Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 977 in window, 6775896 - 6775917, 22 bps 
B D                   Human  cagggct-t-ggg---ttagagttgca
B D                   Chimp  cagggct-t-ggg---ttaaagttgca
B D                 Gorilla  cagggct-t-ggg---ttaaagttgca
B D               Orangutan  cagggct-t-ggg---ttaaagttgca
B D                  Gibbon  cagggct-t-ggg---ttaaagttgca
B D                  Rhesus  cagggct-t-ggg---ttaaagttgca
B D     Crab-eating macaque  cagggct-t-ggg---ttaaagttgca
B D                  Baboon  cagggct-t-ggg---ttaaagttgca
B D            Green monkey  caaggct-t-ggg---ttaaagttgca
B D                Marmoset  cagggct-t-ggg---ttaaagttgca
B D         Squirrel monkey  cagggct-t-ggg---ttaaagttgca
B D                Bushbaby  cagggct-t-ggg---ttaaagttgca
         Chinese tree shrew  caggact-t-ggg---ttacagttgca
B D                Squirrel  tggggctct-gg----ataaagtttca
     Lesser Egyptian jerboa  -ggggct-t-ag----ttaaacttgta
               Prairie vole  tgggact-t-ga----ttaaagttgtg
B D         Chinese hamster  tggggat-t-gg----ttaaagttgtg
             Golden hamster  tggggct-t-gg----ttaacggtgtg
B D                   Mouse  tagggct-c-tg----ttaaaattgtg
B D                     Rat  tagggct-c-gg----ttaaaattgtg
B D          Naked mole-rat  cagtgct-g-ggg---ttaaagttaca
B D              Guinea pig  caaggtt-t-gga---ttaaagttgca
                 Chinchilla  cagggtt-t-ggg---ttaaagttgca
           Brush-tailed rat  cagggtt-t-ggg---ttaaagttgca
B D                  Rabbit  cagggct-t-ggg---ttcaagttgca
B D                    Pika  gagggct-t-ggg---ttaaagtcaca
B D                     Pig  cagggct-t-ggg---taaaagttgca
B D                  Alpaca  cagggct-t-ggg---gtaaagttgca
             Bactrian camel  cagggct-t-ggg---gtaaagttgca
B D                 Dolphin  cagggcc-t-ggg---ttaaagtcgca
               Killer whale  cagggcc-t-ggg---ttaaagtcgca
           Tibetan antelope  cagggat-t-gaa---ttaaagttgca
B D                     Cow  cagggat-t-gag---ttaaagttgca
B D                   Sheep  cagggat-t-gaa---ttaaagttgca
              Domestic goat  cagggat-t-gaa---ttaaagttgca
B D                   Horse  cagggct-t-gga---ttaaagttgca
B D        White rhinoceros  cagggct-t-ggg---ttaaagttgca
B D                     Cat  cagggct-t-ggg---ttaaagttgca
B D                     Dog  cagtgct-tgggg---ggaaagttgca
B D                 Ferret   caatgct-t-tgg---ttcaaattgca
B D                   Panda  cagtgct-t-ggg---ttaaagttgca
             Pacific walrus  cagtgct-t-ggc---ttaaagttgca
               Weddell seal  cagtgct-t-ggc---ttaacgttgca
           Black flying-fox  cagggct-t-ggg---ttaaagttgaa
B D                 Megabat  cagggct-t-ggg---ttaaagttgaa
              Big brown bat  cagggct-t-ggg---ttaaagttgca
       David's myotis (bat)  cagggct-t-ggg---ttaaagttgca
B D                Microbat  cagggct-t-ggg---ttaaagttgca
B D                Hedgehog  taggact-g-aag---ttaaggttgca
B D                   Shrew  cggggct-t-ggg---ttaaagttgca
            Star-nosed mole  tagggct-t-ggg---gtaaagtcaca
B D                Elephant  cagggct-t-gga---ttaaagttgca
        Cape elephant shrew  cagggct-t-ggg---ttaaaattaca
B D                 Manatee  caaggct-t-ggg---ttaaagttgca
           Cape golden mole  cagggtt-----------aaaattgca
B D                  Tenrec  cagggct-g-ggg---tgaaagttgca
                   Aardvark  taggctt-t-ggg---ttaaagttgca
B D               Armadillo  cagggct-t-ggg---ttaaagttgca
B D                 Opossum  -aggact-t-ctg---cca--------
B D         Tasmanian devil  taggaca-c-ataggttca--------
B D             Stickleback  ---------------------------
    Yellowbelly pufferfish  ===========================
B D                    Fugu  ===========================
B D                  Turkey  ===========================
B D                 Chicken  ===========================
  D            Mallard duck  ===========================
        Tibetan ground jay  ===========================
B D             Zebra finch  ===========================
  D  White-throated sparrow  ===========================
B D               Zebrafish  ===========================
B D           X. tropicalis  ===========================
  D         Green seaturtle  ===========================
B D      American alligator  ===========================
B D              Budgerigar  ===========================
  D             Rock pigeon  ===========================
  D     Collared flycatcher  ===========================
B D     Medium ground finch  ===========================
B D                  Lizard  ---------------------------
  D        Peregrine falcon  ---------------------------
  D            Saker falcon  ===========================
B D                Platypus  ===========================
B D                 Wallaby  ===========================

Inserts between block 1 and 2 in window
B D               Squirrel 1bp
    Lesser Egyptian jerboa 4024bp

Alignment block 2 of 977 in window, 6775918 - 6775925, 8 bps 
B D                   Human  ggaagtgg
B D                   Chimp  ggaagtgg
B D                 Gorilla  ggaagtgg
B D               Orangutan  ggaagtgg
B D                  Gibbon  ggaagtgg
B D                  Rhesus  ggaagtgg
B D     Crab-eating macaque  ggaagtgg
B D                  Baboon  ggaagtgg
B D            Green monkey  ggaagtgg
B D                Marmoset  ggaagtgg
B D         Squirrel monkey  ggaagtgg
B D                Bushbaby  ggaagtgg
         Chinese tree shrew  ggaaatgg
B D                Squirrel  gaagttg-
               Prairie vole  ctagttga
B D         Chinese hamster  ggagttga
             Golden hamster  ggagttga
B D                   Mouse  ggagttga
B D                     Rat  agagttga
B D          Naked mole-rat  ggaagtgg
B D              Guinea pig  ggaagtgg
                 Chinchilla  ggaagtgg
           Brush-tailed rat  ggaattgg
B D                  Rabbit  ggaagtgg
B D                    Pika  agaagtgg
B D                     Pig  gatggtgg
B D                  Alpaca  ggaaatga
             Bactrian camel  gtaaatga
B D                 Dolphin  ggaagtgg
               Killer whale  ggaagtgg
           Tibetan antelope  ggaggcaa
B D                     Cow  ggaggcag
B D                   Sheep  ggaggcaa
              Domestic goat  ggaggcaa
B D                   Horse  ggaagtgg
B D        White rhinoceros  ggaagtgg
B D                     Cat  ggaagtgg
B D                     Dog  ggaagtgg
B D                 Ferret   ggaagtgg
B D                   Panda  ggaagtgg
             Pacific walrus  ggaagtgg
               Weddell seal  ggaagtgg
           Black flying-fox  ggaaatgg
B D                 Megabat  ggaaatgg
              Big brown bat  ggaagtgg
       David's myotis (bat)  ggaagtgg
B D                Microbat  ggaagtgg
B D                Hedgehog  ggaaatgg
B D                   Shrew  ggaagtga
            Star-nosed mole  gaaaatgg
B D                Elephant  ggacgttg
        Cape elephant shrew  ggatgttg
B D                 Manatee  ggacattg
           Cape golden mole  ggacgttg
B D                  Tenrec  ggatggtg
                   Aardvark  gactgttg
B D               Armadillo  ggaagttg
B D                 Opossum  gga-----
B D         Tasmanian devil  gga-----
B D             Stickleback  --------
    Yellowbelly pufferfish  ========
B D                    Fugu  ========
B D                  Turkey  ========
B D                 Chicken  ========
  D            Mallard duck  ========
        Tibetan ground jay  ========
B D             Zebra finch  ========
  D  White-throated sparrow  ========
B D               Zebrafish  ========
B D           X. tropicalis  ========
  D         Green seaturtle  ========
B D      American alligator  ========
B D              Budgerigar  ========
    Lesser Egyptian jerboa  ========
  D             Rock pigeon  ========
  D     Collared flycatcher  ========
B D     Medium ground finch  ========
B D                  Lizard  --------
  D        Peregrine falcon  --------
  D            Saker falcon  ========
B D                Platypus  ========
B D                 Wallaby  ========

Inserts between block 2 and 3 in window
B D               Hedgehog 1392bp

Alignment block 3 of 977 in window, 6775926 - 6775959, 34 bps 
B D                   Human  cctgga----tttgggaggagtgaa-------taaat-ccgtccct
B D                   Chimp  cctgga----tttgggaggagtgaa-------taaat-ccgtccct
B D                 Gorilla  cctgga----tttgggaggagtgaa-------taaat-ccgtccct
B D               Orangutan  cctgga----tttgggaggagagaa-------taaat-ccgtccct
B D                  Gibbon  cctgga----tttgggaggagtgaa-------taaat-ccgtccct
B D                  Rhesus  cctaga----tttgggaggagttaa-------taaat-ccgtccct
B D     Crab-eating macaque  cctaga----tttgggaggagttaa-------taaat-ccgtccct
B D                  Baboon  cctaga----tttgggaggagttaa-------taaat-ccgtccct
B D            Green monkey  cctaga----tttgggaggagttaa-------taaat-ccgtccct
B D                Marmoset  cttgga----tttgggaggagttaa-------taaat-ccgtccct
B D         Squirrel monkey  cttgga----tttgggaggagttaa-------taaat-ccgtccct
B D                Bushbaby  cctgga----tttgggaggagttaa-------taaat-cagttcca
         Chinese tree shrew  cctgga----tgtgggaggagttta-------aaaat-cagtccgt
B D                Squirrel  cctgga----tttggaaggagttaa-------taaat-cagcccct
               Prairie vole  cctgga----ttcggaaggagttaa-------taaat-cagtccct
B D         Chinese hamster  cctgga----tttggaaggggctaa-------taaat-cagtccct
             Golden hamster  cctgga----tttggagggagttaa-------taaac-cagtccct
B D                   Mouse  cctggg----tttcgaaggagctga-------taaat-ccgtccct
B D                     Rat  cctggg----tttagaaggagctaa-------taaat-cagtccct
B D          Naked mole-rat  cctgga----tttggaaggagttaa-------caaat-cgatctct
B D              Guinea pig  cctgga----tttggaaggagttaa-------taaat-cagtc-ca
                 Chinchilla  cctgga----tttggaaggagttaa-------taaat-cagtccct
           Brush-tailed rat  cctgga----tttggaaggagttaa-------taaat-cagtctct
B D                  Rabbit  cctggg----tttgggaggagctga-------taaag-cagtgcct
B D                    Pika  cctgga----tttggaaggagttaa-------taaaa-catgctga
B D                     Pig  cctgga----tttgggaggagttaa-------taaat-cagtccct
B D                  Alpaca  cctgga----tttgggaggagttaa-------taaat-cagtccct
             Bactrian camel  cctgga----tttgggaggagttaa-------taaat-cagtccct
B D                 Dolphin  cctgga----ttggggaggaatgaa-------taaat-ccgtccct
               Killer whale  cctgga----ttggggaggaattaa-------taaat-ccgtccct
           Tibetan antelope  tctgga----ctgggg-ggagttga-------taaat-cagtccct
B D                     Cow  tctgga----ctgggg-ggagttga-------taaat-cagtcctg
B D                   Sheep  tctgga----ctgggg-ggagttga-------taaat-cagtccct
              Domestic goat  tctgga----ctgggg-ggagttga-------taaat-cagtccct
B D                   Horse  cctgga----tttcggaggaattaa-------gaaat-cagtccct
B D        White rhinoceros  cctgga----tttgggaggagttaa-------taaat-cagtccct
B D                     Cat  cctgga----tttgggaggagttaa-------tcaat-cagtccct
B D                     Dog  cctgga----tttgggaggagctaa-------taaat-cagtccct
B D                 Ferret   tttgga----tttgggaggagttaa-------taaatccagtccct
B D                   Panda  cctgga----tttgggaggagttaa-------taaat-cagtccct
             Pacific walrus  cttgga----tttgg--ggagttaa-------caaat-cagtccct
               Weddell seal  cttgga----tttgggaggagttaa-------taaat-cagtcctt
           Black flying-fox  cctgga----tttgggaggagttaa-------taaat-cagtccct
B D                 Megabat  cctgga----tttgggaggagttaa-------taaat-cagtccct
              Big brown bat  cctggg----tttgggaggagttaa-------tacat-cagttcct
       David's myotis (bat)  cctgga----tctgggaggagttaa-------tacat-cagttcct
B D                Microbat  cctgga----tttgggaggagttaa-------tacat-cagttcct
B D                Hedgehog  cctgaa----tttggaaagagttaa-------taaat-cggt-ctt
B D                   Shrew  cctgga----tttgg------------------gaat-ctgtcccc
            Star-nosed mole  cctggg----ttggg-aggagttaa-------taaat-cagcccct
B D                Elephant  cttgga----tttgggagaagttaa-------taaat-catgccct
        Cape elephant shrew  attgga----ttggggaagagttga-------taaat-caggccct
B D                 Manatee  cttgga----tttgggaggagtc------------at-cagtccct
           Cape golden mole  cttgga----ttggggaggagttga-------taaat-cagtctct
B D                  Tenrec  cttgga---tttggggaggagttga-------taaat-c-------
                   Aardvark  cttgga----tttgggaggagttga-------taaat-cagttctt
B D               Armadillo  cttgga----tttgggagaagttaa-------taaat-cagtcgct
B D                 Opossum  --tggactatctgtgaaagaataac---tttctatat-cgatccag
B D         Tasmanian devil  --tgaa----ctgtgaaacagtaacaaatttctatat-tgatccac
B D             Stickleback  ----------------------------------------------
    Yellowbelly pufferfish  ==============================================
B D                    Fugu  ==============================================
B D                  Turkey  ==============================================
B D                 Chicken  ==============================================
  D            Mallard duck  ==============================================
        Tibetan ground jay  ==============================================
B D             Zebra finch  ==============================================
  D  White-throated sparrow  ==============================================
B D               Zebrafish  ==============================================
B D           X. tropicalis  ==============================================
  D         Green seaturtle  ==============================================
B D      American alligator  ==============================================
B D              Budgerigar  ==============================================
    Lesser Egyptian jerboa  ==============================================
  D             Rock pigeon  ==============================================
  D     Collared flycatcher  ==============================================
B D     Medium ground finch  ==============================================
B D                  Lizard  ----------------------------------------------
  D        Peregrine falcon  ----------------------------------------------
  D            Saker falcon  ==============================================
B D                Platypus  ==============================================
B D                 Wallaby  ==============================================

Inserts between block 3 and 4 in window
          Tibetan antelope 319bp

Alignment block 4 of 977 in window, 6775960 - 6775960, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Marmoset  t
B D         Squirrel monkey  g
B D                Bushbaby  t
         Chinese tree shrew  t
B D                Squirrel  t
               Prairie vole  a
B D         Chinese hamster  t
             Golden hamster  t
B D                   Mouse  t
B D                     Rat  t
B D          Naked mole-rat  t
B D              Guinea pig  t
                 Chinchilla  t
           Brush-tailed rat  t
B D                  Rabbit  t
B D                    Pika  a
B D                     Pig  t
B D                  Alpaca  t
             Bactrian camel  t
B D                 Dolphin  t
               Killer whale  t
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  t
B D                     Dog  t
B D                 Ferret   t
B D                   Panda  t
             Pacific walrus  t
               Weddell seal  t
           Black flying-fox  t
B D                 Megabat  t
              Big brown bat  t
       David's myotis (bat)  t
B D                Microbat  t
B D                Hedgehog  g
B D                   Shrew  g
            Star-nosed mole  t
B D                Elephant  t
        Cape elephant shrew  t
B D                 Manatee  t
           Cape golden mole  t
                   Aardvark  t
B D               Armadillo  t
B D                 Opossum  t
B D         Tasmanian devil  t
B D             Stickleback  -
    Yellowbelly pufferfish  =
B D                    Fugu  =
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  =
  D  White-throated sparrow  =
B D               Zebrafish  =
B D           X. tropicalis  =
  D         Green seaturtle  =
B D      American alligator  =
B D              Budgerigar  =
    Lesser Egyptian jerboa  =
  D             Rock pigeon  =
  D     Collared flycatcher  =
B D     Medium ground finch  =
B D                  Lizard  -
  D        Peregrine falcon  -
  D            Saker falcon  =
B D                Platypus  =
B D                 Wallaby  =
B D                  Tenrec  -

Inserts between block 4 and 5 in window
B D                  Sheep 318bp

Alignment block 5 of 977 in window, 6775961 - 6775961, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D                Squirrel  g
B D          Naked mole-rat  g
B D              Guinea pig  g
                 Chinchilla  g
           Brush-tailed rat  g
B D                  Rabbit  g
B D                    Pika  g
B D                     Pig  a
B D                  Alpaca  a
             Bactrian camel  a
B D                 Dolphin  a
               Killer whale  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                 Ferret   g
B D                   Panda  g
             Pacific walrus  g
               Weddell seal  g
           Black flying-fox  g
B D                 Megabat  g
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                Hedgehog  a
B D                   Shrew  g
            Star-nosed mole  g
B D                Elephant  g
        Cape elephant shrew  a
B D                 Manatee  g
           Cape golden mole  g
                   Aardvark  g
B D               Armadillo  t
B D                 Opossum  g
B D         Tasmanian devil  g
            Golden hamster  -
B D             Stickleback  -
    Yellowbelly pufferfish  =
B D                    Fugu  =
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  =
  D  White-throated sparrow  =
B D               Zebrafish  =
B D           X. tropicalis  =
  D         Green seaturtle  =
B D      American alligator  =
B D              Budgerigar  =
    Lesser Egyptian jerboa  =
  D             Rock pigeon  =
  D     Collared flycatcher  =
B D     Medium ground finch  =
B D                  Lizard  -
  D        Peregrine falcon  -
  D            Saker falcon  =
B D                Platypus  =
B D                 Wallaby  =
B D         Chinese hamster  -
              Prairie vole  -
B D                  Tenrec  -
B D                     Rat  -
B D                   Mouse  -

Inserts between block 5 and 6 in window
B D                    Cow 319bp
             Domestic goat 316bp

Alignment block 6 of 977 in window, 6775962 - 6775965, 4 bps 
B D                   Human  gtca
B D                   Chimp  gtca
B D                 Gorilla  gtca
B D               Orangutan  gtca
B D                  Gibbon  gtca
B D                  Rhesus  gtca
B D     Crab-eating macaque  gtca
B D                  Baboon  gtca
B D            Green monkey  gtca
B D                Marmoset  gtca
B D         Squirrel monkey  gtca
B D                Bushbaby  atca
         Chinese tree shrew  gtca
B D                Squirrel  gtca
               Prairie vole  gtca
B D         Chinese hamster  gtca
             Golden hamster  gtca
B D                   Mouse  gtca
B D                     Rat  gaca
B D          Naked mole-rat  gata
B D              Guinea pig  gtca
                 Chinchilla  gtca
           Brush-tailed rat  gtca
B D                  Rabbit  gtca
B D                    Pika  gtca
B D                     Pig  gtca
B D                  Alpaca  gtcg
             Bactrian camel  gtca
B D                 Dolphin  gtca
               Killer whale  gtca
           Tibetan antelope  gtca
B D                     Cow  gtca
B D                   Sheep  gtca
              Domestic goat  gtca
B D                   Horse  gtcc
B D        White rhinoceros  gtca
B D                     Cat  gtca
B D                     Dog  gtca
B D                 Ferret   gtca
B D                   Panda  gtca
             Pacific walrus  gtca
               Weddell seal  gtca
           Black flying-fox  gtca
B D                 Megabat  gtca
              Big brown bat  gcca
       David's myotis (bat)  gtca
B D                Microbat  gtca
B D                Hedgehog  gtca
B D                   Shrew  gtca
            Star-nosed mole  gtca
B D                Elephant  gtta
        Cape elephant shrew  gtta
B D                 Manatee  gtta
           Cape golden mole  gtta
B D                  Tenrec  ---a
                   Aardvark  gtta
B D               Armadillo  gtca
B D                 Opossum  atca
B D         Tasmanian devil  atca
B D             Stickleback  ----
    Yellowbelly pufferfish  ====
B D                    Fugu  ====
B D                  Turkey  ====
B D                 Chicken  ====
  D            Mallard duck  ====
        Tibetan ground jay  ====
B D             Zebra finch  ====
  D  White-throated sparrow  ====
B D               Zebrafish  ====
B D           X. tropicalis  ====
  D         Green seaturtle  ====
B D      American alligator  ====
B D              Budgerigar  ====
    Lesser Egyptian jerboa  ====
  D             Rock pigeon  ====
  D     Collared flycatcher  ====
B D     Medium ground finch  ====
B D                  Lizard  ----
  D        Peregrine falcon  ----
  D            Saker falcon  ====
B D                Platypus  ====
B D                 Wallaby  ====

Inserts between block 6 and 7 in window
B D                Opossum 22bp
B D        Tasmanian devil 1664bp

