Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 248 in window, 62371214 - 62371216, 3 bps 
B D                     Human  t------gt---
B D                     Chimp  t------gt---
B D                   Gorilla  t------gt---
B D                 Orangutan  t------gt---
B D                    Gibbon  t------gt---
B D                    Rhesus  c------gt---
B D       Crab-eating macaque  t------gt---
B D                    Baboon  t------gt---
B D              Green monkey  t------gt---
B D                  Marmoset  a------gt---
B D           Squirrel monkey  a------gt---
B D                  Bushbaby  t------gt---
           Chinese tree shrew  c------ga---
B D                       Cat  c-----------
B D                       Dog  c-----------
B D                     Panda  c-----------
               Pacific walrus  c-----------
             Black flying-fox  ------------
B D                   Megabat  ------------
B D                   Opossum  tctcttggg---
B D           Tasmanian devil  -------gg---
  D               Rock pigeon  ------ggt---
  D    White-throated sparrow  ------agccat
B D               Zebra finch  ------acc---
           Tibetan ground jay  ------ggtcct
B D                Budgerigar  ------ctctgt
  D                    Parrot  ------gacttc
  D             Scarlet macaw  ------ggctgc
  D           Green seaturtle  ------agctgt
  D            Painted turtle  ------ggaaat
  D  Chinese softshell turtle  ------ggcaaa
B D                    Medaka  ============
      Yellowbelly pufferfish  ============
          Southern platyfish  ============
B D                 Zebrafish  ============
B D                      Fugu  ============
         Pundamilia nyererei  ============
  D          Peregrine falcon  ============
B D              Atlantic cod  ============
    Mexican tetra (cavefish)  ============
B D                    Turkey  ============
  D              Saker falcon  ============
B D                 Tetraodon  ============
B D                   Chicken  ============
  D       Collared flycatcher  ============
                 Spotted gar  ============
                 Zebra mbuna  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D        American alligator  ============
B D             X. tropicalis  ============
B D       Medium ground finch  ============
B D                     Shrew  ============
              Golden hamster  ============
B D                       Rat  ============
            Brush-tailed rat  ============
                  Chinchilla  ============
B D                Guinea pig  ============
B D            Naked mole-rat  ============
B D                      Pika  ============
B D                     Mouse  ============
B D                    Tenrec  ============
         Cape elephant shrew  ============
               Big brown bat  ============
      Lesser Egyptian jerboa  ============
B D                  Hedgehog  ============
B D           Chinese hamster  ============
            Tibetan antelope  ============
B D                  Platypus  ============
B D                     Sheep  ------------
                Killer whale  ============
              Bactrian camel  ------------
B D                    Alpaca  ------------
               Domestic goat  ------------
B D                       Cow  ------------
B D                   Ferret   ------------
B D                  Squirrel  ============
                Prairie vole  ============
B D                   Manatee  ============
B D                  Elephant  ------------
B D                 Armadillo  ------------
B D                   Dolphin  ============
                    Aardvark  ------------
            Cape golden mole  ============
B D                  Microbat  ============
        David's myotis (bat)  ============
                Weddell seal  ------------
B D          White rhinoceros  ------------
B D                     Horse  ------------

Inserts between block 1 and 2 in window
  D   White-throated sparrow 18bp
B D              Zebra finch 10bp
          Tibetan ground jay 21bp
B D               Budgerigar 41bp
  D                   Parrot 12bp
  D            Scarlet macaw 48bp

Alignment block 2 of 248 in window, 62371217 - 62371249, 33 bps 
B D                     Human  gtgtgcc-------c----agctcac----aggccacgca------------------------gcc---
B D                     Chimp  gtgtgcc-------c----agctcac----aggccacgca------------------------gcc---
B D                   Gorilla  gtgtgcc-------c----agctcac----aggccacaca------------------------gcc---
B D                 Orangutan  gtgtgac-------c----agctca-------------ca------------------------gcc---
B D                    Gibbon  gtgtgcc-------c----agctcat----gggccacaca------------------------gcc---
B D                    Rhesus  gtgtgcc-------c----agttcac----gggccacaca------------------------gcc---
B D       Crab-eating macaque  gtgtgcc-------c----agttcac----gggccacaca------------------------gcc---
B D                    Baboon  gtgtgcc-------c----agctcac----gggccacaca------------------------gcc---
B D              Green monkey  gtgtgcc-------c----agctcac----gggccacaca------------------------gcc---
B D                  Marmoset  gtgtgcc-------c----agctcat----gggccaca--------------------------------
B D           Squirrel monkey  gtgtgcc-------c----agctcgt----gggccacaca------------------------gcc---
B D                  Bushbaby  gtgcacc-------c----tgtgcac----ag--------------------------------------
           Chinese tree shrew  g-gtgtc-------c----agcatga----ggaccagtag------------------------gcc---
B D                       Cat  -----cc-------c----aga------------------------------------------------
B D                       Dog  -----cc-------c----agg------------------------------------------------
B D                     Panda  -----cc-------c----aga------------------------------------------------
               Pacific walrus  -----cc-------c----aga------------------------------------------------
B D                  Elephant  --gctccaggagggc----acctcac----cagctgccca---tgcccaactgtccaccacacagcc---
                     Aardvark  --gctccaggagggc----atctcac----cagctgccca---c--------------------acc---
B D                 Armadillo  --tcctc-------c----atcttct----cttcaggcca---g--------------------tcc---
B D                   Opossum  ctgggct------------agccgag----gcgctctccc------------------------------
B D           Tasmanian devil  cagggcc-------ccccaagtcaga----gagccacccctgg---------------------------
  D               Rock pigeon  --------------g----agggcag----cagctccacc------------------------ctg---
  D              Saker falcon  --------------c----cagcacc----cagctgtccc------------------------tcc---
  D          Peregrine falcon  --------------c----cagcacc----cagctgtccc------------------------tcc---
  D    White-throated sparrow  --------------g----agatcaa----gggcaggaca------------------------tgc---
B D               Zebra finch  --------------c----tgttcct----gtgcaaaaca------------------------tga---
           Tibetan ground jay  --------------g----ggtgccc----ccaccaccca------------------------agg---
B D                Budgerigar  --------------t----cactgcc--------------------------------------------
  D                    Parrot  --------------c----catcccc---caaaaggcaca------------------------ag----
  D             Scarlet macaw  --------------c----cgctcacatgtggacgggatg------------------------aggggg
B D        American alligator  --------------g----aaagcca----ccgccgcccg------------------------tgc---
  D           Green seaturtle  ---------------------------agggggcaagagg------------------------cgc---
  D            Painted turtle  ---------------------------gggggccaagagc------------------------tgg---
  D  Chinese softshell turtle  ---------------------------gccgtctgggagc------------------------tcc---
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Atlantic cod  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Turkey  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D       Collared flycatcher  ======================================================================
                 Spotted gar  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
B D                       Rat  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
               Big brown bat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Hedgehog  ======================================================================
B D           Chinese hamster  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Platypus  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
                Killer whale  ======================================================================
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
               Domestic goat  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------
B D                   Ferret   ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
                Prairie vole  ======================================================================
B D                   Manatee  ======================================================================
B D                   Dolphin  ======================================================================
            Cape golden mole  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                   Megabat  ----------------------------------------------------------------------
            Black flying-fox  ----------------------------------------------------------------------
                Weddell seal  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                     Horse  ----------------------------------------------------------------------

                        Human  ----------ccagg--------------------------
                        Chimp  ----------ccagg--------------------------
                      Gorilla  ----------ccagg--------------------------
                    Orangutan  ----------ccagg--------------------------
                       Gibbon  ----------ccagg--------------------------
                       Rhesus  ----------ccagg--------------------------
          Crab-eating macaque  ----------ccagg--------------------------
                       Baboon  ----------ccagg--------------------------
                 Green monkey  ----------ccagg--------------------------
                     Marmoset  -----------------------------------------
              Squirrel monkey  ----------ccagg--------------------------
                     Bushbaby  -----------------------------------------
           Chinese tree shrew  -----agagtccagg--------------------------
                          Cat  -----------------------------------------
                          Dog  -----------------------------------------
                        Panda  -----------------------------------------
               Pacific walrus  -----------------------------------------
                     Elephant  ----------cctgg--------------------------
                     Aardvark  ----------ccagg--------------------------
                    Armadillo  ----------ccacg--------------------------
                      Opossum  -----------------------------------------
              Tasmanian devil  -----------------------------------------
                  Rock pigeon  ----------------cgctc--------------------
                 Saker falcon  ----------------tgccc--------------------
             Peregrine falcon  ----------------tgccc--------------------
       White-throated sparrow  ----------------aggtc-agag-----------aggg
                  Zebra finch  ----------------ag--c-a------------------
           Tibetan ground jay  ----------------ggttc-g------------------
                   Budgerigar  ----------------aggtc--------------------
                       Parrot  ----------------acccc-a----------------ag
                Scarlet macaw  tcgtggaggaggaggaagccc--------------------
           American alligator  ----------------caccc--------------------
              Green seaturtle  ----------------tggct--------------------
               Painted turtle  ----------------gggcg-agcggctcatctccccgag
     Chinese softshell turtle  ----------------tggcttggcattgcatcccgcactg
                       Medaka  =========================================
       Yellowbelly pufferfish  =========================================
           Southern platyfish  =========================================
                    Zebrafish  =========================================
                         Fugu  =========================================
          Pundamilia nyererei  =========================================
                 Atlantic cod  =========================================
     Mexican tetra (cavefish)  =========================================
                       Turkey  =========================================
                    Tetraodon  =========================================
                      Chicken  =========================================
          Collared flycatcher  =========================================
                  Spotted gar  =========================================
                  Zebra mbuna  =========================================
        Burton's mouthbreeder  =========================================
          Princess of Burundi  =========================================
                X. tropicalis  =========================================
          Medium ground finch  =========================================
                        Shrew  =========================================
               Golden hamster  =========================================
                          Rat  =========================================
             Brush-tailed rat  =========================================
                   Chinchilla  =========================================
                   Guinea pig  =========================================
               Naked mole-rat  =========================================
                         Pika  =========================================
                        Mouse  =========================================
                       Tenrec  =========================================
          Cape elephant shrew  =========================================
                Big brown bat  =========================================
       Lesser Egyptian jerboa  =========================================
                     Hedgehog  =========================================
              Chinese hamster  =========================================
             Tibetan antelope  =========================================
                     Platypus  =========================================
                        Sheep  -----------------------------------------
                 Killer whale  =========================================
               Bactrian camel  -----------------------------------------
                       Alpaca  -----------------------------------------
                Domestic goat  -----------------------------------------
                          Cow  -----------------------------------------
                      Ferret   -----------------------------------------
                     Squirrel  =========================================
                 Prairie vole  =========================================
                      Manatee  =========================================
                      Dolphin  =========================================
             Cape golden mole  =========================================
                     Microbat  =========================================
         David's myotis (bat)  =========================================
                      Megabat  -----------------------------------------
             Black flying-fox  -----------------------------------------
                 Weddell seal  -----------------------------------------
             White rhinoceros  -----------------------------------------
                        Horse  -----------------------------------------

Inserts between block 2 and 3 in window
B D                      Cat 8bp
              Pacific walrus 32bp

Alignment block 3 of 248 in window, 62371250 - 62371256, 7 bps 
B D                     Human  caccact-----
B D                     Chimp  caccact-----
B D                   Gorilla  caccact-----
B D                 Orangutan  caccact-----
B D                    Gibbon  caccact-----
B D                    Rhesus  caccact-----
B D       Crab-eating macaque  caccact-----
B D                    Baboon  caccact-----
B D              Green monkey  caccact-----
B D           Squirrel monkey  caccact-----
           Chinese tree shrew  ctccacc-----
B D                       Dog  --atgct-----
B D                     Panda  ----act-----
B D                  Elephant  cactgct-----
                     Aardvark  cactgct-----
B D                 Armadillo  ------t-----
  D               Rock pigeon  -----ccctggc
  D              Saker falcon  ------ttgcac
  D          Peregrine falcon  ------ttgcac
  D    White-throated sparrow  -----tggggat
B D                Budgerigar  -----cttggtt
  D                    Parrot  -----ctttgcc
  D             Scarlet macaw  -----ctttccg
B D        American alligator  --------tgct
  D            Painted turtle  -----ccc----
  D  Chinese softshell turtle  -----ccctgc-
B D                    Medaka  ============
      Yellowbelly pufferfish  ============
          Southern platyfish  ============
B D                 Zebrafish  ============
B D                      Fugu  ============
         Pundamilia nyererei  ============
B D              Atlantic cod  ============
    Mexican tetra (cavefish)  ============
B D                    Turkey  ============
B D                 Tetraodon  ============
B D                   Chicken  ============
  D       Collared flycatcher  ============
                 Spotted gar  ============
                 Zebra mbuna  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
  D           Green seaturtle  ------------
          Tibetan ground jay  ------------
B D             X. tropicalis  ============
B D       Medium ground finch  ============
B D               Zebra finch  ------------
B D                     Shrew  ============
              Golden hamster  ============
B D                       Rat  ============
B D           Tasmanian devil  ------------
            Brush-tailed rat  ============
                  Chinchilla  ============
B D                Guinea pig  ============
B D            Naked mole-rat  ============
B D                      Pika  ============
B D                     Mouse  ============
B D                    Tenrec  ============
         Cape elephant shrew  ============
               Big brown bat  ============
      Lesser Egyptian jerboa  ============
B D                  Hedgehog  ============
B D           Chinese hamster  ============
            Tibetan antelope  ============
B D                  Platypus  ============
B D                   Opossum  ------------
              Pacific walrus  ============
B D                       Cat  ============
B D                     Sheep  ------------
                Killer whale  ============
              Bactrian camel  ------------
B D                    Alpaca  ------------
               Domestic goat  ------------
B D                       Cow  ------------
B D                   Ferret   ------------
B D                  Squirrel  ============
                Prairie vole  ============
B D                  Bushbaby  ------------
B D                   Manatee  ============
B D                  Marmoset  ------------
B D                   Dolphin  ============
            Cape golden mole  ============
B D                  Microbat  ============
        David's myotis (bat)  ============
B D                   Megabat  ------------
            Black flying-fox  ------------
                Weddell seal  ------------
B D          White rhinoceros  ------------
B D                     Horse  ------------

Alignment block 4 of 248 in window, 62371257 - 62371278, 22 bps 
B D                     Human  cacg-g--------------gg--------------------------cagg-------cc---------
B D                     Chimp  cacg-g--------------gg--------------------------cagg-------cc---------
B D                   Gorilla  cacg-g--------------gg--------------------------cagg-------cc---------
B D                 Orangutan  caca-g--------------gg--------------------------cagg-------cc---------
B D                    Gibbon  cacg-g--------------gg--------------------------cagg-------cc---------
B D                    Rhesus  catg-g--------------gg--------------------------aggc-------cc---------
B D       Crab-eating macaque  catg-g--------------gg--------------------------aggc-------cc---------
B D                    Baboon  catg-g--------------gg--------------------------aggc-------cc---------
B D              Green monkey  catg-g--------------gg--------------------------aggc-------cc---------
B D                  Marmoset  ------------------------------------------------cagc-------cc---------
B D           Squirrel monkey  caca-g--------------gg--------------------------cagc-------cc---------
B D                  Bushbaby  --------------------------------------------------ga-------cc---------
           Chinese tree shrew  atgg-a--------------cg--------------------------ccct-------ac---------
B D                    Alpaca  --------------------ca--------------------------aggc-------tg---------
               Bactrian camel  --------------------ca--------------------------aggc-------cg---------
                 Killer whale  ----------------------------------------------------------------------
B D                       Cow  --------------------ca--------------------------aggg-------cc---------
B D                     Sheep  --------------------ca--------------------------aggg-------cc---------
                Domestic goat  --------------------ca--------------------------aggg-------cc---------
B D                     Horse  -------------------------------------------------agc-------ac---------
B D          White rhinoceros  ------------------------------------------------gggc-------gt---------
B D                       Cat  --------------------ag--------------------------ggat-------cc---------
B D                       Dog  caga-aat-----------acg--------------------------gggcttcatgacc---------
B D                   Ferret   -----------------------------------------------------------cc---------
B D                     Panda  ccg----------------gga--------------------------gggt-------cc---------
                 Weddell seal  --------------------ca--------------------------aggc-------cc---------
             Black flying-fox  ---------------------------------------------------------catg---------
B D                   Megabat  ---------------------------------------------------------catg---------
B D                  Elephant  aaaa-g--------------ta--------------------------aagg-------cc---------
                     Aardvark  cgggta--------------cg--------------------------cagg-------cc---------
B D                 Armadillo  ggaa-a--------------gc--------------------------cagg-------ct---------
B D                   Opossum  ------gctctcttgggccaggt-------------------------gagc-------cgaggcgctct
B D           Tasmanian devil  ------gtatggttggggcagg--------------------------gagc-------ca---------
B D                  Platypus  ----------------------ca------------------------cggc-------cc---------
  D               Rock pigeon  -----------------------tgg----------------------gggc-------tg---------
  D              Saker falcon  -----------------------cgt----------------------g----------ct---------
  D          Peregrine falcon  -----------------------cgt----------------------g----------ct---------
  D    White-throated sparrow  -----------------------gat----------------------gtgt-------ca---------
B D               Zebra finch  ------------------------------------------------gtgc-------cc---------
           Tibetan ground jay  -------------------------t----------------------gagg-------ct---------
B D                Budgerigar  -----------------------ggt----------------------gtca-------cc---------
  D                    Parrot  -----------------------tct----------------tcaacagccc-------cc---------
  D             Scarlet macaw  -----------------------tatgggaaggggtcagggatcatccgtcc-------cc---------
B D        American alligator  -----------------------gat----------------------ggac-------cc---------
  D           Green seaturtle  ------------------------------------------------gggc-------tg---------
  D            Painted turtle  -------------------------a----------------------gggc-------tg-gcacatta
  D  Chinese softshell turtle  ------------------------ag----------------------gggc-------cg---------
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Atlantic cod  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Turkey  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D       Collared flycatcher  ======================================================================
                 Spotted gar  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
B D                       Rat  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
               Big brown bat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Hedgehog  ======================================================================
B D           Chinese hamster  ======================================================================
            Tibetan antelope  ======================================================================
              Pacific walrus  ======================================================================
B D                  Squirrel  ======================================================================
                Prairie vole  ======================================================================
B D                   Manatee  ======================================================================
B D                   Dolphin  ======================================================================
            Cape golden mole  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================

                        Human  ---------ctc------------cac--aga---
                        Chimp  ---------ctc------------cac--aga---
                      Gorilla  ---------ctc------------cac--aga---
                    Orangutan  ---------ctc------------cac--aga---
                       Gibbon  ---------ctc------------cac--aga---
                       Rhesus  ---------ctc------------cac--aga---
          Crab-eating macaque  ---------ctc------------cac--aga---
                       Baboon  ---------ctc------------cac--aga---
                 Green monkey  ---------ctc------------cac--aga---
                     Marmoset  ---------ctc------------cag--aga---
              Squirrel monkey  ---------ctc------------cag--aga---
                     Bushbaby  ---------ctc------------aag--gga---
           Chinese tree shrew  ---------tcc------------cct--ggc---
                       Alpaca  ---------ctc------------ctt--------
               Bactrian camel  ---------ctc------------ctt--------
                 Killer whale  --------------------------c--------
                          Cow  ---------ttc------------ctc--------
                        Sheep  ---------ttc------------ctc--------
                Domestic goat  ---------ttc------------ctc--------
                        Horse  ---------ctc------------ctc--------
             White rhinoceros  ---------ctc------------ctc--------
                          Cat  ---------ctc------------tc---------
                          Dog  ---------ctc------------cgcgg------
                      Ferret   ---------cta------------ctc--------
                        Panda  ---------ctg------------tct-g------
                 Weddell seal  ---------cta------------ccc--------
             Black flying-fox  ---------ctc------------ccc--------
                      Megabat  ---------ctc------------ccc--------
                     Elephant  ---------ctc-----------------------
                     Aardvark  ---------ctc------------cac--------
                    Armadillo  -----------------------------------
                      Opossum  cctgctctcttg------------g----------
              Tasmanian devil  ---------ctg------------g----------
                     Platypus  ---------cgc------------tcc--------
                  Rock pigeon  ---------cag------------tgt-----gga
                 Saker falcon  ---------tag------------cac-----agg
             Peregrine falcon  ---------tag------------cac-----agg
       White-throated sparrow  ---------cag------------cac-----agc
                  Zebra finch  ---------ttg------------aat--------
           Tibetan ground jay  ---------ggg------------aac--------
                   Budgerigar  ---------tgg------------aac-----cgg
                       Parrot  --------acag------------agg-----cat
                Scarlet macaw  ---------tgg------------cag-----cag
           American alligator  ---------ggggggccctgccgcagc-----cgg
              Green seaturtle  -----------g------------gcc-----cat
               Painted turtle  aagcccccgctg------------gcc-----cag
     Chinese softshell turtle  ---------ctg------------gcc-----aat
                       Medaka  ===================================
       Yellowbelly pufferfish  ===================================
           Southern platyfish  ===================================
                    Zebrafish  ===================================
                         Fugu  ===================================
          Pundamilia nyererei  ===================================
                 Atlantic cod  ===================================
     Mexican tetra (cavefish)  ===================================
                       Turkey  ===================================
                    Tetraodon  ===================================
                      Chicken  ===================================
          Collared flycatcher  ===================================
                  Spotted gar  ===================================
                  Zebra mbuna  ===================================
        Burton's mouthbreeder  ===================================
          Princess of Burundi  ===================================
                X. tropicalis  ===================================
          Medium ground finch  ===================================
                        Shrew  ===================================
               Golden hamster  ===================================
                          Rat  ===================================
             Brush-tailed rat  ===================================
                   Chinchilla  ===================================
                   Guinea pig  ===================================
               Naked mole-rat  ===================================
                         Pika  ===================================
                        Mouse  ===================================
                       Tenrec  ===================================
          Cape elephant shrew  ===================================
                Big brown bat  ===================================
       Lesser Egyptian jerboa  ===================================
                     Hedgehog  ===================================
              Chinese hamster  ===================================
             Tibetan antelope  ===================================
               Pacific walrus  ===================================
                     Squirrel  ===================================
                 Prairie vole  ===================================
                      Manatee  ===================================
                      Dolphin  ===================================
             Cape golden mole  ===================================
                     Microbat  ===================================
         David's myotis (bat)  ===================================

Inserts between block 4 and 5 in window
B D                      Cat 2bp
B D                 Elephant 5bp
                    Aardvark 6bp
B D                Armadillo 5bp
B D                  Opossum 10bp
B D          Tasmanian devil 11bp
B D                 Platypus 8bp
  D   White-throated sparrow 1bp

