp  ttt
B D                   Gorilla  ttt
B D                 Orangutan  ttt
B D                    Gibbon  ttt
B D                    Rhesus  ttt
B D       Crab-eating macaque  ttt
B D                    Baboon  ttt
B D              Green monkey  ttt
B D                  Marmoset  ttt
B D           Squirrel monkey  ttt
B D                  Bushbaby  ttc
           Chinese tree shrew  ttt
B D                  Squirrel  tc-
       Lesser Egyptian jerboa  cta
                 Prairie vole  ttg
B D           Chinese hamster  ttg
               Golden hamster  ttg
B D                     Mouse  ttg
B D                       Rat  ttg
B D            Naked mole-rat  tct
                   Chinchilla  tct
             Brush-tailed rat  tct
B D                      Pika  ctg
B D                       Pig  ttt
B D                    Alpaca  cct
               Bactrian camel  cct
B D                   Dolphin  ttt
                 Killer whale  ttt
             Tibetan antelope  ttt
B D                       Cow  ttt
B D                     Sheep  ttt
                Domestic goat  ttt
B D                     Horse  ttt
B D                       Cat  tct
B D                       Dog  tct
B D                   Ferret   tct
B D                     Panda  tct
               Pacific walrus  ttt
                 Weddell seal  ttt
             Black flying-fox  ttt
B D                   Megabat  ttt
                Big brown bat  ttt
         David's myotis (bat)  ctc
B D                  Microbat  ctt
B D                     Shrew  ttt
              Star-nosed mole  tcc
B D                  Elephant  ttt
          Cape elephant shrew  ttt
B D                   Manatee  ttt
             Cape golden mole  ttt
B D                    Tenrec  ctt
                     Aardvark  ttt
B D                 Armadillo  ttt
B D                  Hedgehog  ===
B D                Guinea pig  ---
B D                    Rabbit  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                   Wallaby  ===
  D  Chinese softshell turtle  ===
B D          White rhinoceros  ===

Inserts between block 9 and 10 in window
         Cape elephant shrew 908bp

Alignment block 10 of 152 in window, 53895526 - 53895535, 10 bps 
B D                     Human  tggctatcag
B D                     Chimp  tggctatcag
B D                   Gorilla  tggctatcag
B D                 Orangutan  tggctatcag
B D                    Gibbon  tggctatcag
B D                    Rhesus  tggctatcag
B D       Crab-eating macaque  tggctatcag
B D                    Baboon  tggctatcag
B D              Green monkey  tggctatcag
B D                  Marmoset  tggctttcag
B D           Squirrel monkey  tggcgctcag
B D                  Bushbaby  tgg-----ga
           Chinese tree shrew  tgactatcaa
       Lesser Egyptian jerboa  tggccaccaa
                 Prairie vole  tttccaccag
B D           Chinese hamster  tttccac---
               Golden hamster  cttccac---
B D                     Mouse  tttccaccag
B D                       Rat  tttccaccag
B D            Naked mole-rat  tagatatgag
                   Chinchilla  tggatatgag
             Brush-tailed rat  tggatatgag
B D                      Pika  tgactttcag
B D                       Pig  gggctattg-
B D                    Alpaca  tggctaccag
               Bactrian camel  tggctaccag
B D                   Dolphin  tggctatcag
                 Killer whale  tggctatcag
             Tibetan antelope  caactgtcgg
B D                       Cow  cgactgtcgg
B D                     Sheep  gaactgtcgg
                Domestic goat  caactgtcgg
B D                     Horse  tggctataag
B D          White rhinoceros  ---ctataag
B D                       Cat  tggctatcag
B D                       Dog  tggctatcag
B D                   Ferret   tggctatccg
B D                     Panda  tggttatcag
               Pacific walrus  tgactatcag
                 Weddell seal  tgactatcag
             Black flying-fox  tgtctatcag
B D                   Megabat  tgtctatcaa
                Big brown bat  tggccatcag
         David's myotis (bat)  tggctctcag
B D                  Microbat  tggctatcag
B D                     Shrew  tggctg---g
              Star-nosed mole  cagctattcg
B D                  Elephant  tgactaccag
B D                   Manatee  tgactaacag
             Cape golden mole  tgactgagag
B D                    Tenrec  tgactagcag
                     Aardvark  tgactaacag
B D                 Armadillo  tgactatcag
B D                  Hedgehog  ==========
B D                Guinea pig  ----------
B D                    Rabbit  ==========
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D           Tasmanian devil  ==========
  D            Painted turtle  ==========
  D           Green seaturtle  ==========
B D        American alligator  ==========
B D                Budgerigar  ==========
  D               Rock pigeon  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
         Cape elephant shrew  ==========
B D                   Wallaby  ==========
  D  Chinese softshell turtle  ==========
B D                  Squirrel  ----------

Inserts between block 10 and 11 in window
            Tibetan antelope 399bp
B D                    Sheep 402bp

Alignment block 11 of 152 in window, 53895536 - 53895545, 10 bps 
B D                     Human  tgtcatagtt
B D                     Chimp  tgtcatcgtt
B D                   Gorilla  agtcatagtt
B D                 Orangutan  tgtcatagtt
B D                    Gibbon  tgtcatagtt
B D                    Rhesus  tgtcatagtt
B D       Crab-eating macaque  tgtcatagtt
B D                    Baboon  tgtcatagtt
B D              Green monkey  tgtcatagtt
B D                  Marmoset  tgtcatagtt
B D           Squirrel monkey  tgtcatagtt
B D                  Bushbaby  ggccttagct
           Chinese tree shrew  tgacaacgtt
B D                  Squirrel  -----caggc
       Lesser Egyptian jerboa  ----acaaat
                 Prairie vole  ----acaact
B D           Chinese hamster  -----caact
               Golden hamster  -----caact
B D                     Mouse  ----acaact
B D                       Rat  ----acaact
B D            Naked mole-rat  tgccataatt
                   Chinchilla  agccatagtt
             Brush-tailed rat  agtcgtactt
B D                      Pika  tgtcaatgtt
B D                       Pig  tgtggtagtt
B D                    Alpaca  tggcttagtt
               Bactrian camel  tggcttagtt
B D                   Dolphin  tgtcatagtt
                 Killer whale  tgtcatagtt
B D                       Cow  tatc-tcgtt
                Domestic goat  tatc-tagtt
B D                     Horse  tgtcatagtt
B D          White rhinoceros  tgacaaagtt
B D                       Cat  tgtcgtagtt
B D                       Dog  tgtcataact
B D                   Ferret   tatcatag--
B D                     Panda  tgtcatagtt
               Pacific walrus  tatcatag--
                 Weddell seal  tatcatag--
             Black flying-fox  tgtcagagtt
B D                   Megabat  tgtcagagtt
                Big brown bat  tgtcatagtt
         David's myotis (bat)  tgtcatagtt
B D                  Microbat  tgtcattgtt
B D                     Shrew  tgagatagtt
              Star-nosed mole  tgtcgtggtt
B D                  Elephant  tgtcacagtt
B D                   Manatee  tatcacagtt
             Cape golden mole  tgtcacggtt
B D                    Tenrec  tgtcagggtt
                     Aardvark  tgtcacagtt
B D                 Armadillo  tttcacaatt
B D                  Hedgehog  ==========
B D                Guinea pig  ----------
B D                    Rabbit  ==========
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D           Tasmanian devil  ==========
  D            Painted turtle  ==========
  D           Green seaturtle  ==========
B D        American alligator  ==========
B D                Budgerigar  ==========
  D               Rock pigeon  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
         Cape elephant shrew  ==========
B D                   Wallaby  ==========
  D  Chinese softshell turtle  ==========
B D                     Sheep  ==========
            Tibetan antelope  ==========

Inserts between block 11 and 12 in window
B D                    Shrew 2697bp

Alignment block 12 of 152 in window, 53895546 - 53895567, 22 bps 
B D                     Human  tgct-accagaagtatgg-taatt
B D                     Chimp  tgct-accagaagtatgg-taatc
B D                   Gorilla  tgct-accagaagtatgg-taatt
B D                 Orangutan  tgct-accagaagtatgg-taatt
B D                    Gibbon  tgct-accagaagcatgg-taatt
B D                    Rhesus  tgct-accagaagtatggataatt
B D       Crab-eating macaque  tgct-accagaagtatggataatt
B D                    Baboon  tgct-accagaagtatggataatt
B D              Green monkey  tgct-accagaagtatggataatt
B D                  Marmoset  tgct-accagaagtatggataatt
B D           Squirrel monkey  tgct-accagaagtatggataatt
B D                  Bushbaby  cacg-agtttgagatcgg---cct
           Chinese tree shrew  tgtt-atcagaagtgtagataatt
B D                  Squirrel  taca--------gtgtggataatt
       Lesser Egyptian jerboa  cgct-agtacatgtgtggataatt
                 Prairie vole  tgca-accagatgtatgaataatc
B D           Chinese hamster  tgca-gccagatgtataaataatc
               Golden hamster  tgca-accagatgtatgaataatc
B D                     Mouse  tgca-accagatatatgaataatt
B D                       Rat  tgca-atcaaatgtatgaataatt
B D            Naked mole-rat  tgctaaccagatatggatataatt
                   Chinchilla  tgct-accagatgtgtgtataatt
             Brush-tailed rat  ttct-accaga--tgtgtataatt
B D                      Pika  ggct-agcagaattgtggacaact
B D                       Pig  tgct-accagaagtgtggacaat-
B D                    Alpaca  tgct-accagaagtgtggacaat-
               Bactrian camel  tgct-accagaagtgtggacaat-
B D                   Dolphin  ttct-accagtaatgtggacaat-
                 Killer whale  ttct-accagtaatgtggacaat-
B D                       Cow  ggtt-accagaaacgtggacagt-
                Domestic goat  ggtt-accagaaatgtggacagc-
B D                     Horse  tgcg-accagaagtgtggacagt-
B D          White rhinoceros  tcct-accagaagtgtggacaac-
B D                       Cat  tgcc-accagaagtgtggacaat-
B D                       Dog  tgct-actggaagtgtggacaat-
B D                     Panda  tgct-actgggagtgtggacaat-
             Black flying-fox  tgct-accagaagtgtaaacaat-
B D                   Megabat  tgct-accagaagtgtaaacaat-
                Big brown bat  tgct-accagaagtatggacaac-
         David's myotis (bat)  tgcc-accagaagtatggacaac-
B D                  Microbat  tgct-accagaagtatggacaac-
              Star-nosed mole  tggt-accatcagggtggccacc-
B D                  Elephant  tcct-accagaagagtggaaaact
B D                   Manatee  tcct-accagaattgtggacaatt
             Cape golden mole  ttct-accagaagtgtgggcaatt
B D                    Tenrec  tcct-accagaagggtggacagtt
                     Aardvark  tcct-accaaaagtgtgaacaact
B D                 Armadillo  tgct-accagaaatgtggacaatt
B D                  Hedgehog  ========================
B D                Guinea pig  ------------------------
B D                    Rabbit  ========================
B D                     Shrew  ========================
  D              Mallard duck  ========================
          Tibetan ground jay  ========================
B D           Tasmanian devil  ========================
  D            Painted turtle  ========================
  D           Green seaturtle  ========================
B D        American alligator  ========================
B D                Budgerigar  ========================
  D               Rock pigeon  ========================
  D          Peregrine falcon  ========================
  D              Saker falcon  ========================
         Cape elephant shrew  ========================
B D                   Wallaby  ========================
  D  Chinese softshell turtle  ========================
B D                   Ferret   ------------------------
B D                     Sheep  ========================
            Tibetan antelope  ========================
              Pacific walrus  ------------------------
                Weddell seal  ------------------------

Inserts between block 12 and 13 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                      Cow 360bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                    Panda 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp

Alignment block 13 of 152 in window, 53895568 - 53895569, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
           Chinese tree shrew  ga
B D                  Squirrel  ga
       Lesser Egyptian jerboa  ga
                 Prairie vole  aa
B D           Chinese hamster  aa
               Golden hamster  aa
B D                     Mouse  ga
B D                       Rat  ga
B D            Naked mole-rat  ga
                   Chinchilla  ga
             Brush-tailed rat  ga
B D                      Pika  ga
B D                       Pig  ga
B D                    Alpaca  ga
               Bactrian camel  ga
B D                   Dolphin  ga
                 Killer whale  ga
B D                       Cow  ga
                Domestic goat  ga
B D                     Horse  ga
B D          White rhinoceros  ga
B D                       Cat  ga
B D                       Dog  ga
B D                     Panda  ga
             Black flying-fox  ga
B D                   Megabat  ga
                Big brown bat  ga
         David's myotis (bat)  ga
B D                  Microbat  ga
              Star-nosed mole  -g
B D                  Elephant  ga
B D                   Manatee  ga
             Cape golden mole  ga
B D                    Tenrec  ga
                     Aardvark  ga
B D                 Armadillo  ga
B D                  Hedgehog  ==
B D                Guinea pig  --
B D                    Rabbit  ==
B D                     Shrew  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
         Cape elephant shrew  ==
B D                   Wallaby  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   --
B D                     Sheep  ==
            Tibetan antelope  ==
              Pacific walrus  --
                Weddell seal  --

Alignment block 14 of 152 in window, 53895570 - 53895576, 7 bps 
B D                     Human  gaccacg
B D                     Chimp  gaccacg
B D                   Gorilla  gaccaca
B D                 Orangutan  gaccaca
B D                    Gibbon  gaccaca
B D                    Rhesus  g---aca
B D       Crab-eating macaque  g---aca
B D                    Baboon  g---aca
B D              Green monkey  g---aca
B D                  Marmoset  gaccaca
B D           Squirrel monkey  gaccaca
B D                  Bushbaby  gccaaag
           Chinese tree shrew  gacaaca
B D                  Squirrel  gagaaaa
       Lesser Egyptian jerboa  ggcaaca
                 Prairie vole  gataaca
B D           Chinese hamster  gacaaca
               Golden hamster  gacaaca
B D                     Mouse  gacaaca
B D                       Rat  gacaaca
B D            Naked mole-rat  gacaaca
                   Chinchilla  gacaaca
             Brush-tailed rat  gacaaca
B D                      Pika  gaaatca
B D                       Pig  gatgaca
B D                    Alpaca  gacaaca
               Bactrian camel  gacaaca
B D                   Dolphin  gatgaca
                 Killer whale  gatgaca
B D                       Cow  gacaaca
                Domestic goat  gacgact
B D                     Horse  gacagca
B D          White rhinoceros  gacaaca
B D                       Cat  gacaaca
B D                       Dog  gacaaca
B D                     Panda  gacaaca
             Black flying-fox  gacaaca
B D                   Megabat  gacaaca
                Big brown bat  gactaca
         David's myotis (bat)  gactaca
B D                  Microbat  gactaca
              Star-nosed mole  ggcaata
B D                  Elephant  gacaata
B D                   Manatee  gacaata
             Cape golden mole  aacaata
B D                    Tenrec  gataaca
                     Aardvark  gacagta
B D                  Hedgehog  =======
B D                Guinea pig  -------
B D                    Rabbit  =======
B D                     Shrew  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D           Tasmanian devil  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
B D                Budgerigar  =======
  D               Rock pigeon  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
         Cape elephant shrew  =======
B D                   Wallaby  =======
  D  Chinese softshell turtle  =======
B D                   Ferret   -------
B D                     Sheep  =======
            Tibetan antelope  =======
              Pacific walrus  -------
B D                 Armadillo  -------
                Weddell seal  -------