Alignment block 7 of 977 in window, 6775966 - 6776061, 96 bps 
B D                   Human  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                   Chimp  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                 Gorilla  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D               Orangutan  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                  Gibbon  gcaa----a-tatttactgagcaagg-----------ctt------------------------------
B D                  Rhesus  gcaa----a-tatttactgagtaagg-----------gtt------------------------------
B D     Crab-eating macaque  gcaa----a-tacttactgagtaagg-----------gtt------------------------------
B D                  Baboon  gcaa----a-tatttactgagtaagg-----------gtt------------------------------
B D            Green monkey  gcaa----a-tatttactgagtaagg-----------gtt------------------------------
B D                Marmoset  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D         Squirrel monkey  gcaa----a-tatttactgagcgagg-----------gtt------------------------------
B D                Bushbaby  gcaa----a-tatttacagagcaagg-----------gtt------------------------------
         Chinese tree shrew  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                Squirrel  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
               Prairie vole  gcaa----a-tattt-----gttagg-----------gtt------------------------------
B D         Chinese hamster  gtaa----a-tattt-----gtaagg-----------gtt------------------------------
             Golden hamster  gtaa----a-tattt-----gtaagg-----------gtt------------------------------
B D                   Mouse  g---------tatttagtgaataaggtttttgtttttgtt------------------------------
B D                     Rat  gcaa----attatttagtgaataagg-----------att------------------------------
B D          Naked mole-rat  gcaa----a-tatttactgagcaaga-----------gtt------------------------------
B D              Guinea pig  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
                 Chinchilla  gcaa----a-tatttactgaacaagg-----------gtt------------------------------
           Brush-tailed rat  gtaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                  Rabbit  gcaa----a-tatttactgagcgagg-----------gtt------------------------------
B D                    Pika  gcat----a-tgttt--taagccaga-----------gtt------------------------------
B D                     Pig  gcaa----c-tgtttactgaacgagg-----------gct------------------------------
B D                  Alpaca  gcaa----a-tatttaccgagtgagg-----------act------------------------------
             Bactrian camel  gcaa----a-tatctaccgagtgagg-----------gct------------------------------
B D                 Dolphin  gcaa----a-tatttactgagcgagg-----------gct------------------------------
               Killer whale  gcaa----a-tatttactgagcgagg-----------gct------------------------------
           Tibetan antelope  gcaa----a-tatttactgaacaagg-----------gct------------------------------
B D                     Cow  gcaa----a-tatttactgaacaagg-----------gct------------------------------
B D                   Sheep  gcaa----a-tatttactgaacgagg-----------gct------------------------------
              Domestic goat  gcaa----a-tatttactgaatgagg-----------gcg------------------------------
B D                   Horse  gcaa----a-tatttactgagcaagg-----------gct------------------------------
B D        White rhinoceros  gcaa----a-tatttactgagcaagg-----------gct------------------------------
B D                     Cat  gcaa----a-tatttactgagcaagg-----------gct-----------------------------t
B D                     Dog  gcaa----a-tatttactgagcgaga-----------gctttttt------------------------t
B D                 Ferret   gcaa----a-tatttacagagcaagg-----------gctttttttttcctttctttttctttttctttt
B D                   Panda  gcaa----a-tatttactgagcaagg--------------gcttt------------------------t
             Pacific walrus  gcaa----a-tatttactgagcgagg-----------actgtttt------------------------t
               Weddell seal  gcaa----a-tatttactgagcaagg-----------actgtttttt-------------------tggt
           Black flying-fox  gcaa----a-tatttactgagcgtgg-----------gat------------------------------
B D                 Megabat  gcaa----a-tatttactgagcgtgg-----------gat------------------------------
              Big brown bat  gcaa----a-tatttactgatcatgg-----------gct------------------------------
       David's myotis (bat)  gcaa----a-tatttactgatcatgg-----------gct------------------------------
B D                Microbat  gcaa----g-tatttactgatcatgg-----------gct------------------------------
B D                Hedgehog  gcaaagtca-gctttacttagcaagg-----------gct------------------------------
B D                   Shrew  gcaa----a-tatttactgagcaaag-----------act------------------------------
            Star-nosed mole  gcaa----a-tatttactaagcaagg-----------gtt------------------------------
B D                Elephant  gcaa----a-tatttactgaacaaag-----------gcc------------------------------
        Cape elephant shrew  gcaa----a-tatttactgagcaaag-----------gcc------------------------------
B D                 Manatee  gcaa----a-tatttactgaacaaag-----------gcc------------------------------
           Cape golden mole  gcaa----a-tatttactgagcaaag-----------gcc------------------------------
B D                  Tenrec  gcaa----a-tatttactgagcaaag-----------ggc------------------------------
                   Aardvark  gcaa----a-tatttactgagcaaag-----------gcc------------------------------
B D               Armadillo  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                 Opossum  acaa----g-tatttat-------gg-----------gct------------------------------
B D             Stickleback  ----------------------------------------------------------------------
    Yellowbelly pufferfish  ======================================================================
B D                    Fugu  ======================================================================
B D                  Turkey  ======================================================================
B D                 Chicken  ======================================================================
  D            Mallard duck  ======================================================================
        Tibetan ground jay  ======================================================================
B D             Zebra finch  ======================================================================
  D  White-throated sparrow  ======================================================================
B D         Tasmanian devil  ======================================================================
B D               Zebrafish  ======================================================================
B D           X. tropicalis  ======================================================================
  D         Green seaturtle  ======================================================================
B D      American alligator  ======================================================================
B D              Budgerigar  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
  D             Rock pigeon  ======================================================================
  D     Collared flycatcher  ======================================================================
B D     Medium ground finch  ======================================================================
B D                  Lizard  ----------------------------------------------------------------------
  D        Peregrine falcon  ----------------------------------------------------------------------
  D            Saker falcon  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================

                      Human  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
                      Chimp  -------ttccaagacggta-ta----aaacaaacaca---g------a-------------aaaaa---
                    Gorilla  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
                  Orangutan  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
                     Gibbon  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
                     Rhesus  -------ttccaagacggta-ta----aaacaaacaca---g------a-------------aaaaa---
        Crab-eating macaque  -------ttccaagatggta-ta----aaacaaacaca---g------a-------------aaaaa---
                     Baboon  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
               Green monkey  -------ttccaagacggta-ta----aaacaaacaca---g------a-------------aaaaa---
                   Marmoset  -------ttccaagacagta-ca----aaacaaacaaa---g------a-------------aaaaa---
            Squirrel monkey  -------ttccaagacagta-ca----aaacaaataaa---g------a-------------aaaaa---
                   Bushbaby  -------ttccaagacagta-ta----aaacaaacaga---a------a-------------aaaag---
         Chinese tree shrew  -------ctccaagacagtg-ta----acacaaacaca---c------acacacacaccaacacaca---
                   Squirrel  ----t--ttttaagacagta-ta----aaacaaacata---gaa----a-------------aaaag---
               Prairie vole  -------ttccaagagaata-ta----aaacaaaaaca---ggc---ca-------------aaaaa---
            Chinese hamster  -------ttccaagacaata-taa---aaacaaaaaca---ggcaaaaa-------------aaaaa---
             Golden hamster  -------ttccaagacaat--------aaacaaaaaca---ggc----g-------------aaaaa---
                      Mouse  ----ttattttaaggcaaaa-ta----aaacaaataga---ggcaaaac-------------caaaacca
                        Rat  ----ttttttaaagacagca-ta----aaacaaataca---ggcaaaaa-------------caaaaaca
             Naked mole-rat  -------ttccaagacaata-ga----aaacagacaca---g------a-------------aaa-----
                 Guinea pig  -------ttcgaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
                 Chinchilla  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
           Brush-tailed rat  -------ttccaagacagta-ta----aaacaaacaga----------a-------------aaaaa---
                     Rabbit  -------ttccaagacagta-taaagcaaacagaaaaa----------a-------------aaaaa---
                       Pika  -------ttccaagacagta-aaag--aaaaaaacaca----------g-------------aaaaa---
                        Pig  -------tttcaagacagtg-ta----aaaccaacaca---g------a-------------agaaa---
                     Alpaca  -------tttcaagacagtctta----aaacaagcaca---g------g-------------aaaa----
             Bactrian camel  -------tttcaagacagtc-ta----aaacaagcaca---g------a-------------aaaaa---
                    Dolphin  -------tttcaagacagta-ta----aaacaaacata---g------a-------------agaaa---
               Killer whale  -------tttcaagacagta-ta----aaacaaacata---g------a-------------agaaa---
           Tibetan antelope  -------tttcaagacagtg-ta----aaagaaacata---g------g-------------agaaa---
                        Cow  -------tttcaagacagtg-ta----aaagaaacata---g------g-------------agaaa---
                      Sheep  -------tttcaagacaatg-ta----aaagaaacata---g------g-------------agaaa---
              Domestic goat  -------tttcaagacagtg-ta----gaagaaacata---g------g-------------agaaa---
                      Horse  -------tttcaagacaata-ta----aaacaaacaca---g-----------------------aa---
           White rhinoceros  -------tttcaagacaata-tg----aaacaaacaga---g------a-------------aaaaa---
                        Cat  tttttttttttaagacagta-ta----aaacaaacaca---g------g-------------aagaa---
                        Dog  tttttttttt---aatagtg-ta----aaacaaacaca---g------a-------------aaaaa---
                    Ferret   tttttttttttaagagagta-ta----acgtaaacaca---g------g-------------aaaaa---
                      Panda  tttttttttttaagagagta-ta----aaacaaacaca---g------a-------------aaaaa---
             Pacific walrus  tttttttttttaagagagta-ta----aaacaaacaca---g------a-------------aaaaa---
               Weddell seal  tttttttttttaagagagta-ta----aaacaaacaca---g------a-------------aaaaa---
           Black flying-fox  -------tttcaagaccatg-ta----aaacaaacacacatt------t-------------aaaaa---
                    Megabat  -------tttcaagaccatg-ta----aaacaaacacaca-t------t-------------aaaaa---
              Big brown bat  -------tttcaagacagtg-ta----aaacaaacaca---t------t-------------taaaa---
       David's myotis (bat)  -------tttcaagacagtg-ta----aaacaaacaca---t------t-------------aaaaa---
                   Microbat  -------tttcaagacagtg-ta----aaacaaacaca---t------t-------------aaaaa---
                   Hedgehog  -------taccaagacagca-tc----cagcaagcacc---t------a-------------tacaa---
                      Shrew  -------ttctcagacagta-ga----aaacaaacccc---a------g-------------cctcc---
            Star-nosed mole  -------ttccaagacagca-ta----aagcaaacgca---a------a-------------cacaa---
                   Elephant  -------ttccaagacagta-ta----aaacaaataga---a------a-------------aaaaa---
        Cape elephant shrew  -------ttcc-agacagta-ta----aaacaaacacg---g------g-------------gagaa---
                    Manatee  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
           Cape golden mole  -------tttcaagacagta-ta----aaacaaacaga---a------a-------------aag-----
                     Tenrec  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaca---
                   Aardvark  -------ttccaagacagtt-ta----aaacaaacaca---g------g-------------aaaaa---
                  Armadillo  -------ttccaggacagta-ta----aaacagacata---g------a-------------agaaa---
                    Opossum  -----agctttgggggaata-tt----aattaataaaa---a------g-------------gggaa---
                Stickleback  ----------------------------------------------------------------------
     Yellowbelly pufferfish  ======================================================================
                       Fugu  ======================================================================
                     Turkey  ======================================================================
                    Chicken  ======================================================================
               Mallard duck  ======================================================================
         Tibetan ground jay  ======================================================================
                Zebra finch  ======================================================================
     White-throated sparrow  ======================================================================
            Tasmanian devil  ======================================================================
                  Zebrafish  ======================================================================
              X. tropicalis  ======================================================================
            Green seaturtle  ======================================================================
         American alligator  ======================================================================
                 Budgerigar  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                Rock pigeon  ======================================================================
        Collared flycatcher  ======================================================================
        Medium ground finch  ======================================================================
                     Lizard  ----------------------------------------------------------------------
           Peregrine falcon  ----------------------------------------------------------------------
               Saker falcon  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================

                      Human  ---------------gaat---------------------------------actc---a---gagagta
                      Chimp  ---------------gaat---------------------------------actc---a---gagagta
                    Gorilla  ---------------gaat---------------------------------actc---a---gagagta
                  Orangutan  ---------------gaat---------------------------------actc---a---gagagta
                     Gibbon  ---------------gaat---------------------------------actc---a---gagagta
                     Rhesus  ---------------taat---------------------------------actc---a---gagagta
        Crab-eating macaque  ---------------taat---------------------------------actc---a---gagagta
                     Baboon  ---------------taat---------------------------------actc---a---gagagta
               Green monkey  ---------------taat---------------------------------actc---a---gagagta
                   Marmoset  ---------------gaat---------------------------------actc---a---gaaagta
            Squirrel monkey  ---------------gaat---------------------------------actc---a---gaaagta
                   Bushbaby  ---------------g--------------------------------------tc---a---gaaagta
         Chinese tree shrew  ---------------aaaa---------------------------------accc---a---gaaagtc
                   Squirrel  ---------------cat------------------------------------tc---a---aaaaata
               Prairie vole  ---------------aaa------------------------------------tc---a---gaaagta
            Chinese hamster  ---------------aaa------------------------------------tc---a---gaaagta
             Golden hamster  ---------------taa------------------------------------tc---a---gaaagta
                      Mouse  aaccaaaacaaccccaaa------------------------------------tc---a---gaaagta
                        Rat  aaacaaaacaaccccaaa------------------------------------tc---a---gaaagta
             Naked mole-rat  -----------------------------------------------------------ac-ttaaagtg
                 Guinea pig  ---------------aaa------------------------------------tt---ac-tcaaagtg
                 Chinchilla  ---------------aaa------------------------------------tt---ac-tcaaagtg
           Brush-tailed rat  ---------------aaa------------------------------------tt---ac-tcaaagtg
                     Rabbit  ---------------aaa------------------------------------tc---tcagaaaaaca
                       Pika  ---------------aaa------------------------------------tt---atatataaaag
                        Pig  ---------------aaaaccccaag-----------------------cgccctt---a---gaaagca
                     Alpaca  --------------------------------------------------aaactc---a---gaaagta
             Bactrian camel  ---------------a-ac----aaa-----------------------caaactc---a---gaaagta
                    Dolphin  ---------------aaac---taaa-----------------------caaactc---g---gaaggta
               Killer whale  ---------------aaac---taaa-----------------------caaactc---a---gaaggta
           Tibetan antelope  ---------------acac------------------------------cagactc---a---gaaagta
                        Cow  ---------------acac------------------------------cagactc---a---gaaagta
                      Sheep  ---------------acac------------------------------cagactc---a---gaaagta
              Domestic goat  ---------------acac------------------------------cagactc---a---gaaagta
                      Horse  ---------------aaaa---aacc---------------------------ctc---a---gaaagga
           White rhinoceros  ---------------aaaa---aacc---------------------------ctc---a---gaaagta
                        Cat  ---------------aaaa---aa-----------------aaaccctcaaaactc---a---gaa-gta
                        Dog  ---------------aaaa---ga-------------gaacaaccaccaaaaactc---a---gaaagta
                    Ferret   ---------------aaaa---caaaa-caaaa----caacaaaacccaaaaactt---a---gaaagta
                      Panda  ---------------aaaa---aaca--cacca----caacaaaactcaaaaactc---a---gaaagtg
             Pacific walrus  ---------------aaaa---aaccaccaccaccaccaacaaaaagccaaaactc---a---gaaggtg
               Weddell seal  ----------------------------caacaacaacaacaaaaagccaaaactc---a---gaaagcg
           Black flying-fox  ---------------aaaa---aaaa----------------------aaaaccttcaga---aaa----
                    Megabat  ---------------aaaa---aaaa----------------------aaaaccttcaga---aaa----
              Big brown bat  ---------------aaac---acac----------------------aaaacctc---a---aaa----
       David's myotis (bat)  ---------------aaa----acac-----------------------acacctc---a---aaa----
                   Microbat  ---------------aaac---aaaa-----------------------ccacctc---a---aaa----
                   Hedgehog  ---------------gcaa---acaa-----------------------tacccgc---a---caaaata
                      Shrew  ---------------ctg----------------------------------tccc---c---aggggcc
            Star-nosed mole  ---------------acaa---aaaa------------------------attctc---a---ggaagta
                   Elephant  ---------------aa--------------------------------aatactc---a---gaaagtg
        Cape elephant shrew  ---------------aa--------------------------------tattc----------aaagtg
                    Manatee  ---------------aa--------------------------------tactc-----a---gaaagta
           Cape golden mole  -----------------------------------------------------------a---gaaaata
                     Tenrec  ---------------ca--------------------------------cactc-----a---gaaacga
                   Aardvark  ---------------aa--------------------------------aatactc---a---gaaagta
                  Armadillo  ---------------aaaa---------aaaagtgacaaaaaaacacagaacactc---a---caaagca
                    Opossum  ---------------aaac---------------------------------acta---g---gagtgct
                Stickleback  ----------------------------------------------------------------------
     Yellowbelly pufferfish  ======================================================================
                       Fugu  ======================================================================
                     Turkey  ======================================================================
                    Chicken  ======================================================================
               Mallard duck  ======================================================================
         Tibetan ground jay  ======================================================================
                Zebra finch  ======================================================================
     White-throated sparrow  ======================================================================
            Tasmanian devil  ======================================================================
                  Zebrafish  ======================================================================
              X. tropicalis  ======================================================================
            Green seaturtle  ======================================================================
         American alligator  ======================================================================
                 Budgerigar  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                Rock pigeon  ======================================================================
        Collared flycatcher  ======================================================================
        Medium ground finch  ======================================================================
                     Lizard  ----------------------------------------------------------------------
           Peregrine falcon  ----------------------------------------------------------------------
               Saker falcon  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================

                      Human  tg-tgttgactgg-ttga-------t---------aactat
                      Chimp  tg-tgttgactgg-ttga-------t---------aactat
                    Gorilla  tg-tgttgactgc-ttga-------t---------aactat
                  Orangutan  tg-tgttgactgg-ttga-------t---------aactat
                     Gibbon  tg-tgttgactgg-ttga-------t---------aactat
                     Rhesus  tg-tgttgactgg-ttga-------t---------aactat
        Crab-eating macaque  tg-tgttgactgg-ttga-------t---------aactat
                     Baboon  tg-tgttgactgg-ttga-------t---------aactat
               Green monkey  tg-tgttgactgg-ttga-------t---------aactat
                   Marmoset  tg-tgttcactgg-ttga-------t---------aactat
            Squirrel monkey  tg-tgttcagtgg-ttga-------t---------aactct
                   Bushbaby  tg-tattaactga-ttgg-------t---------aactat
         Chinese tree shrew  tg-tgtcaattga-ctg--------t---------gacggt
                   Squirrel  tg---ttaattga-ttgg-------t---------agctat
               Prairie vole  cg-tgttcaatga-ttgg-------c---------agctac
            Chinese hamster  tg-tgttcattga-ttgg-------t---------agctgt
             Golden hamster  tg-tgttcattga-ttgg-------t---------aactgt
                      Mouse  tg-tgttcattga-ttgg-------c---------agctgt
                        Rat  cgccaatcaatga-gtgg-------c---------agctgt
             Naked mole-rat  tg-tgttcattga-ttgg-------t---------gattat
                 Guinea pig  tg-tgttcattga-tcag-------t---------gattat
                 Chinchilla  tg-tgttcattga-ttgg-------t---------gattat
           Brush-tailed rat  tg-tgtgcattga-tggg-------t---------gattat
                     Rabbit  tg-tgttcgttga-ctgg-------t---------cattgt
                       Pika  ta-tgtttcctgc-ctgg-------g---------agttat
                        Pig  tg-tgttgattga-tcag-------a---------gactgt
                     Alpaca  tg-tgctgattga-tcag-------t---------aactat
             Bactrian camel  tg-tgctgattga-tcgg-------t---------aactac
                    Dolphin  tg-tgttgattga-tcgg-------t---------aactat
               Killer whale  tg-tgttgattga-tcgg-------t---------aactat
           Tibetan antelope  tg-tgttgattga-tcgg-------t---------aactat
                        Cow  tg-tgttgattga-ctgg-------t---------aactat
                      Sheep  tg-tgttgattga-tcgg-------t---------aactat
              Domestic goat  tg-tgttgattga-tcgg-------t---------aactat
                      Horse  ca-tgttgattga-ttgg-------t---------aactat
           White rhinoceros  ca-tgttgattga-ttgg-------t---------aactat
                        Cat  tg-tgttgattga-ttgg-------t---------aactat
                        Dog  ca-tgttgattga-ttgg-------t---------aactat
                    Ferret   tg-tgttgatgga-ttag-------t---------aactat
                      Panda  tg-tgttgatgga-ttgg-------t---------a-----
             Pacific walrus  tg-tgttgatgga-ttgg-------t---------aactag
               Weddell seal  tg-tgttgatgga-ttgg-------t---------aactag
           Black flying-fox  tg-ttttcattga-ttgg-------t---------aactat
                    Megabat  tg-ttttcattga-ttgg-------t---------aactat
              Big brown bat  tg-tgtcgattga-ttgg-------ttattcagtcaatgac
       David's myotis (bat)  tg-tgttgattga-ttgg-------ttattcaatcaattac
                   Microbat  ta-tgttgattga-ttag-------ttattcaatcaattac
                   Hedgehog  tg-tctgtgttca-taggcaaccccc---------agcccc
                      Shrew  cg-cgtgcgttta-ttgg-------t---------cgctgt
            Star-nosed mole  tg-tgtgtatgga-ttgg-------t---------aacggt
                   Elephant  tg-tgttgatgga-ttgg-------t---------aactat
        Cape elephant shrew  tg-tgttgattga-ctga-------t---------aactat
                    Manatee  tg-tgtggattga-ttgg-------t---------aactat
           Cape golden mole  tg-tattgattga-ttgg-------t---------aactat
                     Tenrec  tg-tgctgactgc-ttgg-------t---------aactat
                   Aardvark  tg-tgtagaatga-ttgg-------t---------aactgt
                  Armadillo  tg-tgggaattgatttgg-------t---------agc---
                    Opossum  ta-aatttttcct-ttgt-------t---------aaatat
                Stickleback  -----------------------------------------
     Yellowbelly pufferfish  =========================================
                       Fugu  =========================================
                     Turkey  =========================================
                    Chicken  =========================================
               Mallard duck  =========================================
         Tibetan ground jay  =========================================
                Zebra finch  =========================================
     White-throated sparrow  =========================================
            Tasmanian devil  =========================================
                  Zebrafish  =========================================
              X. tropicalis  =========================================
            Green seaturtle  =========================================
         American alligator  =========================================
                 Budgerigar  =========================================
     Lesser Egyptian jerboa  =========================================
                Rock pigeon  =========================================
        Collared flycatcher  =========================================
        Medium ground finch  =========================================
                     Lizard  -----------------------------------------
           Peregrine falcon  -----------------------------------------
               Saker falcon  =========================================
                   Platypus  =========================================
                    Wallaby  =========================================