Alignment block 5 of 248 in window, 62371279 - 62371287, 9 bps 
B D                     Human  ctt-ggggct------------
B D                     Chimp  cttgggggct------------
B D                   Gorilla  ctt-ggggct------------
B D                 Orangutan  ctt-ggggct------------
B D                    Gibbon  cct-ggggct------------
B D                    Rhesus  ctt-ggggct------------
B D       Crab-eating macaque  ctt-ggggct------------
B D                    Baboon  ctt-ggggct------------
B D              Green monkey  ctt-ggggct------------
B D                  Marmoset  ctt-ggggct------------
B D           Squirrel monkey  ctt-ggcagc------------
B D                  Bushbaby  ctc-agggct------------
           Chinese tree shrew  cat-ggtgct------------
               Golden hamster  ctc-atggtt------------
B D                       Dog  --------ca------------
B D                     Panda  --------cc------------
B D                  Elephant  ctt-ggact-------------
                     Aardvark  gct-ggact-------------
B D                 Armadillo  ctg-g---c-------------
B D                   Opossum  ct--------------------
B D           Tasmanian devil  ct--------------------
B D                  Platypus  ccc-gg----------------
  D               Rock pigeon  --------tg---ctgat--gc
  D              Saker falcon  --------ct---ttggg--ga
  D          Peregrine falcon  --------ct---ttggg--ga
  D    White-throated sparrow  --------tg---caggg--ca
B D               Zebra finch  --------tt---caggg--ca
           Tibetan ground jay  --------ct---cccgg----
B D                Budgerigar  --------cc---cagga--t-
  D                    Parrot  --------tt---ccagg--ag
  D             Scarlet macaw  --------ct---cccgc--tc
B D        American alligator  --------ct---tgggc--gt
  D           Green seaturtle  --------cc---ctcct--gc
  D            Painted turtle  --------ccgctcccct--cc
  D  Chinese softshell turtle  --------tc---cagctgggc
B D                    Medaka  ======================
      Yellowbelly pufferfish  ======================
          Southern platyfish  ======================
B D                 Zebrafish  ======================
B D                      Fugu  ======================
         Pundamilia nyererei  ======================
B D              Atlantic cod  ======================
    Mexican tetra (cavefish)  ======================
B D                    Turkey  ======================
B D                 Tetraodon  ======================
B D                   Chicken  ======================
  D       Collared flycatcher  ======================
                 Spotted gar  ======================
                 Zebra mbuna  ======================
       Burton's mouthbreeder  ======================
         Princess of Burundi  ======================
B D             X. tropicalis  ======================
B D       Medium ground finch  ======================
B D                     Shrew  ======================
B D                       Rat  ======================
            Brush-tailed rat  ======================
                  Chinchilla  ======================
B D                Guinea pig  ======================
B D            Naked mole-rat  ======================
B D                      Pika  ======================
B D                     Mouse  ======================
B D                    Tenrec  ======================
         Cape elephant shrew  ======================
               Big brown bat  ======================
      Lesser Egyptian jerboa  ======================
B D                  Hedgehog  ======================
B D           Chinese hamster  ======================
            Tibetan antelope  ======================
              Pacific walrus  ======================
B D                       Cat  ======================
B D                     Sheep  ----------------------
                Killer whale  ----------------------
              Bactrian camel  ----------------------
B D                    Alpaca  ----------------------
               Domestic goat  ----------------------
B D                       Cow  ----------------------
B D                   Ferret   ----------------------
B D                  Squirrel  ======================
                Prairie vole  ======================
B D                   Manatee  ======================
B D                   Dolphin  ======================
            Cape golden mole  ======================
B D                  Microbat  ======================
        David's myotis (bat)  ======================
B D                   Megabat  ----------------------
            Black flying-fox  ----------------------
                Weddell seal  ----------------------
B D          White rhinoceros  ----------------------
B D                     Horse  ----------------------

Inserts between block 5 and 6 in window
B D                      Dog 7bp
B D                    Panda 2bp

Alignment block 6 of 248 in window, 62371288 - 62371302, 15 bps 
B D                     Human  ct-------------t-caaagccttcca------------------
B D                     Chimp  ct-------------t-caaagccttcca------------------
B D                   Gorilla  ct-------------t-caaagccttcca------------------
B D                 Orangutan  ct-------------t-caaagccttcca------------------
B D                    Gibbon  ct-------------t-caaagccttcca------------------
B D                    Rhesus  ct-------------t-cagagccttcca------------------
B D       Crab-eating macaque  ct-------------t-cagagccttcca------------------
B D                    Baboon  ct-------------t-cagagccttcca------------------
B D              Green monkey  ct-------------t-cagagccttcca------------------
B D                  Marmoset  ct-------------t-cagagccttcca------------------
B D           Squirrel monkey  cc-------------a-cagagccttcca------------------
B D                  Bushbaby  ct-------------t-cagagttgtcca------------------
           Chinese tree shrew  ct-------------agctgagtgtggtg------------------
               Golden hamster  ct-------------t-tagaaccttcag------------------
B D                Guinea pig  ct-------------t-caaagcctt-gg------------------
B D                    Alpaca  ---------------t-gggagccttctg------------------
               Bactrian camel  ---------------t-gggagccttctg------------------
                 Killer whale  ---------------t-gggaaccttctg------------------
B D                       Cow  ---------------c-aggagcattctg------------------
B D                     Sheep  ---------------c-aggagcattctg------------------
                Domestic goat  ---------------c-aggagcattctg------------------
B D                     Horse  ---------------t-gggagccttctg------------------
B D          White rhinoceros  ---------------t-gggagccttctg------------------
B D                       Dog  --agtgacatcaatgt-gcacggagtcct------------------
B D                   Ferret   ---------------t-gggagccttctg------------------
B D                     Panda  ----------ctctgt-gcccagctccca------------------
                 Weddell seal  ---------------t-gggaggcttctg------------------
             Black flying-fox  ---------------a-gagc--------------------------
B D                   Megabat  ---------------a-gagc--------------------------
B D                  Elephant  cc-------------t-cagagcccct--------------------
                     Aardvark  ct-------------t-cagagccttt--------------------
B D                 Armadillo  ca-------------g-cagagctcat--------------------
B D                   Opossum  ---------------g-aggcgctctcct------------------
B D           Tasmanian devil  -----------tgcaa-acacacgcttct------------------
B D                  Platypus  -------------------------cccg------------------
  D               Rock pigeon  ---------------------------tg-----acccacgcgt--g
  D              Saker falcon  ---------------------------ca-----gcc----------
  D          Peregrine falcon  ---------------------------ca-----gcc----------
  D    White-throated sparrow  ---------------------------ggcagaagcaaa--------
B D               Zebra finch  ---------------------------gt-----acaaa--------
           Tibetan ground jay  ----------------------------------gcacg--------
  D                    Parrot  ---------------------------ct-----ccac---------
  D             Scarlet macaw  ---------------------------tt-----cccc---------
B D        American alligator  ---------------------------ct-----gccatgtcgttaa
  D           Green seaturtle  ---------------------------ct-----gtct---------
  D            Painted turtle  ---------------------------ca-----gcct---------
  D  Chinese softshell turtle  ---------------------------ga-----gtct---------
B D                    Medaka  ===============================================
      Yellowbelly pufferfish  ===============================================
          Southern platyfish  ===============================================
B D                 Zebrafish  ===============================================
B D                      Fugu  ===============================================
         Pundamilia nyererei  ===============================================
B D              Atlantic cod  ===============================================
    Mexican tetra (cavefish)  ===============================================
B D                    Turkey  ===============================================
B D                Budgerigar  -----------------------------------------------
B D                 Tetraodon  ===============================================
B D                   Chicken  ===============================================
  D       Collared flycatcher  ===============================================
                 Spotted gar  ===============================================
                 Zebra mbuna  ===============================================
       Burton's mouthbreeder  ===============================================
         Princess of Burundi  ===============================================
B D             X. tropicalis  ===============================================
B D       Medium ground finch  ===============================================
B D                     Shrew  ===============================================
B D                       Rat  ===============================================
            Brush-tailed rat  ===============================================
                  Chinchilla  ===============================================
B D            Naked mole-rat  ===============================================
B D                      Pika  ===============================================
B D                     Mouse  ===============================================
B D                    Tenrec  ===============================================
         Cape elephant shrew  ===============================================
               Big brown bat  ===============================================
      Lesser Egyptian jerboa  ===============================================
B D                  Hedgehog  ===============================================
B D           Chinese hamster  ===============================================
            Tibetan antelope  ===============================================
              Pacific walrus  ===============================================
B D                       Cat  ===============================================
B D                  Squirrel  ===============================================
                Prairie vole  ===============================================
B D                   Manatee  ===============================================
B D                   Dolphin  ===============================================
            Cape golden mole  ===============================================
B D                  Microbat  ===============================================
        David's myotis (bat)  ===============================================

Inserts between block 6 and 7 in window
B D                    Horse 19bp
B D         White rhinoceros 19bp
B D                      Dog 37bp
B D                  Ferret  19bp
                Weddell seal 19bp
B D                 Elephant 2bp
                    Aardvark 2bp
B D                Armadillo 2bp
B D                  Opossum 9bp
B D          Tasmanian devil 8bp

Alignment block 7 of 248 in window, 62371303 - 62371316, 14 bps 
B D                     Human  ggccag--gcaccatg---------
B D                     Chimp  ggccag--gcaccatg---------
B D                   Gorilla  ggccag--gcaccata---------
B D                 Orangutan  gtccag--gcgccatg---------
B D                    Gibbon  ggccag--gcgccatg---------
B D                    Rhesus  ggccag--gcaccatg---------
B D       Crab-eating macaque  ggccag--gcatcatg---------
B D                    Baboon  ggccag--gcaccatg---------
B D              Green monkey  ggccag--gcaccatg---------
B D                  Marmoset  ggccag--g----------------
B D           Squirrel monkey  ggccag--g----------------
B D                  Bushbaby  gggcgg--g---ctgg---------
           Chinese tree shrew  gcctct--gccccttg---------
               Golden hamster  gcctgg--gcaccatg---------
B D                Guinea pig  ctctag--gcatcgtg---------
B D                    Alpaca  -accct--g----------------
               Bactrian camel  -accct--g----------------
                 Killer whale  -agcc--------------------
B D                       Cow  -tccct--g----------------
B D                     Sheep  -tccct--g----------------
                Domestic goat  -tccct--g----------------
B D                     Horse  gtcccc--a----------------
B D          White rhinoceros  gtccac--c----------------
B D                       Dog  gtcccc--t----------------
B D                   Ferret   ttccct--g----------------
                 Weddell seal  gtccct--g----------------
B D                  Elephant  cactgg--g----------------
                     Aardvark  c-cagt--g----------------
B D                 Armadillo  ccccct--t----------------
B D                   Opossum  ggccaggcgagcagag---------
B D           Tasmanian devil  gcccag--gaacccca---------
B D                  Platypus  gccccg--gcaggacc---------
  D               Rock pigeon  -------------gtgc---ccatg
  D    White-throated sparrow  --------------------cccaa
B D               Zebra finch  --------------------ccagc
           Tibetan ground jay  --------------------ccagg
  D             Scarlet macaw  --------------------ctgga
B D        American alligator  -------------gtgcacactggc
B D                    Medaka  =========================
      Yellowbelly pufferfish  =========================
          Southern platyfish  =========================
B D                 Zebrafish  =========================
B D                      Fugu  =========================
         Pundamilia nyererei  =========================
  D          Peregrine falcon  -------------------------
B D              Atlantic cod  =========================
    Mexican tetra (cavefish)  =========================
B D                    Turkey  =========================
  D              Saker falcon  -------------------------
  D                    Parrot  -------------------------
B D                Budgerigar  -------------------------
B D                 Tetraodon  =========================
B D                   Chicken  =========================
  D       Collared flycatcher  =========================
                 Spotted gar  =========================
                 Zebra mbuna  =========================
       Burton's mouthbreeder  =========================
         Princess of Burundi  =========================
  D           Green seaturtle  -------------------------
  D            Painted turtle  -------------------------
B D             X. tropicalis  =========================
B D       Medium ground finch  =========================
  D  Chinese softshell turtle  -------------------------
B D                     Shrew  =========================
B D                       Rat  =========================
            Brush-tailed rat  =========================
                  Chinchilla  =========================
B D            Naked mole-rat  =========================
B D                      Pika  =========================
B D                     Mouse  =========================
B D                    Tenrec  =========================
         Cape elephant shrew  =========================
               Big brown bat  =========================
      Lesser Egyptian jerboa  =========================
B D                  Hedgehog  =========================
B D           Chinese hamster  =========================
B D                     Panda  -------------------------
            Tibetan antelope  =========================
              Pacific walrus  =========================
B D                       Cat  =========================
B D                  Squirrel  =========================
                Prairie vole  =========================
B D                   Manatee  =========================
B D                   Dolphin  =========================
            Cape golden mole  =========================
B D                  Microbat  =========================
        David's myotis (bat)  =========================
B D                   Megabat  -------------------------
            Black flying-fox  -------------------------

Inserts between block 7 and 8 in window
              Golden hamster 12bp
B D                   Alpaca 20bp
              Bactrian camel 20bp
                Killer whale 7bp
B D                      Cow 20bp
B D                    Sheep 20bp
               Domestic goat 20bp
B D                    Horse 4bp
B D         White rhinoceros 4bp
B D                      Dog 4bp
B D                  Ferret  4bp
                Weddell seal 4bp

Alignment block 8 of 248 in window, 62371317 - 62371331, 15 bps 
B D                     Human  ccaggagcat----ggcca-----------
B D                     Chimp  ccaggagcat----ggcca-----------
B D                   Gorilla  ccagaagcat----ggcca-----------
B D                 Orangutan  ccaggagcat----ggcca-----------
B D                    Gibbon  ccaggagcgt----ggcca-----------
B D                    Rhesus  cccggagcat----ggcca-----------
B D       Crab-eating macaque  cccggagcat----gg--------------
B D                    Baboon  cccggagcat----ggcca-----------
B D              Green monkey  cccagagcat----ggcca-----------
B D                  Marmoset  -----agcat----ggcca-----------
B D           Squirrel monkey  -----agcat----ggccg-----------
B D                  Bushbaby  cacacagcgtagtcggtca-----------
           Chinese tree shrew  gctgatgttg----gggtg-----------
B D                Guinea pig  ctgagacccc----ggccc-----------
                 Killer whale  ----------------ccg-----------
             Tibetan antelope  ----------------ctg-----------
B D                     Horse  ----------------gct-----------
B D          White rhinoceros  ----------------cct-----------
B D                       Cat  ----------------cct-----------
B D                       Dog  ----------------aca-----------
B D                   Ferret   ----------------cct-----------
                 Weddell seal  ----------------cct-----------
B D                  Elephant  cccagagcct----ggccc-----------
                     Aardvark  cccagagccc----agcct-----------
B D                 Armadillo  cccggagcct--------------------
B D                   Opossum  ----gcgctc----tcccg-----------
B D           Tasmanian devil  ----ccgcgt----gaccg-----------
B D                  Platypus  ccaacctccg----ggccc-----------
  D               Rock pigeon  ---------------gctgcaggggtag-a
  D              Saker falcon  ----------------ctataggacgtgct
  D          Peregrine falcon  ----------------ctataggacgtgct
  D    White-throated sparrow  ---------------gccacgaggc----a
B D               Zebra finch  ---------------actgggaggc----a
           Tibetan ground jay  ---------------gctgcggagtccg-a
B D                Budgerigar  ----------------ctggggcttg----
  D                    Parrot  ----------------ttgcttcctaag-a
  D             Scarlet macaw  ---------------gctgcagcctgaa-a
B D        American alligator  ---------------tcgttagcaccgg--
  D           Green seaturtle  ----------------ctggaggttgtg--
  D            Painted turtle  ----------------cccgccgct-----
  D  Chinese softshell turtle  ----------------cggcccacc-----
B D                    Medaka  ==============================
      Yellowbelly pufferfish  ==============================
          Southern platyfish  ==============================
B D                 Zebrafish  ==============================
B D                      Fugu  ==============================
         Pundamilia nyererei  ==============================
B D              Atlantic cod  ==============================
    Mexican tetra (cavefish)  ==============================
B D                    Turkey  ==============================
B D                 Tetraodon  ==============================
B D                   Chicken  ==============================
  D       Collared flycatcher  ==============================
                 Spotted gar  ==============================
                 Zebra mbuna  ==============================
       Burton's mouthbreeder  ==============================
         Princess of Burundi  ==============================
B D             X. tropicalis  ==============================
B D       Medium ground finch  ==============================
B D                     Shrew  ==============================
              Golden hamster  ==============================
B D                       Rat  ==============================
            Brush-tailed rat  ==============================
                  Chinchilla  ==============================
B D            Naked mole-rat  ==============================
B D                      Pika  ==============================
B D                     Mouse  ==============================
B D                    Tenrec  ==============================
         Cape elephant shrew  ==============================
               Big brown bat  ==============================
      Lesser Egyptian jerboa  ==============================
B D                  Hedgehog  ==============================
B D           Chinese hamster  ==============================
B D                     Panda  ------------------------------
              Pacific walrus  ==============================
B D                     Sheep  ==============================
              Bactrian camel  ==============================
B D                    Alpaca  ==============================
               Domestic goat  ==============================
B D                       Cow  ==============================
B D                  Squirrel  ==============================
                Prairie vole  ==============================
B D                   Manatee  ==============================
B D                   Dolphin  ==============================
            Cape golden mole  ==============================
B D                  Microbat  ==============================
        David's myotis (bat)  ==============================
B D                   Megabat  ------------------------------
            Black flying-fox  ------------------------------

Inserts between block 8 and 9 in window
B D               Guinea pig 10bp
                Killer whale 12bp
            Tibetan antelope 12bp
B D                    Horse 5bp
B D         White rhinoceros 5bp
B D                      Cat 5bp
B D                      Dog 5bp
B D                  Ferret  5bp
                Weddell seal 5bp
B D                 Elephant 2bp
                    Aardvark 2bp
B D                  Opossum 4bp
B D          Tasmanian devil 4bp

Alignment block 9 of 248 in window, 62371332 - 62371342, 11 bps 
B D                     Human  cc---------------------------gcctt-----------a-------ggg---------
B D                     Chimp  cc---------------------------gcctt-----------a-------ggg---------
B D                   Gorilla  cc---------------------------gcctt-----------a-------ggg---------
B D                 Orangutan  ct---------------------------gcctt-----------a-------ggg---------
B D                    Gibbon  cc---------------------------gcctc-----------a-------ggg---------
B D                    Rhesus  cc---------------------------acctt-----------a-------gtg---------
B D       Crab-eating macaque  cc---------------------------acctt-----------a-------gtg---------
B D                    Baboon  cc---------------------------acctt-----------a-------gtg---------
B D              Green monkey  cc---------------------------acctt-----------a-------gtg---------
B D                  Marmoset  cc---------------------------atctt-----------a-------ggg---------
B D           Squirrel monkey  cc---------------------------atctt-----------a-------ggg---------
B D                  Bushbaby  ct---------------------------atccc-----------a-------ggg---------
           Chinese tree shrew  cc---------------------------tcttt-----------gtggggtctgg---------
B D           Chinese hamster  --------------------------------cc-----------a-------------------
               Golden hamster  --------------------------------tc-----------c-------------------
B D                Guinea pig  ct---------------------------gtctt-----------a-------------------
B D                    Alpaca  ct---------------------------gctgg-------------------------------
               Bactrian camel  ct---------------------------gccgg-------------------------------
                 Killer whale  ct---------------------------gcctg-------------------------------
             Tibetan antelope  ct---------------------------gcctg-------------------------------
B D                       Cow  ct---------------------------gcctg-------------------------------
B D                     Sheep  ct---------------------------gcctg-------------------------------
                Domestic goat  ct---------------------------gccta-------------------------------
B D                     Horse  at---------------------------gcccagctcaac------------------------
B D          White rhinoceros  at---------------------------gcccaaatc---------------------------
B D                       Cat  gt---------------------------gcccagtcctca------------------------
B D                       Dog  ggcgactccggatgagtgtaggaga----gcccttctccgaatga--------------------
B D                   Ferret   gt---------------------------gcccagctccca------------------------
               Pacific walrus  -----------------------------gcccaggcccca------------------------
                 Weddell seal  at---------------------------gcccagccccca------------------------
B D                  Elephant  -------ttttacaatggagggacca--ggg----------------------------------
                     Aardvark  -------tgtcactacagagggacca--ggg----------------------------------
B D                 Armadillo  -------ttgtatta--------------gt----------------------------------
B D                   Opossum  ----------------------------------------------------cctg---------
B D           Tasmanian devil  ----------------------------------------------------ccac---------
B D                  Platypus  ---------------------gccccttggcg---------------------------------
  D               Rock pigeon  -------------------------------------------------------g-gag-gtgg
  D              Saker falcon  -------------------------------------------------------ccgtg-ctgg
  D          Peregrine falcon  -------------------------------------------------------ccgtg-ctgg
  D    White-throated sparrow  -------------------------------------------------------gtgtg-ctca
B D               Zebra finch  -------------------------------------------------------cttagacctg
           Tibetan ground jay  -------------------------------------------------------gctcc-cccg
B D                Budgerigar  ---------------------------------------------------------gcc-tctg
  D                    Parrot  -------------------------------------------------------ctcca-ccat
  D             Scarlet macaw  -------------------------------------------------------tcgtg-tcct
B D        American alligator  ---------------------------------------------------------gca-ctgg
  D           Green seaturtle  ---------------------------------------------------------cca-gccg
  D            Painted turtle  ----------------------------------------------------------ca-gcag
  D  Chinese softshell turtle  ----------------------------------------------------------ca-gc--
B D                    Medaka  =================================================================
      Yellowbelly pufferfish  =================================================================
          Southern platyfish  =================================================================
B D                 Zebrafish  =================================================================
B D                      Fugu  =================================================================
         Pundamilia nyererei  =================================================================
B D              Atlantic cod  =================================================================
    Mexican tetra (cavefish)  =================================================================
B D                    Turkey  =================================================================
B D                 Tetraodon  =================================================================
B D                   Chicken  =================================================================
  D       Collared flycatcher  =================================================================
                 Spotted gar  =================================================================
                 Zebra mbuna  =================================================================
       Burton's mouthbreeder  =================================================================
         Princess of Burundi  =================================================================
B D             X. tropicalis  =================================================================
B D       Medium ground finch  =================================================================
B D                     Shrew  =================================================================
B D                       Rat  =================================================================
            Brush-tailed rat  =================================================================
                  Chinchilla  =================================================================
B D            Naked mole-rat  =================================================================
B D                      Pika  =================================================================
B D                     Mouse  =================================================================
B D                    Tenrec  =================================================================
         Cape elephant shrew  =================================================================
               Big brown bat  =================================================================
      Lesser Egyptian jerboa  =================================================================
B D                  Hedgehog  =================================================================
B D                     Panda  -----------------------------------------------------------------
B D                  Squirrel  =================================================================
                Prairie vole  =================================================================
B D                   Manatee  =================================================================
B D                   Dolphin  =================================================================
            Cape golden mole  =================================================================
B D                  Microbat  =================================================================
        David's myotis (bat)  =================================================================
B D                   Megabat  -----------------------------------------------------------------
            Black flying-fox  -----------------------------------------------------------------

Inserts between block 9 and 10 in window
B D                  Opossum 10bp
B D          Tasmanian devil 11bp