Alignment block 15 of 152 in window, 53895577 - 53895593, 17 bps 
B D                     Human  gag----------------------------------------------------------aaccc---t
B D                     Chimp  gag----------------------------------------------------------aaccc---t
B D                   Gorilla  gag----------------------------------------------------------aaccc---t
B D                 Orangutan  gag----------------------------------------------------------aaccc---t
B D                    Gibbon  ggg----------------------------------------------------------aactc---t
B D                    Rhesus  aag----------------------------------------------------------aaccc---t
B D       Crab-eating macaque  aag----------------------------------------------------------aaccc---t
B D                    Baboon  aag----------------------------------------------------------aaccc---t
B D              Green monkey  aag----------------------------------------------------------aaccc---t
B D                  Marmoset  gag----------------------------------------------------------aaccc---t
B D           Squirrel monkey  gag----------------------------------------------------------aaccc---t
B D                  Bushbaby  caa----------------------------------------------------------gacccccat
           Chinese tree shrew  gag----------------------------------------------------------aagcc---t
B D                  Squirrel  -----------------------------------------------------------------c---t
       Lesser Egyptian jerboa  gag----------------------------------------------------------agcct---t
                 Prairie vole  gaa----------------------------------------------------------aact-----
B D           Chinese hamster  gag----------------------------------------------------------agttc---t
               Golden hamster  gag----------------------------------------------------------aaccc---t
B D                     Mouse  gtg----------------------------------------------------------agcac---t
B D                       Rat  gag----------------------------------------------------------agcat---t
B D            Naked mole-rat  gag----------------------------------------------------------aac-t---t
                   Chinchilla  gag----------------------------------------------------------aac-c---t
             Brush-tailed rat  gag----------------------------------------------------------aat-a---t
B D                    Rabbit  ggg----------------------------------------------------------aaccc---t
B D                      Pika  gag----------------------------------------------------------aaccc---t
B D                       Pig  gag----------------------------------------------------------agccc---t
B D                    Alpaca  gag----------------------------------------------------------agccc---t
               Bactrian camel  gag----------------------------------------------------------agccc---t
B D                   Dolphin  ggg----------------------------------------------------------agccc---t
                 Killer whale  ggg----------------------------------------------------------agccc---t
B D                       Cow  aag----------------------------------------------------------agccc---t
                Domestic goat  gaattgttgttcagtctctcagttgtgtccgactctgtgaccccatggactgcagcacaccaggct---t
B D                     Horse  gag----------------------------------------------------------agctt---t
B D          White rhinoceros  cag----------------------------------------------------------agcct---t
B D                       Cat  gag----------------------------------------------------------aaccc---t
B D                       Dog  gag----------------------------------------------------------agccc---t
B D                     Panda  gag----------------------------------------------------------agccg---t
             Black flying-fox  gag----------------------------------------------------------aacct---t
B D                   Megabat  gag----------------------------------------------------------gacct---t
                Big brown bat  gag----------------------------------------------------------aaccc---t
         David's myotis (bat)  gag----------------------------------------------------------aacct---t
B D                  Microbat  gag----------------------------------------------------------aaccc---t
              Star-nosed mole  gag------------------------------------------------------------ccc---t
B D                  Elephant  gag----------------------------------------------------------aagcc---t
B D                   Manatee  gag----------------------------------------------------------aaccc---g
             Cape golden mole  gag----------------------------------------------------------aaccc---t
B D                    Tenrec  gag----------------------------------------------------------aatcc---t
                     Aardvark  aag----------------------------------------------------------aattc---t
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ----------------------------------------------------------------------
B D                     Shrew  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
         Cape elephant shrew  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ----------------------------------------------------------------------
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
              Pacific walrus  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
                Weddell seal  ----------------------------------------------------------------------

                        Human  ccccaaaa
                        Chimp  ccccaaaa
                      Gorilla  ccccagaa
                    Orangutan  ccccaaaa
                       Gibbon  cctcaaaa
                       Rhesus  ccccaaaa
          Crab-eating macaque  ccccaaaa
                       Baboon  ccccaaaa
                 Green monkey  ccccaaaa
                     Marmoset  ccctaaaa
              Squirrel monkey  ccctaaaa
                     Bushbaby  ctctaaaa
           Chinese tree shrew  ttctaaaa
                     Squirrel  tcctatga
       Lesser Egyptian jerboa  tcctacca
                 Prairie vole  --ctacct
              Chinese hamster  tcctgcct
               Golden hamster  tcctgcct
                        Mouse  tcctactt
                          Rat  tcctacct
               Naked mole-rat  tcctaaaa
                   Chinchilla  tcctaaaa
             Brush-tailed rat  tcctaaaa
                       Rabbit  tcctacaa
                         Pika  tcctgaaa
                          Pig  tcctaagg
                       Alpaca  tcctaaaa
               Bactrian camel  tcct--aa
                      Dolphin  tcctaaaa
                 Killer whale  tcctaaaa
                          Cow  ttctaaaa
                Domestic goat  ccccagaa
                        Horse  tcctaaag
             White rhinoceros  tcctaatg
                          Cat  tcctaaaa
                          Dog  tactaaaa
                        Panda  tcctaaaa
             Black flying-fox  ttct-aaa
                      Megabat  ttct-aaa
                Big brown bat  tcctaaaa
         David's myotis (bat)  tcctaaaa
                     Microbat  tcctaaaa
              Star-nosed mole  ttgcagac
                     Elephant  ttctaaaa
                      Manatee  ttctaaaa
             Cape golden mole  ttctgaaa
                       Tenrec  ttccaaaa
                     Aardvark  ttttaaca
                     Hedgehog  ========
                   Guinea pig  --------
                        Shrew  ========
                 Mallard duck  ========
           Tibetan ground jay  ========
              Tasmanian devil  ========
               Painted turtle  ========
              Green seaturtle  ========
           American alligator  ========
                   Budgerigar  ========
                  Rock pigeon  ========
             Peregrine falcon  ========
                 Saker falcon  ========
          Cape elephant shrew  ========
                      Wallaby  ========
     Chinese softshell turtle  ========
                      Ferret   --------
                        Sheep  ========
             Tibetan antelope  ========
               Pacific walrus  --------
                    Armadillo  --------
                 Weddell seal  --------

Inserts between block 15 and 16 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
               Domestic goat 132bp

Alignment block 16 of 152 in window, 53895594 - 53895609, 16 bps 
B D                     Human  tggtga-------aa-------agccttag
B D                     Chimp  tggtga-------aa-------agccttag
B D                   Gorilla  tggtga-------aa-------agccttag
B D                 Orangutan  cggtga-------aa-------agccttag
B D                    Gibbon  cggtga-------aa-------agccttag
B D                    Rhesus  cggtaa-------aa-------agccttag
B D       Crab-eating macaque  cggtaa-------aa-------agccttag
B D                    Baboon  cggtaa-------aa-------agccttag
B D              Green monkey  cggtaa-------aa-------agccttag
B D                  Marmoset  cagtga-------aa-------aacctcag
B D           Squirrel monkey  cagtga-------ca-------agcctcag
B D                  Bushbaby  ctatcc-------aggcaatgtggtcttgg
           Chinese tree shrew  ctgtaa-------aa-------atcctctg
B D                  Squirrel  cagtga-------aa-------ag------
       Lesser Egyptian jerboa  tggtga-------ca-------ggccacaa
                 Prairie vole  tgataa-------ga-------agccacga
B D           Chinese hamster  tgatga-------ga-------aaccacaa
               Golden hamster  tgatga-------ga-------aaccacaa
B D                     Mouse  tgataa-------ca-------agccacaa
B D                       Rat  tgataa-------ca-------agccacaa
B D            Naked mole-rat  cagtga-------aa-------gccttcag
                   Chinchilla  cagtga-------aa-------gcccacag
             Brush-tailed rat  cagtga-------aa-------gcccacag
B D                    Rabbit  ccgg--------------------------
B D                      Pika  caga--------------------------
B D                       Pig  aggtga-------aa-------ggcctggg
B D                    Alpaca  agacaa-------ag-------ggccttgg
               Bactrian camel  agacaa-------ag-------ggccttgg
B D                   Dolphin  aggtaa-------aa-------ggtcttgg
                 Killer whale  aggtaa-------aa-------ggtcttgg
B D                       Cow  aggtga-------aa-------ggccttgg
                Domestic goat  tggtca-------aa-------ggactgga
B D                     Horse  ttatga-------aa-------ggccttgg
B D          White rhinoceros  cagtga-------aa-------ggccttgg
B D                       Cat  tagtgaggccttgga-------ggccttgg
B D                       Dog  cagtga-------aa-------ggccttgg
B D                     Panda  gagtga-------aa-------ggccttgg
             Black flying-fox  tggtaa-------aa-------ggccttgg
B D                   Megabat  tggtaa-------aa-------ggccttgg
                Big brown bat  gggtta-------aa-------ggtcttgg
         David's myotis (bat)  aggtaa-------ga-------gg-cctgg
B D                  Microbat  gggtaa-------aa-------gg-cctgg
              Star-nosed mole  cagtgg-------aa-------ggcctcgc
B D                  Elephant  gagtga-------aa-------ggtcttgg
B D                   Manatee  gagaga-------aa-------ggtcttgg
             Cape golden mole  gagtac-------aa-------gggcttgg
B D                    Tenrec  gagggg-------aa-------gatcttag
                     Aardvark  gagtga-------aa-------agtcttgg
B D                  Hedgehog  ==============================
B D                Guinea pig  ------------------------------
B D                     Shrew  ==============================
  D              Mallard duck  ==============================
          Tibetan ground jay  ==============================
B D           Tasmanian devil  ==============================
  D            Painted turtle  ==============================
  D           Green seaturtle  ==============================
B D        American alligator  ==============================
B D                Budgerigar  ==============================
  D               Rock pigeon  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================
         Cape elephant shrew  ==============================
B D                   Wallaby  ==============================
  D  Chinese softshell turtle  ==============================
B D                   Ferret   ------------------------------
B D                     Sheep  ==============================
            Tibetan antelope  ==============================
              Pacific walrus  ------------------------------
B D                 Armadillo  ------------------------------
                Weddell seal  ------------------------------

Inserts between block 16 and 17 in window
B D          Squirrel monkey 161bp
               Domestic goat 121bp

Alignment block 17 of 152 in window, 53895610 - 53895617, 8 bps 
B D                     Human  aagccttt
B D                     Chimp  aagccttt
B D                   Gorilla  aagccttt
B D                 Orangutan  aag-----
B D                    Gibbon  aagccttt
B D                    Rhesus  aagctttt
B D       Crab-eating macaque  aagctttt
B D                    Baboon  aagctttt
B D              Green monkey  aagctttt
B D                  Marmoset  aagccttt
B D           Squirrel monkey  aagccttt
B D                  Bushbaby  aagccttt
           Chinese tree shrew  aagccttt
       Lesser Egyptian jerboa  gagctttt
                 Prairie vole  gagccttc
B D           Chinese hamster  gaaccttc
               Golden hamster  gaaccttc
B D                     Mouse  gagtcttc
B D                       Rat  gagtcttc
B D            Naked mole-rat  gagccttt
                   Chinchilla  gagccctt
             Brush-tailed rat  gagcctat
B D                       Pig  aagccttc
B D                    Alpaca  aaaccttt
               Bactrian camel  aaaccttt
B D                   Dolphin  aagccttt
                 Killer whale  aagccttt
             Tibetan antelope  aaggcctt
B D                     Sheep  aaggcctt
                Domestic goat  aaggcctt
B D                     Horse  gagccttt
B D          White rhinoceros  gagccttt
B D                       Cat  aggccttt
B D                       Dog  aggccttt
B D                   Ferret   -----ttt
B D                     Panda  agaccttt
               Pacific walrus  -----ttt
                 Weddell seal  -----ttt
             Black flying-fox  acgccttt
B D                   Megabat  acgccttt
                Big brown bat  aagccctt
         David's myotis (bat)  aagccttt
B D                  Microbat  aagccttt
              Star-nosed mole  aagccttt
B D                  Elephant  aagccttt
B D                   Manatee  aagccttt
             Cape golden mole  aagccttt
B D                    Tenrec  aagtcgtt
                     Aardvark  aagccttt
B D                  Hedgehog  ========
B D                Guinea pig  --------
B D                      Pika  --------
B D                    Rabbit  --------
B D                     Shrew  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D           Tasmanian devil  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
B D                Budgerigar  ========
  D               Rock pigeon  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
         Cape elephant shrew  ========
B D                   Wallaby  ========
  D  Chinese softshell turtle  ========
B D                  Squirrel  --------
B D                 Armadillo  --------
B D                       Cow  --------

Inserts between block 17 and 18 in window
B D                 Marmoset 153bp

Alignment block 18 of 152 in window, 53895618 - 53895618, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  g
           Chinese tree shrew  g
       Lesser Egyptian jerboa  g
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  c
B D            Naked mole-rat  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  t
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  c
B D                  Microbat  g
              Star-nosed mole  g
B D                  Elephant  g
B D                   Manatee  t
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                  Hedgehog  =
B D                Guinea pig  -
B D                      Pika  -
B D                     Shrew  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D          Peregrine falcon  =
  D              Saker falcon  =
         Cape elephant shrew  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =
B D                 Orangutan  -
B D                  Squirrel  -
B D                 Armadillo  -
B D                       Cow  -

Alignment block 19 of 152 in window, 53895619 - 53895635, 17 bps 
B D                     Human  ttttaaaagat----gtggag
B D                     Chimp  ttttaaaagat----gtggag
B D                   Gorilla  ttttaaaagat----gtggag
B D                    Gibbon  tttcaaaagat----gtggag
B D                    Rhesus  gtttaaacgat----gtgaag
B D       Crab-eating macaque  gtttaaacgat----gtgaag
B D                    Baboon  gtttaaacgat----gtgaag
B D              Green monkey  gtttaaatgat----gtgaag
B D                  Marmoset  gtttaaaagat----gtggag
B D           Squirrel monkey  gtttaaaagat----atggag
B D                  Bushbaby  gcttacaggat----ttggag
           Chinese tree shrew  gtttaaaggct----gtcaag
B D                  Squirrel  gttggaaggat----gtagag
       Lesser Egyptian jerboa  gtttaaccaat----gcag-a
                 Prairie vole  ctttaaaggat----gaagaa
B D           Chinese hamster  ttttaaaagat----gaagaa
               Golden hamster  ctttaaaggat----gaagaa
B D                     Mouse  ctttaaaggat----gcagaa
B D                       Rat  ctttaaaggat----gcagaa
B D            Naked mole-rat  gtttaaag---------agag
                   Chinchilla  gtttaagggaa----gtagaa
             Brush-tailed rat  gtttaagggat----gtagag
B D                    Rabbit  cttggaagtct----tcggag
B D                      Pika  --aaaaaggtt----ttggga
B D                       Pig  atataaaggac----gtagag
B D                    Alpaca  gtttaaaggat----gtggag
               Bactrian camel  gtttaaagggt----gtggag
B D                   Dolphin  gttcaaagggc----gtggag
                 Killer whale  gttcaaagggc----gtggag
             Tibetan antelope  gtttgatggag----atggag
B D                       Cow  -ttcgatgggg----gtggag
B D                     Sheep  gtttgatggag----atggag
                Domestic goat  gtttgatggag----atggag
B D                     Horse  gccta-aggat----gtggaa
B D          White rhinoceros  gtttataggat----gtggaa
B D                       Cat  gcttaaagagt----gtggaa
B D                       Dog  gcttaaaggat----atggaa
B D                   Ferret   gcttaaaggat----atggaa
B D                     Panda  gcttaaaggat----gtggaa
               Pacific walrus  acttaaaggat----gtggaa
                 Weddell seal  acttaaaggat----gtggaa
             Black flying-fox  gtttaaagaacatagatagaa
B D                   Megabat  gtttaaagaacatagatagaa
                Big brown bat  gtttaaatgac----ctgaaa
         David's myotis (bat)  gtttaaatgac----gtggaa
B D                  Microbat  gtttaaatgac----gtggaa
              Star-nosed mole  gtttaaaggac----gtggag
B D                  Elephant  -gttaaaggat----gtggag
          Cape elephant shrew  ttttttaaaat----gtgaaa
B D                   Manatee  ggttaaagaat----gtggag
             Cape golden mole  -gttaaaggat----gtagag
B D                    Tenrec  -gttagaggat----gtggag
                     Aardvark  -gttaagggat----gtagaa
B D                  Hedgehog  =====================
B D                Guinea pig  ---------------------
B D                     Shrew  =====================
  D              Mallard duck  =====================
          Tibetan ground jay  =====================
B D           Tasmanian devil  =====================
  D            Painted turtle  =====================
  D           Green seaturtle  =====================
B D        American alligator  =====================
B D                Budgerigar  =====================
  D               Rock pigeon  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
B D                   Wallaby  =====================
  D  Chinese softshell turtle  =====================
B D                 Orangutan  ---------------------
B D                 Armadillo  ---------------------