Inserts between block 7 and 8 in window
B D                Opossum 1621bp

Alignment block 8 of 977 in window, 6776062 - 6776121, 60 bps 
B D                   Human  cggccatgac--agattagccatgt-ctgcag---cacgcacctgcggcc-----------act------
B D                   Chimp  cagccatgac--agattagccatat-ctgcag---cacgcacctgcggcc-----------act------
B D                 Gorilla  cagccatgac--agattagccatgt-ctgcag---cacgcacctgcggcc-----------act------
B D               Orangutan  cagccatgac--agattagccatgt-ctgtag---cactcacctgcggcc-----------act------
B D                  Gibbon  cagccatgac--agattagccatgt-ctgcag---cactcacctgcggcc-----------act------
B D                  Rhesus  cagccatgac--agatta-ctatgt-ctgcag---cactcacctgcggtc-----------act------
B D     Crab-eating macaque  cagccatgac--agatta-ctatgt-ctgcag---cactcacctgcggtc-----------act------
B D                  Baboon  cagccatgac--agatta-ctatgt-ctgcag---cactcacctgcggtc-----------act------
B D            Green monkey  cagccatgac--agatta-ctatgt-ctgcag---cactcacctgcggtc-----------act------
B D                Marmoset  cagccatgac--aggttagcctcgt-ctgcag---cactcatctccggcc-----------act------
B D         Squirrel monkey  cagccgcgac--gggttagcctcgt-ctgcag---cactcaccttcagcc-----------act------
B D                Bushbaby  cagccatgac--agattagtcatgt-ctgctg---cactcatttgcggcc-----------act------
         Chinese tree shrew  cagttatgac--agattagctacgt-ctgcag---tacttacctataacc-----------act------
B D                Squirrel  cagccatgac--attttagcaacat-ctgcag---tagttacctgtcacctgttactgtttagt------
               Prairie vole  cagccacgat---gattagctgtgt-ctgcag---tggtcacctgtggcc-----------atc------
B D         Chinese hamster  gagccatgat---aattagctgtgt-cggcgg---tattcacctgtggcc-----------aat------
             Golden hamster  cagccatgat---aattagctgtgt-ctgcag---tattcactggtggcc-----------att------
B D                   Mouse  cagctgtgac--agatcagctacat-ctatgg--ttatttattttcggct-----------att------
B D                     Rat  cggctgtgacaaagatcagctacat-ttgcag--gtattttccttcggcc-----------att------
B D          Naked mole-rat  cagccgggac--aggttagctacgc-c--tcg---ggttcacctgaggcc-----------act------
B D              Guinea pig  cagtcatgac--agtttaactacat-tggcag---tgttcccctgaggtc-----------act------
                 Chinchilla  tagccatgac--aggttagctacat-cggcag---tgttccc--gagacc-----------act------
           Brush-tailed rat  tagccataac--aggttagctacgt-gggcag---tattcccctgaggtc-----------act------
B D                  Rabbit  cagcgatgac--agattaaccatgt-ctgctg---tgtttacctgtggcc-----------act------
B D                    Pika  cagctgtttc--agattagctggat-ctgcca---tgtttactcctggcc-----------act------
B D                     Pig  ca-------c--agcactgccgtgt-ctgc-----tggccatccatgacc-----------act------
B D                  Alpaca  ca-------c--agcttggctgcca-ctgcag---tgctcgcctgtgggc-----------act------
             Bactrian camel  ca-------c--agcttggctgcca-ctgcag---tgctcgcctgtggcc-----------act------
B D                 Dolphin  ca-------c--cgcttggttgtgt-ctgccg---tactcacctac-gcc-----------act------
               Killer whale  ca-------c--tgcttggttgtgt-ctgccg---tactcacctat-gcc-----------act------
           Tibetan antelope  ca-------c--agcttgtccgagt-ctgcag---tgctcatctataggc-----------act------
B D                     Cow  ca-------c--agcttgtccgtgt-ctgcag---tgctcatctgtggcc-----------act------
B D                   Sheep  ca-------c--aacttgtccgagt-ctgcag---tgctcatctatagcc-----------act------
              Domestic goat  ca-------c--agcttgtccgagt-ctgcag---tgctcatctatagcc-----------act------
B D                   Horse  cagccagggc--accttggctgtgt-ctgcag---tgctcacctgtgg-c-----------tct------
B D        White rhinoceros  cagccaggac--accttggctgtgt-ctgcgg---tactcacctgtgg-c-----------act------
B D                     Cat  gagccacaga--agcttggctgtgtcctgccg---tactcacctgtggcc-----------gct------
B D                     Dog  gagccacgac--agctcagctgtgc-ctgtaa---cactcacct--agca-----------act------
B D                 Ferret   gagccacgac--agctgggctgta---tgttg---tgttcacctgtggtc-----------act------
B D                   Panda  -agccacgac--agcttggctgtgt-ctgtaa---cactcacctgtggtc-----------act------
             Pacific walrus  gagccacaac--agcccagctgtgt-ctgtag---tattcacctggggtc-----------act------
               Weddell seal  gagccacaac--agctcagctatgt-ctgtag---tattcacctggggtc-----------act------
           Black flying-fox  cagc-atgac--aggttggctatgt-ctgcag---tactcacctgtggcc-----------act------
B D                 Megabat  cagc-atgac--aggttggctatgt-ctgcag---tactcacctgtggcc-----------act------
              Big brown bat  caatggtggc--tacctaactgtgt-ctgcag---tactaatctgtggcc-----------act------
       David's myotis (bat)  cagtggtggt--tacttgactgtgt-ctgcag---tactgacctgtggaa-----------act------
B D                Microbat  cagtggtggt--tacttgactgtgt-ctgcag---tactaacctgtggaa-----------act------
B D                Hedgehog  cagccagggc--aaattggttgtgt-ctgcag---tgctcactcatggtc-----------gct------
B D                   Shrew  gggccacagc--ta-------gtga-cc-cag---cgtccacct---gtc-----------cct------
            Star-nosed mole  tagccatgac--cgtttgg-tgtgt-ctacag---gactcacct---gtg-----------gct------
B D                Elephant  tagccatgac--agcttggctatgt-ctggag---tcctcacctg-ggcc-----------act------
        Cape elephant shrew  tggccatgac--agcctggttgtat-ttgtggtcttcttcacctgtggcc-----------act------
B D                 Manatee  cagccatgac--agcttggctatgt-ctgcgg---tcctcatctc-ggcc-----------act------
           Cape golden mole  tagccacaat--agcttgactatgt-ctgcag---tctttacctgtggtc-----------att------
B D                  Tenrec  tagccttgac--agcttggcgatgc-ctgcag---tctttacctgtggct-----------gctgagtag
                   Aardvark  tagccatgac--agcttggctaagt-ctgcag---tcttcacctgtgggc-----------act------
B D               Armadillo  -agccat-ac--agcttgactgcac-ctgcag---tcct-------------------------------
B D             Stickleback  ----------------------------------------------------------------------
    Yellowbelly pufferfish  ======================================================================
B D                    Fugu  ======================================================================
B D                  Turkey  ======================================================================
B D                 Chicken  ======================================================================
  D            Mallard duck  ======================================================================
        Tibetan ground jay  ======================================================================
B D             Zebra finch  ======================================================================
  D  White-throated sparrow  ======================================================================
B D         Tasmanian devil  ======================================================================
B D               Zebrafish  ======================================================================
B D           X. tropicalis  ======================================================================
  D         Green seaturtle  ======================================================================
B D      American alligator  ======================================================================
B D              Budgerigar  ======================================================================
B D                 Opossum  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
  D             Rock pigeon  ======================================================================
  D     Collared flycatcher  ======================================================================
B D     Medium ground finch  ======================================================================
B D                  Lizard  ----------------------------------------------------------------------
  D        Peregrine falcon  ----------------------------------------------------------------------
  D            Saker falcon  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================

                      Human  cagtagtagcacc
                      Chimp  cagtagtagcacc
                    Gorilla  cagtagtagcacc
                  Orangutan  aagtagtagcacc
                     Gibbon  aagtagtagcacc
                     Rhesus  aagtagtagcacc
        Crab-eating macaque  aagtagtagcacc
                     Baboon  aagtagtagcacc
               Green monkey  aagtagtagcacc
                   Marmoset  aagtagtagcacc
            Squirrel monkey  aagtagtagcacc
                   Bushbaby  gaatagtaacacc
         Chinese tree shrew  aaat-gtagcacc
                   Squirrel  aata-gtagcacc
               Prairie vole  ag---------cc
            Chinese hamster  aa---------cc
             Golden hamster  aa---------cc
                      Mouse  aa---gcagcacc
                        Rat  aa---gtagcgcc
             Naked mole-rat  gaacaggagcatc
                 Guinea pig  gaacagtagcatc
                 Chinchilla  gaac-atagcatc
           Brush-tailed rat  gaa--atagcatc
                     Rabbit  gaatagtagcgcc
                       Pika  aactagtaactcc
                        Pig  aaatagtggcgcc
                     Alpaca  aaatggtagcact
             Bactrian camel  aaatggtagcact
                    Dolphin  aaatagctcc---
               Killer whale  aaatagctcc---
           Tibetan antelope  aaatagtagtgcc
                        Cow  aaatggtagtgcc
                      Sheep  aaatagtagtgcc
              Domestic goat  aaatagtagtgcc
                      Horse  aaatagtagcacc
           White rhinoceros  aaatagtagcctt
                        Cat  aaatagtggtacc
                        Dog  aaacagtagcatc
                    Ferret   gaaccgtaacatc
                      Panda  aaacagtagcacc
             Pacific walrus  aaagagtagcacc
               Weddell seal  aaacagtagcacc
           Black flying-fox  gcatagtagcacc
                    Megabat  gcatagtagcacc
              Big brown bat  aaatagtagcacc
       David's myotis (bat)  aaataatagcacc
                   Microbat  aaataatagcacc
                   Hedgehog  caataacagtagt
                      Shrew  cagccgccactac
            Star-nosed mole  gataagtagcagc
                   Elephant  aaatagtagtacc
        Cape elephant shrew  aaatagt------
                    Manatee  aaatagtagtatc
           Cape golden mole  aaatagc------
                     Tenrec  gaacagc------
                   Aardvark  aaatagtagcagc
                  Armadillo  aaatagtaggacc
                Stickleback  -------------
     Yellowbelly pufferfish  =============
                       Fugu  =============
                     Turkey  =============
                    Chicken  =============
               Mallard duck  =============
         Tibetan ground jay  =============
                Zebra finch  =============
     White-throated sparrow  =============
            Tasmanian devil  =============
                  Zebrafish  =============
              X. tropicalis  =============
            Green seaturtle  =============
         American alligator  =============
                 Budgerigar  =============
                    Opossum  =============
     Lesser Egyptian jerboa  =============
                Rock pigeon  =============
        Collared flycatcher  =============
        Medium ground finch  =============
                     Lizard  -------------
           Peregrine falcon  -------------
               Saker falcon  =============
                   Platypus  =============
                    Wallaby  =============

Inserts between block 8 and 9 in window
          Tibetan antelope 213bp
B D                  Sheep 213bp
B D               Elephant 52bp
       Cape elephant shrew 54bp
B D                Manatee 185bp

Alignment block 9 of 977 in window, 6776122 - 6776124, 3 bps 
B D                   Human  cca
B D                   Chimp  cca
B D                 Gorilla  cca
B D               Orangutan  cca
B D                  Gibbon  cca
B D                  Rhesus  cca
B D     Crab-eating macaque  cca
B D                  Baboon  cca
B D            Green monkey  cca
B D                Marmoset  cca
B D         Squirrel monkey  tca
B D                Bushbaby  aca
         Chinese tree shrew  aca
B D                Squirrel  aca
               Prairie vole  aca
B D         Chinese hamster  gca
             Golden hamster  aca
B D                   Mouse  acg
B D                     Rat  aca
B D          Naked mole-rat  aca
B D              Guinea pig  aca
                 Chinchilla  act
           Brush-tailed rat  act
B D                  Rabbit  gca
B D                    Pika  acc
B D                     Pig  aca
B D                  Alpaca  aca
             Bactrian camel  aca
B D                 Dolphin  aca
               Killer whale  aca
           Tibetan antelope  aca
B D                     Cow  aca
B D                   Sheep  aca
              Domestic goat  aca
B D                   Horse  ata
B D        White rhinoceros  acg
B D                     Cat  gaa
B D                     Dog  tca
B D                 Ferret   tca
B D                   Panda  tca
             Pacific walrus  ttg
               Weddell seal  tcg
           Black flying-fox  aca
B D                 Megabat  aca
              Big brown bat  aca
       David's myotis (bat)  aca
B D                Microbat  aca
B D                Hedgehog  gca
B D                   Shrew  acc
            Star-nosed mole  aca
B D                Elephant  cta
        Cape elephant shrew  ctg
           Cape golden mole  ata
B D                  Tenrec  aca
                   Aardvark  aca
B D               Armadillo  tca
B D             Stickleback  ---
    Yellowbelly pufferfish  ===
B D                    Fugu  ===
B D                  Turkey  ===
B D                 Chicken  ===
  D            Mallard duck  ===
        Tibetan ground jay  ===
B D             Zebra finch  ===
  D  White-throated sparrow  ===
B D         Tasmanian devil  ===
B D               Zebrafish  ===
B D           X. tropicalis  ===
  D         Green seaturtle  ===
B D      American alligator  ===
B D              Budgerigar  ===
B D                 Opossum  ===
    Lesser Egyptian jerboa  ===
  D             Rock pigeon  ===
  D     Collared flycatcher  ===
B D     Medium ground finch  ===
B D                  Lizard  ---
  D        Peregrine falcon  ---
  D            Saker falcon  ===
B D                Platypus  ===
B D                 Wallaby  ===
B D                 Manatee  ===

Inserts between block 9 and 10 in window
B D               Elephant 7bp
       Cape elephant shrew 5bp
B D                 Tenrec 1715bp

Alignment block 10 of 977 in window, 6776125 - 6776127, 3 bps 
B D                   Human  cgg
B D                   Chimp  cgg
B D                 Gorilla  cgg
B D               Orangutan  cgg
B D                  Gibbon  cgg
B D                  Rhesus  tgg
B D     Crab-eating macaque  tgg
B D                  Baboon  tgg
B D            Green monkey  tgg
B D                Marmoset  cag
B D         Squirrel monkey  cag
B D                Bushbaby  tgg
         Chinese tree shrew  tag
B D                Squirrel  tag
               Prairie vole  tag
B D         Chinese hamster  cag
             Golden hamster  caa
B D                   Mouse  tga
B D                     Rat  tgt
B D          Naked mole-rat  tag
B D              Guinea pig  tag
                 Chinchilla  tag
           Brush-tailed rat  tag
B D                  Rabbit  tag
B D                    Pika  tcg
B D                     Pig  tag
B D                  Alpaca  tgg
             Bactrian camel  tgg
B D                 Dolphin  aag
               Killer whale  aag
           Tibetan antelope  tag
B D                     Cow  tag
B D                   Sheep  tag
              Domestic goat  tag
B D                   Horse  tag
B D        White rhinoceros  tag
B D                     Cat  tag
B D                     Dog  tag
B D                 Ferret   tag
B D                   Panda  tag
             Pacific walrus  tag
               Weddell seal  tag
           Black flying-fox  cag
B D                 Megabat  cag
              Big brown bat  tag
       David's myotis (bat)  tag
B D                Microbat  tag
B D                Hedgehog  tag
B D                   Shrew  ata
            Star-nosed mole  taa
B D                Elephant  --g
           Cape golden mole  --g
                   Aardvark  -tg
B D               Armadillo  -tg
B D             Stickleback  ---
    Yellowbelly pufferfish  ===
B D                    Fugu  ===
B D                  Turkey  ===
B D                 Chicken  ===
  D            Mallard duck  ===
        Tibetan ground jay  ===
B D             Zebra finch  ===
  D  White-throated sparrow  ===
B D         Tasmanian devil  ===
B D               Zebrafish  ===
B D           X. tropicalis  ===
  D         Green seaturtle  ===
B D      American alligator  ===
B D              Budgerigar  ===
B D                 Opossum  ===
    Lesser Egyptian jerboa  ===
  D             Rock pigeon  ===
  D     Collared flycatcher  ===
B D     Medium ground finch  ===
B D                  Lizard  ---
  D        Peregrine falcon  ---
  D            Saker falcon  ===
       Cape elephant shrew  ===
B D                Platypus  ===
B D                 Wallaby  ===
B D                 Manatee  ===
B D                  Tenrec  ===

Inserts between block 10 and 11 in window
B D                    Cow 217bp
             Domestic goat 213bp

Alignment block 11 of 977 in window, 6776128 - 6776129, 2 bps 
B D                   Human  ca-
B D                   Chimp  ca-
B D                 Gorilla  ca-
B D               Orangutan  ca-
B D                  Gibbon  ca-
B D                  Rhesus  ca-
B D     Crab-eating macaque  ca-
B D                  Baboon  ca-
B D            Green monkey  ca-
B D                Marmoset  ta-
B D         Squirrel monkey  ta-
B D                Bushbaby  ta-
         Chinese tree shrew  ta-
B D                Squirrel  ta-
               Prairie vole  ta-
B D         Chinese hamster  ga-
             Golden hamster  ga-
B D                   Mouse  ta-
B D                     Rat  ta-
B D          Naked mole-rat  ta-
B D              Guinea pig  ta-
                 Chinchilla  ta-
           Brush-tailed rat  ta-
B D                  Rabbit  tc-
B D                    Pika  ta-
B D                     Pig  tc-
B D                  Alpaca  ta-
             Bactrian camel  ta-
B D                 Dolphin  ta-
               Killer whale  ta-
           Tibetan antelope  ta-
B D                     Cow  ta-
B D                   Sheep  ta-
              Domestic goat  ta-
B D                   Horse  ta-
B D        White rhinoceros  ta-
B D                     Cat  ta-
B D                     Dog  ta-
B D                 Ferret   ta-
B D                   Panda  ta-
             Pacific walrus  ta-
               Weddell seal  ta-
           Black flying-fox  ta-
B D                 Megabat  ta-
              Big brown bat  ta-
       David's myotis (bat)  ta-
B D                Microbat  ta-
B D                Hedgehog  ta-
B D                   Shrew  ta-
            Star-nosed mole  ta-
B D                Elephant  -gg
        Cape elephant shrew  -aa
           Cape golden mole  -ag
                   Aardvark  -aa
B D               Armadillo  -gt
B D             Stickleback  ---
    Yellowbelly pufferfish  ===
B D                    Fugu  ===
B D                  Turkey  ===
B D                 Chicken  ===
  D            Mallard duck  ===
        Tibetan ground jay  ===
B D             Zebra finch  ===
  D  White-throated sparrow  ===
B D         Tasmanian devil  ===
B D               Zebrafish  ===
B D           X. tropicalis  ===
  D         Green seaturtle  ===
B D      American alligator  ===
B D              Budgerigar  ===
B D                 Opossum  ===
    Lesser Egyptian jerboa  ===
  D             Rock pigeon  ===
  D     Collared flycatcher  ===
B D     Medium ground finch  ===
B D                  Lizard  ---
  D        Peregrine falcon  ---
  D            Saker falcon  ===
B D                Platypus  ===
B D                 Wallaby  ===
B D                 Manatee  ===
B D                  Tenrec  ===

Inserts between block 11 and 12 in window
B D               Elephant 2bp
       Cape elephant shrew 2bp
          Cape golden mole 2bp
                  Aardvark 838bp
B D              Armadillo 1bp

Alignment block 12 of 977 in window, 6776130 - 6776130, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D                Squirrel  g
               Prairie vole  g
B D         Chinese hamster  g
             Golden hamster  g
B D                   Mouse  g
B D                     Rat  g
B D          Naked mole-rat  g
B D              Guinea pig  g
                 Chinchilla  g
           Brush-tailed rat  g
B D                  Rabbit  g
B D                    Pika  g
B D                     Pig  a
B D                  Alpaca  g
             Bactrian camel  g
B D                 Dolphin  g
               Killer whale  g
           Tibetan antelope  g
B D                     Cow  g
B D                   Sheep  g
              Domestic goat  g
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                 Ferret   g
B D                   Panda  g
             Pacific walrus  g
               Weddell seal  g
           Black flying-fox  g
B D                 Megabat  g
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                Hedgehog  g
B D                   Shrew  g
            Star-nosed mole  g
B D                Elephant  g
        Cape elephant shrew  g
           Cape golden mole  g
                   Aardvark  g
B D               Armadillo  g
B D             Stickleback  -
    Yellowbelly pufferfish  =
B D                    Fugu  =
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  =
  D  White-throated sparrow  =
B D         Tasmanian devil  =
B D               Zebrafish  =
B D           X. tropicalis  =
  D         Green seaturtle  =
B D      American alligator  =
B D              Budgerigar  =
B D                 Opossum  =
    Lesser Egyptian jerboa  =
  D             Rock pigeon  =
  D     Collared flycatcher  =
B D     Medium ground finch  =
B D                  Lizard  -
  D        Peregrine falcon  -
  D            Saker falcon  =
B D                Platypus  =
B D                 Wallaby  =
B D                 Manatee  =
B D                  Tenrec  =