Alignment block 10 of 248 in window, 62371343 - 62371356, 14 bps 
B D                     Human  ctccaggagac---aa----------g
B D                     Chimp  ctccaggagac---aa----------g
B D                   Gorilla  ctccaggagac---aa----------g
B D                 Orangutan  ctccaggagac---aa----------g
B D                    Gibbon  ctccaggagac---aa----------g
B D                    Rhesus  ctccaggagac---aa----------g
B D       Crab-eating macaque  ctccaggagac---aa----------g
B D                    Baboon  caccaggagac---aa----------g
B D              Green monkey  ctccaggagac---aa----------g
B D                  Marmoset  ctcctggggac---aa----------a
B D           Squirrel monkey  ctcccggggac---aa----------a
B D                  Bushbaby  ctctgggatgc---aa----------g
           Chinese tree shrew  cttgagctggg---tg----------g
B D           Chinese hamster  cctcagggtcc---aa----------g
               Golden hamster  ctgcagacagc---ac----------a
B D                Guinea pig  ttacagaggcc---ga----------a
B D                    Alpaca  --ctgtgtgcc---ca----------g
               Bactrian camel  --ctgtgtgcc---ca----------g
                 Killer whale  --ctgtg--------------------
             Tibetan antelope  --ctctgtgcc---ca----------g
B D                       Cow  --ctctgtgcc---ca----------g
B D                     Sheep  --ctctgtgcc---ca----------g
                Domestic goat  --c---aggcc---ca----------g
B D                       Dog  -------cacg---ga----------g
B D                  Elephant  ctcagagaagc---ca----------a
                     Aardvark  ctcagaagggc----------------
B D                 Armadillo  ttctggat-------------------
B D                   Opossum  ccaggtgagcc---ga----------g
B D           Tasmanian devil  ccgggggggcccatgg----------g
B D                  Platypus  ------g--------------------
  D               Rock pigeon  ---ctggagcc---ag----------g
  D              Saker falcon  ---caggggac---aa----------g
  D          Peregrine falcon  ---caggggac---aa----------g
  D    White-throated sparrow  ---ctttctcc---aa----------g
B D               Zebra finch  ---ctggttcc---aa-----------
           Tibetan ground jay  ---cacctctc---aa----------g
B D                Budgerigar  ---ctggggac---ag--gggcagttg
  D                    Parrot  ---ttggagac---at----------g
  D             Scarlet macaw  ---ctgaaagc---ag----------g
B D        American alligator  ---ctgcaggc---at-cctacagctg
  D           Green seaturtle  ---cagggaag---aa----------g
  D            Painted turtle  ---caacaatg---gacccgcctgttg
  D  Chinese softshell turtle  --------------------------g
B D                    Medaka  ===========================
      Yellowbelly pufferfish  ===========================
          Southern platyfish  ===========================
B D                 Zebrafish  ===========================
B D                      Fugu  ===========================
         Pundamilia nyererei  ===========================
B D              Atlantic cod  ===========================
    Mexican tetra (cavefish)  ===========================
B D                    Turkey  ===========================
B D                 Tetraodon  ===========================
B D                   Chicken  ===========================
  D       Collared flycatcher  ===========================
                 Spotted gar  ===========================
                 Zebra mbuna  ===========================
       Burton's mouthbreeder  ===========================
         Princess of Burundi  ===========================
B D             X. tropicalis  ===========================
B D       Medium ground finch  ===========================
B D                     Shrew  ===========================
B D                       Rat  ===========================
            Brush-tailed rat  ===========================
                  Chinchilla  ===========================
B D            Naked mole-rat  ===========================
B D                      Pika  ===========================
B D                     Mouse  ===========================
B D                    Tenrec  ===========================
         Cape elephant shrew  ===========================
               Big brown bat  ===========================
      Lesser Egyptian jerboa  ===========================
B D                  Hedgehog  ===========================
B D                     Panda  ---------------------------
              Pacific walrus  ---------------------------
B D                       Cat  ---------------------------
B D                   Ferret   ---------------------------
B D                  Squirrel  ===========================
                Prairie vole  ===========================
B D                   Manatee  ===========================
B D                   Dolphin  ===========================
            Cape golden mole  ===========================
B D                  Microbat  ===========================
        David's myotis (bat)  ===========================
B D                   Megabat  ---------------------------
            Black flying-fox  ---------------------------
                Weddell seal  ---------------------------
B D          White rhinoceros  ---------------------------
B D                     Horse  ---------------------------

Inserts between block 10 and 11 in window
B D          Chinese hamster 8bp
              Golden hamster 8bp
B D               Guinea pig 16bp

Alignment block 11 of 248 in window, 62371357 - 62371374, 18 bps 
B D                     Human  tcacccgtgca-------ggt--gaca------------------------------
B D                     Chimp  tcacccgtgca-------ggt--gaca------------------------------
B D                   Gorilla  tcacccgtgca-------ggt--gaca------------------------------
B D                 Orangutan  tcacccgtgca-------ggt--gata------------------------------
B D                    Gibbon  tcacccgtgca-------ggt--gaca------------------------------
B D                    Rhesus  g---tcatgca-------ggt--cata------------------------------
B D       Crab-eating macaque  tcacccatgca-------ggt--cata------------------------------
B D                    Baboon  tcacccatgca-------ggt--cata------------------------------
B D              Green monkey  tcacccatgcg-------ggt--cata------------------------------
B D                  Marmoset  ctgcctgtgca-------g--------------------------------------
B D           Squirrel monkey  gcacccctgca-------g--------------------------------------
B D                  Bushbaby  tcacctatcca-------gg-------------------------------------
           Chinese tree shrew  tcactgctgtc-------agg--gcta------------------------------
B D           Chinese hamster  tcacc----------------------------------------------------
               Golden hamster  tttcc---aca-------gga----gt------------------------------
B D            Naked mole-rat  tcacctatcca-------ggt------------------------------------
B D                Guinea pig  tcgtctgtcca-------ggtggagag------------------------------
B D                    Alpaca  -----ctcaca-------ggc--caca------------------------------
               Bactrian camel  -----ctcaca-------ggc--caca------------------------------
             Tibetan antelope  -----cctaca-------ggc----ca------------------------------
B D                       Cow  -----cctaca-------ggc--caca------------------------------
B D                     Sheep  -----cctaca-------ggc--caca------------------------------
                Domestic goat  -----cctaca-------ggc--caca------------------------------
B D                     Horse  ------------------ggc--tgtg------------------------------
B D                       Cat  ------------------ggc--catg------------------------------
B D                       Dog  -----ctgcctggttctggga--gatg------------------------------
B D                   Ferret   ------------------ggc--catg------------------------------
B D                     Panda  ------------------ggc--catg------------------------------
               Pacific walrus  ------------------ggc--catg------------------------------
                 Weddell seal  ------------------ggc--catg------------------------------
B D                  Elephant  -----------------------gaag------------------------------
B D                   Opossum  --gcgc---------------------------------------------------
B D           Tasmanian devil  --gcccgtgga----------------------------------------------
B D                  Platypus  ---cccctctc-------ggg--ggtg------------------------------
  D               Rock pigeon  ----------------------acatg---gtgctgcc-----ttccccaggtgcag
  D              Saker falcon  ----------------------gcagg----------------tgatgtggtggcag
  D          Peregrine falcon  ----------------------gcagg----------------tgatgtggtggcag
  D    White-throated sparrow  ----------------------ctgcc--------------------tccggagca-
B D               Zebra finch  ------------------------------------------------ctgggaaa-
           Tibetan ground jay  ----------------------gtacc---------------------ccggggc--
B D                Budgerigar  ----------------------gtggg------------------gttcag-ggcac
  D                    Parrot  ----------------------gagac------------------actcagctgcac
  D             Scarlet macaw  ----------------------gccga------------------gctcaggggagc
B D        American alligator  ----------------------gcacacgcgggtcccca-tggccactcgcgggccg
  D           Green seaturtle  ----------------------tcacg-------ggcg--ctatgctacagagggag
  D            Painted turtle  ----------------------tcacg---gtgaggcagcccctccgttagaggcga
  D  Chinese softshell turtle  ----------------------cctca----tgctgc---ccccagtctagtgggcg
B D                    Medaka  =========================================================
      Yellowbelly pufferfish  =========================================================
          Southern platyfish  =========================================================
B D                 Zebrafish  =========================================================
B D                      Fugu  =========================================================
         Pundamilia nyererei  =========================================================
B D              Atlantic cod  =========================================================
    Mexican tetra (cavefish)  =========================================================
B D                    Turkey  =========================================================
B D                 Tetraodon  =========================================================
B D                   Chicken  =========================================================
  D       Collared flycatcher  =========================================================
                 Spotted gar  =========================================================
                 Zebra mbuna  =========================================================
       Burton's mouthbreeder  =========================================================
         Princess of Burundi  =========================================================
B D             X. tropicalis  =========================================================
B D       Medium ground finch  =========================================================
B D                     Shrew  =========================================================
B D                       Rat  =========================================================
            Brush-tailed rat  =========================================================
                  Chinchilla  =========================================================
B D                      Pika  =========================================================
B D                     Mouse  =========================================================
B D                    Tenrec  =========================================================
         Cape elephant shrew  =========================================================
               Big brown bat  =========================================================
      Lesser Egyptian jerboa  =========================================================
B D                  Hedgehog  =========================================================
                Killer whale  ---------------------------------------------------------
B D                  Squirrel  =========================================================
                Prairie vole  =========================================================
B D                   Manatee  =========================================================
B D                 Armadillo  ---------------------------------------------------------
B D                   Dolphin  =========================================================
                    Aardvark  ---------------------------------------------------------
            Cape golden mole  =========================================================
B D                  Microbat  =========================================================
        David's myotis (bat)  =========================================================
B D                   Megabat  ---------------------------------------------------------
            Black flying-fox  ---------------------------------------------------------
B D          White rhinoceros  ---------------------------------------------------------

Inserts between block 11 and 12 in window
B D                 Elephant 7bp
B D                 Platypus 3bp

Alignment block 12 of 248 in window, 62371375 - 62371409, 35 bps 
B D                     Human  t----------------------------gcct---------------cacgcct---------------
B D                     Chimp  t----------------------------gcct---------------cacgcct---------------
B D                   Gorilla  t----------------------------gcct---------------catgcct---------------
B D                 Orangutan  t----------------------------gcct---------------catgcct---------------
B D                    Gibbon  t----------------------------gcct---------------catgcct---------------
B D                    Rhesus  t----------------------------gcct---------------catgcct---------------
B D       Crab-eating macaque  t----------------------------gcct---------------catgcct---------------
B D                    Baboon  t----------------------------gcct---------------catgcct---------------
B D              Green monkey  t----------------------------gcct---------------catgcct---------------
B D                  Marmoset  -----------------------------gccg---------------agtgccc---------------
B D           Squirrel monkey  -----------------------------gcca---------------tgtgccc---------------
B D                  Bushbaby  --------------------------------------------------tgcct---------------
           Chinese tree shrew  t----------------------------ccct--------------ggaagcct---------------
B D           Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  t----------------------------gacc---------------taagggc---------------
B D            Naked mole-rat  --------------------------------c---------------tgtgcct---------------
B D                Guinea pig  t----------------------------ggcc---------------tgtgcct---------------
B D                    Alpaca  c----------------------------tccc---------------ccagagt---------------
               Bactrian camel  c----------------------------tccc---------------ccagagt---------------
B D                   Dolphin  tgcctgctgtgtgcccagctcataggccagccc---------------ccagggt---------------
                 Killer whale  -----------tgcccagctcataggccagccc---------------ccagggt---------------
             Tibetan antelope  -----------------------------gtct---------------ccagggt---------------
B D                       Cow  -----------------------------gtcc---------------ccagggt---------------
B D                     Sheep  -----------------------------gtct---------------ccagggt---------------
                Domestic goat  -----------------------------gtct---------------ccagggt---------------
B D                     Horse  -------------------------------cc---------------t---------------------
B D          White rhinoceros  -------------------------------ac---------------aggctgt---------------
B D                       Cat  -----------------------------cccc---------------tcacact---------------
B D                       Dog  -----------------------------caccattagctggaaggaaccagaaa---------------
B D                   Ferret   -----------------------------atcc---------------c---------------------
B D                     Panda  -----------------------------ctcc---------------ccagggt---------------
               Pacific walrus  -----------------------------ctcc---------------ccaggat---------------
                 Weddell seal  -----------------------------ctcc---------------ccaggat---------------
             Black flying-fox  ----------------------------------------------------------------------
B D                   Megabat  ----------------------------------------------------------------------
         David's myotis (bat)  -----------------------------------------------------ctctgggagccttgt--
B D                  Microbat  -----------------------------------------------------ctctgggagccttgt--
B D                  Elephant  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
B D                  Platypus  ----------------------------------------------------------------------
  D               Rock pigeon  -------------------------------------------------ccctgc----------cctgc
  D              Saker falcon  -------------------------------------------------cccacg----------taagc
  D          Peregrine falcon  -------------------------------------------------cccacg----------taagc
  D    White-throated sparrow  ----------------------------------------------------------------------
B D               Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
B D                Budgerigar  --------------------------------------------------------------------ga
  D                    Parrot  ----------------------------------------------------------------------
  D             Scarlet macaw  --------------------------------------------------------------------ga
B D        American alligator  -------------------------------------------------gccaggagcacgggaatggga
  D           Green seaturtle  -------------------------------------------------tgaggg------------taa
  D            Painted turtle  -------------------------------------------------tcaggg---------------
  D  Chinese softshell turtle  -------------------------------------------------ttactg---------------
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Atlantic cod  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Turkey  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D       Collared flycatcher  ======================================================================
                 Spotted gar  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                     Shrew  ======================================================================
B D                       Rat  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
               Big brown bat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Hedgehog  ======================================================================
B D                  Squirrel  ======================================================================
                Prairie vole  ======================================================================
B D                   Manatee  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ----gcc--------------ca-------ctccccg--------------------aggcccga-----
                        Chimp  ----gcc--------------ca-------ctccccg--------------------aggcccga-----
                      Gorilla  ----gcc--------------ca-------ctccccg--------------------aggcccga-----
                    Orangutan  ----g----------------------------cctg--------------------aggcccga-----
                       Gibbon  ----gcc--------------ca-------ctccccg--------------------aggcccga-----
                       Rhesus  ----gcc--------------ca-------ctccccaag--acccctg-c-------aggcccga-----
          Crab-eating macaque  ----gcc--------------ca-------ctccccaag--acccctg-c-------aggcccga-----
                       Baboon  ----gcc--------------ca-------ctccccaag--acccctg-c-------aggcccga-----
                 Green monkey  ----gcc--------------ca-------cttcccaag--acccctg-c-------aggcccga-----
                     Marmoset  ----acc--------------ca-------ctccctgtg--gcccctg-c-------aggcctga-----
              Squirrel monkey  ----gcc--------------ca-------ctccctgtg--gcccctg-t-------aggcctga-----
                     Bushbaby  ----gtc--------------tg-------ctctgtgcagtgccactg-c-------aggcctga-----
           Chinese tree shrew  ----gct--------------gg-------ctgcc----------------------aggcctga-----
              Chinese hamster  --------------------------------------------cctg-c-------aggcctga-----
               Golden hamster  ----cca---------------a-------gcgggtccatcacccctg-c-------aggcttga-----
               Naked mole-rat  ----cct---------------a-------ctccccacggcacccaca-c-------aggcctgg-----
                   Guinea pig  ----gcc-----------------------ctgcccacagcagcctcagc-------aggcctgg-----
                       Alpaca  ----gcc--------------ca-------ctg----------------c-------aggcctga-----
               Bactrian camel  ----gcc--------------ca-------ctg----------------c-------aggcctga-----
                      Dolphin  ----gcc--------------ca-------ctg----------------c-------aggcctga-----
                 Killer whale  ----gcc--------------ca-------ctg----------------c-------aggcctga-----
             Tibetan antelope  ----gcc--------------ca-------ctg----------------a-------aggccaga-----
                          Cow  ----gcc--------------ca--------tg----------------a-------aggccaga-----
                        Sheep  ----gcc--------------ca-------ctg----------------a-------aggccgga-----
                Domestic goat  ----gcc--------------ca-------ctg----------------a-------aggccgga-----
                        Horse  ----------------------a-------cca----------------c-------actcctga-----
             White rhinoceros  ----gcc--------------ca-------cca----------------c-------atgcctga-----
                          Cat  ----gcc--------------ca-------ctg----------------c-------aggcctga-----
                          Dog  ----gctcag-----------ca-------ctg----------------cga----gaggctgct-----
                      Ferret   ------------------------------ctg----------------c-------aggcctga-----
                        Panda  ----gca--------------ca-------ctg----------------c-------aggcctga-----
               Pacific walrus  ----gcc--------------ca-------ctg----------------c-------aggcctga-----
                 Weddell seal  ----gcc--------------ca-------cgg----------------c-------aggcctga-----
             Black flying-fox  ----gcc--------------cg-------ctg----------------c-------g--cccga-----
                      Megabat  ----gcc--------------cg-------ctg----------------c-------g--cccga-----
         David's myotis (bat)  ----gac--------------ct-------ctg----------------t-------gtccctga-----
                     Microbat  ----gac--------------ct-------ctg----------------t-------gtccctga-----
                     Elephant  ---------------------------------------------------agtctagggtctgc-----
                     Aardvark  ------------------------------------------------------ctggggcctgc-----
                    Armadillo  ------------------------------------------------------ttgggagttgt-----
                      Opossum  ------------------------------------------------------------tcttc-----
              Tasmanian devil  -----------------------------------------------------------tcctgg-----
                     Platypus  --------gggnnnnnnnnnncc-------ccccccacccctttccgg-g-------ggtccccc-----
                  Rock pigeon  agccacc--------------ccaacacggctccttc------------c-------gtgcc--------
                 Saker falcon  aaaccac--------------cg-------ctccggc------------c-------ggctctcctagga
             Peregrine falcon  aaaccac--------------cg-------ctccggc------------c-------ggctctcctagga
       White-throated sparrow  ----cct--------------gca-----gttcctgc------------t-------gtgcctcag----
                  Zebra finch  ----att--------------cc-------tttttgc------------t-------gtagcttgt----
           Tibetan ground jay  ----tcc--------------cca-----gttcctgc---------------------------------
                   Budgerigar  gggttgt--------------cg--------------------------g-------gggtctcacagtg
                       Parrot  ----tgt--------------cc-------tccctct------------g-------ggacctcaccatg
                Scarlet macaw  gaaagat--------------cg-------ttccc------------------------atctcaaaata
           American alligator  cgganac--------------ct-----------------------------------------------
              Green seaturtle  aaccagg--------------gg-------ccccagct-----------t-------gcatct-------
               Painted turtle  ----agg--------------gg--------------------------t-------gtgta--------
     Chinese softshell turtle  ----cag--------------gg-------ccacagatggcaag-----t-------gcagctcc-----
                       Medaka  ======================================================================
       Yellowbelly pufferfish  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                         Fugu  ======================================================================
          Pundamilia nyererei  ======================================================================
                 Atlantic cod  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Turkey  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
          Collared flycatcher  ======================================================================
                  Spotted gar  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                        Shrew  ======================================================================
                          Rat  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                         Pika  ======================================================================
                        Mouse  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                Big brown bat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Hedgehog  ======================================================================
                     Squirrel  ======================================================================
                 Prairie vole  ======================================================================
                      Manatee  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ---ccc-----------------------
                        Chimp  ---ccc-----------------------
                      Gorilla  ---ccc-----------------------
                    Orangutan  ---ccc-----------------------
                       Gibbon  ---ccc-----------------------
                       Rhesus  ---ccc-----------------------
          Crab-eating macaque  ---ccc-----------------------
                       Baboon  ---ccc-----------------------
                 Green monkey  ---ccc-----------------------
                     Marmoset  ---ccc-----------------------
              Squirrel monkey  ---ccc-----------------------
                     Bushbaby  ---cct-----------------------
           Chinese tree shrew  ---tcc-----------------------
              Chinese hamster  ---ccc-----------------------
               Golden hamster  ---ccc-----------------------
               Naked mole-rat  ---cca-----------------------
                   Guinea pig  ---cca-----------------------
                       Alpaca  ---tcc-----------------------
               Bactrian camel  ---tcc-----------------------
                      Dolphin  ---gcc-----------------------
                 Killer whale  ---gcc-----------------------
             Tibetan antelope  ---ccc-----------------------
                          Cow  ---ccc-----------------------
                        Sheep  ---ccc-----------------------
                Domestic goat  ---ccc-----------------------
                        Horse  ---cca-----------------------
             White rhinoceros  ---ccc-----------------------
                          Cat  ---cct-----------------------
                          Dog  ---tct-----------------------
                      Ferret   ---cct-----------------------
                        Panda  ---cct-----------------------
               Pacific walrus  ---cct-----------------------
                 Weddell seal  ---cct-----------------------
             Black flying-fox  ---ccc-----------------------
                      Megabat  ---ccc-----------------------
         David's myotis (bat)  ---tcc-----------------------
                     Microbat  ---tcc-----------------------
                     Elephant  ---tca-----------------------
                     Aardvark  ---tca-----------------------
                    Armadillo  ---ccc-----------------------
                      Opossum  ---cac-----------------------
              Tasmanian devil  ---ctc-----------------------
                     Platypus  ---ccc-----------------------
                  Rock pigeon  ---ccagg-------------tcccacc-
                 Saker falcon  ---ccagg-----------gtggcggtgt
             Peregrine falcon  ---ccagg-----------gtggcggtgt
       White-throated sparrow  ---ccagggagcagacagaattgccacag
                  Zebra finch  ---ctggg-------------tgggccag
           Tibetan ground jay  ---ccgcg-------------tgttgccc
                   Budgerigar  ---ccctg-------------tgcagcct
                       Parrot  g--cccag--------tacctcccagcat
                Scarlet macaw  gactccag------------ctccatttt
           American alligator  ---ccagg-----------ctccaaacag
              Green seaturtle  ---ctgct-------------cccagcaa
               Painted turtle  ---ctgtg-------------tccaccac
     Chinese softshell turtle  ---ctgtt-------------cc---cgc
                       Medaka  =============================
       Yellowbelly pufferfish  =============================
           Southern platyfish  =============================
                    Zebrafish  =============================
                         Fugu  =============================
          Pundamilia nyererei  =============================
                 Atlantic cod  =============================
     Mexican tetra (cavefish)  =============================
                       Turkey  =============================
                    Tetraodon  =============================
                      Chicken  =============================
          Collared flycatcher  =============================
                  Spotted gar  =============================
                  Zebra mbuna  =============================
        Burton's mouthbreeder  =============================
          Princess of Burundi  =============================
                X. tropicalis  =============================
          Medium ground finch  =============================
                        Shrew  =============================
                          Rat  =============================
             Brush-tailed rat  =============================
                   Chinchilla  =============================
                         Pika  =============================
                        Mouse  =============================
                       Tenrec  =============================
          Cape elephant shrew  =============================
                Big brown bat  =============================
       Lesser Egyptian jerboa  =============================
                     Hedgehog  =============================
                     Squirrel  =============================
                 Prairie vole  =============================
                      Manatee  =============================
             Cape golden mole  =============================

Inserts between block 12 and 13 in window
          Chinese tree shrew 122bp
B D                 Elephant 19bp
                    Aardvark 23bp
B D                Armadillo 26bp
B D                  Opossum 20bp
B D          Tasmanian devil 11bp
  D             Saker falcon 6bp
  D         Peregrine falcon 6bp
  D   White-throated sparrow 61bp
B D              Zebra finch 64bp
          Tibetan ground jay 54bp
B D               Budgerigar 28bp
  D                   Parrot 16bp
  D            Scarlet macaw 21bp
B D       American alligator 49bp
  D          Green seaturtle 9bp
  D           Painted turtle 8bp
  D Chinese softshell turtle 8bp