Inserts between block 19 and 20 in window
B D                    Horse 16bp

Alignment block 20 of 152 in window, 53895636 - 53895644, 9 bps 
B D                     Human  atgaattcc
B D                     Chimp  atgaattcc
B D                   Gorilla  atgaattcc
B D                    Gibbon  atgaattcc
B D                    Rhesus  atgaattcc
B D       Crab-eating macaque  atgaattcc
B D                    Baboon  atgaattcc
B D              Green monkey  atgaattcc
B D                  Marmoset  atgaatgct
B D           Squirrel monkey  atgaattct
B D                  Bushbaby  atgaattcc
           Chinese tree shrew  attaattcc
B D                  Squirrel  attaattca
       Lesser Egyptian jerboa  attaattcc
                 Prairie vole  attaattcc
B D           Chinese hamster  attaattcc
               Golden hamster  attaattcc
B D                     Mouse  attaattcc
B D                       Rat  attaattcc
B D            Naked mole-rat  attaattcc
                   Chinchilla  attaattct
             Brush-tailed rat  attaattcc
B D                    Rabbit  attaattcc
B D                      Pika  at-------
B D                       Pig  tttaatctc
B D                    Alpaca  cttaatctc
               Bactrian camel  cttaatctc
B D                   Dolphin  cttaatctc
                 Killer whale  cttaatctc
             Tibetan antelope  cttaacctc
B D                       Cow  cttaacctc
B D                     Sheep  cttaacctc
                Domestic goat  cttaacctc
B D          White rhinoceros  cttaatcca
B D                       Cat  cttaatccc
B D                       Dog  cttaatccc
B D                   Ferret   cttaatccc
B D                     Panda  cttaatccc
               Pacific walrus  cttaatccc
                 Weddell seal  cttaatccc
             Black flying-fox  cttaatccc
B D                   Megabat  cttaatccc
                Big brown bat  ctcaatccc
         David's myotis (bat)  cccaatccc
B D                  Microbat  ctccatccc
              Star-nosed mole  ttgaatccc
B D                  Elephant  attaatccc
          Cape elephant shrew  attaatccc
B D                   Manatee  attaatccc
             Cape golden mole  aataa-tcc
B D                    Tenrec  aataatttc
                     Aardvark  agtaatcac
B D                  Hedgehog  =========
B D                Guinea pig  ---------
B D                     Shrew  =========
  D              Mallard duck  =========
          Tibetan ground jay  =========
B D           Tasmanian devil  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D        American alligator  =========
B D                Budgerigar  =========
  D               Rock pigeon  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
B D                   Wallaby  =========
  D  Chinese softshell turtle  =========
B D                 Orangutan  ---------
B D                     Horse  =========
B D                 Armadillo  ---------

Alignment block 21 of 152 in window, 53895645 - 53895846, 202 bps 
B D                     Human  tg---------agagttta----------gat-gc---ttctcctacccctcctcc-tctggcctcatga
B D                     Chimp  tg---------agagttta----------gat-gc---ttctcctacccctcctcc-tctggcctcatga
B D                   Gorilla  tg---------agagttta----------gat-gc---ttctcccacccctcctcc-tctggcctcatga
B D                 Orangutan  ------------------------------------------------------cc-tccggcctcatga
B D                    Gibbon  tg---------agagttta----------gat-gc---ttctcccacccctcctcc-tctggcctcatga
B D                    Rhesus  tg---------agagttta----------gat-gc---ctctcccacccctcctccttctggcctcataa
B D       Crab-eating macaque  tg---------agagttta----------gat-gc---ctctcccacccctcctccttctggcctcataa
B D                    Baboon  tg---------agagttta----------gat-gc---ctctcccacccctcctctttctggcctcataa
B D              Green monkey  tg---------agagttta----------gat-gc---ctctcccacccctcctccttctcgcctcatga
B D                  Marmoset  tg---------agagttga----------gat-gc---ttctcccacccctcctccttctggcctcatga
B D           Squirrel monkey  tg---------agagttta----------gat-gc---ttctcccacccctcctccttctggcctcatga
B D                  Bushbaby  ta---------agaatgtatgagg---cgtat-tc---ctctcccaaccctcatctttcttgtgtcttga
           Chinese tree shrew  tgcaaaattttgaaatata----------aac-gc---ttctcccaaccctcatccctcttgtctcgtgg
B D                  Squirrel  tg---------gaaatttatgaagt-gtagat-gt--------------ctcatccttcgtgcttcatga
       Lesser Egyptian jerboa  tt---------agaaattgtgagtc-tcggat-gg---ttccctcagctttcatctttcttatgttgtga
                 Prairie vole  tg---------ggtc-tcatgaggt-ttggat-gc---cttcctcagctctcatctttcttgcttcatgc
B D           Chinese hamster  tg---------ggcctttataagg--ttgggt-gt---ctccctcagccctcatttttcttgcattgtag
               Golden hamster  tg---------ggcctttatgaggt-ttggat-at---ctccctcagccctcatctttcttgctttgtgg
B D                     Mouse  tg---------ggatgttatgagac-tcggat-gt---ctccctcagccctcatctttcttagttcatga
B D                       Rat  tg---------ggccgttacgagac-ttggat-at---ctccctcagccctcatctttcttagttcatga
B D            Naked mole-rat  tg---------ggagtttatgaggt-gtacat-gc---ctctc-caaacttcatccttcttgacttacga
                   Chinchilla  ta---------ggtgtttatgaggt-gcacag-ac---ctctc-caaccttcatccttctcggcttatga
             Brush-tailed rat  tg---------ggaatttatgaggt-gcacat-gc---ctcat-caaccttcatccttcttggtttatga
B D                    Rabbit  ag---------ag-----------------ac-gc---ctcct-tgaccttcacc-ttcttgcctcgtgg
B D                      Pika  ----------------------------------------------accctaatc-ttcttgcctcactc
B D                       Pig  tg---------agagtttatgggggaatcgat-ac---ctctcccagccctcatcctccttgccccgtga
B D                    Alpaca  tg---------agcatttaagaggg-gtagat-ac---ccctcccagccctcatcctccttgctccatga
               Bactrian camel  tg---------agcatttaagaggg-gtagat-ac---ccctcccagccctcatcctccttgctccataa
B D                   Dolphin  tg---------agaatttatggggg-gtagat-gt---ctctcccaaccgtcatcctccttactccacaa
                 Killer whale  tg---------agaatttatggggg-gtagat-gt---ctctcccaaccgtcatcctccttactccacag
             Tibetan antelope  tg---------agaatgtatgaggg-gtagataac---ctttcccaaccttcatcctcctcactcc---a
B D                       Cow  tg---------agattgtttgaggg-gtagataac---ctttcccaaccttcatcctctttactccacaa
B D                     Sheep  tg---------agaatgtatgaggg-gtagataac---ctttcccaaccttcatcctcctcactcc---a
                Domestic goat  tg---------agaatgtatgaggg-gtagataac---ctttcccaaccttcttcctccttactcc---a
B D                       Cat  tg---------agaatttaggaggt-gtagac-at---ctctgccagccttaatcctccctgccccatga
B D                       Dog  tg---------agaattcaggagat-atag-c-ac---ctctgccagccttcatcctccctaccccatga
B D                   Ferret   tg---------agaatttagaagat-gtagac-ac---ccctgccagccttcattctccctatcccatga
B D                     Panda  tg---------agaatttaggaggt-gtagac-ac---ctctggcagccttcatcctgcctaccccatga
               Pacific walrus  tg---------agaatttaggagat-gtagac-at---acctgctagctttcatcctccctaccccatga
                 Weddell seal  tg---------agaatttaggagat-gtagac-at---acctgctagccttcatcctccctaccccatga
             Black flying-fox  tg---------agaatttatgaagt-gtaaat-gc---ttctcccaactctcattctccttgccctagaa
B D                   Megabat  tg---------agaatttatgaagt-gtaaat-gc---ttctcccaactctcattctccttgccctagaa
                Big brown bat  ta---------agaac---tgaggt-ataaat-gc---ctctcccaaccctcatcctccttgccccacga
         David's myotis (bat)  ga---------agaacttataaggt-ataaat-gc---ctctcccaaccctcatcctccttgccccacta
B D                  Microbat  ta---------agaacttataaggt-ataaat-gc---ctctcccaaccctcatcctccttgccccacta
              Star-nosed mole  tg---------agagtttatgaagt-gtaggt-ac---ctct-ccaattctcaacctctttgccccatgt
B D                  Elephant  tg---------agaagttatgaggt-atagac-aa---ctctaccaaccctcatcctccttgccccatga
          Cape elephant shrew  tg---------agaagt----------tagag-at---cattcccagttgttaaactccttgcttgaaaa
B D                   Manatee  -g---------agaagttaagaggt-atagac-ac---ctctcccaacactcatcctccttgccctatga
             Cape golden mole  tg---------agaagctgtaaagt-gtaaat-gt---ctctctcgttcctcatcctcctt-ctccatga
B D                    Tenrec  tg---------agaagttaggagat-aaaagc-ttctcctctcctattcctcatcatcct----------
                     Aardvark  tg---------agaagttatgaggt-acagat-gt---ctcccccaaccctcatcctccttgccccacga
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ----------------------------------------------------------------------
B D                     Shrew  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D          White rhinoceros  ----------------------------------------------------------------------
B D                     Horse  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------

                        Human  tgtcctgccattcgtacatttgagacatgtgctaaagaatatctacccatcctgcacatcttcacc----
                        Chimp  tgtcctgccattcgtacatttgagacatgtgctaaagaatatctacccatcctgcacatcttcacc----
                      Gorilla  tgtcctgccattcgtacatttgagacatgtgctaaagaatatctacccatcctgcacatcttcacc----
                    Orangutan  tgtcctgccattcgtacatttgagacatgtgctaaagaatatctacccatcctgcacatcttcacc----
                       Gibbon  tgtcctgccattggtacatttgagacatgtgctaaagaatatctacccatcctgcgcatcttcacc----
                       Rhesus  tgtcctgccattcgtacatttgagacatgtgctaaagaatatctacccatcctgcgcatcttcaca----
          Crab-eating macaque  tgtcctgccattcgtacatttgagacatgtgctaaagaatatctacccatcctgcgcatcttcaca----
                       Baboon  tgtcctgccattcgtacatttgagacatgtgctaaagaatatctacccatcctgcgcatcttcaca----
                 Green monkey  tgtcctgccattcgtacgtttgagacatgtgctaaagaatatctacccatcctgcgcatcttcaca----
                     Marmoset  tgtcctgccattcatacatttgag--atgtgctaaagtgtatctacccatcctgctcatcttcacc----
              Squirrel monkey  tgtcctgccattcgtacatttgagacatgtgctaaagtgtatctacccatcctgctcattttcacc----
                     Bushbaby  tgtcctagcatttgtacatttgagacgtgtactaaagagtatttaacaatgctgctcatcttcacc----
           Chinese tree shrew  tgtcctagcgcgtgtacagctgagatatgtattaaagcatatttaacaacactgctcaccttcacc----
                     Squirrel  catcctagcatttgtgcattc-agacat-cactgaggaatatttaacaatactgctcaccttcacc----
       Lesser Egyptian jerboa  tgacctagcacttgtacattttggacatggacataagactaagaaacaatactttccactttgact----
                 Prairie vole  tgttctagtgtttgtacatttgggacatggactaaagaccacacaacaatactgtctgcctctgga----
              Chinese hamster  tgttctctcacttatatgttccagacatggactaaagaccatgcaacaatactgtctgcctataac----
               Golden hamster  tgctctctcaactacacattccagacatggactaaagatcatgcaacaatactgtctgcctatagc----
                        Mouse  tgttctagcgtttgcatgtttgaggcatggactaaagactatgcaacaat--tgtctgtctttacc----
                          Rat  tgttctagcatttgtatgtttgaggcatggactaaagactatacaatgat--tgtctgtctttacc----
               Naked mole-rat  tgtcttagcatttatgcattt-agacatgtgctaaagcatatttaaca-tactggtcacctctacc----
                   Chinchilla  tgtcttcgcatttgtgcatgt-atacatgtgctacagcgtatttaataatatcgctcacctctacc----
             Brush-tailed rat  tgtcttagcatttatgcattt-agacatgtgctaaagcctatttcatattattgctcatctctacc----
                       Rabbit  tgtcttagtatgtgtgtgcttgaggggtgtactaaagaccgttgaacaacactgcccgccctcgct----
                         Pika  tgtcttagcatctgtgcacttgaggaatattctaaagaccatgtagtcacactgttcagtttcacc----
                          Pig  tgtc--agcctttctaa-tttgagacacatacta---aatacttaatagtgttgtcctcctacatc----
                       Alpaca  tgtc--agcgtttgtacatttgagacacgtactggaaagtatctaacaa-cctgttccccttcatc----
               Bactrian camel  tgtc--agtgtttgtacatttgagatacgtactggaaagtatctaacaa-cctgttccccttcatc----
                      Dolphin  catc--agcatttgcacatttgagatttgtactaaagaatatttaacaagcctgttccccttcacc----
                 Killer whale  catc--agcatttgcacatttgagatttgtactaaagaatatttaacaagcctgttccccttcacc----
             Tibetan antelope  catc--agcatttgtac-tttgagacttgtacgaaagaatatttaacagtgccgttccccttcagc----
                          Cow  catc--agcatttgtac-ttcgagactcttacaaaagaatatttaacagtgccgtttcccttcagc----
                        Sheep  cgtc--agcatttgtac-tttgagactcgtacaaaagaacatttaacagtgccgttccccttcagc----
                Domestic goat  catc--agcatttgtac-tttgagactcgtacgaaagaacgtttaacagtgccggtccccttcagc----
                          Cat  tgtc--agcatttgtacatttgagacatgtaataaagaatattaaatgatattgctcacca---------
                          Dog  tgtc--agcatttgtacatttgagacatgtaatgaagaatttttagtgacactacttactgtcatc----
                      Ferret   tttc--agcatttatacatttgagacatgtaataaagaatatttagtgacactgctaaccatcatc----
                        Panda  catc--agcatttgtatatctgagacatgtaataaagaatgtttagtgacactgcttaccatcatc----
               Pacific walrus  tgtc--agcatttgtacatttgagacatgtagtaaagaatatttagtgacactgcttaccatcatc----
                 Weddell seal  tgtc--agcatttgtatatttgagacatgtagtaaagaatatttagtgacactgcttaccatcatc----
             Black flying-fox  tgtc--agcattt------------tacacaccagaaaatatttaacaatactgctcaccttcacc----
                      Megabat  tgtc--agcattt------------tacacaccagaaaatatttaacaatactgctcaccttcacc----
                Big brown bat  tgtc--agtattt------------tacttactaaagaatatttagcaatactgctcaccttcacctagc
         David's myotis (bat)  tgtc--agtattt------------tacttacgaaagaatatttagcaatactgctcaccttcacc----
                     Microbat  tgtc--agtattt------------tacttactaaagaatatttagcaatactgctcaccttcacc----
              Star-nosed mole  tgccctagaacttgtgcgcgtgaggtgtacgcaggagggtacttggcaacgctgtttgtcctcacc----
                     Elephant  tgtcctacctgaataacatttgagacatgtactaaaggacatttaacaacactcttcaccttcacc----
          Cape elephant shrew  ggttctagctaaatataatttgag------actaaagaacatttaagaacactgctcatcttcatc----
                      Manatee  tgtcctagctgaataacatttgagacatgtactaaagaacatttaacaacactcttcacctttacc----
             Cape golden mole  tgtcctagctgaataaaatttgagacatgcactaaacaacatttagcaacactgtttggctttacc----
                       Tenrec  -----tgcctcagtaaaagttgagacatttatgaaagaacactttcaaacacggttcacttttacc----
                     Aardvark  tgtccaagctgagtaaaatttgacacatatactaaagaacatttaacaacactcttcaccttcacc----
                     Hedgehog  ======================================================================
                   Guinea pig  ----------------------------------------------------------------------
                        Shrew  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================
             White rhinoceros  ----------------------------------------------------------------------
                        Horse  ======================================================================
                    Armadillo  ----------------------------------------------------------------------