Inserts between block 12 and 13 in window
B D               Elephant 127bp
       Cape elephant shrew 26bp

Alignment block 13 of 977 in window, 6776131 - 6776142, 12 bps 
B D                   Human  gtgcttaa----------------------ta----at
B D                   Chimp  gtgcttaa----------------------ta----at
B D                 Gorilla  gtgcttaa----------------------ta----at
B D               Orangutan  gtgcttaa----------------------taatgtat
B D                  Gibbon  gtgcttaa----------------------ca----at
B D                  Rhesus  gtgcttaa----------------------ta----at
B D     Crab-eating macaque  gtgcttaa----------------------ta----at
B D                  Baboon  gtgcttaa----------------------ta----at
B D            Green monkey  gtgcttaa----------------------ta----at
B D                Marmoset  gtacttaa----------------------ta----at
B D         Squirrel monkey  gtgctcaa----------------------ta----at
B D                Bushbaby  gtgattaa----------------------ta----at
         Chinese tree shrew  gtgcttaa----------------------ta----ac
B D                Squirrel  gtgcttaa----------------------ta----at
               Prairie vole  gtgcttgg----------------------ta----gt
B D         Chinese hamster  gcgcttagtcac------------------tg----gt
             Golden hamster  gtgcttagtgatggtcacgggagccaggcatg----gt
B D                   Mouse  ccgcttag----------------------ca----at
B D                     Rat  gtgcttag----------------------ca----at
B D          Naked mole-rat  gtgcctaa----------------------t-----ag
B D              Guinea pig  gtgcttaa----------------------ta----ag
                 Chinchilla  gtgcttaa----------------------ta----ag
           Brush-tailed rat  gtgcttaa----------------------ta----ag
B D                  Rabbit  gtgcttaa----------------------ta----at
B D                    Pika  gtgcttac----------------------tc----ct
B D                     Pig  gtgcttag----------------------tg----at
B D                  Alpaca  gtgcttaa----------------------ta----at
             Bactrian camel  gtgcttaa----------------------ta----at
B D                 Dolphin  gcacttaa----------------------ta----at
               Killer whale  gcacttaa----------------------ta----at
           Tibetan antelope  gtgcttaa----------------------ta----at
B D                     Cow  gtgcttaa----------------------ta----at
B D                   Sheep  gtgcttaa----------------------ta----at
              Domestic goat  gtgcttaa----------------------ta----at
B D                   Horse  gtcctgaa----------------------ta----at
B D        White rhinoceros  gtgctgaa----------------------ta----at
B D                     Cat  gtgcttaa----------------------ta----ag
B D                     Dog  gtgcttaa----------------------ta----at
B D                 Ferret   gtgctcag----------------------ta----at
B D                   Panda  gtgcttaa----------------------ta----ct
             Pacific walrus  gtgcttaa----------------------ta----gt
               Weddell seal  gtgcttaa----------------------ta----at
           Black flying-fox  gtgcttaa----------------------ta----ct
B D                 Megabat  gtgcttaa----------------------ta----ct
              Big brown bat  gtgcttaa-----------------------------t
       David's myotis (bat)  gtgcttaa-----------------------------t
B D                Microbat  gtgctgaa-----------------------------t
B D                Hedgehog  gtgctcag----------------------ta----gt
B D                   Shrew  gaac----------------------------------
            Star-nosed mole  gggcttca----------------------ta----at
B D                Elephant  ttgcttaa----------------------ta----at
        Cape elephant shrew  gtcctcaa----------------------ta----at
B D                 Manatee  gtgcttaa----------------------ta----at
           Cape golden mole  gtatttaa----------------------ca----at
                   Aardvark  gtgcttag----------------------ta----gt
B D               Armadillo  gggctta-----------------------ta----at
B D             Stickleback  --------------------------------------
    Yellowbelly pufferfish  ======================================
B D                    Fugu  ======================================
B D                  Turkey  ======================================
B D                 Chicken  ======================================
  D            Mallard duck  ======================================
        Tibetan ground jay  ======================================
B D             Zebra finch  ======================================
  D  White-throated sparrow  ======================================
B D         Tasmanian devil  ======================================
B D               Zebrafish  ======================================
B D           X. tropicalis  ======================================
  D         Green seaturtle  ======================================
B D      American alligator  ======================================
B D              Budgerigar  ======================================
B D                 Opossum  ======================================
    Lesser Egyptian jerboa  ======================================
  D             Rock pigeon  ======================================
  D     Collared flycatcher  ======================================
B D     Medium ground finch  ======================================
B D                  Lizard  --------------------------------------
  D        Peregrine falcon  --------------------------------------
  D            Saker falcon  ======================================
B D                Platypus  ======================================
B D                 Wallaby  ======================================
B D                  Tenrec  ======================================

Inserts between block 13 and 14 in window
        Chinese tree shrew 951bp
B D                Ferret  175bp
B D               Hedgehog 3bp
B D                  Shrew 1bp

Alignment block 14 of 977 in window, 6776143 - 6776144, 2 bps 
B D                   Human  gt
B D                   Chimp  gt
B D                 Gorilla  gt
B D               Orangutan  gt
B D                  Gibbon  gt
B D                  Rhesus  gt
B D     Crab-eating macaque  gt
B D                  Baboon  gt
B D            Green monkey  gt
B D                Marmoset  at
B D         Squirrel monkey  gt
B D                Bushbaby  gt
         Chinese tree shrew  gt
B D                Squirrel  gc
               Prairie vole  gt
B D         Chinese hamster  ga
             Golden hamster  gg
B D                   Mouse  tt
B D                     Rat  gt
B D          Naked mole-rat  gt
B D              Guinea pig  gt
                 Chinchilla  gt
           Brush-tailed rat  tt
B D                  Rabbit  at
B D                    Pika  gt
B D                     Pig  gt
B D                  Alpaca  gc
             Bactrian camel  gc
B D                 Dolphin  gg
               Killer whale  gt
           Tibetan antelope  gt
B D                     Cow  gt
B D                   Sheep  gt
              Domestic goat  gt
B D                   Horse  gc
B D        White rhinoceros  at
B D                     Cat  gt
B D                     Dog  gt
B D                 Ferret   gt
B D                   Panda  gt
             Pacific walrus  gt
               Weddell seal  gt
           Black flying-fox  gt
B D                 Megabat  gt
              Big brown bat  gt
       David's myotis (bat)  ga
B D                Microbat  ga
B D                Hedgehog  gc
B D                Elephant  gt
        Cape elephant shrew  gt
B D                 Manatee  gt
           Cape golden mole  tt
                   Aardvark  at
B D               Armadillo  gt
B D                   Shrew  ==
B D             Stickleback  --
    Yellowbelly pufferfish  ==
B D                    Fugu  ==
B D                  Turkey  ==
B D                 Chicken  ==
  D            Mallard duck  ==
        Tibetan ground jay  ==
B D             Zebra finch  ==
  D  White-throated sparrow  ==
B D         Tasmanian devil  ==
B D               Zebrafish  ==
B D           X. tropicalis  ==
  D         Green seaturtle  ==
B D      American alligator  ==
B D              Budgerigar  ==
B D                 Opossum  ==
    Lesser Egyptian jerboa  ==
  D             Rock pigeon  ==
  D     Collared flycatcher  ==
B D     Medium ground finch  ==
B D                  Lizard  --
  D        Peregrine falcon  --
  D            Saker falcon  ==
B D                Platypus  ==
B D                 Wallaby  ==
B D                  Tenrec  ==
           Star-nosed mole  --

Inserts between block 14 and 15 in window
              Prairie vole 134bp
B D        Chinese hamster 106bp
            Golden hamster 109bp

Alignment block 15 of 977 in window, 6776145 - 6776146, 2 bps 
B D                   Human  at
B D                   Chimp  at
B D                 Gorilla  at
B D               Orangutan  at
B D                  Gibbon  at
B D                  Rhesus  at
B D     Crab-eating macaque  at
B D                  Baboon  at
B D            Green monkey  at
B D                Marmoset  gt
B D         Squirrel monkey  gg
B D                Bushbaby  at
         Chinese tree shrew  at
B D                Squirrel  at
               Prairie vole  at
B D         Chinese hamster  at
             Golden hamster  at
B D                   Mouse  at
B D                     Rat  at
B D          Naked mole-rat  ac
B D              Guinea pig  ac
                 Chinchilla  ac
           Brush-tailed rat  ac
B D                  Rabbit  gc
B D                    Pika  gt
B D                     Pig  at
B D                  Alpaca  at
             Bactrian camel  at
B D                 Dolphin  ac
               Killer whale  ac
           Tibetan antelope  at
B D                     Cow  at
B D                   Sheep  at
              Domestic goat  at
B D                   Horse  at
B D        White rhinoceros  at
B D                     Cat  ac
B D                     Dog  at
B D                 Ferret   ac
B D                   Panda  at
             Pacific walrus  ac
               Weddell seal  ac
           Black flying-fox  at
B D                 Megabat  at
              Big brown bat  ac
       David's myotis (bat)  at
B D                Microbat  at
B D                Hedgehog  at
            Star-nosed mole  at
B D                Elephant  gt
        Cape elephant shrew  gt
B D                 Manatee  gt
           Cape golden mole  gt
                   Aardvark  at
B D               Armadillo  gt
B D                   Shrew  ==
B D             Stickleback  --
    Yellowbelly pufferfish  ==
B D                    Fugu  ==
B D                  Turkey  ==
B D                 Chicken  ==
  D            Mallard duck  ==
        Tibetan ground jay  ==
B D             Zebra finch  ==
  D  White-throated sparrow  ==
B D         Tasmanian devil  ==
B D               Zebrafish  ==
B D           X. tropicalis  ==
  D         Green seaturtle  ==
B D      American alligator  ==
B D              Budgerigar  ==
B D                 Opossum  ==
    Lesser Egyptian jerboa  ==
  D             Rock pigeon  ==
  D     Collared flycatcher  ==
B D     Medium ground finch  ==
B D                  Lizard  --
  D        Peregrine falcon  --
  D            Saker falcon  ==
B D                Platypus  ==
B D                 Wallaby  ==
B D                  Tenrec  ==

Inserts between block 15 and 16 in window
B D                    Rat 160bp

Alignment block 16 of 977 in window, 6776147 - 6776151, 5 bps 
B D                   Human  a-gag--a----
B D                   Chimp  a-gag--g----
B D                 Gorilla  a-gag--g----
B D               Orangutan  a-gag--g----
B D                  Gibbon  a-gag--g----
B D                  Rhesus  a-gag--a----
B D     Crab-eating macaque  a-gag--a----
B D                  Baboon  a-gag--a----
B D            Green monkey  a-gag--a----
B D                Marmoset  a-gag--g----
B D         Squirrel monkey  aggag--g----
B D                Bushbaby  a-----------
         Chinese tree shrew  a-ttg--g----
B D                Squirrel  -------a----
               Prairie vole  -------a----
B D         Chinese hamster  -------g----
             Golden hamster  -------g----
B D                   Mouse  -------a----
B D          Naked mole-rat  -------c----
B D              Guinea pig  -------c----
                 Chinchilla  -------c----
           Brush-tailed rat  -------c----
B D                  Rabbit  ---agtgg----
B D                    Pika  -----tgg----
B D                     Pig  -------c----
B D                  Alpaca  -------g----
             Bactrian camel  -------g----
B D                 Dolphin  -------a----
               Killer whale  -------a----
           Tibetan antelope  -------a----
B D                     Cow  -------a----
B D                   Sheep  -------a----
              Domestic goat  -------a----
B D                   Horse  -------a----
B D        White rhinoceros  -------a----
B D                     Cat  -------a----
B D                     Dog  -------a----
B D                 Ferret   -------a----
B D                   Panda  -------a----
             Pacific walrus  -------a----
               Weddell seal  -------a----
           Black flying-fox  -------a----
B D                 Megabat  -------a----
              Big brown bat  -------a----
       David's myotis (bat)  -------a----
B D                Microbat  -------a----
B D                Hedgehog  -------a----
            Star-nosed mole  -------a----
B D                Elephant  -------attgg
        Cape elephant shrew  -------accag
B D                 Manatee  -------ttcgg
           Cape golden mole  -------attgg
                   Aardvark  -------atcag
B D               Armadillo  -------attgg
B D                   Shrew  ============
B D             Stickleback  ------------
    Yellowbelly pufferfish  ============
B D                    Fugu  ============
B D                  Turkey  ============
B D                 Chicken  ============
  D            Mallard duck  ============
        Tibetan ground jay  ============
B D             Zebra finch  ============
  D  White-throated sparrow  ============
B D         Tasmanian devil  ============
B D               Zebrafish  ============
B D           X. tropicalis  ============
  D         Green seaturtle  ============
B D      American alligator  ============
B D              Budgerigar  ============
B D                 Opossum  ============
    Lesser Egyptian jerboa  ============
  D             Rock pigeon  ============
  D     Collared flycatcher  ============
B D     Medium ground finch  ============
B D                  Lizard  ------------
  D        Peregrine falcon  ------------
  D            Saker falcon  ============
B D                Platypus  ============
B D                 Wallaby  ============
B D                  Tenrec  ============
B D                     Rat  ============

Inserts between block 16 and 17 in window
B D                    Pig 4bp
B D                 Alpaca 4bp
            Bactrian camel 4bp
B D                Dolphin 4bp
              Killer whale 4bp
          Tibetan antelope 4bp
B D                    Cow 4bp
B D                  Sheep 4bp
             Domestic goat 4bp
B D                  Horse 4bp
B D       White rhinoceros 4bp
B D                    Cat 4bp
B D                    Dog 191bp
B D                Ferret  4bp
B D                  Panda 4bp
            Pacific walrus 4bp
              Weddell seal 4bp
          Black flying-fox 4bp
B D                Megabat 4bp
             Big brown bat 3bp
      David's myotis (bat) 3bp
B D               Microbat 3bp
B D               Hedgehog 4bp
           Star-nosed mole 4bp

Alignment block 17 of 977 in window, 6776152 - 6776156, 5 bps 
B D                   Human  ttgaa
B D                   Chimp  ttgaa
B D                 Gorilla  ttgaa
B D               Orangutan  ttgaa
B D                  Gibbon  ttgaa
B D                  Rhesus  ttgaa
B D     Crab-eating macaque  ttgaa
B D                  Baboon  ttgaa
B D            Green monkey  ttgaa
B D                Marmoset  ttgaa
B D         Squirrel monkey  ttgaa
B D                Bushbaby  ttgaa
         Chinese tree shrew  ttgag
B D                Squirrel  ttgat
               Prairie vole  ttgat
B D         Chinese hamster  ttgat
             Golden hamster  ttgat
B D                   Mouse  ttgga
B D          Naked mole-rat  ttggc
B D              Guinea pig  ctggc
                 Chinchilla  ttagc
           Brush-tailed rat  ttggc
B D                  Rabbit  ttgaa
B D                    Pika  ttggg
B D                     Pig  ttaaa
B D                  Alpaca  ttgaa
             Bactrian camel  ttaaa
B D                 Dolphin  ttgaa
               Killer whale  ttgaa
           Tibetan antelope  ttgaa
B D                     Cow  ttgaa
B D                   Sheep  ttgaa
              Domestic goat  ttgaa
B D                   Horse  ttgaa
B D        White rhinoceros  ttgaa
B D                     Cat  ttgaa
B D                     Dog  ttaag
B D                 Ferret   ttcag
B D                   Panda  ttgag
             Pacific walrus  ttgag
               Weddell seal  ttgag
           Black flying-fox  ttgaa
B D                 Megabat  ttgaa
              Big brown bat  ttgaa
       David's myotis (bat)  ttgaa
B D                Microbat  ttgaa
B D                Hedgehog  ctgca
B D                   Shrew  cgggg
            Star-nosed mole  ctgag
B D                Elephant  ctgaa
        Cape elephant shrew  ttg--
B D                 Manatee  ttgaa
           Cape golden mole  ttgaa
                   Aardvark  ttgaa
B D               Armadillo  ttgaa
B D             Stickleback  -----
    Yellowbelly pufferfish  =====
B D                    Fugu  =====
B D                  Turkey  =====
B D                 Chicken  =====
  D            Mallard duck  =====
        Tibetan ground jay  =====
B D             Zebra finch  =====
  D  White-throated sparrow  =====
B D         Tasmanian devil  =====
B D               Zebrafish  =====
B D           X. tropicalis  =====
  D         Green seaturtle  =====
B D      American alligator  =====
B D              Budgerigar  =====
B D                 Opossum  =====
    Lesser Egyptian jerboa  =====
  D             Rock pigeon  =====
  D     Collared flycatcher  =====
B D     Medium ground finch  =====
B D                  Lizard  -----
  D        Peregrine falcon  -----
  D            Saker falcon  =====
B D                Platypus  =====
B D                 Wallaby  =====
B D                  Tenrec  =====
B D                     Rat  =====

Inserts between block 17 and 18 in window
B D               Squirrel 4bp
              Prairie vole 4bp
B D        Chinese hamster 4bp
            Golden hamster 4bp
B D                  Mouse 143bp
B D         Naked mole-rat 4bp
B D             Guinea pig 4bp
                Chinchilla 4bp
          Brush-tailed rat 4bp

Alignment block 18 of 977 in window, 6776157 - 6776182, 26 bps 
B D                   Human  tgaatacgtgaacatgctaatggata
B D                   Chimp  tgaatacgtgaacatgctaatggatg
B D                 Gorilla  tgaatacgtgaacatgctaatggata
B D               Orangutan  tgaatacgtgaacatgctaatggata
B D                  Gibbon  tgaatacgtgaacatgctaatggata
B D                  Rhesus  tgaatacatgaacatgctaatggata
B D     Crab-eating macaque  tgaatacatgaacatgctaatggata
B D                  Baboon  tgaatacatgaacgtgctaatggata
B D            Green monkey  tgaatacatgaacatgctaatggata
B D                Marmoset  tgaatacgtgaacatgctaatagata
B D         Squirrel monkey  tgaatatgtgaacatgctaatagata
B D                Bushbaby  tgaataaatgaacatgctaacaaata
         Chinese tree shrew  tgaataaataaataagctaacaaaca
B D                Squirrel  aaaataaatgaatacactaataaata
               Prairie vole  tgaccaagtaaacgaattaacaaaca
B D         Chinese hamster  tgactaagtaagcgaactaacaagca
             Golden hamster  tgactaagtaaacgaactaacaagca
B D                   Mouse  tgaatgagtaaatgacctaaca----
B D          Naked mole-rat  tgaatgaatgagtaagctaacaaata
B D              Guinea pig  tgaataaatgaataagctaacaaata
                 Chinchilla  tgaataaatgaaaaagctaacgaata
           Brush-tailed rat  tgaataaattaataagctaacaaata
B D                  Rabbit  tgactga-caaataagctgacagata
B D                    Pika  tgactt----aacaag----------
B D                     Pig  taaataaatgaacatgttaatgaata
B D                  Alpaca  tgaataaatgactatgctaacaagta
             Bactrian camel  tgaataaatgactatgctaacaagta
B D                 Dolphin  tgaataaatgaatctgcc----aacg
               Killer whale  tgaataaatgaatctgcc----aaca
           Tibetan antelope  tgaataaatgaatctactaataaata
B D                     Cow  tgaataaatgaatctactaataaata
B D                   Sheep  tgaataaatgaatctactaataaata
              Domestic goat  tgaataaatgaatctactaataaata
B D                   Horse  tgaataaa-gaatacacccgcaaatt
B D        White rhinoceros  tgaataaa-gaacacaccagcaaaca
B D                     Cat  ggaataaatgaatatgttaaca-gtc
B D                     Dog  caaataaatgaacatgctaacaggtc
B D                 Ferret   caaatcagtgaatatgctaataggtc
B D                   Panda  cgaatcagtgaacacgctgacaggtc
             Pacific walrus  tgactcagtgagtgcgctgacaggtc
               Weddell seal  tgaatcagtgagtacactgacaggtc
           Black flying-fox  taagtaaatgaatatgttaagaaata
B D                 Megabat  taaataaatgaatatgttaagaaata
              Big brown bat  tgactaagtgattatgctagcaaata
       David's myotis (bat)  tgaataagtgattatgctagcaaata
B D                Microbat  tgaataagtgattatgctagcaaata
B D                Hedgehog  ggagttagccactgtgcttacaggga
B D                   Shrew  tggatacatgagtttcctgatagata
            Star-nosed mole  tgaaaacatggagacactgacgagag
B D                Elephant  tgaatcaatgaataagctaacaaata
        Cape elephant shrew  ------aatgattaagttagcaacta
B D                 Manatee  tgaataaatgaataagctaacaaata
           Cape golden mole  tgaataaatgaataagctaacaaata
                   Aardvark  tgaatacatgaataagttaacaaata
B D               Armadillo  tg----aatgaataagttaacaggta
B D             Stickleback  --------------------------
    Yellowbelly pufferfish  ==========================
B D                    Fugu  ==========================
B D                  Turkey  ==========================
B D                 Chicken  ==========================
  D            Mallard duck  ==========================
        Tibetan ground jay  ==========================
B D             Zebra finch  ==========================
  D  White-throated sparrow  ==========================
B D         Tasmanian devil  ==========================
B D               Zebrafish  ==========================
B D           X. tropicalis  ==========================
  D         Green seaturtle  ==========================
B D      American alligator  ==========================
B D              Budgerigar  ==========================
B D                 Opossum  ==========================
    Lesser Egyptian jerboa  ==========================
  D             Rock pigeon  ==========================
  D     Collared flycatcher  ==========================
B D     Medium ground finch  ==========================
B D                  Lizard  --------------------------
  D        Peregrine falcon  --------------------------
  D            Saker falcon  ==========================
B D                Platypus  ==========================
B D                 Wallaby  ==========================
B D                  Tenrec  ==========================
B D                     Rat  ==========================