Alignment block 13 of 248 in window, 62371410 - 62371433, 24 bps 
B D                     Human  aaaggctgcc-------------------------------actgggttc------acacc---------
B D                     Chimp  aaaggctgcc-------------------------------actgggttc------acacc---------
B D                   Gorilla  aaaggccgcc-------------------------------actgggttc------acacc---------
B D                 Orangutan  aaaggccgcc-------------------------------actggattc------tcacc---------
B D                    Gibbon  aaaggccgcc-------------------------------actgggttc------acacc---------
B D                    Rhesus  aaagtccgcc-------------------------------actgggttc------acaca---------
B D       Crab-eating macaque  aaagtccgcc-------------------------------actgggttc------acaca---------
B D                    Baboon  aaaggccgcc-------------------------------actgggttc------ataca---------
B D              Green monkey  aaaggctgcc-------------------------------actgggttc------atacg---------
B D                  Marmoset  acgggccacc-------------------------------actgggttc------ccaca---------
B D           Squirrel monkey  acgggccacc-------------------------------actgggttc------ccaca---------
B D                  Bushbaby  gaaggacgtctgctgcaggcccaggcctgggaggcagggcagccaggttc------acaca---------
B D           Chinese hamster  -aaggcagtc-------------------------------actg---cc------ccac----------
               Golden hamster  -aaggcagtc-------------------------------acca---cc------ccgca---------
B D            Naked mole-rat  -gaggcagct-------------------------------gctg---cc------atgc----------
B D                Guinea pig  -g-gacagct-------------------------------gcca---tg------gtgc----------
B D                  Elephant  -------------------------------------------aaggcct------ggccc---------
                     Aardvark  -------------------------------------------aaggcct------ggcca---------
B D                 Armadillo  -------------------------------------------gcagctc----agggtca---------
B D                   Opossum  -----------------------------------------gaggcgctctcccgctctcc---------
B D           Tasmanian devil  -----------------------------------------------ctctcttgccttct---------
  D               Rock pigeon  ----------------------------------------------------------------------
  D              Saker falcon  ----------------------------------------------------------------------
  D          Peregrine falcon  ----------------------------------------------------------------------
  D           Green seaturtle  ------------------------------------------------------------agatgctgct
  D            Painted turtle  ----------------------------------------------------------------gcagga
  D  Chinese softshell turtle  ----------------------------------------------------------------ccgcaa
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Atlantic cod  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Turkey  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D       Collared flycatcher  ======================================================================
                 Spotted gar  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D        American alligator  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D               Zebra finch  ======================================================================
B D                     Shrew  ======================================================================
B D                       Rat  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
               Big brown bat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Panda  ----------------------------------------------------------------------
            Tibetan antelope  ----------------------------------------------------------------------
B D                  Platypus  ----------------------------------------------------------------------
              Pacific walrus  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
B D                       Cat  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
                Killer whale  ----------------------------------------------------------------------
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
               Domestic goat  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------
B D                   Ferret   ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
                Prairie vole  ======================================================================
          Chinese tree shrew  ======================================================================
B D                   Manatee  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================
B D                  Microbat  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
B D                   Megabat  ----------------------------------------------------------------------
            Black flying-fox  ----------------------------------------------------------------------
                Weddell seal  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                     Horse  ----------------------------------------------------------------------

                        Human  --------------------
                        Chimp  --------------------
                      Gorilla  --------------------
                    Orangutan  --------------------
                       Gibbon  --------------------
                       Rhesus  --------------------
          Crab-eating macaque  --------------------
                       Baboon  --------------------
                 Green monkey  --------------------
                     Marmoset  --------------------
              Squirrel monkey  --------------------
                     Bushbaby  --------------------
              Chinese hamster  --------------------
               Golden hamster  --------------------
               Naked mole-rat  --------------------
                   Guinea pig  --------------------
                     Elephant  --------------------
                     Aardvark  --------------------
                    Armadillo  --------------------
                      Opossum  --------------------
              Tasmanian devil  --------------------
                  Rock pigeon  -------------atccagc
                 Saker falcon  -----------------agc
             Peregrine falcon  -----------------agc
              Green seaturtle  gccagg------tacccagc
               Painted turtle  gccaga------tcccaacc
     Chinese softshell turtle  accagggcagcttcctcagc
                       Medaka  ====================
       Yellowbelly pufferfish  ====================
           Southern platyfish  ====================
                    Zebrafish  ====================
                         Fugu  ====================
          Pundamilia nyererei  ====================
                 Atlantic cod  ====================
     Mexican tetra (cavefish)  ====================
                       Turkey  ====================
                       Parrot  ====================
                   Budgerigar  ====================
                Scarlet macaw  ====================
                    Tetraodon  ====================
                      Chicken  ====================
          Collared flycatcher  ====================
                  Spotted gar  ====================
                  Zebra mbuna  ====================
        Burton's mouthbreeder  ====================
          Princess of Burundi  ====================
           American alligator  ====================
       White-throated sparrow  ====================
           Tibetan ground jay  ====================
                X. tropicalis  ====================
          Medium ground finch  ====================
                  Zebra finch  ====================
                        Shrew  ====================
                          Rat  ====================
             Brush-tailed rat  ====================
                   Chinchilla  ====================
                         Pika  ====================
                        Mouse  ====================
                       Tenrec  ====================
          Cape elephant shrew  ====================
                Big brown bat  ====================
       Lesser Egyptian jerboa  ====================
                     Hedgehog  ====================
                        Panda  --------------------
             Tibetan antelope  --------------------
                     Platypus  --------------------
               Pacific walrus  --------------------
                          Dog  --------------------
                          Cat  --------------------
                        Sheep  --------------------
                 Killer whale  --------------------
               Bactrian camel  --------------------
                       Alpaca  --------------------
                Domestic goat  --------------------
                          Cow  --------------------
                      Ferret   --------------------
                     Squirrel  ====================
                 Prairie vole  ====================
           Chinese tree shrew  ====================
                      Manatee  ====================
                      Dolphin  --------------------
             Cape golden mole  ====================
                     Microbat  --------------------
         David's myotis (bat)  --------------------
                      Megabat  --------------------
             Black flying-fox  --------------------
                 Weddell seal  --------------------
             White rhinoceros  --------------------
                        Horse  --------------------

Inserts between block 13 and 14 in window
  D              Rock pigeon 23bp
  D             Saker falcon 30bp
  D         Peregrine falcon 30bp
  D          Green seaturtle 27bp
  D           Painted turtle 24bp
  D Chinese softshell turtle 21bp

Alignment block 14 of 248 in window, 62371434 - 62371462, 29 bps 
B D                     Human  t--------ggg----------------------------------------------------------
B D                     Chimp  t--------ggg----------------------------------------------------------
B D                   Gorilla  t--------ggg----------------------------------------------------------
B D                 Orangutan  t--------ggg----------------------------------------------------------
B D                    Gibbon  t--------ggg----------------------------------------------------------
B D                    Rhesus  t--------agg----------------------------------------------------------
B D       Crab-eating macaque  t--------agg----------------------------------------------------------
B D                    Baboon  t--------agg----------------------------------------------------------
B D              Green monkey  t--------ggg----------------------------------------------------------
B D                  Marmoset  t--------ggg----------------------------------------------------------
B D           Squirrel monkey  t--------ggg----------------------------------------------------------
B D                  Bushbaby  c--------aggcatgggggtgaggggacagcaatctgatgtaggcccaggcctgggaggtagggcagcc
B D           Chinese hamster  g--------ggt----------------------------------------------------------
               Golden hamster  a--------ggt----------------------------------------------------------
B D            Naked mole-rat  a--------agt----------------------------------------------------------
B D                Guinea pig  c--------agt----------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
B D                   Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
B D                     Horse  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                       Cat  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
B D                   Ferret   ----------------------------------------------------------------------
B D                     Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
B D                   Megabat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
B D                  Microbat  ----------------------------------------------------------------------
B D                  Elephant  t--------gct----------------------------------------------------------
                     Aardvark  t--------ggt----------------------------------------------------------
B D                 Armadillo  t--------gga----------------------------------------------------------
B D                   Opossum  t--------ggg----------------------------------------------------------
B D           Tasmanian devil  tcaccgttgggg----------------------------------------------------------
B D                  Platypus  ----------------------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------------------
  D              Saker falcon  ----------------------------------------------------------------------
  D          Peregrine falcon  ----------------------------------------------------------------------
  D    White-throated sparrow  ----------------------------------------------------------------------
B D               Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Atlantic cod  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Turkey  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D       Collared flycatcher  ======================================================================
                 Spotted gar  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                     Shrew  ======================================================================
B D                       Rat  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
               Big brown bat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Hedgehog  ======================================================================
B D                  Squirrel  ======================================================================
                Prairie vole  ======================================================================
          Chinese tree shrew  ======================================================================
B D                   Manatee  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ---------------------------------ggg----tttcaggtg---------------------
                        Chimp  ---------------------------------ggg----tttcaggtg---------------------
                      Gorilla  ---------------------------------ggg----tttcaggtg---------------------
                    Orangutan  ---------------------------------gga----tttcaggtg---------------------
                       Gibbon  ---------------------------------ggg----tttcaggtg---------------------
                       Rhesus  ---------------------------------gga----tttgagatg---------------------
          Crab-eating macaque  ---------------------------------gga----tttgagatg---------------------
                       Baboon  ---------------------------------gga----tttgagatg---------------------
                 Green monkey  ---------------------------------gga----tttgaggtg---------------------
                     Marmoset  ---------------------------------ggg----tgtgaggtg---------------------
              Squirrel monkey  ---------------------------------ggg----tgtgaggtg---------------------
                     Bushbaby  agattcacatatgggcatgagggtggggggacaagg----attaagacg---------------------
              Chinese hamster  ---------------------------------gga----ggcctgata---------------------
               Golden hamster  ---------------------------------gga----ggcctgatg---------------------
               Naked mole-rat  ---------------------------------caa----gggtggatg---------------------
                   Guinea pig  ---------------------------------caa----ggctgggtg---------------------
                       Alpaca  ------------------------------ccgggg----gtcctgatg-----------------cggg
               Bactrian camel  ------------------------------ctgggg----gtcctgatg-----------------tggg
                      Dolphin  ------------------------------tcgggt----gtcctgatg------------------ggg
                 Killer whale  ------------------------------tcgggt----gtcctgatg------------------ggg
             Tibetan antelope  ------------------------------tcgggc----atcctggtg------------------ggc
                          Cow  ------------------------------tcgggc----atcctggtg------------------ggc
                        Sheep  ------------------------------ttgagc----atcctggtg------------------ggc
                Domestic goat  ------------------------------ttgggc----atcctggtg------------------ggc
                        Horse  ------------------------------tcgggt----ggcctgatg---------------gggggt
             White rhinoceros  ------------------------------tcgagt----ggcctgat----------------gggggt
                          Cat  ------------------------------gctggc----gtcctcatgg------------tgggaggt
                          Dog  ------------------------------gtgggttggaactcttacgg------------ctccacgt
                      Ferret   ------------------------------gtgggc----atcctgatgg------------tgggagga
                        Panda  ------------------------------gtgggc----accctgatgg------------tggaaggt
               Pacific walrus  ------------------------------gtgggc----atcctgatgg------------ccagaggt
                 Weddell seal  ------------------------------gtgggc----atcctgatgg------------ccggaggt
             Black flying-fox  ------------------------------tcgggc----atcctg------------------gggtgg
                      Megabat  ------------------------------tcgggc----atcctg------------------gggtgg
         David's myotis (bat)  ------------------------------tcaggc----atcct--------------------gatgg
                     Microbat  ------------------------------tcaggc----atcct--------------------gatgg
                     Elephant  --------------------------gcacagataa----agcctgataggg-------tgggtagatga
                     Aardvark  -----------------ggtcactgggcacagataa----ggcctgatag--------------------
                    Armadillo  ------------------------------ggaacg----agcccccggg--------------------
                      Opossum  ------------------------------ccaggt----gagctgagg---------------------
              Tasmanian devil  ------------------------------ccggga----gggccttgg---------------------
                     Platypus  ------------------------------------tcccctttgggcggggtccactctttttgagggg
                  Rock pigeon  ----------------------------------------------------------------------
                 Saker falcon  ----------------------------------------------------------------------
             Peregrine falcon  ----------------------------------------------------------------------
       White-throated sparrow  ----------------------------------------------------------------------
                  Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                Scarlet macaw  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------
              Green seaturtle  ----------------------------------------------------------------------
               Painted turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
                       Medaka  ======================================================================
       Yellowbelly pufferfish  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                         Fugu  ======================================================================
          Pundamilia nyererei  ======================================================================
                 Atlantic cod  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Turkey  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
          Collared flycatcher  ======================================================================
                  Spotted gar  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                        Shrew  ======================================================================
                          Rat  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                         Pika  ======================================================================
                        Mouse  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                Big brown bat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Hedgehog  ======================================================================
                     Squirrel  ======================================================================
                 Prairie vole  ======================================================================
           Chinese tree shrew  ======================================================================
                      Manatee  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ggc-cccca-tgcca----------------------
                        Chimp  ggc-cccca-tgcca----------------------
                      Gorilla  ggc-cccca-tgcca----------------------
                    Orangutan  ggc-cccca-tgcca----------------------
                       Gibbon  ggc-cccca-tgcaa----------------------
                       Rhesus  ggc-cccca-tgcga----------------------
          Crab-eating macaque  ggc-cccca-tgcga----------------------
                       Baboon  ggc-cccca-tgcaa----------------------
                 Green monkey  gg--cccca-tgcaa----------------------
                     Marmoset  ggc-cccca-tgcga----------------------
              Squirrel monkey  ggc-cccca-tgcga----------------------
                     Bushbaby  ggt-ctcca-tacaa----------------------
              Chinese hamster  -------------------------------------
               Golden hamster  -------------------------------------
               Naked mole-rat  gg------------g----------------------
                   Guinea pig  -------------------------------------
                       Alpaca  cgc-ctgca-cacca----------------------
               Bactrian camel  cgc-ctgca-cacca----------------------
                      Dolphin  ggg-cttta-tactg----------------------
                 Killer whale  ggg-cttta-tactg----------------------
             Tibetan antelope  agt-ttgta-ccttg----------------------
                          Cow  aat-ttgta-ccttg----------------------
                        Sheep  agt-ttgta-ccttg----------------------
                Domestic goat  agt-ttgta-ccttg----------------------
                        Horse  ggt-ccaca-cacca----------------------
             White rhinoceros  ggt-ctgca-cgcca----------------------
                          Cat  ggg-aggtg-ccccg----------------------
                          Dog  cg--ctgca-ccccg----------------------
                      Ferret   ggacttgcc-cacag----------------------
                        Panda  ggatttgca-cactc----------------------
               Pacific walrus  ggacttgca-cacca----------------------
                 Weddell seal  ggacttgca-cacca----------------------
             Black flying-fox  ggg-ttgca-cagca----------------------
                      Megabat  ggg-ttgca-cagca----------------------
         David's myotis (bat)  gg-----------------------------------
                     Microbat  gg-----------------------------------
                     Elephant  gcc-tcata-cccca----------------------
                     Aardvark  acc-tcatgtcccca----------------------
                    Armadillo  ggt-ccacctccctg----------------------
                      Opossum  cgc-tc-------------------------------
              Tasmanian devil  ggc-cc-------------------------------
                     Platypus  gg-----------------------------------
                  Rock pigeon  -------------agggaagcatgtcca-----gctg
                 Saker falcon  -------------tgggaagg------------gctg
             Peregrine falcon  -------------tgggaagg------------gctg
       White-throated sparrow  -------------cggggg------------------
                  Zebra finch  -------------cagctg------------------
           Tibetan ground jay  -------------tgggag------------------
                   Budgerigar  -------------tgggtgag------------agct
                       Parrot  -------------tgggcagc------------ccca
                Scarlet macaw  -------------tggatgtc------------acct
           American alligator  -------------tggggg------------------
              Green seaturtle  -------------tgagagtcacggctcctgaacccc
               Painted turtle  -------------caggtaccacgccccc----ccct
     Chinese softshell turtle  -------------aaggtgacatgg--------gcag
                       Medaka  =====================================
       Yellowbelly pufferfish  =====================================
           Southern platyfish  =====================================
                    Zebrafish  =====================================
                         Fugu  =====================================
          Pundamilia nyererei  =====================================
                 Atlantic cod  =====================================
     Mexican tetra (cavefish)  =====================================
                       Turkey  =====================================
                    Tetraodon  =====================================
                      Chicken  =====================================
          Collared flycatcher  =====================================
                  Spotted gar  =====================================
                  Zebra mbuna  =====================================
        Burton's mouthbreeder  =====================================
          Princess of Burundi  =====================================
                X. tropicalis  =====================================
          Medium ground finch  =====================================
                        Shrew  =====================================
                          Rat  =====================================
             Brush-tailed rat  =====================================
                   Chinchilla  =====================================
                         Pika  =====================================
                        Mouse  =====================================
                       Tenrec  =====================================
          Cape elephant shrew  =====================================
                Big brown bat  =====================================
       Lesser Egyptian jerboa  =====================================
                     Hedgehog  =====================================
                     Squirrel  =====================================
                 Prairie vole  =====================================
           Chinese tree shrew  =====================================
                      Manatee  =====================================
             Cape golden mole  =====================================

Inserts between block 14 and 15 in window
B D                 Elephant 4bp
                    Aardvark 4bp
B D                Armadillo 3bp
  D   White-throated sparrow 34bp
B D              Zebra finch 45bp
          Tibetan ground jay 28bp
B D       American alligator 34bp

Alignment block 15 of 248 in window, 62371463 - 62371469, 7 bps 
B D                     Human  g--------aggggg----
B D                     Chimp  g--------aggggg----
B D                   Gorilla  g--------aggtgg----
B D                 Orangutan  g--------atgggg----
B D                    Gibbon  g--------acgggg----
B D                    Rhesus  g--------a-gggg----
B D       Crab-eating macaque  g--------a-gggg----
B D                    Baboon  g--------aggggg----
B D              Green monkey  g--------aggggg----
B D                  Marmoset  g--------aggggg----
B D           Squirrel monkey  g--------aagggg----
B D                  Bushbaby  g--------aggggg----
B D            Naked mole-rat  g--------agaggt----
B D                    Alpaca  g--------ag--------
               Bactrian camel  g--------ag--------
B D                   Dolphin  g--------aggggg----
                 Killer whale  g--------aggggg----
             Tibetan antelope  g--------aggggg----
B D                       Cow  g--------aggggg----
B D                     Sheep  g--------aggggg----
                Domestic goat  g--------aggggg----
B D                     Horse  a--------agaggg----
B D          White rhinoceros  g--------agcgg-----
B D                       Cat  g--------aggggg----
B D                       Dog  tccc----cccaggc----
B D                   Ferret   g--------atggag----
B D                     Panda  g--------agggga----
               Pacific walrus  g--------aggggg----
                 Weddell seal  g--------aggggg----
             Black flying-fox  ---------gagggg----
B D                   Megabat  ---------gagggg----
                Big brown bat  g--------gagggg----
         David's myotis (bat)  g--------gagggg----
B D                  Microbat  g--------gagggg----
B D                  Elephant  -------------gg----
                     Aardvark  -------------ag----
B D                   Opossum  -tcccgctctcttgg----
B D           Tasmanian devil  -ggcagagccctgta----
B D                  Platypus  ----------ggggg----
  D               Rock pigeon  ------------gggtcct
  D              Saker falcon  ------------gggcccc
  D          Peregrine falcon  ------------gggcccc
B D                Budgerigar  ------------gagcctt
  D                    Parrot  ------------g------
  D             Scarlet macaw  ------------g------
  D           Green seaturtle  ------------gcgggca
  D            Painted turtle  ------------gggctca
  D  Chinese softshell turtle  ------------gccggtg
B D                    Medaka  ===================
      Yellowbelly pufferfish  ===================
          Southern platyfish  ===================
B D                 Zebrafish  ===================
B D                      Fugu  ===================
         Pundamilia nyererei  ===================
B D              Atlantic cod  ===================
    Mexican tetra (cavefish)  ===================
B D                    Turkey  ===================
B D                 Tetraodon  ===================
B D                   Chicken  ===================
  D       Collared flycatcher  ===================
                 Spotted gar  ===================
                 Zebra mbuna  ===================
       Burton's mouthbreeder  ===================
         Princess of Burundi  ===================
B D        American alligator  ===================
  D    White-throated sparrow  ===================
          Tibetan ground jay  ===================
B D             X. tropicalis  ===================
B D       Medium ground finch  ===================
B D               Zebra finch  ===================
B D                     Shrew  ===================
              Golden hamster  -------------------
B D                       Rat  ===================
            Brush-tailed rat  ===================
                  Chinchilla  ===================
B D                Guinea pig  -------------------
B D                      Pika  ===================
B D                     Mouse  ===================
B D                    Tenrec  ===================
         Cape elephant shrew  ===================
      Lesser Egyptian jerboa  ===================
B D                  Hedgehog  ===================
B D           Chinese hamster  -------------------
B D                  Squirrel  ===================
                Prairie vole  ===================
          Chinese tree shrew  ===================
B D                   Manatee  ===================
B D                 Armadillo  ===================
            Cape golden mole  ===================

Inserts between block 15 and 16 in window
  D              Rock pigeon 18bp
  D             Saker falcon 20bp
  D         Peregrine falcon 20bp
B D               Budgerigar 72bp
  D                   Parrot 2647bp
  D            Scarlet macaw 45bp
  D          Green seaturtle 11bp
  D           Painted turtle 11bp
  D Chinese softshell turtle 11bp