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  acagtggtcggcaaactcattagacaacagagcggcaaaccgcggctcgtgagccgcagtttgccgacca
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                   Guinea pig  ----------------------------------------------------------------------
                        Shrew  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================
             White rhinoceros  ----------------------------------------------------------------------
                        Horse  ======================================================================
                    Armadillo  ----------------------------------------------------------------------

                        Human  ------tggaaaa-atgctggctgat---tccatg---tg------------------------------
                        Chimp  ------tggaaaa-atgctggctgat---tccatg---tg------------------------------
                      Gorilla  ------tggaaaa-atgctggctgat---tccatg---tg------------------------------
                    Orangutan  ------tggaaga-atgctggctgat---tccatg---tg------------------------------
                       Gibbon  ------tggaaga-atgctggctgat---tccatg---tg------------------------------
                       Rhesus  ------tggaaga-atgctggctgat---ttcatg---tg------------------------------
          Crab-eating macaque  ------tggaaga-atgctggctgat---ttcatg---tg------------------------------
                       Baboon  ------tggaaga-atgctggctgat---ttcatg---tg------------------------------
                 Green monkey  ------tggaaga-atgctggctgat---ttcatg---tg------------------------------
                     Marmoset  ------tggaaga-atgctggctgat---tccata---tg------------------------------
              Squirrel monkey  ------tggagga-atgctggctgat---tctatg---tg------------------------------
                     Bushbaby  ------tggaaac-acattggctgct---tccatgacatg------------------------------
           Chinese tree shrew  ------gggagac-atactggttgatacattgaca---ca------------------------------
                     Squirrel  ------tggaaac--agttggctggt---tctgtgacatg------------------------------
       Lesser Egyptian jerboa  ------tggaaga-ggattggctaac---tccatgacatt------------------------------
                 Prairie vole  ------tgaaaaacaagccgaatggt---cccatgaaatg------------------------------
              Chinese hamster  ------tggaaaacaggctgaatagt---cccatgacatg------------------------------
               Golden hamster  ------tggaaaacaggctgaatggt---cccatgaagtg------------------------------
                        Mouse  ------tggaaaatatgttcaatgat---cccatgacatg------------------------------
                          Rat  ------tggaaaagatgttcaatgat---cccatgatatg------------------------------
               Naked mole-rat  ------tggaagc-acactggctagt---tccatgacagg------------------------------
                   Chinchilla  ------tggaagc-atactggctatt---ccaatgacaga------------------------------
             Brush-tailed rat  ------tagaaac-atactggctagt---cccattgtaga------------------------------
                       Rabbit  ------tacaatc-tcactggctgac---tccacaacatg------------------------------
                         Pika  ------tggaatc-ataccagctgat---ctcatggtgtg------------------------------
                          Pig  ------tggcagc-ttattggctggt---tccagaacatg------------------------------
                       Alpaca  ------tggcagc-ttattgg----t---tccatgacatg------------------------------
               Bactrian camel  ------tggcagc-ttactgg----t---tccatgacatg------------------------------
                      Dolphin  ------tggcagc-ttattggctggt---tcca-gatatg------------------------------
                 Killer whale  ------tggcagc-ttattggctggt---tccatgatatg------------------------------
             Tibetan antelope  ------tggaagc-ttactggctggt---tccatgacata------------------------------
                          Cow  ------tggcagc-ttattggctgct---tccatgacttg------------------------------
                        Sheep  ------tggaagc-ttattggctggt---tccatgacatg------------------------------
                Domestic goat  ------tgtaagc-ttattggttggt---tccatgacatg------------------------------
                          Cat  -------ggtagt-atactgacaagt---tctatgacatg------------------------------
                          Dog  ------tggcagc-atactgactggt---tccatgacatg------------------------------
                      Ferret   ------tggaaaa-atattgactgat---tccatgacatg------------------------------
                        Panda  ------tggcaac-atactgactggt---tccatgacatg------------------------------
               Pacific walrus  ------tggaagc-atattgactggt---tccatgacatg------------------------------
                 Weddell seal  ------tggaagc-atattgaccggt---tccatgacatg------------------------------
             Black flying-fox  ------tagtagc-atattggctggt---tctatgacttg------------------------------
                      Megabat  ------tagtagc-atattggttggt---tctatgacttg------------------------------
                Big brown bat  ctgacttagcaac-atattggctggt---actataacatg------------------------------
         David's myotis (bat)  ------tagcagc-atatgggctggt---actataacatg------------------------------
                     Microbat  ------tagcagc-atattggctggt---actataacatg------------------------------
              Star-nosed mole  ------tggaggc-atatcggatgct---tcc-tgtggtg------------------------------
                     Elephant  ------tggaagc-acattggctggt---tctatgacatg------------------------------
          Cape elephant shrew  ------tgaaagc-atattgtccggt---tctgtgacatg------------------------------
                      Manatee  ------tggaagc-atattggctggt---tctctgacttg------------------------------
             Cape golden mole  ------tggaagc-atattggctggt---cctgtgacatgtcctcagagtcctggtatggtgctgtgggc
                       Tenrec  ------tgcaagt-atattggctcct---tctctggcatg------------------------------
                     Aardvark  ------tggaagc-atattggctggt---tctgtgacgtg------------------------------
                     Hedgehog  ======================================================================
                   Guinea pig  ----------------------------------------------------------------------
                        Shrew  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================
             White rhinoceros  ----------------------------------------------------------------------
                        Horse  ======================================================================
                    Armadillo  ----------------------------------------------------------------------

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  taatgtgtcagactgcaaagtcatttgaactgcagggtcagtggtccaaagctcaccagctgctccttgg
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                   Guinea pig  ----------------------------------------------------------------------
                        Shrew  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================
             White rhinoceros  ----------------------------------------------------------------------
                        Horse  ======================================================================
                    Armadillo  ----------------------------------------------------------------------

                        Human  ---tcc---cacagggggat--------------------------------------------------
                        Chimp  ---tcc---cacaaggggat--------------------------------------------------
                      Gorilla  ---tcc---cacaaggggat--------------------------------------------------
                    Orangutan  ---tcc---cacaaggggat--------------------------------------------------
                       Gibbon  ---tcc---caaaaggggat--------------------------------------------------
                       Rhesus  ---tcc---caaaaggggat--------------------------------------------------
          Crab-eating macaque  ---tcc---caaaaggggat--------------------------------------------------
                       Baboon  ---tcc---cagaaggggat--------------------------------------------------
                 Green monkey  ---tcc---ctcaaggggat--------------------------------------------------
                     Marmoset  ---tcc---cacagggggat--------------------------------------------------
              Squirrel monkey  ---tcc---cacagggtgat--------------------------------------------------
                     Bushbaby  ---tcc---cacaggggg-c--------------------------------------------------
           Chinese tree shrew  ---tct---ctcaaggggac--------------------------------------------------
                     Squirrel  ---tct---cacaagaggac--------------------------------------------------
       Lesser Egyptian jerboa  ---ttc---tacaagaggcc--------------------------------------------------
                 Prairie vole  ---tcc---cacaacaggga--------------------------------------------------
              Chinese hamster  ---tcg---cacaacagcaa--------------------------------------------------
               Golden hamster  ---ttc---cacaacagcaa--------------------------------------------------
                        Mouse  ---ttt---cacaagaggaa--------------------------------------------------
                          Rat  ---tcc---cacaagaggaa--------------------------------------------------
               Naked mole-rat  ---tccacctataacaggat--------------------------------------------------
                   Chinchilla  ---tccacttacaagaggac--------------------------------------------------
             Brush-tailed rat  ---tccacctacaagaggat--------------------------------------------------
                       Rabbit  ---tcc---cac-gggaggc--------------------------------------------------
                         Pika  ---acc---cacaaggaggc--------------------------------------------------
                          Pig  ---tcc---tgcaagcaaac--------------------------------------------------
                       Alpaca  ---tcc---cacagcggggc--------------------------------------------------
               Bactrian camel  ---tcc---cacagcggggc--------------------------------------------------
                      Dolphin  ---ttc-----caaggggac--------------------------------------------------
                 Killer whale  ---ttc-----caaggggac--------------------------------------------------
             Tibetan antelope  ---ttc---cacaagggaac--------------------------------------------------
                          Cow  ---tcc---cacaagggaag--------------------------------------------------
                        Sheep  ---ttc---cacaagggaac--------------------------------------------------
                Domestic goat  ---ttc---cacaagggaac--------------------------------------------------
                          Cat  ---tcc---cacaaaagggt--------------------------------------------------
                          Dog  ---tcc---tacaaggg-gt--------------------------------------------------
                      Ferret   ---tcc---cataagggggt--------------------------------------------------
                        Panda  ---tcc---cacaaggggat--------------------------------------------------
               Pacific walrus  ---tcc---cacaagggggt--------------------------------------------------
                 Weddell seal  ---tcc---cacaagggagt--------------------------------------------------
             Black flying-fox  ---tcc---cacaa-gggat--------------------------------------------------
                      Megabat  ---tcc---cacaa-gggat--------------------------------------------------
                Big brown bat  ---tct---cccaaggggac--------------------------------------------------
         David's myotis (bat)  ---tct---cccaaggggat--------------------------------------------------
                     Microbat  ---tct---cccaaggggat--------------------------------------------------
              Star-nosed mole  ---ccc---caaaa-ggggc--------------------------------------------------
                     Elephant  ---ttc---cacaa-tggat--------------------------------------------------
          Cape elephant shrew  ---tcc---cacaa-tggat--------------------------------------------------
                      Manatee  ---ttc---cacaa-tggat--------------------------------------------------
             Cape golden mole  aaaccc---tatac-agggttgctatgagtcggaatcgactcgatggcactaaacaacagcaacaacaac
                       Tenrec  ---ccc---cacac-tgggt--------------------------------------------------
                     Aardvark  ---tcc---cacaa-ctgat--------------------------------------------------
                     Hedgehog  ======================================================================
                   Guinea pig  ----------------------------------------------------------------------
                        Shrew  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================
             White rhinoceros  ----------------------------------------------------------------------
                        Horse  ======================================================================
                    Armadillo  ----------------------------------------------------------------------

                        Human  ---------------gtgttgatttggatagtgggc--agcagaa----agcctttgctattcagaatat
                        Chimp  ---------------gtgttgatttggatagtgggc--agcagaa----agcctttgctattcagaatat
                      Gorilla  ---------------gtgttgatttggatagtgggc--agcagaa----agcctttgctattcagaatat
                    Orangutan  ---------------gtgttgatttggaaagtgggc--agcagaa----agcctttgctattcagaatat
                       Gibbon  ---------------gtgttgatttggctagtgggc--agcagaa----agcctttgctattcagaatat
                       Rhesus  ---------------gtgttgattcagatagtgggc--agcagaa----agcctttgctattcagaattt
          Crab-eating macaque  ---------------gtgttgattcagatagtgggc--agcagaa----agcctttgctattcagaattt
                       Baboon  ---------------gtgttgattcggatagtgggc--agcagaa----agcctttgctattcagaattt
                 Green monkey  ---------------gtgttgattcggagagtgggc--agcagaa----agcctttgctattcagaattt
                     Marmoset  ---------------gtgttgattc--------agc--agcagaa----agcctttgccattcagaatat
              Squirrel monkey  ---------------gtgttgattcggat-gtgggc--agcagaa----agcctttgccattcagaatat
                     Bushbaby  ---------------atgttgatttggccagtggac--agcagaa----agtctttgctattcaggacat
           Chinese tree shrew  ---------------aggttaatctaaaccatgaac--agcagaa----agcttttgccattcaggatat
                     Squirrel  ---------------ttattgatttcgacagtgaac--agaataa----atcctttgttattcaggatgt
       Lesser Egyptian jerboa  ---------------aggttgatttgaac--------------------agccattg----tcaggatat
                 Prairie vole  ---------------agtttggtttgaacagtggac--caaagaa----agccattg----tcaggctct
              Chinese hamster  ---------------aggttgatttgaacagtggat--caaagaa----agccattg----tcagggtat
               Golden hamster  ---------------aggttgatttgaacagtggac--caaagaa----agccattg----tcatggtat
                        Mouse  ---------------aggttgatttgagctatagaa--caaagaa----agtcattg----ttagggcat
                          Rat  ---------------aggttgacttgaacagtggaa--caaagaa----agccattg----tcagggcat
               Naked mole-rat  ---------------aaggaggtttgggcaatggacaaaaaaaaa----agcctttgttatttaaaatag
                   Chinchilla  ---------------agggaggtttggacagtggac--aaaagaa----agcctttgctacttagaatat
             Brush-tailed rat  ---------------agggaggtttgtataggggac--aaaagaa----agccttctctatttagaatat
                       Rabbit  ---------------agg-----ttggaccgtggac--agcacaa----accc-tcgctattcaggacac
                         Pika  ---------------agg-----ttcgacagcagac--agcagaa----aacc-ttgtcatttaagacac
                          Pig  ---------------aggttgatggggac---------agcagag----agcctttgctgttggggatat
                       Alpaca  ---------------aggttgatttgaag---------ggtagaa----agcctttgctattcaggatat
               Bactrian camel  ---------------aggttga-ttgaag---------agtagaa----agcctttgctattcaggatat
                      Dolphin  ---------------aggttgatttggac---------agtagaa----agcctttgctattcaggatat
                 Killer whale  ---------------aggttgatttggac---------agtagaa----agcctttgctattcaggatat
             Tibetan antelope  ---------------aggttgatttagac---------agtagaa----agcctctgctattcaggacat
                          Cow  ---------------aggttgatttagac---------agtagaa----agcctctgctatttaggacat
                        Sheep  ---------------aggttgatttagac---------agtagaa----agcctctgctattcaggacat
                Domestic goat  ---------------aggttgattgagac---------agtagaa----agcctctgctattcaggacat
                          Cat  ---------------atgttgatttggat---------agtagaa----ggcttttgctatttgggatat
                          Dog  ---------------aggttgacttggac---------agtagaa----ggcctttgctatttgagatat
                      Ferret   ---------------aggttgatatggac---------aatagaa----ggcctttgctatttgagatat
                        Panda  ---------------aggttgatttggac---------agtagca----ggcctttgctgttcaggatat
               Pacific walrus  ---------------aggttgatttagac---------agtagaa----ggcctttgctattcgggatat
                 Weddell seal  ---------------aggttgatttagac---------agtagaa----ggcctttgctattcaggatat
             Black flying-fox  ---------------aggttaatttggac---------cgcagag----agcctttgctattcaggatat
                      Megabat  ---------------aggttaatttggac---------cgtagag----agcctttgctattcaggatat
                Big brown bat  ---------------aggttcatttggac---------agtagaa----agcctttgctcttcaggatat
         David's myotis (bat)  ---------------aggttcatttggac---------agtagaa----agcttttgctattcaggatat
                     Microbat  ---------------aggttcatttggac---------agtagaa----agcctttgctattcaggatat
              Star-nosed mole  ---------------aggtgggtctggtc---------agtagaa----tg--tctgttattcaggacat
                     Elephant  ---------------aggttgatttggat---------agcagaa----agcctttgctattcaggatat
          Cape elephant shrew  ---------------a------------------------cagaaaggcaggctttgtttttcaagatat
                      Manatee  ---------------aggttgatttgtac---------agcagaa----agcctttgctattcaggatat
             Cape golden mole  atgacatgtcatcagtggtaggtttggac---------agcagaa----agcctttcctattcagaatat
                       Tenrec  ---------------aggtttatttggat---------aggaaga----cgtctttgcgagtcagggtat
                     Aardvark  ---------------tggttga-ttgtgc---------agcagaa----agcgtttgctgttcaagatat
                     Hedgehog  ======================================================================
                   Guinea pig  ----------------------------------------------------------------------
                        Shrew  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================
             White rhinoceros  ----------------------------------------------------------------------
                        Horse  ======================================================================
                    Armadillo  ----------------------------------------------------------------------