Inserts between block 18 and 19 in window
B D                  Shrew 1375bp

Alignment block 19 of 977 in window, 6776183 - 6776203, 21 bps 
B D                   Human  atac----atc--tcctgaagg----ccaat
B D                   Chimp  atac----atc--tcctgaagg----ccaat
B D                 Gorilla  atac----atc--tcctgaagg----ccaat
B D               Orangutan  atac----atc--tcctgaagg----ccaat
B D                  Gibbon  atac----atc--tcctgaagg----ccaat
B D                  Rhesus  atac----atc--tcctgaagg----ccaat
B D     Crab-eating macaque  atac----atc--tcctgaagg----ccaat
B D                  Baboon  atac----atc--tcctgaagg----ccaat
B D            Green monkey  atac----att--tcctgaagg----ccaa-
B D                Marmoset  atac----atc--tcctgaagg----ccagt
B D         Squirrel monkey  acac----gtc--tcctgaagg----ccagt
B D                Bushbaby  atac----atc--tcctgaggg----ccaat
         Chinese tree shrew  gaac----acc--ccctgagga----ccgat
B D                Squirrel  atat----gcc--tcctcagag----tcaat
               Prairie vole  acat----atc--tctaggctg----ttaac
B D         Chinese hamster  acat----atc--tctagaatg----ttagc
             Golden hamster  ccat----atc--tctaggatg----ttagt
B D                   Mouse  -cat----ac----------tg----gtaac
B D          Naked mole-rat  ccgc----agg--tcctgagtg----ccat-
B D              Guinea pig  a------------tcctgaatg----caat-
                 Chinchilla  gttc----atg--tcctgaatg----caat-
           Brush-tailed rat  atgc----atg--tgctgaatg----caat-
B D                  Rabbit  atac----atcggtcctgaggg----ccaat
B D                    Pika  ---------------ctgaggg----ctgac
B D                     Pig  agac----atc--tcccagagg----ccaa-
B D                  Alpaca  atac----atc--tcccaaagg----ccagt
             Bactrian camel  atac----atc--tcccaaagg----ccaat
B D                 Dolphin  acac----acc--tcctgaagc----ccagt
               Killer whale  acac----atc--tcctgaaga----ccagt
           Tibetan antelope  accc----ata--tctcaaaga----ccagg
B D                     Cow  accc----ata--tctcaaaga----ccagg
B D                   Sheep  accc----ata--tctcaaaga----ccagg
              Domestic goat  accc----ata--tctcgaaga----ccagg
B D                   Horse  atacgtctgtc--tcctgagag----ccaat
B D        White rhinoceros  gtac----atc--tcccgaggg----ccaat
B D                     Cat  gtac----atc--tcctgaggg----tcagt
B D                     Dog  atat----ctc--tcctggggg----cccat
B D                 Ferret   ttac----atc--tccttaggg----ccaat
B D                   Panda  acac----atc--tcctgaggg----ccagt
             Pacific walrus  atac----atc--tcccaaggg----ccaat
               Weddell seal  atac----atc--ttccaaggg----ccaat
           Black flying-fox  atat----ata--ttctgaggg----ccaat
B D                 Megabat  atat----ata--ttctgaggg----ccaat
              Big brown bat  atac----atc--ccctgtctg----ccaat
       David's myotis (bat)  atac----atc--ccctatctg----ccagt
B D                Microbat  atac----atc--ccctgtctg----ccagt
B D                Hedgehog  acac----agc--tcctgaggg----ccttc
            Star-nosed mole  atac----atc--ccctgacag----ttcat
B D                Elephant  atac----ctc--tcctaaggg----tcaac
        Cape elephant shrew  atac----att--ttctgagggttaatcaac
B D                 Manatee  atac----atc--tcctgaggg----tcagc
           Cape golden mole  atac----atc--tcctgaggg----ctaat
                   Aardvark  atac----atc--tcctgaggg----tcagt
B D               Armadillo  acac----atc--tcctgaggg----ccagc
B D                   Shrew  ===============================
B D             Stickleback  -------------------------------
    Yellowbelly pufferfish  ===============================
B D                    Fugu  ===============================
B D                  Turkey  ===============================
B D                 Chicken  ===============================
  D            Mallard duck  ===============================
        Tibetan ground jay  ===============================
B D             Zebra finch  ===============================
  D  White-throated sparrow  ===============================
B D         Tasmanian devil  ===============================
B D               Zebrafish  ===============================
B D           X. tropicalis  ===============================
  D         Green seaturtle  ===============================
B D      American alligator  ===============================
B D              Budgerigar  ===============================
B D                 Opossum  ===============================
    Lesser Egyptian jerboa  ===============================
  D             Rock pigeon  ===============================
  D     Collared flycatcher  ===============================
B D     Medium ground finch  ===============================
B D                  Lizard  -------------------------------
  D        Peregrine falcon  -------------------------------
  D            Saker falcon  ===============================
B D                Platypus  ===============================
B D                 Wallaby  ===============================
B D                  Tenrec  ===============================
B D                     Rat  ===============================

Inserts between block 19 and 20 in window
B D               Squirrel 1bp

Alignment block 20 of 977 in window, 6776204 - 6776321, 118 bps 
B D                   Human  cctgagtt-ttcacttgctttctggat---------acctctaactagatgtt--------------ata
B D                   Chimp  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------ata
B D                 Gorilla  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------ata
B D               Orangutan  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------ata
B D                  Gibbon  cctgagtt-ttcacttgcgttctggat---------acctctaactagatatt--------------ata
B D                  Rhesus  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------cta
B D     Crab-eating macaque  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------cta
B D                  Baboon  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------cta
B D            Green monkey  cctgagtt-ttcacttgctttct-gat---------acctctaactagatatt--------------cta
B D                Marmoset  tctgagtt-ttcacttgctttctggat---------acctgtacctagatact--------------ata
B D         Squirrel monkey  tctgagtt-ttcacttgc-ttctggat---------acctctacctagatact--------------ata
B D                Bushbaby  cctgaatt-tctacctgctttctggat---------atctctatctagatacc--------------ata
         Chinese tree shrew  cctgaatt-ttcacctgctttttagggtgaaaattaatttctgcctagatatt--------------ata
B D                Squirrel  ccaaa-ta-tctacctgcttttagaat---------a------------------------------tct
               Prairie vole  cctga-at-cccgctcaccttatctat---------aactctgtctggacatatta-------------t
B D         Chinese hamster  cctga-at-cctacgtgccttttctat---------aactctgtctaggtactgtgttg--------act
             Golden hamster  cctga-at-cctacacactttttctgt---------a------------------------------act
B D                   Mouse  cctga-at-cccacacacattttctat---------aactttatcttgatattatgttg--------act
B D                     Rat  cctga-at-cccacgcatgttttccat---------aactctatctagatatggtattg--------act
B D          Naked mole-rat  cctgactt-tctgcctgctttctgaat---------atctctccctagctatg--------------aca
B D              Guinea pig  cctgactt-tctacctgcttcctgaat---------atct--------ctatt--------------aga
                 Chinchilla  cttgactt-tccacctacttcctgaat---------atctttccctcgctatt--------------aga
           Brush-tailed rat  cctgactt-tctacctgcttcctgaat---------ctctctccctagctatt--------------aga
B D                  Rabbit  cgtgaatt-tcctcgcattttctggat---------gtcttcacctagatatta-------------tat
B D                    Pika  cccaggtcgcccttccattttctgggc---------atctgtg--tagataatg-------------cac
B D                     Pig  gctaaatt-tccacgtgcttcccacat---------atctctccctagatgtgg-------------tcc
B D                  Alpaca  gctgaatt-tctacctgcttccca--c---------atctttgcctagatcttg-------------tac
             Bactrian camel  gctgaatt-tccacctgcttccca--c---------atctctacctagatcttg-------------tac
B D                 Dolphin  gctggatt-tccacctgcttcccaggt---------atctctacgtagatatgg-------------tac
               Killer whale  gctggatt-tccacctgcttcccaggt---------atctctacgtagatatgg-------------tac
           Tibetan antelope  gctgaatt-tccacttgtttcccat-t---------gtctctacctagatatgg-------------tac
B D                     Cow  gctgaatt-tccacttgtttcccacgt---------atctctacctagatatgg-------------tac
B D                   Sheep  gctgaatt-tgcacttgtttcccatgt---------ttctctacctagatatgg-------------tac
              Domestic goat  gctgaatt-tccacttgtttcccatgt---------gtctctacctagatatgg-------------tac
B D                   Horse  ggtgaa-t-tccacctgcttcctggat---------atctctacctagatatgg-------------tac
B D        White rhinoceros  gctgaatt-tctacctacttcctgggt---------gtctctacctagatatgg-------------tac
B D                     Cat  gctgaatt-tccacctgt-tccaggat---------a------cctagatatgg-------------tac
B D                     Dog  gctaactt-tctgcctgc-tccaggat---------atctctacctagacatcg-------------tac
B D                 Ferret   gctgactt-----------tccaggag---------agctctgcttatatggca-------------tac
B D                   Panda  gccgactt-tccacctgc-tccaggct---------agctctacctagatgtca-------------tac
             Pacific walrus  gctgactt-tccacctgc-tccaggat---------cgctctccctagatgtca-------------tac
               Weddell seal  gctgactt-tccacctgc-tccaggat---------agctctccctcgatgtca-------------tac
           Black flying-fox  attgaatt-ctcacatgcttcctggat---------a-tcatagctgcac--------------------
B D                 Megabat  attgaatt-ctcacatgcttcctggat---------a-tcatagctgtac--------------------
              Big brown bat  gctgaatt-tccatatacttcctggaa---------atttctacctagatctcc-------------tag
       David's myotis (bat)  gctgaatt-tccatatacttcctggaa---------atttctacctagat--------------------
B D                Microbat  gctgaatt-tccatatacttcctggaa---------atttctacctagat--------------------
B D                Hedgehog  actgagct-tccatctggctcctgagc---------agttcctcctggatatcacacaccccaccccacc
            Star-nosed mole  gatggatt-ttcacctgctcgctgtct---------acttctacctagata----------------gtt
B D                Elephant  actgcatt-tccacctgtttcctggct---------gtctctacctagatatcg-------------tac
        Cape elephant shrew  actgtgtt-ttcatctacttcctagtt---------agcttgacctaggtattg-------------ta-
B D                 Manatee  actgcatt-tccacctgtttcctggct---------atctctacctagatatcg-------------tac
           Cape golden mole  actgcatt-tctatctgcttcctggat---------ctct----ctagatattg-------------tac
                   Aardvark  actgcatt-tccacctgcttcctggat---------atttctgtctagatattg-------------tat
B D               Armadillo  a--------------------ctagag---------agctctccct------------------------
B D                   Shrew  ======================================================================
B D             Stickleback  ----------------------------------------------------------------------
    Yellowbelly pufferfish  ======================================================================
B D                    Fugu  ======================================================================
B D                  Turkey  ======================================================================
B D                 Chicken  ======================================================================
  D            Mallard duck  ======================================================================
        Tibetan ground jay  ======================================================================
B D             Zebra finch  ======================================================================
  D  White-throated sparrow  ======================================================================
B D         Tasmanian devil  ======================================================================
B D               Zebrafish  ======================================================================
B D           X. tropicalis  ======================================================================
  D         Green seaturtle  ======================================================================
B D      American alligator  ======================================================================
B D              Budgerigar  ======================================================================
B D                 Opossum  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
  D             Rock pigeon  ======================================================================
  D     Collared flycatcher  ======================================================================
B D     Medium ground finch  ======================================================================
B D                  Lizard  ----------------------------------------------------------------------
  D        Peregrine falcon  ----------------------------------------------------------------------
  D            Saker falcon  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                  Tenrec  ======================================================================

                      Human  -ccacc---tctcagccgcc--------------ttaccctgaaccccagctttttctccca---c-caa
                      Chimp  -ccacc---tctcagccgcc--------------tcaccctgaaccccagctttttctccca---c-caa
                    Gorilla  -ccacc---tctcagccgcc--------------tcaccctgaaccccagctttttctccca---c-caa
                  Orangutan  -ccacc---tctcagccgcc--------------tcaccctgaaccccatctttttctccca---c-caa
                     Gibbon  -ccacc---tctcagccacc--------------tcaccctgaaccccatctttttctccca---c-caa
                     Rhesus  -ccacc---tctcagccgcc--------------tcaccctgaatcccatctttttctacca---c-caa
        Crab-eating macaque  -ccacc---tctcagccgcc--------------tcaccctgaatcccatctttttctacca---c-caa
                     Baboon  -ccacc---tctcagccgcc--------------tcaccctgaatcccatctttttctacca---c-caa
               Green monkey  -ccacc---tctcagccgcc--------------tcaccctgaatcccatctttttctacca---c-caa
                   Marmoset  -ccacc---tctcagctgcc--------------tcaccctgaaccccatctttttctccca---c-caa
            Squirrel monkey  -ccacc---tctcagctgcc--------------tcaccctgaaccccatctttttctccca---c-caa
                   Bushbaby  -ccatc---cctcag---ca--------------tcaccctgaactctatcttttcctcaca---c-caa
         Chinese tree shrew  cccacc---cttcag---cc--------------tcactctgaaccccaccttccccctact---c-caa
                   Squirrel  -acatt---cctcag---cc--------------tcatcctgaaccccattattgtcttatg---c-caa
               Prairie vole  -ctacc---cctcag---ct--------------tcactgggaaccccgtcttt---tcacg---t-cag
            Chinese hamster  -ctacc---cctcag---ct--------------tcactgggaacctcatcttc---tccct---t-cag
             Golden hamster  -ctacc---cctcag---ct--------------tcactgggaaccccatcttt---tcact---t-cag
                      Mouse  -caacc---cttcag---ct--------------tcacagggaaccccatcttt---ttaag---t-cac
                        Rat  -caacc---cctcag---ct--------------tcacagggaaccccatcttt---tcaag---t-cac
             Naked mole-rat  -ccac----ccttag---gc--------------acacctggg--cctaccttttctttatg---c-cag
                 Guinea pig  -ctact---ccttag---cc--------------tcatcctggaccctacc-attccttata---c-cag
                 Chinchilla  -ccact---ccttag---cc--------------tcaccctggaccctgccttttcgttatg---t-caa
           Brush-tailed rat  -ccact---ccttag---cc--------------tcaccctggatcctgccttttccttgtg---c-cga
                     Rabbit  -gtact---ccg-gg---cc--------------tccctctgagccccatttttttctgaca---c-cag
                       Pika  -ccact---cctcag---cc--------------tcatgcggagtgccatcttttccc-acg---c-cag
                        Pig  -ccgca---cttcag---cc--------------tcaccttgaacctcatcttttcccc--ac--c-cag
                     Alpaca  -ccaca---cctcag---ccgttgggagcactttttccccacagtaccatcttttccccacat--c-cag
             Bactrian camel  -ccaca---cctcag---ccgttgggagcactttttccccacagtaccatcttttccccacat--c-cag
                    Dolphin  -ccaca---cctcag---cc--------------tcactctgagccccatcttttcctcgcac--c-caa
               Killer whale  -ccaca---cctcag---cc--------------tcactctgagccccatcttttcctcgcac--c-cag
           Tibetan antelope  -ccaca----ctcag---cc--------------tcactctgaaccccatcttttcctcatac--c-cag
                        Cow  -ccaca----ctcag---cc--------------tcactctgatccccatcttttcctcatac--c-cag
                      Sheep  -ccaaa----ctcag---cc--------------tcactctgaaccccatcttttcctcatac--c-cag
              Domestic goat  -ccaca----ctcag---cc--------------tcactctgaaccccatcttttcctcatac--c-cag
                      Horse  -ccaca---cctcag---ct--------------ttactctgaataccgtctttgcctcagcc--t-cag
           White rhinoceros  -ccata---cctcag---cc--------------tcactctgaaccccatcttttcctcacac--t-caa
                        Cat  -cccca---cctcag---cc--------------tcactctgaaccccatcttttcctcacac--t-gag
                        Dog  -ccaca---ccccag---cc--------------tcgctctgaa-tccatcctttcctcatac--t-gca
                    Ferret   -ccaca---gcccag---ct--------------tcactccaagccccatcctttcctcacaccat-gtg
                      Panda  -ccaca---cccctg---cc--------------tcactccgaaccccatccttccctcaca---c-gtg
             Pacific walrus  -ccaca---ccgcag---cc--------------tcactccgaaccccatcctttcctcacaccgc-gag
               Weddell seal  -ccaca---ccccag---cc--------------tcaccccgaaccccatcctttcctcacaccac-gtg
           Black flying-fox  ----------ctcag---cc--------------tcactctggatcccatcttttcctcatgc--c-caa
                    Megabat  ----------ctcaa---cc--------------tcactctggatcccatcttttcctcatgc--c-caa
              Big brown bat  -tcaca---cctcag---cc--------------tcactctgaaccccatcttttcctcatgt--t-aag
       David's myotis (bat)  ----------ctcag---cc--------------tcactctgaaccccatcttttcctcatgc--t-aag
                   Microbat  ----------ctcag---cc--------------gcactctgaaccccatcttttcctcatgc--t-aag
                   Hedgehog  -ccaccccacccccg---cc--------------ttgctctgaacttcatcttttcatcaccc--tcaaa
            Star-nosed mole  -ctatc---cctcgg---cc--------------tcacattgaaccccat-tttccatcacac--t-gga
                   Elephant  -ccaca---ctgcag---cc--------------tcatgctgaaccccatcttttcctcacac--c-cag
        Cape elephant shrew  -ccaca---ccacaa---ct--------------tcatgctgag-cccattttttcctcatac--t-caa
                    Manatee  -ccaca---ctgcag---tg--------------taatgctgaaccccatcttttcctcacac--c-caa
           Cape golden mole  -ccaca---tagcag---tc--------------ttatgctgaacgccat--------------------
                   Aardvark  -ccaca---ctgcag---cc--------------tcatgctgaaccccatcttttcctcaaac--c-caa
                  Armadillo  ------------cag---cc--------------tcaccctgaagtccgtcttttcctcacac--c-tac
                      Shrew  ======================================================================
                Stickleback  ----------------------------------------------------------------------
     Yellowbelly pufferfish  ======================================================================
                       Fugu  ======================================================================
                     Turkey  ======================================================================
                    Chicken  ======================================================================
               Mallard duck  ======================================================================
         Tibetan ground jay  ======================================================================
                Zebra finch  ======================================================================
     White-throated sparrow  ======================================================================
            Tasmanian devil  ======================================================================
                  Zebrafish  ======================================================================
              X. tropicalis  ======================================================================
            Green seaturtle  ======================================================================
         American alligator  ======================================================================
                 Budgerigar  ======================================================================
                    Opossum  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                Rock pigeon  ======================================================================
        Collared flycatcher  ======================================================================
        Medium ground finch  ======================================================================
                     Lizard  ----------------------------------------------------------------------
           Peregrine falcon  ----------------------------------------------------------------------
               Saker falcon  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                     Tenrec  ======================================================================

                      Human  tccccttgctgactca-gcctgtca----
                      Chimp  tccccttgccgactca-gcctgtca----
                    Gorilla  tccccttgtcgactca-gcctgtca----
                  Orangutan  tccccttgctgactca-gcctgtca----
                     Gibbon  tccccttgctgactca-gcctgtca----
                     Rhesus  tccccttgctgactca-gcctgtca----
        Crab-eating macaque  tccccttgctgactca-gcctgtca----
                     Baboon  tccccttgctgactca-gcctgtca----
               Green monkey  tccccttgctgactca-gcctgtca----
                   Marmoset  tccccttgctgactca-gcctgtca----
            Squirrel monkey  tccccttgctggttca-gcctgtcg----
                   Bushbaby  acctctggctgactca-gcctgtca----
         Chinese tree shrew  tcctcgtgtggactca-ggctgtca----
                   Squirrel  ttcactttctcactta-gcctgtca----
               Prairie vole  -ccctttgctaactca-gtctattg----
            Chinese hamster  tctttttgcttactca-gcctgtta----
             Golden hamster  gctttttgctgactca-gcctatta----
                      Mouse  -ccctttgccgactta-gtctatta----
                        Rat  -cccttggctgactca-gtctatta----
             Naked mole-rat  tcccctggctgattta-gcctgtta----
                 Guinea pig  tcctcttggtgattta-gcctgtta----
                 Chinchilla  tcctcttgctgattta-gcctgtta----
           Brush-tailed rat  ttgccttgctgattta-tcctgtta----
                     Rabbit  -cctcggcctgg-----------ga----
                       Pika  -cctctagctg------------------
                        Pig  tcctctggctaagatg--cccttct----
                     Alpaca  tcctcttgtgaagtct--gctttct----
             Bactrian camel  tccccttgtgaagtct--gctttcc----
                    Dolphin  tcctcttgctaagtca--ccttccc----
               Killer whale  tcctcttgctaagtca--ccttccc----
           Tibetan antelope  tcctcttgctaagtca--tttctgc----
                        Cow  tcctcttgctaagtca--cttctgc----
                      Sheep  tcctcttgctaagtca--cttctgc----
              Domestic goat  tcctcttgctaagtca--cttctgc----
                      Horse  tcctcttgccgactta-gcctttct----
           White rhinoceros  tcctcttactgacttg-gcctttct----
                        Cat  ccctcttgctgactta-gcctttct----
                        Dog  ttctcttgctgactta-gccactct----
                    Ferret   tcctcttgctgactta-gcctttct----
                      Panda  tcctcctgctgactta-gcctttct----
             Pacific walrus  tcctcttgctgactta-gcctttct----
               Weddell seal  tcctcttgctgactta-gcctttct----
           Black flying-fox  tcctcttgctgactta-gcctttct----
                    Megabat  tcctcttgctgactta-gcctttct----
              Big brown bat  ---tctcgctgacgtc-gcctttct----
       David's myotis (bat)  ---tcttgctgactta-tcctttct----
                   Microbat  ---tcttgctgactta-gcctttct----
                   Hedgehog  tcctcttgctgactta-acctttta----
            Star-nosed mole  tcttcctattgactta-gcctttca----
                   Elephant  tcttcttaatgacttaagtctttctgtca
        Cape elephant shrew  tccttttgctgacgtaagcctttctgtta
                    Manatee  tcctcttactgccttaagcctttctgtca
           Cape golden mole  --ctcttgttgacttaagcagttttgtca
                   Aardvark  tccttttgctgacataagcctttctgtca
                  Armadillo  tccttttgct--cttaagctttcctgtca
                      Shrew  =============================
                Stickleback  -----------------------------
     Yellowbelly pufferfish  =============================
                       Fugu  =============================
                     Turkey  =============================
                    Chicken  =============================
               Mallard duck  =============================
         Tibetan ground jay  =============================
                Zebra finch  =============================
     White-throated sparrow  =============================
            Tasmanian devil  =============================
                  Zebrafish  =============================
              X. tropicalis  =============================
            Green seaturtle  =============================
         American alligator  =============================
                 Budgerigar  =============================
                    Opossum  =============================
     Lesser Egyptian jerboa  =============================
                Rock pigeon  =============================
        Collared flycatcher  =============================
        Medium ground finch  =============================
                     Lizard  -----------------------------
           Peregrine falcon  -----------------------------
               Saker falcon  =============================
                   Platypus  =============================
                    Wallaby  =============================
                     Tenrec  =============================