Alignment block 16 of 248 in window, 62371470 - 62371498, 29 bps 
B D                     Human  -------------------------tgc-----agacag-----gctt----agg-----tg--------
B D                     Chimp  -------------------------tgc-----agacag-----gctt----agg-----tg--------
B D                   Gorilla  -------------------------tgc-----agacag-----gctt----agg-----tg--------
B D                 Orangutan  -------------------------tgc-----agacag-----gctt----agg-----tg--------
B D                    Gibbon  -------------------------tgc-----agacag-----gctt----agg-----tg--------
B D                    Rhesus  -------------------------cgc-----agacag-----gctt----agg-----tg--------
B D       Crab-eating macaque  -------------------------cgc-----agacag-----gctt----agg-----tg--------
B D                    Baboon  -------------------------cac-----agacag-----gctt----agg-----tg--------
B D              Green monkey  -------------------------cgc-----agacag-----gctt----agg-----tg--------
B D                  Marmoset  -------------------------t-c-----aggcag-----gctt----agg-----gg--------
B D           Squirrel monkey  -------------------------t-c-----aggcag-----gctt----agg-----gg--------
B D                  Bushbaby  -------------------------tag-----agacag-----gccc----aag-----ca--------
B D           Chinese hamster  -------------------------ctt-----ag------------------gg-----t---------
               Golden hamster  -------------------------cgt-----ag------------------gg-----t---------
B D            Naked mole-rat  -------------------------ggg-----ggag---------------agg-----tg--------
B D                Guinea pig  -------------------------gct-----ggac---------------agg-----tg--------
B D                    Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
B D                   Dolphin  -------------------------cac-----agacag-----gctt----agg-----t---------
                 Killer whale  -------------------------cac-----agacag-----gctt----agg-----t---------
             Tibetan antelope  -------------------------tcc-----agacac-----gctt----acg-----t---------
B D                       Cow  -------------------------tcc-----agacag-----gctc----aca-----t---------
B D                     Sheep  -------------------------tcc-----agacac-----gctt----acg-----t---------
                Domestic goat  -------------------------tcc-----agacat-----gctt----acg-----t---------
B D                     Horse  -------------------------tgc-----agacag-----gctt----agg-----t---------
B D          White rhinoceros  --------------------------gc-----agagag-----gctt----agg-----t---------
B D                       Cat  -------------------------cac-----agacag-----gcta----ggg-----t---------
B D                       Dog  -------------------------cac-----tgg-gg-----gctt----cca-----c---------
B D                   Ferret   -------------------------cat-----aggcag-----gctt----agg-----t---------
B D                     Panda  -------------------------cac-----aggcag-----gctt----agg-----c---------
               Pacific walrus  -------------------------cag-----aggcag-----gcta----agg-----t---------
                 Weddell seal  -------------------------cag-----aggcag-----gctt----agg-----t---------
             Black flying-fox  -------------------------cac-----aggcag-----gctt----agg-----t---------
B D                   Megabat  -------------------------cac-----aggcag-----gctt----agg-----t---------
                Big brown bat  -------------------------cac-----agacag-----gctt----agg-----t---------
         David's myotis (bat)  -------------------------cac-----agacag-----gctt----agg-----t---------
B D                  Microbat  -------------------------cac-----agacag-----gctt----agg-----t---------
B D                  Elephant  -------------------------cac-----agacaggtggcaccc----agg-----tg-----tct
                     Aardvark  -------------------------tac-----agatag-----accc----aggaaggctg-----ttg
B D                 Armadillo  -------------------------cac-----aggccg--------c----agg---------------
B D                   Opossum  -------------------------gcc-----aggcga-----gctg----agg-----c---------
B D           Tasmanian devil  -------------------------ccccacaaaaacaa-----gatgcaaaagg-----a---------
B D                  Platypus  -------------------------ggg-----ggaaag-----ggga----agg-----ggggtttccc
  D               Rock pigeon  --cagtgg--------------gtgctg-----ggcca--------------------------------
  D              Saker falcon  --cgggga--------gagcagctgccc-----gcgaa--------------------------------
  D          Peregrine falcon  --cgggga--------gagcagctgccc-----gccaa--------------------------------
  D    White-throated sparrow  --caagga----gccaaagtgaaggcct-----agaga--------------------------------
B D               Zebra finch  ttcagggcat--gccccagtt-ctgcct-----gcaga--------------------------------
           Tibetan ground jay  --caggga----tccag-----gtgtct-----ggg----------------------------------
B D                Budgerigar  --caggca-----------------ctc-----agaca--------------------------------
  D             Scarlet macaw  --tgagct-----------------ctt-----agaga--------------------------------
B D        American alligator  accangga--------gggatgccccct-----gcaat--------------------------------
  D           Green seaturtle  gccaggcacagggcctgccat--gcccc-----agccg--------------------------------
  D            Painted turtle  gccagcccc---gctcggcactagcccc-----acacg--------------------------------
  D  Chinese softshell turtle  gtggagag----gacctactttcttctc-----a------------------------------------
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Atlantic cod  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Turkey  ======================================================================
  D                    Parrot  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D       Collared flycatcher  ======================================================================
                 Spotted gar  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                     Shrew  ======================================================================
B D                       Rat  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Hedgehog  ======================================================================
B D                  Squirrel  ======================================================================
                Prairie vole  ======================================================================
          Chinese tree shrew  ======================================================================
B D                   Manatee  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ---gt-------gcc------ca-gtg-t
                        Chimp  ---gt-------gcc------ca-gtg-t
                      Gorilla  ---gt-------gcc------ta-gtg-t
                    Orangutan  ---gt-------gcc------ca-gtg-t
                       Gibbon  ---gt-------gcc------ca-gtg-t
                       Rhesus  ---gt-------gcc------ca-gtg-t
          Crab-eating macaque  ---gt-------gcc------ca-gtg-t
                       Baboon  ---gt-------gcc------ca-gtg-t
                 Green monkey  ---gt-------gcc------ca-gtg-t
                     Marmoset  ---ct-------gcc------caggtg-t
              Squirrel monkey  ---gt-------gcc------cgggtg-t
                     Bushbaby  ---gt-------gcc------tgggtgct
              Chinese hamster  ------------------------gtg-g
               Golden hamster  ------------------------gtt-g
               Naked mole-rat  ---gc-------ccc------c--atg-c
                   Guinea pig  ---gc-------tcc------ag-gta-c
                       Alpaca  ------------------------gtg-c
               Bactrian camel  ------------------------gtg-c
                      Dolphin  ---gt-------gcc------ca-gtg-c
                 Killer whale  ---gt-------gcc------ca-gtg-c
             Tibetan antelope  ---gt-------gcc------ca-gtg-c
                          Cow  ---gt-------gcc------ca-gtg-c
                        Sheep  ---gt-------gcc------ca-gtg-c
                Domestic goat  ---gt-------gcc------ca-gtg-c
                        Horse  ---gt-------gcc------caggtg-c
             White rhinoceros  ---gt-------gcc------cagggc-c
                          Cat  ---gc-------gcc------cagggg-c
                          Dog  ---tt-------ggctcagaataggag-c
                      Ferret   ---gt-------ggc------cagggg-c
                        Panda  ---gt-------gtc------cagggg-c
               Pacific walrus  ---gt-------gtc------cagggg-c
                 Weddell seal  ---gt-------gtc------cagggg-c
             Black flying-fox  ---ga-------gcc------caggag-c
                      Megabat  ---ga-------gcc------caggag-c
                Big brown bat  ---gt-------gct------ctggtg-c
         David's myotis (bat)  ---gt-------gct------ctggtg-c
                     Microbat  ---gt-------gct------ctggtg-c
                     Elephant  ggggc------------------------
                     Aardvark  agggt------------------------
                    Armadillo  ---gc------------------------
                      Opossum  ---gc-tctcccgct------c-------
              Tasmanian devil  ---gcagttacagct------c-------
                     Platypus  cccgc------------------------
                  Rock pigeon  -----------------------------
                 Saker falcon  -----------------------------
             Peregrine falcon  -----------------------------
       White-throated sparrow  -----------------------------
                  Zebra finch  -----------------------------
           Tibetan ground jay  -----------------------------
                   Budgerigar  -----------------------------
                Scarlet macaw  -----------------------------
           American alligator  -----------------------------
              Green seaturtle  -----------------------------
               Painted turtle  -----------------------------
     Chinese softshell turtle  -----------------------------
                       Medaka  =============================
       Yellowbelly pufferfish  =============================
           Southern platyfish  =============================
                    Zebrafish  =============================
                         Fugu  =============================
          Pundamilia nyererei  =============================
                 Atlantic cod  =============================
     Mexican tetra (cavefish)  =============================
                       Turkey  =============================
                       Parrot  =============================
                    Tetraodon  =============================
                      Chicken  =============================
          Collared flycatcher  =============================
                  Spotted gar  =============================
                  Zebra mbuna  =============================
        Burton's mouthbreeder  =============================
          Princess of Burundi  =============================
                X. tropicalis  =============================
          Medium ground finch  =============================
                        Shrew  =============================
                          Rat  =============================
             Brush-tailed rat  =============================
                   Chinchilla  =============================
                         Pika  =============================
                        Mouse  =============================
                       Tenrec  =============================
          Cape elephant shrew  =============================
       Lesser Egyptian jerboa  =============================
                     Hedgehog  =============================
                     Squirrel  =============================
                 Prairie vole  =============================
           Chinese tree shrew  =============================
                      Manatee  =============================
             Cape golden mole  =============================

Inserts between block 16 and 17 in window
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  3bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Elephant 11bp
                    Aardvark 26bp
B D                Armadillo 20bp
B D                  Opossum 11bp
B D          Tasmanian devil 11bp

Alignment block 17 of 248 in window, 62371499 - 62371514, 16 bps 
B D                     Human  cggag-----atctg--gagagg-------------
B D                     Chimp  cggag-----atctg--gagagg-------------
B D                   Gorilla  tggag-----atctg--gagagg-------------
B D                 Orangutan  gggag-----atctg--gagagg-------------
B D                    Gibbon  aggag-----acctg--gagaga-------------
B D                    Rhesus  gggag-----accta--gagagg-------------
B D       Crab-eating macaque  ggggg-----accta--gagagg-------------
B D                    Baboon  gggag-----accta--gacagg-------------
B D              Green monkey  gggag-----acctg--gagagg-------------
B D                  Marmoset  ggggg-----acctg--gagagg-------------
B D           Squirrel monkey  aggat-----acctg--gagaag-------------
B D                  Bushbaby  gggag-----acctg--g---gg-------------
           Chinese tree shrew  tggag-----gtct-------ga-------------
B D           Chinese hamster  aggag-----agtgt--g------------------
               Golden hamster  aggag-----agtgt--g------------------
B D            Naked mole-rat  gggac-----agctg--g------------------
B D                Guinea pig  aacag-----agcga--g------------------
B D                    Alpaca  ttgag-----acctg--g-gctg-------------
               Bactrian camel  ttgag-----acctg--g-gctt-------------
B D                   Dolphin  acgag-------acgcag-gctg-------------
                 Killer whale  acgag-------acgcag-gctg-------------
             Tibetan antelope  atggg-------ctg--g-gctg-------------
B D                       Cow  atggg-------ctg--g-gctg-------------
B D                     Sheep  atggg-------ctg--g-gctg-------------
                Domestic goat  atggg-------ctg--g-gctg-------------
B D                     Horse  aggag-----acctg--g-gcag-------------
B D          White rhinoceros  gggag-----acctg--g-gctg-------------
B D                       Cat  aggag-----accag--g-gcca-------------
B D                       Dog  agacc-----ctcgc--c-gccc-------------
B D                   Ferret   aggag-----accag--g-gctg-------------
B D                     Panda  aggag-----atcgg--g-gctg-------------
               Pacific walrus  aggag-----accag--g-gctg-------------
                 Weddell seal  aggag-----accag--g-actg-------------
             Black flying-fox  ggaag-----gcctt--g-gttg-------------
B D                   Megabat  ggaag-----gcctg--g-gttg-------------
                Big brown bat  ag-ag-----gcctg--a-gctg-------------
         David's myotis (bat)  ag-ag-----gcctg--g-gctg-------------
B D                  Microbat  ag-ag-----gcctg--g-gctg-------------
B D                  Elephant  gggag-----g-------------------------
                     Aardvark  gggag-----g-------------------------
B D                 Armadillo  ggagg-----a-------------------------
B D                   Opossum  gcgag-------------------------------
B D           Tasmanian devil  gcagg-------------------------------
B D                  Platypus  ccgagttcccacccg--g------------------
  D               Rock pigeon  --------------------tgagaa----------
  D              Saker falcon  --------------------cagcagctgggtat-c
  D          Peregrine falcon  --------------------cagcagctgggtat-c
  D    White-throated sparrow  --------------------cag-------------
B D               Zebra finch  --------------------gtgt------------
B D                Budgerigar  --------------------ctgtca----------
  D             Scarlet macaw  --------------------tgatag----------
B D        American alligator  --------------------gaagaccccggccc-g
  D           Green seaturtle  --------------------gaggttgaggggcaca
  D            Painted turtle  --------------------aaggtcaga------c
  D  Chinese softshell turtle  -----------------------------------c
B D                    Medaka  ====================================
      Yellowbelly pufferfish  ====================================
          Southern platyfish  ====================================
B D                 Zebrafish  ====================================
B D                      Fugu  ====================================
         Pundamilia nyererei  ====================================
B D              Atlantic cod  ====================================
    Mexican tetra (cavefish)  ====================================
B D                    Turkey  ====================================
  D                    Parrot  ====================================
B D                 Tetraodon  ====================================
B D                   Chicken  ====================================
  D       Collared flycatcher  ====================================
                 Spotted gar  ====================================
                 Zebra mbuna  ====================================
       Burton's mouthbreeder  ====================================
         Princess of Burundi  ====================================
          Tibetan ground jay  ------------------------------------
B D             X. tropicalis  ====================================
B D       Medium ground finch  ====================================
B D                     Shrew  ====================================
B D                       Rat  ====================================
            Brush-tailed rat  ====================================
                  Chinchilla  ====================================
B D                      Pika  ====================================
B D                     Mouse  ====================================
B D                    Tenrec  ====================================
         Cape elephant shrew  ====================================
      Lesser Egyptian jerboa  ====================================
B D                  Hedgehog  ====================================
B D                  Squirrel  ====================================
                Prairie vole  ====================================
B D                   Manatee  ====================================
            Cape golden mole  ====================================

Inserts between block 17 and 18 in window
B D                 Elephant 763bp
                    Aardvark 10bp
B D                Armadillo 1bp

Alignment block 18 of 248 in window, 62371515 - 62371529, 15 bps 
B D                     Human  gtcag--------cat----------c-cgggct----------
B D                     Chimp  gtcag--------cat----------c-caggct----------
B D                   Gorilla  gtcag--------cat----------c-cgggct----------
B D                 Orangutan  gtcag--------cat----------c-cgggct----------
B D                    Gibbon  gtcag--------cat----------c-caggct----------
B D                    Rhesus  gtcag--------cat----------c-ccggct----------
B D       Crab-eating macaque  gtcag--------cat----------c-ccggct----------
B D                    Baboon  gtcag--------cat----------c-ctggct----------
B D              Green monkey  gtcag--------cat----------c-ccggct----------
B D                  Marmoset  gtcag--------cat----------c-ccaggt----------
B D           Squirrel monkey  gtcag--------cgg----------c-ccacgt----------
B D                  Bushbaby  gacag--------tcc----------cacagggt----------
           Chinese tree shrew  gccta--------ctt----------c-cttggg----------
B D           Chinese hamster  ----t--------aat----------g-gtggct----------
               Golden hamster  ----t--------aac----------g-gtggct----------
B D            Naked mole-rat  ----g--------tga----------a-ctggct----------
B D                Guinea pig  ----g--------tga----------c-ccggct----------
B D                    Alpaca  gccag--------ccc----------c-ccaggt----------
               Bactrian camel  gccag--------ccc----------c-ccaggt----------
B D                   Dolphin  gccag--------ccc----------c-ccgggt----------
                 Killer whale  gccag--------ccc----------c-ccgggt----------
             Tibetan antelope  gccag---------cc----------c-gcaggt----------
B D                       Cow  gccag---------cc----------c-ccaggt----------
B D                     Sheep  gccag---------cc----------c-ccaggt----------
                Domestic goat  gccag---------cc----------c-ccaggt----------
B D                     Horse  gccag--------ccc----------c-tcaggt----------
B D          White rhinoceros  gccag--------ccc----------a-ccaggt----------
B D                       Cat  gccag--------tcc----------c-cccgat----------
B D                       Dog  agcag--------gcc----------c-ctccgt----------
B D                   Ferret   gccgg--------tcc----------c-cccaat----------
B D                     Panda  gccagt-------tcc----------c-cccaat----------
               Pacific walrus  gccag--------tcc----------c-ctcaat----------
                 Weddell seal  gccag--------tcc----------c-ctcaat----------
             Black flying-fox  gccac--------cgccatccccaccc-ccaggt----------
B D                   Megabat  gccac--------cgccatccccaccc-ccaggt----------
                Big brown bat  gccat--------ccctgt-------c-ccaggt----------
         David's myotis (bat)  gccag--------ccccgt-------c-ccaggt----------
B D                  Microbat  gccat--------ccccgt-------c-ccaggt----------
                     Aardvark  ccc-----------------------------------------
B D                 Armadillo  gcc-----------------------------------------
B D                   Opossum  -----ctgaggcgctc----------t-cccgct----------
B D           Tasmanian devil  -----ggaaggggccc----------c-caaact----------
B D                  Platypus  -cccc--------ccc----------c-ccggag----------
  D               Rock pigeon  -----------------------------------aaccgaaga
  D              Saker falcon  -------------------------------g-gcacccgacgc
  D          Peregrine falcon  -------------------------------g-gcacccgacgc
B D                Budgerigar  -----------------------------------acc------
  D             Scarlet macaw  -----------------------------------agc------
B D        American alligator  -------------------------------gcacagcatggac
  D           Green seaturtle  -------------------------------gctcagtgagtgc
  D            Painted turtle  -------------------------------gttcactgagcgt
  D  Chinese softshell turtle  -------------------------------tgccactga----
B D                    Medaka  ============================================
      Yellowbelly pufferfish  ============================================
          Southern platyfish  ============================================
B D                 Zebrafish  ============================================
B D                      Fugu  ============================================
         Pundamilia nyererei  ============================================
B D              Atlantic cod  ============================================
    Mexican tetra (cavefish)  ============================================
B D                    Turkey  ============================================
  D                    Parrot  ============================================
B D                 Tetraodon  ============================================
B D                   Chicken  ============================================
  D       Collared flycatcher  ============================================
                 Spotted gar  ============================================
                 Zebra mbuna  ============================================
       Burton's mouthbreeder  ============================================
         Princess of Burundi  ============================================
  D    White-throated sparrow  --------------------------------------------
          Tibetan ground jay  --------------------------------------------
B D             X. tropicalis  ============================================
B D       Medium ground finch  ============================================
B D               Zebra finch  --------------------------------------------
B D                     Shrew  ============================================
B D                       Rat  ============================================
            Brush-tailed rat  ============================================
                  Chinchilla  ============================================
B D                      Pika  ============================================
B D                     Mouse  ============================================
B D                    Tenrec  ============================================
         Cape elephant shrew  ============================================
      Lesser Egyptian jerboa  ============================================
B D                  Hedgehog  ============================================
B D                  Squirrel  ============================================
                Prairie vole  ============================================
B D                   Manatee  ============================================
B D                  Elephant  ============================================
            Cape golden mole  ============================================

Inserts between block 18 and 19 in window
B D          Chinese hamster 7bp
              Golden hamster 5bp
B D           Naked mole-rat 4bp
B D               Guinea pig 3bp
                    Aardvark 2bp
B D                Armadillo 2bp
B D                  Opossum 2bp
B D          Tasmanian devil 2bp
B D                 Platypus 1bp