Inserts between block 21 and 22 in window
         Cape elephant shrew 223bp

Alignment block 22 of 152 in window, 53895847 - 53895854, 8 bps 
B D                     Human  gg--------------------------------------------aa------at-g----------g
B D                     Chimp  gg--------------------------------------------aa------at-g----------g
B D                   Gorilla  gg--------------------------------------------aa------at-g----------g
B D                 Orangutan  gg--------------------------------------------aa------at-g----------g
B D                    Gibbon  gg--------------------------------------------aa------at-g----------g
B D                    Rhesus  gg--------------------------------------------aa------at-g----------g
B D       Crab-eating macaque  gg--------------------------------------------aa------at-g----------g
B D                    Baboon  gg--------------------------------------------aa------at-g----------g
B D              Green monkey  gg--------------------------------------------aa------at-g----------g
B D                  Marmoset  gg--------------------------------------------aa------at-g----------g
B D           Squirrel monkey  ag--------------------------------------------aa------at-g----------g
B D                  Bushbaby  gg--------------------------------------------aa------at-g----------g
           Chinese tree shrew  gg--------------------------------------------gacaagggat-gcaagaggggtg
B D                  Squirrel  ga--------------------------------------------ga------at-g----------g
       Lesser Egyptian jerboa  gaaattggagaagatagcaccagaaaagtctttctagtaccctcagag------aa-g----------a
                 Prairie vole  ga--------------------------------------------aa------ct-g----------a
B D           Chinese hamster  ga--------------------------------------------aa------tt-g----------a
               Golden hamster  ga--------------------------------------------aa------tt-g----------a
B D                     Mouse  ga--------------------------------------------ag------tt-g----------a
B D                       Rat  ga--------------------------------------------aa------tt-g----------a
B D            Naked mole-rat  ag--------------------------------------------ga------gt-g----------g
                   Chinchilla  ag--------------------------------------------ga------gt-g----------a
             Brush-tailed rat  aa--------------------------------------------ga------at-g----------g
B D                    Rabbit  ga--------------------------------------------ga------ac-t----------g
B D                      Pika  ag--------------------------------------------aa------actt----------g
B D                       Pig  gg--------------------------------------------ga------at-g----------g
B D                    Alpaca  gg--------------------------------------------ga------gt-g----------g
               Bactrian camel  gg--------------------------------------------ga------gt-g----------g
B D                   Dolphin  gg--------------------------------------------ga------gt-g----------g
                 Killer whale  gg--------------------------------------------ga------gt-g----------g
             Tibetan antelope  gg--------------------------------------------ga------gt-g----------a
B D                       Cow  gg--------------------------------------------ga------gt-g----------a
B D                     Sheep  gg--------------------------------------------ga------gt-g----------a
                Domestic goat  gg--------------------------------------------ga------gt-g----------a
B D                       Cat  gg--------------------------------------------ga------aa-g----------g
B D                       Dog  gg--------------------------------------------aa------at-g-----------
B D                   Ferret   gg--------------------------------------------ga------at-g----------g
B D                     Panda  gg--------------------------------------------ga------ct-g----------g
               Pacific walrus  gg--------------------------------------------ga------at-g----------g
                 Weddell seal  gg--------------------------------------------ga------at-g----------g
             Black flying-fox  ag--------------------------------------------ga------at-g----------g
B D                   Megabat  ag--------------------------------------------ga------at-g----------g
                Big brown bat  ag--------------------------------------------gg------at-g----------g
         David's myotis (bat)  gg--------------------------------------------ga------at-g----------t
B D                  Microbat  gg--------------------------------------------ga------at-g----------g
              Star-nosed mole  gg--------------------------------------------g----------------------
B D                  Elephant  ga--------------------------------------------ga------at-g----------g
B D                   Manatee  gg--------------------------------------------ga------at-g----------g
             Cape golden mole  gg--------------------------------------------gc------at-g----------a
B D                    Tenrec  ga--------------------------------------------gg------at-g----------a
                     Aardvark  ga--------------------------------------------gg------at-g----------g
B D                  Hedgehog  =====================================================================
B D                Guinea pig  ---------------------------------------------------------------------
B D                     Shrew  =====================================================================
  D              Mallard duck  =====================================================================
          Tibetan ground jay  =====================================================================
B D           Tasmanian devil  =====================================================================
  D            Painted turtle  =====================================================================
  D           Green seaturtle  =====================================================================
B D        American alligator  =====================================================================
B D                Budgerigar  =====================================================================
  D               Rock pigeon  =====================================================================
  D          Peregrine falcon  =====================================================================
  D              Saker falcon  =====================================================================
         Cape elephant shrew  =====================================================================
B D                   Wallaby  =====================================================================
  D  Chinese softshell turtle  =====================================================================
B D          White rhinoceros  ---------------------------------------------------------------------
B D                     Horse  =====================================================================
B D                 Armadillo  ---------------------------------------------------------------------

Alignment block 23 of 152 in window, 53895855 - 53895873, 19 bps 
B D                     Human  gagaaat---------------------------------------------------------------
B D                     Chimp  gagaaat---------------------------------------------------------------
B D                   Gorilla  gagaaat---------------------------------------------------------------
B D                 Orangutan  gagaaat---------------------------------------------------------------
B D                    Gibbon  gagaaat---------------------------------------------------------------
B D                    Rhesus  gagaaat---------------------------------------------------------------
B D       Crab-eating macaque  gagaaat---------------------------------------------------------------
B D                    Baboon  gagaaat---------------------------------------------------------------
B D              Green monkey  gagaaat---------------------------------------------------------------
B D                  Marmoset  gagaaat---------------------------------------------------------------
B D           Squirrel monkey  gagaaac---------------------------------------------------------------
B D                  Bushbaby  gggaaat---------------------------------------------------------------
           Chinese tree shrew  gggaaat---------------------------------------------------------------
B D                  Squirrel  gaga-at---------------------------------------------------------------
       Lesser Egyptian jerboa  aagggatagggcccgccgggtgtgatggctcatgcctttaatcccagcactcgggaggcagaggtaggag
                 Prairie vole  gagagat---------------------------------------------------------------
B D           Chinese hamster  gagagat---------------------------------------------------------------
               Golden hamster  gagagat---------------------------------------------------------------
B D                     Mouse  ggtatat---------------------------------------------------------------
B D                       Rat  gagagat---------------------------------------------------------------
B D            Naked mole-rat  gagg-at---------------------------------------------------------------
                   Chinchilla  gaga-at---------------------------------------------------------------
             Brush-tailed rat  gaga-at---------------------------------------------------------------
B D                    Rabbit  aggaaaa---------------------------------------------------------------
B D                      Pika  gggaaat---------------------------------------------------------------
B D                       Pig  gggaaat---------------------------------------------------------------
B D                    Alpaca  gagaaat---------------------------------------------------------------
               Bactrian camel  gggaaat---------------------------------------------------------------
B D                   Dolphin  gggaaat---------------------------------------------------------------
                 Killer whale  gggaaat---------------------------------------------------------------
             Tibetan antelope  gggaaat---------------------------------------------------------------
B D                       Cow  gggaaat---------------------------------------------------------------
B D                     Sheep  gggaaat---------------------------------------------------------------
                Domestic goat  gggaaat---------------------------------------------------------------
B D                       Cat  ggtaaat---------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
B D                   Ferret   ggggaat---------------------------------------------------------------
B D                     Panda  gggacat---------------------------------------------------------------
               Pacific walrus  gggaaat---------------------------------------------------------------
                 Weddell seal  gggaaat---------------------------------------------------------------
             Black flying-fox  gggaaat---------------------------------------------------------------
B D                   Megabat  gggaaat---------------------------------------------------------------
                Big brown bat  gggaaat---------------------------------------------------------------
         David's myotis (bat)  gggaaat---------------------------------------------------------------
B D                  Microbat  gggaaat---------------------------------------------------------------
              Star-nosed mole  --gaaag---------------------------------------------------------------
B D                  Elephant  -ggaaat---------------------------------------------------------------
          Cape elephant shrew  gagaaat---------------------------------------------------------------
B D                   Manatee  -ggaagt---------------------------------------------------------------
             Cape golden mole  -gga------------------------------------------------------------------
B D                    Tenrec  -gaaaat---------------------------------------------------------------
                     Aardvark  -ggagat---------------------------------------------------------------
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ----------------------------------------------------------------------
B D                     Shrew  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D          White rhinoceros  ----------------------------------------------------------------------
B D                     Horse  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  aatcgccatgagttcaatgccaccctgagactacagagttaattccaggtcagcctggaccatagtgaga
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                   Guinea pig  ----------------------------------------------------------------------
                        Shrew  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================
             White rhinoceros  ----------------------------------------------------------------------
                        Horse  ======================================================================
                    Armadillo  ----------------------------------------------------------------------

                        Human  -----------ggagccagaaaa
                        Chimp  -----------ggagccagaaaa
                      Gorilla  -----------ggagccagaaaa
                    Orangutan  -----------ggagccagaaaa
                       Gibbon  -----------ggagccagaaaa
                       Rhesus  -----------ggagccagaaaa
          Crab-eating macaque  -----------ggagccagaaaa
                       Baboon  -----------ggagccagaaaa
                 Green monkey  -----------ggagccagaaaa
                     Marmoset  -----------ggagccagaaaa
              Squirrel monkey  -----------ggagccagaaaa
                     Bushbaby  -----------ggagccagaaag
           Chinese tree shrew  -----------gggtccagaaaa
                     Squirrel  -----------ggagacataaaa
       Lesser Egyptian jerboa  ccctacctcgaaaaaccaaaaaa
                 Prairie vole  -----------ggaaacag--ag
              Chinese hamster  -----------ggaaccagaaag
               Golden hamster  -----------agaaccagaaag
                        Mouse  -----------aaaaccaaaaag
                          Rat  -----------aaaaccaaaagg
               Naked mole-rat  -----------ggagcaagaata
                   Chinchilla  -----------ggaataagaata
             Brush-tailed rat  -----------gaagtatgaata
                       Rabbit  -----------ggagccagaacg
                         Pika  -----------ggggcctggctg
                          Pig  -----------ggagccagaaaa
                       Alpaca  -----------ggagccaggaaa
               Bactrian camel  -----------ggagccagaaaa
                      Dolphin  -----------ggagccagaaag
                 Killer whale  -----------ggagccagaaag
             Tibetan antelope  -----------ggagccagaaaa
                          Cow  -----------ggagccagaaaa
                        Sheep  -----------ggagccagaaaa
                Domestic goat  -----------ggagccagaaaa
                          Cat  -----------gaagccagaaaa
                          Dog  -----------ggagccagaaaa
                      Ferret   -----------ggagccagaaaa
                        Panda  -----------ggagccagaatg
               Pacific walrus  -----------ggagccagaaaa
                 Weddell seal  -----------ggagccagaaaa
             Black flying-fox  -----------ggagccagaaaa
                      Megabat  -----------ggagccagaaaa
                Big brown bat  -----------ggagccagagaa
         David's myotis (bat)  -----------ggaaccagaaaa
                     Microbat  -----------ggaaccagaaaa
              Star-nosed mole  -----------agaactagggtc
                     Elephant  -----------agagccagaaaa
          Cape elephant shrew  -----------ggagccagaaaa
                      Manatee  -----------agagccagaaaa
             Cape golden mole  ------------gagccagaaag
                       Tenrec  -----------ggagctaggaaa
                     Aardvark  -----------ggagccagataa
                     Hedgehog  =======================
                   Guinea pig  -----------------------
                        Shrew  =======================
                 Mallard duck  =======================
           Tibetan ground jay  =======================
              Tasmanian devil  =======================
               Painted turtle  =======================
              Green seaturtle  =======================
           American alligator  =======================
                   Budgerigar  =======================
                  Rock pigeon  =======================
             Peregrine falcon  =======================
                 Saker falcon  =======================
                      Wallaby  =======================
     Chinese softshell turtle  =======================
             White rhinoceros  -----------------------
                        Horse  =======================
                    Armadillo  -----------------------

Inserts between block 23 and 24 in window
B D                   Rhesus 23bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 136bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
             Star-nosed mole 1bp