Inserts between block 20 and 21 in window
B D                    Pig 4bp
B D                 Alpaca 4bp
            Bactrian camel 4bp
B D                Dolphin 4bp
              Killer whale 4bp
          Tibetan antelope 4bp
B D                    Cow 4bp
B D                  Sheep 4bp
             Domestic goat 4bp
B D                  Horse 4bp
B D       White rhinoceros 4bp
B D                    Cat 4bp
B D                    Dog 2bp
B D                Ferret  4bp
B D                  Panda 4bp
            Pacific walrus 4bp
              Weddell seal 4bp
          Black flying-fox 4bp
B D                Megabat 4bp
             Big brown bat 4bp
      David's myotis (bat) 4bp
B D               Microbat 4bp
B D               Hedgehog 8207bp
           Star-nosed mole 4bp

Alignment block 21 of 977 in window, 6776322 - 6776412, 91 bps 
B D                   Human  g---taat-cc-----------------actggta-tccatcca-cctcg-aaacctgg-cctcctcc-t
B D                   Chimp  g---taat-cc-----------------accggta-tccaccaa-cctcg-aaacctgg-cctcctcc-t
B D                 Gorilla  g---taat-cc-----------------actggta-tccaccca-ccttg-aaacctgg-cctcctcc-t
B D               Orangutan  g---taat-cc-----------------actggta-tccactca-cctcg-aaacctgg-cctcctcc-t
B D                  Gibbon  g---taat-cc-----------------actggta-tccaccca-ccccg-aaacctgg-cctcctcc-t
B D                  Rhesus  g---taat-cc-----------------actggta-tccaccca-cctcg-aaacctgg-ccgcctcc-t
B D     Crab-eating macaque  g---taat-cc-----------------actggta-tccaccca-cctcg-aaacctgg-ccgcctcc-t
B D                  Baboon  g---taat-cc-----------------actggta-tccaccca-cctcg-aaacctgg-cctcctcc-t
B D            Green monkey  g---taat-cc-----------------actggta-tccaccca-cctcg-aaacctgg-cctcctcc-t
B D                Marmoset  t---taat--c-----------------cctggta-tctactca-ctttg-aaacctgg-cctactcc-t
B D         Squirrel monkey  t---taat-cc-----------------cctggta-tccaccca-cttcgaaaacctgg-cctactcc-t
B D                Bushbaby  g---tca--cc-----------------actggtattccactta-ccctg-aaacctgg-cctcttcctt
         Chinese tree shrew  g---taac-cc----------------tactggtg-tccactta-ccccg-aagcct------------t
B D                Squirrel  t---taactcc-----------------attggaa-ttccactc-atcct-aaccctgg-agtcctcc-t
               Prairie vole  g---taagtcc-----------------actggaa-ttccacac-ccccc-taac--------tcttc-t
B D         Chinese hamster  g---taaatcc-----------------attggaa-ttccacac-atccc-taaa--------cctgc-t
             Golden hamster  g---taaatcc-----------------attggaa-ttccatgc-atccc-taac--------ccttc-t
B D                   Mouse  g---caacgcc-----------------attggaa-tcccactc-ctccc-aaac--------ccccc-c
B D                     Rat  g---taactcc-----------------actggaa-tcccactc-agccc-aaac--------ccttc-t
B D          Naked mole-rat  t---ttact-c-----------------actggaa-tcccaact-cccca-gagcttgg-cctcctct-t
B D              Guinea pig  t---ttacact-----------------gttggaa-tctcagtg-cccca-tatcctgg-ccccctct-t
                 Chinchilla  t---ttatgct-----------------gctggac-tcccagtg-cctca-gatcctgg-tctcctct-t
           Brush-tailed rat  t---ttatg---------------------------ttccagtg-cctca-gactctgg-cctcctct-t
B D                  Rabbit  g---tagcccc-----------------actggtgtcccctcct-ccaca-aagcctgg-ggtccttc-t
B D                    Pika  ------------------------------------tccttccc-acatg-aagc------------c-t
B D                     Pig  g---aaacccc-----------------ggtcaca-tcctactcatcctg-gaacccga-cctcctcc-t
B D                  Alpaca  g---taactcc-----------------agttgtg-tcccactcctcctg-aaacctgg-cctcctcc-t
             Bactrian camel  g---taactcc-----------------agttgtg-tcccactcctcctg-aaacctgg-cctcctcc-t
B D                 Dolphin  g--------cc-----------------actcgtg-tcctactcatcctc-aa-------cttcctcc-t
               Killer whale  g--------cc-----------------actcgtg-tcctactcatcctc-aa-------cttcctcc-t
           Tibetan antelope  g---taactcc-----------------aatcatg-ttttactcatcctg-aaacctgg-cctccttc-c
B D                     Cow  g---taactcc-----------------aatcatg-ttctactcatcctg-aaacctgg-cctccttc-c
B D                   Sheep  g---tagctcc-----------------aatcatg-ttttactcatcctg-aaacctga-cctccttc-c
              Domestic goat  g---taactcc-----------------aatcatg-ttttactcatcctg-aaacctgg-cctccttc-c
B D                   Horse  g---taactcc-----------------acttgta-tcccattcaccctg-aaacctgg-cctcctcc-t
B D        White rhinoceros  g---taactcc-----------------actcgta-tcccactcaccctg-aaacctgg-cctgctcc-t
B D                     Cat  g---taactcccccccaccccaccccctgccccaa-tcccacttgccctg-acacttag-cctcccac-t
B D                     Dog  g---taactcc-----------------gtttgca-tcccactc-cccct-g----tgg-tttcttgt-t
B D                 Ferret   g---taact-----------------------gca-tcccactc-cccct-gaaactgg-cctcctgt-t
B D                   Panda  g---taactcc-----------------acctgta-tctcgctc-ccctg-aaacctgg-cctcctgt-t
             Pacific walrus  g---taactcc-----------------acctgta-ccccactc-cactg-aaacttgg-cctcccgt-t
               Weddell seal  g---taactcc-----------------acccgta-tcccactc-ccctg-aaacttgg-cctcctgt-t
           Black flying-fox  g---taattcc-----------------aatctca-tcccactcactata-aaacctgg-cctctttc-t
B D                 Megabat  a---taattcc-----------------aatctca-tcccactcactata-aaacctggacctctttc-t
              Big brown bat  a---taacgcc-----------------atttgca-tcccactcaccctg-aaacctgg-ctttctcc-t
       David's myotis (bat)  a---taatgcc-----------------atttgca-tcccactcaccctg-aaacctgg-ctttctcc-t
B D                Microbat  a---taacgcc-----------------attttca-tcccactcaccctg-aaacctgg-ctttctcc-t
            Star-nosed mole  a---taactcc-----------------acttata-tcctgctcaccctg-acatctg--ccccctgc-t
B D                Elephant  g---taactct-----------------act-----------------tg-aaacctgg-ccttctcc-t
        Cape elephant shrew  gtactaactcc-----------------act-----------------tg-gaacctcg-ccttctc---
B D                 Manatee  g---taacttc-----------------att-----------------tg-aaacctgg-ccttctcc-t
           Cape golden mole  g---tgactcc-----------------act-----------------ta-aaacctgg-ccttctt---
                   Aardvark  g---taactcc-----------------act-----------------tg-aaagctgg-ccttctcc-t
B D               Armadillo  c---tagctcc-----------------acttgta-tctcagtcgccctg-aaacctgg-ccctctcc-t
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Stickleback  ----------------------------------------------------------------------
    Yellowbelly pufferfish  ======================================================================
B D                    Fugu  ======================================================================
B D                  Turkey  ======================================================================
B D                 Chicken  ======================================================================
  D            Mallard duck  ======================================================================
        Tibetan ground jay  ======================================================================
B D             Zebra finch  ======================================================================
  D  White-throated sparrow  ======================================================================
B D         Tasmanian devil  ======================================================================
B D               Zebrafish  ======================================================================
B D           X. tropicalis  ======================================================================
  D         Green seaturtle  ======================================================================
B D      American alligator  ======================================================================
B D              Budgerigar  ======================================================================
B D                 Opossum  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
  D             Rock pigeon  ======================================================================
  D     Collared flycatcher  ======================================================================
B D     Medium ground finch  ======================================================================
B D                  Lizard  ----------------------------------------------------------------------
  D        Peregrine falcon  ----------------------------------------------------------------------
  D            Saker falcon  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                  Tenrec  ======================================================================

                      Human  ct--------ctacatcccatcagt--------catc-aaagtccaccagttctttctgtcc-aa
                      Chimp  ct--------ctacatcccatcagt--------catc-aaagtccaccagttctttctgtcc-aa
                    Gorilla  ct--------ctacatcccgtcagt--------catc-aaagtccaccagttctttctgtcc-aa
                  Orangutan  ct--------ctacatcccatcagt--------catc-acagtccaccagttctttctgtcc-aa
                     Gibbon  ct--------ctacatcccgtcagt--------catc-aaagcccaccagttctttctgtcc-aa
                     Rhesus  cc--------ctacatcccatcagt--------catc-aaagcccaccagttctttctgtcc-aa
        Crab-eating macaque  cc--------ctacgtcccatcagt--------catc-aaagcccaccagttctttctgtcc-aa
                     Baboon  cc--------ctacgtcccatcagt--------catc-aaagcccaccagttctttctgtcc-aa
               Green monkey  cc--------ctacgtcccatcagt--------catc-aaagcccaccagttctttctgtcc-aa
                   Marmoset  cc--------tcatatcccatcagt--------cacc-aaagtccaccagttctttctgtcc-at
            Squirrel monkey  cc--------tcacatcccatcagt--------cacc-aaagtccaccagttctttctgtcc-aa
                   Bushbaby  tc--------ccacatcaggtcagt--------cagc-aaaacataccagttctttctgtcc-ag
         Chinese tree shrew  cc--------c----tcacgccagt--------cacc-aagg-ccacctg----ctccgtcc-gg
                   Squirrel  tc-------cccatgtccagtcagt--------cacc-aaagcccacctattccttctgtcc-ag
               Prairie vole  tt-------gccgcactcagtcagt--------cctc-aaaacccacccata-cttctgccc-aa
            Chinese hamster  tt-------gccatatccagtccgt--------tctc-aaag-ccacccatt-ctcctgacc-ag
             Golden hamster  tt-------gccacatccagtcagt--------tccc-aaagcccacccttt-ctcctgacc-aa
                      Mouse  tt------tgccacattca-acagt--------cacc-aaagcccacccat------------aa
                        Rat  ttaaagcccgcc-cattct-tctgcctttcatgcttc-caagtacactcatg-cttttgaggcag
             Naked mole-rat  tt-------ccagaatcaattcggt--------cacc-aaagcccactcatt----ctgtct-ag
                 Guinea pig  tt-------ccggaatccatttggt--------cacc-aaagttcacttattcttcctttct-ag
                 Chinchilla  tc-------cctgagtccattcggt--------cacc-aaagcccactcattcttcctgtct-ag
           Brush-tailed rat  tt-------cccgaatccatttggt--------ctccaaaagcccattcattcttcctatct-ag
                     Rabbit  gt-------acacagtcca--------------tccc-aaaggctatcggttctttctgtcc-ag
                       Pika  ac-------acccagtgca--------------tacc-ca------------ccttgtgtcc-ag
                        Pig  tc--------------ccaatcagt--------tgcc-aaaggctaccagttccttctgtct-ga
                     Alpaca  tc------cccgacgtcccatcagt--------cgac-aaagcctaccacgtctttctgtcc-aa
             Bactrian camel  tc------cccgatgtcccatcagt--------cgac-aaagcctaccaagtctttctgtcc-aa
                    Dolphin  tc--------------ccagtcagt--------tacc-acagcctaccagttctttctgtcc-aa
               Killer whale  tc--------------ccagtcagt--------tacc-acagcctaccagttctttctgtcc-aa
           Tibetan antelope  tc--------------ctaatcagt--------tgcc-acagtctgccagttctttctgtcc-aa
                        Cow  tc--------------ctaatcagt--------tgcc-acagtctaccagttctttctgtcc-aa
                      Sheep  tc--------------ctaatcggt--------tgcc-acagtctgccagttctttctgtcc-aa
              Domestic goat  tc--------------ctaatcagt--------tgcc-acagtctgccagttctttctgtcc-aa
                      Horse  tc------ccccacatctagtcact--------c-----aagcccaccgattccttctgtcc-aa
           White rhinoceros  tc------ccccacatccagtcacc--------c-----aagcccaccaattccttctgtcc-aa
                        Cat  tc------ctccacatccagtcagt--------tgac-aaagcctcccaattctttccatcc-aa
                        Dog  -----------------------------------------------------------------
                    Ferret   tc------ctccacatccaatcagc--------ccac-aaagcctcccaattttctccatcc-aa
                      Panda  tc------ct-cacatccagtcggc--------acac-aaagcctcccaattctgtccgtcc-aa
             Pacific walrus  tc------ctccacatccagtcagc--------ccac-aaagcctcccaattttgtctgtcc-ta
               Weddell seal  tc------ctccacatccagtcagc--------ccac-aaagcctcccaactttgtccgtcc-ta
           Black flying-fox  tc------tcccatgtccagtcagt--------ctcc-aaagcctaccaattctttccttcc-aa
                    Megabat  tc------tcccatgtccagtcagt--------ctcc-aaagcctaccaattctttccttcc-aa
              Big brown bat  tc------cctcgtgtccactcagt--------tgcc-aaagcctaccaattctttctgtct-aa
       David's myotis (bat)  tc------cctcatgtccagtcagt--------tgcc-aaagcctaccaattctttctgtct-aa
                   Microbat  tc------cctcatgtccagtcagt--------tgcc-gaagcctaccaattctttctgtct-aa
            Star-nosed mole  tc------cttgta--cccaccagt--------tgcc-aaagcccacccagccttcctgccc-ag
                   Elephant  tc---tttccctacatgcgatcagg--------cact-aaagcctgccaattctttct-gcc-ag
        Cape elephant shrew  -------ttcttatatgaagtcagt--------cacc-aaagtcc-ccagttctttctctct-at
                    Manatee  tc---tctccctacatgaagtcatt--------cacc-aatgcccactaattctttcagtcc-aa
           Cape golden mole  -c---tctctccacatgcagtcagt--------cacc-aaagcacacccattcttcctattc-ag
                   Aardvark  ca---tctcctcatatgcattcagt--------cacc-aaagtctaccaattctttta-tct-gg
                  Armadillo  ct---gtcccctacgtccagtca-------------c-aaagcctactcgttctttcttccc-aa
                   Hedgehog  =================================================================
                      Shrew  =================================================================
                Stickleback  -----------------------------------------------------------------
     Yellowbelly pufferfish  =================================================================
                       Fugu  =================================================================
                     Turkey  =================================================================
                    Chicken  =================================================================
               Mallard duck  =================================================================
         Tibetan ground jay  =================================================================
                Zebra finch  =================================================================
     White-throated sparrow  =================================================================
            Tasmanian devil  =================================================================
                  Zebrafish  =================================================================
              X. tropicalis  =================================================================
            Green seaturtle  =================================================================
         American alligator  =================================================================
                 Budgerigar  =================================================================
                    Opossum  =================================================================
     Lesser Egyptian jerboa  =================================================================
                Rock pigeon  =================================================================
        Collared flycatcher  =================================================================
        Medium ground finch  =================================================================
                     Lizard  -----------------------------------------------------------------
           Peregrine falcon  -----------------------------------------------------------------
               Saker falcon  =================================================================
                   Platypus  =================================================================
                    Wallaby  =================================================================
                     Tenrec  =================================================================

Inserts between block 21 and 22 in window
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 219bp

Alignment block 22 of 977 in window, 6776413 - 6776414, 2 bps 
B D                   Human  tg
B D                   Chimp  tg
B D                 Gorilla  tg
B D               Orangutan  tg
B D                  Gibbon  tg
B D                  Rhesus  tg
B D     Crab-eating macaque  tg
B D                  Baboon  tg
B D            Green monkey  tg
B D                Marmoset  tg
B D         Squirrel monkey  tg
B D                Bushbaby  tg
         Chinese tree shrew  cg
B D                Squirrel  tg
               Prairie vole  tg
B D         Chinese hamster  tg
             Golden hamster  tg
B D                   Mouse  ag
B D                     Rat  ag
B D          Naked mole-rat  tg
B D              Guinea pig  ta
                 Chinchilla  tg
           Brush-tailed rat  tg
B D                  Rabbit  tg
B D                    Pika  ca
B D                     Pig  -g
B D                  Alpaca  -g
             Bactrian camel  -g
B D                 Dolphin  -g
               Killer whale  -g
           Tibetan antelope  -g
B D                     Cow  -a
B D                   Sheep  -g
              Domestic goat  -g
B D                     Cat  -g
B D                     Dog  -a
B D                 Ferret   -g
B D                   Panda  -g
             Pacific walrus  -g
               Weddell seal  -g
           Black flying-fox  -g
B D                 Megabat  -g
              Big brown bat  -g
       David's myotis (bat)  -g
B D                Microbat  -g
            Star-nosed mole  -g
B D                Elephant  tg
        Cape elephant shrew  tg
B D                 Manatee  tg
           Cape golden mole  tg
                   Aardvark  tg
B D               Armadillo  tg
B D                Hedgehog  ==
B D                   Shrew  ==
B D             Stickleback  --
    Yellowbelly pufferfish  ==
B D                    Fugu  ==
B D                  Turkey  ==
B D                 Chicken  ==
  D            Mallard duck  ==
        Tibetan ground jay  ==
B D             Zebra finch  ==
  D  White-throated sparrow  ==
B D         Tasmanian devil  ==
B D               Zebrafish  ==
B D           X. tropicalis  ==
  D         Green seaturtle  ==
B D      American alligator  ==
B D              Budgerigar  ==
B D                 Opossum  ==
    Lesser Egyptian jerboa  ==
  D             Rock pigeon  ==
  D     Collared flycatcher  ==
B D     Medium ground finch  ==
B D                  Lizard  --
  D        Peregrine falcon  --
  D            Saker falcon  ==
B D                Platypus  ==
B D                 Wallaby  ==
B D                  Tenrec  ==
B D        White rhinoceros  ==
B D                   Horse  ==

Inserts between block 22 and 23 in window
B D        Chinese hamster 1655bp
B D                  Mouse 31bp
B D                    Rat 24bp
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp
           Star-nosed mole 1bp

Alignment block 23 of 977 in window, 6776415 - 6776415, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  t
B D         Squirrel monkey  t
B D                Bushbaby  a
         Chinese tree shrew  t
B D                Squirrel  t
               Prairie vole  c
B D                   Mouse  c
B D                     Rat  c
B D          Naked mole-rat  t
B D              Guinea pig  g
           Brush-tailed rat  c
B D                  Rabbit  t
B D                    Pika  t
B D                     Pig  c
B D                  Alpaca  t
             Bactrian camel  t
B D                 Dolphin  t
               Killer whale  t
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  t
B D                     Dog  t
B D                 Ferret   t
B D                   Panda  t
             Pacific walrus  t
               Weddell seal  t
           Black flying-fox  t
B D                 Megabat  t
              Big brown bat  t
       David's myotis (bat)  t
B D                Microbat  t
            Star-nosed mole  t
B D                Elephant  t
        Cape elephant shrew  t
B D                 Manatee  t
           Cape golden mole  t
                   Aardvark  t
B D               Armadillo  g
B D                Hedgehog  =
B D                   Shrew  =
            Golden hamster  -
B D             Stickleback  -
    Yellowbelly pufferfish  =
B D                    Fugu  =
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  =
  D  White-throated sparrow  =
B D         Tasmanian devil  =
B D               Zebrafish  =
B D           X. tropicalis  =
  D         Green seaturtle  =
B D      American alligator  =
B D              Budgerigar  =
B D                 Opossum  =
                Chinchilla  -
    Lesser Egyptian jerboa  =
  D             Rock pigeon  =
  D     Collared flycatcher  =
B D     Medium ground finch  =
B D                  Lizard  -
  D        Peregrine falcon  -
  D            Saker falcon  =
B D                Platypus  =
B D                 Wallaby  =
B D         Chinese hamster  =
B D                  Tenrec  =

Inserts between block 23 and 24 in window
              Prairie vole 396bp
B D                  Mouse 1bp
B D                    Rat 1bp