Alignment block 19 of 248 in window, 62371530 - 62371601, 72 bps 
B D                     Human  ----------------cct---tg----g-------------------------gctct--ccacagatg
B D                     Chimp  ----------------cc----tg----g-------------------------gctct--ccacagatg
B D                   Gorilla  ----------------cc----tg----g-------------------------gctct--ccacagatg
B D                 Orangutan  ----------------cc----tg----g-------------------------gttct--ccacagatg
B D                    Gibbon  ----------------cc----tg----g-------------------------gctct--ccacagatg
B D                    Rhesus  ----------------cc----tg----g-------------------------gctct--ccacatatg
B D       Crab-eating macaque  ----------------cc----tg----g-------------------------gctct--ccacatgtg
B D                    Baboon  ----------------cc----tg----g-------------------------gctct--ccacatatg
B D              Green monkey  ----------------cc----tg----g-------------------------gtgct--ccacatatg
B D                  Marmoset  ----------------cc----tg----g-------------------------gctct--ccacagata
B D           Squirrel monkey  ----------------cc----tg----g-------------------------gctct--ccacagatg
B D                  Bushbaby  ----------------cc----tg----g-------------------------gctct--ccacaggtg
           Chinese tree shrew  ----------------cc----tg----a-------------------------gtccc--c------tg
                 Prairie vole  ----------------cc----ca----a-------------------------gcact--acacagg-g
B D           Chinese hamster  ----------------cc----ca----g-------------------------gcatt--acacaag-g
               Golden hamster  ----------------cc----ca----g-------------------------gcatg--gcacaag-g
B D            Naked mole-rat  ----------------cc----tg----t-------------------------gctct--ccactgg-g
B D                Guinea pig  -----------------c----tg----t-------------------------cctct--ccacagg-a
B D                    Alpaca  ----------------cc----tg----g-------------------------gctat--ccacagagg
               Bactrian camel  ----------------cc----tg----g-------------------------gctat--ccacagagg
B D                   Dolphin  ----------------cc----tg----g-------------------------gctct--ccacggagg
                 Killer whale  ----------------cc----tg----g-------------------------gctct--ccacggagg
             Tibetan antelope  ----------------cc----ag----g-------------------------gctct--acacagcag
B D                       Cow  ----------------cc----ag----g-------------------------gctct--acacagaag
B D                     Sheep  ----------------cc----ag----g-------------------------gctct--acacagaag
                Domestic goat  ----------------cc----ag----g-------------------------gctct--acacagaag
B D                     Horse  ----------------cc----tg----g-------------------------gctct--ccccagag-
B D          White rhinoceros  ----------------cc----tg----g-------------------------gctct--ccccaaag-
B D                       Cat  ----------------cc----tg----g-------------------------gctcc--cccaggagc
B D                       Dog  ----------------cc----ag----t-------------------------ccttg--ctgaggagc
B D                   Ferret   ----------------cc----tg----g-------------------------gctct--cccaggagg
B D                     Panda  ----------------gc----tg----g-------------------------gctgt--cccaggagg
               Pacific walrus  ----------------cc----tc----a-------------------------gctct--cccaggagg
                 Weddell seal  ----------------cc----tc----g-------------------------gctct--cccaggagg
             Black flying-fox  ----------------cc----cg----g-------------------------gctct--ccggagagg
B D                   Megabat  ----------------cc----tg----g-------------------------gctct--ccagagagg
                Big brown bat  ----------------cc----tg----g-------------------------actct--ccacagagg
         David's myotis (bat)  ----------------cc----tg----g-------------------------actct--ccgcagagg
B D                  Microbat  ----------------cc----tg----g-------------------------actct--ccgcagagg
                     Aardvark  ----------------tc----tg----gcctgtggtaccatgaccatagcagggccca--gtgcagggc
B D                 Armadillo  ----------------cc----gg----g-----------------------------------------
B D                   Opossum  ----------------ct----tg----g-------------------------gccaggcgagcagagg
B D           Tasmanian devil  ----------------gt----cg----c-------------------------g------gagcagtta
B D                  Platypus  -------------------------------------------------------ccct--cgaattgga
  D               Rock pigeon  ccagag-cctccttcttc----ca----c-------------------------agtcc--caccacc--
  D              Saker falcon  tttgag-----gagtgac----ag----c-------------------------agcag--cagcggggc
  D          Peregrine falcon  tttgag-----gagtgac----ag----c-------------------------agcag--cagcggggc
  D    White-throated sparrow  ----------------ga----ga----c-------------------------agatg--cagagagag
B D               Zebra finch  ------------ggtcag----ga----c-------------------------agtcc--cagcta---
           Tibetan ground jay  ------------------------------------------------------agtcc--ccgcgag--
B D                Budgerigar  -----------acgccac----cc----g-------------------------ggtcc--ccctgca--
  D             Scarlet macaw  ------------tgttgc----ca----t-------------------------gcccc--ccc------
B D        American alligator  tcggag-gccganccccc----gc----a-------------------------gatgc--ccgtgagct
  D           Green seaturtle  tt----------tgcttcttgggaaattc-------------------------agccc--cacag----
  D            Painted turtle  ttcatgagcacatgctggctggga----c-------------------------agccc-----------
  D  Chinese softshell turtle  ------------tgctgc----aa----t-------------------------agcac-----------
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Atlantic cod  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Turkey  ======================================================================
  D                    Parrot  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D       Collared flycatcher  ======================================================================
                 Spotted gar  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                     Shrew  ======================================================================
B D                       Rat  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Hedgehog  ======================================================================
B D                  Squirrel  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ct----------------------c-cc----------------cgaggctc--------ctct------
                        Chimp  ct----------------------c-cc----------------cgaggctc--------ctct------
                      Gorilla  ct----------------------c-cc----------------cgaggctc--------ctct------
                    Orangutan  ct----------------------c-cc----------------cgaggctc--------ctct------
                       Gibbon  ct----------------------c-cc----------------cgaggcac--------ctct------
                       Rhesus  ct----------------------c-cg----------------agaggctc--------ctct------
          Crab-eating macaque  ct----------------------c-cg----------------agaggctc--------ctct------
                       Baboon  ct----------------------c-cg----------------agaggctc--------ctct------
                 Green monkey  ct----------------------c-cg----------------agaggctc--------ttct------
                     Marmoset  gt----------------------c-cc----------------caaggctc--------ctct------
              Squirrel monkey  gt----------------------c-cc----------------caaggctc--------ctct------
                     Bushbaby  tt----------------------c-cc----------------tgaggctc--------agct------
           Chinese tree shrew  cc----------------------c-cc----------------acag---------------c------
                 Prairie vole  ct----------------------c-ct----------------caaggttc--------ctct------
              Chinese hamster  ct----------------------cact----------------caaggttt--------ccct------
               Golden hamster  ct----------------------cact----------------caaggttt--------ccct------
               Naked mole-rat  at----------------------t-ct----------------caagcccc--------ttcc------
                   Guinea pig  at----------------------t-cc----------------caggctct--------ctcc------
                       Alpaca  tt----------------------c-cc----------------caaggctc--------cttt------
               Bactrian camel  tt----------------------c-cc----------------caaggctc--------cttt------
                      Dolphin  tt----------------------c-cc----------------caaagctc--------ctgt------
                 Killer whale  tt----------------------c-cc----------------caaagctc--------ctgt------
             Tibetan antelope  tt----------------------c-cc----------------caaagctc--------cttt------
                          Cow  tt----------------------c-cc----------------caaagctc--------cttt------
                        Sheep  tt----------------------c-cc----------------caaagctc--------cttt------
                Domestic goat  tt----------------------c-cc----------------caaagctc--------cttt------
                        Horse  gt----------------------c-tc------------------------------------------
             White rhinoceros  gt----------------------c-tc------------------------------------------
                          Cat  gt----------------------c-cc----------------caa-----------------------
                          Dog  at----------------------c-ctgcttccctccccctcacgggggac--------tttggccttg
                      Ferret   gt----------------------t-cc----------------caaagctc--------cttt------
                        Panda  gt----------------------c-cc----------------caaagctc--------cttt------
               Pacific walrus  gt----------------------c-cc----------------caaagctc--------cttt------
                 Weddell seal  gt----------------------c-cc----------------caaagctc--------gttt------
             Black flying-fox  tt----------------------c-cc----------------cgaagctc--------cctt------
                      Megabat  tt----------------------c-cc----------------cgaagctc--------cctt------
                Big brown bat  tt----------------------c-cc----------------caaagctg--------cctt------
         David's myotis (bat)  tt----------------------c-cc----------------caaagctg--------cctt------
                     Microbat  tt----------------------c-cc----------------caaagctg--------cctt------
                     Aardvark  ct----------------------c-cc----------------ccactccc--------acctccgtcc
                    Armadillo  -t----------------------c-cc----------------cgacggct--------ctctacgctg
                      Opossum  cg----------------------c-tc----------------tcccgctc--------tcttgggcca
              Tasmanian devil  ct----------------------c-ac----------------cggttctc--------ccttg-----
                     Platypus  ac----------------------c-at----------------aaagtttg--------cggg------
                  Rock pigeon  ------------------------a-ac----------------atgagctc--------cagc------
                 Saker falcon  -----------------------tg-tt----------------cccccccg--------caga------
             Peregrine falcon  cccccaccgtcactccacttgagtg-ct----------------cagccctgctctgtccccaa------
       White-throated sparrow  --------------------aggtg-tc----------------acaggggc--------tctg------
                  Zebra finch  ------------------------g-ct----------------gcaggctg--------cttg------
           Tibetan ground jay  ------------------------t-tc----------------ccgggacc--------cctg------
                   Budgerigar  ------------------------t-tt----------------cctggc--------------------
                Scarlet macaw  --------------------------tt----------------cttggccg--------cttt------
           American alligator  gtaactccctcat-----------g-cc----------------cgctgccc--------ccac------
              Green seaturtle  ------------------------g-ct----------------ctgagtcg--------ccag------
               Painted turtle  ------------------------g-ag----------------ccaagaca--------atgg------
     Chinese softshell turtle  ------------------------c-ag----------------ccgggatc--------aggg------
                       Medaka  ======================================================================
       Yellowbelly pufferfish  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                         Fugu  ======================================================================
          Pundamilia nyererei  ======================================================================
                 Atlantic cod  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Turkey  ======================================================================
                       Parrot  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
          Collared flycatcher  ======================================================================
                  Spotted gar  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                        Shrew  ======================================================================
                          Rat  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                         Pika  ======================================================================
                        Mouse  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Hedgehog  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ----------------tgc-c--caccc----ag------------------------------------
                        Chimp  ----------------tgc-c--caccc----ag------------------------------------
                      Gorilla  ----------------tgc-c--caccc----ag------------------------------------
                    Orangutan  ----------------cac-c--caccc----ag------------------------------------
                       Gibbon  ----------------cgc-c--caccc----ag------------------------------------
                       Rhesus  ----------------tgc-c--gaccc----ag------------------------------------
          Crab-eating macaque  ----------------tgc-c--gaccc----ag------------------------------------
                       Baboon  ----------------cgc-c--caccc----ag------------------------------------
                 Green monkey  ----------------cgc-c--caccc----ag------------------------------------
                     Marmoset  ----------------cga-c--catcc----at------------------------------------
              Squirrel monkey  -----------------gc-c--caccc----at------------------------------------
                     Bushbaby  ----------------ccc-t--gacca----gg------------------------------------
           Chinese tree shrew  ----------------agc-t--ggcac----ag------------------------------------
                 Prairie vole  ----------------c-c-c--taccc----ag------------------------------------
              Chinese hamster  ----------------c-c-c--taccc----ag------------------------------------
               Golden hamster  ----------------c-c-c--taccc----ag------------------------------------
               Naked mole-rat  ----------------c-t-ccgcacct----gg------------------------------------
                   Guinea pig  -----------------------cacct----g-------------------------------------
                       Alpaca  ----------------ctc-c--cattc----gg------------------------------------
               Bactrian camel  ----------------ctc-c--cattc----gg------------------------------------
                      Dolphin  ----------------ctc-c--cactc----at------------------------------------
                 Killer whale  ----------------ctc-c--cactc----ag------------------------------------
             Tibetan antelope  ----------------ctc-c--cactc----gg------------------------------------
                          Cow  ----------------ctc-c--cactc----ag------------------------------------
                        Sheep  ----------------ctc-c--cactc----gg------------------------------------
                Domestic goat  ----------------ctc-c--cactc----gg------------------------------------
                        Horse  ----------------ccc-c---actt----gg------------------------------------
             White rhinoceros  ----------------ctc-c--aactt----gg------------------------------------
                          Cat  -------------------------tta----gg------------------------------------
                          Dog  tcac------------ccc-c--acctg----ggacat----------catggagcccccacccccttgt
                      Ferret   -----------------cc-c--agctg----gg------------------------------------
                        Panda  ----------------ccc-c--agttg----gg------------------------------------
               Pacific walrus  ----------------ccc-c--agttg----ga------------------------------------
                 Weddell seal  ----------------ccc-c--agttg----ga------------------------------------
             Black flying-fox  ----------------cac-c--cactt----gg------------------------------------
                      Megabat  ----------------cac-c--cactt----gg------------------------------------
                Big brown bat  ----------------ccc-c--gactt----gg------------------------------------
         David's myotis (bat)  ----------------ccc-c--aactt----gg------------------------------------
                     Microbat  ----------------ccc-c--gactt----gg------------------------------------
                     Aardvark  atccgtgatggggc--ccc-a--gcccc----tg------------------------------------
                    Armadillo  tgcccagacag-----ccc-c--gttcc----tg------------------------------------
                      Opossum  ggcgagctgaggcgctctc-c--cact-------------------------------------------
              Tasmanian devil  ----------------ttt-c--cact-------------------------------------------
                     Platypus  ----------------ttg-g--ggccg----gg------------------------------------
                  Rock pigeon  ----------------accgc--agcct----gtgtgc----acag------------------------
                 Saker falcon  ----------------acc-c--acccc----agggcc--------------------------------
             Peregrine falcon  ----------------ccc-c--gtccc----agcccc----cca-------------------------
       White-throated sparrow  ----------------gct-c--agcct----ggcaga--------------------------------
                  Zebra finch  ----------------tgt-c--agccc----agccgc--------------------------------
           Tibetan ground jay  ----------------act-c-------------------------------------------------
                   Budgerigar  -----------------cc-c-------------------------------------------------
                Scarlet macaw  ----------------tcc-c-------------------------------------------------
           American alligator  ----------------acc-c--agggc----tgcctccataccaggg----------------------
              Green seaturtle  ----------------gcc-c--tgggc----ag------------------------------------
               Painted turtle  ----------------gac-c--tgccc----ag------------------------------------
     Chinese softshell turtle  ----------------tgc-c--cgtcccgagag------------------------------------
                       Medaka  ======================================================================
       Yellowbelly pufferfish  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                         Fugu  ======================================================================
          Pundamilia nyererei  ======================================================================
                 Atlantic cod  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Turkey  ======================================================================
                       Parrot  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
          Collared flycatcher  ======================================================================
                  Spotted gar  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                        Shrew  ======================================================================
                          Rat  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                         Pika  ======================================================================
                        Mouse  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Hedgehog  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
             Cape golden mole  ======================================================================

                        Human  -----------c----------------------tccttttcttc-------------------------
                        Chimp  -----------c----------------------tccttttcttc-------------------------
                      Gorilla  -----------c----------------------tccttttcttc-------------------------
                    Orangutan  -----------c----------------------tccttttcttc-------------------------
                       Gibbon  -----------c----------------------tccttttcttt-------------------------
                       Rhesus  -----------c----------------------tccttttcttc-------------------------
          Crab-eating macaque  -----------c----------------------tccttttcttc-------------------------
                       Baboon  -----------c----------------------tccttttcttc-------------------------
                 Green monkey  -----------c----------------------tccttttcttc-------------------------
                     Marmoset  -----------c----------------------tccttttcttc-------------------------
              Squirrel monkey  -----------c----------------------tccctgtcttc-------------------------
                     Bushbaby  -----------a----------------------tcattttcttc-------------------------
           Chinese tree shrew  -----------c----------------------gc----------------------------------
                 Prairie vole  -----------c----------------------ttctcttctcc-------------------------
              Chinese hamster  -----------c----------------------ttctcttctcc-------------------------
               Golden hamster  -----------c----------------------ttctcttctcc-------------------------
               Naked mole-rat  -----------c----------------------ttgctttcttc-------------------------
                   Guinea pig  ------------------------------------gctttcttc-------------------------
                       Alpaca  -----------a----------------------tcatcgtcttc-------------------------
               Bactrian camel  -----------a----------------------ccaacatcttc-------------------------
                      Dolphin  -----------c----------------------tcacctccttc-------------------------
                 Killer whale  -----------c----------------------tcacctccttc-------------------------
             Tibetan antelope  -----------c----------------------tcacctccttc-------------------------
                          Cow  -----------c----------------------tcacctccttc-------------------------
                        Sheep  -----------c----------------------tcacctccttc-------------------------
                Domestic goat  -----------c----------------------tcacctccttc-------------------------
                        Horse  -----------c----------------------ttgccttcttc-------------------------
             White rhinoceros  -----------t----------------------ttgccttcttc-------------------------
                          Cat  -----------c----------------------ttgccttctcc-------------------------
                          Dog  ctggccgcctcc----------------------ctccctccctc-------------------------
                      Ferret   -----------c----------------------ttgccttcctc-------------------------
                        Panda  -----------c----------------------ttgccttcttc-------------------------
               Pacific walrus  -----------c----------------------ttgccttcttc-------------------------
                 Weddell seal  -----------c----------------------ttgccttcttc-------------------------
             Black flying-fox  -----------c----------------------tcacct---tc-------------------------
                      Megabat  -----------c----------------------tcacct---tc-------------------------
                Big brown bat  -----------c----------------------tcacct---tc-------------------------
         David's myotis (bat)  ----------------------------------tcacct---tc-------------------------
                     Microbat  ----------------------------------tcacct---tc-------------------------
                     Aardvark  -----------tgagcccaagggacgcccaaccaccaccttccatggggcagtgcctggttgcagactgc
                    Armadillo  -----------c----------------------ccacctcccac-------------------------
                      Opossum  -----------c----------------------tc-------tt-------------------------
              Tasmanian devil  -----------c----------------------tc---tccttt-------------------------
                     Platypus  -----------cgtaaggagg-------------ttgttccctgc-------------------------
                  Rock pigeon  ----------------------------------------------------------------------
                 Saker falcon  ----------------------------------------------------------------------
             Peregrine falcon  ----------------------------------------------------------------------
       White-throated sparrow  ----------------------------------------------------------------------
                  Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                Scarlet macaw  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------
              Green seaturtle  ----------------------------------------------------------------------
               Painted turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
                       Medaka  ======================================================================
       Yellowbelly pufferfish  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                         Fugu  ======================================================================
          Pundamilia nyererei  ======================================================================
                 Atlantic cod  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Turkey  ======================================================================
                       Parrot  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
          Collared flycatcher  ======================================================================
                  Spotted gar  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                        Shrew  ======================================================================
                          Rat  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                         Pika  ======================================================================
                        Mouse  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Hedgehog  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
             Cape golden mole  ======================================================================

                        Human  -ccaa----------------------gtggcaag
                        Chimp  -ccaa----------------------gtggcaag
                      Gorilla  -ccga----------------------gtggcaag
                    Orangutan  -ccaa----------------------gtggcgag
                       Gibbon  -ccaa----------------------gtggcaag
                       Rhesus  -ccaa----------------------gtggcaag
          Crab-eating macaque  -ccaa----------------------gtggcaag
                       Baboon  -ccaa----------------------gtggcaag
                 Green monkey  -ccaa----------------------gtggcaag
                     Marmoset  -ccaa----------------------gtggcagg
              Squirrel monkey  -ccag----------------------gtggcagg
                     Bushbaby  -ctaa----------------------gcagaaca
           Chinese tree shrew  ---ag----------------------gcagagat
                 Prairie vole  -acag----------------------gtcggatg
              Chinese hamster  -acag----------------------gtgggatg
               Golden hamster  -acag----------------------gtgggatg
               Naked mole-rat  -ccag----------------------ctgagcc-
                   Guinea pig  -cctg-----------------------tga----
                       Alpaca  -ctgg------------------------------
               Bactrian camel  -ctgg------------------------------
                      Dolphin  -ccaa------------------------------
                 Killer whale  -ccaa------------------------------
             Tibetan antelope  -cgga------------------------------
                          Cow  -caga------------------------------
                        Sheep  -cgaa------------------------------
                Domestic goat  -cgga------------------------------
                        Horse  -acaa------------------------------
             White rhinoceros  -ccaa------------------------------
                          Cat  -ccag------------------------------
                          Dog  -cccg------------------------------
                      Ferret   -ccac------------------------------
                        Panda  -ccag------------------------------
               Pacific walrus  -ccca------------------------------
                 Weddell seal  -ccca------------------------------
             Black flying-fox  -tcag------------------------------
                      Megabat  -tcag------------------------------
                Big brown bat  -ccaa------------------------------
         David's myotis (bat)  -ccaa------------------------------
                     Microbat  -ccaa------------------------------
                     Aardvark  acctgtctttgacctcatcacccacccacaacaca
                    Armadillo  -cctg------------------------------
                      Opossum  -gggc----------------------ctggcgag
              Tasmanian devil  -ggaa----------------------ccagcagg
                     Platypus  -cccg----------------------tcggcagg
                  Rock pigeon  -----------------------------------
                 Saker falcon  -----------------------------------
             Peregrine falcon  -----------------------------------
       White-throated sparrow  -----------------------------------
                  Zebra finch  -----------------------------------
           Tibetan ground jay  -----------------------------------
                   Budgerigar  -----------------------------------
                Scarlet macaw  -----------------------------------
           American alligator  -----------------------------------
              Green seaturtle  -----------------------------------
               Painted turtle  -----------------------------------
     Chinese softshell turtle  -----------------------------------
                       Medaka  ===================================
       Yellowbelly pufferfish  ===================================
           Southern platyfish  ===================================
                    Zebrafish  ===================================
                         Fugu  ===================================
          Pundamilia nyererei  ===================================
                 Atlantic cod  ===================================
     Mexican tetra (cavefish)  ===================================
                       Turkey  ===================================
                       Parrot  ===================================
                    Tetraodon  ===================================
                      Chicken  ===================================
          Collared flycatcher  ===================================
                  Spotted gar  ===================================
                  Zebra mbuna  ===================================
        Burton's mouthbreeder  ===================================
          Princess of Burundi  ===================================
                X. tropicalis  ===================================
          Medium ground finch  ===================================
                        Shrew  ===================================
                          Rat  ===================================
             Brush-tailed rat  ===================================
                   Chinchilla  ===================================
                         Pika  ===================================
                        Mouse  ===================================
                       Tenrec  ===================================
          Cape elephant shrew  ===================================
       Lesser Egyptian jerboa  ===================================
                     Hedgehog  ===================================
                     Squirrel  ===================================
                      Manatee  ===================================
                     Elephant  ===================================
             Cape golden mole  ===================================

Inserts between block 19 and 20 in window
B D                 Platypus 26bp

Alignment block 20 of 248 in window, 62371602 - 62371624, 23 bps 
B D                     Human  ------------------------------gagaa--gc----------------gcttgg-----gc--
B D                     Chimp  ------------------------------gagaa--gc----------------gcttgg-----gc--
B D                   Gorilla  ------------------------------gagaa--gt----------------gcttgg-----gc--
B D                 Orangutan  ------------------------------gagaa--gc----------------gcttgg-----gc--
B D                    Gibbon  ------------------------------gagaa--gc----------------gcttgg-----gc--
B D                    Rhesus  ------------------------------gagaa--gt----------------gcttgg-----ac--
B D       Crab-eating macaque  ------------------------------gagaa--gt----------------gcttgg-----ac--
B D                    Baboon  ------------------------------gagaa--gt----------------gcttgg-----ac--
B D              Green monkey  ------------------------------gagaa--gt----------------gcttgg-----ac--
B D                  Marmoset  ------------------------------gagaa--gc-------------------------------
B D           Squirrel monkey  ------------------------------gagaa--gc----------------ccctgg-----gc--
B D                  Bushbaby  ------------------------------gagaa--tt---------------ggcttgg-----gt--
           Chinese tree shrew  ------------------------------gtgga--cg----------------gcaggg-----tc--
                 Prairie vole  ------------------------------aagac--gt---------------aacttta-----gc--
B D           Chinese hamster  ------------------------------aagac--gc---------------aacttta-----gc--
               Golden hamster  ------------------------------aagat--gt---------------aacttta-----gc--
B D            Naked mole-rat  ------------------------------aaggc--gt---------------tgcttaa-----tc--
B D                Guinea pig  -------------------------------------------------------gcttca-----tc--
B D                    Alpaca  -------------------------------------------------------------------c--
               Bactrian camel  -------------------------------------------------------------------c--
B D                   Dolphin  -------------------------------------------------------------------c--
                 Killer whale  -------------------------------------------------------------------c--
             Tibetan antelope  -------------------------------------------------------------------c--
B D                       Cow  -------------------------------------------------------------------c--
B D                     Sheep  -------------------------------------------------------------------c--
                Domestic goat  -------------------------------------------------------------------c--
B D                     Horse  -------------------------------------------------------------------c--
B D          White rhinoceros  -------------------------------------------------------------------c--
B D                       Cat  -------------------------------------------------------------------c--
B D                       Dog  -------------------------------------------------------------------ccc
B D                   Ferret   -------------------------------------------------------------------t--
B D                     Panda  -------------------------------------------------------------------c--
               Pacific walrus  -------------------------------------------------------------------c--
                 Weddell seal  -------------------------------------------------------------------c--
             Black flying-fox  -------------------------------------------------------------------t--
B D                   Megabat  -------------------------------------------------------------------t--
                Big brown bat  -------------------------------------------------------------------c--
         David's myotis (bat)  -------------------------------------------------------------------c--
B D                  Microbat  -------------------------------------------------------------------c--
                     Aardvark  ------------------------------gtgga--cctcttgctacccct--ttgtgtg-----gc--
B D                 Armadillo  ----------------------------------------------------------------------
B D                   Opossum  ------------------------------cagaggcgctctcccactctcttgggcctggcgagcag--
B D           Tasmanian devil  ------------------------------accag--gctcgccctagaaccaaggcacgggggtcac--
  D               Rock pigeon  -aaaggctggcgg----------ca--ccaggacc-----------------------------------
  D              Saker falcon  -----gctctctt----------caagcacccacc-----------------------------------
  D          Peregrine falcon  -----gctcccct----------cc--ctccctgc-----------------------------------
  D    White-throated sparrow  -----gagccctcctccctggtgct--ctggagac-----------------------------------
B D               Zebra finch  -----gttgtctc----------cc--ctgcagcc-----------------------------------
           Tibetan ground jay  -----------------------cc--ctgcagcc-----------------------------------
B D                Budgerigar  -----------------------ca--ctgctgtt-----------------------------------
  D             Scarlet macaw  -----------------------tc--ctcctgtt-----------------------------------
B D        American alligator  caggagtcatcccccgcc-----cc--ccgcagcc-----------------------------------
  D           Green seaturtle  --------ggcagag--------cc--ctgtctgt-----------------------------------
  D            Painted turtle  -----cctggcacaga-------cc--caccctgc-----------------------------------
  D  Chinese softshell turtle  -----cctggcag----------cc--caaaccga-----------------------------------
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Atlantic cod  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Turkey  ======================================================================
  D                    Parrot  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D       Collared flycatcher  ======================================================================
                 Spotted gar  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                     Shrew  ======================================================================
B D                       Rat  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Hedgehog  ======================================================================
B D                  Platypus  ======================================================================
B D                  Squirrel  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ----------------------------t-ggt----gccc
                        Chimp  ----------------------------t-ggt----gccc
                      Gorilla  ----------------------------t-ggt----gccc
                    Orangutan  ----------------------------t-ggt----gccc
                       Gibbon  ----------------------------t-ggt----gccc
                       Rhesus  ----------------------------c-agt----gccc
          Crab-eating macaque  ----------------------------c-agt----gccc
                       Baboon  ----------------------------c-agt----gccc
                 Green monkey  ----------------------------c-agt----gccc
                     Marmoset  -----------------------------------------
              Squirrel monkey  ----------------------------t-ggt----ggcc
                     Bushbaby  ----------------------------t-ggt----g--c
           Chinese tree shrew  -------------------------cctt-ggt----cgcc
                 Prairie vole  ----------------------------tggat----gtcc
              Chinese hamster  ----------------------------tggat----gccc
               Golden hamster  ----------------------------caggt----gcc-
               Naked mole-rat  ----------------------------tcggt----gcct
                   Guinea pig  ----------------------------tcgg-------ct
                       Alpaca  ----------------------------t-ggt----gtcc
               Bactrian camel  ----------------------------t-ggt----gtcc
                      Dolphin  ----------------------------t-ggt----gtcc
                 Killer whale  ----------------------------t-ggt----gtcc
             Tibetan antelope  ----------------------------t-ggt----gtcc
                          Cow  ----------------------------t-ggt----gtcc
                        Sheep  ----------------------------t-ggt----gtcc
                Domestic goat  ----------------------------t-ggt----gtcc
                        Horse  ----------------------------t-aat----gccc
             White rhinoceros  ----------------------------t-ggt----gccc
                          Cat  ----------------------------t-ggt----accc
                          Dog  caggtctggaccctccaggaaccacccac-gga----gcca
                      Ferret   ----------------------------t-ggt----gcct
                        Panda  ----------------------------a-ggt----gccc
               Pacific walrus  ----------------------------t-ggt----gtcc
                 Weddell seal  ----------------------------t-ggt----gccc
             Black flying-fox  ------------------------------ggc----accc
                      Megabat  ------------------------------ggc----accc
                Big brown bat  ----------------------------a-ggc----atcc
         David's myotis (bat)  ----------------------------a-ggc----atcc
                     Microbat  ----------------------------a-ggc----atcc
                     Aardvark  ----------------------------t-gcc----ctcc
                    Armadillo  --------------------------------------tcc
                      Opossum  ----------------------------a-ggc----gctc
              Tasmanian devil  ----------------------------t-ggccaaagctc
                  Rock pigeon  -----------------------------------------
                 Saker falcon  -----------------------------------------
             Peregrine falcon  -----------------------------------------
       White-throated sparrow  -----------------------------------------
                  Zebra finch  -----------------------------------------
           Tibetan ground jay  -----------------------------------------
                   Budgerigar  -----------------------------------------
                Scarlet macaw  -----------------------------------------
           American alligator  -----------------------------------------
              Green seaturtle  -----------------------------------------
               Painted turtle  -----------------------------------------
     Chinese softshell turtle  -----------------------------------------
                       Medaka  =========================================
       Yellowbelly pufferfish  =========================================
           Southern platyfish  =========================================
                    Zebrafish  =========================================
                         Fugu  =========================================
          Pundamilia nyererei  =========================================
                 Atlantic cod  =========================================
     Mexican tetra (cavefish)  =========================================
                       Turkey  =========================================
                       Parrot  =========================================
                    Tetraodon  =========================================
                      Chicken  =========================================
          Collared flycatcher  =========================================
                  Spotted gar  =========================================
                  Zebra mbuna  =========================================
        Burton's mouthbreeder  =========================================
          Princess of Burundi  =========================================
                X. tropicalis  =========================================
          Medium ground finch  =========================================
                        Shrew  =========================================
                          Rat  =========================================
             Brush-tailed rat  =========================================
                   Chinchilla  =========================================
                         Pika  =========================================
                        Mouse  =========================================
                       Tenrec  =========================================
          Cape elephant shrew  =========================================
       Lesser Egyptian jerboa  =========================================
                     Hedgehog  =========================================
                     Platypus  =========================================
                     Squirrel  =========================================
                      Manatee  =========================================
                     Elephant  =========================================
             Cape golden mole  =========================================