Alignment block 24 of 152 in window, 53895874 - 53895911, 38 bps 
B D                     Human  -tgtt-tacagaa-----cagtgagag---aagaa--aagg-aaaactacc
B D                     Chimp  -tgtt-tacagaa-----cagtgagag---aagaa--aagg-aaaactacc
B D                   Gorilla  -tgtt-tacagaa-----cagtgagag---aagaa--aagg-aaaactacc
B D                 Orangutan  -tgtt-tacagaa-----cagtgagag---aagaa--aagg-aaaactacc
B D                    Gibbon  -tgtt-tacagaa-----cagtgagag---aagaa--aagg-aaaactacc
B D                    Rhesus  -tgtt-tacagaa-----cagtgagag---aagaa--aagg-aaaactacc
B D       Crab-eating macaque  -tgtt-tacagaa-----cagtgagag---aagaa--aagg-aaaactacc
B D                    Baboon  -tgtt-tacagaa-----cagtgagag---aagaa--aagg-aaaactacc
B D              Green monkey  -tgtt-tacagaa-----cagtgagag---aagaa--aagg-aaaagtacc
B D                  Marmoset  -tgtt-tacagaa-----cagtgagag---aagaa--aaga-aaaaat-cc
B D           Squirrel monkey  -tgtt-tacagaa-----tgatgagag---aagaa--aagg-aaaaatacc
B D                  Bushbaby  -tggt-tatagta-----cagtaaggg---aataa--aggg-gaaaatatt
           Chinese tree shrew  -tgttgtatagga-----cagtgagga---aagaa--a-gg-aaaaatacc
B D                  Squirrel  -gttt-tatagaa-----cagtaagac--atgaaa--gg---gaaaatatt
       Lesser Egyptian jerboa  -tgtc-tatgaaattgtccaaaggcagtaaatgaattaatg-aaaaatact
                 Prairie vole  -gttt-tatagaa-----tgctggcag--aatgac--ggct-aggaacact
B D           Chinese hamster  -gttt-tatagaa-----cactggcag--aatgaa--ggcc-aggaatact
               Golden hamster  -gttt-tttttaa-----cattgacag--aataaa--ggcc-agaaatact
B D                     Mouse  -gttt-tacagaa-----cactgacag--aatcaa--agtt-agcaagact
B D                       Rat  -gttt-tatagaa-----cattgacag--aatgaa--agtt-agaaagaca
B D            Naked mole-rat  -gttt-tatagaa-----caataagag---ataaa--agag-aaaaatacc
                   Chinchilla  -gctt-tatagaa-----cagtaagag---ataaa--aggg-gaaaatgcc
             Brush-tailed rat  -gttt-tatagac-----cagcaagag---ataaa--aggg-aaaaatacc
B D                    Rabbit  -attt-tatagga-----cagtgagag---aagag--aggg-aaaaatact
B D                      Pika  -attt-tatagga-----cagtgagaa---aagaa--aggg-aaaaatgct
B D                       Pig  -gtct-catgaga-----cagtaagag---aagaa--aggg-agagatgcc
B D                    Alpaca  -gttt-catgaga-----cagtgagag---aagaa--aggg-agaaacacc
               Bactrian camel  -gttt-catgaga-----cagtgagag---aagaa--aggg-agaaacacc
B D                   Dolphin  -gttt-catgaga-----tggtgagag---aagaa--aggg-agaaatacc
                 Killer whale  -gttt-catgaga-----tggtgagag---aagaa--aggg-agaaatacc
             Tibetan antelope  -gttt-cataaga-----cagtgagaa---aagaa--cgcg-aaagatacc
B D                       Cow  -gttt-cataaga-----cagtgagaa---aagaa--tgag-aaagatacc
B D                     Sheep  -gttt-cataaga-----cagtgagaa---aagaa--cacg-aaagatacc
                Domestic goat  -gttt-cttaaga-----cagtgagaa---aagaa--cgcg-aaagatacg
B D                       Cat  -gttt-tatagga-----cagtgagag---aagaa--atggcagaaacacc
B D                       Dog  -attt-cacagga-----cagtgagaa-----gaa--atggcagaaacacc
B D                   Ferret   -gttt-tatagga-----cagtgaaag--aaaaaa--atggcagaaacacc
B D                     Panda  -attt-ttgggga-----cagtgaaag------aa--gtgacagaggcgcc
               Pacific walrus  -gttt-tatagga-----cagtgaaag--aaaaaa--atggcagaaacacc
                 Weddell seal  -gttt-tatagga-----cagtgaaag---aaaaa--acggcagaaacacc
             Black flying-fox  -gttt-tatagga-----cagtgagag---aagaa--agag-agaaacacc
B D                   Megabat  -gttt-tatagga-----cagtgagag---aagaa--agag-agaaacacc
                Big brown bat  -gtta-tatagga-----caatgagag---aagga--aggg-agaaacacc
         David's myotis (bat)  -gtta-tatagga-----caatgagag---aagga--aagg-agaaacacc
B D                  Microbat  -gtta-tatggga-----caatgagag---aagga--aggg-agaaacacc
              Star-nosed mole  -gttc-tatagga-----caatgagag---aggaa--aggg-ggaaaca--
B D                  Elephant  tgttt-tatagga-----caatgagag------aa--gggg-aaaaacatt
          Cape elephant shrew  tgttt-tccaaaa-----cagtaagag------aa--agaa-aaaagcatt
B D                   Manatee  tcttt-tatagga-----caatgagag------aa--gggg-aaaaacatc
             Cape golden mole  tgttt-tacagga-----ctgtgagag------aa--gaag-aaaagcatg
B D                    Tenrec  ccttt-tatagga-----cagtgagag------aa--gcgg-ggaa-catc
                     Aardvark  tgttt-tatagga-----cagtaagaa------ag--ggag-aaaaacatc
B D                  Hedgehog  ===================================================
B D                Guinea pig  ---------------------------------------------------
B D                     Shrew  ===================================================
  D              Mallard duck  ===================================================
          Tibetan ground jay  ===================================================
B D           Tasmanian devil  ===================================================
  D            Painted turtle  ===================================================
  D           Green seaturtle  ===================================================
B D        American alligator  ===================================================
B D                Budgerigar  ===================================================
  D               Rock pigeon  ===================================================
  D          Peregrine falcon  ===================================================
  D              Saker falcon  ===================================================
B D                   Wallaby  ===================================================
  D  Chinese softshell turtle  ===================================================
B D          White rhinoceros  ---------------------------------------------------
B D                     Horse  ===================================================
B D                 Armadillo  ---------------------------------------------------

Alignment block 25 of 152 in window, 53895912 - 53895914, 3 bps 
B D                     Human  caa
B D                     Chimp  caa
B D                   Gorilla  caa
B D                 Orangutan  caa
B D                    Gibbon  caa
B D                    Rhesus  caa
B D       Crab-eating macaque  caa
B D                    Baboon  caa
B D              Green monkey  caa
B D                  Marmoset  caa
B D           Squirrel monkey  caa
B D                  Bushbaby  caa
           Chinese tree shrew  caa
B D                  Squirrel  cca
       Lesser Egyptian jerboa  caa
                 Prairie vole  caa
B D           Chinese hamster  caa
               Golden hamster  cga
B D                     Mouse  caa
B D                       Rat  caa
B D            Naked mole-rat  aaa
                   Chinchilla  aaa
             Brush-tailed rat  aac
B D                    Rabbit  cca
B D                      Pika  caa
B D                       Pig  caa
B D                    Alpaca  caa
               Bactrian camel  caa
B D                   Dolphin  caa
                 Killer whale  caa
             Tibetan antelope  caa
B D                       Cow  caa
B D                     Sheep  caa
                Domestic goat  caa
B D          White rhinoceros  caa
B D                       Cat  caa
B D                       Dog  caa
B D                   Ferret   caa
B D                     Panda  cag
               Pacific walrus  caa
                 Weddell seal  caa
             Black flying-fox  caa
B D                   Megabat  caa
                Big brown bat  caa
         David's myotis (bat)  caa
B D                  Microbat  caa
              Star-nosed mole  gaa
B D                  Elephant  caa
          Cape elephant shrew  caa
B D                   Manatee  caa
             Cape golden mole  caa
B D                    Tenrec  aaa
                     Aardvark  caa
B D                  Hedgehog  ===
B D                Guinea pig  ---
B D                     Shrew  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                   Wallaby  ===
  D  Chinese softshell turtle  ===
B D                     Horse  ===
B D                 Armadillo  ---

Inserts between block 25 and 26 in window
B D                      Dog 1443bp

Alignment block 26 of 152 in window, 53895915 - 53895918, 4 bps 
B D                     Human  agga
B D                     Chimp  agga
B D                   Gorilla  agga
B D                 Orangutan  agta
B D                    Gibbon  agta
B D                    Rhesus  ggta
B D       Crab-eating macaque  ggta
B D                    Baboon  ggta
B D              Green monkey  ggta
B D                  Marmoset  ggta
B D           Squirrel monkey  ggta
B D                  Bushbaby  ggta
           Chinese tree shrew  ggca
B D                  Squirrel  ggta
       Lesser Egyptian jerboa  ggta
                 Prairie vole  ggga
B D           Chinese hamster  ggga
               Golden hamster  ggga
B D                     Mouse  ggga
B D                       Rat  ggga
B D            Naked mole-rat  ggta
                   Chinchilla  ggca
             Brush-tailed rat  agta
B D                    Rabbit  gctt
B D                      Pika  ggtt
B D                       Pig  agga
B D                    Alpaca  agta
               Bactrian camel  agta
B D                   Dolphin  agta
                 Killer whale  agta
             Tibetan antelope  agta
B D                       Cow  agta
B D                     Sheep  agta
                Domestic goat  agta
B D          White rhinoceros  ggta
B D                       Cat  agta
B D                   Ferret   agga
B D                     Panda  agtg
               Pacific walrus  agta
                 Weddell seal  agta
             Black flying-fox  tgta
B D                   Megabat  tgta
                Big brown bat  agta
         David's myotis (bat)  actt
B D                  Microbat  agta
              Star-nosed mole  agtt
B D                  Elephant  ggta
          Cape elephant shrew  ggta
B D                   Manatee  ggta
             Cape golden mole  ggta
B D                    Tenrec  caca
                     Aardvark  gata
B D                  Hedgehog  ====
B D                Guinea pig  ----
B D                     Shrew  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
B D                Budgerigar  ====
  D               Rock pigeon  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                   Wallaby  ====
  D  Chinese softshell turtle  ====
B D                     Horse  ====
B D                 Armadillo  ----
B D                       Dog  ====

Inserts between block 26 and 27 in window
            Black flying-fox 1bp
B D                  Megabat 1bp
             Star-nosed mole 1bp

Alignment block 27 of 152 in window, 53895919 - 53895925, 7 bps 
B D                     Human  cagctga
B D                     Chimp  cagctga
B D                   Gorilla  cagctga
B D                 Orangutan  cagctga
B D                    Gibbon  cagctga
B D                    Rhesus  cagctga
B D       Crab-eating macaque  cagctga
B D                    Baboon  cagctga
B D              Green monkey  cagctga
B D                  Marmoset  cagctga
B D           Squirrel monkey  cagctga
B D                  Bushbaby  cagctgg
           Chinese tree shrew  cagctga
B D                  Squirrel  gagctga
       Lesser Egyptian jerboa  aagttga
                 Prairie vole  aagttca
B D           Chinese hamster  aagttca
               Golden hamster  aagtcca
B D                     Mouse  aagttta
B D                       Rat  aagttct
B D            Naked mole-rat  cagctaa
                   Chinchilla  cagctga
             Brush-tailed rat  cagctgg
B D                    Rabbit  gcgtgga
B D                      Pika  gagttga
B D                       Pig  cagctga
B D                    Alpaca  cagctga
               Bactrian camel  cagctga
B D                   Dolphin  cagctga
                 Killer whale  cagctga
             Tibetan antelope  ctataga
B D                       Cow  ctgcaga
B D                     Sheep  ctgcaga
                Domestic goat  ctgcaga
B D                     Horse  cagatga
B D          White rhinoceros  cagatga
B D                       Cat  cagttga
B D                   Ferret   ca-ttga
B D                     Panda  cagtcga
               Pacific walrus  cagttga
                 Weddell seal  cacttga
             Black flying-fox  aaactga
B D                   Megabat  aaactga
                Big brown bat  aaactga
         David's myotis (bat)  aaactga
B D                  Microbat  aaactga
              Star-nosed mole  gggacga
B D                  Elephant  cagtcaa
          Cape elephant shrew  tagccta
B D                   Manatee  cagccaa
             Cape golden mole  cagccaa
B D                    Tenrec  ccgccaa
                     Aardvark  cag----
B D                  Hedgehog  =======
B D                Guinea pig  -------
B D                     Shrew  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D           Tasmanian devil  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
B D                Budgerigar  =======
  D               Rock pigeon  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
B D                   Wallaby  =======
  D  Chinese softshell turtle  =======
B D                 Armadillo  -------
B D                       Dog  =======

Alignment block 28 of 152 in window, 53895926 - 53895931, 6 bps 
B D                     Human  cctgtt
B D                     Chimp  cctgtt
B D                   Gorilla  cctgtt
B D                 Orangutan  cctgtt
B D                    Gibbon  cctgtt
B D                    Rhesus  cctgtt
B D       Crab-eating macaque  cctgtt
B D                    Baboon  cctgtt
B D              Green monkey  actgtt
B D                  Marmoset  cctgtt
B D           Squirrel monkey  cctgtt
B D                  Bushbaby  tct---
           Chinese tree shrew  cctgca
B D                  Squirrel  ccttct
       Lesser Egyptian jerboa  tgtacc
                 Prairie vole  cctgtc
B D           Chinese hamster  cctgct
               Golden hamster  cctgtt
B D                     Mouse  cctatt
B D                       Rat  cctgtt
B D            Naked mole-rat  cttact
                   Chinchilla  cttact
             Brush-tailed rat  cctccc
B D                    Rabbit  cctgcc
B D                      Pika  cctgct
B D                       Pig  cctgct
B D                    Alpaca  cctgct
               Bactrian camel  cctgct
B D                   Dolphin  cctgct
                 Killer whale  cctgct
             Tibetan antelope  cctgct
B D                       Cow  cctgct
B D                     Sheep  cctact
                Domestic goat  cctgct
B D                     Horse  cctgct
B D          White rhinoceros  cctgct
B D                       Cat  cctact
B D                   Ferret   cctatt
B D                     Panda  cccact
               Pacific walrus  cttact
                 Weddell seal  cctac-
             Black flying-fox  cctgc-
B D                   Megabat  cctac-
                Big brown bat  cctgc-
         David's myotis (bat)  cctgc-
B D                  Microbat  cctgc-
B D                  Hedgehog  cctgct
              Star-nosed mole  cctgct
B D                  Elephant  cctacc
          Cape elephant shrew  cttgcc
B D                   Manatee  tctacc
             Cape golden mole  cctacc
B D                    Tenrec  ctgacc
B D                Guinea pig  ------
B D                     Shrew  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D           Tasmanian devil  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
B D                Budgerigar  ======
  D               Rock pigeon  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D                   Wallaby  ======
                    Aardvark  ------
  D  Chinese softshell turtle  ======
B D                 Armadillo  ------
B D                       Dog  ======