Alignment block 24 of 977 in window, 6776416 - 6776417, 2 bps 
B D                   Human  cc-----
B D                   Chimp  cc-----
B D                 Gorilla  cc-----
B D               Orangutan  ct-----
B D                  Gibbon  ct-----
B D                  Rhesus  ct-----
B D     Crab-eating macaque  ct-----
B D                  Baboon  ct-----
B D            Green monkey  ct-----
B D                Marmoset  cc-----
B D         Squirrel monkey  ct-----
B D                Bushbaby  ct-----
         Chinese tree shrew  ct-----
B D                Squirrel  c------
B D                   Mouse  c------
B D                     Rat  a------
B D          Naked mole-rat  c------
B D              Guinea pig  c------
           Brush-tailed rat  c------
B D                  Rabbit  c------
B D                    Pika  c------
B D                     Pig  -c-----
B D                  Alpaca  -c-----
             Bactrian camel  -c-----
B D                 Dolphin  -c-----
               Killer whale  -c-----
           Tibetan antelope  -c-----
B D                     Cow  -c-----
B D                   Sheep  -c-----
              Domestic goat  -c-----
B D                   Horse  -c-----
B D        White rhinoceros  -c-----
B D                     Cat  -c-----
B D                     Dog  -t-----
B D                 Ferret   -c-----
B D                   Panda  -c-----
             Pacific walrus  -c-----
               Weddell seal  -c-----
           Black flying-fox  -c-----
B D                 Megabat  -c-----
              Big brown bat  -t-----
       David's myotis (bat)  -t-----
B D                Microbat  -t-----
            Star-nosed mole  -c-----
B D                Elephant  -cattct
        Cape elephant shrew  -ctttct
B D                 Manatee  -cttttt
           Cape golden mole  -ctttct
                   Aardvark  -ctgtct
B D               Armadillo  -c----c
B D                Hedgehog  =======
B D                   Shrew  =======
            Golden hamster  -------
B D             Stickleback  -------
    Yellowbelly pufferfish  =======
B D                    Fugu  =======
B D                  Turkey  =======
B D                 Chicken  =======
  D            Mallard duck  =======
        Tibetan ground jay  =======
B D             Zebra finch  =======
  D  White-throated sparrow  =======
B D         Tasmanian devil  =======
B D               Zebrafish  =======
B D           X. tropicalis  =======
  D         Green seaturtle  =======
B D      American alligator  =======
B D              Budgerigar  =======
B D                 Opossum  =======
                Chinchilla  -------
    Lesser Egyptian jerboa  =======
  D             Rock pigeon  =======
  D     Collared flycatcher  =======
B D     Medium ground finch  =======
B D                  Lizard  -------
  D        Peregrine falcon  -------
  D            Saker falcon  =======
B D                Platypus  =======
B D                 Wallaby  =======
B D         Chinese hamster  =======
              Prairie vole  =======
B D                  Tenrec  =======

Inserts between block 24 and 25 in window
B D               Squirrel 1bp
B D                  Mouse 1bp
B D                    Rat 1bp
B D         Naked mole-rat 1bp
B D             Guinea pig 1bp
          Brush-tailed rat 1bp
B D                 Rabbit 1bp
B D                   Pika 1bp
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 4bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp
           Star-nosed mole 1bp

Alignment block 25 of 977 in window, 6776418 - 6776421, 4 bps 
B D                   Human  tctt
B D                   Chimp  tctt
B D                 Gorilla  tctt
B D               Orangutan  tctt
B D                  Gibbon  tctt
B D                  Rhesus  tctt
B D     Crab-eating macaque  tctt
B D                  Baboon  tctt
B D            Green monkey  tctt
B D                Marmoset  tctt
B D         Squirrel monkey  tctt
B D                Bushbaby  ttct
         Chinese tree shrew  tctt
B D                Squirrel  tctt
               Prairie vole  tctg
             Golden hamster  --tt
B D                   Mouse  tctg
B D                     Rat  cctg
B D          Naked mole-rat  tctt
B D              Guinea pig  tcta
                 Chinchilla  tctt
           Brush-tailed rat  tctt
B D                  Rabbit  tctt
B D                    Pika  tcta
B D                     Pig  tctc
B D                  Alpaca  tccc
             Bactrian camel  tctc
B D                 Dolphin  tcct
               Killer whale  tcct
           Tibetan antelope  tctt
B D                     Cow  tctt
B D                   Sheep  tctt
              Domestic goat  tctt
B D                   Horse  tctt
B D        White rhinoceros  tctt
B D                     Cat  tctt
B D                     Dog  tcta
B D                 Ferret   tctt
B D                   Panda  tcgt
             Pacific walrus  tctt
               Weddell seal  tctt
           Black flying-fox  tctt
B D                 Megabat  tctt
              Big brown bat  tctt
       David's myotis (bat)  tctt
B D                Microbat  tctt
            Star-nosed mole  tcct
B D                Elephant  tctt
        Cape elephant shrew  tctt
B D                 Manatee  tctt
           Cape golden mole  tctt
                   Aardvark  tctt
B D               Armadillo  tctt
B D                Hedgehog  ====
B D                   Shrew  ====
B D             Stickleback  ----
    Yellowbelly pufferfish  ====
B D                    Fugu  ====
B D                  Turkey  ====
B D                 Chicken  ====
  D            Mallard duck  ====
        Tibetan ground jay  ====
B D             Zebra finch  ====
  D  White-throated sparrow  ====
B D         Tasmanian devil  ====
B D               Zebrafish  ====
B D           X. tropicalis  ====
  D         Green seaturtle  ====
B D      American alligator  ====
B D              Budgerigar  ====
B D                 Opossum  ====
    Lesser Egyptian jerboa  ====
  D             Rock pigeon  ====
  D     Collared flycatcher  ====
B D     Medium ground finch  ====
B D                  Lizard  ----
  D        Peregrine falcon  ----
  D            Saker falcon  ====
B D                Platypus  ====
B D                 Wallaby  ====
B D         Chinese hamster  ====
B D                  Tenrec  ====

Inserts between block 25 and 26 in window
B D               Squirrel 1bp
              Prairie vole 1bp
            Golden hamster 1bp
B D                  Mouse 167bp
B D                    Rat 61bp
B D         Naked mole-rat 1bp
B D             Guinea pig 1bp
                Chinchilla 1bp
          Brush-tailed rat 1bp
B D                 Rabbit 1bp
B D                   Pika 1bp
B D                    Pig 14bp
B D                 Alpaca 14bp
            Bactrian camel 14bp
B D                Dolphin 12bp
              Killer whale 12bp
          Tibetan antelope 216bp
B D                    Cow 216bp
B D                  Sheep 65bp
             Domestic goat 65bp

Alignment block 26 of 977 in window, 6776422 - 6776422, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                 Ferret   g
B D                   Panda  g
             Pacific walrus  g
               Weddell seal  g
           Black flying-fox  g
B D                 Megabat  g
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
            Star-nosed mole  g
B D                Elephant  g
        Cape elephant shrew  g
B D                 Manatee  g
           Cape golden mole  g
                   Aardvark  g
B D               Armadillo  g
B D                Hedgehog  =
B D              Guinea pig  =
B D                    Pika  =
B D                  Rabbit  =
B D                   Shrew  =
            Golden hamster  =
          Brush-tailed rat  =
B D             Stickleback  -
    Yellowbelly pufferfish  =
B D                    Fugu  =
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  =
  D  White-throated sparrow  =
B D         Tasmanian devil  =
B D               Zebrafish  =
B D           X. tropicalis  =
  D         Green seaturtle  =
B D      American alligator  =
B D              Budgerigar  =
B D                 Opossum  =
                Chinchilla  =
B D          Naked mole-rat  =
    Lesser Egyptian jerboa  =
  D             Rock pigeon  =
  D     Collared flycatcher  =
B D     Medium ground finch  =
B D                  Lizard  -
  D        Peregrine falcon  -
  D            Saker falcon  =
B D                Platypus  =
B D                 Wallaby  =
B D         Chinese hamster  =
              Prairie vole  =
B D                  Tenrec  =
B D                     Pig  =
B D                 Dolphin  =
B D                     Rat  =
B D                   Mouse  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Bactrian camel  =
B D                  Alpaca  =
B D                Squirrel  =
B D                     Cow  =
              Killer whale  =

Alignment block 27 of 977 in window, 6776423 - 6776431, 9 bps 
B D                   Human  aag-gtcaac
B D                   Chimp  aag-gtcaac
B D                 Gorilla  aag-gtcaac
B D               Orangutan  aag-gtcgac
B D                  Gibbon  aag-gtcaac
B D                  Rhesus  aag-gtcaac
B D     Crab-eating macaque  aag-gtcaac
B D                  Baboon  aag-gtcaac
B D            Green monkey  aag-gtcaac
B D                Marmoset  aag-gtcaac
B D         Squirrel monkey  aag-gtcaac
B D                Bushbaby  gagaatcaac
         Chinese tree shrew  -ag-gacaac
B D                Squirrel  tag-gccaac
               Prairie vole  aag-atcagc
             Golden hamster  atg-gccaga
B D                     Rat  aaa-atcaac
B D          Naked mole-rat  -------a--
B D              Guinea pig  -------a--
                 Chinchilla  -------a--
           Brush-tailed rat  -------a--
B D                  Rabbit  agg-atgggc
B D                    Pika  aag-actgac
B D                   Horse  agc-atccac
B D        White rhinoceros  ag--------
B D                     Cat  agc-gtcagc
B D                     Dog  act-ctgcac
B D                 Ferret   agg-gtcagc
B D                   Panda  agg-gtcagc
             Pacific walrus  agg-gtcacc
               Weddell seal  agg-gtccgc
           Black flying-fox  agg-gtccac
B D                 Megabat  agg-gtccac
              Big brown bat  agg-gtccat
       David's myotis (bat)  agg-gcccgt
B D                Microbat  agg-gcccgt
            Star-nosed mole  aag-gccagt
B D                Elephant  agg-gccaac
        Cape elephant shrew  agg-a-caac
B D                 Manatee  agg-accaac
           Cape golden mole  agg-gccaac
                   Aardvark  agg-gccaac
B D               Armadillo  agg-gccagc
B D                Hedgehog  ==========
B D                   Shrew  ==========
B D             Stickleback  ----------
    Yellowbelly pufferfish  ==========
B D                    Fugu  ==========
B D                  Turkey  ==========
B D                 Chicken  ==========
  D            Mallard duck  ==========
        Tibetan ground jay  ==========
B D             Zebra finch  ==========
  D  White-throated sparrow  ==========
B D         Tasmanian devil  ==========
B D               Zebrafish  ==========
B D           X. tropicalis  ==========
  D         Green seaturtle  ==========
B D      American alligator  ==========
B D              Budgerigar  ==========
B D                 Opossum  ==========
    Lesser Egyptian jerboa  ==========
  D             Rock pigeon  ==========
  D     Collared flycatcher  ==========
B D     Medium ground finch  ==========
B D                  Lizard  ----------
  D        Peregrine falcon  ----------
  D            Saker falcon  ==========
B D                Platypus  ==========
B D                 Wallaby  ==========
B D         Chinese hamster  ==========
B D                  Tenrec  ==========
B D                     Pig  ==========
B D                 Dolphin  ==========
B D                   Mouse  ==========
             Domestic goat  ==========
B D                   Sheep  ==========
          Tibetan antelope  ==========
            Bactrian camel  ==========
B D                  Alpaca  ==========
B D                     Cow  ==========
              Killer whale  ==========

Inserts between block 27 and 28 in window
       Cape elephant shrew 152bp

Alignment block 28 of 977 in window, 6776432 - 6776446, 15 bps 
B D                   Human  tgtttta-tgt-----a-gacg-------------------------
B D                   Chimp  tgtttta-tgt-----a-gaca-------------------------
B D                 Gorilla  tgtttta-tgt-----a-gaca-------------------------
B D               Orangutan  tgtttta-tgt-----a-gaca-------------------------
B D                  Gibbon  tgtttta-tgt-----a-ga-a-------------------------
B D                  Rhesus  tgtttta-tgt-----a-gaca-------------------------
B D     Crab-eating macaque  tgtttta-tgt-----a-gaca-------------------------
B D                  Baboon  tgtttta-tgt-----a-gaca-------------------------
B D            Green monkey  tgtttta-tgt-----a-gaca-------------------------
B D                Marmoset  tgttcta-tgt-----a-gaca-------------------------
B D         Squirrel monkey  tgttcga-tgt-----a-gaca-------------------------
B D                Bushbaby  tgttcca-tgt-----acaaga-------------------------
         Chinese tree shrew  tggcttt-tgc-----a-caga-------------------------
B D                Squirrel  catttta-cgtgcaac-------------------------------
               Prairie vole  -----tg-tgtttagc-------------------------------
             Golden hamster  ---------gtct----------------------------------
B D                     Rat  -----tg-tgttcagg-------------------------------
B D                  Rabbit  tgtttta-tgt------------------------------------
B D                    Pika  tacttaa-tgttgaac-------------------------------
B D                     Pig  ----tag-agt-----c------------------------------
B D                  Alpaca  ----ttg-agt-----c------------------------------
             Bactrian camel  ----ttg-agt-----c------------------------------
B D                 Dolphin  ----tcg-agt-----c------------------------------
               Killer whale  ----tcg-agt-----c------------------------------
B D                   Sheep  ----gca-tgc-----c------------------------------
              Domestic goat  ----gca-tgc-----c------------------------------
B D                   Horse  tattttg-cat-----c------------------------------
B D        White rhinoceros  ggttttg-tgt-----c------------------------------
B D                     Cat  tgtttcg-tgt-----t------------------------------
B D                     Dog  tgtaaca-ggt-----g------------------------------
B D                 Ferret   tgttttg-tgt-----t------------------------------
B D                   Panda  tgttttg-tgt-----t------------------------------
             Pacific walrus  tgtttcc-ggt-----t------------------------------
               Weddell seal  tgtttcc-ggt-----t------------------------------
           Black flying-fox  tgttttg-tgt-----c------------------------------
B D                 Megabat  tgttttg-tat-----c------------------------------
              Big brown bat  tgttctg-tgt-----c------------------------------
       David's myotis (bat)  tgttttg-tgt-----c------------------------------
B D                Microbat  tgttttg-tgt-----c------------------------------
            Star-nosed mole  tgttttg-gtt-----c------------------------------
B D                Elephant  tgcttta-tgg-----a-----gttttctcatgttatctccacaaca
B D                 Manatee  tgcttca-tgg-----a-----gttttcccatggtatctccacaaca
           Cape golden mole  tgcttca-tgg-----a-----gttttc-catggtagttctgcaata
                   Aardvark  tgtttca-tgg-----a-----gttttc-catggtatctccacaaca
B D               Armadillo  tccttcaccta-----a-----cctttcccaggctagccccacagcc
B D                Hedgehog  ===============================================
B D              Guinea pig  -----------------------------------------------
B D                   Shrew  ===============================================
          Brush-tailed rat  -----------------------------------------------
B D             Stickleback  -----------------------------------------------
    Yellowbelly pufferfish  ===============================================
B D                    Fugu  ===============================================
B D                  Turkey  ===============================================
B D                 Chicken  ===============================================
  D            Mallard duck  ===============================================
        Tibetan ground jay  ===============================================
B D             Zebra finch  ===============================================
  D  White-throated sparrow  ===============================================
B D         Tasmanian devil  ===============================================
B D               Zebrafish  ===============================================
B D           X. tropicalis  ===============================================
  D         Green seaturtle  ===============================================
B D      American alligator  ===============================================
B D              Budgerigar  ===============================================
B D                 Opossum  ===============================================
                Chinchilla  -----------------------------------------------
B D          Naked mole-rat  -----------------------------------------------
    Lesser Egyptian jerboa  ===============================================
  D             Rock pigeon  ===============================================
  D     Collared flycatcher  ===============================================
B D     Medium ground finch  ===============================================
B D                  Lizard  -----------------------------------------------
  D        Peregrine falcon  -----------------------------------------------
  D            Saker falcon  ===============================================
       Cape elephant shrew  ===============================================
B D                Platypus  ===============================================
B D                 Wallaby  ===============================================
B D         Chinese hamster  ===============================================
B D                  Tenrec  ===============================================
B D                   Mouse  ===============================================
          Tibetan antelope  ===============================================
B D                     Cow  ===============================================

Inserts between block 28 and 29 in window
        Chinese tree shrew 1bp
B D               Squirrel 1bp
              Prairie vole 2bp
            Golden hamster 2bp
B D                    Rat 1bp
B D                 Rabbit 3bp
B D                   Pika 12bp
B D                    Pig 4bp
B D                 Alpaca 4bp
            Bactrian camel 4bp
B D                Dolphin 4bp
              Killer whale 4bp
B D                  Sheep 6bp
             Domestic goat 6bp
B D                  Horse 4bp
B D       White rhinoceros 4bp
B D                    Cat 4bp
B D                    Dog 14bp
B D                Ferret  4bp
B D                  Panda 4bp
            Pacific walrus 4bp
              Weddell seal 4bp
          Black flying-fox 4bp
B D                Megabat 4bp
             Big brown bat 4bp
      David's myotis (bat) 4bp
B D               Microbat 4bp
           Star-nosed mole 4bp

Alignment block 29 of 977 in window, 6776447 - 6776453, 7 bps 
B D                   Human  gctca----at
B D                   Chimp  gctca----at
B D                 Gorilla  gctca----at
B D               Orangutan  gctca----at
B D                  Gibbon  gctca----at
B D                  Rhesus  gctca----at
B D     Crab-eating macaque  gctca----at
B D                  Baboon  gctca----at
B D            Green monkey  gctca----at
B D                Marmoset  gctca----at
B D         Squirrel monkey  gctca----at
B D                Bushbaby  actcc----at
         Chinese tree shrew  gtttg----at
B D                Squirrel  actct----at
               Prairie vole  -ctcagggggg
             Golden hamster  -ctggctaaat
B D                   Mouse  gctca--gggg
B D                     Rat  gctca--gggg
B D          Naked mole-rat  --tca----gt
B D              Guinea pig  -ttca----at
                 Chinchilla  -ttca----at
           Brush-tailed rat  -ttca----gt
B D                  Rabbit  actca----gt
B D                    Pika  gctcc----tt
B D                     Pig  -ttcc----at
B D                  Alpaca  -ttcc----at
             Bactrian camel  -ttcc----ac
B D                 Dolphin  -ttcc----aa
               Killer whale  -ttcc----aa
B D                   Sheep  -tctc----ta
              Domestic goat  -tctc----ta
B D                   Horse  -ttcc----ct
B D        White rhinoceros  -ttcc----at
B D                     Cat  -ttcc----at
B D                 Ferret   -gaac----ag
B D                   Panda  -ttcc----ag
             Pacific walrus  -gtcc----gg
               Weddell seal  -gtcc----ag
           Black flying-fox  -tccc----at
B D                 Megabat  -tccc----at
              Big brown bat  -tccc----ac
       David's myotis (bat)  -tctc----at
B D                Microbat  -tccc----at
            Star-nosed mole  -ttcc----at
B D                Elephant  tttcg----at
B D                 Manatee  ttttg----at
           Cape golden mole  attcg----at
                   Aardvark  att--------
B D               Armadillo  tctca----ct
B D                Hedgehog  ===========
B D                   Shrew  ===========
B D             Stickleback  -----------
    Yellowbelly pufferfish  ===========
B D                    Fugu  ===========
B D                  Turkey  ===========
B D                 Chicken  ===========
  D            Mallard duck  ===========
        Tibetan ground jay  ===========
B D             Zebra finch  ===========
  D  White-throated sparrow  ===========
B D         Tasmanian devil  ===========
B D               Zebrafish  ===========
B D           X. tropicalis  ===========
  D         Green seaturtle  ===========
B D      American alligator  ===========
B D              Budgerigar  ===========
B D                 Opossum  ===========
    Lesser Egyptian jerboa  ===========
  D             Rock pigeon  ===========
  D     Collared flycatcher  ===========
B D     Medium ground finch  ===========
B D                  Lizard  -----------
  D        Peregrine falcon  -----------
  D            Saker falcon  ===========
       Cape elephant shrew  ===========
B D                Platypus  ===========
B D                 Wallaby  ===========
B D         Chinese hamster  ===========
B D                  Tenrec  ===========
          Tibetan antelope  ===========
B D                     Dog  ===========
B D                     Cow  ===========

Inserts between block 29 and 30 in window
B D                    Pig 21bp
B D                 Alpaca 22bp
            Bactrian camel 22bp
B D                Dolphin 22bp
              Killer whale 22bp
B D                  Sheep 129bp
             Domestic goat 129bp
B D                  Horse 22bp
B D       White rhinoceros 22bp
B D                    Cat 21bp
B D                Ferret  22bp
B D                  Panda 24bp
            Pacific walrus 22bp
              Weddell seal 22bp
          Black flying-fox 21bp
B D                Megabat 20bp
             Big brown bat 21bp
      David's myotis (bat) 21bp
B D               Microbat 21bp
           Star-nosed mole 22bp