Alignment block 21 of 248 in window, 62371625 - 62371684, 60 bps 
B D                     Human  t-------------gtgc--------------a-------------------------gg-cgggcc---
B D                     Chimp  t-------------gtgc--------------a-------------------------gg-cgggcc---
B D                   Gorilla  t-------------gtgc--------------a-------------------------gg-cggacc---
B D                 Orangutan  t-------------gtgc--------------c-------------------------gg-cgggcc---
B D                    Gibbon  t-------------gtgc--------------a-------------------------gg-tgggcc---
B D                    Rhesus  t-------------gtgc--------------a-------------------------gg-tgggcc---
B D       Crab-eating macaque  t-------------gtgc--------------a-------------------------gg-tgggcc---
B D                    Baboon  t-------------gtgc--------------a-------------------------gg-tgggcc---
B D              Green monkey  t-------------gtgc--------------a-------------------------gg-tgggcc---
B D                  Marmoset  ----------------------------------------------------------------acc---
B D           Squirrel monkey  t-------------gtgt--------------a-------------------------ga-tggacc---
B D                  Bushbaby  t-------------gggt--------------a-------------------------tg-cgggcc---
           Chinese tree shrew  t-------------gcac--------------a-------------------------ggcccggcc---
                 Prairie vole  t-------------gaag--------------a-------------------------ga-gagg-----
B D           Chinese hamster  t-------------aagaggagggcacaaccta-------------------------gg-gagg-----
               Golden hamster  --------------------------------a-------------------------gg-gagg-----
B D            Naked mole-rat  g-------------cgac--------------a-------------------------ga-tggtcc---
B D                Guinea pig  g--------------gac--------------a-------------------------ga-gcgg-c---
B D                    Alpaca  t-------------ggac--------------t-------------------------gg-caggcc---
               Bactrian camel  t-------------ggac--------------t-------------------------gg-caggcc---
B D                   Dolphin  t-------------aggc--------------a-------------------------gg-caggcc---
                 Killer whale  t-------------agac--------------a-------------------------gg-caggcc---
             Tibetan antelope  t-------------agat--------------g-------------------------gc-caggcc---
B D                       Cow  t-------------agat--------------g-------------------------gg-caggcc---
B D                     Sheep  t-------------agat--------------g-------------------------gc-caggcc---
                Domestic goat  t-------------agat--------------g-------------------------gc-caggcc---
B D                     Horse  t-------------ggac--------------a-------------------------gg-caggcc---
B D          White rhinoceros  t-------------gggc--------------a-------------------------gg-cgggcc---
B D                       Cat  t-------------ggac--------------a-------------------------gg-caggct---
B D                       Dog  g-------------tggg--------------t-------------------------gt-tgggct---
B D                   Ferret   g-------------gggc--------------a-------------------------gg-cggact---
B D                     Panda  t-------------gaac--------------a-------------------------gg-caggct---
               Pacific walrus  a-------------ggac--------------a-------------------------gg-cgggct---
                 Weddell seal  a-------------ggac--------------a-------------------------gg-cgggct---
             Black flying-fox  t-------------------------------g-------------------------ga-cgggcc---
B D                   Megabat  t-------------------------------g-------------------------ga-cgggcc---
                Big brown bat  t--------------gcc--------------g-------------------------gg-caggcc---
         David's myotis (bat)  t-------------ggcc--------------g-------------------------gg-cgggcc---
B D                  Microbat  t-------------ggcc--------------g-------------------------gg-caggcc---
                     Aardvark  c-------------accc--------------a-------------------------gg-gcagcc---
B D                 Armadillo  t-------------gccc--------------a-------------------------gg-g--gac---
B D                   Opossum  tcccgctcgccttgggcc--------------a-------------------------ag-tgagcc---
B D           Tasmanian devil  ctggcaaggcctctggcc--------------c-------------------------ag-agggtc---
B D                  Platypus  t-------------gtgc--------------a-------------------------gc-cccgcc---
  D               Rock pigeon  -----------------------------ccca------------------cgagcgggg-gcagct---
  D              Saker falcon  -----------------------------gtca-------------ctccacttgagtgc-tcagcc---
  D          Peregrine falcon  -----------------------------ctca--------gtttcccccgcaggagagg-ggagccgca
  D    White-throated sparrow  -----------------------------cctg-------------------------gc-acagcc---
B D               Zebra finch  -----------------------------cccg-------------------ctgcgagc-acaccc---
           Tibetan ground jay  -----------------------------cgac-------------------------tc-gcaccc---
B D                Budgerigar  -----------------------------ccca-----tgccctgagacccactgcctgc-tcagcc---
  D             Scarlet macaw  -----------------------------cccggcttttccctcccgacgtgtgggctgg-aaaact---
B D        American alligator  -----------------------------ccat-------------------------gc-ccacct---
  D           Green seaturtle  -----------------------------tg------------------------agagc-tttgtg---
  D            Painted turtle  -----------------------------tgtg------------------c--cagggc-gccatc---
  D  Chinese softshell turtle  -----------------------------cggg------------------cgagaaggc-agggtg---
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Atlantic cod  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Turkey  ======================================================================
  D                    Parrot  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D       Collared flycatcher  ======================================================================
                 Spotted gar  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                     Shrew  ======================================================================
B D                       Rat  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Hedgehog  ======================================================================
B D                  Squirrel  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ---------------c-------------------------------------a----gc----------
                        Chimp  ---------------c-------------------------------------a----gc----------
                      Gorilla  ---------------c-------------------------------------a----gc----------
                    Orangutan  ---------------c-------------------------------------a----gc----------
                       Gibbon  ---------------c-------------------------------------a----gc----------
                       Rhesus  ---------------c-------------------------------------g----gc----------
          Crab-eating macaque  ---------------c-------------------------------------g----gc----------
                       Baboon  ---------------c-------------------------------------g----gc----------
                 Green monkey  ---------------c-------------------------------------g----gt----------
                     Marmoset  ---------------t-------------------------------------g----cc----------
              Squirrel monkey  ---------------t-------------------------------------g----gc----------
                     Bushbaby  ---------------c-------------------------------------a----g-----------
           Chinese tree shrew  ---------------c-------------------------------------a----gc----------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
               Naked mole-rat  ---------------a-------------------------------------g----g-----------
                   Guinea pig  ---------------a-------------------------------------g----g-----------
                       Alpaca  ---------------t-------------------------------------g----ac----------
               Bactrian camel  ---------------t-------------------------------------g----ac----------
                      Dolphin  ---------------t-------------------------------------g----gc----------
                 Killer whale  ---------------t-------------------------------------g----gc----------
             Tibetan antelope  ---------------t-------------------------------------g----gc----------
                          Cow  ---------------t-------------------------------------g----gc----------
                        Sheep  ---------------t-------------------------------------g----tc----------
                Domestic goat  ---------------t-------------------------------------g----gc----------
                        Horse  ---------------t-------------------------------------g----gc----------
             White rhinoceros  ---------------t-------------------------------------a----gc----------
                          Cat  ----------------------------------------------------------gc----------
                          Dog  ----------------------------------------------------------gctctgatttcc
                      Ferret   ----------------------------------------------------------g-----------
                        Panda  ----------------------------------------------------------g-----------
               Pacific walrus  ----------------------------------------------------------gc----------
                 Weddell seal  ----------------------------------------------------------gc----------
             Black flying-fox  ---------------c-------------------------------------a----gc----------
                      Megabat  ---------------c-------------------------------------a----gc----------
                Big brown bat  ---------------g-------------------------------------g----ac----------
         David's myotis (bat)  ---------------g-------------------------------------g----gc----------
                     Microbat  ---------------a-------------------------------------g----gc----------
                     Aardvark  ---------------c-------------------------------------a----gc----------
                    Armadillo  ---------------c-------------------------------------a----g-----------
                      Opossum  ---------------gg------------------------------------g----gc----------
              Tasmanian devil  ---------------atc-----------------------------------t----gc----------
                     Platypus  ---------------c-------------------------------------a----gc----------
                  Rock pigeon  ---------------ct------------------------------------g----ga----------
                 Saker falcon  ---------------ctgct---------------------------------c----tg----------
             Peregrine falcon  cgtagggctgggacaccctc---------------------------------c----tg----------
       White-throated sparrow  ---------------c------------------------------------------ga----------
                  Zebra finch  ---------------ct------------------------------------gacaagg----------
           Tibetan ground jay  ---------------cc------------------------------------g----gg----------
                   Budgerigar  ---------------ctccctgcatccca------------------------g----gg----------
                Scarlet macaw  ---------------tttcatttgtgacaaagagaggaaaacaaaactcagccg----aa----------
           American alligator  ---------------g-------------------------------------g----ag----------
              Green seaturtle  ---------------g-------------------------------------g----aa----------
               Painted turtle  ---------------g-------------------------------------g----ac----------
     Chinese softshell turtle  ---------------a-------------------------------------c----aa----------
                       Medaka  ======================================================================
       Yellowbelly pufferfish  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                         Fugu  ======================================================================
          Pundamilia nyererei  ======================================================================
                 Atlantic cod  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Turkey  ======================================================================
                       Parrot  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
          Collared flycatcher  ======================================================================
                  Spotted gar  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                        Shrew  ======================================================================
                          Rat  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                         Pika  ======================================================================
                        Mouse  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Hedgehog  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
             Cape golden mole  ======================================================================

                        Human  -------------cc---------------------------catgaca-------------------ag
                        Chimp  -------------cc---------------------------cacgaca-------------------ag
                      Gorilla  -------------cc---------------------------catgaca-------------------ag
                    Orangutan  -------------cc---------------------------catgaca-------------------ag
                       Gibbon  -------------cc---------------------------catgaca-------------------ag
                       Rhesus  -------------cc---------------------------catgaca-------------------ag
          Crab-eating macaque  -------------cc---------------------------catgaca-------------------ag
                       Baboon  -------------cc---------------------------catgaca-------------------ag
                 Green monkey  -------------cc---------------------------catgaca-------------------ag
                     Marmoset  -------------cc---------------------------catgaca-------------------ag
              Squirrel monkey  -------------cc---------------------------catgaca-------------------ag
                     Bushbaby  -------------cc---------------------------cacacca-------------------ag
           Chinese tree shrew  -------------ct-------------------------------gca-------------------ag
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
               Naked mole-rat  --------------c---------------------------cacgaca-------------------ag
                   Guinea pig  --------------c---------------------------cacgcc----------------------
                       Alpaca  -------------cc---------------------------tataaaa-------------------ag
               Bactrian camel  -------------cc---------------------------tataaaa-------------------ag
                      Dolphin  -------------cc---------------------------tatagaa-------------------ag
                 Killer whale  -------------cc---------------------------tatagaa-------------------ag
             Tibetan antelope  -------------tc---------------------------tctagaa-------------------gg
                          Cow  -------------tt---------------------------tctagaa-------------------gg
                        Sheep  -------------tc---------------------------tctagaa-------------------gg
                Domestic goat  -------------tc---------------------------tctagaa-------------------gg
                        Horse  -------------cc---------------------------tatgaaa-------------------aa
             White rhinoceros  -------------cc---------------------------tataaaa-------------------ag
                          Cat  -------------cc---------------------------tataaaa-------------------aa
                          Dog  cggatttcttcattc---------------------------tattaaatgaaatctcagctgtgtcctg
                      Ferret   -------------gc---------------------------tataaag--------------------g
                        Panda  -------------cc---------------------------tataaaa--------------------g
               Pacific walrus  -------------cc---------------------------tataaaa--------------------g
                 Weddell seal  -------------cc---------------------------tataaaa--------------------g
             Black flying-fox  -------------cc---------------------------tgtagag-------------------tg
                      Megabat  -------------cc---------------------------tgtagag-------------------tg
                Big brown bat  -------------cc---------------------------tataaaa-------------------ag
         David's myotis (bat)  -------------cc---------------------------tatagaa-------------------ag
                     Microbat  -------------cc---------------------------tatgaaa-------------------ag
                     Aardvark  -------------ct---------------------------taggcag-------------------gg
                    Armadillo  --------------------------------------------agaag-------------------gg
                      Opossum  -------------tg---------------------------gctaggg-------------------ag
              Tasmanian devil  -------------tc---------------------------tcagagg-------------------ag
                     Platypus  -------------tg---------------------------caagcgt-------------------tg
                  Rock pigeon  -------------gc---------------------------ccccctc-------------------ca
                 Saker falcon  -------------tc---------------------------cccaacc-------------------cc
             Peregrine falcon  -------------tc---------------------------gcaatca-------------------cc
       White-throated sparrow  -------------ga---------------------------agccaag-------------------tc
                  Zebra finch  -------------tg---------------------------aaccacg-------------------cc
           Tibetan ground jay  -------------ac---------------------------caccgcg-------------------ac
                   Budgerigar  -------------gt---------------------------ccccacc-------------------cc
                Scarlet macaw  -------------at---------------------------tccaatc-------------------cc
           American alligator  -------------ct---------------------------cttcaag-------------------ct
              Green seaturtle  -------------gc---------------------------cctgaag-------------------ag
               Painted turtle  -------------cctccccaactccttccctctgccctccgccttgcc-------------------ag
     Chinese softshell turtle  -------------gc--------------------------------cg-------------------ag
                       Medaka  ======================================================================
       Yellowbelly pufferfish  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                         Fugu  ======================================================================
          Pundamilia nyererei  ======================================================================
                 Atlantic cod  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Turkey  ======================================================================
                       Parrot  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
          Collared flycatcher  ======================================================================
                  Spotted gar  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                        Shrew  ======================================================================
                          Rat  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                         Pika  ======================================================================
                        Mouse  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Hedgehog  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
             Cape golden mole  ======================================================================

                        Human  -------cag-----gc------aa-------------------a-----cctg----------------
                        Chimp  -------cag-----gc------aa-------------------a-----cctg----------------
                      Gorilla  -------cag-----gc------aa-------------------a-----cctg----------------
                    Orangutan  -------cag-----gc------aa-------------------a-----cctg----------------
                       Gibbon  -------cag-----gc------aa-------------------a-----cctg----------------
                       Rhesus  -------cag-----ac------aa-------------------a-----cctg----------------
          Crab-eating macaque  -------cag-----ac------aa-------------------a-----cctg----------------
                       Baboon  -------cag-----ac------aa-------------------a-----cctg----------------
                 Green monkey  -------cag-----aa------aa-------------------a-----cctg----------------
                     Marmoset  -------aac-----ac------aa-------------------a----ccctg----------------
              Squirrel monkey  -------cac-----tc------aa-------------------a-----gctg----------------
                     Bushbaby  -------c-------cc------at-------------------g-----actg----------------
           Chinese tree shrew  -------cac-----cc----tgca-------------------g-----cctg----------------
                 Prairie vole  ----------------a------ac-------------------a-----ctta----------------
              Chinese hamster  ----------------c------ct-------------------c-----cata----------------
               Golden hamster  ----------------c------ct-------------------c-----catg----------------
               Naked mole-rat  ----------------c------ac-------------------g-----tttg----------------
                   Guinea pig  ----------------t------gc-------------------a-----cacg----------------
                       Alpaca  -------cat-----at------ga-------------------c-----cccg----------------
               Bactrian camel  -------cac-----at------ga-------------------c-----cccg----------------
                      Dolphin  -------cac-----ag------ga-------------------a-----ccca----------------
                 Killer whale  -------cac-----aa------ga-------------------a-----ccca----------------
             Tibetan antelope  -------cac-----ac------ac-------------------a-----tcca----------------
                          Cow  -------cac-----ac------ac-------------------a-----tcca----------------
                        Sheep  -------cac-----ac------ac-------------------a-----tcca----------------
                Domestic goat  -------cac-----ac------ac-------------------a-----tcca----------------
                        Horse  -------cac-----at------ga-------------------a-----ccca----------------
             White rhinoceros  -------cac-----at------ga-------------------a-----ccca----------------
                          Cat  -------ctt-----gc------tg-------------------g-----ctgg----------------
                          Dog  -------ccctg---tt------gg-------------------c-----cccgccgtacctccaggcct
                      Ferret   -------cgc-----at------ga-------------------c-----cccg----------------
                        Panda  -------cac-----at------ga-------------------a-----ccca----------------
               Pacific walrus  -------cac-----at------ga-------------------c-----ccca----------------
                 Weddell seal  -------cac-----at------ga-------------------c-----ccca----------------
             Black flying-fox  -------cac-----gc------gt-------------------a-----cctg----------------
                      Megabat  -------cac-----gc------gt-------------------a-----cctg----------------
                Big brown bat  -------cac-----ga------gc-------------------g-----cctg----------------
         David's myotis (bat)  -------cat-----ga------gt-------------------a-----cctg----------------
                     Microbat  -------cac-----ga------gt-------------------a-----cctg----------------
                     Aardvark  -------agccaccagc------gggccttcttggtggcag-----------------------------
                    Armadillo  ---------------gc------gg---------------------------------------------
                      Opossum  -------cag-----gcgatgtggg-------------------accacaccca----------------
              Tasmanian devil  -------cag-----cc----cggg-------------------g-------ca----------------
                     Platypus  -------atg-----tc------gg-------------------a-----gctt----------------
                  Rock pigeon  -----gtagg-----cc------ag-------------------g-----agac----------------
                 Saker falcon  --gtcccagc-----cc-cccagca-------------------c-----ccct----------------
             Peregrine falcon  --gcgccgga-----cc------ca-------------------g-----actc----------------
       White-throated sparrow  --------------------------------------------c-----ctgt----------------
                  Zebra finch  --gtgctggc-----cg------tg---------------g---g-----ctac----------------
           Tibetan ground jay  ---ctccgag-----tc------tg---------------g---g-----ctcc----------------
                   Budgerigar  --atcccagg-----tc------ag-------------------c-----atct----------------
                Scarlet macaw  aaaccccaaa-----cc------cg---------------gtgcc-----tttt----------------
           American alligator  --gccgtcgt-----ct------ga-------------------g-----accg----------------
              Green seaturtle  --gggccaga-----tt------ta-------------------a-----gttg----------------
               Painted turtle  --gccctggg-----gc------tc-------------------a-----gtga----------------
     Chinese softshell turtle  --gccacagac----gc------tg-------------------a-----ccct----------------
                       Medaka  ======================================================================
       Yellowbelly pufferfish  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                         Fugu  ======================================================================
          Pundamilia nyererei  ======================================================================
                 Atlantic cod  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Turkey  ======================================================================
                       Parrot  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
          Collared flycatcher  ======================================================================
                  Spotted gar  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                X. tropicalis  ======================================================================
          Medium ground finch  ======================================================================
                        Shrew  ======================================================================
                          Rat  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                         Pika  ======================================================================
                        Mouse  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Hedgehog  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ----------gggtgc-------tcag-----a---------aa----t-gggg--g
                        Chimp  ----------gggtgc-------tcag-----a---------aa----t-gggg--g
                      Gorilla  ----------gggtgc-------tcag-----a---------aa----t-gggg--g
                    Orangutan  ----------gggtgc-------tcag-----a---------aa----t-gggg--g
                       Gibbon  ----------gggtgc-------tcag-----a---------aa----c-gggg--g
                       Rhesus  ----------gggtgc-------tcag-----a---------aa----t-gggg--g
          Crab-eating macaque  ----------gggtgc-------tcag-----a---------aa----t-gggg--g
                       Baboon  ----------gggtgc-------tcag-----a---------aa----t-gggg--g
                 Green monkey  ----------gggtgc-------tcag-----a---------aa----tggggg--g
                     Marmoset  ----------gggtgc-------ttag-----a---------aa----t-gggg--g
              Squirrel monkey  ----------gagtgc-------tcag-----a---------aa----t-gggg--g
                     Bushbaby  ----------ggatcc-------tggg-----a---------ag----c-atgg--g
           Chinese tree shrew  ----------gga-gc-------tcag-----a-----------------gaag--c
                 Prairie vole  ----------taacag----------gtataca---------ac----c-tagg--g
              Chinese hamster  ----------cagtgg-------tcagtgtaat---------gc----t-caag--a
               Golden hamster  ----------cagtgg-------tcaatgtgat---------gc----t-caag--a
               Naked mole-rat  ----------tgcccc-------tgggtgctca---------gc----t-ttgg--g
                   Guinea pig  ----------tgtagc-------tgggcgcccacatgcatgtgc----t-cagg--g
                       Alpaca  ----------ggatac-------tctg-----a---------aa----t-ctgg---
               Bactrian camel  ----------ggatac-------tccg-----a---------aa----t-ctgg---
                      Dolphin  ----------ggatgc-------tcag-----a---------ca----t-gtgg---
                 Killer whale  ----------ggatgc-------tcag-----a---------ca----t-gtgg---
             Tibetan antelope  ----------ggatgc-------tcag-----a---------aa----t-gtga---
                          Cow  ----------ggatgc-------tcag-----a---------aa----t-gtga---
                        Sheep  ----------ggatgc-------tcag-----a---------aa----t-gtga---
                Domestic goat  ----------ggatgc-------tcag-----a---------aa----t-gtga---
                        Horse  ----------ggatgc-------tcag-----a---------aa----t-gtggg--
             White rhinoceros  ----------ggatgc-------tcag-----a---------aa----t-atga---
                          Cat  ----------ggctgc-------tc-------a---------aa----t-cagg---
                          Dog  ggtgaagggcaggtgc-------caga-----g---------agcggcc-acgg---
                      Ferret   ----------gggtgc-------tcgg-----g---------ag----t-acag---
                        Panda  ----------gcatgc-------tccg-----a---------aa----t-aggg---
               Pacific walrus  ----------ggatgc-------ccgg-----a---------aa----t-atgg---
                 Weddell seal  ----------ggatgc-------ccgg-----a---------aa----t-atgg---
             Black flying-fox  ----------tgatgc-------tcag-----a---------aa----c-atgg-g-
                      Megabat  ----------tgatgc-------tcag-----a---------aa----c-atgg-g-
                Big brown bat  ----------ggatgc-------tcag-----g---------aa----c-atgg-g-
         David's myotis (bat)  ----------gg-tgc-------tcag-----g---------aa----c-atgg-g-
                     Microbat  ----------ga-tgc-------tcag-----g---------aa----c-atgg-g-
                     Aardvark  ---------------------------------------------------------
                    Armadillo  ---------------------------------------------------------
                      Opossum  ----------agaagctgcctggggag------------------------------
              Tasmanian devil  ----------gggagc-------ggag------------------------------
                     Platypus  ----------ggacct-------tttg-----c---------ca----c-aagg---
                  Rock pigeon  ----------acacag-------gcag------------------------------
                 Saker falcon  ----------ccctcc-------ctgc------------------------------
             Peregrine falcon  ----------acccac-------ttga------------------------------
       White-throated sparrow  ----------gtccag-------gggt------------------------------
                  Zebra finch  ----------ggacag-------gagg------------------------------
           Tibetan ground jay  ----------gcccag-------caag------------------------------
                   Budgerigar  ----------gc------------agg------------------------------
                Scarlet macaw  ----------gccatc-------aagg------------------------------
           American alligator  ----------ccttag-------acga------------------------------
              Green seaturtle  ----------gggtgt-------taca------------------------------
               Painted turtle  ----------tgattt-------caca------------------------------
     Chinese softshell turtle  ----------gggctt-------cctg------------------------------
                       Medaka  =========================================================
       Yellowbelly pufferfish  =========================================================
           Southern platyfish  =========================================================
                    Zebrafish  =========================================================
                         Fugu  =========================================================
          Pundamilia nyererei  =========================================================
                 Atlantic cod  =========================================================
     Mexican tetra (cavefish)  =========================================================
                       Turkey  =========================================================
                       Parrot  =========================================================
                    Tetraodon  =========================================================
                      Chicken  =========================================================
          Collared flycatcher  =========================================================
                  Spotted gar  =========================================================
                  Zebra mbuna  =========================================================
        Burton's mouthbreeder  =========================================================
          Princess of Burundi  =========================================================
                X. tropicalis  =========================================================
          Medium ground finch  =========================================================
                        Shrew  =========================================================
                          Rat  =========================================================
             Brush-tailed rat  =========================================================
                   Chinchilla  =========================================================
                         Pika  =========================================================
                        Mouse  =========================================================
                       Tenrec  =========================================================
          Cape elephant shrew  =========================================================
       Lesser Egyptian jerboa  =========================================================
                     Hedgehog  =========================================================
                     Squirrel  =========================================================
                      Manatee  =========================================================
                     Elephant  =========================================================
             Cape golden mole  =========================================================