Inserts between block 28 and 29 in window
B D                    Panda 1373bp

Alignment block 29 of 152 in window, 53895932 - 53895945, 14 bps 
B D                     Human  taaaag-----------------------------cagaat-----------------------------
B D                     Chimp  taaaag-----------------------------cagaat-----------------------------
B D                   Gorilla  taaaag-----------------------------cagaat-----------------------------
B D                 Orangutan  taaaag-----------------------------cagaat-----------------------------
B D                    Gibbon  taaaag-----------------------------cagaat-----------------------------
B D                    Rhesus  taaaag-----------------------------cagaat-----------------------------
B D       Crab-eating macaque  taaaag-----------------------------cagaat-----------------------------
B D                    Baboon  taaaag-----------------------------cagaat-----------------------------
B D              Green monkey  taaaag-----------------------------cagaat-----------------------------
B D                  Marmoset  taaatg-----------------------------cagaat-----------------------------
B D           Squirrel monkey  taaatg-----------------------------cagaat-----------------------------
           Chinese tree shrew  taaaag-----------------------------caggatattgggaaagtggcgatgtatttttgcat
B D                  Squirrel  taaaag-----------------------------caggag-----------------------------
       Lesser Egyptian jerboa  taagag-----------------------------caaaat-----------------------------
                 Prairie vole  taaaag-----------------------------cagaat-----------------------------
B D           Chinese hamster  taaaag-----------------------------cagaat-----------------------------
               Golden hamster  taaaag-----------------------------cag--------------------------------
B D                     Mouse  taaaag-----------------------------cagaat-----------------------------
B D                       Rat  taaaag-----------------------------cagaat-----------------------------
B D            Naked mole-rat  taaaag-----------------------------caagat-----------------------------
                   Chinchilla  ttaaag-----------------------------caagat-----------------------------
             Brush-tailed rat  taaaag-----------------------------caagat-----------------------------
B D                    Rabbit  taaaag-----------------------------caaaat-----------------------------
B D                      Pika  taaaggaaagataaacttaaaagacccccaaaagacagagg-----------------------------
B D                       Pig  taaaag-----------------------------caggac-----------------------------
B D                    Alpaca  taaaag-----------------------------cagggc-----------------------------
               Bactrian camel  taaaag-----------------------------cagggc-----------------------------
B D                   Dolphin  taaaag-----------------------------caggac-----------------------------
                 Killer whale  taaaag-----------------------------caggac-----------------------------
             Tibetan antelope  tcaaag-----------------------------caggac-----------------------------
B D                       Cow  taaaag-----------------------------caggac-----------------------------
B D                     Sheep  taaaag-----------------------------caggac-----------------------------
                Domestic goat  taaaag-----------------------------caggac-----------------------------
B D                     Horse  taaaag-----------------------------caggct-----------------------------
B D          White rhinoceros  taaaag-----------------------------caggct-----------------------------
B D                       Cat  taaaaa-----------------------------ctggac-----------------------------
B D                   Ferret   taaaaa-----------------------------taggac-----------------------------
               Pacific walrus  taaaaa-----------------------------taggtt-----------------------------
                 Weddell seal  taaaaa-----------------------------taggat-----------------------------
             Black flying-fox  taaaag----------------------------------------------------------------
B D                   Megabat  taaaag----------------------------------------------------------------
                Big brown bat  tataag-----------------------------caggat-----------------------------
         David's myotis (bat)  cataag-----------------------------caggat-----------------------------
B D                  Microbat  cataag-----------------------------caggat-----------------------------
B D                  Hedgehog  t-aagg-----------------------------tggatc-----------------------------
              Star-nosed mole  taaagg-----------------------------cagg-------------------------------
B D                  Elephant  taaaat--------------------------tattaggat-----------------------------
          Cape elephant shrew  taaaat--------------------------tattaggat-----------------------------
B D                   Manatee  taaaat--------------------------tgttaggat-----------------------------
             Cape golden mole  taaaat-------------------------atatt----------------------------------
B D                    Tenrec  tactac--------------------------tattagcat-----------------------------
                     Aardvark  ---------------------------------------at-----------------------------
B D                Guinea pig  ----------------------------------------------------------------------
B D                     Shrew  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
B D                     Panda  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------
B D                       Dog  ======================================================================

                        Human  -------------------------------------------at
                        Chimp  -------------------------------------------at
                      Gorilla  -------------------------------------------at
                    Orangutan  -------------------------------------------ac
                       Gibbon  -------------------------------------------at
                       Rhesus  -------------------------------------------at
          Crab-eating macaque  -------------------------------------------at
                       Baboon  -------------------------------------------at
                 Green monkey  -------------------------------------------at
                     Marmoset  -------------------------------------------at
              Squirrel monkey  -------------------------------------------at
           Chinese tree shrew  agaaaaatatggaaaactatgtcatgactttctcaactatctaat
                     Squirrel  -------------------------------------------at
       Lesser Egyptian jerboa  -------------------------------------------at
                 Prairie vole  -------------------------------------------aa
              Chinese hamster  -------------------------------------------ag
               Golden hamster  ---------------------------------------------
                        Mouse  -------------------------------------------at
                          Rat  -------------------------------------------at
               Naked mole-rat  -------------------------------------------at
                   Chinchilla  -------------------------------------------ac
             Brush-tailed rat  -------------------------------------------at
                       Rabbit  -------------------------------------------ct
                         Pika  -------------------------------------------ct
                          Pig  -------------------------------------------at
                       Alpaca  -------------------------------------------at
               Bactrian camel  -------------------------------------------at
                      Dolphin  -------------------------------------------at
                 Killer whale  -------------------------------------------at
             Tibetan antelope  -------------------------------------------at
                          Cow  -------------------------------------------at
                        Sheep  -------------------------------------------at
                Domestic goat  -------------------------------------------at
                        Horse  -------------------------------------------at
             White rhinoceros  -------------------------------------------at
                          Cat  -------------------------------------------at
                      Ferret   -------------------------------------------at
               Pacific walrus  -------------------------------------------at
                 Weddell seal  -------------------------------------------at
             Black flying-fox  ---------------------------------------------
                      Megabat  ---------------------------------------------
                Big brown bat  -------------------------------------------at
         David's myotis (bat)  -------------------------------------------at
                     Microbat  -------------------------------------------at
                     Hedgehog  -------------------------------------------ac
              Star-nosed mole  ---------------------------------------------
                     Elephant  -------------------------------------------at
          Cape elephant shrew  -------------------------------------------aa
                      Manatee  -------------------------------------------at
             Cape golden mole  ---------------------------------------------
                       Tenrec  -------------------------------------------gc
                     Aardvark  -------------------------------------------gt
                   Guinea pig  ---------------------------------------------
                        Shrew  =============================================
                 Mallard duck  =============================================
           Tibetan ground jay  =============================================
              Tasmanian devil  =============================================
               Painted turtle  =============================================
              Green seaturtle  =============================================
           American alligator  =============================================
                   Budgerigar  =============================================
                  Rock pigeon  =============================================
             Peregrine falcon  =============================================
                 Saker falcon  =============================================
                      Wallaby  =============================================
                     Bushbaby  ---------------------------------------------
     Chinese softshell turtle  =============================================
                        Panda  =============================================
                    Armadillo  ---------------------------------------------
                          Dog  =============================================

Inserts between block 29 and 30 in window
B D                      Rat 174bp
B D                     Pika 19bp

Alignment block 30 of 152 in window, 53895946 - 53895946, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
B D           Chinese hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                  Hedgehog  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                Guinea pig  -
B D                     Shrew  =
              Golden hamster  -
  D              Mallard duck  =
          Tibetan ground jay  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                   Wallaby  =
                Prairie vole  -
B D                       Cat  -
B D                   Megabat  -
  D  Chinese softshell turtle  =
B D                   Ferret   -
B D                     Panda  =
              Pacific walrus  -
            Black flying-fox  -
B D                 Armadillo  -
                Weddell seal  -
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -
B D                       Dog  =

Inserts between block 30 and 31 in window
B D                    Mouse 437bp

Alignment block 31 of 152 in window, 53895947 - 53895952, 6 bps 
B D                     Human  cttaaa
B D                     Chimp  cttaaa
B D                   Gorilla  cttaaa
B D                 Orangutan  cttaaa
B D                    Gibbon  cttaaa
B D                    Rhesus  cttaag
B D       Crab-eating macaque  cttaag
B D                    Baboon  cttaag
B D              Green monkey  cttaag
B D                  Marmoset  cttaaa
B D           Squirrel monkey  cttaaa
B D                  Bushbaby  cttaaa
           Chinese tree shrew  cctaga
B D                  Squirrel  ctaaag
       Lesser Egyptian jerboa  ctt--g
                 Prairie vole  -----a
B D           Chinese hamster  cttaca
B D                       Rat  cttaaa
B D            Naked mole-rat  ctaaaa
                   Chinchilla  ctaaaa
             Brush-tailed rat  ttaaaa
B D                    Rabbit  cttaaa
B D                      Pika  tttaaa
B D                       Pig  tttaaa
B D                    Alpaca  tttaaa
               Bactrian camel  ttt-aa
B D                   Dolphin  tttaaa
                 Killer whale  tttaaa
             Tibetan antelope  tttaaa
B D                       Cow  tttaaa
B D                     Sheep  tttaaa
                Domestic goat  tttaaa
B D                     Horse  tttaaa
B D          White rhinoceros  tttaaa
B D                       Cat  -----a
B D                   Ferret   -----c
               Pacific walrus  -----a
                 Weddell seal  -----a
                Big brown bat  -----a
         David's myotis (bat)  -----a
B D                  Microbat  -----a
B D                  Hedgehog  tttaag
              Star-nosed mole  tttaag
B D                  Elephant  tttaaa
          Cape elephant shrew  tt----
B D                   Manatee  tttaaa
             Cape golden mole  tt----
B D                    Tenrec  tt----
                     Aardvark  ttttaa
B D                Guinea pig  ------
B D                     Shrew  ======
              Golden hamster  ------
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D           Tasmanian devil  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
B D                Budgerigar  ======
  D               Rock pigeon  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D                   Wallaby  ======
B D                   Megabat  ------
  D  Chinese softshell turtle  ======
B D                     Mouse  ======
B D                     Panda  ======
            Black flying-fox  ------
B D                 Armadillo  ------
B D                       Dog  ======

Inserts between block 31 and 32 in window
B D                   Rabbit 35bp
B D                     Pika 150bp

Alignment block 32 of 152 in window, 53895953 - 53895960, 8 bps 
B D                     Human  ata---cccca
B D                     Chimp  ata---cccca
B D                   Gorilla  ata---accca
B D                 Orangutan  gta---cccca
B D                    Gibbon  ata---cccca
B D                    Rhesus  ata---cccca
B D       Crab-eating macaque  ata---cccca
B D                    Baboon  ata---cccca
B D              Green monkey  ata---cccca
B D                  Marmoset  aga---cccca
B D           Squirrel monkey  aga---cccca
B D                  Bushbaby  aga---cccca
           Chinese tree shrew  aga---cctca
B D                  Squirrel  aga---cccca
       Lesser Egyptian jerboa  aga---tctca
                 Prairie vole  aga---cctca
B D           Chinese hamster  aga---cctca
B D                       Rat  ggc---cctca
B D            Naked mole-rat  ata---atcca
                   Chinchilla  atg---cccca
             Brush-tailed rat  ata---cccca
B D                    Rabbit  acg---atgca
B D                      Pika  atg---actca
B D                       Pig  aga---cccca
B D                    Alpaca  aga---cccca
               Bactrian camel  aga---ccgca
B D                   Dolphin  aga---cccca
                 Killer whale  aga---cccca
             Tibetan antelope  aga---cctta
B D                       Cow  aga---cccca
B D                     Sheep  aga---cctca
                Domestic goat  aga---cccca
B D                     Horse  aga---cacca
B D          White rhinoceros  aga---cacca
B D                       Cat  agg---ccctc
B D                   Ferret   agagccccctc
               Pacific walrus  agg--cccccc
                 Weddell seal  agg-ccccccc
                Big brown bat  aga---ccctc
         David's myotis (bat)  aga---c-acc
B D                  Microbat  aga---ctccc
B D                  Hedgehog  aaa---ctgta
              Star-nosed mole  --a---cccca
B D                  Elephant  aga---cctca
          Cape elephant shrew  --------ttt
B D                   Manatee  aga---cctca
             Cape golden mole  ----------g
B D                    Tenrec  ----------t
                     Aardvark  ata---cctca
B D                Guinea pig  -----------
B D                     Shrew  ===========
              Golden hamster  -----------
  D              Mallard duck  ===========
          Tibetan ground jay  ===========
B D           Tasmanian devil  ===========
  D            Painted turtle  ===========
  D           Green seaturtle  ===========
B D        American alligator  ===========
B D                Budgerigar  ===========
  D               Rock pigeon  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
B D                   Wallaby  ===========
B D                   Megabat  -----------
  D  Chinese softshell turtle  ===========
B D                     Mouse  ===========
B D                     Panda  ===========
            Black flying-fox  -----------
B D                 Armadillo  -----------
B D                       Dog  ===========

Inserts between block 32 and 33 in window
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
B D                      Rat 6bp

Alignment block 33 of 152 in window, 53895961 - 53895964, 4 bps 
B D                     Human  agga
B D                     Chimp  agga
B D                   Gorilla  agga
B D                 Orangutan  aaga
B D                    Gibbon  aaga
B D                    Rhesus  aaga
B D       Crab-eating macaque  aaga
B D                    Baboon  aaga
B D              Green monkey  aaga
B D                  Marmoset  aaga
B D           Squirrel monkey  aaga
B D                  Bushbaby  aaga
           Chinese tree shrew  aaga
B D                  Squirrel  aaga
       Lesser Egyptian jerboa  aaga
                 Prairie vole  aaga
B D           Chinese hamster  aagg
               Golden hamster  atga
B D            Naked mole-rat  aaga
                   Chinchilla  aaga
             Brush-tailed rat  aaga
B D                    Rabbit  ---a
B D                      Pika  ---a
B D                       Pig  aaga
B D                    Alpaca  aaga
               Bactrian camel  aaga
B D                   Dolphin  aaga
                 Killer whale  aaga
             Tibetan antelope  agga
B D                       Cow  agga
B D                     Sheep  agga
                Domestic goat  agga
B D                     Horse  aaga
B D          White rhinoceros  aaga
B D                       Cat  caaa
B D                   Ferret   aaaa
               Pacific walrus  aaaa
                 Weddell seal  aaaa
                Big brown bat  caaa
         David's myotis (bat)  caaa
B D                  Microbat  caaa
B D                  Hedgehog  acga
              Star-nosed mole  aaca
B D                  Elephant  aaga
          Cape elephant shrew  aaaa
B D                   Manatee  aaga
             Cape golden mole  aaaa
B D                    Tenrec  aaga
                     Aardvark  aaga
B D                Guinea pig  ----
B D                     Shrew  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
B D                Budgerigar  ====
  D               Rock pigeon  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                   Wallaby  ====
B D                   Megabat  ----
  D  Chinese softshell turtle  ====
B D                       Rat  ====
B D                     Mouse  ====
B D                     Panda  ====
            Black flying-fox  ----
B D                 Armadillo  ----
B D                       Dog  ====

Inserts between block 33 and 34 in window
B D                   Rabbit 276bp
B D                     Pika 73bp