Alignment block 30 of 977 in window, 6776454 - 6776472, 19 bps 
B D                   Human  gagagagatactg---------------------------------------------------------
B D                   Chimp  gagagaaatactg---------------------------------------------------------
B D                 Gorilla  gagagagatactg---------------------------------------------------------
B D               Orangutan  gagagagatacca---------------------------------------------------------
B D                  Gibbon  gagagagatactg---------------------------------------------------------
B D                  Rhesus  gagaaagatactg---------------------------------------------------------
B D     Crab-eating macaque  gagaaagata--g---------------------------------------------------------
B D                  Baboon  gagaaagatactg---------------------------------------------------------
B D            Green monkey  gagaaagatactg---------------------------------------------------------
B D                Marmoset  gagagaaatactg---------------------------------------------------------
B D         Squirrel monkey  gagagagataccg---------------------------------------------------------
B D                Bushbaby  ggtagagatgtta---------------------------------------------------------
         Chinese tree shrew  gggagaacgtttg---------------------------------------------------------
B D                Squirrel  tggagagattgtt------acctccatt--------------------------------------ttat
               Prairie vole  acgtgatactgtc------attc-----------------------------------------------
             Golden hamster  atctgagactctg------a--------------------------------------------------
B D                   Mouse  gagagagactgac------atct-----------------------------------------------
B D                     Rat  aagagggattgtc------attt-----------------------------------------------
B D          Naked mole-rat  gggagacataatt------acccccact------------------------------------------
B D              Guinea pig  ggaagag--agtt------atccctgtt------------------------------------------
                 Chinchilla  ggaagagatagtt------atccttgct------------------------------------------
           Brush-tailed rat  agaagagatagta------atccctgctttacaaaaagaggggctggggaaatggctcagtggaataagc
B D                  Rabbit  aagagagatcatgtgacccacccctgtt------------------------------------------
B D                    Pika  ggaagagttagcgtg----agctctgtg------------------------------------------
B D                     Pig  gggagggatagtg---------------------------------------------------------
B D                  Alpaca  gggagagagactg---------------------------------------------------------
             Bactrian camel  gggagagagactg---------------------------------------------------------
B D                 Dolphin  gggagagagattg---------------------------------------------------------
               Killer whale  gggagagagattg---------------------------------------------------------
           Tibetan antelope  gggagaaatattg---------------------------------------------------------
B D                     Cow  gggagaaatactg---------------------------------------------------------
B D                   Sheep  gggagaaatattg---------------------------------------------------------
              Domestic goat  gggagaaatattg---------------------------------------------------------
B D                   Horse  gggagagagacta---------------------------------------------------------
B D        White rhinoceros  gggagagatatta---------------------------------------------------------
B D                     Cat  gggagag--actg---------------------------------------------------------
B D                     Dog  ggaa------------------------------------------------------------------
B D                 Ferret   ggaagag--attg---------------------------------------------------------
B D                   Panda  gggagag--atgg---------------------------------------------------------
             Pacific walrus  gggagag--attg---------------------------------------------------------
               Weddell seal  gggagag--attg---------------------------------------------------------
           Black flying-fox  gggagat---ttt---------------------------------------------------------
B D                 Megabat  gggagat---ttt---------------------------------------------------------
              Big brown bat  gcgagat--gctt---------------------------------------------------------
       David's myotis (bat)  gtgagat--gctt---------------------------------------------------------
B D                Microbat  gcgagat--gctt---------------------------------------------------------
            Star-nosed mole  ggcagat--actg---------------------------------------------------------
B D                Elephant  gagggagatctta---------------------------------------------------------
B D                 Manatee  gagagaggtctta---------------------------------------------------------
           Cape golden mole  cagagag-tctta---------------------------------------------------------
B D               Armadillo  ggacaagatatta---------------------------------------------------------
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Stickleback  ----------------------------------------------------------------------
    Yellowbelly pufferfish  ======================================================================
B D                    Fugu  ======================================================================
B D                  Turkey  ======================================================================
B D                 Chicken  ======================================================================
  D            Mallard duck  ======================================================================
        Tibetan ground jay  ======================================================================
B D             Zebra finch  ======================================================================
  D  White-throated sparrow  ======================================================================
B D         Tasmanian devil  ======================================================================
B D               Zebrafish  ======================================================================
B D           X. tropicalis  ======================================================================
  D         Green seaturtle  ======================================================================
B D      American alligator  ======================================================================
B D              Budgerigar  ======================================================================
B D                 Opossum  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
  D             Rock pigeon  ======================================================================
  D     Collared flycatcher  ======================================================================
B D     Medium ground finch  ======================================================================
B D                  Lizard  ----------------------------------------------------------------------
  D        Peregrine falcon  ----------------------------------------------------------------------
  D            Saker falcon  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D         Chinese hamster  ======================================================================
                  Aardvark  ----------------------------------------------------------------------
B D                  Tenrec  ======================================================================

                      Human  ----------------------------------------------------------------------
                      Chimp  ----------------------------------------------------------------------
                    Gorilla  ----------------------------------------------------------------------
                  Orangutan  ----------------------------------------------------------------------
                     Gibbon  ----------------------------------------------------------------------
                     Rhesus  ----------------------------------------------------------------------
        Crab-eating macaque  ----------------------------------------------------------------------
                     Baboon  ----------------------------------------------------------------------
               Green monkey  ----------------------------------------------------------------------
                   Marmoset  ----------------------------------------------------------------------
            Squirrel monkey  ----------------------------------------------------------------------
                   Bushbaby  ----------------------------------------------------------------------
         Chinese tree shrew  ----------------------------------------------------------------------
                   Squirrel  gttttgttttgtttttgtggtgctggggattgaacccagggccttgagcttgtgaggcaggctctctacc
               Prairie vole  ----------------------------------------------------------------------
             Golden hamster  ----------------------------------------------------------------------
                      Mouse  ----------------------------------------------------------------------
                        Rat  ----------------------------------------------------------------------
             Naked mole-rat  ----------------------------------------------------------------------
                 Guinea pig  ----------------------------------------------------------------------
                 Chinchilla  ----------------------------------------------------------------------
           Brush-tailed rat  gcttccttggcaagcccaagggcctgagttcaagc-----------------------------------
                     Rabbit  ----------------------------------------------------------------------
                       Pika  ----------------------------------------------------------------------
                        Pig  ----------------------------------------------------------------------
                     Alpaca  ----------------------------------------------------------------------
             Bactrian camel  ----------------------------------------------------------------------
                    Dolphin  ----------------------------------------------------------------------
               Killer whale  ----------------------------------------------------------------------
           Tibetan antelope  ----------------------------------------------------------------------
                        Cow  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
              Domestic goat  ----------------------------------------------------------------------
                      Horse  ----------------------------------------------------------------------
           White rhinoceros  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                        Dog  ----------------------------------------------------------------------
                    Ferret   ----------------------------------------------------------------------
                      Panda  ----------------------------------------------------------------------
             Pacific walrus  ----------------------------------------------------------------------
               Weddell seal  ----------------------------------------------------------------------
           Black flying-fox  ----------------------------------------------------------------------
                    Megabat  ----------------------------------------------------------------------
              Big brown bat  ----------------------------------------------------------------------
       David's myotis (bat)  ----------------------------------------------------------------------
                   Microbat  ----------------------------------------------------------------------
            Star-nosed mole  ----------------------------------------------------------------------
                   Elephant  ----------------------------------------------------------------------
                    Manatee  ----------------------------------------------------------------------
           Cape golden mole  ----------------------------------------------------------------------
                  Armadillo  ----------------------------------------------------------------------
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                Stickleback  ----------------------------------------------------------------------
     Yellowbelly pufferfish  ======================================================================
                       Fugu  ======================================================================
                     Turkey  ======================================================================
                    Chicken  ======================================================================
               Mallard duck  ======================================================================
         Tibetan ground jay  ======================================================================
                Zebra finch  ======================================================================
     White-throated sparrow  ======================================================================
            Tasmanian devil  ======================================================================
                  Zebrafish  ======================================================================
              X. tropicalis  ======================================================================
            Green seaturtle  ======================================================================
         American alligator  ======================================================================
                 Budgerigar  ======================================================================
                    Opossum  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                Rock pigeon  ======================================================================
        Collared flycatcher  ======================================================================
        Medium ground finch  ======================================================================
                     Lizard  ----------------------------------------------------------------------
           Peregrine falcon  ----------------------------------------------------------------------
               Saker falcon  ======================================================================
        Cape elephant shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
            Chinese hamster  ======================================================================
                   Aardvark  ----------------------------------------------------------------------
                     Tenrec  ======================================================================

                      Human  -------------------------------ttac------------cc
                      Chimp  -------------------------------ttac------------cc
                    Gorilla  -------------------------------ttac------------cc
                  Orangutan  -------------------------------ttac------------cc
                     Gibbon  -------------------------------ttac------------cc
                     Rhesus  -------------------------------ttac------------cc
        Crab-eating macaque  -------------------------------ttac------------cc
                     Baboon  -------------------------------ttac------------cc
               Green monkey  -------------------------------ttac------------cc
                   Marmoset  -------------------------------ttac------------cc
            Squirrel monkey  -------------------------------ttac------------cc
                   Bushbaby  -------------------------------ttac------------ct
         Chinese tree shrew  -------------------------------ttac------------ct
                   Squirrel  agctgagctgtaaacccagcccacccccattttat------------gg
               Prairie vole  --------------------------ctgctttac------------ag
             Golden hamster  ----------------------------ggttgac------------ct
                      Mouse  --------------------------gtgctttac------------ag
                        Rat  --------------------------ctgtttcac------------ag
             Naked mole-rat  -------------------------------ttac-------------a
                 Guinea pig  -------------------------------ttac------------aa
                 Chinchilla  -------------------------------ttac------------aa
           Brush-tailed rat  --------------------------tctggttccgccaaaaaaaaaaa
                     Rabbit  -------------------------------ttac------------ag
                       Pika  -------------------------------aatg------------tg
                        Pig  -------------------------------ttgc------------cc
                     Alpaca  -------------------------------ttgc------------cc
             Bactrian camel  -------------------------------ttgc------------cc
                    Dolphin  -------------------------------ttgt------------cc
               Killer whale  -------------------------------ttgt------------cc
           Tibetan antelope  -------------------------------ttgt------------ct
                        Cow  -------------------------------ttgt------------ct
                      Sheep  -------------------------------ttgt------------ct
              Domestic goat  -------------------------------ttgt------------ct
                      Horse  -------------------------------tcat------------ct
           White rhinoceros  -------------------------------ttac------------cc
                        Cat  -------------------------------tcac------------cc
                        Dog  -------------------------------------------------
                    Ferret   -------------------------------ttgc------------cc
                      Panda  -------------------------------ttac------------cc
             Pacific walrus  -------------------------------ttgc------------cc
               Weddell seal  -------------------------------ttgc------------cc
           Black flying-fox  -------------------------------tac---------------
                    Megabat  -------------------------------acg---------------
              Big brown bat  -------------------------------tat---------------
       David's myotis (bat)  -------------------------------tct---------------
                   Microbat  -------------------------------tat---------------
            Star-nosed mole  -------------------------------tcac------------cc
                   Elephant  -------------------------------tttc------------ct
                    Manatee  -------------------------------ttac------------ct
           Cape golden mole  -------------------------------ttat------------gt
                  Armadillo  -------------------------------ccac------------tt
                   Hedgehog  =================================================
                      Shrew  =================================================
                Stickleback  -------------------------------------------------
     Yellowbelly pufferfish  =================================================
                       Fugu  =================================================
                     Turkey  =================================================
                    Chicken  =================================================
               Mallard duck  =================================================
         Tibetan ground jay  =================================================
                Zebra finch  =================================================
     White-throated sparrow  =================================================
            Tasmanian devil  =================================================
                  Zebrafish  =================================================
              X. tropicalis  =================================================
            Green seaturtle  =================================================
         American alligator  =================================================
                 Budgerigar  =================================================
                    Opossum  =================================================
     Lesser Egyptian jerboa  =================================================
                Rock pigeon  =================================================
        Collared flycatcher  =================================================
        Medium ground finch  =================================================
                     Lizard  -------------------------------------------------
           Peregrine falcon  -------------------------------------------------
               Saker falcon  =================================================
        Cape elephant shrew  =================================================
                   Platypus  =================================================
                    Wallaby  =================================================
            Chinese hamster  =================================================
                   Aardvark  -------------------------------------------------
                     Tenrec  =================================================

Inserts between block 30 and 31 in window
B D                    Pig 13bp
B D                 Alpaca 13bp
            Bactrian camel 13bp
B D                Dolphin 13bp
              Killer whale 13bp
          Tibetan antelope 13bp
B D                    Cow 13bp
B D                  Sheep 13bp
             Domestic goat 13bp
B D                  Horse 9bp
B D       White rhinoceros 9bp
B D                    Cat 12bp
B D                Ferret  213bp
B D                  Panda 10bp
            Pacific walrus 7bp
              Weddell seal 7bp
          Black flying-fox 4bp
B D                Megabat 3bp
             Big brown bat 4bp
      David's myotis (bat) 4bp
B D               Microbat 4bp
           Star-nosed mole 13bp

Alignment block 31 of 977 in window, 6776473 - 6776502, 30 bps 
B D                   Human  c--------------gaag--actttc--tcaaa-------------acagc--tgggaagtg
B D                   Chimp  c--------------gaag--actttc--tcaaa-------------acagc--tgggaagtg
B D                 Gorilla  c--------------gaag--actttc--tcaaa-------------acagc--tgggaagtg
B D               Orangutan  ct-------------gaag--actttc--tcaaa-------------acagc--tgggaagtg
B D                  Gibbon  tc-------------gaag--actttc--tcaaa-------------acagt--tgggaagtg
B D                  Rhesus  ct-------------gaag--actttc--tcaaa-------------acacc--tgggaagtg
B D     Crab-eating macaque  ct-------------gaag--actttc--tcaaa-------------acacc--tgggaagtg
B D                  Baboon  ct-------------gaag--actttc--tcaaa-------------acacc--tgggaagtg
B D            Green monkey  cc-------------gaag--acattc--tcaaa-------------acacc--tgggaagtg
B D                Marmoset  gt-------------gaag--actttc--tcaaa--------gtcacacagc--tgggaagtg
B D         Squirrel monkey  ct-------------gaag--actttc--tcgaa--------gtcacacagc--tgggaaatg
B D                Bushbaby  ctgt--tttaggga-gaaggaaatttc--tcaac--------gtcacacagc--tgggaagta
         Chinese tree shrew  gctg--tacaga---gaagcacctttc--tcagcgtcaccctgtcacgtagc--tggggagtg
B D                Squirrel  a--------------gaaggaatgttc--tcaaa--------gtcacacagc--tgggacatg
               Prairie vole  a--------------gaaggcgtggtc--tcaag--------gtggtaccac--cgggagatg
             Golden hamster  t--------------gaactcctgaac--cagtg--------atctttctgc--ctctacctc
B D                   Mouse  a--------------gaaggagta--t--tcaag--------gtcacaccac--tgccaaatg
B D                     Rat  a--------------gaagggatg--t--tcaag--------gtcacgccactttgagaaatg
B D          Naked mole-rat  a--------------aaaagaacattc--tcaaa--------gttacacagc---agaaagtg
B D              Guinea pig  a--------------aaaagaatgttc--tcaaa--------atcacacagc---aggaaatg
                 Chinchilla  a--------------aaagggatgttt--tcaaa--------atcacatagc---aggaagtg
           Brush-tailed rat  a--------------aaaggaatgttc--tcaaa--------atcacatagc---agaaagtg
B D                  Rabbit  a--------------ggaggaactttc--ttaca-----------------c---agcaagtg
B D                    Pika  a--------------gcagaaactttc--acaaa----------------------------g
B D                     Pig  ----------------aaggaacttgc--ccaaa--------gtcacacagc--tgggaagcg
B D                  Alpaca  ----------------aaggaactttc--ccaag--------gtcgccctgc--tgagaagtg
             Bactrian camel  ----------------aaggaactttc--ccaag--------gtcaccctgc--tgagaagtg
B D                 Dolphin  ----------------aaggaactttc--ccaaa--------gtcacagagc--tgggaagtg
               Killer whale  ----------------aaggaattttc--ccaaa--------gtcacagagc--tgggaagtg
           Tibetan antelope  ----------------aaggaactttc--tcaaa--------gtcacatagc--tgggaagag
B D                     Cow  ----------------aaggagctttc--tcaaa--------gtcacatagc--tgggaagag
B D                   Sheep  ----------------aaggaactgtc--tcaaa--------gtcacatagc--tgggaagag
              Domestic goat  ----------------aaggaactttc--tcaaa--------gtcacatagc--tgggaagag
B D                   Horse  ----------------agagaactttc--ccaaa--------gtcacacagc--tgggaaacg
B D        White rhinoceros  ----------------agagaactctc--ccaaa--------gtcacacagc--tgggaagtg
B D                     Cat  ----------------gaaagaatttc--tcaaa---------tcacacagc--tgggaagta
B D                     Dog  ------------------aggaatttc--ttgaa---------tcacacagt--tgggaagtg
B D                 Ferret   ----------------gaagggattttgcttaag---------tcacacggc--cagcaagtg
B D                   Panda  ----------------gaagggatttc---caac---------tcacagggc--tgggaagcg
             Pacific walrus  ----------------gaaggaatttc--tcaaa---------tcacaggcc--tgggaagtg
               Weddell seal  ----------------gaaggaatttc--tcaaa---------tcacaggcc--tgggaagtg
           Black flying-fox  ----------------gaggagctttc--ctaaa--------gtcacgtagc--tgctaagtg
B D                 Megabat  -------------------gagctttc--ct-aa--------gtcacgtagc--tgct-agtg
              Big brown bat  ----------------gaggaacattc--ccaga--------gccacacaca--tgagaagtg
       David's myotis (bat)  ----------------gaggaacattc--ccaaa--------gtcacacacc--ggggaagtg
B D                Microbat  ----------------gaggaacattc--ccaaa--------gtcacacccc--agggaagtg
            Star-nosed mole  ----------------aaggagctctc--gcaag--------gtcacacagc--tgggatgcg
B D                Elephant  --tggtttcacaaagagggaaacattt--ccaga--------gtcacacagt--taagaagtt
B D                 Manatee  --ttgtttcaccaagagggaaactttt--ccaaa--------ggcacacagt--tgggaagtt
           Cape golden mole  --ctgtttcat--agagagaagctttt--ccaaa--------gtcacacatt--t-ggaagtt
                   Aardvark  ---tgtttcatagacagggaaac--tt--ccaaa--------gtcacacagt--tgggaagtt
B D               Armadillo  ---tgttttacatagaaggaagctttc--ccaaa--------gtcac-------tgggaagtg
B D                Hedgehog  ===============================================================
B D                   Shrew  ===============================================================
B D             Stickleback  ---------------------------------------------------------------
    Yellowbelly pufferfish  ===============================================================
B D                    Fugu  ===============================================================
B D                  Turkey  ===============================================================
B D                 Chicken  ===============================================================
  D            Mallard duck  ===============================================================
        Tibetan ground jay  ===============================================================
B D             Zebra finch  ===============================================================
  D  White-throated sparrow  ===============================================================
B D         Tasmanian devil  ===============================================================
B D               Zebrafish  ===============================================================
B D           X. tropicalis  ===============================================================
  D         Green seaturtle  ===============================================================
B D      American alligator  ===============================================================
B D              Budgerigar  ===============================================================
B D                 Opossum  ===============================================================
    Lesser Egyptian jerboa  ===============================================================
  D             Rock pigeon  ===============================================================
  D     Collared flycatcher  ===============================================================
B D     Medium ground finch  ===============================================================
B D                  Lizard  ---------------------------------------------------------------
  D        Peregrine falcon  ---------------------------------------------------------------
  D            Saker falcon  ===============================================================
       Cape elephant shrew  ===============================================================
B D                Platypus  ===============================================================
B D                 Wallaby  ===============================================================
B D         Chinese hamster  ===============================================================
B D                  Tenrec  ===============================================================

Alignment block 32 of 977 in window, 6776503 - 6776519, 17 bps 
B D                   Human  ccagactc-tggg-tctaa
B D                   Chimp  ccagactc-tggg-tctaa
B D                 Gorilla  ccagactc-tggg-tctaa
B D               Orangutan  ccagactc-tggg-tctaa
B D                  Gibbon  ccagactc-tggg-tctaa
B D                  Rhesus  ccagactc-tggg-tctaa
B D     Crab-eating macaque  ccagactc-tggg-tctaa
B D                  Baboon  ccaggctc-tggg-tctaa
B D            Green monkey  ccagactc-tggg-tctaa
B D                Marmoset  ccagactc-aggg-tctaa
B D         Squirrel monkey  ccagactc-aggg-tctaa
B D                Bushbaby  ccagactc-aggg-tctga
         Chinese tree shrew  ctaatctc-aagg--ctaa
B D                Squirrel  ccagactc-attg-tctaa
               Prairie vole  ctaggccc--ggg-tctaa
             Golden hamster  caagtgct--ggg-attac
B D                   Mouse  ctagagtc-atgg-tctaa
B D                     Rat  ctagactc-aggg-tctaa
B D          Naked mole-rat  ccaggctc-----------
B D              Guinea pig  tcagactc-cagg-actaa
                 Chinchilla  ccatactg---ag-actaa
           Brush-tailed rat  ccagactc---ag-actaa
B D                  Rabbit  tcaggc-c-aggg-tctac
B D                    Pika  tcaggctc-aggg-tctgg
B D                     Pig  ccaga-tt-gggc-tctaa
B D                  Alpaca  ccggactt-ggg--tctaa
             Bactrian camel  ccagactt-ggg--tctaa
B D                 Dolphin  ccagactt-ggg--gctga
               Killer whale  ccagactt-ggg--gctaa
           Tibetan antelope  ccagg-tt-ggg--gctaa
B D                     Cow  ccagg-tt-ggg--gctaa
B D                   Sheep  ccagg-tt-ggg--gctaa
              Domestic goat  ccagg-tt-ggg--gctaa
B D                   Horse  ccaggctc-gggg-tctaa
B D        White rhinoceros  ccaggctc-gagg-tctaa
B D                     Cat  ccagcctc-gggg-tctaa
B D                     Dog  ccagcctc-gagg-tctga
B D                 Ferret   ccagcctt-gggg-cctaa
B D                   Panda  ccagcctc-gggg-tctaa
             Pacific walrus  cccgcctc-gggg-tctaa
               Weddell seal  ccagcctc-gggg-tctaa
           Black flying-fox  ccagactc-ggag-tctaa
B