Inserts between block 21 and 22 in window
B D                    Horse 1213bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 2bp
B D                Armadillo 2bp
B D                 Platypus 4bp

Alignment block 22 of 248 in window, 62371685 - 62371688, 4 bps 
B D                     Human  g--g-----------cc---
B D                     Chimp  g--g-----------cc---
B D                   Gorilla  g--g-----------cc---
B D                 Orangutan  g--g-----------cc---
B D                    Gibbon  g--g-----------cc---
B D                    Rhesus  a--g-----------cc---
B D       Crab-eating macaque  a--g-----------cc---
B D                    Baboon  g--g-----------cc---
B D              Green monkey  g--g-----------cc---
B D                  Marmoset  agcg-----------ct---
B D           Squirrel monkey  ggcg-----------cc---
B D                  Bushbaby  g--t-----------gg---
           Chinese tree shrew  t--g-----------cc---
                 Prairie vole  a-------------------
B D           Chinese hamster  a--t-----------tc---
               Golden hamster  a--t-----------tc---
B D            Naked mole-rat  g--g-----------cc---
B D                Guinea pig  g--g-----------cc---
B D                    Alpaca  ---g-----------gc---
               Bactrian camel  ---g-----------gc---
B D                   Dolphin  ---g-----------gc---
                 Killer whale  ---g-----------gc---
             Tibetan antelope  ---g-----------gc---
B D                       Cow  ---g-----------gc---
B D                     Sheep  ---g-----------gc---
                Domestic goat  ---g-----------gc---
B D          White rhinoceros  ---g-----------gc---
B D                       Cat  ---g-----------ac---
B D                       Dog  ---t-----------gt---
B D                   Ferret   ---g-----------gc---
B D                     Panda  ---g-----------gt---
               Pacific walrus  ---g-----------gc---
                 Weddell seal  ---g-----------gc---
                     Aardvark  ----------------c---
B D                   Opossum  ---g-----------ct---
B D           Tasmanian devil  ---g-----------ct---
B D                  Platypus  ---g-----------tc---
  D               Rock pigeon  ---g-----------gt--c
  D              Saker falcon  ---c-----------tc--a
  D          Peregrine falcon  ---c-----------ac--a
  D    White-throated sparrow  ---gctgca------ac--t
B D               Zebra finch  ---atggcactccctac--t
           Tibetan ground jay  ---a-----------gt--t
B D                Budgerigar  ---g-----------ac---
  D             Scarlet macaw  ---g-----------gctct
B D        American alligator  ---g-----------cc--c
  D           Green seaturtle  ---g-----------ac--c
  D            Painted turtle  ---c-----------gc--c
  D  Chinese softshell turtle  ---t-----------cc--c
B D                    Medaka  ====================
      Yellowbelly pufferfish  ====================
          Southern platyfish  ====================
B D                 Zebrafish  ====================
B D                      Fugu  ====================
         Pundamilia nyererei  ====================
B D              Atlantic cod  ====================
    Mexican tetra (cavefish)  ====================
B D                    Turkey  ====================
  D                    Parrot  ====================
B D                 Tetraodon  ====================
B D                   Chicken  ====================
  D       Collared flycatcher  ====================
                 Spotted gar  ====================
                 Zebra mbuna  ====================
       Burton's mouthbreeder  ====================
         Princess of Burundi  ====================
B D             X. tropicalis  ====================
B D       Medium ground finch  ====================
B D                     Shrew  ====================
B D                       Rat  ====================
            Brush-tailed rat  ====================
                  Chinchilla  ====================
B D                      Pika  ====================
B D                     Mouse  ====================
B D                    Tenrec  ====================
         Cape elephant shrew  ====================
               Big brown bat  ====================
      Lesser Egyptian jerboa  ====================
B D                  Hedgehog  ====================
B D                  Squirrel  ====================
B D                   Manatee  ====================
B D                  Elephant  ====================
B D                 Armadillo  ====================
            Cape golden mole  ====================
B D                  Microbat  ====================
        David's myotis (bat)  ====================
B D                   Megabat  ====================
            Black flying-fox  ====================
B D                     Horse  ====================

Inserts between block 22 and 23 in window
                Prairie vole 5bp
B D          Chinese hamster 16bp
              Golden hamster 915bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 2bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
                    Aardvark 18bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                 Platypus 2bp

Alignment block 23 of 248 in window, 62371689 - 62371694, 6 bps 
B D                     Human  tcatgg-------------------
B D                     Chimp  tcgtgg-------------------
B D                   Gorilla  tcatgg-------------------
B D                 Orangutan  tcatgg-------------------
B D                    Gibbon  tcatgg-------------------
B D                    Rhesus  ttgtgg-------------------
B D       Crab-eating macaque  ttgtgg-------------------
B D                    Baboon  tcgtgg-------------------
B D              Green monkey  tcgtgg-------------------
B D                  Marmoset  tcatgg-------------------
B D           Squirrel monkey  tcatgg-------------------
B D                  Bushbaby  gagtgg-------------------
           Chinese tree shrew  ccagag-------------------
B D                    Alpaca  tcaggg-------------------
               Bactrian camel  tcaggg-------------------
B D                   Dolphin  tcatga-------------------
                 Killer whale  tcatga-------------------
             Tibetan antelope  ttgtga-------------------
B D                       Cow  ttgtga-------------------
B D                     Sheep  ttgtga-------------------
                Domestic goat  ttgtga-------------------
B D          White rhinoceros  ccgtga-------------------
B D                       Cat  tcatgg-------------------
B D                       Dog  atgcga-------------------
B D                   Ferret   acatga-------------------
B D                     Panda  ttgtga-------------------
               Pacific walrus  tcgtga-------------------
                 Weddell seal  ccgtga-------------------
             Black flying-fox  ttgcgg-------------------
B D                   Megabat  ttgcgg-------------------
                Big brown bat  ctgtga-------------------
         David's myotis (bat)  ttgtgg-------------------
B D                  Microbat  ttgtgg-------------------
                     Aardvark  ttctgg-------------------
B D                 Armadillo  tccagg-------------------
B D                   Opossum  tcaagg-------------------
B D           Tasmanian devil  ----gg-------------------
B D                  Platypus  ccatc--------------------
  D               Rock pigeon  -----t------------------c
  D              Saker falcon  -----g------------------t
  D          Peregrine falcon  -----t------------------c
  D    White-throated sparrow  -----g------------------t
B D               Zebra finch  -----g-gatcgtcaa--------g
           Tibetan ground jay  -----g------------------g
  D             Scarlet macaw  -----g------------------a
B D        American alligator  -----t------------------t
  D           Green seaturtle  -----tggagcatcctgctggacgg
  D            Painted turtle  -----t------------------g
  D  Chinese softshell turtle  -----t------------------g
B D                    Medaka  =========================
      Yellowbelly pufferfish  =========================
          Southern platyfish  =========================
B D                 Zebrafish  =========================
B D                      Fugu  =========================
         Pundamilia nyererei  =========================
B D              Atlantic cod  =========================
    Mexican tetra (cavefish)  =========================
B D                    Turkey  =========================
  D                    Parrot  =========================
B D                Budgerigar  -------------------------
B D                 Tetraodon  =========================
B D                   Chicken  =========================
  D       Collared flycatcher  =========================
                 Spotted gar  =========================
                 Zebra mbuna  =========================
       Burton's mouthbreeder  =========================
         Princess of Burundi  =========================
B D             X. tropicalis  =========================
B D       Medium ground finch  =========================
B D                     Shrew  =========================
              Golden hamster  =========================
B D                       Rat  =========================
            Brush-tailed rat  =========================
                  Chinchilla  =========================
B D                Guinea pig  -------------------------
B D            Naked mole-rat  -------------------------
B D                      Pika  =========================
B D                     Mouse  =========================
B D                    Tenrec  =========================
         Cape elephant shrew  =========================
      Lesser Egyptian jerboa  =========================
B D                  Hedgehog  =========================
B D           Chinese hamster  =========================
B D                  Squirrel  =========================
                Prairie vole  =========================
B D                   Manatee  =========================
B D                  Elephant  =========================
            Cape golden mole  =========================
B D                     Horse  =========================

Inserts between block 23 and 24 in window
B D                   Alpaca 192bp
              Bactrian camel 178bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 3bp
               Domestic goat 3bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 9bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp
B D                  Opossum 2bp
B D          Tasmanian devil 2bp

Alignment block 24 of 248 in window, 62371695 - 62371696, 2 bps 
B D                     Human  ag-
B D                     Chimp  ag-
B D                   Gorilla  ag-
B D                 Orangutan  ag-
B D                    Gibbon  ag-
B D                    Rhesus  ag-
B D       Crab-eating macaque  ag-
B D                    Baboon  ag-
B D              Green monkey  ag-
B D                  Marmoset  ag-
B D           Squirrel monkey  ag-
B D                  Bushbaby  gg-
           Chinese tree shrew  gg-
                     Aardvark  ag-
B D                 Armadillo  ag-
B D                   Opossum  ag-
B D           Tasmanian devil  gg-
B D                  Platypus  aa-
  D               Rock pigeon  -gg
  D              Saker falcon  -tt
  D          Peregrine falcon  -gt
  D    White-throated sparrow  -gg
B D               Zebra finch  -aa
           Tibetan ground jay  -gg
  D             Scarlet macaw  -ga
B D        American alligator  -gt
  D           Green seaturtle  -gg
  D            Painted turtle  -at
  D  Chinese softshell turtle  -gc
B D                    Medaka  ===
      Yellowbelly pufferfish  ===
          Southern platyfish  ===
B D                 Zebrafish  ===
B D                      Fugu  ===
         Pundamilia nyererei  ===
B D              Atlantic cod  ===
    Mexican tetra (cavefish)  ===
B D                    Turkey  ===
  D                    Parrot  ===
B D                Budgerigar  ---
B D                 Tetraodon  ===
B D                   Chicken  ===
  D       Collared flycatcher  ===
                 Spotted gar  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D             X. tropicalis  ===
B D       Medium ground finch  ===
B D                     Shrew  ===
              Golden hamster  ===
B D                       Rat  ===
            Brush-tailed rat  ===
                  Chinchilla  ===
B D                Guinea pig  ---
B D            Naked mole-rat  ---
B D                      Pika  ===
B D                     Mouse  ===
B D                    Tenrec  ===
         Cape elephant shrew  ===
               Big brown bat  ===
      Lesser Egyptian jerboa  ===
B D                  Hedgehog  ===
B D           Chinese hamster  ===
B D                     Panda  ===
            Tibetan antelope  ===
              Pacific walrus  ===
B D                       Dog  ===
B D                       Cat  ===
B D                     Sheep  ===
                Killer whale  ===
              Bactrian camel  ===
B D                    Alpaca  ===
               Domestic goat  ===
B D                       Cow  ===
B D                   Ferret   ---
B D                  Squirrel  ===
                Prairie vole  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D                   Dolphin  ===
            Cape golden mole  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                   Megabat  ===
            Black flying-fox  ===
                Weddell seal  ===
B D          White rhinoceros  ===
B D                     Horse  ===

Inserts between block 24 and 25 in window
B D                 Platypus 5bp

Alignment block 25 of 248 in window, 62371697 - 62371714, 18 bps 
B D                     Human  -----------------------ctctg--------t----------ggg-g-----tggtc--------
B D                     Chimp  -----------------------ctctg--------t----------ggg-g-----tggtc--------
B D                   Gorilla  -----------------------ctctg--------t----------ggg-g-----tggtc--------
B D                 Orangutan  -----------------------ctctg--------t----------ggg-g-----tggtc--------
B D                    Gibbon  -----------------------ctctg--------t----------ggg-g-----tggtc--------
B D                    Rhesus  -----------------------ctctg--------t----------a-g-g-----tggtc--------
B D       Crab-eating macaque  -----------------------ctctg--------t----------a-g-g-----tggtc--------
B D                    Baboon  -----------------------ctctg--------t----------agg-g-----tggtc--------
B D              Green monkey  -----------------------ctctg--------t----------agg-g-----tggtc--------
B D                  Marmoset  -----------------------ctctg--------t----------ggg-g-----tggtc--------
B D           Squirrel monkey  -----------------------ctctg--------t----------ggg-g-----tggtc--------
B D                  Bushbaby  -----------------------ttctgatgctcatt----------ggg-g-----cagtc--------
           Chinese tree shrew  -----------------------c-ctg--------t----------ggc-c-----ctctc--------
                 Prairie vole  -------------------------cca--------t----------gca-g-----aggtc--------
B D           Chinese hamster  -------------------------gag--------t----------gtg-g-----gggtc--------
B D            Naked mole-rat  -------------------------tcg--------tgatgcgccaggca-g-----tgctc--------
B D                Guinea pig  -------------------------tca--------t----cgct--gtg-a-----tggtc--------
               Bactrian camel  -----------------------ctcca--------t----------ggg-g-----tgttt--------
B D                   Dolphin  -----------------------cccca--------t----------ggg-g-----tggtc--------
                 Killer whale  -----------------------cccca--------t----------ggg-g-----tggtc--------
             Tibetan antelope  -----------------------cccca--------t----------agg-c-----tggac--------
B D                       Cow  -----------------------cccca--------t----------agg-c-----tggtc--------
B D                     Sheep  -----------------------cccca--------t----------agg-c-----tggac--------
                Domestic goat  -----------------------cccca--------t----------agg-c-----tggac--------
B D          White rhinoceros  -----------------------cacca--------t----------ggg-g-----tggtc--------
B D                       Cat  -----------------------ctctg--------c----------aga-a-----tgatgtacattca
B D                       Dog  -----------------------cgctc--------t----------ggc-c-----cctgc--------
B D                   Ferret   -----------------------ctccg--------a----------ggatg-----ccacg--------
B D                     Panda  -----------------------ctctg--------c----------gga-g-----tgacg--------
               Pacific walrus  -----------------------ctctg--------t----------gga-g-----caagg--------
                 Weddell seal  -----------------------ctctg--------t----------gga-g-----cgagg--------
             Black flying-fox  -----------------------cccca--------t----------gga-g-----tgatc--------
B D                   Megabat  -----------------------cccca--------t----------gga-g-----tgatc--------
                Big brown bat  -----------------------ctcga--------t----------ggg-g-----tgatc--------
         David's myotis (bat)  -----------------------ctcga--------t----------ggg-g-----tg-tc--------
B D                  Microbat  -----------------------ctcga--------t----------ggg-g-----tgatc--------
                     Aardvark  ---------------------------------------ctctctcacgt-g-----tctgc--------
B D                 Armadillo  -----------------------------------------------ggt-g-----ggtgc--------
B D                   Opossum  -----------------------ccctg--------t----------gtt-c-----ttgt---------
B D           Tasmanian devil  -----------------------gcctg--------t----------ggg-cagaggctgc---------
B D                  Platypus  -----------------------tgctc--------c----------agt-g-----tggtc--------
  D               Rock pigeon  ctctgtgaggat---------gtgtctg--------g---------------------------------
  D              Saker falcon  ccccc---gcag---------gagaggg--------g---------------------------------
  D          Peregrine falcon  cactg---ggac---------aggatca--------g---------------------------------
  D    White-throated sparrow  cccct---ggtg---------gtacctg--------t---------------------------------
B D               Zebra finch  ctcct---gggg---------ccgcctg--------t---------------------------------
           Tibetan ground jay  ctccc---gca--------------ctc--------c---------------------------------
B D                Budgerigar  ---aa---gcca---------gccccct--------g---------------------------------
  D             Scarlet macaw  cctcg---ggca---------ttgccca--------t---------------------------------
B D        American alligator  tcttg---gaga---------g---cca--------g---------------------------------
  D           Green seaturtle  c-------aaggggacaagcaggctctg--------t---------------------------------
  D            Painted turtle  c-------gagg---------ggttctg--------g---------------------------------
  D  Chinese softshell turtle  ctgt----gaggagagggggtggtgccc--------g---------------------------------
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Atlantic cod  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Turkey  ======================================================================
  D                    Parrot  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D       Collared flycatcher  ======================================================================
                 Spotted gar  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D             X. tropicalis  ======================================================================
B D       Medium ground finch  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  ======================================================================
B D                       Rat  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Hedgehog  ======================================================================
B D                    Alpaca  ======================================================================
B D                  Squirrel  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
            Cape golden mole  ======================================================================
B D                     Horse  ======================================================================

                        Human  -------tg-c
                        Chimp  -------tg-c
                      Gorilla  -------tg-c
                    Orangutan  -------tg-c
                       Gibbon  -------tg-c
                       Rhesus  -------tg-c
          Crab-eating macaque  -------tg-c
                       Baboon  -------tg-c
                 Green monkey  -------tg-c
                     Marmoset  -------tg-c
              Squirrel monkey  -------tg-c
                     Bushbaby  -------ag-c
           Chinese tree shrew  -------tg-t
                 Prairie vole  -------aa--
              Chinese hamster  -------ag--
               Naked mole-rat  -------agc-
                   Guinea pig  -------ag--
               Bactrian camel  -------gg-t
                      Dolphin  -------ag-c
                 Killer whale  -------ag-c
             Tibetan antelope  -------ag-t
                          Cow  -------ag-t
                        Sheep  -------ag-t
                Domestic goat  -------ag-t
             White rhinoceros  -------ag-c
                          Cat  gtgtcacag-a
                          Dog  -------cg-g
                      Ferret   -------ag-a
                        Panda  -------ag-a
               Pacific walrus  -------ag-a
                 Weddell seal  -------ag-a
             Black flying-fox  -------ag-t
                      Megabat  -------ag-t
                Big brown bat  -------ag-c
         David's myotis (bat)  -------ag-c
                     Microbat  -------ag-c
                     Aardvark  -----------
                    Armadillo  -----------
                      Opossum  -----------
              Tasmanian devil  -----------
                     Platypus  -------tg-a
                  Rock pigeon  -----------
                 Saker falcon  -----------
             Peregrine falcon  -----------
       White-throated sparrow  -----------
                  Zebra finch  -----------
           Tibetan ground jay  -----------
                   Budgerigar  -----------
                Scarlet macaw  -----------
           American alligator  -----------
              Green seaturtle  -----------
               Painted turtle  -----------
     Chinese softshell turtle  -----------
                       Medaka  ===========
       Yellowbelly pufferfish  ===========
           Southern platyfish  ===========
                    Zebrafish  ===========
                         Fugu  ===========
          Pundamilia nyererei  ===========
                 Atlantic cod  ===========
     Mexican tetra (cavefish)  ===========
                       Turkey  ===========
                       Parrot  ===========
                    Tetraodon  ===========
                      Chicken  ===========
          Collared flycatcher  ===========
                  Spotted gar  ===========
                  Zebra mbuna  ===========
        Burton's mouthbreeder  ===========
          Princess of Burundi  ===========
                X. tropicalis  ===========
          Medium ground finch  ===========
                        Shrew  ===========
               Golden hamster  ===========
                          Rat  ===========
             Brush-tailed rat  ===========
                   Chinchilla  ===========
                         Pika  ===========
                        Mouse  ===========
                       Tenrec  ===========
          Cape elephant shrew  ===========
       Lesser Egyptian jerboa  ===========
                     Hedgehog  ===========
                       Alpaca  ===========
                     Squirrel  ===========
                      Manatee  ===========
                     Elephant  ===========
             Cape golden mole  ===========
                        Horse  ===========

Inserts between block 25 and 26 in window
                Prairie vole 1bp
B D          Chinese hamster 1bp
B D           Naked mole-rat 815bp
                    Aardvark 25bp
B D                Armadillo 1bp
B D                  Opossum 3bp
B D          Tasmanian devil 9bp
B D                 Platypus 4bp

Alignment block 26 of 248 in window, 62371715 - 62371729, 15 bps 
B D                     Human  gtggc---------gac-----c-----------gaaagt------------------------------
B D                     Chimp  gtggc---------gac-----c