Alignment block 34 of 152 in window, 53895965 - 53895977, 13 bps 
B D                     Human  ctgagg-cttt-tgt
B D                     Chimp  ctgagg-cttt-tgt
B D                   Gorilla  ctgagg-cttt-tgt
B D                 Orangutan  ctgagg-cttt-tgt
B D                    Gibbon  ctgagg-cttt-tgt
B D                    Rhesus  ctgagg-cttt-ggt
B D       Crab-eating macaque  ctgagg-cttt-ggt
B D                    Baboon  ctgagg-cttt-ggt
B D              Green monkey  ctgagg-cttt-ggt
B D                  Marmoset  ctgagg-cttt-tgt
B D           Squirrel monkey  ctgagg-cttt-tgt
B D                  Bushbaby  ctgagg-cttt-tat
           Chinese tree shrew  ctcaga-cttt-tgt
B D                  Squirrel  ctgagg-cttt-tgt
       Lesser Egyptian jerboa  ctgggt-tttt-tgt
                 Prairie vole  ttggac-cttt-tgt
B D           Chinese hamster  ttggac-cttt-tgt
               Golden hamster  ttggac-cttt-tgt
B D                     Mouse  -aggac-tgtt-tgt
B D                       Rat  -tggac-tgtt-tgt
B D            Naked mole-rat  ctgagg-cttt-tgt
                   Chinchilla  ttgagg-cttt-tgt
             Brush-tailed rat  ttgaag-cttt-tat
B D                    Rabbit  ctctct-ctct-ctc
B D                      Pika  ctctgg-ctgt-tgt
B D                       Pig  cggagg-cctt-tgt
B D                    Alpaca  ctgaggctttt-tgt
               Bactrian camel  ctgaggctttt-tgt
B D                   Dolphin  ctgagg-cttt-tgt
                 Killer whale  ctgagg-cttt-tgt
             Tibetan antelope  ctaagg-tgct-ttt
B D                       Cow  ctgagg-tgtt-tgt
B D                     Sheep  ctgagg-tgct-tgt
                Domestic goat  ctgagg-tgct-tgt
B D                     Horse  ctgagg-cttt-tgt
B D          White rhinoceros  ctgagg-cttt-tgt
B D                       Cat  ctgagg-cttt-tgt
B D                   Ferret   ctgaga-cttt-tgt
               Pacific walrus  ctgaga-cttt-ttt
                 Weddell seal  ctgaga-cttt-tgt
             Black flying-fox  ccgagg-cttt-tgt
B D                   Megabat  ccgagg-cttt-tgt
                Big brown bat  ctgagg-cttt-tgt
         David's myotis (bat)  ctgagg-cttt-tgt
B D                  Microbat  ctgagg-cttt-tgt
B D                  Hedgehog  ctgcaa-cttt-tgt
              Star-nosed mole  ctg-gg-ctct-tgt
B D                  Elephant  ctgagg-ttttctgt
          Cape elephant shrew  ctgagg-ttttctct
B D                   Manatee  ctgagg-ttttctgt
             Cape golden mole  aagagg-ttttctgt
B D                    Tenrec  gtgaggtttttctat
                     Aardvark  ctgagg-ttttctgt
B D                Guinea pig  ---------------
B D                     Shrew  ===============
  D              Mallard duck  ===============
          Tibetan ground jay  ===============
B D           Tasmanian devil  ===============
  D            Painted turtle  ===============
  D           Green seaturtle  ===============
B D        American alligator  ===============
B D                Budgerigar  ===============
  D               Rock pigeon  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
B D                   Wallaby  ===============
  D  Chinese softshell turtle  ===============
B D                     Panda  ===============
B D                 Armadillo  ---------------
B D                       Dog  ===============

Inserts between block 34 and 35 in window
B D                     Pika 3bp

Alignment block 35 of 152 in window, 53895978 - 53895982, 5 bps 
B D                     Human  aac---at
B D                     Chimp  aac---at
B D                   Gorilla  aac---at
B D                 Orangutan  aat---at
B D                    Gibbon  aac---at
B D                    Rhesus  aac---at
B D       Crab-eating macaque  aac---at
B D                    Baboon  aac---at
B D              Green monkey  aac---at
B D                  Marmoset  aac---at
B D           Squirrel monkey  aac---at
B D                  Bushbaby  aac---at
           Chinese tree shrew  aac---at
B D                  Squirrel  agt---at
       Lesser Egyptian jerboa  aatgtagt
                 Prairie vole  aac---at
B D           Chinese hamster  aat---at
               Golden hamster  aac---at
B D                     Mouse  aat---gt
B D                       Rat  aac---tt
B D            Naked mole-rat  aac---gt
                   Chinchilla  aat---ac
             Brush-tailed rat  aat---ac
B D                    Rabbit  cat---tt
B D                      Pika  tat---tt
B D                       Pig  agc---at
B D                    Alpaca  aac---gt
               Bactrian camel  aac---gt
B D                   Dolphin  aac---at
                 Killer whale  aac---at
             Tibetan antelope  aac---at
B D                       Cow  aac---at
B D                     Sheep  aac---at
                Domestic goat  aac---at
B D                     Horse  aac---at
B D          White rhinoceros  aac---at
B D                       Cat  aac---at
B D                   Ferret   aac---at
               Pacific walrus  aac---at
                 Weddell seal  aat---gt
             Black flying-fox  aac---at
B D                   Megabat  aac---at
                Big brown bat  aac---at
         David's myotis (bat)  aac---at
B D                  Microbat  aac---at
B D                  Hedgehog  aac---gt
              Star-nosed mole  agc---at
B D                  Elephant  aac---at
          Cape elephant shrew  a-----ct
B D                   Manatee  aac---at
             Cape golden mole  aac---tt
B D                    Tenrec  aac---at
                     Aardvark  aac---at
B D                 Armadillo  cac---ac
B D                Guinea pig  --------
B D                     Shrew  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D           Tasmanian devil  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
B D                Budgerigar  ========
  D               Rock pigeon  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
B D                   Wallaby  ========
  D  Chinese softshell turtle  ========
B D                     Panda  ========
B D                       Dog  ========

Inserts between block 35 and 36 in window
          Chinese tree shrew 1534bp

Alignment block 36 of 152 in window, 53895983 - 53895996, 14 bps 
B D                     Human  gagtgatgagtatt
B D                     Chimp  gagtgatgagtatt
B D                   Gorilla  gagtgataagtatt
B D                 Orangutan  gagtgatgagtatt
B D                    Gibbon  gagtgatgagtatt
B D                    Rhesus  cagtgatgaatatt
B D       Crab-eating macaque  cagtgatgaatatt
B D                    Baboon  cagtgatgagtatt
B D              Green monkey  cagtgatgagtatt
B D                  Marmoset  gaatgaggaatatt
B D           Squirrel monkey  gaatgaggaatatt
B D                  Bushbaby  gaatgatgagtatg
B D                  Squirrel  caatgatgagcatt
       Lesser Egyptian jerboa  gagtgctgactttt
                 Prairie vole  gaacaatgaataga
B D           Chinese hamster  gagcaatggatata
               Golden hamster  gagcaatgaatata
B D                     Mouse  gagcaatgaatata
B D                       Rat  gagcaatggatgta
B D            Naked mole-rat  gagtgaagagtgtt
                   Chinchilla  aagtgaagagtatt
             Brush-tailed rat  aagcaaagaatatt
B D                    Rabbit  ca--aataaataaa
B D                      Pika  gaggagtgaaccag
B D                       Pig  gagtaatgagtatt
B D                    Alpaca  aagtgatgagtatt
               Bactrian camel  gagtggtgagtatt
B D                   Dolphin  gggtgaggagtatt
                 Killer whale  gagtgaggagtatt
             Tibetan antelope  gagtgacgggtatt
B D                       Cow  gagtgacaagtatt
B D                     Sheep  gagtgatgggtatt
                Domestic goat  gagtgacaggtatt
B D                     Horse  aagtgatgagtatt
B D          White rhinoceros  aagtgatgagtatt
B D                       Cat  aaaatatgtt----
B D                   Ferret   aggtgatatgtatt
               Pacific walrus  acatgatgtgtatt
                 Weddell seal  acatgatgtgtatt
             Black flying-fox  gagtgatg----tt
B D                   Megabat  gagtgatg----tt
                Big brown bat  gaatgatgaatatt
         David's myotis (bat)  gaatgatgactatt
B D                  Microbat  gaatgatgactatt
B D                  Hedgehog  cagtgatgagcatg
              Star-nosed mole  ggatgatgactatg
B D                  Elephant  gagtgataactatc
          Cape elephant shrew  gagtgatcactatc
B D                   Manatee  gagtgataactatc
             Cape golden mole  gagtgataattatc
B D                    Tenrec  gggtgatacctatc
                     Aardvark  gagtggtaactacc
B D                 Armadillo  gaatgatgagtatt
B D                Guinea pig  --------------
B D                     Shrew  ==============
  D              Mallard duck  ==============
          Tibetan ground jay  ==============
B D           Tasmanian devil  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D        American alligator  ==============
B D                Budgerigar  ==============
  D               Rock pigeon  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
          Chinese tree shrew  ==============
B D                   Wallaby  ==============
  D  Chinese softshell turtle  ==============
B D                     Panda  ==============
B D                       Dog  ==============

Inserts between block 36 and 37 in window
B D                      Cat 1307bp

Alignment block 37 of 152 in window, 53895997 - 53895999, 3 bps 
B D                     Human  aaa
B D                     Chimp  aaa
B D                   Gorilla  aaa
B D                 Orangutan  aaa
B D                    Gibbon  caa
B D                    Rhesus  aaa
B D       Crab-eating macaque  aaa
B D                    Baboon  aaa
B D              Green monkey  aaa
B D                  Marmoset  aaa
B D           Squirrel monkey  aaa
B D                  Bushbaby  aaa
B D                  Squirrel  aaa
       Lesser Egyptian jerboa  gaa
                 Prairie vole  aaa
B D           Chinese hamster  aaa
               Golden hamster  aaa
B D                     Mouse  aaa
B D                       Rat  aaa
B D            Naked mole-rat  -aa
                   Chinchilla  aaa
             Brush-tailed rat  aaa
B D                    Rabbit  taa
B D                      Pika  cag
B D                       Pig  aaa
B D                    Alpaca  aaa
               Bactrian camel  aaa
B D                   Dolphin  aaa
                 Killer whale  aaa
             Tibetan antelope  aaa
B D                       Cow  aaa
B D                     Sheep  aaa
                Domestic goat  aaa
B D                     Horse  aaa
B D          White rhinoceros  aaa
B D                       Cat  aaa
B D                       Dog  aaa
B D                   Ferret   aaa
B D                     Panda  aaa
               Pacific walrus  aaa
                 Weddell seal  aaa
             Black flying-fox  aaa
B D                   Megabat  aaa
                Big brown bat  aaa
         David's myotis (bat)  aaa
B D                  Microbat  aaa
B D                  Hedgehog  aca
              Star-nosed mole  aaa
B D                  Elephant  gag
          Cape elephant shrew  agg
B D                   Manatee  aag
             Cape golden mole  aag
B D                    Tenrec  agg
                     Aardvark  aag
B D                 Armadillo  aag
B D                Guinea pig  ---
B D                     Shrew  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
          Chinese tree shrew  ===
B D                   Wallaby  ===
  D  Chinese softshell turtle  ===

Inserts between block 37 and 38 in window
B D                  Ferret  1442bp

Alignment block 38 of 152 in window, 53896000 - 53896001, 2 bps 
B D                     Human  g------------------------------------------------------------g-
B D                     Chimp  g------------------------------------------------------------g-
B D                   Gorilla  g------------------------------------------------------------g-
B D                 Orangutan  g------------------------------------------------------------g-
B D                    Gibbon  g------------------------------------------------------------g-
B D                    Rhesus  g------------------------------------------------------------g-
B D       Crab-eating macaque  g------------------------------------------------------------g-
B D                    Baboon  g------------------------------------------------------------g-
B D              Green monkey  g------------------------------------------------------------g-
B D                  Marmoset  g------------------------------------------------------------g-
B D           Squirrel monkey  g------------------------------------------------------------g-
B D                  Bushbaby  a------------------------------------------------------------a-
B D                  Squirrel  g------------------------------------------------------------g-
       Lesser Egyptian jerboa  a------------------------------------------------------------g-
                 Prairie vole  a------------------------------------------------------------g-
B D           Chinese hamster  a------------------------------------------------------------g-
               Golden hamster  a------------------------------------------------------------g-
B D                     Mouse  a------------------------------------------------------------g-
B D                       Rat  a------------------------------------------------------------g-
B D            Naked mole-rat  a------------------------------------------------------------g-
                   Chinchilla  a------------------------------------------------------------g-
             Brush-tailed rat  a------------------------------------------------------------g-
B D                    Rabbit  ata----------------------------------------------cagtaagtagg-g-
B D                      Pika  ataggagattctttctctctttctcattctctctcttactctgaactacaaataagtaaaca-
B D                       Pig  -------------------------------------------------------------g-
B D                    Alpaca  -------------------------------------------------------------g-
               Bactrian camel  -------------------------------------------------------------g-
B D                   Dolphin  -------------------------------------------------------------g-
                 Killer whale  -------------------------------------------------------------g-
             Tibetan antelope  -------------------------------------------------------------g-
B D                       Cow  -------------------------------------------------------------g-
B D                     Sheep  -------------------------------------------------------------g-
                Domestic goat  -------------------------------------------------------------g-
B D                     Horse  -------------------------------------------------------------g-
B D          White rhinoceros  -------------------------------------------------------------g-
B D                       Cat  -------------------------------------------------------------g-
B D                       Dog  -------------------------------------------------------------g-
B D                   Ferret   -------------------------------------------------------------g-
B D                     Panda  -------------------------------------------------------------g-
               Pacific walrus  -------------------------------------------------------------g-
                 Weddell seal  -------------------------------------------------------------g-
             Black flying-fox  -------------------------------------------------------------g-
B D                   Megabat  -------------------------------------------------------------g-
                Big brown bat  -------------------------------------------------------------g-
         David's myotis (bat)  -------------------------------------------------------------g-
B D                  Microbat  -------------------------------------------------------------g-
B D                  Hedgehog  -------------------------------------------------------------g-
              Star-nosed mole  -------------------------------------------------------------g-
B D                  Elephant  -------------------------------------------------------------gc
          Cape elephant shrew  -------------------------------------------------------------gc
B D                   Manatee  -------------------------------------------------------------gc
B D                    Tenrec  -------------------------------------------------------------gt
                     Aardvark  -------------------------------------------------------------gc
B D                 Armadillo  -------------------------------------------------------------gc
B D                Guinea pig  ---------------------------------------------------------------
B D                     Shrew  ===============================================================
  D              Mallard duck  ===============================================================
          Tibetan ground jay  ===============================================================
B D           Tasmanian devil  ===============================================================
  D            Painted turtle  ===============================================================
  D           Green seaturtle  ===============================================================
B D        American alligator  ===============================================================
B D                Budgerigar  ===============================================================
  D               Rock pigeon  ===============================================================
  D          Peregrine falcon  ===============================================================
  D              Saker falcon  ===============================================================
            Cape golden mole  ---------------------------------------------------------------
          Chinese tree shrew  ===============================================================
B D                   Wallaby  ===============================================================
  D  Chinese softshell turtle  ===============================================================

Inserts between block 38 and 39 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1258bp
                Weddell seal 1264bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp
             Star-nosed mole 1bp

Alignment block 39 of 152 in window, 53896002 - 53896007, 6 bps 
B D                     Human  ta-aaag
B D                     Chimp  ta-aaag
B D                   Gorilla  ta-aaag
B D                 Orangutan  ta-aaag
B D                    Gibbon  ta-aaag
B D                    Rhesus  ta-aaag
B D       Crab-eating macaque  ta-aaag
B D                    Baboon  ta-aacg
B D              Green monkey  ta-aaag
B D                  Marmoset  ta-aaag
B D           Squirrel monkey  ta-aaag
B D                  Bushbaby  ta-aaag
B D                  Squirrel  ca-aaag
       Lesser Egyptian jerboa  ta-aaag
                 Prairie vole  tg--agg
B D           Chinese hamster  tg--aga
               Golden hamster  tg--agg
B D                     Mouse  tg-agag
B D                       Rat  tgaaaag
B D            Naked mole-rat  aa-aaag
                   Chinchilla  aa-aaac
             Brush-tailed rat  aa-aaag
B D                    Rabbit  ta-gaat